-- dump date   	20140619_015046
-- class       	Genbank::CDS
-- table       	cds_note
-- id	note
YP_106626.1	ATP-dependent; carboxylate-amine ligase with weak glutamate--cysteine ligase activity
YP_106627.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein RSC3299 or RS02528 SWALL:Q8XU94 (EMBL:AL646074) (407 aa) fasta scores: E(): 2.8e-63, 43.31% id in 404 aa. N-terminus is weakly similar to the N-terminal region of Escherichia coli glutathione-regulated potassium-efflux system protein KefB or TrkB SWALL:KEFB_ECOLI (SWALL:P45522) (601 aa) fasta scores: E(): 0.0018, 26.94% id in 360 aa
YP_106628.2	catalyzes the formation of 5-methylaminomethyl-2-thiouridine in position 34 of the anticodon of tRNA molecules
YP_106629.1	Previously sequenced as Burkholderia pseudomallei DNA-binding protein HU-alpha HupA or DbhA SWALL:DBHA_BURPS (SWALL:Q9ZF89) (92 aa) fasta scores: E(): 4.2e-29, 100% id in 92 aa. Similar to Ralstonia solanacearum probable DNA-binding protein HU-beta HupB2 or RSC2521 or RS01061 SWALL:Q8XWF3 (EMBL:AL646070) (94 aa) fasta scores: E(): 6.5e-17, 62.36% id in 93 aa
YP_106630.1	Previously sequenced as Burkholderia pseudomallei hypothetical 49.5 kDa protein SWALL:Q9ZF88 (EMBL:AF110185) (447 aa) fasta scores: E(): 1.7e-175, 96.42% id in 447 aa. Similar to Ralstonia solanacearum hypothetical protein RSC0045 or RS01868 SWALL:Q8Y3D5 (EMBL:AL646057) (424 aa) fasta scores: E(): 1.2e-52, 57.84% id in 446 aa
YP_106631.1	Previously sequenced as Burkholderia pseudomallei hypothetical 18.2 kDa protein SWALL:Q9ZF87 (EMBL:AF110185) (161 aa) fasta scores: E(): 3.1e-65, 99.37% id in 161 aa. Similar to Shigella flexneri IpgF protein precursor SWALL:IPGF_SHIFL (SWALL:Q07568) (152 aa) fasta scores: E(): 1.4e-12, 37.58% id in 141 aa
YP_106632.1	Previously sequenced as Burkholderia pseudomallei general secretory pathway protein D GspD SWALL:Q9ZF86 (EMBL:AF110185) (750 aa) fasta scores: E(): 0, 99.86% id in 750 aa. CDS is extended at the N-terminus in comparison to the previously sequenced protein. Similar to Erwinia chrysanthemi general secretion pathway protein D precursor OutD SWALL:GSPD_ERWCH (SWALL:P31700) (712 aa) fasta scores: E(): 2.5e-21, 33.23% id in 680 aa
YP_106633.1	Previously sequenced as Burkholderia pseudomallei general secretory pathway protein E GspE SWALL:Q9ZF85 (EMBL:AF110185) (497 aa) fasta scores: E(): 4.9e-168, 99.19% id in 497 aa. Similar to Erwinia carotovora general secretion pathway protein E OutE SWALL:GSPE_ERWCA (SWALL:P31703) (498 aa) fasta scores: E(): 2.9e-74, 53.09% id in 484 aa
YP_106634.1	Previously sequenced as Burkholderia pseudomallei general secretory pathway protein F GspF SWALL:Q9ZF84 (EMBL:AF110185) (405 aa) fasta scores: E(): 2.3e-145, 99.25% id in 405 aa. Similar to Erwinia carotovora general secretion pathway protein F OutF SWALL:GSPF_ERWCA (SWALL:P31705) (408 aa) fasta scores: E(): 9.6e-60, 43.1% id in 406 aa
YP_106635.1	Previously sequenced as Burkholderia pseudomallei protein essential for the secretion of exoproducts GspC SWALL:Q9ZF83 (EMBL:AF110185) (136 aa) fasta scores: E(): 8.2e-48, 100% id in 136 aa. Similar to the N-terminal region of Ralstonia solanacearum  general secretion pathway related transmembrane protein GspC or RSC3105 or RS00558 SWALL:Q8XUT0 (EMBL:AL646073) (228 aa) fasta scores: E(): 8.9e-12, 42.33% id in 137 aa
YP_106636.1	Previously sequenced as Burkholderia pseudomallei general secretory pathway protein G GspG SWALL:Q9ZF82 (EMBL:AF110185) (150 aa) fasta scores: E(): 2.1e-58, 100% id in 150 aa. Similar to Erwinia carotovora general secretion pathway protein G precursor OutG SWALL:GSPG_ERWCA (SWALL:P31586) (156 aa) fasta scores: E(): 2.5e-27, 53.57% id in 140 aa
YP_106637.1	Previously sequenced as Burkholderia pseudomallei general secretory pathway protein H GspH SWALL:Q9ZF81 (EMBL:AF110185) (159 aa) fasta scores: E(): 4.1e-60, 100% id in 159 aa. Similar to Erwinia carotovora general secretion pathway protein G precursor OutG SWALL:GSPG_ERWCA (SWALL:P31586) (156 aa) fasta scores: E(): 0.38, 29.73% id in 111 aa
YP_106638.1	Previously sequenced as Burkholderia pseudomallei general secretory pathway protein I GspI SWALL:Q9ZF80 (EMBL:AF110185) (134 aa) fasta scores: E(): 1.1e-49, 100% id in 134 aa. Similar to Pseudomonas aeruginosa general secretion pathway protein I precursor XcpV or PddC SWALL:GSPI_PSEAE (SWALL:Q00516) (129 aa) fasta scores: E(): 0.00019, 37% id in 100 aa
YP_106639.1	N-terminal region is identical to the previously sequenced Burkholderia pseudomallei general secretory pathway protein J GspJ SWALL:Q9ZF79 (EMBL:AF110185) (217 aa) fasta scores: E(): 3.3e-70, 100% id in 192 aa. CDS differs from the previously sequenced protein in the C-terminal region. C-terminal region is similar to Burkholderia cepacia general secretory pathway protein GspJ SWALL:Q9F1P4 (EMBL:AB050004) (222 aa) fasta scores: E(): 3e-60, 75.67% id in 222 aa
YP_106640.1	Previously sequenced as Burkholderia pseudomallei general secretory pathway protein K GspK SWALL:Q9ZF78 (EMBL:AF110185) (356 aa) fasta scores: E(): 9.2e-126, 99.15% id in 356 aa. Similar to Erwinia carotovora general secretion pathway protein K OutK SWALL:GSPK_ERWCA (SWALL:P31706) (328 aa) fasta scores: E(): 0.59, 24.63% id in 345 aa
YP_106641.1	Previously sequenced as Burkholderia pseudomallei general secretory pathway protein L GspL SWALL:Q9ZF77 (EMBL:AF110185) (444 aa) fasta scores: E(): 3.1e-79, 95.67% id in 462 aa. CDS is extended at the N-terminus in comparison to the previously sequenced protein. CDS also contains extra internal amino acid residues (229 to 246) relative to the previously sequenced protein. C-terminal region is similar to Pseudomonas aeruginosa general secretion pathway protein L XcpY SWALL:GSPL_PSEAE (SWALL:P25060) (382 aa) fasta scores: E(): 0.75, 24.33% id in 378 aa
YP_106642.1	Previously sequenced as Burkholderia pseudomallei general secretory pathway protein M GspM SWALL:Q9ZF76 (EMBL:AF110185) (168 aa) fasta scores: E(): 3.3e-58, 100% id in 168 aa. Similar to Erwinia carotovora general secretion pathway protein M OutM SWALL:GSPM_ERWCA (SWALL:P31709) (164 aa) fasta scores: E(): 0.00098, 26.58% id in 158 aa
YP_106643.1	Previously sequenced as Burkholderia pseudomallei general secretory pathway protein N GspN SWALL:Q9ZF75 (EMBL:AF110185) (263 aa) fasta scores: E(): 1e-102, 100% id in 263 aa. Similar to Aeromonas hydrophila general secretion pathway protein N ExeN SWALL:GSPN_AERHY (SWALL:P41852) (252 aa) fasta scores: E(): 1.1, 24.8% id in 250 aa
YP_106644.1	Previously sequenced as Burkholderia pseudomallei hypothetical 56.3 kDa protein SWALL:Q9ZF74 (EMBL:AF110185) (541 aa) fasta scores: E(): 5e-157, 98% id in 551 aa. CDS contains extra internal amino acid residues (514 to 524) relative to the previously sequenced protein. Similar to Pseudomonas aeruginosa outer membrane protein precursor OprM or OprK SWALL:OPRM_PSEAE (SWALL:Q51487) (485 aa) fasta scores: E(): 3.8e-33, 34.73% id in 501 aa
YP_106645.1	No significant database matches. Possible alternative upstream translational start site
YP_106646.1	Previously sequenced as Burkholderia pseudomallei hypothetical 18.0 kDa protein SWALL:Q9ZF73 (EMBL:AF110185) (163 aa) fasta scores: E(): 3.8e-58, 99.38% id in 163 aa. Similar to Escherichia coli multiple antibiotic resistance protein MarR or SoxQ or CfxB or InaR SWALL:MARR_ECOLI (SWALL:P27245) (144 aa) fasta scores: E(): 9.1e-08, 35.38% id in 130 aa
YP_106647.1	Previously sequenced as Burkholderia pseudomallei hypothetical 55.5 kDa protein SWALL:Q9ZF72 (EMBL:AF110185) (520 aa) fasta scores: E(): 3e-195, 99.8% id in 520 aa. Similar to Escherichia coli multidrug resistance protein B EmrB SWALL:EMRB_ECOLI (SWALL:P27304) (512 aa) fasta scores: E(): 2.3e-105, 53.17% id in 504 aa. Similar to BPSS0538, 56.736% identity (57.834% ungapped) in 527 aa overlap ; BPSS1350, 56.546% identity (57.640% ungapped) in 527 aa overlap and to BPSL1915, 51.303% identity (51.303% ungapped) in 499 aa overlap
YP_106648.1	Similar to Bacillus subtilis transcriptional regulatory protein GltC SWALL:GLTC_BACSU (SWALL:P20668) (300 aa) fasta scores: E(): 9.8e-21, 31.13% id in 273 aa, and to Salmonella typhimurium  LysR family transcriptional regulator STM4270 SWALL:Q8ZKG0 (EMBL:AE008900) (295 aa) fasta scores: E(): 2.4e-47, 47.55% id in 286 aa
YP_106649.1	Similar to Pseudomonas aeruginosa hypothetical protein PA3432 SWALL:Q9HYH3 (EMBL:AE004764) (129 aa) fasta scores: E(): 5e-16, 46.78% id in 109 aa, and to Vibrio cholerae hypothetical protein VC2101 SWALL:Q9KQ99 (EMBL:AE004284) (146 aa) fasta scores: E(): 9.1e-13, 41.32% id in 121 aa
YP_106650.1	Similar to Vibrio cholerae hypothetical protein VC2100 SWALL:Q9KQA0 (EMBL:AE004284) (229 aa) fasta scores: E(): 1.1e-42, 52.48% id in 221 aa, and to Salmonella typhi membrane protein STY4470 SWALL:Q8Z1R3 (EMBL:AL627282) (229 aa) fasta scores: E(): 4e-39, 48.87% id in 223 aa
YP_106651.2	interacts with cytoplasmic MS ring of the basal body and may act to stabilize the MotAB complexes which surround the MS ring
YP_106652.1	with FliG and FliN makes up the switch complex which is involved in switching the direction of the flagella rotation
YP_106653.1	Similar to Ralstonia solanacearum probable flagellar motor switch protein RSP0377 or RS00805 SWALL:Q8XSU0 (EMBL:AL646078) (156 aa) fasta scores: E(): 4.9e-26, 61.07% id in 167 aa> C-terminal region is similar to Erwinia carotovora flagellar motor switch protein FliN or MopA SWALL:FLIN_ERWCA (SWALL:P35539) (106 aa) fasta scores: E(): 1.4e-21, 67.3% id in 104 aa. Possible alternative translational start site
YP_106654.1	Similar to Escherichia coli flagellar protein FliO or FlbD or FlaP SWALL:FLIO_ECOLI (SWALL:P22586) (121 aa) fasta scores: E(): 1.1e-05, 43% id in 100 aa, and to Erwinia carotovora MopB protein SWALL:MOPB_ERWCA (SWALL:P34199) (140 aa) fasta scores: E(): 3.6e-05, 38.31% id in 107 aa
YP_106655.1	FliP, with proteins FliQ and FliR, forms the core of the central channel in the flagella export apparatus
YP_106656.1	with proteins FliP and FliR forms the core of the central channel in the flagella export apparatus
YP_106657.1	Similar to Escherichia coli flagellar biosynthetic protein FliR or FlaP SWALL:FLIR_ECOLI (SWALL:P33135) (261 aa) fasta scores: E(): 4.8e-40, 47.75% id in 245 aa, and to Erwinia carotovora flagellar biosynthetic protein FliR or MopE SWALL:FLIR_ERWCA (SWALL:P34202) (261 aa) fasta scores: E(): 7.2e-42, 47.45% id in 255 aa
YP_106658.1	Similar to Rhizobium leguminosarum transcriptional regulator HmrR SWALL:HMMR_RHILV (SWALL:Q9X5V4) (129 aa) fasta scores: E(): 1.2e-06, 33.33% id in 132 aa, and to Pseudomonas aeruginosa probable transcriptional regulator PA5116 SWALL:Q9HU68 (EMBL:AE004924) (141 aa) fasta scores: E(): 3.3e-33, 72.66% id in 139 aa
YP_106659.1	Similar to Rhizobium loti hypothetical protein MLR5379 SWALL:Q98BY2 (EMBL:AP003006) (281 aa) fasta scores: E(): 3.2e-50, 51.29% id in 271 aa, and to Caulobacter crescentus methlytransferase, UbiE-Coq5 family CC3495 SWALL:Q9A2R1 (EMBL:AE006008) (276 aa) fasta scores: E(): 2.6e-42, 46.46% id in 269 aa
YP_106660.1	Similar to Rhizobium loti hypothetical protein MLL7507 SWALL:Q985V9 (EMBL:AP003012) (167 aa) fasta scores: E(): 3.4e-18, 42.46% id in 146 aa, and to Agrobacterium tumefaciens hypothetical protein ATU2174 or AGR_C_3945 SWALL:Q8UDF3 (EMBL:AE009168) (169 aa) fasta scores: E(): 1.8e-16, 37.5% id in 144 aa
YP_106661.1	Similar to Rhizobium loti ABC transporter substrate-binding protein MLR7949 SWALL:Q984L7 (EMBL:AP003013) (337 aa) fasta scores: E(): 4e-65, 60.85% id in 327 aa, and to Ralstonia solanacearum hypothetical signal peptide protein rsc3391 or rs05672 SWALL:Q8XU03 (EMBL:AL646075) (328 aa) fasta scores: E(): 8.4e-68, 60.63% id in 315 aa
YP_106662.1	Similar to Ralstonia solanacearum probable ATP-binding ABC transporter protein rsc1199 or rs02665 SWALL:Q8Y045 (EMBL:AL646063) (270 aa) fasta scores: E(): 1.5e-46, 54.44% id in 259 aa, and to the C-terminal region of Rhizobium loti ABC transporter ATP-binding protein mlr7950 SWALL:Q984L6 (EMBL:AP003013) (300 aa) fasta scores: E(): 9.9e-67, 72.97% id in 259 aa
YP_106663.1	Similar to Rhizobium loti ABC transporter permease mlr7951 SWALL:Q984L5 (EMBL:AP003013) (292 aa) fasta scores: E(): 7.7e-64, 60.96% id in 269 aa, and to Agrobacterium tumefaciens ABC transporter membrane spanning protein atu4260 or agr_l_1202 SWALL:Q8U839 (EMBL:AE009355) (265 aa) fasta scores: E(): 7.8e-39, 45.93% id in 246 aa
YP_106664.1	Two-component regulatory system family, sensor kinase. Similar to Escherichia coli sensor protein QseC SWALL:QSEC_ECOLI (SWALL:P40719) (449 aa) fasta scores: E(): 7.1e-23, 28.06% id in 449 aa, and to Rhizobium loti two-component system, sensor protein mll7952 SWALL:Q984L4 (EMBL:AP003013) (452 aa) fasta scores: E(): 3.7e-56, 41.75% id in 455 aa
YP_106665.1	Two-component regulatory system family, response regulator protein. Similar to Salmonella typhimurium transcriptional regulatory protein TctD SWALL:TCTD_SALTY (SWALL:P22104) (224 aa) fasta scores: E(): 2.9e-35, 48.43% id in 223 aa, and to Ralstonia solanacearum probable response regulator transcription regulator protein rsc3392 or rs05673 SWALL:Q8XU02 (EMBL:AL646075) (224 aa) fasta scores: E(): 1.5e-47, 58.44% id in 219 aa
YP_106666.1	Similar to Bordetella pertussis outer membrane porin protein precursor SWALL:OMP_BORPE (SWALL:Q04064) (385 aa) fasta scores: E(): 3.8e-13, 28.26% id in 414 aa, and to Ralstonia solanacearum probable porin signal peptide protein rsc3390 or rs05671 SWALL:Q8XU04 (EMBL:AL646075) (376 aa) fasta scores: E(): 6.2e-77, 54.33% id in 381 aa
YP_106667.1	Similar to Escherichia coli type III restriction-modification system EcoP15I enzyme Mod SWALL:T3MO_ECOLI (SWALL:P12364) (645 aa) fasta scores: E(): 3.5e-39, 30.38% id in 655 aa, and to Chlorobium tepidum TLS type III restriction system methylase Mod SWALL:AAM72143 (EMBL:AE012856) (669 aa) fasta scores: E(): 1.7e-190, 67.66% id in 671 aa
YP_106668.1	Similar to Chlorobium tepidum TLS type III restriction system endonuclease Res SWALL:AAM72146 (EMBL:AE012856) (991 aa) fasta scores: E(): 0, 66.83% id in 998 aa, and to Fusobacterium nucleatum type III restriction-modification system restriction subunit FN0417 SWALL:Q8RG91 (EMBL:AE010553) (997 aa) fasta scores: E(): 1.1e-151, 43.51% id in 1002 aa
YP_106669.1	Similar to Burkholderia cepacia major porin protein OpcP1 SWALL:Q45106 (EMBL:D63823) (361 aa) fasta scores: E(): 1.4e-22, 38.08% id in 386 aa, and to Ralstonia solanacearum probable porin precursor transmembrane protein rsp0337 or rs00714 SWALL:Q8XSY0 (EMBL:AL646078) (351 aa) fasta scores: E(): 1.2e-18, 34.13% id in 331 aa
YP_106670.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa4070 SWALL:Q9HWV8 (EMBL:AE004823) (316 aa) fasta scores: E(): 1.1e-17, 30.39% id in 306 aa. C-terminus is similar to the C-terminal region of Escherichia coli transcriptional activator FeaR or MaoR or MaoB SWALL:FEAR_ECOLI (SWALL:Q47129) (301 aa) fasta scores: E(): 9.5e-14, 30.61% id in 245 aa
YP_106671.1	Similar to Pseudomonas aeruginosa high-affinity branched-chain amino acid transport ATP-binding protein BraG or pa1070 SWALL:BRAG_PSEAE (SWALL:P21630) (233 aa) fasta scores: E(): 6.3e-22, 39.35% id in 216 aa, and to Brucella melitensis high-affinity branched-chain amino acid transport ATP-binding protein bmeii0119 SWALL:Q8YDQ6 (EMBL:AE009650) (234 aa) fasta scores: E(): 2.3e-24, 39.73% id in 229 aa
YP_106672.1	Similar to Rhizobium meliloti  high-affinity branched-chain amino acid transport ATP-binding ABC transporter protein R02584 or smc02357 SWALL:Q92MM9 (EMBL:AL591791) (244 aa) fasta scores: E(): 2.1e-18, 37.44% id in 235 aa, and to Rhizobium loti branched-chain amino acid ABC transporter ATP-binding protein mll4886 SWALL:Q98D29 (EMBL:AP003005) (241 aa) fasta scores: E(): 2.6e-17, 37.23% id in 239 aa
YP_106673.1	Similar to Aeropyrum pernix hypothetical high-affinity branched-chain amino acid transport permease APE1304 SWALL:Q9YCF3 (EMBL:AP000061) (349 aa) fasta scores: E(): 1.8e-10, 26.99% id in 326 aa. C-terminal region is similar to the N-terminal region of Brucella melitensis high-affinity branched-chain amino acid transport system permease LivM / high-affinity branched-chain amino acid transport ATP-binding protein LivG bmeii0120 SWALL:Q8YDQ5 (EMBL:AE009650) (515 aa) fasta scores: E(): 2.8e-13, 34.29% id in 277 aa
YP_106674.1	Similar to Brucella melitensis high-affinity branched-chain amino acid transport system permease bmeii0121 SWALL:Q8YDQ4 (EMBL:AE009650) (292 aa) fasta scores: E(): 1.3e-19, 30.99% id in 271 aa, and to Agrobacterium tumefaciens ABC transporter membrane spanning protein atu5524 or agr_pat_780 SWALL:Q8UJF3 (EMBL:AE008972) (298 aa) fasta scores: E(): 6.4e-16, 28.36% id in 282 aa
YP_106675.1	N-terminus is weakly similar to N-terminal regions of Pseudomonas aeruginosa leucine-, isoleucine-, valine-, threonine-, and alanine-binding protein precursor BraC SWALL:BRAC_PSEAE (SWALL:P21175) (373 aa) fasta scores: E(): 0.0088, 22.61% id in 367 aa, and to Ralstonia solanacearum probable leu/ile/val-binding signal peptide protein rsc2864 or rs00241 SWALL:Q8XVG7 (EMBL:AL646072) (385 aa) fasta scores: E(): 2.9e-05, 25% id in 360 aa. CDS is a possible lipoprotein, but has a poor N-terminal signal sequence
YP_106676.1	Similar to Escherichia coli phenylacetaldehyde dehydrogenase FeaB or PadA or MaoB SWALL:FEAB_ECOLI (SWALL:P80668) (499 aa) fasta scores: E(): 2.5e-88, 49.79% id in 498 aa, and to Pseudomonas aeruginosa probable aldehyde dehydrogenase pa4073 SWALL:Q9HWV5 (EMBL:AE004823) (495 aa) fasta scores: E(): 1.1e-114, 62.29% id in 488 aa. Similar to BPSS0868, 59.714% identity (60.707% ungapped) in 489 aa overlap. Similar to BPSS0868, 59.714% identity (60.707% ungapped) in 489 aa overlap
YP_106677.1	Similar to Pseudomonas aeruginosa hypothetical protein pa1817 SWALL:Q9I2S8 (EMBL:AE004608) (129 aa) fasta scores: E(): 5e-26, 56.69% id in 127 aa, and to Agrobacterium tumefaciens hypothetical protein atu4878 or agr_l_27 SWALL:Q8U6C9 (EMBL:AE009416) (137 aa) fasta scores: E(): 0.002, 23.84% id in 130 aa
YP_106678.1	Similar to Klebsiella aerogenes MoaF protein precursor SWALL:MOAF_KLEAE (SWALL:P54796) (262 aa) fasta scores: E(): 1.3e-16, 31.81% id in 242 aa, and to Pseudomonas aeruginosa hypothetical protein pa4087 SWALL:Q9HWU1 (EMBL:AE004825) (274 aa) fasta scores: E(): 1.2e-16, 31.95% id in 266 aa
YP_106679.1	Similar to Klebsiella aerogenes MoaE protein SWALL:MOAE_KLEAE (SWALL:P54795) (257 aa) fasta scores: E(): 8.1e-33, 46.18% id in 262 aa, and to Escherichia coli oxidoreductase UcpA SWALL:UCPA_ECOLI (SWALL:P37440) (263 aa) fasta scores: E(): 3.2e-22, 36.68% id in 259 aa
YP_106680.1	Similar to Pseudomonas oleovorans alcohol dehydrogenase [acceptor] AlkJ or AlcO SWALL:ALKJ_PSEOL (SWALL:Q00593) (558 aa) fasta scores: E(): 6.6e-88, 45.17% id in 549 aa, and to Rhizobium loti probable dehydrogenase mll1008 SWALL:Q98LI5 (EMBL:AP002996) (537 aa) fasta scores: E(): 2.7e-92, 46.45% id in 536 aa
YP_106681.1	Similar to Clostridium acetobutylicum predicted transcriptional regulator cac0571 SWALL:Q97LI9 (EMBL:AE007572) (107 aa) fasta scores: E(): 1.3e-20, 57% id in 100 aa, and to Caulobacter crescentus hypothetical protein CC3408 SWALL:Q9A2Z8 (EMBL:AE006001) (108 aa) fasta scores: E(): 2.1e-20, 57% id in 100 aa
YP_106682.1	No significant database matches to the full length CDS. N-terminus is similar to the N-terminal regions of Caulobacter crescentus hypothetical protein CC3409 SWALL:Q9A2Z7 (EMBL:AE006001) (187 aa) fasta scores: E(): 1.9e-11, 37.93% id in 145 aa, and Listeria innocua hypothetical protein lin0609 SWALL:Q92E52 (EMBL:AL596165) (196 aa) fasta scores: E(): 0.057, 27.27% id in 176 aa
YP_106683.1	Similar to Synechocystis sp. fatty acid desaturase DesA SWALL:DESA_SYNY3 (SWALL:P20388) (351 aa) fasta scores: E(): 3.3e-05, 23.58% id in 335 aa, and to Caulobacter crescentus hypothetical protein CC3422 SWALL:Q9A2Y4 (EMBL:AE006002) (329 aa) fasta scores: E(): 1.5e-20, 40% id in 330 aa
YP_106684.1	Poor database matches. Weakly similar to Sulfolobus solfataricus ring oxydation complex/ phenylacetic acid degradation related protein SSO2022 SWALL:Q97WU2 (EMBL:AE006809) (266 aa) fasta scores: E(): 0.0008, 23% id in 226 aa
YP_106685.1	Similar to Streptomyces coelicolor  transcriptional regulator sco6746 or SC5f2A.29 SWALL:Q9X7Q2 (EMBL:AL049587) (325 aa) fasta scores: E(): 1.5e-15, 31.15% id in 337 aa, and to Xanthomonas axonopodis pv. citri str. 306 transcriptional regulator AraC family AdpA SWALL:AAM38899 (EMBL:AE012054) (336 aa) fasta scores: E(): 2.8e-14, 29.73% id in 333 aa
YP_106686.1	Similar to the C-terminal region of Homo sapiens acyl-CoA dehydrogenase, long-chain specific, mitochondrial precursor ACADL SWALL:ACDL_HUMAN (SWALL:P28330) (430 aa) fasta scores: E(): 3.3e-80, 54.64% id in 377 aa, and to the full length Pseudomonas aeruginosa probable acyl-CoA dehydrogenase pa4435 SWALL:Q9HVY0 (EMBL:AE004858) (381 aa) fasta scores: E(): 1.2e-108, 69.84% id in 378 aa
YP_106687.1	Catalyzes the synthesis of acetoacetyl coenzyme A from two molecules of acetyl coenzyme A. It can also act as a thiolase, catalyzing the reverse reaction and generating two-carbon units from the four-carbon product of fatty acid oxidation
YP_106688.1	Similar to Pseudomonas fragi fatty oxidation complex alpha subunit [includes: enoyl-CoA hydratase; delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase; 3-hydroxyacyl-CoA dehydrogenase; 3- hydroxybutyryl-CoA epimerase] FaoA SWALL:FAOB_PSEFR (SWALL:P28793) (715 aa) fasta scores: E(): 5e-65, 36.06% id in 721 aa, and to Caulobacter crescentus fatty oxidation complex, alpha subunit CC0076 SWALL:Q9ABZ4 (EMBL:AE005681) (709 aa) fasta scores: E(): 8.9e-130, 55.26% id in 684 aa
YP_106689.1	Similar to Homo sapiens alpha-methylacyl-CoA racemase AMACR SWALL:AMAC_HUMAN (SWALL:Q9UHK6) (382 aa) fasta scores: E(): 1.9e-50, 41.17% id in 374 aa, and to Rhizobium loti probable fatty acid CoA racemase mlr2316 SWALL:Q98IP3 (EMBL:AP002999) (389 aa) fasta scores: E(): 1e-77, 57.89% id in 380 aa
YP_106690.1	Poor database matches. Similar to an internal region of Thermotoga maritima chaperonin TM1394 SWALL:HSLO_THEMA (SWALL:Q9X1B4) (290 aa) fasta scores: E(): 6.9, 26.94% id in 167 aa
YP_106691.1	Poor database matches. Similar to Ralstonia solanacearum probable lipoprotein rsc2710 or rs00012 SWALL:Q8XVW7 (EMBL:AL646071) (146 aa) fasta scores: E(): 4.9e-15, 44.37% id in 151 aa
YP_106692.1	Poor database matches. C-terminal region is similar to Salmonella typhi hypothetical protein STY0300 SWALL:Q8Z969 (EMBL:AL627266) (133 aa) fasta scores: E(): 0.0034, 33.91% id in 115 aa
YP_106693.1	Poor database matches. Similar to the N-terminus of Streptomyces coelicolor  membrane protein sco0399 or SCF62.25 SWALL:Q9RJI9 (EMBL:AL121855) (407 aa) fasta scores: E(): 6, 34.95% id in 103 aa
YP_106694.1	Similar to Pseudomonas fluorescens transmembrane regulator PrtR SWALL:Q9KIN0 (EMBL:AF228766) (242 aa) fasta scores: E(): 2.2e-34, 47.45% id in 236 aa, and to Xanthomonas axonopodis pv. citri str. 306 transmembrane regulator protein PrtR SWALL:AAM38824 (EMBL:AE012047) (250 aa) fasta scores: E(): 2.5e-26, 40.63% id in 251 aa
YP_106695.1	Similar to Pseudomonas fluorescens  RNA polymerase sigma factor PrtI SWALL:Q9KIM9 (EMBL:AF228767) (165 aa) fasta scores: E(): 1.5e-36, 61.67% id in 167 aa, and to Xanthomonas axonopodis pv. citri str. 306 ecf sigma factor PrtI SWALL:AAM38825 (EMBL:AE012047) (171 aa) fasta scores: E(): 3.9e-32, 56.97% id in 172 aa
YP_106696.1	Similar to the N-terminal region of Nicotiana tabacum catalase isozyme 1 CAT-1 SWALL:CAT1_TOBAC (SWALL:P49319) (492 aa) fasta scores: E(): 1.1e-06, 26.54% id in 324 aa, and to the full length Xanthomonas campestris pv. campestris str. ATCC 33913 catalase SrpA SWALL:AAM43127 (EMBL:AE012511) (363 aa) fasta scores: E(): 5.7e-59, 49.09% id in 330 aa. Possible alternative translational start site
YP_106697.1	Similar to Escherichia coli cytochrome b561 CybB SWALL:C561_ECOLI (SWALL:P08732) (176 aa) fasta scores: E(): 1.5e-07, 31.66% id in 180 aa, and to Xanthomonas axonopodis pv. citri str. 306 cytochrome b561 YodB SWALL:AAM38827 (EMBL:AE012047) (180 aa) fasta scores: E(): 7.9e-37, 60% id in 170 aa
YP_106698.1	negatively supercoils closed circular double-stranded DNA
YP_106699.1	binds the polymerase to DNA and acts as a sliding clamp
YP_106700.1	binds to the dnaA-box as an ATP-bound complex at the origin of replication during the initiation of chromosomal replication; can also affect transcription of multiple genes including itself.
YP_106701.1	in Escherichia coli transcription of this gene is enhanced by polyamines
YP_106702.1	Similar to Escherichia coli ribonuclease P protein component RnpA SWALL:RNPA_ECOLI (SWALL:P06277) (119 aa) fasta scores: E(): 2.3e-05, 36.63% id in 101 aa, and to Ralstonia solanacearum probable ribonuclease P protein component rsc0002 or rs01824 SWALL:Q8Y3H8 (EMBL:AL646057) (131 aa) fasta scores: E(): 1.3e-17, 52.25% id in 111 aa
YP_106703.1	Similar to Ralstonia solanacearum hypothetical protein rsc0003 or rs01825 SWALL:Q8Y3H7 (EMBL:AL646057) (104 aa) fasta scores: E(): 1.4e-17, 62.66% id in 75 aa, and to Pseudomonas aeruginosa hypothetical protein pa2045 SWALL:YK45_PSEAE (SWALL:Q9I270) (86 aa) fasta scores: E(): 6.6e-16, 65.21% id in 69 aa
YP_106704.1	functions to insert inner membrane proteins into the IM in Escherichia coli; interacts with transmembrane segments; functions in both Sec-dependent and -independent membrane insertion; similar to Oxa1p in mitochondria
YP_106705.1	No significant database matches. Doubtful CDS. Similar to BPSS2172, 81.818% identity (82.500% ungapped) in 121 aa overlap. Possible alternative translational start sites
YP_106706.1	in Escherichia coli this protein is involved in the biosynthesis of the hypermodified nucleoside 5-methylaminomethyl-2-thiouridine, which is found in the wobble position of some tRNAs and affects ribosomal frameshifting; shows potassium-dependent dimerization and GTP hydrolysis; also involved in regulation of glutamate-dependent acid resistance and activation of gadE
YP_106707.1	Similar to Escherichia coli prophage cp4-57 integrase IntA or SlpA or IntX SWALL:INTA_ECOLI (SWALL:P32053) (413 aa) fasta scores: E(): 3.9e-38, 33.57% id in 408 aa, and to Ralstonia solanacearum  integrase rsc2489 or rs01107 SWALL:Q8XWI5 (EMBL:AL646070) (417 aa) fasta scores: E(): 1.7e-45, 38.15% id in 401 aa
YP_106708.1	No significant database matches to the full length CDS. C-terminus is similar to the C-terminal region of Salmonella typhimurium  inner membrane protein STM2745 SWALL:Q8ZMQ9 (EMBL:AE008824) (689 aa) fasta scores: E(): 2.4e-63, 35.3% id in 609 aa. Internal region is similar to the internal region of Escherichia coli DNA primase TraC SWALL:TRC4_ECOLI (SWALL:P27189) (1061 aa) fasta scores: E(): 3.1e-22, 39.32% id in 267 aa. Similar to BPSS0382 (956 aa) fasta scores: E(): 0, 91.832% identity in 955 aa overlap
YP_106711.1	Similar to Ralstonia solanacearum hypothetical protein rsc0965 or rs04404 SWALL:Q8Y0S8 (EMBL:AL646062) (58 aa) fasta scores: E(): 7.2e-05, 51.11% id in 45 aa, and to N-terminal region of Streptomyces coelicolor acetyltransferase sco0630 or SCF56.14c SWALL:Q9RD52 (EMBL:AL133424) (173 aa) fasta scores: E(): 6.8, 39.58% id in 48 aa
YP_106712.1	Poor database matches. Weakly similar to N-terminal regions of Neisseria meningitidis  DNA repair protein NMA0992 SWALL:Q9JV51 (EMBL:AL162754) (459 aa) fasta scores: E(): 7.2, 25.67% id in 148 aa, and Ralstonia solanacearum hypothetical protein rsc3362 or rs02637 SWALL:Q8XU32 (EMBL:AL646074) (276 aa) fasta scores: E(): 4, 29.93% id in 147 aa
YP_106714.1	Poor database matches. Similar to Ralstonia solanacearum hypothetical protein rsp0267 or rs03699 SWALL:Q8XT48 (EMBL:AL646077) (287 aa) fasta scores: E(): 3e-27, 34.94% id in 289 aa, and to Mycobacterium tuberculosis hypothetical protein RV0836c or MT0857 or MTV043.29c SWALL:O53848 (EMBL:AL022004) (248 aa) fasta scores: E(): 3.4e-08, 29.96% id in 247 aa
YP_106715.1	No significant database matches to the full length CDS. C-terminus is similar to C-terminal regions of Ralstonia solanacearum hypothetical protein rsp0266 or rs03700 SWALL:Q8XT49 (EMBL:AL646077) (370 aa) fasta scores: E(): 1.3e-24, 35.66% id in 272 aa, and Corynebacterium glutamicum ATCC 13032 hypothetical protein CGl2790 SWALL:BAC00184 (EMBL:AP005282) (375 aa) fasta scores: E(): 3.6e-07, 26.04% id in 311 aa
YP_106716.1	Similar to Ralstonia solanacearum ISRso14-transposase OrfB protein SWALL:Q8XF72 (EMBL:AL646083) (275 aa) fasta scores: E(): 7.1e-98, 86.86% id in 274 aa, and to Pseudomonas aeruginosa hypothetical protein pa0987 SWALL:Q9I4Y2 (EMBL:AE004531) (280 aa) fasta scores: E(): 4.2e-77, 70.49% id in 261 aa
YP_106717.1	Identical to Burkholderia cepacia insertion element IS407 hypothetical 10.0 kDa protein SWALL:YI74_BURCE (SWALL:P24580) (87 aa) fasta scores: E(): 3.7e-32, 100% id in 87 aa. Similar to Ralstonia solanacearum ISRso14-transposase OrfA protein SWALL:Q8XGL4 (EMBL:AL646083) (87 aa) fasta scores: E(): 2.1e-29, 93.1% id in 87 aa
YP_106718.1	Poor database matches. Weakly similar to internal region of Synechocystis sp. lipoprotein NlpD or SLR0993 SWALL:P74517 (EMBL:D90915) (715 aa) fasta scores: E(): 3.7, 22.95% id in 257 aa
YP_106719.1	Poor database matches. Similar to Ralstonia solanacearum probable lipoprotein rsc2263 or rs01296 SWALL:Q8XX53 (EMBL:AL646069) (391 aa) fasta scores: E(): 4.8e-89, 67.09% id in 392 aa
YP_106720.1	Poor database matches. Similar to Ralstonia solanacearum probable lipoprotein rsc2264 or rs01295 SWALL:Q8XX52 (EMBL:AL646069) (50 aa) fasta scores: E(): 1.6e-12, 74.51% id in 51 aa, and to the N-terminal region of Deinococcus radiodurans hypothetical protein DR1795 SWALL:Q9RTG9 (EMBL:AE002020) (264 aa) fasta scores: E(): 6.5, 40.38% id in 52 aa
YP_106721.1	Poor database matches. Similar to Mus musculus cryptdin-related protein 4C-2 precursor DEFCR-RS7 SWALL:DEFW_MOUSE (SWALL:P50715) (91 aa) fasta scores: E(): 0.73, 28.57% id in 84 aa
YP_106722.1	Similar to Escherichia coli spermidine n(1)-acetyltransferase SpeG SWALL:ATDA_ECOLI (SWALL:P37354) (185 aa) fasta scores: E(): 9e-46, 63.84% id in 177 aa, and to Listeria monocytogenes  spermidine acetyltransferase SpeG SWALL:AAM48485 (EMBL:AF084042) (172 aa) fasta scores: E(): 6.2e-46, 68.9% id in 164 aa
YP_106724.1	Similar to Ralstonia solanacearum hypothetical protein rsc0785 or rs05053 SWALL:Q8Y1A5 (EMBL:AL646061) (182 aa) fasta scores: E(): 4.7e-39, 57.77% id in 180 aa, and to Xanthomonas campestris pv. campestris str. ATCC 33913 conserved hypothetical protein xcc2289 SWALL:AAM41568 (EMBL:AE012336) (182 aa) fasta scores: E(): 2.1e-34, 55.21% id in 163 aa
YP_106725.1	Similar to Pseudomonas aeruginosa probable ring-cleaving dioxygenase pa2546 SWALL:Q9I0T8 (EMBL:AE004682) (143 aa) fasta scores: E(): 1.8e-22, 53.03% id in 132 aa, and to the N-terminal region of Rhodococcus globerulus biphenyl-2,3-diol 1,2-dioxygenase II BphC2 SWALL:BHC2_RHOGO (SWALL:P47232) (189 aa) fasta scores: E(): 0.011, 29.85% id in 134 aa
YP_106726.1	Similar to Escherichia coli ada regulatory protein Ada SWALL:ADA_ECOLI (SWALL:P06134) (354 aa) fasta scores: E(): 3.3e-58, 48.71% id in 351 aa, and to Pseudomonas aeruginosa O6-methylguanine-DNA methyltransferase pa2118 SWALL:Q9I1Z7 (EMBL:AE004639) (358 aa) fasta scores: E(): 3.4e-57, 48.32% id in 358 aa
YP_106727.1	Similar to Escherichia coli DNA-3-methyladenine glycosylase II AlkA or AidA SWALL:3MG2_ECOLI (SWALL:P04395) (282 aa) fasta scores: E(): 1.3e-24, 37.24% id in 290 aa, and to Pseudomonas aeruginosa DNA-3-methyladenine glycosidase II pa1686 SWALL:Q9I339 (EMBL:AE004596) (297 aa) fasta scores: E(): 7.8e-43, 48.13% id in 295 aa
YP_106728.1	involved in the first step of glutathione biosynthesis
YP_106729.1	Poor database matches. Similar to the C-terminal regions of Pseudomonas aeruginosa RNA polymerase sigma factor RpoD or RpoDA SWALL:RPSD_PSEAE (SWALL:P26480) (617 aa) fasta scores: E(): 4.3e-35, 33.48% id in 445 aa, and to Bordetella pertussis RNA polymerase sigma factor RpoD SWALL:P77833 (EMBL:U73858) (733 aa) fasta scores: E(): 3.7e-39, 39.14% id in 350 aa
YP_106733.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa2447 SWALL:Q9I135 (EMBL:AE004672) (307 aa) fasta scores: E(): 3.8e-43, 44.14% id in 299 aa, and to Ralstonia solanacearum probable transcription regulator protein rsp0910 or rs01682 SWALL:Q8XRE4 (EMBL:AL646081) (309 aa) fasta scores: E(): 8.5e-36, 39.72% id in 287 aa
YP_106734.1	Similar to Escherichia coli putrescine-binding periplasmic protein precursor PotF SWALL:POTF_ECOLI (SWALL:P31133) (370 aa) fasta scores: E(): 3.7e-63, 47.23% id in 362 aa, and to Pseudomonas aeruginosa polyamine transport protein pa0301 SWALL:Q9I6J0 (EMBL:AE004468) (365 aa) fasta scores: E(): 1.4e-67, 50.14% id in 357 aa
YP_106735.1	Similar to Pseudomonas aeruginosa probable acetylpolyamine aminohydrolase pa3774 SWALL:Q9HXM1 (EMBL:AE004796) (380 aa) fasta scores: E(): 5.1e-47, 41.71% id in 374 aa, and to an internal region of Homo sapiens histone deacetylase 6 HDAC6 SWALL:HDA6_HUMAN (SWALL:Q9UBN7) (1215 aa) fasta scores: E(): 3.1e-33, 37.6% id in 367 aa
YP_106736.1	Similar to Pseudomonas aeruginosa probable hydratase pa0293 SWALL:Q9I6J8 (EMBL:AE004467) (292 aa) fasta scores: E(): 2.1e-77, 65.48% id in 281 aa, and to the C-terminal region of Homo sapiens beta-ureidopropionase BUP1 SWALL:BUP1_HUMAN (SWALL:Q9UBR1) (384 aa) fasta scores: E(): 3e-14, 29.61% id in 287 aa
YP_106737.1	Similar to bacteriophage HP1 probable portal protein SWALL:VPQ_BPHP1 (SWALL:P51717) (345 aa) fasta scores: E(): 1.4e-33, 34.16% id in 319 aa, and to Ralstonia solanacearum probable bacteriophage protein rsc1941 or rs03510 SWALL:Q8XY22 (EMBL:AL646067) (361 aa) fasta scores: E(): 3.4e-91, 62.42% id in 354 aa. C-terminal region is similar to BPSL0173, 99.390% identity (99.390% ungapped) in 328 aa overlap and to BPSS1062, 99.085% identity (99.085% ungapped) in 328 aa overlap
YP_106739.1	Poor database matches. Similar to Ralstonia solanacearum hypothetical protein rsc2888 or rs00212 SWALL:Q8XVE3 (EMBL:AL646072) (152 aa) fasta scores: E(): 1.1e-20, 44.58% id in 157 aa. C-terminal region is similar to Ralstonia solanacearum hypothetical protein rsc2388 or rs02761 SWALL:Q8XWT2 (EMBL:AL646069) (84 aa) fasta scores: E(): 2.7e-11, 48.14% id in 81 aa. C-terminal region is similar to BPSL1373, 55.224% identity (55.224% ungapped) in 134 aa overlap
YP_106741.1	Similar to Pseudomonas aeruginosa hypothetical protein pa0957 SWALL:Q9I501 (EMBL:AE004529) (135 aa) fasta scores: E(): 1.3e-08, 31.34% id in 134 aa, and to Brucella melitensis hypothetical cytosolic protein bmei0304 SWALL:Q8YIY5 (EMBL:AE009472) (135 aa) fasta scores: E(): 2.1e-08, 33.85% id in 127 aa
YP_106742.1	Poor database matches. Similar to Ralstonia solanacearum hypothetical protein rsc0013 or rs01835 SWALL:Q8Y3G7 (EMBL:AL646057) (297 aa) fasta scores: E(): 1.2e-82, 70.77% id in 284 aa, and to the C-terminal region of Caulobacter crescentus hypothetical protein CC3383 SWALL:Q9A323 (EMBL:AE005999) (353 aa) fasta scores: E(): 0.6, 24.21% id in 256 aa
YP_106743.1	Similar to Escherichia coli 2-ketogluconate reductase TkrA SWALL:TKRA_ECOLI (SWALL:P37666) (324 aa) fasta scores: E(): 8.3e-17, 28% id in 325 aa, and to Ralstonia solanacearum  D-3-phosphoglycerate dehydrogenase oxidoreductase rsc0016 or rs01838 SWALL:Q8Y3G4 (EMBL:AL646057) (353 aa) fasta scores: E(): 8.8e-100, 72.72% id in 341 aa
YP_106744.1	No significant database matches to the full length CDS. CDS is extended at the C-terminus in comparison to orthologues. Similar to Xanthomonas campestris pv. campestris str. ATCC 33913 transcriptional regulator xcc3667 SWALL:AAM42937 (EMBL:AE012487) (311 aa) fasta scores: E(): 3.1e-45, 50% id in 292 aa, and to Ralstonia solanacearum probable transcription regulator protein rsc0065 or rs02244 SWALL:Q8Y3B5 (EMBL:AL646057) (312 aa) fasta scores: E(): 3e-47, 47.44% id in 293 aa
YP_106745.1	decatenates replicating daughter chromosomes
YP_106746.1	Similar to Emericella nidulans thioredoxin SWALL:THIO_EMENI (SWALL:P29429) (109 aa) fasta scores: E(): 0.0055, 31.25% id in 80 aa, and to Ralstonia solanacearum  thioredoxin-like protein rsc0067 or rs02246 SWALL:Q8Y3B3 (EMBL:AL646057) (129 aa) fasta scores: E(): 2.2e-24, 57.72% id in 123 aa
YP_106747.1	C-terminus is similar to the C-terminal region of Haemophilus influenzae DNA processing chain A protein Smf or DprA SWALL:SMF_HAEIN (SWALL:P43862) (373 aa) fasta scores: E(): 2.1e-30, 41.92% id in 322 aa. Full length CDS is similar to the C-terminal region of Ralstonia solanacearum probable Smf protein rsc0068 or rs02247 SWALL:Q8Y3B2 (EMBL:AL646057) (401 aa) fasta scores: E(): 8.4e-58, 53.33% id in 360 aa. Possible alternative translational start site after codon 21
YP_106748.1	cleaves off formyl group from N-terminal methionine residues of newly synthesized proteins; binds iron(2+)
YP_106749.1	modifies the free amino group of the aminoacyl moiety of methionyl-tRNA(fMet) which is important in translation initiation; inactivation of this gene in Escherichia coli severely impairs growth
YP_106750.1	Similar to Ralstonia solanacearum probable transporter transmembrane protein rsc0073 or rs02251 SWALL:Q8Y3A7 (EMBL:AL646057) (215 aa) fasta scores: E(): 1.1e-55, 68.69% id in 214 aa, and to Ralstonia solanacearum probable transport transmembrane protein rsc0418 or rs03386 SWALL:Q8Y2B8 (EMBL:AL646059) (206 aa) fasta scores: E(): 5.9e-26, 40.29% id in 201 aa
YP_106751.1	Similar to Streptococcus gordonii Challis probable protease HtpX homolog SWALL:HTPX_STRGC (SWALL:O30795) (297 aa) fasta scores: E(): 3.2e-25, 39.79% id in 294 aa, and to Ralstonia solanacearum probable metalloprotease zinc transmembrane protein rsc0074 or rs02252 SWALL:Q8Y3A6 (EMBL:AL646057) (286 aa) fasta scores: E(): 4.1e-92, 86.97% id in 284 aa
YP_106752.1	C-terminal region is similar to Escherichia coli sun protein Sun or Fmu or Fmv or RsmB SWALL:SUN_ECOLI (SWALL:P36929) (429 aa) fasta scores: E(): 3.6e-46, 37.86% id in 441 aa, and to Ralstonia solanacearum  RNA methyltransferase rsc0075 or rs02273 SWALL:Q8Y3A5 (EMBL:AL646057) (441 aa) fasta scores: E(): 1.4e-89, 59.11% id in 450 aa. CDS appear to be extended at the N-terminus in comparison to orthologues
YP_106753.1	Similar to Neisseria meningitidis hypothetical protein nma0161 SWALL:Q9JWZ1 (EMBL:AL162752) (199 aa) fasta scores: E(): 1.2e-17, 36.87% id in 179 aa, and to the N-terminal region of Ralstonia solanacearum probable proline rich signal peptide protein rsc0076 or rs02253 SWALL:Q8Y3A4 (EMBL:AL646057) (256 aa) fasta scores: E(): 3.4e-38, 56.14% id in 171 aa
YP_106754.1	Two-component regulatory system family, sensor kinase. Similar to Azorhizobium caulinodans nitrogen regulation protein NtrY SWALL:NTRY_AZOCA (SWALL:Q04850) (771 aa) fasta scores: E(): 2.7e-25, 26.65% id in 814 aa, and to Ralstonia solanacearum probable two component sensor histidine kinase transcription regulator protein rsc0077 or rs02275 SWALL:Q8Y3A3 (EMBL:AL646057) (811 aa) fasta scores: E(): 6.7e-118, 58.61% id in 824 aa
YP_106755.1	Two-component regulatory system family, response regulator protein. Similar to Bradyrhizobium japonicum transcriptional regulatory protein FixJ SWALL:FIXJ_BRAJA (SWALL:P23221) (205 aa) fasta scores: E(): 1.1e-09, 31.15% id in 199 aa, and to Ralstonia solanacearum probable two component response regulator transcription regulator protein rsc0078 or rs02276 SWALL:Q8Y3A2 (EMBL:AL646057) (239 aa) fasta scores: E(): 5.9e-33, 72.19% id in 241 aa
YP_106756.1	Similar to the N-terminal regions of Escherichia coli prophage dlp12 integrase IntD or Int SWALL:INTD_ECOLI (SWALL:P24218) (387 aa) fasta scores: E(): 5.1e-19, 36.06% id in 366 aa, and Bacteriophage Sfx integrase Int SWALL:Q9ZXG4 (EMBL:U82084) (386 aa) fasta scores: E(): 4.7e-21, 38.21% id in 369 aa. Note - terminates within tRNA gene that is attachment site for phage
YP_106757.1	Poor database matches. Similar to Ralstonia solanacearum hypothetical protein rsc0967 or rs04399 SWALL:Q8Y0S6 (EMBL:AL646062) (933 aa) fasta scores: E(): 6.5e-153, 50.53% id in 930 aa. N-terminus is similar to the N-termial region of Anabaena sp. DNA primase ALL323 SWALL:Q8YX92 (EMBL:AP003585) (640 aa) fasta scores: E(): 0.21, 23.27% id in 391 aa
YP_106763.1	Similar to Ralstonia solanacearum hypothetical protein rsc1899 or rs03466 SWALL:Q8XY64 (EMBL:AL646067) (68 aa) fasta scores: E(): 2.2, 28.78% id in 66 aa
YP_106765.1	No significant database matches to the full length CDS. N-terminus is similar to the N-terminal regions of bacteriophage APSE-1 hypothetical protein P43 SWALL:Q9T1Q5 (EMBL:AF157835) (256 aa) fasta scores: E(): 3.6e-10, 35.33% id in 133 aa, and to Yersinia pestis  phage protein YPO2093 SWALL:Q8ZER2 (EMBL:AJ414151) (187 aa) fasta scores: E(): 1.1e-13, 42.42% id in 132 aa
YP_106766.1	Similar to bacteriophage K139 hypothetical proteinOrf13 SWALL:Q8W755 (EMBL:AF125163) (83 aa) fasta scores: E(): 1.9e-07, 35.71% id in 84 aa, and to Ralstonia solanacearum  bacteriophage transcriptional activator-related transcription regulator protein rsc0964 or rs04403 SWALL:Q8Y0S9 (EMBL:AL646062) (73 aa) fasta scores: E(): 7.6e-08, 47.36% id in 76 aa
YP_106767.1	Poor database matches. Similar to an internal region of Salmonella typhimurium and Salmonella typhi hypothetical protein STM2627 or STM1013 or STY1021 SWALL:O84891 (EMBL:AF001386) (124 aa) fasta scores: E(): 5.3, 31.76% id in 85 aa
YP_106768.1	Poor database matches. Similar to Methanobacterium thermoautotrophicum hypothetical protein MTH467 SWALL:O26567 (EMBL:AE000831) (53 aa) fasta scores: E(): 6.3, 41.17% id in 51 aa
YP_106769.1	Similar to Ralstonia solanacearum  DNA-binding repressor transcription regulator protein rsc1907 or rs03481 SWALL:Q8XY56 (EMBL:AL646067) (173 aa) fasta scores: E(): 2.2e-19, 43.45% id in 168 aa, and to Xanthomonas campestris pv. campestris str. ATCC 33913 phage-related protein Z2969 SWALL:AAM42269 (EMBL:AE012413) (142 aa) fasta scores: E(): 3.2e-11, 43.13% id in 153 aa
YP_106770.1	Poor database matches. C-terminus is similar to the N-terminal region of Neisseria meningitidis  phage transposase NMA1284 SWALL:Q9JUJ5 (EMBL:AL162755) (657 aa) fasta scores: E(): 1, 25.98% id in 177 aa
YP_106772.1	Similar to bacteriophage 186 late control gene D protein SWALL:VPD_BP186 (SWALL:P21679) (389 aa) fasta scores: E(): 4.9e-35, 41.59% id in 363 aa, and to Xanthomonas campestris pv. campestris str. ATCC 33913 phage-related tail protein D SWALL:AAM42266 (EMBL:AE012413) (328 aa) fasta scores: E(): 8e-63, 49.69% id in 328 aa. Similar to BPSS1089, 97.253% identity (97.253% ungapped) in 364 aa overlap
YP_106773.1	Similar to bacteriophage phi CTX Orf26 protein SWALL:Q9ZXJ9 (EMBL:AB008550) (146 aa) fasta scores: E(): 2.6e-21, 51.2% id in 125 aa, and to Xanthomonas campestris pv. campestris str. ATCC 33913 phage-related tail protein U SWALL:AAM42265 (EMBL:AE012413) (133 aa) fasta scores: E(): 3.7e-21, 53.6% id in 125 aa. Similar to BPSS1088, 98.582% identity (98.582% ungapped) in 141 aa overlap
YP_106774.1	Similar to bacteriophage phi CTX Orf25 protein SWALL:Q9ZXK0 (EMBL:AB008550) (904 aa) fasta scores: E(): 2.4e-15, 27.65% id in 1045 aa, and to Ralstonia solanacearum probable phage-related tail transmembrane protein rsc1914 or rs03483 SWALL:Q8XY49 (EMBL:AL646067) (887 aa) fasta scores: E(): 1.5e-86, 39.43% id in 989 aa. Similar to BPSS1087, 84.514% identity (84.514% ungapped) in 988 aa overlap
YP_106775.1	Similar to bacteriophage phi CTX Orf24.5 protein SWALL:Q9ZXK1 (EMBL:AB008550) (39 aa) fasta scores: E(): 1.9e-07, 56.75% id in 37 aa, and to Xanthomonas campestris pv. campestris str. ATCC 33913 phage-related protein orf52 SWALL:AAM42263 (EMBL:AE012413) (37 aa) fasta scores: E(): 4.4e-08, 62.16% id in 37 aa
YP_106776.1	Similar to bacteriophage phi CTX Orf24 protein SWALL:Q9ZXK2 (EMBL:AB008550) (108 aa) fasta scores: E(): 6.9e-14, 54.83% id in 93 aa, and to Ralstonia solanacearum probable phage-related protein rsc1916 or rs03484 SWALL:Q8XY47 (EMBL:AL646067) (118 aa) fasta scores: E(): 4.6e-13, 55.31% id in 94 aa. Identical to BPSS1086, 100.000% identity (100.000% ungapped) in 114 aa overlap
YP_106777.1	Similar to bacteriophage P2 major tail tube protein FII SWALL:VPF2_BPP2 (SWALL:P22502) (171 aa) fasta scores: E(): 1.8e-26, 44.7% id in 170 aa, and to Xanthomonas campestris pv. campestris str. ATCC 33913 phage-related tail protein FII SWALL:AAM42261 (EMBL:AE012413) (169 aa) fasta scores: E(): 8.2e-37, 54.16% id in 168 aa. Similar to BPSS1085, 99.408% identity (99.408% ungapped) in 169 aa overlap
YP_106778.1	Similar to bacteriophage P2 major tail sheath protein FI SWALL:VPF1_BPP2 (SWALL:P22501) (395 aa) fasta scores: E(): 2.1e-90, 61.63% id in 391 aa, and to Ralstonia solanacearum probable phage-related protein rsc1918 or rs03487 SWALL:Q8XY45 (EMBL:AL646067) (391 aa) fasta scores: E(): 3.1e-100, 67.26% id in 388 aa. Identical to BPSS1084, 100.000% identity (100.000% ungapped) in 390 aa overlap
YP_106779.1	N-terminus is similar to bacteriophage lambda tail fiber assembly protein Tfa SWALL:TFA_LAMBD (SWALL:P03740) (194 aa) fasta scores: E(): 0.011, 27.89% id in 190 aa, and to the N-terminal region of Ralstonia solanacearum tail fiber assembly-like protein rsc1920 or rs03489 SWALL:Q8XY43 (EMBL:AL646067) (250 aa) fasta scores: E(): 3.5e-09, 41.73% id in 115 aa. Similar to BPSS1083, 97.758% identity (97.758% ungapped) in 223 aa overlap
YP_106780.1	No significant database matches to the full length CDS. N-terminal region is similar to Xanthomonas campestris pv. campestris str. ATCC 33913 phage-related tail fiber protein Orf8 SWALL:AAM42256 (EMBL:AE012412) (401 aa) fasta scores: E(): 9e-20, 31.07% id in 399 aa. C-terminus is similar to the C-terminal region of Escherichia coli side tail fiber protein homolog from lambdoid prophage RAC StfR SWALL:STFR_ECOLI (SWALL:P76072) (1120 aa) fasta scores: E(): 0.02, 25.6% id in 578 aa. Similar to BPSS1082, 98.348% identity (98.348% ungapped) in 787 aa overlap
YP_106781.1	Similar to bacteriophage phi CTX Orf19 protein SWALL:Q9ZXK7 (EMBL:AB008550) (178 aa) fasta scores: E(): 4.7e-15, 37.83% id in 148 aa, and to Xanthomonas axonopodis pv. citri str. 306 phage-related tail protein I SWALL:AAM37503 (EMBL:AE011905) (180 aa) fasta scores: E(): 3.5e-30, 50.29% id in 171 aa. Similar to BPSS1081, 99.457% identity (99.457% ungapped) in 184 aa overlap
YP_106782.1	Similar to bacteriophage P2 baseplate assembly protein J SWALL:VPJ_BPP2 (SWALL:P51767) (302 aa) fasta scores: E(): 2.4e-45, 45.6% id in 296 aa, and to Salmonella typhi phage baseplate assembly protein STY3689 SWALL:Q8Z344 (EMBL:AL627279) (302 aa) fasta scores: E(): 2.3e-48, 49.66% id in 296 aa. Similar to BPSS1080, 95.017% identity (95.017% ungapped) in 301 aa overlap
YP_106783.1	Similar to bacteriophage P2 baseplate assembly protein W SWALL:VPW_BPP2 (SWALL:P51768) (115 aa) fasta scores: E(): 9.9e-12, 36.28% id in 113 aa, and to bacteriophage phi CTX Orf17 protein SWALL:Q9ZXK9 (EMBL:AB008550) (114 aa) fasta scores: E(): 1.1e-15, 43.59% id in 117 aa. Similar to BPSS1079, 99.167% identity (99.167% ungapped) in 120 aa overlap
YP_106784.1	Similar to bacteriophage P2 baseplate assembly protein V SWALL:VPV_BPP2 (SWALL:P31340) (211 aa) fasta scores: E(): 4.3e-14, 34.93% id in 229 aa, and to Xanthomonas campestris pv. campestris str. ATCC 33913 phage-related baseplate protein V SWALL:AAM42258 (EMBL:AE012413) (187 aa) fasta scores: E(): 2.8e-16, 36.46% id in 181 aa. Similar to BPSS1078, 96.903% identity (96.903% ungapped) in 226 aa overlap
YP_106785.1	Similar to Brucella abortus modification methylase CcrM SWALL:MTB1_BRUAB (SWALL:O30570) (377 aa) fasta scores: E(): 4.1e-06, 31.66% id in 259 aa, and to Xanthomonas campestris pv. campestris str. ATCC 33913 site-specific DNA-methyltransferase xcc2967 SWALL:AAM42239 (EMBL:AE012411) (234 aa) fasta scores: E(): 1.3e-37, 47.21% id in 233 aa. Similar to BPSS1077, 95.926% identity (95.926% ungapped) in 270 aa overlap
YP_106787.1	Similar to bacteriophage P2 tail completion protein S SWALL:VPS_BPP2 (SWALL:P36934) (150 aa) fasta scores: E(): 9.2e-13, 36.84% id in 152 aa, and to Xanthomonas axonopodis pv. citri str. 306 phage-related tail protein S SWALL:AAM37500 (EMBL:AE011905) (148 aa) fasta scores: E(): 4e-25, 50.99% id in 151 aa. Similar to BPSS1075, 94.194% identity (94.194% ungapped) in 155 aa overlap
YP_106788.1	Similar to bacteriophage P2 tail completion protein R SWALL:VPR_BPP2 (SWALL:P36933) (155 aa) fasta scores: E(): 9.4e-13, 37.87% id in 132 aa, and to Ralstonia solanacearum probable tail completion-like protein rsc1929 or rs03499 SWALL:Q8XY34 (EMBL:AL646067) (144 aa) fasta scores: E(): 2.2e-19, 44.92% id in 138 aa. Similar to BPSS1074, 97.101% identity (97.101% ungapped) in 138 aa overlap
YP_106789.1	Similar to bacteriophage phi CTX Orf12.5 protein SWALL:Q9ZXL4 (EMBL:AB008550) (89 aa) fasta scores: E(): 9.3e-09, 41.97% id in 81 aa, and to Salmonella typhimurium Fels-2 prophage: similar to protein from phage CTX STM2713 SWALL:Q8ZMT9 (EMBL:AE008823) (94 aa) fasta scores: E(): 6.2e-09, 43.59% id in 78 aa. Possible alternative translational start site
YP_106790.1	Similar to bacteriophage P2 LysB protein SWALL:LYSB_BPP2 (SWALL:P51770) (141 aa) fasta scores: E(): 0.00013, 35.41% id in 144 aa, and to bacteriophage phi CTX Orf12 protein SWALL:Q9ZXL5 (EMBL:AB008550) (153 aa) fasta scores: E(): 0.0051, 31.65% id in 139 aa. Similar to BPSS1073, 98.571% identity (98.571% ungapped) in 140 aa overlap
YP_106791.1	Similar to bacteriophage phi CTX Orf11 protein SWALL:Q9ZXL6 (EMBL:AB008550) (268 aa) fasta scores: E(): 2.2e-45, 51.3% id in 269 aa, and to Ralstonia solanacearum phage-related protein rsc1931 or rs03500 SWALL:Q8XY32 (EMBL:AL646067) (268 aa) fasta scores: E(): 3.3e-50, 56.77% id in 273 aa. Similar to BPSS1072, 98.148% identity (98.148% ungapped) in 270 aa overlap
YP_106792.1	Similar to bacteriophage phi CTX Orf10 protein SWALL:Q9ZXL7 (EMBL:AB008550) (90 aa) fasta scores: E(): 2.9e-06, 37.5% id in 80 aa, and to Xanthomonas campestris pv. campestris str. ATCC 33913 phage-related protein Orf90 SWALL:AAM42249 (EMBL:AE012412) (91 aa) fasta scores: E(): 4.7e-10, 41.75% id in 91 aa. Identical to BPSS1071, 100.000% identity (100.000% ungapped) in 90 aa overlap
YP_106793.1	Similar to bacteriophage phi CTX protein SWALL:Q9ZXL8 (EMBL:AB008550) (117 aa) fasta scores: E(): 0.00085, 31.85% id in 113 aa, and to Xanthomonas campestris pv. campestris str. ATCC 33913 phage-related protein Orf89 SWALL:AAM42248 (EMBL:AE012412) (118 aa) fasta scores: E(): 1.6e-15, 51.75% id in 114 aa. Identical to BPSS1070, 100.000% identity (100.000% ungapped) in 114 aa overlap
YP_106794.1	Similar to bacteriophage P2 tail protein X SWALL:VPX_BPP2 (SWALL:P51772) (67 aa) fasta scores: E(): 2.4e-11, 69.81% id in 53 aa, and to Xanthomonas campestris pv. campestris str. ATCC 33913 phage-related tail protein X SWALL:AAM42247 (EMBL:AE012412) (69 aa) fasta scores: E(): 3.6e-13, 59.42% id in 69 aa. Identical to BPSS1069, 100.000% identity (100.000% ungapped) in 68 aa overlap
YP_106795.1	No significant database matches. Similar to BPSS1068, 97.590% identity (97.590% ungapped) in 83 aa overlap
YP_106796.1	Similar to bacteriophage P2 head completion/stabilization protein L SWALL:VPL_BPP2 (SWALL:P25475) (169 aa) fasta scores: E(): 2.8e-15, 42.25% id in 142 aa, and to Ralstonia solanacearum probable bacteriophage protein rsc1935 or rs03504 SWALL:Q8XY28 (EMBL:AL646067) (159 aa) fasta scores: E(): 2.8e-26, 55.34% id in 159 aa. Similar to BPSS1067, 98.113% identity (98.113% ungapped) in 159 aa overlap
YP_106797.1	Similar to bacteriophage P2 terminase, endonuclease subunit M SWALL:VPM_BPP2 (SWALL:P25476) (247 aa) fasta scores: E(): 2.7e-27, 46.29% id in 216 aa, and to Ralstonia solanacearum probable bacteriophage protein rsc1936 or rs03505 SWALL:Q8XY27 (EMBL:AL646067) (240 aa) fasta scores: E(): 8.6e-30, 48.73% id in 238 aa. Similar to BPSS1066, 99.561% identity (99.561% ungapped) in 228 aa overlap
YP_106798.1	Similar to bacteriophage P2 major capsid protein precursor N SWALL:VPN_BPP2 (SWALL:P25477) (357 aa) fasta scores: E(): 5.7e-70, 55.84% id in 342 aa, and to bacteriophage phi CTX protein SWALL:Q9ZXM3 (EMBL:AB008550) (338 aa) fasta scores: E(): 1.6e-83, 64.39% id in 337 aa. Similar to BPSS1065, 97.626% identity (97.917% ungapped) in 337 aa overlap
YP_106799.1	Similar to bacteriophage P2 presumed capsid scaffolding protein O SWALL:VPO_BPP2 (SWALL:P25478) (284 aa) fasta scores: E(): 3e-24, 43.44% id in 290 aa, and to bacteriophage phi CTX protein SWALL:Q9ZXM4 (EMBL:AB008550) (273 aa) fasta scores: E(): 9e-31, 44.71% id in 284 aa. Similar to BPSS1064, 98.885% identity (98.885% ungapped) in 269 aa overlap
YP_106800.1	Similar to bacteriophage P2 terminase, ATPase subunit P SWALL:VPP_BPP2 (SWALL:P25479) (590 aa) fasta scores: E(): 4.2e-136, 56.15% id in 593 aa, and to bacteriophage phi CTX protein SWALL:Q9ZXM5 (EMBL:AB008550) (594 aa) fasta scores: E(): 5.3e-160, 67.19% id in 564 aa. Simlar to BPSS1063, 98.980% identity (98.980% ungapped) in 588 aa overlap
YP_106801.1	Similar to bacteriophage P2 presumed portal vertex protein Q SWALL:VPQ_BPP2 (SWALL:P25480) (344 aa) fasta scores: E(): 5.5e-78, 54.65% id in 344 aa, and to Ralstonia solanacearum probable bacteriophage protein rsc1941 or rs03510 SWALL:Q8XY22 (EMBL:AL646067) (361 aa) fasta scores: E(): 1.1e-90, 61.69% id in 355 aa. Similar to BPSS1062, 99.430% identity (99.430% ungapped) in 351 aa overlap and to the C-terminal region of BPSL0111, 99.390% identity (99.390% ungapped) in 328 aa overlap
YP_106802.1	Similar to Ralstonia solanacearum hypothetical protein rsp0076 or rs05545 SWALL:Q8XTN0 (EMBL:AL646076) (99 aa) fasta scores: E(): 5.5e-10, 50% id in 88 aa, and to Xylella fastidiosa hypothetical protein XF2763 SWALL:Q9P9V8 (EMBL:AE004082) (102 aa) fasta scores: E(): 3e-11, 44.68% id in 94 aa. CDS is extended at the C-terminus in comparison to orthologues. Similar to BPSS1061, 99.153% identity (99.153% ungapped) in 118 aa overlap
YP_106803.1	Similar to Xylella fastidiosa hypothetical protein XF1703 SWALL:Q9PCS5 (EMBL:AE003994) (102 aa) fasta scores: E(): 2e-15, 45.91% id in 98 aa, and to Haemophilus influenzae hypothetical protein HI1419 SWALL:YE19_HAEIN (SWALL:P44190) (99 aa) fasta scores: E(): 3.7e-14, 48.93% id in 94 aa. Simlar to BPSS1060, 95.690% identity (95.690% ungapped) in 116 aa overlap
YP_106805.1	Similar to Caulobacter crescentus ExsB protein CC3160 SWALL:Q9A3P2 (EMBL:AE005980) (242 aa) fasta scores: E(): 4.4e-62, 63.39% id in 224 aa, and to Rhizobium loti hypothetical protein MLL5936 SWALL:Q98AM3 (EMBL:AP003007) (245 aa) fasta scores: E(): 4.8e-57, 58.97% id in 234 aa
YP_106806.1	Similar to Ralstonia solanacearum hypothetical protein rsc1449 or rs03858 SWALL:Q8XZF2 (EMBL:AL646064) (212 aa) fasta scores: E(): 1.4e-57, 67.29% id in 211 aa, and to Caulobacter crescentus hypothetical protein CC3159 SWALL:Q9A3P3 (EMBL:AE005980) (210 aa) fasta scores: E(): 1.8e-55, 64.28% id in 210 aa
YP_106807.1	Similar to Ralstonia solanacearum  6-pyruvoyl tetrahydrobiopterin synthase rsc1450 or rs03857 SWALL:Q8XZF1 (EMBL:AL646064) (158 aa) fasta scores: E(): 1.1e-34, 65.27% id in 144 aa, and to Neisseria meningitidis hypothetical protein NMA0704 SWALL:Q9JVT6 (EMBL:AL162754) (140 aa) fasta scores: E(): 3e-13, 39.18% id in 148 aa
YP_106808.1	Similar to Escherichia coli 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase HpcH or HpaI SWALL:HPAI_ECOLI (SWALL:Q47098) (262 aa) fasta scores: E(): 1.6e-31, 44.57% id in 249 aa, and to Escherichia coli 2-dehydro-3-deoxyglucarate aldolase GarL SWALL:GARL_ECOLI (SWALL:P23522) (256 aa) fasta scores: E(): 6e-32, 46.21% id in 238 aa
YP_106809.1	Similar to Ralstonia solanacearum  signal peptide protein rsc0024 or rs01846 SWALL:Q8Y3F6 (EMBL:AL646057) (252 aa) fasta scores: E(): 2e-31, 43.7% id in 254 aa. C-terminus is similar to the C-terminal region of Neisseria meningitidis hypothetical protein NMB0419 SWALL:Q9K0Y5 (EMBL:AE002398) (198 aa) fasta scores: E(): 2.2e-11, 36.18% id in 152 aa
YP_106810.1	Similar to Escherichia coli rod shape-determining protein roda MrdB or RodA SWALL:RODA_ECOLI (SWALL:P15035) (370 aa) fasta scores: E(): 1.1e-38, 49.6% id in 379 aa, and to Ralstonia solanacearum probable rod shape-determining rsc0063 or rs05768 SWALL:Q8Y3B7 (EMBL:AL646057) (380 aa) fasta scores: E(): 5.3e-111, 70.18% id in 379 aa
YP_106811.1	Similar to Escherichia coli penicillin-binding protein 2 MrdA or PbpA SWALL:PBP2_ECOLI (SWALL:P08150) (633 aa) fasta scores: E(): 2.2e-44, 40% id in 645 aa, and to Ralstonia solanacearum probable substrate-binding transmembrane protein rsc0062 or rs05767 SWALL:Q8Y3B8 (EMBL:AL646057) (801 aa) fasta scores: E(): 7.3e-132, 61.75% id in 808 aa. CDS is extended at the C-terminus in comparison to all orthologues except the Ralstonia solanacearum protein
YP_106812.1	Similar to Escherichia coli rod shape-determining protein MreD SWALL:MRED_ECOLI (SWALL:P16927) (162 aa) fasta scores: E(): 1.4e-06, 29.41% id in 153 aa, and to Ralstonia solanacearum probable rod shape-determining mred transmembrane protein rsc0061 or rs01884 SWALL:Q8Y3B9 (EMBL:AL646057) (170 aa) fasta scores: E(): 2.7e-43, 65.29% id in 170 aa
YP_106813.1	in some organisms this protein is a transmembrane protein while in others it is periplasmic; involved in some organisms with other components of the MreBCD complex and with penicillin binding proteins in the periplasm or cell wall
YP_106814.1	functions in MreBCD complex in some organisms
YP_106815.1	allows the formation of correctly charged Asn-tRNA(Asn) or Gln-tRNA(Gln) through the transamidation of misacylated Asp-tRNA(Asn) or Glu-tRNA(Gln) in organisms which lack either or both of asparaginyl-tRNA or glutaminyl-tRNA synthetases; reaction takes place in the presence of glutamine and ATP through an activated phospho-Asp-tRNA(Asn) or phospho-Glu-tRNA; some Mycoplasma proteins contain an N-terminal fusion to an unknown domain
YP_106816.1	allows the formation of correctly charged Asn-tRNA(Asn) or Gln-tRNA(Gln) through the transamidation of misacylated Asp-tRNA(Asn) or Glu-tRNA(Gln) in organisms which lack either or both of asparaginyl-tRNA or glutaminyl-tRNA synthetases; reaction takes place in the presence of glutamine and ATP through an activated phospho-Asp-tRNA(Asn) or phospho-Glu-tRNA
YP_106817.1	allows the formation of correctly charged Asn-tRNA(Asn) or Gln-tRNA(Gln) through the transamidation of misacylated Asp-tRNA(Asn) or Glu-tRNA(Gln) in organisms which lack either or both of asparaginyl-tRNA or glutaminyl-tRNA synthetases; reaction takes place in the presence of glutamine and ATP through an activated phospho-Asp-tRNA(Asn) or phospho-Glu-tRNA
YP_106818.1	Similar to Ralstonia solanacearum hypothetical protein rsc0138 or rs01008 SWALL:Q8Y343 (EMBL:AL646057) (275 aa) fasta scores: E(): 1.4e-64, 58.84% id in 277 aa, and to Deinococcus radiodurans hypothetical protein DR0132 SWALL:Q9RY20 (EMBL:AE001875) (266 aa) fasta scores: E(): 1.1e-41, 45.21% id in 261 aa
YP_106819.1	Similar to the C-terminal region of Homo sapiens DNA repair major apurinic/ apyrimidinic endonuclease APEX or APE or HAP1 or REF1 or APX SWALL:APE1_HUMAN (SWALL:P27695) (317 aa) fasta scores: E(): 1.2e-32, 37.94% id in 253 aa, and to the full length Ralstonia solanacearum  exodeoxyribonuclease III protein rsc0140 or rs01010 SWALL:Q8Y341 (EMBL:AL646057) (261 aa) fasta scores: E(): 5.7e-90, 79.45% id in 258 aa
YP_106820.1	Similar to Mycobacterium tuberculosis, and Mycobacterium bovis NADP-dependent alcohol dehydrogenase AdhC or Adh SWALL:ADH_MYCTU (SWALL:P31975) (346 aa) fasta scores: E(): 3.3e-68, 56% id in 350 aa, and to Xylella fastidiosa NADP-alcohol dehydrogenase XF1136 SWALL:Q9PE92 (EMBL:AE003949) (352 aa) fasta scores: E(): 3.9e-72, 58.48% id in 342 aa
YP_106821.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa1380 SWALL:Q9I3W4 (EMBL:AE004567) (321 aa) fasta scores: E(): 2.2e-59, 56.08% id in 296 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa2276 SWALL:Q9I1J8 (EMBL:AE004653) (296 aa) fasta scores: E(): 9.1e-50, 49.11% id in 283 aa
YP_106822.1	Similar to Ralstonia solanacearum hypothetical signal peptide protein rsc0153 or rs01023 SWALL:Q8Y328 (EMBL:AL646057) (314 aa) fasta scores: E(): 1e-30, 38.64% id in 295 aa. C-terminal region is similar to Pasteurella multocida hypothetical protein PM1190 SWALL:Q9CLN0 (EMBL:AE006159) (257 aa) fasta scores: E(): 4.5e-17, 29.21% id in 243 aa
YP_106823.1	Similar to Neisseria meningitidis AmpG-related protein NMB0360 SWALL:Q9K133 (EMBL:AE002392) (427 aa) fasta scores: E(): 4.9e-90, 54.76% id in 420 aa, and to Neisseria gonorrhoeae glutamine synthetase SWALL:P95363 (EMBL:U82701) (427 aa) fasta scores: E(): 4.2e-88, 53.57% id in 420 aa. Possible alternative translational start site
YP_106824.1	Similar to Ralstonia solanacearum hypothetical protein rsc0026 or rs01849 SWALL:Q8Y3F4 (EMBL:AL646057) (215 aa) fasta scores: E(): 1.1e-59, 75.25% id in 194 aa, and to Neisseria meningitidis hypothetical protein NMB0939 SWALL:Q9JZQ6 (EMBL:AE002445) (193 aa) fasta scores: E(): 9.1e-32, 46.87% id in 192 aa
YP_106825.1	Catalyzes the conversion of acetyl-CoA and L-homoserine to CoA and O-acetyl-L-homoserine
YP_106826.1	FtsZ binding protein; synthetically lethal with a defect in the Min system; this protein is the first identified nucleoid occlusion factor which works along with the Min system to properly position the FtsZ ring assembly
YP_106827.1	Poor database matches. C-terminus is similar to the C-terminal region of Ralstonia solanacearum hypothetical protein rsc0032 or rs01855 SWALL:Q8Y3E8 (EMBL:AL646057) (287 aa) fasta scores: E(): 4.3e-40, 55% id in 240 aa. Internal region is similar to the N-terminus of Neisseria meningitidis  hydrolase NMB0040 SWALL:Q9K1P1 (EMBL:AE002362) (237 aa) fasta scores: E(): 1.9e-14, 36.5% id in 189 aa
YP_106828.1	catalyzes the phosphorylation of N-acetyl-L-glutamate to form N-acetyl-L-glutamate 5-phosphate
YP_106829.1	Two-component regulatory system family, sensor kinase. Similar to Rhodobacter sphaeroides sensor histidine kinase RegB or PrrB SWALL:REGB_RHOSH (SWALL:Q53068) (462 aa) fasta scores: E(): 4.6e-22, 30.26% id in 423 aa, and to Ralstonia solanacearum probable transmembrane sensor histidine kinase transcription regulator protein rsc0039 or rs01862 SWALL:Q8Y3E1 (EMBL:AL646057) (448 aa) fasta scores: E(): 2.1e-49, 46.62% id in 429 aa
YP_106830.1	Two-component regulatory system family, response regulator protein. Similar to Rhodovulum sulfidophilum photosynthetic apparature regulatory protein RegA SWALL:REGA_RHOSU (SWALL:O82868) (183 aa) fasta scores: E(): 4.4e-24, 46.32% id in 177 aa, and to Pseudomonas aeruginosa probable two-component response regulator pa4493 SWALL:Q9HVS8 (EMBL:AE004863) (186 aa) fasta scores: E(): 7.5e-29, 52.27% id in 176 aa
YP_106831.1	heat shock protein involved in degradation of misfolded proteins
YP_106832.1	heat shock protein involved in degradation of misfolded proteins
YP_106833.1	Similar to Ralstonia solanacearum  dnaK suppressor protein rsc0046 or rs01869 SWALL:Q8Y3D4 (EMBL:AL646057) (139 aa) fasta scores: E(): 3.6e-41, 86.13% id in 137 aa, and to the C-terminal region of Escherichia coli dnaK suppressor protein DksA SWALL:DKSA_ECOLI (SWALL:P18274) (151 aa) fasta scores: E(): 3.7e-15, 46.21% id in 119 aa
YP_106834.1	Similar to Ralstonia solanacearum hypothetical protein rsc0047 or rs01870 SWALL:Q8Y3D3 (EMBL:AL646057) (362 aa) fasta scores: E(): 1.2e-96, 72.57% id in 361 aa. Weakly similar to the N-terminal region of Pseudomonas chlororaphis protein required for the expression of the nitrile hydratase genes SWALL:P47K_PSECL (SWALL:P31521) (419 aa) fasta scores: E(): 9.5e-18, 29.94% id in 354 aa
YP_106835.1	Similar to Ralstonia solanacearum hypothetical protein rsc0051 or rs01874 SWALL:Q8Y3C9 (EMBL:AL646057) (397 aa) fasta scores: E(): 2.2e-80, 71.46% id in 424 aa, and to Yersinia pestis hypothetical protein YPO1445 SWALL:Q8ZG67 (EMBL:AJ414148) (396 aa) fasta scores: E(): 3.7e-45, 41.33% id in 421 aa
YP_106836.1	site-specific tyrosine recombinase which cuts and rejoins DNA molecules; binds cooperatively to specific DNA consensus sites; forms a heterotetrameric complex with XerC; XerCD exhibit similar sequences; essential to convert chromosome dimers to monomers during cell division and functions during plasmid segregation; cell division protein FtsK may regulate the XerCD complex; enzyme from Streptococcus group has unusual active site motifs
YP_106837.1	Similar to Ralstonia solanacearum hypothetical protein rsc0053 or rs01876 SWALL:Q8Y3C7 (EMBL:AL646057) (237 aa) fasta scores: E(): 1.2e-43, 53.3% id in 242 aa, and to Pseudomonas fluorescens hypothetical protein SWALL:O05323 (EMBL:Y12268) (240 aa) fasta scores: E(): 2.9e-06, 29.15% id in 247 aa
YP_106838.1	involved in lysine biosynthesis; DAP epimerase; produces DL-diaminopimelate from LL-diaminopimelate
YP_106839.1	Acylates the intermediate (KDO)2-lipid IVA to form (KDO)2-(lauroyl)-lipid IVA
YP_106840.1	methionine adenosyltransferase; catalyzes the formation of S-adenosylmethionine from methionine and ATP; methionine adenosyltransferase
YP_106841.1	No significant database matches. Doubtful CDS
YP_106842.1	Weakly similar to Homo sapiens phytanoyl-CoA dioxygenase, peroxisomal precursor PHYH or PAHX SWALL:PAHX_HUMAN (SWALL:O14832) (338 aa) fasta scores: E(): 3.7e-09, 26.08% id in 253 aa. C-terminal region is similar to Ralstonia solanacearum probable hydroxylase rsp0209 or rs06150 SWALL:Q8XTA5 (EMBL:AL646077) (263 aa) fasta scores: E(): 3.9e-44, 47.84% id in 255 aa. Possible alternative translational start site
YP_106844.1	Similar to Xanthomonas axonopodis oxidoreductase XAC3199 SWALL:AAM38043 (EMBL:AE011965) (346 aa) fasta scores: E(): 7.6e-104, 77.03% id in 344 aa, and to Mus musculus voltage-gated potassium channel beta-2 subunit KCNAB2 or KCNB3 or CKbeta2 SWALL:KVB2_MOUSE (SWALL:Q64284) (367 aa) fasta scores: E(): 1.2e-30, 35.93% id in 320 aa
YP_106845.1	Poor database matches. Similar to the N-terminal region of Mus musculus 4833420e20rik protein SWALL:Q9CPT9 (EMBL:AK014734) (261 aa) fasta scores: E(): 5.8, 36.92% id in 65 aa, and to C-terminal region of Chlamydia pneumoniae hypothetical protein CPN0211 or CP0554 SWALL:Q9Z8X3 (EMBL:AE001607) (98 aa) fasta scores: E(): 1.4, 35.18% id in 54 aa
YP_106846.1	Similar to Pseudomonas aeruginosa hypothetical protein PA2712 SWALL:Q9I0D0 (EMBL:AE004699) (287 aa) fasta scores: E(): 2.5e-45, 51.94% id in 283 aa, and to Pseudomonas aeruginosa hypothetical protein PA3358 SWALL:Q9HYN8 (EMBL:AE004758) (292 aa) fasta scores: E(): 1.2e-21, 40.2% id in 291 aa
YP_106847.1	Similar to Ralstonia solanacearum  transporter transmembrane protein rsc3069 or rs00513 SWALL:Q8XUW4 (EMBL:AL646073) (428 aa) fasta scores: E(): 1.5e-80, 57.51% id in 426 aa, and to Pseudomonas aeruginosa probable MFS transporter PA5030 SWALL:Q9HUD9 (EMBL:AE004916) (438 aa) fasta scores: E(): 1.4e-67, 48.79% id in 416 aa
YP_106849.1	catalyzes the phosphorylation of protein substrates at serine and threonine residues in vitro; specific substrate in vivo has not been identified yet; plays a role in long-term cell survival and expression of surface appendages
YP_106850.1	Similar to Pseudomonas sp. coniferyl aldehyde dehydrogenase CalB SWALL:CALB_PSESP (SWALL:O86447) (480 aa) fasta scores: E(): 4.8e-77, 47.36% id in 475 aa, and to Pseudomonas aeruginosa probable coniferyl aldehyde dehydrogenase PA0366 SWALL:CALB_PSEAE (SWALL:Q9I6C8) (476 aa) fasta scores: E(): 9.8e-91, 53.03% id in 462 aa
YP_106851.1	Similar to Escherichia coli aidB protein SWALL:AIDB_ECOLI (SWALL:P33224) (541 aa) fasta scores: E(): 4.5e-89, 47.49% id in 518 aa. Previously sequenced as Burkholderia pseudomallei  acyl-CoA dehydrogenase AidB SWALL:Q9ANZ8 (EMBL:AF317886) (554 aa) fasta scores: E(): 0, 99.81% id in 554 aa. Similar to BPSL3386, 60.759% identity (61.993% ungapped) in 553 aa overlap
YP_106852.1	Similar to Pseudomonas oleovorans alcohol dehydrogenase [acceptor] AlkJ or AlcO SWALL:ALKJ_PSEOL (SWALL:Q00593) (558 aa) fasta scores: E(): 3.4e-98, 48.26% id in 547 aa, and to Rhizobium loti dehydrogenase, polyethylene glycol dehydrogenase, alcohol dehydrogenase, L-sorbose dehydrogenase MLL3225 SWALL:Q98GQ1 (EMBL:AP003001) (535 aa) fasta scores: E(): 3.8e-117, 56.05% id in 537 aa
YP_106853.1	C-terminal region is similar to Salmonella typhimurium flagellar hook-length control protein FliK or FlaE or FlaR SWALL:FLIK_SALTY (SWALL:P26416) (405 aa) fasta scores: E(): 2.5e-13, 32.43% id in 410 aa. Full length CDS is similar to Ralstonia solanacearum probable flagellar hook-length control protein rsp0395 or rs00823 SWALL:Q8XSS2 (EMBL:AL646078) (516 aa) fasta scores: E(): 1.6e-14, 32.62% id in 515 aa
YP_106854.1	Similar to Salmonella typhimurium, and Salmonella typhi flagellar fliJ protein FliJ or FlaO or FlaS SWALL:FLIJ_SALTY (SWALL:P26463) (147 aa) fasta scores: E(): 1.9e-09, 32.85% id in 140 aa, and to Burkholderia cepacia  flagellar chaperone FliJ SWALL:Q8VQP3 (EMBL:AF453480) (152 aa) fasta scores: E(): 1.2e-41, 80% id in 150 aa
YP_106855.1	Similar to Salmonella typhimurium flagellum-specific ATP synthase FliI or FlaC SWALL:FLII_SALTY (SWALL:P26465) (456 aa) fasta scores: E(): 9.9e-107, 69.53% id in 453 aa, and to Burkholderia cepacia flagellar ATPase FliI SWALL:Q8VQP4 (EMBL:AF453480) (501 aa) fasta scores: E(): 2.4e-158, 88.8% id in 509 aa. CDS is extended at the N-terminus in comparison to orthologues. Possible alternative translation start site
YP_106856.1	binds to and inhibits the function of flagella specific ATPase FliI
YP_106857.1	One of three proteins involved in switching the direction of the flagellar rotation
YP_106858.1	the MS-ring anchors the flagellum to the cytoplasmic membrane; part of the flagellar basal body which consists of four rings L, P, S, and M mounted on a central rod
YP_106859.1	Similar to Salmonella typhimurium flagellar hook-basal body complex protein FliE or FlaN SWALL:FLIE_SALTY (SWALL:P26462) (103 aa) fasta scores: E(): 8.5e-10, 43.24% id in 111 aa, and to Burkholderia cepacia flagellar hook-basal body protein FliE SWALL:Q8VQP8 (EMBL:AF453480) (114 aa) fasta scores: E(): 1.4e-27, 82.45% id in 114 aa
YP_106860.1	Similar to Salmonella typhimurium flagellar protein FliS SWALL:FLIS_SALTY (SWALL:P26609) (135 aa) fasta scores: E(): 2e-19, 50% id in 132 aa, and to Ralstonia solanacearum probable flagellar protein rsp0384 or rs00812 SWALL:Q8XST3 (EMBL:AL646078) (140 aa) fasta scores: E(): 1.3e-17, 50% id in 136 aa
YP_106861.1	Similar to Ralstonia solanacearum probable flagellar protein rsp0385 or rs00813 SWALL:Q8XST2 (EMBL:AL646078) (118 aa) fasta scores: E(): 0.0005, 34.44% id in 90 aa, and to Yersinia pestis fliT protein ypo1839 SWALL:Q8ZF79 (EMBL:AJ414150) (120 aa) fasta scores: E(): 5.6, 24.24% id in 99 aa
YP_106862.1	Poor database matches. Weakly similar to Rhizobium meliloti chemotaxis protein MotD SWALL:MOTD_RHIME (SWALL:Q52964) (475 aa) fasta scores: E(): 0.13, 25.46% id in 483 aa. N-terminal region is weakly similar to Xanthomonas axonopodis hypothetical protein XAC0071 SWALL:AAM34963 (EMBL:AE011630) (346 aa) fasta scores: E(): 0.018, 29.73% id in 333 aa
YP_106863.1	Similar to Helicobacter pylori  member of ABC transporter family AbcB or JHP1483 SWALL:O30551 (EMBL:AF010307) (90 aa) fasta scores: E(): 1.3e-08, 41.46% id in 82 aa, and to the C-terminal region of Escherichia coli flagellar biosynthetic protein FlhB SWALL:FLHB_ECOLI (SWALL:P76299) (382 aa) fasta scores: E(): 9.2e-07, 39.8% id in 103 aa
YP_106864.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc3067 or rs00511 SWALL:Q8XUW6 (EMBL:AL646073) (247 aa) fasta scores: E(): 6.5e-14, 45.7% id in 221 aa, and to Vibrio cholerae hypothetical protein VC0283 SWALL:Q9KV73 (EMBL:AE004116) (225 aa) fasta scores: E(): 1.5e-12, 30.69% id in 215 aa. Lack of similarity at the N-terminus in comparison to other proteins
YP_106865.1	Similar to Ralstonia solanacearum hypothetical protein rsc1463 rsc1463 or rs03844 SWALL:Q8XZD8 (EMBL:AL646064) (343 aa) fasta scores: E(): 9.1e-102, 78.59% id in 341 aa, and to Pseudomonas aeruginosa hypothetical protein PA4618 SWALL:Q9HVH3 (EMBL:AE004876) (323 aa) fasta scores: E(): 7.4e-37, 38% id in 321 aa
YP_106866.1	Similar to Ralstonia solanacearum probable amino-acid transporter transmembrane protein rsc1588 or rs03950 SWALL:Q8XZ18 (EMBL:AL646065) (476 aa) fasta scores: E(): 1.1e-128, 74.83% id in 461 aa, and to Bacillus subtilis hypothetical protein YhdG SWALL:O07576 (EMBL:Y14082) (465 aa) fasta scores: E(): 3.3e-112, 65.43% id in 460 aa
YP_106867.1	Two-component regulatory system family, response regulator protein. Similar to Pseudomonas aeruginosa response regulator GacA SWALL:GACA_PSEAE (SWALL:Q51373) (214 aa) fasta scores: E(): 1.1e-24, 38.38% id in 211 aa, and to Ralstonia solanacearum response regulator transcription regulator protein rsc0292 or rs03259 SWALL:Q8Y2P3 (EMBL:AL646058) (210 aa) fasta scores: E(): 4.7e-30, 45.23% id in 210 aa
YP_106868.1	Similar to Azotobacter vinelandii ferredoxin--NADP reductase Fpr SWALL:FENR_AZOVI (SWALL:Q44532) (257 aa) fasta scores: E(): 4.6e-66, 63.67% id in 256 aa, and to Neisseria meningitidis  ferredoxin--NADP reductase nma1442 or nmb1044 SWALL:Q9JRE3 (EMBL:AL162756) (258 aa) fasta scores: E(): 1.2e-68, 66.92% id in 257 aa. Similar to BPSL2208, 61.328% identity (61.328% ungapped) in 256 aa overlap
YP_106869.1	Similar to Escherichia coli threonine efflux protein RhtC SWALL:RHTC_ECOLI (SWALL:P27846) (206 aa) fasta scores: E(): 4.7e-10, 31.5% id in 219 aa, and to Pseudomonas aeruginosa hypothetical protein PA1620 SWALL:Q9I3A2 (EMBL:AE004589) (213 aa) fasta scores: E(): 5.4e-15, 34.41% id in 215 aa
YP_106870.1	Similar to Salmonella typhimurium  cytoplasmic protein STM0813 SWALL:Q8ZQP3 (EMBL:AE008733) (252 aa) fasta scores: E(): 2e-15, 32.53% id in 249 aa, and to Pseudomonas aeruginosa hypothetical protein PA2156 SWALL:Q9I1V9 (EMBL:AE004642) (245 aa) fasta scores: E(): 2.3e-15, 33.99% id in 253 aa
YP_106871.1	No significant database matches. Possible alternative translational start site
YP_106873.1	Similar to Agrobacterium tumefaciens dehydrogenase atu2734 or AGR_C_4955 SWALL:Q8UBW6 (EMBL:AE009221) (367 aa) fasta scores: E(): 3.7e-76, 58.51% id in 364 aa, and to Rhizobium loti hypothetical protein MLL4765 SWALL:Q98DC4 (EMBL:AP003004) (370 aa) fasta scores: E(): 5.5e-76, 59.29% id in 366 aa
YP_106874.1	Similar to Ralstonia solanacearum high potential iron-sulfur protein precursor rsc3086 or rs00538 SWALL:HPIS_RALSO (SWALL:Q8XUU7) (103 aa) fasta scores: E(): 1.3e-14, 50.96% id in 104 aa. -terminal region is similar to Rhodocyclus gelatinosus high potential iron-sulfur protein Hip SWALL:HPIS_RHOGE (SWALL:P00265) (74 aa) fasta scores: E(): 1.3e-11, 54.16% id in 72 aa
YP_106875.1	Similar to Salmonella typhimurium, and Salmonella typhi citrate-proton symporter CitA SWALL:CIT1_SALTY (SWALL:P24115) (434 aa) fasta scores: E(): 3.4e-53, 38.55% id in 428 aa, and to Pseudomonas aeruginosa probable MFS transporter pa4343 SWALL:Q9HW58 (EMBL:AE004850) (439 aa) fasta scores: E(): 9.4e-83, 53.69% id in 406 aa
YP_106876.1	Similar to Escherichia coli periplasmic dipeptide transport protein precursor DppA SWALL:DPPA_ECOLI (SWALL:P23847) (535 aa) fasta scores: E(): 8.8e-120, 55.29% id in 519 aa, and to Pseudomonas aeruginosa probable binding protein component of ABC transporter pa4496 SWALL:Q9HVS5 (EMBL:AE004863) (537 aa) fasta scores: E(): 4.6e-148, 66.17% id in 541 aa
YP_106877.1	Similar to Escherichia coli dipeptide transport system permease DppB SWALL:DPPB_ECOLI (SWALL:P37316) (339 aa) fasta scores: E(): 2.7e-85, 65.48% id in 339 aa, and to Pseudomonas aeruginosa probable permease of ABC transporter pa4503 SWALL:Q9HVR8 (EMBL:AE004864) (336 aa) fasta scores: E(): 5.2e-92, 74.7% id in 336 aa
YP_106878.1	Similar to Escherichia coli dipeptide transport system permease DppC SWALL:DPPC_ECOLI (SWALL:P37315) (300 aa) fasta scores: E(): 2.3e-63, 56.33% id in 300 aa, and to Pseudomonas aeruginosa probable permease of ABC transporter pa4504 SWALL:Q9HVR7 (EMBL:AE004864) (303 aa) fasta scores: E(): 1.2e-73, 66.77% id in 304 aa
YP_106879.1	Similar to Escherichia coli dipeptide transport ATP-binding protein DppD SWALL:DPPD_ECOLI (SWALL:P37314) (327 aa) fasta scores: E(): 1.7e-59, 56.87% id in 320 aa, and to Pseudomonas aeruginosa probable ATP-binding component of ABC transporter pa4505 SWALL:Q9HVR6 (EMBL:AE004864) (324 aa) fasta scores: E(): 5e-67, 64.37% id in 320 aa
YP_106880.1	Part of the ABC transporter complex DppABCDF involved in the transport of dipeptides
YP_106881.1	Weakly similar to Xanthomonas campestris hypothetical protein XCC2296 SWALL:AAM41575 (EMBL:AE012337) (321 aa) fasta scores: E(): 4.6e-12, 29.73% id in 296 aa, and to Brucella melitensis hypothetical exported protein BMEI0146 SWALL:Q8YJE0 (EMBL:AE009457) (286 aa) fasta scores: E(): 2.3e-07, 29.63% id in 270 aa
YP_106882.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc2167 or rs01432 SWALL:Q8XXE7 (EMBL:AL646068) (318 aa) fasta scores: E(): 3e-78, 65.2% id in 319 aa, and to Yersinia pestis  membrane protein ypo2702 SWALL:Q8ZD87 (EMBL:AJ414153) (339 aa) fasta scores: E(): 3.5e-52, 54.14% id in 338 aa
YP_106883.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc2168 or rs01431 SWALL:Q8XXE6 (EMBL:AL646068) (239 aa) fasta scores: E(): 5.1e-62, 69.45% id in 239 aa, and to Yersinia pestis  membrane protein ypo2701 SWALL:Q8ZD88 (EMBL:AJ414153) (243 aa) fasta scores: E(): 8.1e-60, 65.41% id in 240 aa
YP_106884.1	Similar to Ralstonia solanacearum hypothetical protein rsc2169 or rs01430 SWALL:Q8XXE5 (EMBL:AL646068) (247 aa) fasta scores: E(): 7.6e-61, 67.34% id in 245 aa, and to Escherichia coli hypothetical protein YbgL SWALL:YBGL_ECOLI (SWALL:P75746) (244 aa) fasta scores: E(): 2.8e-57, 62.29% id in 244 aa
YP_106885.1	Similar to Ralstonia solanacearum hypothetical protein rsc2170 or rs01429 SWALL:Q8XXE4 (EMBL:AL646068) (353 aa) fasta scores: E(): 3.2e-32, 54.44% id in 360 aa, and to an internal region of Saccharomyces cerevisiae urea amidolyase [includes: urea carboxylase; allophanate hydrolase] DUR1,2 SWALL:DUR1_YEAST (SWALL:P32528) (1835 aa) fasta scores: E(): 2.4e-15, 32.19% id in 351 aa
YP_106886.1	Similar to Ralstonia solanacearum hypothetical protein rsc2171 or rs01428 SWALL:Q8XXE3 (EMBL:AL646068) (215 aa) fasta scores: E(): 1.5e-50, 63.67% id in 212 aa, and to Salmonella typhimurium  carboxylase stm0712 SWALL:Q8ZQV8 (EMBL:AE008729) (218 aa) fasta scores: E(): 6.4e-42, 55.18% id in 212 aa
YP_106887.1	Similar to the Ralstonia solanacearum hypothetical protein rsc1721 or rs02911 SWALL:Q8XYN7 (EMBL:AL646066) (188 aa) fasta scores: E(): 2.1e-33, 55.21% id in 163 aa, and Brucella melitensis hypothetical protein BMEII0603 SWALL:Q8YCC9 (EMBL:AE009696) (199 aa) fasta scores: E(): 4.6e-27, 46.62% id in 163 aa. CDS is truncated at the N-terminus is comparison to other orthologues
YP_106888.1	Similar to Ralstonia solanacearum hypothetical protein rsc0089 or rs02262 SWALL:Q8Y391 (EMBL:AL646057) (201 aa) fasta scores: E(): 5.6e-24, 45.55% id in 180 aa, and to Rhizobium loti hypothetical protein mll0364 SWALL:Q98N02 (EMBL:AP002994) (197 aa) fasta scores: E(): 2.6e-16, 35.91% id in 181 aa
YP_106889.1	Similar to Escherichia coli soluble lytic murein transglycosylase precursor Slt or SltY SWALL:SLT_ECOLI (SWALL:P03810) (645 aa) fasta scores: E(): 5.8e-31, 27.49% id in 662 aa, and to Ralstonia solanacearum probable soluble lytic murein transglycosylase precursor transmembrane protein rsc0088 or rs02278 SWALL:Q8Y392 (EMBL:AL646057) (650 aa) fasta scores: E(): 9.4e-96, 57.01% id in 656 aa
YP_106890.1	Similar to the C-terminal region of Bos taurus NADH-ubiquinone oxidoreductase 39 kDa subunit, mitochondrial precursor NDUFA9 SWALL:NUEM_BOVIN (SWALL:P34943) (380 aa) fasta scores: E(): 7.2e-17, 31.14% id in 305 aa, and to the full length Ralstonia solanacearum  NADH-ubiquinone oxidoreductase oxidoreductase rsc0087 or rs02261 SWALL:Q8Y393 (EMBL:AL646057) (334 aa) fasta scores: E(): 3.6e-40, 47.18% id in 337 aa
YP_106891.1	Similar to Pseudomonas pseudoalcaligenes glutathione S-transferase BphX0 SWALL:Q52037 (EMBL:D85853) (203 aa) fasta scores: E(): 7.5e-05, 30.8% id in 198 aa, and to Ralstonia solanacearum hypothetical protein rsc0086 or rs02260 SWALL:Q8Y394 (EMBL:AL646057) (229 aa) fasta scores: E(): 7.5e-42, 57% id in 207 aa
YP_106892.1	catalyzes the addition and repair of the essential 3'-terminal CCA sequence in tRNAs without using a nucleic acid template; phosphohydrolase activities include hydrolysis of pyrophosphate, 5'-nucleoside tri- and diphosphates, NADP, and 2'-AMP with the production of Pi, metal-dependent phosphodiesterase activity for 2',3'-cAMP, 2',3'-cGMP, and 2',3'-cCMP, and hydrolysis 2',3'-cyclic substrates with the formation of 2'-nucleotides and 3'-nucleotides; these phosphohydrolase activities are probably involved in the repair of the tRNA 3'-CCA terminus degraded by intracellular RNases
YP_106893.1	Similar to the N-terminal regions of Xanthomonas axonopodis RebB protein rebB SWALL:AAM37859 (EMBL:AE011943) (97 aa) fasta scores: E(): 1.5e-19, 86.95% id in 69 aa, and to Caedibacter taeniospiralis RebB protein SWALL:Q46365 (EMBL:U04524) (105 aa) fasta scores: E(): 3.2e-06, 46.03% id in 63 aa. C-terminal region of the CDS appears to be either truncated, or divergent in comparison to other proteins
YP_106894.1	Similar to Proteus mirabilis flagella synthesis protein FlgN SWALL:FLGN_PROMI (SWALL:P96975) (146 aa) fasta scores: E(): 0.078, 24.82% id in 141 aa, and to Yersinia pestis flagella synthesis protein ypo1796 SWALL:Q8ZFC1 (EMBL:AJ414150) (146 aa) fasta scores: E(): 0.00017, 28.67% id in 143 aa
YP_106895.1	Similar to Salmonella typhimurium negative regulator of flagellin synthesis FlgM or FlgR or MviS SWALL:FLGM_SALTY (SWALL:P26477) (97 aa) fasta scores: E(): 0.59, 29.09% id in 110 aa, and to Ralstonia solanacearum probable negative regulator of flagellin synthesis rsp0340 or rs00833 SWALL:Q8XSX7 (EMBL:AL646078) (106 aa) fasta scores: E(): 0.0033, 36.03% id in 111 aa
YP_106896.2	required for the assembly of the flagellar basal body P-ring
YP_106897.1	with FlgF and C makes up the proximal portion of the flagellar basal body rod
YP_106898.1	with FlgF and B makes up the proximal portion of the flagellar basal body rod
YP_106899.2	acts as a scaffold for the assembly of hook proteins onto the flagellar basal body rod; Yersinia, Vibrio parahaemolyticus, Bradyrhizobium and other organisms have 2 copies of some flagellar genes; in V. parahaemolyticus one set used for lateral flagella production and the other is used for the polar flagella production
YP_106900.1	the hook connects flagellar basal body to the flagellar filament
YP_106901.1	FlgF, with FlgB and C, makes up the proximal portion of the flagellar basal body rod
YP_106902.1	makes up the distal portion of the flagellar basal body rod
YP_106903.1	part of the basal body which consists of four rings L, P, S, and M mounted on a central rod; Burkholderia thailandensis has 2 copies of this and other flagella genes
YP_106904.2	part of the basal body which consists of four rings L, P, S, and M mounted on a central rod; Vibrio parahaemolyticus, Yersinia, Bradyrhizobium and other bacteria have two copies of this and other flagellar genes; the V. parahaemolyticus protein is associated with the polar flagella and the Bradyrhizobium protein is associated with the thick flagellum
YP_106905.1	Flagellum-specific muramidase which hydrolyzes the peptidoglycan layer to assemble the rod structure in the periplasmic space
YP_106906.1	Similar to Escherichia coli hypothetical protein YcgR SWALL:YCGR_ECOLI (SWALL:P76010) (244 aa) fasta scores: E(): 9.3e-24, 33.61% id in 241 aa, and to Yersinia pestis hypothetical protein YPO3220 SWALL:Q8ZC10 (EMBL:AJ414156) (252 aa) fasta scores: E(): 1.8e-23, 32.5% id in 240 aa
YP_106907.1	with FlgL acts as a hook filament junction protein to join the flagellar filament to the hook
YP_106908.1	with FlgK acts as a hook filament junction protein to join the flagellar filament to the hook; Yersinia, Vibrio parahaemolyticus, Bradyrhizobium and other organisms have 2 copies of this and other flagellar genes.
YP_106909.1	Similar to Bacillus caldolyticus uracil permease PyrP SWALL:PYRP_BACCL (SWALL:P41006) (432 aa) fasta scores: E(): 1.2e-48, 40.99% id in 422 aa, and to Escherichia coli  purine permease YcdG SWALL:YCDG_ECOLI (SWALL:P75892) (442 aa) fasta scores: E(): 1.3e-106, 70.25% id in 437 aa
YP_106910.1	Glycine cleavage system transcriptional activator; activates the gcvTHP operon in the presence of glycine and represses the operon in its absence
YP_106911.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0979 or rs04313 SWALL:Q8Y0R4 (EMBL:AL646062) (193 aa) fasta scores: E(): 9.4e-22, 43.25% id in 178 aa, and to the N-terminal region of Pseudomonas aeruginosa chromate transport protein ChrA SWALL:CHRA_PSEAE (SWALL:P14285) (416 aa) fasta scores: E(): 5e-07, 30.86% id in 162 aa
YP_106912.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0980 or rs04384 SWALL:Q8Y0R3 (EMBL:AL646062) (181 aa) fasta scores: E(): 8.1e-20, 36.87% id in 179 aa, and to Bacillus subtilis hypothetical protein YwrA SWALL:O05215 (EMBL:Z93767) (178 aa) fasta scores: E(): 1.7e-10, 29.94% id in 167 aa
YP_106913.1	Poor database matches. Weakly similar to Rhizobium meliloti hypothetical protein SWALL:Q91UP1 (EMBL:AJ304453) (111 aa) fasta scores: E(): 0.085, 25% id in 84 aa
YP_106914.1	Similar to Pseudomonas aeruginosa hypothetical protein pa0128 SWALL:Q9I704 (EMBL:AE004450) (113 aa) fasta scores: E(): 1.3e-21, 56.52% id in 115 aa, and to Yersinia pestis hypothetical protein ypo2730 SWALL:Q8ZD62 (EMBL:AJ414153) (113 aa) fasta scores: E(): 2.6e-21, 57.89% id in 114 aa
YP_106915.1	Similar to Listeria monocytogenes hypothetical protein lmo0450 SWALL:Q8Y9S3 (EMBL:AL591975) (221 aa) fasta scores: E(): 5.1e-15, 31.73% id in 208 aa, and to Methanosarcina mazei hypothetical protein MM2287 SWALL:AAM31983 (EMBL:AE013470) (277 aa) fasta scores: E(): 3.5e-20, 37.43% id in 195 aa
YP_106916.1	Similar to Bordetella pertussis outer membrane porin protein precursor SWALL:OMP_BORPE (SWALL:Q04064) (385 aa) fasta scores: E(): 8.1e-14, 29% id in 400 aa, and to Ralstonia solanacearum probable outer membrane porin signal peptide protein rsc3091 or rs00544 SWALL:Q8XUU4 (EMBL:AL646073) (376 aa) fasta scores: E(): 2.7e-40, 42.05% id in 390 aa
YP_106919.1	Weakly similar to Chlorobium tepidum hypothetical protein CT1155 SWALL:AAM72388 (EMBL:AE012876) (354 aa) fasta scores: E(): 0.00043, 23.89% id in 318 aa, and Methanopyrus kandleri predicted integral membrane protein MK1387 SWALL:Q8TVK2 (EMBL:AE010432) (327 aa) fasta scores: E(): 0.0039, 23.88% id in 314 aa. CDS is extended athe N-terminus in comparison to other proteins. Possible alternative translational start site
YP_106920.1	No significant database matches to the full length CDS. Internal region is weakly similar to the N-terminal region of Homo sapiens ceramide glucosyltransferase UGCG SWALL:CEGT_HUMAN (SWALL:Q16739) (394 aa) fasta scores: E(): 1.3e-14, 27.58% id in 319 aa. C-terminal region is similar to Synechocystis sp. ceramide glucosyltransferase slr0813 SWALL:P74046 (EMBL:D90911) (389 aa) fasta scores: E(): 3.1e-32, 29.7% id in 377 aa. Possible alternative translational start site
YP_106921.1	C-terminal region is similar to Pseudomonas aeruginosa porin B precursor OprB SWALL:PORB_PSEAE (SWALL:Q51485) (454 aa) fasta scores: E(): 3.1e-09, 27.09% id in 465 aa, and to Ralstonia solanacearum  porin B precursor rsp1632 or rs02190 SWALL:Q8XPK8 (EMBL:AL646086) (456 aa) fasta scores: E(): 4.4e-08, 29.29% id in 471 aa. Possible alternative translational start site
YP_106922.1	N-terminal region is similar to Pseudomonas aeruginosa manganese transport protein MntH2 SWALL:MNT2_PSEAE (SWALL:Q9RPF2) (438 aa) fasta scores: E(): 7.4e-14, 26.54% id in 437 aa. Similar to Burkholderia cepacia genomovar III natural resistance-associated macrophage protein NRAMP SWALL:Q8VP26 (EMBL:AY028431) (548 aa) fasta scores: E(): 4.1e-176, 82.24% id in 552 aa
YP_106923.1	Poor database matches. Similar to Ralstonia solanacearum hypothetical protein rsc0126 or rs00996 SWALL:Q8Y355 (EMBL:AL646057) (73 aa) fasta scores: E(): 3.5e-11, 60.81% id in 74 aa
YP_106924.1	Similar to Pseudomonas aeruginosa glutathione reductase Gor SWALL:GSHR_PSEAE (SWALL:P23189) (451 aa) fasta scores: E(): 3.5e-83, 53.91% id in 447 aa, and to Burkholderia cepacia glutathione reductase Gor SWALL:GSHR_BURCE (SWALL:P48639) (449 aa) fasta scores: E(): 7.2e-91, 56.6% id in 447 aa
YP_106925.1	catalyzes the formation of arginosuccinate from citrulline and aspartate in arginine biosynthesis
YP_106927.1	Poor database matches. Similar to Xanthomonas axonopodis hypothetical protein xac4135 SWALL:AAM38970 (EMBL:AE012063) (233 aa) fasta scores: E(): 1.3e-20, 37.33% id in 233 aa
YP_106928.1	Similar to Salmonella typhimurium  copper chaperone stm0355 SWALL:Q8ZRG5 (EMBL:AE008711) (64 aa) fasta scores: E(): 5.8e-06, 40.98% id in 61 aa, and to Brucella melitensis heavy metal binding protein bmei1032 SWALL:Q8YGX3 (EMBL:AE009543) (65 aa) fasta scores: E(): 0.00018, 43.07% id in 65 aa
YP_106929.1	Similar to Salmonella typhimurium  cation transporting P-type ATPase SilP SWALL:SILP_SALTY (SWALL:Q9ZHC7) (824 aa) fasta scores: E(): 4.4e-125, 51.5% id in 833 aa, and to Rhizobium loti cation transporting P-type ATPase mlr5325 SWALL:Q98C24 (EMBL:AP003006) (839 aa) fasta scores: E(): 4.9e-128, 57.19% id in 778 aa
YP_106930.1	Similar to Xanthomonas axonopodis hypothetical protein XAC0838 SWALL:AAM35726 (EMBL:AE011715) (212 aa) fasta scores: E(): 1.8e-45, 67.82% id in 202 aa, and to Rhizobium loti hypothetical protein MLL4130 SWALL:Q98EQ7 (EMBL:AP003003) (212 aa) fasta scores: E(): 4.8e-34, 54.63% id in 205 aa
YP_106931.1	Similar to Ralstonia solanacearum  glycine rich transmembrane protein rsc0663 or rs01568 SWALL:Q8Y1M7 (EMBL:AL646060) (279 aa) fasta scores: E(): 1.5e-32, 51.31% id in 267 aa, and to Xanthomonas axonopodis glycine rich protein xac0839 SWALL:AAM35727 (EMBL:AE011716) (286 aa) fasta scores: E(): 7.8e-32, 47.4% id in 270 aa
YP_106932.1	Similar to Xanthomonas campestris hypothetical protein xcc0785 SWALL:AAM40100 (EMBL:AE012178) (164 aa) fasta scores: E(): 1.4e-23, 49.32% id in 148 aa, and to Ralstonia solanacearum hypothetical protein rsc0662 or rs01567 SWALL:Q8Y1M8 (EMBL:AL646060) (173 aa) fasta scores: E(): 2.6e-17, 37.03% id in 162 aa
YP_106934.1	Similar to Alcaligenes eutrophus nickel and cobalt resistance protein CnrC SWALL:CNRC_ALCEU (SWALL:P37974) (418 aa) fasta scores: E(): 1.2e-10, 27.8% id in 410 aa, and to Ralstonia solanacearum  outer membrane cation efflux protein rsp0926 or rs05407 SWALL:Q8XRD2 (EMBL:AL646081) (434 aa) fasta scores: E(): 2.4e-35, 35.96% id in 431 aa
YP_106935.1	N-terminal region is similar to Salmonella typhimurium  membrane fusion protein SilB precursor silB SWALL:SILB_SALTY (SWALL:Q9ZHD0) (430 aa) fasta scores: E(): 1.8e-37, 31.41% id in 417 aa. Full length CDS is similar to Ralstonia solanacearum  cation efflux system transmembrane protein rsp0927 or rs05406 SWALL:Q8XRD1 (EMBL:AL646081) (513 aa) fasta scores: E(): 3.2e-51, 38.89% id in 527 aa
YP_106936.1	Similar to Salmonella typhimurium  cation efflux system protein SilA SWALL:SILA_SALTY (SWALL:Q9ZHC9) (1048 aa) fasta scores: E(): 0, 61.03% id in 1047 aa, and to Ralstonia solanacearum probable cation efflux system transmembrane protein rsp0928 or rs05405 SWALL:Q8XRD0 (EMBL:AL646081) (1047 aa) fasta scores: E(): 0, 72.76% id in 1039 aa
YP_106937.1	Similar to Ralstonia solanacearum hypothetical signal peptide protein rsp0929 or rs05404 SWALL:Q8XRC9 (EMBL:AL646081) (114 aa) fasta scores: E(): 1.2e-07, 44.24% id in 113 aa. C-terminus is similar to the C-terminal region of Rhizobium meliloti hypothetical signal peptide protein smc02284 r00588 or smc02284 SWALL:Q92S41 (EMBL:AL591784) (94 aa) fasta scores: E(): 0.006, 36.98% id in 73 aa
YP_106938.1	Poor database matches. C-terminus is weakly similar to the C-terminal region of Gallus gallus avidin-related protein 4/5 precursor SWALL:AVR4_CHICK (SWALL:P56734) (150 aa) fasta scores: E(): 0.0092, 27.82% id in 115 aa
YP_106939.1	Catalyzes the first step in hexosamine metabolism, converting fructose-6P into glucosamine-6P using glutamine as a nitrogen source
YP_106940.1	[includes: UDP-N-acetylglucosamine pyrophosphorylase; glucosamine-1-phosphate N-acetyltransferase]; Similar to Escherichia coli, and Escherichia coli O157:H7 bifunctional glmU protein [includes: UDP-N-acetylglucosamine pyrophosphorylase; glucosamine-1-phosphate N-acetyltransferase] GlmU SWALL:GLMU_ECO57 (SWALL:P17114) (456 aa) fasta scores: E(): 1.1e-85, 54.42% id in 452 aa, and to Ralstonia solanacearum probable UDP-N-acetylglucosamine pyrophosphorylase rsc0177 or rs01048 SWALL:Q8Y304 (EMBL:AL646057) (455 aa) fasta scores: E(): 1.3e-111, 68.36% id in 452 aa
YP_106941.1	TtcA; YdaO; catalyzes the thiolation of cytosine 32 in specific tRNAs
YP_106942.1	Similar to Ralstonia solanacearum hypothetical protein rsc0157 or rs01027 SWALL:Q8Y324 (EMBL:AL646057) (130 aa) fasta scores: E(): 1.2e-34, 69.04% id in 126 aa, and to Escherichia coli dihydroneopterin aldolase FolB SWALL:FOLB_ECOLI (SWALL:P31055) (122 aa) fasta scores: E(): 1.8, 23.21% id in 112 aa
YP_106943.1	Poor database matches. C-terminal region is similar to Ralstonia solanacearum  oxidoreductase rsc0156 or rs01026 SWALL:Q8Y325 (EMBL:AL646057) (267 aa) fasta scores: E(): 4.1e-14, 44.96% id in 258 aa. Possible alternative translational start site
YP_106944.1	Similar to Ralstonia solanacearum hypothetical protein rsc0155 or rs01025 SWALL:Q8Y326 (EMBL:AL646057) (397 aa) fasta scores: E(): 1.5e-78, 56.52% id in 391 aa, and to Neisseria meningitidis hypothetical protein nma2076 SWALL:Q9JSY7 (EMBL:AL162758) (405 aa) fasta scores: E(): 4.7e-58, 47.69% id in 390 aa
YP_106945.1	Similar to Thermoanaerobacter tengcongensis hypothetical protein TTE1181 SWALL:Q8RAN1 (EMBL:AE013080) (70 aa) fasta scores: E(): 0.027, 31.25% id in 64 aa, and to Bacillus halodurans hypothetical protein bh1226 SWALL:Q9KDI7 (EMBL:AP001511) (71 aa) fasta scores: E(): 0.3, 26.31% id in 57 aa
YP_106947.1	Similar to Escherichia coli fructokinase CscK SWALL:SCRK_ECOLI (SWALL:P40713) (307 aa) fasta scores: E(): 9.5e-18, 32.53% id in 292 aa, and to Deinococcus radiodurans fructokinase dr0728 SWALL:Q9RWE1 (EMBL:AE001928) (303 aa) fasta scores: E(): 6.8e-56, 54.05% id in 296 aa
YP_106948.1	Similar to Xanthomonas campestris hypothetical protein xcc1510 SWALL:Q8PAH3 (EMBL:AE012251) (401 aa) fasta scores: E(): 1.8e-88, 59.11% id in 406 aa, and to Xylella fastidiosa hypothetical protein xf1611 SWALL:Q9PCZ3 (EMBL:AE003988) (401 aa) fasta scores: E(): 4.8e-86, 57.88% id in 406 aa. CDS is extended at the C-terminus in comparison to orthologues
YP_106949.1	Similar to Bacillus subtilis degradation activator DegA SWALL:DEGA_BACSU (SWALL:P37947) (337 aa) fasta scores: E(): 5.3e-19, 30.29% id in 340 aa, and to Xanthomonas campestris transcriptional regulator xcc3356 SWALL:Q8P5I5 (EMBL:AE012454) (343 aa) fasta scores: E(): 2.8e-24, 37.72% id in 334 aa
YP_106950.1	Similar to Escherichia coli methyl-accepting chemotaxis protein I Tsr or CheD SWALL:MCP1_ECOLI (SWALL:P02942) (551 aa) fasta scores: E(): 5.7e-40, 34.86% id in 522 aa, and to Ralstonia solanacearum probable methyl-accepting chemotaxis transmembrane protein rsp0303 or rs05471 SWALL:Q8XT14 (EMBL:AL646077) (515 aa) fasta scores: E(): 6.1e-47, 37.4% id in 516 aa
YP_106951.1	Similar to Pseudomonas aeruginosa hypothetical protein pa2026 SWALL:YK26_PSEAE (SWALL:P39879) (333 aa) fasta scores: E(): 3.5e-85, 66.66% id in 333 aa, and to Xanthomonas campestris hypothetical protein xcc3822 SWALL:Q8P489 (EMBL:AE012503) (330 aa) fasta scores: E(): 2.8e-72, 60.12% id in 326 aa
YP_106953.1	Similar to Bordetella pertussis outer membrane porin protein precursor SWALL:OMP_BORPE (SWALL:Q04064) (385 aa) fasta scores: E(): 1.1e-10, 31.45% id in 391 aa, and to Ralstonia solanacearum probable porin precursor transmembrane protein rsp0337 or rs00714 SWALL:Q8XSY0 (EMBL:AL646078) (351 aa) fasta scores: E(): 1.6e-71, 55.84% id in 351 aa
YP_106954.1	Similar to Rhizobium loti transcriptional regulator mll4082 SWALL:Q98EU3 (EMBL:AP003003) (301 aa) fasta scores: E(): 3.6e-32, 39.24% id in 293 aa, and to Ralstonia solanacearum probable transcription regulator protein rsp0910 or rs01682 SWALL:Q8XRE4 (EMBL:AL646081) (309 aa) fasta scores: E(): 2.2e-31, 38.53% id in 314 aa
YP_106955.1	Similar to Ralstonia solanacearum hypothetical protein rsc0255 or rs00690 SWALL:Q8Y2T0 (EMBL:AL646058) (327 aa) fasta scores: E(): 4.6e-91, 78.23% id in 317 aa, and to Caulobacter crescentus hypothetical protein cc2372 SWALL:Q9A5S5 (EMBL:AE005906) (335 aa) fasta scores: E(): 6.2e-73, 63.77% id in 323 aa
YP_106956.1	Similar to Ralstonia solanacearum hypothetical haloacetate dehalogenase H-1 protein rsc0256 or rs00691 SWALL:Q8Y2S9 (EMBL:AL646058) (308 aa) fasta scores: E(): 2.3e-80, 64.66% id in 300 aa, and to Anabaena sp. hypothetical protein ALR0039 SWALL:Q8Z0Q1 (EMBL:AP003581) (291 aa) fasta scores: E(): 1.6e-62, 52.94% id in 289 aa. CDS contains extra residues at the N-terminus in comparison to some orthologues. Possible alternative translational start site
YP_106957.1	Similar to Bacillus subtilis transcriptional regulator LrpC SWALL:LRPC_BACSU (SWALL:P96582) (144 aa) fasta scores: E(): 1.1e-09, 29.32% id in 133 aa, and to Rhizobium loti transcriptional regulator mll3910 SWALL:Q98F66 (EMBL:AP003003) (152 aa) fasta scores: E(): 3.1e-32, 63.63% id in 143 aa. CDS is extended at the N-terminus in comparison to orthologues
YP_106958.1	Similar to Rhizobium loti hypothetical protein mlr3911 SWALL:Q98F65 (EMBL:AP003003) (301 aa) fasta scores: E(): 8.9e-60, 58.3% id in 295 aa, and to Rhizobium meliloti hypothetical transmembrane protein r00343 or smc00424 SWALL:Q92SM8 (EMBL:AL591783) (304 aa) fasta scores: E(): 1.6e-57, 56.61% id in 295 aa
YP_106959.1	Similar to Ralstonia solanacearum hypothetical protein rsc0260 or rs00695 SWALL:Q8Y2S5 (EMBL:AL646058) (170 aa) fasta scores: E(): 6.2e-42, 70.73% id in 164 aa, and to Aeropyrum pernix hypothetical protein ape2540 SWALL:Q9Y8U3 (EMBL:AP000064) (152 aa) fasta scores: E(): 4.5e-09, 33.33% id in 150 aa
YP_106960.1	catalyzes the formation of acetoacetate and acetyl-CoA from 3-hydroxy-3-methylglutaryl-CoA
YP_106961.1	Similar to Ralstonia solanacearum  2-hydroxyacid dehydrogenase oxidoreductase rsc0262 or rs00697 SWALL:Q8Y2S3 (EMBL:AL646058) (313 aa) fasta scores: E(): 5.5e-65, 57.5% id in 313 aa, and to Salmonella typhi 2-hydroxyacid dehydrogenase in phoH-csgG intergenic region sty1172 SWALL:Q8Z7M6 (EMBL:AL627269) (312 aa) fasta scores: E(): 1.6e-54, 50.16% id in 313 aa
YP_106962.1	Similar to Bordetella pertussis hypothetical protein SWALL:O30442 (EMBL:AF006000) (143 aa) fasta scores: E(): 7.7e-40, 71.85% id in 135 aa, and to Pseudomonas aeruginosa probable ring-cleaving dioxygenase pa0817 SWALL:Q9I5C2 (EMBL:AE004517) (141 aa) fasta scores: E(): 2.1e-38, 68.34% id in 139 aa
YP_106963.1	Similar to Ralstonia solanacearum hypothetical protein rsc1344 or rs02866 SWALL:Q8XZQ1 (EMBL:AL646064) (222 aa) fasta scores: E(): 1.4e-23, 44.04% id in 193 aa, and to Caulobacter crescentus hypothetical protein cc2185 SWALL:Q9A6A9 (EMBL:AE005890) (207 aa) fasta scores: E(): 3.8e-20, 37.56% id in 205 aa
YP_106964.1	Similar to Xanthomonas campestris MutT/NUDIX family protein xcc0078 SWALL:Q8PEA3 (EMBL:AE012101) (144 aa) fasta scores: E(): 5.4e-24, 54.88% id in 133 aa, and to the C-terminal region of Methanococcus jannaschii ADP-ribose pyrophosphatase NudF SWALL:ADPP_METJA (SWALL:Q58549) (169 aa) fasta scores: E(): 1.2e-08, 39.47% id in 114 aa
YP_106965.1	Similar to Pseudomonas aeruginosa non-hemolytic phospholipase C precursor PlcN SWALL:PHLN_PSEAE (SWALL:P15713) (692 aa) fasta scores: E(): 2.5e-77, 48.87% id in 708 aa, and to Burkholderia pseudomallei non-hemolytic phospholipase C precursor PlcN SWALL:PHLN_BURPS (SWALL:Q9RGS8) (700 aa) fasta scores: E(): 2.2e-128, 52.84% id in 721 aa. Similar to BPSL2403, 52.705% identity (56.632% ungapped) in 721 aa overlap
YP_106967.1	Similar to Escherichia coli, and Enterobacter aerogenes leucine-responsive regulatory protein Lrp or AlsB or LivR or Ihb or OppI SWALL:LRP_ENTAE (SWALL:P19494) (163 aa) fasta scores: E(): 1.5e-21, 44% id in 150 aa, and to Ralstonia solanacearum probable transcription regulator protein rsp1377 or rs02081 SWALL:Q8XQA9 (EMBL:AL646084) (152 aa) fasta scores: E(): 2.2e-48, 80.92% id in 152 aa
YP_106968.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein rsp1376 or rs02082 SWALL:Q8XQB0 (EMBL:AL646084) (250 aa) fasta scores: E(): 4.5e-70, 78.47% id in 223 aa. Weakly similar to Bacillus subtilis branched-chain amino acid transport protein AzlC SWALL:AZLC_BACSU (SWALL:O07942) (254 aa) fasta scores: E(): 8.2e-10, 21.25% id in 240 aa
YP_106969.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein rsp1375 or rs02083 SWALL:Q8XQB1 (EMBL:AL646084) (100 aa) fasta scores: E(): 1.8e-24, 73.46% id in 98 aa, and to Rhizobium loti hypothetical protein msl2426 SWALL:Q98IF5 (EMBL:AP002999) (99 aa) fasta scores: E(): 7.8e-23, 69.69% id in 99 aa
YP_106970.1	Similar to Deinococcus radiodurans hydrolase-related protein dr1403 SWALL:Q9RUI3 (EMBL:AE001985) (277 aa) fasta scores: E(): 2.8e-32, 38.62% id in 277 aa. C-terminus is similar to the C-terminal region of Ralstonia solanacearum hydrolase-related protein rsc3406 or rs01715 SWALL:Q8XTY9 (EMBL:AL646075) (266 aa) fasta scores: E(): 1.3e-29, 38.96% id in 231 aa
YP_106971.1	Similar to Ralstonia solanacearum probable lipoprotein rsc0373 or rs03341 SWALL:Q8Y2G3 (EMBL:AL646058) (200 aa) fasta scores: E(): 1.9e-23, 39.17% id in 194 aa, and to Xanthomonas campestris hypothetical protein xcc2038 SWALL:Q8P928 (EMBL:AE012309) (184 aa) fasta scores: E(): 8.4e-18, 36.75% id in 185 aa
YP_106972.1	No significant database matches to the full length CDS. Internal region is weakly similar to the C-terminal region of Dactylium dendroides galactose oxidase precursor GaoA SWALL:GAOA_DACDE (SWALL:Q01745) (680 aa) fasta scores: E(): 2.5e-17, 24.01% id in 658 aa
YP_106973.1	Similar to Escherichia coli dihydrodipicolinate synthase DapA SWALL:DAPA_ECOLI (SWALL:P05640) (292 aa) fasta scores: E(): 7.7e-22, 33.45% id in 278 aa, and to Ralstonia solanacearum probable dihydrodipicolinate synthase-related transmembrane protein rsc0665 or rs01570 SWALL:Q8Y1M5 (EMBL:AL646060) (304 aa) fasta scores: E(): 2.1e-40, 44.8% id in 279 aa
YP_106974.1	No significant database matches to the full length CDS. C-terminal region is similar to Burkholderia cepacia insertion element IS402 hypothetical protein SWALL:YI22_BURCE (SWALL:P24537) (147 aa) fasta scores: E(): 2.1e-17, 53.53% id in 99 aa, and Ralstonia solanacearum probable tis1421-transposase orfa protein SWALL:Q8XGS3 (EMBL:AL646082) (134 aa) fasta scores: E(): 1.5e-14, 51.04% id in 96 aa
YP_106975.1	Poor database matches. C-terminal region is weakly similar to Ralstonia solanacearum hypothetical protein rsc0613 or rs01514 SWALL:Q8Y1S6 (EMBL:AL646060) (190 aa) fasta scores: E(): 0.024, 25% id in 188 aa
YP_106976.1	Poor database matches. Similar to Ralstonia solanacearum hypothetical protein rsc0613 or rs01514 SWALL:Q8Y1S6 (EMBL:AL646060) (190 aa) fasta scores: E(): 1.3e-15, 34.97% id in 183 aa
YP_106977.1	Similar to the C-terminal regions of Brucella melitensis nitrogen assimilation regulatory protein bmei0868 SWALL:Q8YHD3 (EMBL:AE009527) (453 aa) fasta scores: E(): 1.6e-11, 33.88% id in 183 aa, and to Salmonella typhimurium  transcriptional regulator of two-component regulator protein YfhA SWALL:Q8ZN32 (EMBL:AE008816) (445 aa) fasta scores: E(): 1.3e-10, 34.83% id in 178 aa
YP_106978.1	Similar to Salmonella typhimurium sulfate-binding protein precursor Sbp SWALL:SUBI_SALTY (SWALL:P02906) (329 aa) fasta scores: E(): 3.4e-65, 55.52% id in 326 aa, and to Ralstonia solanacearum probable sulfate-binding precursor signal peptide protein rsc1336 or rs02858 SWALL:Q8XZQ9 (EMBL:AL646064) (336 aa) fasta scores: E(): 1.3e-68, 59.13% id in 323 aa. BPSL1839, 58.480% identity (60.606% ungapped) in 342 aa overlap
YP_106979.1	Similar to Ralstonia solanacearum probable carboxypeptidase rsc1003 or rs04289 SWALL:Q8Y0P0 (EMBL:AL646062) (543 aa) fasta scores: E(): 1e-43, 39.22% id in 543 aa, and to Deinococcus radiodurans carboxypeptidase-related protein dr0964 SWALL:Q9RVQ8 (EMBL:AE001948) (500 aa) fasta scores: E(): 2.7e-31, 33.75% id in 480 aa. CDS contains an extended N-terminal region is comparison to orthologues
YP_106980.1	Poor database matches. C-terminus is similar to the C-terminal region of Ralstonia solanacearum  calcium binding signal peptide protein rsc3104 or rs00557 SWALL:Q8XUT1 (EMBL:AL646073) (194 aa) fasta scores: E(): 0.077, 39.47% id in 76 aa
YP_106981.1	Similar to Ralstonia solanacearum  ATP-sensitive inward rectifier potassium channel related transmembrane protein rsc0450 or rs04452 SWALL:Q8Y286 (EMBL:AL646059) (307 aa) fasta scores: E(): 1.6e-79, 71.08% id in 294 aa, and to Anabaena sp. hypothetical protein all0954 SWALL:Q8YY97 (EMBL:AP003584) (303 aa) fasta scores: E(): 1e-45, 43% id in 293 aa
YP_106982.1	catalyzes the ferredoxin-dependent oxidative decarboxylation of arylpyruvates
YP_106983.1	Similar to Yersinia pestis   na(+)/h(+) exchanger protein ypo3630 SWALL:Q8ZAZ9 (EMBL:AJ414158) (549 aa) fasta scores: E(): 4e-91, 50.18% id in 556 aa, and to Escherichia coli  na(+)/h(+) exchanger protein YjcE SWALL:YJCE_ECOLI (SWALL:P32703) (549 aa) fasta scores: E(): 2.3e-90, 49.27% id in 550 aa
YP_106984.1	Weakly similar to Clostridium acetobutylicum sensory protein, containing EAL-domain cac0322 SWALL:Q97M76 (EMBL:AE007546) (412 aa) fasta scores: E(): 1.3e-16, 23.65% id in 389 aa. C-terminal region is similar to and to Rhizobium loti hypothetical protein mll2537 SWALL:Q98I70 (EMBL:AP002999) (282 aa) fasta scores: E(): 7.1e-18, 37.22% id in 231 aa
YP_106985.1	Similar to the C-terminal region of Xanthomonas axonopodis hypothetical protein xac2194 SWALL:Q8PKH9 (EMBL:AE011856) (160 aa) fasta scores: E(): 3.3e-10, 38.65% id in 119 aa, and to the full length Brucella melitensis hypothetical membrane spanning protein bmei1195 SWALL:Q8YGG4 (EMBL:AE009558) (142 aa) fasta scores: E(): 5.7, 29.2% id in 113 aa
YP_106986.1	Similar to an internal region of Homo sapiens alkaline phosphatase, placental type 1 precursor ALPP or PLAP SWALL:PPB1_HUMAN (SWALL:P05187) (535 aa) fasta scores: E(): 2e-16, 37.23% id in 470 aa, and to the full length Ralstonia solanacearum  alkaline phosphatase lipoprotein transmembrane rsc0097 or rs02267 SWALL:Q8Y383 (EMBL:AL646057) (483 aa) fasta scores: E(): 2e-99, 63.03% id in 487 aa. Similar to BPSL0361, 56.639% identity (61.625% ungapped) in 482 aa overlap
YP_106987.1	Similar to an internal region of Homo sapiens alkaline phosphatase, placental type 1 precursor ALPP or PLAP SWALL:PPB1_HUMAN (SWALL:P05187) (535 aa) fasta scores: E(): 2.7e-32, 35.45% id in 471 aa, and to the full length Ralstonia solanacearum  alkaline phosphatase signal peptide protein rsc0098 or rs02280 SWALL:Q8Y382 (EMBL:AL646057) (467 aa) fasta scores: E(): 1.6e-98, 62.92% id in 472 aa. Similar to BPSL0360, 56.432% identity (61.400% ungapped) in 482 aa overlap
YP_106988.1	Poor database matches. Similar to Ralstonia solanacearum  signal peptide protein rsc0099 or rs02268 SWALL:Q8Y381 (EMBL:AL646057) (232 aa) fasta scores: E(): 0.0083, 35.54% id in 256 aa
YP_106989.1	Similar to Escherichia coli copper homeostasis protein CutC SWALL:CUTC_ECOLI (SWALL:P46719) (248 aa) fasta scores: E(): 3.3e-17, 36.17% id in 235 aa, and to Caulobacter crescentus hypothetical protein CC2360 SWALL:Q9A5T7 (EMBL:AE005905) (245 aa) fasta scores: E(): 2e-21, 41.23% id in 211 aa
YP_106990.1	Similar to Escherichia coli biotin synthase BioB SWALL:BIOB_ECOLI (SWALL:P12996) (346 aa) fasta scores: E(): 5.2e-80, 61.58% id in 315 aa, and to Ralstonia solanacearum probable biotin synthase rsc0266 or rs03233 SWALL:Q8Y2R9 (EMBL:AL646058) (360 aa) fasta scores: E(): 1e-98, 74.37% id in 320 aa
YP_106991.1	DTB synthetase; dethiobiotin synthase; involved in production of dethiobiotin from ATP and 7,8-diaminononanoate and carbon dioxide; contains magnesium
YP_106992.1	catalyzes the formation of 8-amino-7-oxononanoate from 6-carboxyhexanoyl-CoA and L-alanine
YP_106993.1	catalyzes the formation of S-adenosyl-4-methylthionine-2-oxobutanoate and 7,8-diaminononanoate from S-adenosyl-L-methionine and 8-amino-7-oxononanoate
YP_106994.1	Internal region is similar to Ralstonia solanacearum hypothetical signal peptide protein rsc0268 or rs03235 SWALL:Q8Y2R7 (EMBL:AL646058) (308 aa) fasta scores: E(): 6.1e-43, 48.32% id in 269 aa, and weakly similar to Caulobacter crescentus hypothetical protein cc0087 SWALL:Q9ABY3 (EMBL:AE005683) (252 aa) fasta scores: E(): 0.00019, 30.08% id in 236 aa
YP_106995.1	Similar to Ralstonia solanacearum hypothetical protein rsc0270 or rs03237 SWALL:Q8Y2R5 (EMBL:AL646058) (144 aa) fasta scores: E(): 3.7e-25, 56.37% id in 149 aa, and to Xanthomonas campestris hypothetical protein xcc4159 SWALL:AAM43375 (EMBL:AE012541) (129 aa) fasta scores: E(): 3.1e-14, 48.57% id in 140 aa
YP_106996.1	Similar to Ralstonia solanacearum hypothetical oxidoreductase rsc0275 or rs03242 SWALL:Q8Y2R0 (EMBL:AL646058) (236 aa) fasta scores: E(): 3.1e-41, 57.75% id in 232 aa. C-terminal region is similar to Myxococcus xanthus C-factor cell-cell signaling protein CsgA or SpoC SWALL:CSGA_MYXXA (SWALL:P21158) (166 aa) fasta scores: E(): 5.8e-11, 37.86% id in 169 aa
YP_106997.1	Catalyzes the synthesis of acetoacetyl coenzyme A from two molecules of acetyl coenzyme A. It can also act as a thiolase, catalyzing the reverse reaction and generating two-carbon units from the four-carbon product of fatty acid oxidation
YP_106998.1	Similar to Ralstonia solanacearum probable carbonic anhydrase rsc0277 or rs03244 SWALL:Q8Y2Q8 (EMBL:AL646058) (226 aa) fasta scores: E(): 3.5e-55, 68.15% id in 201 aa, and to Xanthomonas axonopodis carbonic anhydrase xac1604 SWALL:AAM36472 (EMBL:AE011793) (220 aa) fasta scores: E(): 9.4e-54, 63.67% id in 212 aa. CDS is extended at the C-terminus in comparison to orthologues
YP_106999.1	catalyzes the phosphorylation/dephosphorylation of the enzyme isocitrate dehydrogenase on a specific serine which regulates activity; unphosphorylated IDH is fully active when cells are grown on glucose while the enzyme becomes phosphorylated and inactive in the presence of acetate or ethanol
YP_107000.1	Similar to Ralstonia solanacearum hypothetical protein rsc0281 or rs03248 SWALL:Q8Y2Q4 (EMBL:AL646058) (359 aa) fasta scores: E(): 4.5e-99, 65.45% id in 359 aa, and to Caulobacter crescentus metallo-beta-lactamase cc0395 SWALL:Q9AB39 (EMBL:AE005712) (317 aa) fasta scores: E(): 1.2e-40, 42.54% id in 322 aa. CDS is extended at the N-terminus in comparison to the C. crescentus protein
YP_107001.1	Similar to Pseudomonas aeruginosa probable ATP-binding component of ABC transporter pa1425 SWALL:Q9I3R9 (EMBL:AE004572) (538 aa) fasta scores: E(): 4.1e-65, 45.23% id in 535 aa. Weakly similar to Staphylococcus epidermidis erythromycin resistance ATP-binding protein MsrA SWALL:MSRA_STAEP (SWALL:P23212) (488 aa) fasta scores: E(): 5e-11, 25.83% id in 542 aa
YP_107002.1	Similar to Escherichia coli periplasmic dipeptide transport protein precursor DppA SWALL:DPPA_ECOLI (SWALL:P23847) (535 aa) fasta scores: E(): 2.1e-90, 43.59% id in 523 aa, and to Pseudomonas aeruginosa probable binding protein component of ABC dipeptide transporter pa5317 SWALL:Q9HTN7 (EMBL:AE004944) (526 aa) fasta scores: E(): 8.9e-134, 63.51% id in 529 aa
YP_107003.1	Similar to the N-terminal regions of Ralstonia solanacearum probable acetyl-CoA acetyltransferase rsc0276 or rs03243 SWALL:Q8Y2Q9 (EMBL:AL646058) (393 aa) fasta scores: E(): 4.5e-14, 39.81% id in 211 aa, and Pseudomonas aeruginosa probable acyl-CoA thiolase pa2553 SWALL:Q9I0T1 (EMBL:AE004683) (396 aa) fasta scores: E(): 2e-12, 37.93% id in 203 aa
YP_107004.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa1285 SWALL:Q9I459 (EMBL:AE004558) (149 aa) fasta scores: E(): 8.6e-12, 34.89% id in 149 aa, and to Agrobacterium tumefaciens transcriptional regulator, MarR family atu0852 or agr_c_1559 SWALL:Q8UH33 (EMBL:AE009052) (148 aa) fasta scores: E(): 5e-08, 33.33% id in 141 aa. Possible alternative translational start site
YP_107005.1	Similar to Streptomyces exfoliatus 20-beta-hydroxysteroid dehydrogenase SWALL:2BHD_STREX (SWALL:P19992) (255 aa) fasta scores: E(): 2.2e-09, 28.86% id in 246 aa, and to Streptomyces albus oxidoreductase homologue SitS SWALL:Q9RPT7 (EMBL:AF145724) (223 aa) fasta scores: E(): 6.8e-34, 49.33% id in 225 aa
YP_107006.1	Similar to Ralstonia solanacearum probable dehydrogenase/reductase oxidoreductase rsc0284 or rs03251 SWALL:Q8Y2Q1 (EMBL:AL646058) (266 aa) fasta scores: E(): 6e-36, 62.64% id in 257 aa, and to Mycobacterium tuberculosis  oxidoreductase rv0945 or mt0971 or MTCY10D7.29c SWALL:Y945_MYCTU (SWALL:P71564) (253 aa) fasta scores: E(): 4.9e-18, 34.28% id in 245 aa
YP_107007.1	Similar to Burkholderia cepacia thiol:disulfide interchange protein DsbA SWALL:DSBA_BURCE (SWALL:Q9RHV8) (212 aa) fasta scores: E(): 5.7e-73, 87.73% id in 212 aa, and to Ralstonia solanacearum probable thiol:disulfide interchange signal peptide protein rsc0285 or rs03252 SWALL:Q8Y2Q0 (EMBL:AL646058) (218 aa) fasta scores: E(): 8e-39, 50.22% id in 221 aa
YP_107008.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein rsc0286 or rs03253 SWALL:Q8Y2P9 (EMBL:AL646058) (238 aa) fasta scores: E(): 3.5e-09, 40.9% id in 286 aa, and to Xanthomonas campestris hypothetical protein xcc3862 SWALL:AAM43093 (EMBL:AE012507) (286 aa) fasta scores: E(): 1.5e-06, 30.61% id in 294 aa
YP_107009.1	catalyzes a two-step reaction, first charging an arginine molecule by linking its carboxyl group to the alpha-phosphate of ATP, followed by transfer of the aminoacyl-adenylate to its tRNA; class-I aminoacyl-tRNA synthetase
YP_107010.1	Similar to Ralstonia solanacearum hypothetical protein rsc0288 or rs03255 SWALL:Q8Y2P7 (EMBL:AL646058) (105 aa) fasta scores: E(): 3.5e-11, 42.72% id in 110 aa
YP_107011.1	Similar to Ralstonia solanacearum probable 5-methyltetrahydrofolate--homocysteine methyltransferase rsc0294 or rs03261 SWALL:Q8Y2P1 (EMBL:AL646058) (905 aa) fasta scores: E(): 0, 83.75% id in 905 aa, and to the C-terminal region of Escherichia coli 5-methyltetrahydrofolate--homocysteine methyltransferase MetH SWALL:METH_ECOLI (SWALL:P13009) (1226 aa) fasta scores: E(): 1.7e-129, 62.72% id in 904 aa. BPSL0385 and BPSL03856 are similar to the N- and C-terminal regions of many 5-methyltetrahydrofolate--homocysteine methyltransferases. In some organisms these two domains are also found as separate coding sequences. Effect on the function of CDSs is not known
YP_107012.1	Similar to Ralstonia solanacearum probable 5-methyltetrahydrofolate--homocysteine methyltransferase rsc0295 or rs03262 SWALL:Q8Y2P0 (EMBL:AL646058) (346 aa) fasta scores: E(): 2.9e-107, 80.29% id in 345 aa, and to the N-terminal region Escherichia coli 5-methyltetrahydrofolate--homocysteine methyltransferase MetH SWALL:METH_ECOLI (SWALL:P13009) (1226 aa) fasta scores: E(): 3.2e-72, 59.07% id in 325 aa. BPSL0385 and BPSL03856 are similar to the N- and C-terminal regions of many 5-methyltetrahydrofolate--homocysteine methyltransferases. In some organisms these two domains are also found as separate coding sequences. Effect on the function of CDSs is not known
YP_107013.1	Similar to Ralstonia solanacearum hypothetical protein rsc0297 or rs03264 SWALL:Q8Y2N8 (EMBL:AL646058) (85 aa) fasta scores: E(): 7.8e-19, 68.6% id in 86 aa. Possible alternative translational start sites
YP_107014.1	Similar to Ralstonia solanacearum  prolin-rich signal peptide protein rsc0299 or rs03266 SWALL:Q8Y2N6 (EMBL:AL646058) (355 aa) fasta scores: E(): 3e-17, 42.35% id in 366 aa
YP_107015.1	Similar to Streptomyces coelicolor glycerol operon regulatory protein GylR SWALL:GYLR_STRCO (SWALL:P15360) (254 aa) fasta scores: E(): 8e-11, 32.04% id in 259 aa, and to Ralstonia solanacearum probable transcription regulator protein rsc0300 or rs03267 SWALL:Q8Y2N5 (EMBL:AL646058) (290 aa) fasta scores: E(): 1.6e-52, 55% id in 280 aa. CDS is extended at the N-terminus in comparison to S coelicolor protein
YP_107016.1	Similar to Ralstonia solanacearum hypothetical protein rsc0301 or rs03268 SWALL:Q8Y2N4 (EMBL:AL646058) (330 aa) fasta scores: E(): 5.7e-101, 76.22% id in 328 aa, and to Xanthomonas campestris  dioxygenase xcc0591 SWALL:AAM39907 (EMBL:AF204145) (329 aa) fasta scores: E(): 6e-75, 60.99% id in 323 aa
YP_107017.1	Catalyzes the reversible hydration of unsaturated fatty acyl-CoA to beta-hydroxyacyl-CoA
YP_107018.1	Poor database matches. similar to Ralstonia solanacearum hypothetical protein rsc0305 or rs03272 SWALL:Q8Y2N0 (EMBL:AL646058) (294 aa) fasta scores: E(): 3.2e-07, 37.15% id in 288 aa. C-terminus is similar to the C-terminal region of Pseudomonas aeruginosa polyhydroxyalkanoate synthesis protein pa5060 SWALL:Q9HUC3 (EMBL:AE004919) (309 aa) fasta scores: E(): 0.011, 33.95% id in 215 aa
YP_107019.1	Similar to Ralstonia solanacearum hypothetical protein rsc0306 or rs03273 SWALL:Q8Y2M9 (EMBL:AL646058) (391 aa) fasta scores: E(): 2.6e-77, 53.66% id in 382 aa, and to Pseudomonas aeruginosa hypothetical protein pa3241 SWALL:Q9HYZ9 (EMBL:AE004747) (389 aa) fasta scores: E(): 9.9e-52, 42.33% id in 385 aa
YP_107020.1	Similar to Burkholderia cepacia hypothetical protein SWALL:Q9ZGQ4 (EMBL:AF076477) (283 aa) fasta scores: E(): 7e-108, 92.72% id in 275 aa, and to Ralstonia solanacearum hypothetical protein rsc0308 or rs03275 SWALL:Q8Y2M7 (EMBL:AL646058) (289 aa) fasta scores: E(): 1.1e-102, 84.08% id in 289 aa
YP_107021.1	Similar to Alcaligenes eutrophus protein required for both lithoautotrophic (hydrogen plus carbon dioxide) and organoautotrophic (formate) growth Aut SWALL:Q43999 (EMBL:U07639) (164 aa) fasta scores: E(): 5.4e-39, 69.32% id in 163 aa, and to Ralstonia solanacearum  transferase rsc0309 or rs03276 SWALL:Q8Y2M6 (EMBL:AL646058) (166 aa) fasta scores: E(): 8.9e-40, 70.18% id in 161 aa
YP_107023.1	type III; catalyzes the formation of (R)-4'-phosphopantothenate from (R)-pantothenate in coenzyme A biosynthesis; type III pantothenate kinases are not subject to feedback inhibition from coenzyme A and have a high Km for ATP
YP_107024.1	catalyzes the formation of biotinyl-5'-AMP, also acts as a transcriptional repressor of the biotin operon
YP_107025.1	Similar to Ralstonia solanacearum hypothetical protein rsc3362 or rs02637 SWALL:Q8XU32 (EMBL:AL646074) (276 aa) fasta scores: E(): 2.6e-50, 63.32% id in 259 aa
YP_107026.1	Similar to Escherichia coli 2',3'-cyclic-nucleotide 2'-phosphodiesterase precursor CpdB SWALL:CN16_ECOLI (SWALL:P08331) (647 aa) fasta scores: E(): 3.5e-61, 43.32% id in 674 aa, and to Ralstonia solanacearum probable 2',3'-cyclic-nucleotide 2'-phosphodiesterase precursor transmembrane protein rsc3363 or rs02638 SWALL:Q8XU31 (EMBL:AL646074) (681 aa) fasta scores: E(): 5.9e-215, 81.63% id in 675 aa
YP_107027.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0313 or rs03280 SWALL:Q8Y2M2 (EMBL:AL646058) (374 aa) fasta scores: E(): 5.2e-80, 60.81% id in 370 aa, and to Pseudomonas aeruginosa probable permease of ABC transporter pa3211 SWALL:Q9HZ29 (EMBL:AE004744) (381 aa) fasta scores: E(): 2.4e-33, 35.67% id in 384 aa
YP_107028.1	Similar to Ralstonia solanacearum probable ATP-binding ABC transporter protein rsc0314 or rs03281 SWALL:Q8Y2M1 (EMBL:AL646058) (298 aa) fasta scores: E(): 5.7e-54, 61.97% id in 263 aa, and to Pseudomonas aeruginosa probable ATP-binding component of ABC transporter pa3212 SWALL:Q9HZ28 (EMBL:AE004744) (264 aa) fasta scores: E(): 8.9e-44, 52.29% id in 262 aa. CDS is truncated at the N-terminus in comparison to some orthologue
YP_107029.1	Similar to Ralstonia solanacearum probable signal peptide protein rsc0315 or rs03282 SWALL:Q8Y2M0 (EMBL:AL646058) (330 aa) fasta scores: E(): 3.9e-31, 44.86% id in 321 aa, and to Pseudomonas aeruginosa hypothetical protein Pa3213 pa3213 SWALL:Q9HZ27 (EMBL:AE004744) (312 aa) fasta scores: E(): 5.7e-10, 25.9% id in 305 aa
YP_107030.1	Similar to Ralstonia solanacearum probable lipoprotein rsc0316 or rs03283 SWALL:Q8Y2L9 (EMBL:AL646058) (211 aa) fasta scores: E(): 1.2e-17, 38.3% id in 201 aa, and to Pseudomonas aeruginosa hypothetical protein pa3214 SWALL:Q9HZ26 (EMBL:AE004744) (214 aa) fasta scores: E(): 2.2e-05, 28.15% id in 206 aa
YP_107031.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0317 or rs03284 SWALL:Q8Y2L8 (EMBL:AL646058) (408 aa) fasta scores: E(): 2.6e-53, 44.02% id in 393 aa
YP_107032.1	Similar to Clostridium pasteurianum ferredoxin, 2Fe-2S SWALL:FER2_CLOPA (SWALL:P07324) (102 aa) fasta scores: E(): 7.4e-13, 42% id in 100 aa, and to Ralstonia solanacearum  ferredoxin 2Fe-2S protein rsc0329 or rs03296 SWALL:Q8Y2K6 (EMBL:AL646058) (108 aa) fasta scores: E(): 3.7e-27, 65.71% id in 105 aa
YP_107033.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0328 or rs03295 SWALL:Q8Y2K7 (EMBL:AL646058) (215 aa) fasta scores: E(): 7.7e-54, 66.35% id in 217 aa, and to Neisseria meningitidis hypothetical protein nma1086 SWALL:Q9JUY1 (EMBL:AL162755) (213 aa) fasta scores: E(): 9.5e-22, 39.23% id in 209 aa
YP_107034.1	Similar to Escherichia coli penicillin-binding protein 6 precursor DacC SWALL:DACC_ECOLI (SWALL:P08506) (400 aa) fasta scores: E(): 5.8e-48, 42.21% id in 379 aa, and to Ralstonia solanacearum probable penicillin-binding rsc0327 or rs03294 SWALL:Q8Y2K8 (EMBL:AL646058) (397 aa) fasta scores: E(): 1.8e-79, 58.8% id in 403 aa
YP_107035.1	Similar to Bacillus licheniformis D-alanine aminotransferase Dat SWALL:DAAA_BACLI (SWALL:P54692) (283 aa) fasta scores: E(): 8.7e-28, 40.42% id in 282 aa, and to Listeria innocua D-alanine aminotransferase lin1660 SWALL:DAAA_LISIN (SWALL:Q92B90) (289 aa) fasta scores: E(): 1.8e-27, 36.74% id in 283 aa
YP_107036.1	Similar to Ralstonia solanacearum hypothetical protein rsc0326 or rs03293 SWALL:Q8Y2K9 (EMBL:AL646058) (97 aa) fasta scores: E(): 4.2e-17, 53.92% id in 102 aa, and to Neisseria meningitidis hypothetical protein nma1380 or nmb1218 SWALL:Q9JRI4 (EMBL:AL162755) (91 aa) fasta scores: E(): 3.9e-15, 54.11% id in 85 aa
YP_107037.1	Glycine cleavage system transcriptional activator; activates the gcvTHP operon in the presence of glycine and represses the operon in its absence
YP_107038.1	Poor database matches. Weakly similar to Ralstonia solanacearum hypothetical protein rsc0324 or rs03291 SWALL:Q8Y2L1 (EMBL:AL646058) (119 aa) fasta scores: E(): 0.0043, 29.35% id in 109 aa
YP_107039.2	lipoyl/octanoyltransferase; catalyzes the transfer of the lipoyl/octanoyl moiety of lipoyl/octanoyl-ACP onto lipoate-dependent enzymes like pyruvate dehydrogenase and the glycine cleavage system H protein
YP_107040.1	catalyzes the radical-mediated insertion of two sulfur atoms into an acyl carrier protein (ACP) bound to an octanoyl group to produce a lipoyl group
YP_107041.1	Similar to Bacillus subtilis gamma-glutamyltranspeptidase precursor Ggt SWALL:GGT_BACSU (SWALL:P54422) (587 aa) fasta scores: E(): 9.3e-32, 34.66% id in 600 aa, and to Ralstonia solanacearum probable gamma-glutamyltranspeptidase precursor protein rsc2921 or rs00172 SWALL:Q8XVB0 (EMBL:AL646072) (623 aa) fasta scores: E(): 8.5e-98, 54.25% id in 599 aa
YP_107042.1	Poor database matches. Similar to the C-terminal region of Caulobacter crescentus hypothetical protein cc1436 SWALL:Q9A8B8 (EMBL:AE005818) (314 aa) fasta scores: E(): 1.9, 31.57% id in 114 aa
YP_107043.1	Similar to Rhizobium loti transcriptional regulator mlr2977 SWALL:Q98H90 (EMBL:AP003000) (299 aa) fasta scores: E(): 3.2e-24, 32.88% id in 298 aa, and to Ralstonia solanacearum probable transcription regulator protein rsp0910 or rs01682 SWALL:Q8XRE4 (EMBL:AL646081) (309 aa) fasta scores: E(): 9e-24, 29.83% id in 295 aa
YP_107044.1	Similar to Cavia porcellus peroxisomal bifunctional enzyme [includes: enoyl-CoA hydratase; 3,2-trans-enoyl-CoA isomerase; 3-hydroxyacyl-CoA dehydrogenase] EHHADH SWALL:ECHP_CAVPO (SWALL:P55100) (725 aa) fasta scores: E(): 2.1e-66, 40.82% id in 703 aa, and to Rhizobium loti enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase mll4199 SWALL:Q98EK7 (EMBL:AP003003) (689 aa) fasta scores: E(): 1.1e-111, 50.14% id in 698 aa
YP_107045.1	Similar to Ralstonia solanacearum  acyl-CoA dehydrogenase oxidoreductase rsc2045 or rs03610 SWALL:Q8XXR8 (EMBL:AL646068) (398 aa) fasta scores: E(): 3.9e-95, 59.2% id in 402 aa, and to Caulobacter crescentus acyl-CoA dehydrogenase cc1310 SWALL:Q9A8P3 (EMBL:AE005806) (404 aa) fasta scores: E(): 9.4e-81, 49.87% id in 407 aa. Similar to BPSL1228, 58.209% identity (58.794% ungapped) in 402 aa overlap
YP_107046.1	Similar to Ralstonia solanacearum  acyl-CoA dehydrogenase oxidoreductase rsc2044 or rs03609 SWALL:Q8XXR9 (EMBL:AL646068) (376 aa) fasta scores: E(): 9e-59, 49.06% id in 373 aa, and to Caulobacter crescentus acyl-CoA dehydrogenase cc1807 SWALL:Q9A7B7 (EMBL:AE005855) (382 aa) fasta scores: E(): 1.7e-42, 38.68% id in 380 aa
YP_107047.1	Similar to Rhizobium meliloti  conserved membrane-anchored protein rb0848 or smb21182 SWALL:Q92V66 (EMBL:AL603645) (394 aa) fasta scores: E(): 1.7e-62, 44.33% id in 388 aa, and to Sphingomonas aromaticivorans hypothetical protein ORF1338 SWALL:O86014 (EMBL:AF079317) (388 aa) fasta scores: E(): 1.9e-57, 44.74% id in 371 aa
YP_107048.1	Similar to Salmonella typhi  membrane protein sty4472 SWALL:Q8Z1R1 (EMBL:AL627282) (104 aa) fasta scores: E(): 5.9e-10, 36.36% id in 99 aa, and to Salmonella typhimurium  inner membrane protein stm4274 SWALL:Q8ZKF7 (EMBL:AE008900) (104 aa) fasta scores: E(): 5.9e-10, 36.36% id in 99 aa
YP_107049.1	member of the sodium:solute symporter family; cotranscribed with the acs gene which encodes acetyl coenzyme A synthase; mutations affect acetate uptake
YP_107050.1	involved in the transport of C4-dicarboxylates across the membrane
YP_107051.1	Possible alternative translational start site. Similar to Rhizobium leguminosarum C4-dicarboxylate transport sensor protein DctB SWALL:DCTB_RHILE (SWALL:P10047) (622 aa) fasta scores: E(): 8.5e-47, 37.99% id in 629 aa, and to Ralstonia solanacearum probable C4-dicarboxylate transport sensor kinase transcription regulator protein rsc0331 or rs03298 SWALL:Q8Y2K4 (EMBL:AL646058) (665 aa) fasta scores: E(): 5.9e-57, 55.17% id in 667 aa
YP_107052.1	Similar to Rhizobium meliloti C4-dicarboxylate transport transcriptional regulatory protein DctD SWALL:DCTD_RHIME (SWALL:P13632) (460 aa) fasta scores: E(): 7.2e-76, 49.23% id in 455 aa, and to Ralstonia solanacearum probable C4-dicarboxylate transport response regulator transcription regulator protein rsc0332 or rs03299 SWALL:Q8Y2K3 (EMBL:AL646058) (438 aa) fasta scores: E(): 4.8e-109, 69.81% id in 444 aa. Similar to BPSS0063, 52.715% identity (54.312% ungapped) in 442 aa overlap
YP_107053.1	Similar to Neisseria meningitidis  periplasmic protein nma0493 SWALL:Q9JW89 (EMBL:AL162753) (162 aa) fasta scores: E(): 2.8e-17, 41.4% id in 157 aa, and to the C-terminal region of Ralstonia solanacearum  transmembrane protein rsc0333 or rs03300 SWALL:Q8Y2K2 (EMBL:AL646058) (213 aa) fasta scores: E(): 5.4e-38, 60.77% id in 181 aa
YP_107054.1	Similar to Ralstonia solanacearum  transmembrane protein rsc0335 or rs03302 SWALL:Q8Y2K0 (EMBL:AL646058) (189 aa) fasta scores: E(): 1.2e-11, 36.86% id in 198 aa
YP_107055.1	Similar to Anabaena sp. hypothetical protein ALR2045 SWALL:Q8YVD3 (EMBL:AP003588) (253 aa) fasta scores: E(): 3.7e-19, 33.64% id in 214 aa, and to Pseudomonas fluorescens  thioesterase PltG SWALL:Q9X3R5 (EMBL:AF081920) (260 aa) fasta scores: E(): 4.6e-18, 31.07% id in 251 aa
YP_107056.1	Similar to Vibrio cholerae hypothetical protein vca0382 SWALL:Q9KMH2 (EMBL:AE004374) (141 aa) fasta scores: E(): 4.6e-16, 42.06% id in 126 aa, and to Methanobacterium thermoautotrophicum N-terminal acetyltransferase complex, subunit Ard1 MTH999 SWALL:O27080 (EMBL:AE000872) (156 aa) fasta scores: E(): 0.0022, 31.46% id in 143 aa
YP_107057.1	Similar to Haemophilus influenzae competence protein ComM SWALL:COMM_HAEIN (SWALL:P45049) (509 aa) fasta scores: E(): 2.5e-43, 47.03% id in 523 aa, and to Ralstonia solanacearum probable mg(2+) chelatase rsc0338 or rs03305 SWALL:Q8Y2J7 (EMBL:AL646058) (510 aa) fasta scores: E(): 3.2e-67, 63.55% id in 524 aa
YP_107058.1	Similar to Ralstonia solanacearum hypothetical protein rsc0340 or rs03307 SWALL:Q8Y2J5 (EMBL:AL646058) (87 aa) fasta scores: E(): 1.8e-15, 69.73% id in 76 aa, and to Pseudomonas aeruginosa hypothetical protein pa5289 SWALL:Q9HTR5 (EMBL:AE004941) (86 aa) fasta scores: E(): 1.5e-07, 50.61% id in 81 aa
YP_107059.1	Similar to Klebsiella pneumoniae nitrogen regulatory protein P-II GlnB SWALL:GLNB_KLEPN (SWALL:P11671) (112 aa) fasta scores: E(): 2.2e-26, 70.53% id in 112 aa, and to Ralstonia solanacearum probable nitrogen regulatory P-II transcription regulator protein rsc0342 or rs06099 SWALL:Q8Y2J3 (EMBL:AL646058) (112 aa) fasta scores: E(): 1.1e-32, 84.82% id in 112 aa. Similar to BPSL1027, 75.000% identity (75.000% ungapped) in 112 aa overlap
YP_107060.1	C-terminal region is similar to Bacillus subtilis probable ammonium transporter NrgA SWALL:NRGA_BACSU (SWALL:Q07429) (404 aa) fasta scores: E(): 7.4e-39, 50.61% id in 407 aa. Similar to Xanthomonas axonopodis ammonium transporter xac0206 SWALL:Q9RBJ9 (EMBL:AE011645) (491 aa) fasta scores: E(): 2.1e-60, 52.12% id in 470 aa. CDS is extended at the N-terminus in comparison to orthologues. N-terminus of the CDS contains an alanine rich region. Possible alternative translational start site
YP_107061.1	Similar to Thiobacillus ferrooxidans glutamate--cysteine ligase GshA SWALL:Q56277 (EMBL:U81808) (436 aa) fasta scores: E(): 3.8e-78, 50.59% id in 419 aa, and to Ralstonia solanacearum hypothetical protein rsc0344 or rs03311 SWALL:Q8Y2J1 (EMBL:AL646058) (431 aa) fasta scores: E(): 2e-125, 71.86% id in 430 aa
YP_107062.1	catalyzes the second step in the glutathione biosynthesis pathway, where it synthesizes ATP + gamma-L-glutamyl-L-cysteine + glycine = ADP + phosphate + glutathione
YP_107063.1	Similar to the N-terminal region of Escherichia coli PTS system, mannose-specific IIab component ManX or PtsL or GptB SWALL:PTNA_ECOLI (SWALL:P08186) (322 aa) fasta scores: E(): 0.00046, 32.46% id in 154 aa, and to the full length Ralstonia solanacearum hypothetical protein rsc0346 or rs03313 SWALL:Q8Y2J0 (EMBL:AL646058) (169 aa) fasta scores: E(): 1.2e-23, 63.28% id in 128 aa. CDS is truncated at the N-terminus in comparison to the R. solanacearum protein, but is a similar length to other orthologues
YP_107064.1	Similar to Escherichia coli Salmonella typhimurium, and Salmonella typhi phosphocarrier protein HPr or PtsH SWALL:PTHP_ECOLI (SWALL:P07006) (85 aa) fasta scores: E(): 3.2e-08, 40.96% id in 83 aa, and to Alcaligenes eutrophus phosphocarrier protein hpr phbH SWALL:PTHP_ALCEU (SWALL:P23537) (89 aa) fasta scores: E(): 2.8e-26, 79.77% id in 89 aa
YP_107065.1	Similar to Escherichia coli phosphoenolpyruvate-protein phosphotransferase PtsI SWALL:PT1_ECOLI (SWALL:P08839) (575 aa) fasta scores: E(): 1.3e-68, 38.17% id in 571 aa, and to Ralstonia solanacearum probable phosphoenolpyruvate-protein phosphotransferase transmembrane rsc0348 or rs03315 SWALL:Q8Y2I8 (EMBL:AL646058) (586 aa) fasta scores: E(): 1.5e-149, 69.62% id in 586 aa
YP_107066.1	ATP-dependent adenylate transferase, transfers adenyl moiety to the MoeD subunit of molybdopterin synthase
YP_107067.1	Similar to Ralstonia solanacearum  carboxy-terminal processing protease transmembrane protein rsc0352 or rs03319 SWALL:Q8Y2I4 (EMBL:AL646058) (549 aa) fasta scores: E(): 6.1e-118, 66.91% id in 535 aa. C-terminus is similar to the C-terminal region of Bartonella bacilliformis carboxy-terminal processing protease precursor CtpA SWALL:CTPA_BARBA (SWALL:Q44879) (434 aa) fasta scores: E(): 6.4e-30, 45.18% id in 374 aa
YP_107068.1	2,3-bisphosphoglycerate-dependent; catalyzes the interconversion of 2-phosphoglycerate to 3-phosphoglycerate
YP_107069.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0354 or rs03321 SWALL:Q8Y2I2 (EMBL:AL646058) (151 aa) fasta scores: E(): 8.6e-30, 60.14% id in 138 aa, and to Xanthomonas axonopodis hypothetical protein xac0220 SWALL:AAM35112 (EMBL:AE011647) (144 aa) fasta scores: E(): 3.2e-14, 40.94% id in 127 aa
YP_107070.1	Similar to Escherichia coli glutaredoxin 3 GrxC SWALL:GLR3_ECOLI (SWALL:P37687) (82 aa) fasta scores: E(): 1.6e-11, 48.14% id in 81 aa, and to Ralstonia solanacearum probable glutaredoxin 3 rsc0355 or rs03322 SWALL:Q8Y2I1 (EMBL:AL646058) (85 aa) fasta scores: E(): 1.3e-23, 75.29% id in 85 aa
YP_107071.1	molecular chaperone that is required for the normal export of envelope proteins out of the cell cytoplasm; in Escherichia coli this proteins forms a homotetramer in the cytoplasm and delivers proteins to be exported to SecA
YP_107072.1	[NAD(P)+]; catalyzes the NAD(P)H-dependent reduction of glycerol 3-phosphate to glycerone phosphate
YP_107073.1	Similar to Chlorobium tepidum histone macro-H2A1-related protein ct2219 SWALL:AAM73435 (EMBL:AE012967) (172 aa) fasta scores: E(): 1.9e-36, 63.25% id in 166 aa, and to Pseudomonas aeruginosa hypothetical protein pa3693 SWALL:Y0J3_PSEAE (SWALL:Q9HXU7) (173 aa) fasta scores: E(): 5.6e-34, 63.75% id in 160 aa
YP_107074.1	Similar to Ralstonia solanacearum  tRNA/rRNA methyltransferase rsc0358 or rs03326 SWALL:Q8Y2H8 (EMBL:AL646058) (156 aa) fasta scores: E(): 1.2e-49, 78.84% id in 156 aa, and to Neisseria meningitidis RNA methyltransferase, TrmH family nmb0268 SWALL:Q9K199 (EMBL:AE002383) (154 aa) fasta scores: E(): 2.4e-37, 60% id in 155 aa
YP_107075.1	Similar to Haemophilus influenzae competence protein F Comf SWALL:COMF_HAEIN (SWALL:P31773) (229 aa) fasta scores: E(): 5e-10, 30.31% id in 221 aa, and to Ralstonia solanacearum  competence protein F-related protein rsc0359 or rs03327 SWALL:Q8Y2H7 (EMBL:AL646058) (240 aa) fasta scores: E(): 4.8e-28, 47.52% id in 242 aa
YP_107076.1	Similar to the C-terminal region of Ralstonia solanacearum  biotin synthesis protein rsc0360 or rs03328 SWALL:Q8Y2H6 (EMBL:AL646058) (367 aa) fasta scores: E(): 4.4e-51, 50.31% id in 320 aa, and to the full length Xanthomonas campestris biotin synthesis protein xcc0383 SWALL:AAM39702 (EMBL:AE012134) (294 aa) fasta scores: E(): 4.6e-16, 37.84% id in 288 aa. Weakly similar to Escherichia coli biotin synthesis protein BioC SWALL:BIOC_ECOLI (SWALL:P12999) (251 aa) fasta scores: E(): 0.0089, 26.56% id in 271 aa
YP_107077.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0361 or rs03329 SWALL:Q8Y2H5 (EMBL:AL646058) (171 aa) fasta scores: E(): 3.2e-21, 45.39% id in 163 aa, and to Brucella melitensis hypothetical membrane spanning protein bmei1783 SWALL:Q8YEU4 (EMBL:AE009611) (179 aa) fasta scores: E(): 0.00072, 25.56% id in 176 aa
YP_107078.1	No significant database matches to the full length CDS. N-terminal region is similar to Paracoccus denitrificans cytochrome c oxidase polypeptide II precursor CtaC or CtaB or CoiI SWALL:COX2_PARDE (SWALL:P08306) (298 aa) fasta scores: E(): 1.2e-27, 34.84% id in 287 aa, and Pseudomonas aeruginosa cytochrome c oxidase, subunit II pa0105 SWALL:Q9I727 (EMBL:AE004449) (374 aa) fasta scores: E(): 9.4e-60, 48.54% id in 344 aa
YP_107079.1	Similar to Bradyrhizobium japonicum cytochrome c oxidase polypeptide I CtaD or CoxA SWALL:COX1_BRAJA (SWALL:P31833) (541 aa) fasta scores: E(): 2.6e-121, 55.88% id in 544 aa, and to Ralstonia solanacearum probable cytochrome c oxidase polypeptide I rsc0363 or rs03331 SWALL:Q8Y2H3 (EMBL:AL646058) (534 aa) fasta scores: E(): 3e-186, 84.86% id in 535 aa. Similar to BPSS0086, 78.719% identity (79.317% ungapped) in 531 aa overlap
YP_107080.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein rsc0364 or rs03332 SWALL:Q8Y2H2 (EMBL:AL646058) (43 aa) fasta scores: E(): 0.86, 39.39% id in 33 aa
YP_107081.1	involved in the insertion of copper into subunit I of cytochrome C oxidase
YP_107082.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0366 or rs03334 SWALL:Q8Y2H0 (EMBL:AL646058) (70 aa) fasta scores: E(): 4.5e-12, 58.73% id in 63 aa
YP_107083.1	Similar to Salmo salar cytochrome c oxidase polypeptide III CoxIII SWALL:COX3_SALSA (SWALL:Q36860) (261 aa) fasta scores: E(): 2.4e-28, 42.02% id in 276 aa, and to Ralstonia solanacearum probable cytochrome c oxidase subunit III transmembrane protein rsc0367 or rs03335 SWALL:Q8Y2G9 (EMBL:AL646058) (286 aa) fasta scores: E(): 1.4e-87, 72.04% id in 279 aa
YP_107084.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0368 or rs03336 SWALL:Q8Y2G8 (EMBL:AL646058) (69 aa) fasta scores: E(): 9.7e-14, 63.76% id in 69 aa, and to Xanthomonas campestris hypothetical protein Xcc3828 SWALL:Q8P483 (EMBL:AE012503) (72 aa) fasta scores: E(): 2.5e-05, 35.71% id in 70 aa
YP_107085.1	Similar to Ralstonia solanacearum  transmembrane cytochrome oxidase complex biogenesis factor transmembrane protein rsc0369 or rs03337 SWALL:Q8Y2G7 (EMBL:AL646058) (256 aa) fasta scores: E(): 6.5e-33, 43.62% id in 243 aa, and to Rhizobium loti hypothetical protein mlr7500 SWALL:Q985W4 (EMBL:AP003011) (251 aa) fasta scores: E(): 6.8e-11, 29.67% id in 246 aa. Possible alternative translational start site
YP_107086.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0370 or rs03338 SWALL:Q8Y2G6 (EMBL:AL646058) (215 aa) fasta scores: E(): 6.2e-38, 52.7% id in 203 aa, and to Xanthomonas axonopodis hypothetical protein xac3881 SWALL:AAM38723 (EMBL:AE012037) (191 aa) fasta scores: E(): 6.1e-06, 26.56% id in 192 aa
YP_107087.1	Similar to Ralstonia solanacearum  heme O oxygenase CtaA SWALL:Q8Y2G5 (EMBL:AL646058) (363 aa) fasta scores: E(): 4.5e-83, 63.63% id in 330 aa, and to Pseudomonas aeruginosa hypothetical protein pa0112 SWALL:Q9I720 (EMBL:AE004449) (357 aa) fasta scores: E(): 1.1e-50, 45.59% id in 329 aa
YP_107088.1	converts protoheme IX and farnesyl diphosphate to heme O
YP_107089.1	Similar to Ralstonia solanacearum probable lipoprotein rsc0373 or rs03341 SWALL:Q8Y2G3 (EMBL:AL646058) (200 aa) fasta scores: E(): 5.3e-49, 64.76% id in 193 aa> Internal region is similar to Homo sapiens mitochondrial, cytochrome c oxidase subunit II processing protein SCO2 SWALL:SCO2_HUMAN (SWALL:O43819) (266 aa) fasta scores: E(): 8e-17, 35.67% id in 171 aa
YP_107090.1	Similar to Streptomyces coelicolor hypothetical protein sco6725 or SC5f2A.08c SWALL:Q9X7N1 (EMBL:AL049587) (98 aa) fasta scores: E(): 2.1e-13, 50% id in 90 aa, and to Rhizobium loti hypothetical protein mlr3009 SWALL:Q98H68 (EMBL:AP003000) (101 aa) fasta scores: E(): 1.8e-10, 42.9% id in 91 aa
YP_107091.1	Similar to Ralstonia solanacearum  methyl-accepting chemotaxis transmembrane protein rsc2799 or rs05622 SWALL:Q8XVN1 (EMBL:AL646071) (515 aa) fasta scores: E(): 1.7e-104, 64.32% id in 513 aa. C-terminus is similar to the C-terminal region of Escherichia coli methyl-accepting chemotaxis protein I Tsr or CheD SWALL:MCP1_ECOLI (SWALL:P02942) (551 aa) fasta scores: E(): 3.9e-56, 61.65% id in 326 aa. Simlar to BPSS1218, 54.386% identity (54.492% ungapped) in 513 aa overlap
YP_107092.1	Similar to Pasteurella haemolytica outer membrane lipoprotein 3 precursor PlpC SWALL:PLPC_PASHA (SWALL:Q08870) (263 aa) fasta scores: E(): 5.1e-41, 49.41% id in 257 aa, and to the C-terminal region of Ralstonia solanacearum  outermembrane signal peptide protein rsc3386 or rs06100 SWALL:Q8XU08 (EMBL:AL646075) (529 aa) fasta scores: E(): 5.9e-63, 66.79% id in 268 aa. Similar to BPSS0266, 63.806% identity (64.528% ungapped) in 268 aa overlap and to BPSL2501, 60.294% identity (62.121% ungapped) in 272 aa overlapNote, although CDS is similar to characterized and predicted lipoproteins, it does not contain residues required for lipoprotein processing
YP_107093.1	Similar to Ralstonia solanacearum hypothetical signal peptide protein rsc1740 or rs02928 SWALL:Q8XYL8 (EMBL:AL646066) (329 aa) fasta scores: E(): 1.2e-77, 74.77% id in 329 aa, and to Pseudomonas aeruginosa hypothetical protein pa3836 SWALL:Q9HXG8 (EMBL:AE004801) (325 aa) fasta scores: E(): 2.9e-70, 67.83% id in 314 aa
YP_107094.1	Similar to Ralstonia solanacearum  transmembrane ABC transporter protein rsc1739 or rs02927 SWALL:Q8XYL9 (EMBL:AL646066) (303 aa) fasta scores: E(): 3.9e-90, 83.83% id in 297 aa. Weakly similar to the C-terminal region of Escherichia coli ribose transport system permease RbsC SWALL:RBSC_ECOLI (SWALL:P04984) (321 aa) fasta scores: E(): 5.1e-08, 23.81% id in 294 aa
YP_107095.1	Similar to Ralstonia solanacearum probable ATP-binding ABC transporter protein rsc1738 or rs02926 SWALL:Q8XYM0 (EMBL:AL646066) (264 aa) fasta scores: E(): 1.3e-71, 84.47% id in 264 aa, and to the N-terminal region Escherichia coli sulfate transport ATP-binding protein CysA SWALL:CYSA_ECOLI (SWALL:P16676) (365 aa) fasta scores: E(): 2.8e-12, 33.79% id in 219 aa
YP_107096.1	Similar to Ralstonia solanacearum hypothetical protein rsp0799 or rs01908 SWALL:Q8XRN2 (EMBL:AL646080) (523 aa) fasta scores: E(): 3e-53, 46.44% id in 521 aa, and to Xanthomonas axonopodis hypothetical protein xac1198 SWALL:Q8PN75 (EMBL:AE011749) (472 aa) fasta scores: E(): 9.2e-33, 36.67% id in 499 aa
YP_107097.1	DNA polymerase involved in damage-induced mutagenesis and translesion synthesis. It is not the major replicative DNA polymerase.
YP_107098.1	Similar to Pseudomonas aeruginosa hypothetical protein pa5220 SWALL:Q9HTX0 (EMBL:AE004935) (273 aa) fasta scores: E(): 8.4e-70, 65.68% id in 271 aa
YP_107099.1	Similar to Pseudomonas aeruginosa hypothetical protein pa5219 SWALL:Q9HTX1 (EMBL:AE004935) (397 aa) fasta scores: E(): 2.9e-62, 48.59% id in 391 aa. Weakly similar to Streptomyces lividans chloramphenicol resistance protein CmlR SWALL:CMLR_STRLI (SWALL:P31141) (392 aa) fasta scores: E(): 1.6e-09, 26.79% id in 377 aa
YP_107100.1	Similar to Pseudomonas syringae hypothetical protein SWALL:Q52580 (EMBL:U27310) (327 aa) fasta scores: E(): 6.8e-20, 32.71% id in 321 aa. C-terminus is weakly similar to the C-terminal region of Synechocystis sp. fatty acid desaturase DesA SWALL:DESA_SYNY3 (SWALL:P20388) (351 aa) fasta scores: E(): 8.7e-07, 28.91% id in 249 aa
YP_107101.1	Similar to Haemophilus influenzae diaminobutyrate--2-oxoglutarate aminotransferase Dat SWALL:DAT_HAEIN (SWALL:P44951) (454 aa) fasta scores: E(): 2.2e-76, 49.51% id in 412 aa, and to Rhizobium meliloti diaminobutyrate--2-oxoglutarate aminotransferase RhbA SWALL:RHBA_RHIME (SWALL:Q9Z3R2) (470 aa) fasta scores: E(): 4.9e-91, 54.4% id in 443 aa. Similar to BPSS1635, 56.019% identity (56.674% ungapped) in 432 aa overlap
YP_107103.1	No significant database matches to the full length CDS. C-terminus is similar to the C-terminal regions of Rhizobium meliloti  ABC transporter permease rb0870 or smb21204 SWALL:Q92V47 (EMBL:AL603645) (370 aa) fasta scores: E(): 7.5e-09, 28.5% id in 228 aa, and Brucella melitensis daunorubicin resistance transmembrane protein bmeii0801 SWALL:Q8YBT5 (EMBL:AE009714) (379 aa) fasta scores: E(): 2.9e-07, 24.59% id in 305 aa
YP_107104.1	Similar to Streptomyces coelicolor  ABC transporter ATP-binding subunit sco2305 or scc30.13 SWALL:Q9L008 (EMBL:AL352972) (308 aa) fasta scores: E(): 5.7e-09, 30.59% id in 317 aa, and to the N-terminal region of Rhodobacter capsulatus molybdenum transport ATP-binding protein ModC or MolD SWALL:MODC_RHOCA (SWALL:Q08381) (363 aa) fasta scores: E(): 1.8e-08, 28.98% id in 314 aa
YP_107105.1	Similar to Pseudomonas syringae syringomycin biosynthesis regulatory protein SyrP SWALL:P97053 (EMBL:U88574) (353 aa) fasta scores: E(): 1.9e-25, 35.54% id in 332 aa, and to Streptomyces verticillus SyrP-like protein SWALL:Q9FB16 (EMBL:AF210249) (339 aa) fasta scores: E(): 3.1e-32, 37.5% id in 320 aa
YP_107106.1	Similar to the N-terminal regions of Deinococcus radiodurans  methyltransferase dr0026 SWALL:Q9RYC4 (EMBL:AE001866) (269 aa) fasta scores: E(): 1.1e-08, 36.36% id in 209 aa, and Amycolatopsis mediterranei methyltransferase SWALL:O52570 (EMBL:AF040570) (272 aa) fasta scores: E(): 1.5e-05, 30.8% id in 224 aa
YP_107107.1	Similar to Corynebacterium glutamicum 2-methylcitrate synthase 2 PrpC2 or cgl0659 SWALL:BAB98052 (EMBL:AF434799) (383 aa) fasta scores: E(): 6.2e-07, 26.81% id in 358 aa, and to Antarctic bacterium DS2-3R citrate synthase GltA or CisY SWALL:CISY_ABDS2 (SWALL:O34002) (379 aa) fasta scores: E(): 0.004, 23.59% id in 356 aa
YP_107108.1	Similar to Mycobacterium tuberculosis  acyl-CoA dehydrogenase rv0244c or mtv034.10c or mt0258 SWALL:O53666 (EMBL:AL021929) (611 aa) fasta scores: E(): 2.2e-44, 32.47% id in 622 aa, and to Pseudomonas aeruginosa probable acyl-CoA dehydrogenase pa1284 SWALL:Q9I460 (EMBL:AE004558) (606 aa) fasta scores: E(): 2.3e-43, 33.49% id in 612 aa
YP_107109.1	Weakly similar to Escherichia coli 3-oxoacyl-[acyl-carrier-protein] synthase III FabH SWALL:FABH_ECOLI (SWALL:P24249) (317 aa) fasta scores: E(): 1.2, 24.28% id in 313 aa, and to Streptomyces coelicolor  acyl carrier protein synthase sco3246 or SCE29.15c SWALL:Q9Z4Y5 (EMBL:AL035707) (330 aa) fasta scores: E(): 2.4e-06, 28.42% id in 299 aa
YP_107110.1	Similar to Agrobacterium tumefaciens long-chain fatty acid-CoA ligase fadd or atu1672 or AGR_C_3078 SWALL:Q8UET3 (EMBL:AE009124) (510 aa) fasta scores: E(): 5e-60, 39.18% id in 513 aa, and to the N-terminal region of Pseudomonas syringae syringomycin biosynthesis enzyme 1 SyrB1 SWALL:Q52400 (EMBL:U25130) (614 aa) fasta scores: E(): 9.5e-30, 30.71% id in 521 aa. Simlar to the C-terminal region of BPSS1568, 50.958% identity (53.737% ungapped) in 522 aa overlap
YP_107111.1	Similar to Pseudomonas aeruginosa diaminopimelate decarboxylase LysA SWALL:DCDA_PSEAE (SWALL:P19572) (415 aa) fasta scores: E(): 5e-06, 27.2% id in 386 aa, and to Xanthomonas axonopodis diaminopimelate decarboxylase xac3181 SWALL:Q8PHR8 (EMBL:AE011963) (398 aa) fasta scores: E(): 1.7e-09, 27.34% id in 395 aa
YP_107112.1	Poor database matches. Similar to Erwinia chrysanthemi hypothetical protein VfmA SWALL:Q8RKD3 (EMBL:AJ438188) (275 aa) fasta scores: E(): 0.00013, 22.61% id in 252 aa
YP_107113.1	Weakly similar to Streptomyces coelicolor  membrane protein sco5299 or SC6G9.34 SWALL:Q9XAE8 (EMBL:AL079356) (312 aa) fasta scores: E(): 7e-07, 24.83% id in 302 aa, and to Synechocystis sp. hypothetical protein SLL0265 SWALL:P74402 (EMBL:D90914) (301 aa) fasta scores: E(): 0.29, 22.55% id in 266 aa
YP_107116.1	Similar to Cylindrotheca sp. acyl carrier protein AcpP or Acl1 or Acp SWALL:ACP_CYLSN (SWALL:P27060) (80 aa) fasta scores: E(): 4.5, 36.36% id in 66 aa
YP_107117.1	Poor database matches. N-terminus is weakly similar to the C-terminal region of Streptomyces coelicolor lipase sco3219 or SCE8.12c SWALL:Q9Z360 (EMBL:AL035654) (391 aa) fasta scores: E(): 1.7, 27.92% id in 265 aa
YP_107118.1	Similar to Burkholderia cepacia  amino acid activating protein required for lipopeptide antibiotic production AfcA SWALL:Q9ZGQ2 (EMBL:AF076477) (587 aa) fasta scores: E(): 6.1e-106, 50.68% id in 586 aa, and to the N-terminal region of Myxococcus xanthus saframycin Mx1 synthetase B SafB SWALL:Q50857 (EMBL:U24657) (1770 aa) fasta scores: E(): 2.4e-41, 32.09% id in 567 aa
YP_107119.1	Similar to Bacillus subtilis als operon regulatory protein AlsR SWALL:ALSR_BACSU (SWALL:Q04778) (302 aa) fasta scores: E(): 1.3e-26, 33.33% id in 288 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa5218 SWALL:Q9HTX2 (EMBL:AE004934) (304 aa) fasta scores: E(): 7.6e-45, 48.09% id in 289 aa
YP_107120.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa3757 SWALL:Q9HXN8 (EMBL:AE004794) (247 aa) fasta scores: E(): 3.5e-49, 58.65% id in 237 aa, and to Xanthomonas axonopodis GnrR family transcriptional regulator xac0711 SWALL:AAM35600 (EMBL:AE011701) (255 aa) fasta scores: E(): 1e-41, 50.6% id in 247 aa. Similar to BPSL0891, 62.500% identity (62.500% ungapped) in 240 aa overlap
YP_107121.1	Similar to Escherichia coli N-acetylglucosamine-6-phosphate deacetylase NagA SWALL:NAGA_ECOLI (SWALL:P15300) (382 aa) fasta scores: E(): 5.2e-23, 34.12% id in 337 aa, and to Pseudomonas aeruginosa probable N-acetylglucosamine-6-phosphate deacetylase pa3758 SWALL:Q9HXN7 (EMBL:AE004794) (363 aa) fasta scores: E(): 6.3e-93, 68.14% id in 361 aa
YP_107122.1	Similar to Pseudomonas aeruginosa probable aminotransferase pa3759 SWALL:Q9HXN6 (EMBL:AE004794) (340 aa) fasta scores: E(): 1e-70, 65.08% id in 338 aa, and to the C-terminal regions of many glucosamine--fructose-6-phosphate aminotransferases , including of Escherichia coli glucosamine--fructose-6-phosphate aminotransferase [isomerizing] GlmS SWALL:GLMS_ECOLI (SWALL:P17169) (608 aa) fasta scores: E(): 1.8e-09, 28.9% id in 339 aa
YP_107123.1	Similar to Pseudomonas aeruginosa probable phosphotransferase pa3760 SWALL:Q9HXN5 (EMBL:AE004794) (842 aa) fasta scores: E(): 8e-102, 49.53% id in 860 aa. C-terminus is similar to the C-terminal region of Rhodobacter capsulatus multiphosphoryl transfer protein frub(hi) SWALL:PTF1_RHOCA (SWALL:P23388) (827 aa) fasta scores: E(): 2.7e-78, 40.73% id in 739 aa
YP_107124.1	N-terminus is similar to the N-terminal region of Escherichia coli PTS system, N-acetylglucosamine-specific IIabc component NagE or PstN SWALL:PTAA_ECOLI (SWALL:P09323) (648 aa) fasta scores: E(): 1.2e-88, 52.51% id in 516 aa. Full length CDS is similar to Pseudomonas aeruginosa probable phosphotransferase system protein pa3761 SWALL:Q9HXN4 (EMBL:AE004794) (570 aa) fasta scores: E(): 1.2e-85, 56.15% id in 577 aa
YP_107125.1	Similar to Serratia marcescens chitobiase precursor Chb SWALL:CHB_SERMA (SWALL:Q54468) (885 aa) fasta scores: E(): 2e-118, 46.94% id in 801 aa, and to Burkholderia cepacia  chitinase Bcc1 SWALL:Q9F1K5 (EMBL:AB053088) (826 aa) fasta scores: E(): 0, 85.8% id in 831 aa. CDS is truncated at the C-terminus in comparison to orthologues
YP_107126.1	Similar to Bordetella pertussis  exported protein SWALL:Q7W092 (EMBL:BX640411) (41 aa) fasta scores: E(): 1.1e-07, 71.42% id in 28 aa, and to Shewanella oneidensis conserved hypothetical protein SWALL:Q8EC60 (EMBL:AE015765) (38 aa) fasta scores: E(): 2.4e-07, 61.29% id in 31 aa
YP_107127.1	Similar to Escherichia coli cytochrome d ubiquinol oxidase subunit II CydB or Cyd-2 SWALL:CYDB_ECOLI (SWALL:P11027) (379 aa) fasta scores: E(): 1.6e-77, 52.91% id in 378 aa, and to Caulobacter crescentus cytochrome d ubiquinol oxidase subunit II cc0763 SWALL:Q9AA43 (EMBL:AE005752) (383 aa) fasta scores: E(): 1.1e-84, 59.57% id in 376 aa
YP_107128.1	Similar to Escherichia coli cytochrome d ubiquinol oxidase subunit I CydA or Cyd-1 SWALL:CYDA_ECOLI (SWALL:P11026) (522 aa) fasta scores: E(): 6e-137, 64.87% id in 521 aa, and to Azotobacter vinelandii cytochrome d ubiquinol oxidase subunit I CydA SWALL:CYDA_AZOVI (SWALL:Q09049) (537 aa) fasta scores: E(): 6.2e-143, 68.66% id in 517 aa
YP_107130.1	binds with the catalytic core of RNA polymerase to produce the holoenzyme; this sigma factor is responsible for the expression of heat shock promoters
YP_107131.1	Similar to Ralstonia solanacearum probable signal peptide protein rsp1201 or rs03145 SWALL:Q8XQM1 (EMBL:AL646083) (187 aa) fasta scores: E(): 1.3e-20, 38.25% id in 183 aa
YP_107132.1	Similar to Ralstonia solanacearum hypothetical protein rsc3100 or rs00553 SWALL:Q8XUT5 (EMBL:AL646073) (131 aa) fasta scores: E(): 0.88, 29.82% id in 114 aa
YP_107133.1	N-terminus is similar to the N-terminal region of Saccharomyces cerevisiae 2-isopropylmalate synthase LEU4 SWALL:LEU1_YEAST (SWALL:P06208) (619 aa) fasta scores: E(): 1.8e-95, 56.1% id in 442 aa. Similar to Ralstonia solanacearum 2-isopropylmalate synthase 2 rsp0322 or rs05445 SWALL:Q8XSZ5 (EMBL:AL646078) (576 aa) fasta scores: E(): 8.2e-119, 58.87% id in 552 aa
YP_107134.1	No significant database matches to the full length CDS. C-terminus is similar to the C-terminal region of Anabaena sp. hypothetical protein ALL0878 SWALL:Q8YYH2 (EMBL:AP003583) (272 aa) fasta scores: E(): 2.4e-12, 30.18% id in 222 aa, and to Streptomyces coelicolor acetyltransferase sco7150 or sc9a4.12C SWALL:Q9FBU1 (EMBL:AL391072) (278 aa) fasta scores: E(): 2.4e-06, 30.83% id in 240 aa. Similar to BPSS1168, 69.888% identity (69.888% ungapped) in 269 aa overlap
YP_107135.1	Similar to Yersinia pestis  glycosyl transferase ypo2522 SWALL:Q8ZDN8 (EMBL:AJ414152) (319 aa) fasta scores: E(): 5.8e-38, 43.33% id in 300 aa, and weakly similar Bradyrhizobium japonicum anthranilate phosphoribosyltransferase TrpD SWALL:TRPD_BRAJA (SWALL:P94326) (337 aa) fasta scores: E(): 4.7e-06, 24.41% id in 299 aa
YP_107136.1	Similar to Klebsiella pneumoniae nitrate reductase NasA SWALL:NASA_KLEPN (SWALL:Q06457) (866 aa) fasta scores: E(): 9.5e-90, 40.97% id in 947 aa, and to Xanthomonas campestris nitrate reductase xcc2009 SWALL:AAM41298 (EMBL:AE012305) (912 aa) fasta scores: E(): 6.1e-181, 56.06% id in 931 aa
YP_107137.1	Similar to Bacillus subtilis assimilatory nitrite reductase [NAD(P)H] small subunit NasE or NirD SWALL:NASE_BACSU (SWALL:P42436) (106 aa) fasta scores: E(): 9.4e-09, 34.69% id in 98 aa, and to Xanthomonas campestris nitrite assimilation small subunit xcc2008 SWALL:AAM41297 (EMBL:AE012305) (119 aa) fasta scores: E(): 7.5e-22, 57.75% id in 116 aa
YP_107138.1	Similar to the N-terminal region of Klebsiella pneumoniae nitrite reductase [NAD(P)H] NasB SWALL:NIRB_KLEPN (SWALL:Q06458) (957 aa) fasta scores: E(): 2.3e-90, 36.3% id in 785 aa, and to the full length Pseudomonas aeruginosa assimilatory nitrite reductase large subunit pa1781 SWALL:Q9I2W1 (EMBL:AE004603) (816 aa) fasta scores: E(): 0, 74.11% id in 792 aa
YP_107139.1	Similar to Homo sapiens maleylacetoacetate isomerase GSTZ1 or MAAI SWALL:MAAI_HUMAN (SWALL:O43708) (216 aa) fasta scores: E(): 2.5e-31, 47.39% id in 211 aa, and to Ralstonia solanacearum probable maleylacetoacetate isomerase rsc0384 or rs03352 SWALL:Q8Y2F2 (EMBL:AL646059) (216 aa) fasta scores: E(): 3.5e-54, 63.38% id in 213 aa
YP_107140.1	Similar to the C-terminal region of Escherichia coli cell division protein FtsY SWALL:FTSY_ECOLI (SWALL:P10121) (497 aa) fasta scores: E(): 6.4e-41, 44% id in 425 aa, and to the full length Neisseria meningitidis cell division protein FtsY homolog nma0291 SWALL:FTSY_NEIMA (SWALL:P57010) (421 aa) fasta scores: E(): 4.2e-50, 50.33% id in 443 aa
YP_107141.1	Similar to Ralstonia solanacearum hypothetical protein rsc0389 or rs03357 SWALL:Q8Y2E7 (EMBL:AL646059) (215 aa) fasta scores: E(): 3.1e-31, 52.31% id in 216 aa, and to Xanthomonas campestris hypothetical protein xcc2392 SWALL:AAM41670 (EMBL:AE012348) (207 aa) fasta scores: E(): 6.3e-24, 47.57% id in 206 aa
YP_107142.1	Catalyzes the conversion of ATP and pantetheine 4'-phosphate to diphosphate and 3'-dephospho-coA
YP_107143.1	Similar to Chromatium vinosum ferredoxin Fdx SWALL:FER_CHRVI (SWALL:P00208) (82 aa) fasta scores: E(): 2.3e-19, 72% id in 75 aa, and to Ralstonia solanacearum probable ferredoxin protein rsc0391 or rs03359 SWALL:Q8Y2E5 (EMBL:AL646059) (82 aa) fasta scores: E(): 6.2e-26, 85.36% id in 82 aa
YP_107144.1	catalyzes the formation of L-histidinol phosphate from imidazole-acetol phosphate and glutamate in histidine biosynthesis
YP_107145.1	Enables the recycling of peptidyl-tRNAs produced at termination of translation
YP_107146.2	the Ctc family of proteins consists of two types, one that contains the N-terminal ribosomal protein L25 domain only which in Escherichia coli binds the 5S rRNA while a subset of proteins contain a C-terminal extension that is involved in the stress response
YP_107147.1	catalyzes the formation of 5-phospho-alpha-D-ribose 1-phosphate from D-ribose 5-phosphate and ATP
YP_107148.1	An essential enzyme in the nonmevalonate pathway of isopentenyl diphosphate and dimethylallyl diphosphate biosynthesis
YP_107149.1	Incorporates lipoproteins in the outer membrane after they are released by the LolA protein
YP_107150.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein rsc0398 or rs03366 SWALL:Q8Y2D8 (EMBL:AL646059) (642 aa) fasta scores: E(): 2.2e-43, 41.42% id in 630 aa> C-terminus is similar to the C-terminal region of Pseudomonas aeruginosa hypothetical protein pa4667 SWALL:YAG7_PSEAE (SWALL:P42810) (590 aa) fasta scores: E(): 1.7e-38, 30.1% id in 558 aa
YP_107151.1	Involved in base excision repair of DNA damaged by oxidation or by mutagenic agents. Acts as DNA glycosylase that recognizes and removes damaged bases
YP_107152.1	Similar to Escherichia coli A/G-specific adenine glycosylase MutY or MicA SWALL:MUTY_ECOLI (SWALL:P17802) (350 aa) fasta scores: E(): 6.2e-58, 44.69% id in 349 aa, and to Ralstonia solanacearum probable A/G-specific adenine glycosylase rsc0401 or rs03369 SWALL:Q8Y2D5 (EMBL:AL646059) (362 aa) fasta scores: E(): 7.1e-74, 59.67% id in 367 aa
YP_107153.1	Similar to Ralstonia solanacearum hypothetical protein rsc0402 or rs03370 SWALL:Q8Y2D4 (EMBL:AL646059) (216 aa) fasta scores: E(): 1.1e-38, 50.72% id in 207 aa. Weakly similar to the N-terminal region of Bacillus subtilis ATP-dependent protease LonA or Lon SWALL:LON1_BACSU (SWALL:P37945) (774 aa) fasta scores: E(): 0.58, 21.35% id in 192 aa
YP_107154.1	Similar to Ralstonia solanacearum hypothetical protein rsc0403 or rs03371 SWALL:Q8Y2D3 (EMBL:AL646059) (296 aa) fasta scores: E(): 4.3e-67, 62.75% id in 298 aa, and to Neisseria meningitidis hypothetical protein nmb0738 SWALL:Q9K080 (EMBL:AE002428) (284 aa) fasta scores: E(): 4.2e-46, 50.87% id in 287 aa
YP_107155.1	catalyzes the phosphorylation of the phosphocarrier protein HPr of the bacterial phosphotransferase system
YP_107156.1	Similar to Escherichia coli nitrogen regulatory IIA protein PtsN or RpoP SWALL:PTSN_ECOLI (SWALL:P31222) (163 aa) fasta scores: E(): 1.9e-13, 36.3% id in 146 aa, and to Ralstonia solanacearum  nitrogen regulatory IIA rsc0406 or rs03374 SWALL:Q8Y2D0 (EMBL:AL646059) (151 aa) fasta scores: E(): 2.6e-44, 78.14% id in 151 aa
YP_107157.1	Similar to Ralstonia solanacearum  sigma-54 modulation protein rsc0407 or rs03375 SWALL:Q8Y2C9 (EMBL:AL646059) (117 aa) fasta scores: E(): 3.8e-25, 64.65% id in 116 aa, and to Alcaligenes eutrophus probable sigma(54) modulation protein SWALL:RP5M_ALCEU (SWALL:P28613) (130 aa) fasta scores: E(): 3.8e-23, 68% id in 100 aa
YP_107158.1	sigma factors are initiation factors that promote the attachment of RNA polymerase to specific initiation sites and are then released; sigma 54 factor is responsible for the expression of enzymes involved in nitrogen assimilation and metabolism; the rhizobia often have 2 copies of this sigma factor; in Rhizobium etli RpoN1 shown to be involved in the assimilation of several nitrogen and carbon sources during free-living aerobic growth and RpoN2 is involved in symbiotic nitrogen fixation; in Bradyrhizobium both RpoN1 and N2 are functional in free-living and symbiotic conditions, rpoN1 gene was regulated in response to oxygen
YP_107159.1	Similar to Ralstonia solanacearum probable ATP-binding ABC transporter protein rsc0409 or rs03377 SWALL:Q8Y2C7 (EMBL:AL646059) (262 aa) fasta scores: E(): 9.2e-66, 79.11% id in 249 aa, and to Alcaligenes eutrophus hypothetical protein SWALL:Q9EX70 (EMBL:AJ131690) (263 aa) fasta scores: E(): 1.1e-64, 80.4% id in 250 aa
YP_107160.1	Similar to Ralstonia solanacearum  signal peptide protein rsc0410 or rs03378 SWALL:Q8Y2C6 (EMBL:AL646059) (191 aa) fasta scores: E(): 4.2e-29, 52.68% id in 186 aa. N-terminal region is similar to Alcaligenes eutrophus hypothetical protein SWALL:Q9EX71 (EMBL:AJ131690) (155 aa) fasta scores: E(): 6.9e-19, 51.4% id in 142 aa
YP_107161.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0411 or rs03379 SWALL:Q8Y2C5 (EMBL:AL646059) (210 aa) fasta scores: E(): 2.7e-28, 49.18% id in 183 aa, and to Pseudomonas aeruginosa hypothetical protein pa4459 SWALL:Q9HVV8 (EMBL:AE004860) (190 aa) fasta scores: E(): 8.8e-07, 27.89% id in 190 aa
YP_107162.1	Similar to Ralstonia solanacearum hypothetical protein rsc0412 or rs03380 SWALL:Q8Y2C4 (EMBL:AL646059) (195 aa) fasta scores: E(): 1e-34, 60.47% id in 167 aa, and to Pseudomonas aeruginosa hypothetical protein pa4458 SWALL:Q9HVV9 (EMBL:AE004860) (179 aa) fasta scores: E(): 9.8e-29, 52.9% id in 172 aa
YP_107163.1	Similar to Ralstonia solanacearum hypothetical protein rsc0413 or rs03381 SWALL:Q8Y2C3 (EMBL:AL646059) (333 aa) fasta scores: E(): 5.4e-79, 69.11% id in 327 aa, and to Xanthomonas campestris polysialic acid capsule expression protein xcc2797 SWALL:AAM42069 (EMBL:AE012392) (333 aa) fasta scores: E(): 3.4e-68, 59.69% id in 325 aa. Similar to BPSL2770, 50.649% identity (52.000% ungapped) in 308 aa overlap
YP_107164.1	N-terminal region is similar to Escherichia coli glutathione-regulated potassium-efflux system protein KefB or TrkB SWALL:KEFB_ECOLI (SWALL:P45522) (601 aa) fasta scores: E(): 4.3e-51, 33.63% id in 562 aa. Full length CDS is similar to Ralstonia solanacearum glutathione-regulated potassium-efflux system K+/H+ antiporter transmembrane protein rsc0414 or rs03382 SWALL:Q8Y2C2 (EMBL:AL646059) (659 aa) fasta scores: E(): 2.6e-158, 66.86% id in 658 aa
YP_107165.1	catalyzes a salvage reaction resulting in the formation of AMP which is metabolically less costly than a de novo synthesis
YP_107166.1	Similar to Escherichia coli homoserine/homoserine lactone efflux protein RhtB SWALL:RHTB_ECOLI (SWALL:P27847) (206 aa) fasta scores: E(): 3e-15, 30.1% id in 196 aa, and to Ralstonia solanacearum probable transport transmembrane protein rsc0418 or rs03386 SWALL:Q8Y2B8 (EMBL:AL646059) (206 aa) fasta scores: E(): 1.7e-46, 61.65% id in 206 aa
YP_107167.1	Similar to Ralstonia solanacearum hypothetical protein rsc1874 or rs03434 SWALL:Q8XY89 (EMBL:AL646067) (267 aa) fasta scores: E(): 5e-43, 48.88% id in 268 aa, and to the C-terminal region of Arabidopsis thaliana hypothetical protein AT5G19460 SWALL:Q8VXZ0 (EMBL:AY074342) (374 aa) fasta scores: E(): 8.2e-25, 35.58% id in 267 aa
YP_107168.1	produces formate from formyl-tetrahydrofolate which is the major source of formate for PurT in de novo purine nucleotide biosynthesis; has a role in one-carbon metabolism; forms a homohexamer; activated by methionine and inhibited by glycine
YP_107169.1	Similar to Ralstonia solanacearum probable transmembrane protein rsp0411 or rs00868 SWALL:Q8XSQ6 (EMBL:AL646078) (341 aa) fasta scores: E(): 8.7e-43, 44.44% id in 333 aa, and to weakly similar to Listeria monocytogenes hypothetical protein lmo0949 SWALL:Q8Y8F5 (EMBL:AL591977) (348 aa) fasta scores: E(): 6.8e-06, 23.16% id in 341 aa
YP_107170.1	Similar to Neisseria gonorrhoeae excinuclease ABC subunit A UvrA SWALL:UVRA_NEIGO (SWALL:Q50968) (950 aa) fasta scores: E(): 4e-202, 73.84% id in 952 aa, and to Ralstonia solanacearum probable excinuclease ABC subunit A rsc0420 or rs03388 SWALL:Q8Y2B6 (EMBL:AL646059) (954 aa) fasta scores: E(): 0, 84.8% id in 954 aa
YP_107171.1	Similar to Ralstonia solanacearum  multidrug-efflux transporter transmembrane protein rsc0421 or rs03389 SWALL:Q8Y2B5 (EMBL:AL646059) (387 aa) fasta scores: E(): 2.8e-94, 67.01% id in 382 aa. Weakly similar to Staphylococcus aureus quinolone resistance protein NorA SWALL:NORA_STAAM (SWALL:P21191) (388 aa) fasta scores: E(): 6.5e-11, 24.73% id in 372 aa
YP_107172.1	binds to single stranded DNA and may facilitate the binding and interaction of other proteins to DNA
YP_107174.1	N-terminus is similar to Corynebacterium glutamicum hypothetical protein SWALL:Q8VVJ6 (EMBL:AJ420072) (81 aa) fasta scores: E(): 0.0066, 46.66% id in 60 aa, and to the N-terminal region of Lactobacillus plantarum WCFS1 prophage LP1 protein 8 SWALL:Q88YW0 (EMBL:AL935253) (120 aa) fasta scores: E(): 0.008, 50% id in 56 aa
YP_107176.1	No significant database matches. Similar to BPSL0759, 75.904% identity (76.829% ungapped) in 166 aa overlap
YP_107178.1	Poor database matches. N-terminus is weakly similar to the N-terminal region of Rhizobium etli hypothetical protein YH035 SWALL:AAM54968 (EMBL:U80928) (101 aa) fasta scores: E(): 0.0068, 40.84% id in 71 aa
YP_107179.1	Similar to bacteriophage phiE125 protein gp29 SWALL:Q8W6S2 (EMBL:AF447491) (186 aa) fasta scores: E(): 7.3e-05, 30.32% id in 155 aa. N-terminus is similar to Ralstonia solanacearum hypothetical protein rsp0632 or rs03735 SWALL:Q8XS49 (EMBL:AL646079) (96 aa) fasta scores: E(): 7.2e-11, 44.56% id in 92 aa
YP_107180.1	Similar to the C-terminal region of Ralstonia solanacearum  transmembrane protein rsc1707 or rs02900 SWALL:Q8XYQ1 (EMBL:AL646066) (371 aa) fasta scores: E(): 1.6e-25, 36.84% id in 285 aa
YP_107182.1	No significant database matches. Doubtful CDS
YP_107183.1	Similar to internal regions of Chlorobium tepidum DNA helicase,  SWALL:Q8KC08 (EMBL:AE012917) (1510 aa) fasta scores: E(): 1.3e-08, 76.59% id in 47 aa, and to Clostridium acetobutylicum superfamily I DNA helicase SWALL:Q97ES1 (EMBL:AE007800) (1351 aa) fasta scores: E(): 0.94, 50% id in 46 aa
YP_107184.1	C-terminal region is similar to Rhizobium etli hypothetical protein YH035 SWALL:AAM54968 (EMBL:U80928) (101 aa) fasta scores: E(): 6.2e-07, 40.81% id in 98 aa, and Caulobacter crescentus Cro/CI family transcriptional regulator cc2771 SWALL:Q9A4Q9 (EMBL:AE005942) (119 aa) fasta scores: E(): 0.046, 35.48% id in 93 aa. Possible alternative translational start site
YP_107185.1	No significant database matches to the full length CDS. C-terminal region is similar to Sinorhizobium meliloti phage PBC5 hypothetical protein Orf68 SWALL:Q8W6F9 (EMBL:AF448724) (127 aa) fasta scores: E(): 3.4, 31.53% id in 111 aa
YP_107186.1	Poor database matches. Weakly similar to an internal region of Herpes simplex virus DNA polymerase processivity factor UL42 SWALL:VPAP_HSV11 (SWALL:P10226) (488 aa) fasta scores: E(): 4.4, 27.48% id in 211 aa
YP_107187.1	Poor database matches. C-terminal region is weakly similar to Caulobacter crescentus hypothetical protein CC3552 SWALL:Q9A2K9 (EMBL:AE006014) (118 aa) fasta scores: E(): 2.4, 28.57% id in 98 aa
YP_107188.1	N-terminus is similar to the N-terminal region of Stigmatella aurantiaca  transcriptional repressor SWALL:Q93TW4 (EMBL:AF319998) (119 aa) fasta scores: E(): 3.1e-06, 48.64% id in 74 aa. Full length CDS is weakly similar to Clostridium acetobutylicum predicted transcriptional regulator cac1578 SWALL:Q97IR2 (EMBL:AE007667) (110 aa) fasta scores: E(): 0.01, 27.36% id in 95 aa
YP_107190.1	Poor database matches. C-terminus is similar to the C-terminal region of Anabaena sp. hypothetical protein ALL4139 SWALL:Q8YPQ3 (EMBL:AP003595) (238 aa) fasta scores: E(): 8.9e-06, 33.11% id in 151 aa
YP_107192.1	Poor database matches. Weakly similar to Halobacterium sp. hypothetical protein VNG6173c SWALL:Q9HHY2 (EMBL:AE005152) (667 aa) fasta scores: E(): 0.0023, 22.22% id in 513 aa, and to Agrobacterium tumefaciens hypothetical protein Yme SWALL:O52294 (EMBL:AF242881) (660 aa) fasta scores: E(): 0.034, 21.92% id in 625 aa
YP_107194.1	Poor database matches. Weakly similar to the N-terminal region of Bacillus halodurans dipeptidase bh2271 SWALL:Q9KAL6 (EMBL:AP001515) (310 aa) fasta scores: E(): 3.6, 20.1% id in 194 aa
YP_107195.1	Similar to Thermoplasma acidophilum hypothetical protein TA0490 SWALL:Q9HKV3 (EMBL:AL445064) (277 aa) fasta scores: E(): 9.1e-47, 48.16% id in 272 aa, and to Thermoplasma volcanium hypothetical protein TV0581 or tvg0570508 SWALL:Q97B76 (EMBL:AP000992) (277 aa) fasta scores: E(): 1.1e-45, 47.42% id in 272 aa
YP_107196.1	Similar to Thermoplasma acidophilum hypothetical protein TA0489 SWALL:Q9HKV4 (EMBL:AL445064) (231 aa) fasta scores: E(): 4.9e-10, 25.41% id in 240 aa, and to Thermoplasma volcanium hypothetical protein TV0582 or tvg0571216 SWALL:Q97B75 (EMBL:AP000992) (232 aa) fasta scores: E(): 3e-07, 24.78% id in 230 aa
YP_107197.1	No significant database matches to the full length CDS. N-terminus is similar to the C-terminal regions of Thermoplasma acidophilum hypothetical protein TA0488 SWALL:Q9HKV5 (EMBL:AL445064) (409 aa) fasta scores: E(): 4.6e-16, 31.67% id in 281 aa, and Thermoplasma volcanium hypothetical protein TV0583 or TVG0571194 SWALL:Q97B74 (EMBL:AP000992) (401 aa) fasta scores: E(): 2e-15, 29.43% id in 282 aa
YP_107200.1	Poor database matches. Internal region is weakly similar to an internal region of Bacillus sp. subtilisin precursor Sub1 SWALL:SUBT_BACS9 (SWALL:P28842) (420 aa) fasta scores: E(): 0.036, 28.52% id in 305 aa. N-terminus is weakly similar to the N-terminal region of Thermoanaerobacter tengcongensis subtilisin-like serine proteases TTE0824 SWALL:Q8RBJ2 (EMBL:AE013049) (561 aa) fasta scores: E(): 0.003, 26.44% id in 484 aa
YP_107203.1	Poor database matches. N-terminus is weakly similar to the N-terminal region of Xanthomonas axonopodis hypothetical protein XAC2902 SWALL:AAM37747 (EMBL:AE011932) (616 aa) fasta scores: E(): 3.3e-08, 23.19% id in 608 aa
YP_107204.1	Weakly similar to Pasteurella multocida hypothetical protein PM1948 SWALL:Q9CJP6 (EMBL:AE006231) (506 aa) fasta scores: E(): 3.4e-08, 23.3% id in 502 aa, and to Xanthomonas axonopodis hypothetical protein XAC2903 SWALL:AAM37748 (EMBL:AE011932) (526 aa) fasta scores: E(): 6.7e-07, 25.44% id in 507 aa
YP_107205.1	Weakly similar to Xanthomonas axonopodis integrase/recombinase Int or XAC2904 SWALL:AAM37749 (EMBL:AE011932) (439 aa) fasta scores: E(): 1.3e-07, 24.29% id in 428 aa, and to Escherichia coli O157:H7  site specific recombinase ECS3512 SWALL:Q8X3D8 (EMBL:AP002562) (401 aa) fasta scores: E(): 9e-07, 23.34% id in 377 aa
YP_107206.1	Weakly similar to Pseudomonas putida, and Pseudomonas sp. carboxymethylenebutenolidase ClcD SWALL:CLCD_PSEPU (SWALL:P11453) (236 aa) fasta scores: E(): 3.7e-05, 24.65% id in 215 aa. Similar to Streptomyces coelicolor hypothetical protein SCO0254 or SCJ9A.33c SWALL:Q9S1N7 (EMBL:AL109972) (246 aa) fasta scores: E(): 1.6e-24, 38.43% id in 242 aa
YP_107209.1	Similar to Ralstonia solanacearum hypothetical protein rsc2699 or rs00020 SWALL:Q8XVX6 (EMBL:AL646071) (105 aa) fasta scores: E(): 1.7e-16, 55.44% id in 101 aa
YP_107210.1	Poor database matches. Internal region is similar to an internal region of Staphylococcus aureus exfoliative toxin B plasmid hypothetical protein Orf24 SWALL:Q8VVS1 (EMBL:AP003088) (590 aa) fasta scores: E(): 4.4e-06, 22.03% id in 472 aa
YP_107215.1	Poor database matches. N-terminus is similar to the N-terminal region of Staphylococcus aureus aureus hypothetical protein MW0047 SWALL:Q8VUW0 (EMBL:AB063172) (206 aa) fasta scores: E(): 7.5, 26.19% id in 84 aa
YP_107216.1	Similar to Escherichia coli  recombinase SWALL:Q8VR85 (EMBL:AF447814) (200 aa) fasta scores: E(): 1.2e-47, 61.22% id in 196 aa, and to the C-terminal region of Escherichia coli integrase/recombinase XerD or XprB SWALL:XERD_ECOLI (SWALL:P21891) (298 aa) fasta scores: E(): 0.00042, 23.03% id in 165 aa
YP_107217.1	Poor database matches. Weakly similar to Caenorhabditis elegans hypothetical protein R13F6.1 SWALL:Q95QB8 (EMBL:U00046) (149 aa) fasta scores: E(): 1.9, 25.75% id in 132 aa
YP_107218.1	Similar to Thermoanaerobacter tengcongensis hypothetical protein TTE0299 SWALL:Q8RCV6 (EMBL:AE013003) (110 aa) fasta scores: E(): 3e-11, 44.21% id in 95 aa, and to Alcaligenes eutrophus hypothetical protein in acoC 3'region SWALL:YAC7_ALCEU (SWALL:P27749) (113 aa) fasta scores: E(): 6.7e-11, 40% id in 95 aa
YP_107219.1	N-terminus is weakly similar to Photorhabdus luminescens insecticidal toxin complex protein TcaC SWALL:O85153 (EMBL:AF046867) (1485 aa) fasta scores: E(): 3.7e-18, 22.82% id in 1472 aa, and to the N-terminal reion of Yersinia pestis insecticidal toxin complex YPO3678 SWALL:Q8ZAV4 (EMBL:AJ414158) (1496 aa) fasta scores: E(): 7.7e-20, 25.34% id in 1227 aa
YP_107220.1	Internal region is similar to the C-terminal region of Photorhabdus luminescens insecticidal toxin complex protein TccB SWALL:O85156 (EMBL:AF047028) (1565 aa) fasta scores: E(): 0.028, 22.05% id in 544 aa. Contains coiled-coiled domains, residues 520 to 549 and 640 to 666
YP_107225.1	Poor database matches. N-terminus is weakly similar to the N-terminal region of Streptomyces coelicolor hypothetical protein SCO1806 or SCI33.05c SWALL:Q9AJX1 (EMBL:AL513407) (876 aa) fasta scores: E(): 0.071, 26.79% id in 321 aa
YP_107226.1	No significant database matches to the full length CDS. N-terminal region is similar to Myxococcus xanthus serine/threonine-protein kinase Pkn2 SWALL:PKN2_MYXXA (SWALL:P54736) (830 aa) fasta scores: E(): 2e-20, 26.44% id in 624 aa. C-terminal region is similar to Rhizobium meliloti  adenylate cyclase ra0987 or sma1789 SWALL:Q92Y97 (EMBL:AE007284) (1118 aa) fasta scores: E(): 8.3e-47, 27.54% id in 1042 aa
YP_107229.1	Poor database matches. Similar to Streptomyces violaceoruber granaticin biosynthetic gene cluster protein Gra-Orf12 SWALL:Q9ZA45 (EMBL:AJ011500) (751 aa) fasta scores: E(): 6.9e-09, 34.97% id in 729 aa
YP_107230.1	Similar to Ralstonia solanacearum  aldolase rsc0806 or rs05016 SWALL:Q8Y184 (EMBL:AL646061) (261 aa) fasta scores: E(): 7.7e-36, 43.52% id in 255 aa, and to an internal region of Homo sapiens alpha adducin ADD1 or ADDA SWALL:ADDA_HUMAN (SWALL:P35611) (737 aa) fasta scores: E(): 9.6e-27, 41.4% id in 256 aa
YP_107231.1	No significant database matches to the full length CDS. C-terminus is similar to the C-terminal regions of Pseudomonas aeruginosa hypothetical protein PA0861 SWALL:Q9I580 (EMBL:AE004521) (818 aa) fasta scores: E(): 6.4e-71, 41.01% id in 668 aa, and Rhizobium loti hypothetical protein MLR3171 SWALL:Q98GU5 (EMBL:AP003001) (832 aa) fasta scores: E(): 6.8e-65, 38.74% id in 671 aa
YP_107232.1	Similar to Escherichia coli  O-antigen transporter RfbX or Wzx SWALL:RFBX_ECOLI (SWALL:P37746) (415 aa) fasta scores: E(): 4.6e-37, 29.34% id in 409 aa, and to Methanobacterium thermoautotrophicum O-antigen transporter MTH347 SWALL:O26447 (EMBL:AE000819) (420 aa) fasta scores: E(): 1.2e-44, 32.34% id in 405 aa
YP_107233.1	Similar to Escherichia coli glycosyltransferase WcaO SWALL:Q9X4C4 (EMBL:AF104912) (393 aa) fasta scores: E(): 1.5e-22, 28.93% id in 356 aa, and to Rhizobium meliloti  glycosyltransferase, forming alpha-gylcosyl linkages protein ExpE4 or rb0887 or smb21311 SWALL:P96434 (EMBL:Z79692) (420 aa) fasta scores: E(): 8e-10, 28.57% id in 350 aa
YP_107234.1	Similar to Salmonella typhimurium mannose-1-phosphate guanylyltransferase ManC or CpsB or RfbM SWALL:MANC_SALTY (SWALL:P26340) (480 aa) fasta scores: E(): 2.4e-83, 52.26% id in 486 aa, and to Aeromonas hydrophila  mannose-1-phosphate guanylyltransferase ManC SWALL:AAM22554 (EMBL:AF343089) (501 aa) fasta scores: E(): 1.2e-88, 47.74% id in 488 aa. Similar to BPSS1835, 63.843% identity (64.644% ungapped) in 484 aa overlap. CDS is extended at the C-terminus in comparison to orthologues and paralogue
YP_107235.1	N-terminal region is similar to Escherichia coli protein ElaA SWALL:ELAA_ECOLI (SWALL:P52077) (153 aa) fasta scores: E(): 1.9e-10, 34% id in 150 aa, and to Pseudomonas aeruginosa hypothetical protein PA0115 SWALL:Q9I717 (EMBL:AE004449) (150 aa) fasta scores: E(): 2.2e-10, 34.43% id in 151 aa. CDS is extended at the C-terminus in comparison to orthologues
YP_107236.1	Similar to Actinobacillus actinomycetemcomitans mannosyl transferase Orf7 SWALL:Q9JRR8 (EMBL:AB041266) (372 aa) fasta scores: E(): 1.6e-73, 53.51% id in 370 aa, and to Anabaena sp. mannosyl transferase ALL4830 SWALL:Q8YMU7 (EMBL:AP003597) (379 aa) fasta scores: E(): 3.6e-64, 49.18% id in 370 aa. CDS is extended at the C-terminus in comparison to orthologues. N-terminal region is similar to an internal region of BPSS1684, 66.067% identity (67.102% ungapped) in 389 aa overlap
YP_107237.1	Similar to Aeromonas hydrophila hypothetical protein SWALL:Q9X647 (EMBL:AF131869) (264 aa) fasta scores: E(): 2.7e-11, 32.66% id in 251 aa
YP_107238.1	Similar to Escherichia coli transcriptional regulatory protein ZraR or HydG SWALL:ZRAR_ECOLI (SWALL:P14375) (441 aa) fasta scores: E(): 9.5e-49, 39.66% id in 416 aa, and to Ralstonia solanacearum  sigma-54 interacting transcription regulator protein rsc1186 or rs05718 SWALL:Q8Y058 (EMBL:AL646063) (458 aa) fasta scores: E(): 2.2e-77, 50.83% id in 421 aa. Similar to BPSL2474, 58.652% identity (60.277% ungapped) in 445 aa overlap , and to BPSL2475, 55.928% identity (57.208% ungapped) in 447 aa overlap. Possible alternative translational start site
YP_107239.1	Poor database matches. Weakly similar to Agrobacterium tumefaciens hypothetical protein ATU2576 or AGR_C_4666 SWALL:Q8UCC2 (EMBL:AE009203) (619 aa) fasta scores: E(): 9.6e-17, 30.24% id in 625 aa
YP_107240.1	Similar to Agrobacterium tumefaciens mannosidase ATU2575 or AGR_C_4665 SWALL:Q8UCC3 (EMBL:AE009203) (818 aa) fasta scores: E(): 1.9e-138, 46.9% id in 823 aa. Weakly similar to Capra hircus beta-mannosidase precursor MANBA SWALL:MANB_CAPHI (SWALL:Q95327) (879 aa) fasta scores: E(): 1.9e-15, 24.54% id in 770 aa
YP_107241.1	Similar to Agrobacterium tumefaciens hypothetical protein ATU2574 or AGR_C_4664 SWALL:Q8UCC4 (EMBL:AE009203) (327 aa) fasta scores: E(): 3.4e-48, 43.36% id in 309 aa
YP_107242.1	Similar to Agrobacterium tumefaciens hypothetical protein ATU2573 or AGR_C_4663 SWALL:Q8UCC5 (EMBL:AE009203) (327 aa) fasta scores: E(): 8.2e-73, 56.23% id in 313 aa
YP_107243.1	Similar to Agrobacterium tumefaciens acyl-CoA dehydrogenase Acd or ATU2572 or AGR_C_4660 SWALL:Q8UCC6 (EMBL:AE009203) (393 aa) fasta scores: E(): 3.7e-73, 50.91% id in 381 aa, and to Clostridium acetobutylicum acyl-CoA dehydrogenase, short-chain specific Bcd or CAC2711 SWALL:ACDS_CLOAB (SWALL:P52042) (379 aa) fasta scores: E(): 1.3e-07, 21.39% id in 374 aa. CDS is extended at the N-terminus in comparison to orthologues
YP_107244.1	Involved in the biosynthetic pathways of fatty acids, phospholipids, lipopolysaccharides, and oligosaccharides
YP_107245.1	Similar to Synechocystis sp. hypothetical protein SLL1169 SWALL:P74198 (EMBL:D90913) (238 aa) fasta scores: E(): 1.4e-22, 34.52% id in 223 aa, and to Rhizobium loti hypothetical protein MLR2110 SWALL:Q98J44 (EMBL:AP002999) (243 aa) fasta scores: E(): 8.4e-11, 28.44% id in 225 aa. Possible alternative translational start site
YP_107246.1	Similar to Synechocystis sp. hypothetical protein SLL1169 SWALL:P74198 (EMBL:D90913) (238 aa) fasta scores: E(): 5.3e-35, 40.92% id in 237 aa, and to Rhizobium meliloti hypothetical protein ra1066 or sma1948 SWALL:Q92Y22 (EMBL:AE007292) (238 aa) fasta scores: E(): 2.9e-21, 34.07% id in 226 aa. CDS is extended at the C-terminus in comparison to orthologues
YP_107247.1	Similar to Escherichia coli  colanic biosynthesis UDP-glucose lipid carrier transferase WcaJ SWALL:WCAJ_ECOLI (SWALL:P71241) (464 aa) fasta scores: E(): 9.8e-58, 37.08% id in 480 aa, and to Klebsiella pneumoniae probable capsular polysaccharide biosynthesis glycosyltransferase SWALL:YC14_KLEPN (SWALL:Q48460) (465 aa) fasta scores: E(): 8.3e-54, 35.71% id in 476 aa. Similar to BPSS1834, 50.433% identity (50.873% ungapped) in 462 aa overlap
YP_107248.1	Similar to Vibrio vulnificus capsular polysaccharide transport protein Wza SWALL:Q938A5 (EMBL:AY055488) (378 aa) fasta scores: E(): 1.4e-22, 33.9% id in 407 aa, and to Ralstonia solanacearum EPSI polysaccharide export outer membrane protein EpsA SWALL:EPA1_RALSO (SWALL:P58597) (381 aa) fasta scores: E(): 1.3e-20, 34.65% id in 404 aa
YP_107249.1	Similar to Rhizobium meliloti  glycosyltransferase rb0655 or smb21076 SWALL:Q92VP4 (EMBL:AL603644) (377 aa) fasta scores: E(): 3.7e-42, 38.85% id in 368 aa, and to Deinococcus radiodurans mannosyltransferase dra0039 SWALL:Q9RZB5 (EMBL:AE001862) (343 aa) fasta scores: E(): 1.5e-29, 37.92% id in 356 aa. Possible alternative translational start site
YP_107250.1	Poor database matches. Internal region is weakly similar to an internal region of Escherichia coli UDP-N-acetylglucosamine--n-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol n-acetylglucosamine transferase MurG SWALL:MURG_ECOLI (SWALL:P17443) (354 aa) fasta scores: E(): 2, 27.45% id in 153 aa
YP_107251.1	Similar to Brucella melitensis hypothetical protein bmei1920 SWALL:Q8YEF8 (EMBL:AE009625) (128 aa) fasta scores: E(): 2.6e-19, 50.82% id in 122 aa, and to Rhizobium loti hypothetical protein mll1617 SWALL:Q98K65 (EMBL:AP002997) (147 aa) fasta scores: E(): 6.6e-18, 50.4% id in 123 aa. CDS is extended at the N-terminus in comparison to B. melitensis protein
YP_107252.1	Similar to Streptomyces hygroscopicus acetyl-hydrolase Bah SWALL:BAH_STRHY (SWALL:Q01109) (299 aa) fasta scores: E(): 4.6e-39, 47.48% id in 278 aa, and to Ralstonia solanacearum  lipase/esterase rsc0439 or rs03408 SWALL:Q8Y297 (EMBL:AL646059) (317 aa) fasta scores: E(): 3.1e-56, 53.18% id in 314 aa. CDS is extended at the N-terminus in comparison to S. hygroscopicus acetyl-hydrolase
YP_107253.1	Similar to Pseudomonas aeruginosa staphylolytic protease preproenzyme LasA SWALL:P72166 (EMBL:U68175) (263 aa) fasta scores: E(): 1.5e-12, 39.43% id in 284 aa, and to Xanthomonas axonopodis hypothetical protein xac0112 SWALL:AAM35004 (EMBL:AE011634) (263 aa) fasta scores: E(): 8.4e-18, 45.55% id in 281 aa
YP_107254.1	Similar to Streptomyces glaucescens tetracenomycin C resistance and export protein TcmA SWALL:TCMA_STRGA (SWALL:P39886) (538 aa) fasta scores: E(): 1.8e-31, 30.13% id in 511 aa, and to Burkholderia cepacia major facilitator superfamily transporter homologue SWALL:Q9RPH2 (EMBL:AF158699) (531 aa) fasta scores: E(): 4.2e-168, 85.31% id in 531 aa
YP_107255.1	Similar to Salmonella typhimurium multiple antibiotic resistance protein MarR SWALL:MARR_SALTY (SWALL:Q56069) (144 aa) fasta scores: E(): 0.0021, 31.35% id in 118 aa, and to Burkholderia cepacia MarR homologue SWALL:Q9RPH3 (EMBL:AF158699) (148 aa) fasta scores: E(): 3.1e-46, 81.81% id in 143 aa
YP_107256.1	Similar to Pyrococcus furiosus protease I PfpI SWALL:PFPI_PYRFU (SWALL:Q51732) (166 aa) fasta scores: E(): 2.3e-10, 33.69% id in 187 aa, and to Burkholderia cepacia hypothetical protein SWALL:Q45084 (EMBL:AF158699) (197 aa) fasta scores: E(): 1.4e-67, 91.19% id in 193 aa
YP_107257.1	Similar to Burkholderia cepacia D-serine deaminase Dsd SWALL:Q45085 (EMBL:AF158699) (432 aa) fasta scores: E(): 8.8e-141, 82.39% id in 426 aa, and to Ralstonia solanacearum probable D-serine deaminase rsp1185 or rs03129 SWALL:Q8XQN7 (EMBL:AL646083) (425 aa) fasta scores: E(): 8.3e-112, 66.9% id in 429 aa
YP_107258.1	Similar to Ralstonia solanacearum hypothetical protein rsp1186 or rs03130 SWALL:Q8XQN6 (EMBL:AL646083) (289 aa) fasta scores: E(): 5.1e-60, 60.62% id in 287 aa. Weakly similar to Escherichia coli als operon repressor protein RpiR SWALL:RPIR_ECOLI (SWALL:P39266) (296 aa) fasta scores: E(): 4.5e-08, 26.31% id in 247 aa
YP_107259.1	Similar to Alcaligenes xylosoxydans xylosoxydans D-aminoacylase Dan SWALL:NDAD_ALCXX (SWALL:P72349) (483 aa) fasta scores: E(): 3.8e-83, 50.95% id in 473 aa, and to Ralstonia solanacearum probable N-acyl-D-glutamate deacylase rsp1187 or rs03131 SWALL:Q8XQN5 (EMBL:AL646083) (494 aa) fasta scores: E(): 2.2e-126, 69.48% id in 485 aa
YP_107260.1	Similar to Bacillus subtilis  regulator of purine biosynthesis YabJ SWALL:YABJ_BACSU (SWALL:P37552) (124 aa) fasta scores: E(): 1.2e-10, 36.52% id in 115 aa, and to Ralstonia solanacearum hypothetical protein rsp1188 or rs03132 SWALL:Q8XQN4 (EMBL:AL646083) (128 aa) fasta scores: E(): 2.9e-35, 70.63% id in 126 aa, and to Homo sapiens 14.5 kDa translational inhibitor protein PSP SWALL:UK14_HUMAN (SWALL:P52758) (137 aa) fasta scores: E(): 9.5e-11, 34.64% id in 127 aa
YP_107261.1	catalyzes the NADPH-dependent reduction of 7-cyano-7-deazaguanine (preQ0) to 7-aminomethyl-7-deazaguanine (preQ1) in queuosine biosynthesis
YP_107262.1	threonine deaminase; threonine dehydratase; in Escherichia coli, IlvA is part of the isoleucine biosynthetic pathway
YP_107263.1	Similar to Ralstonia solanacearum  oxidoreductase rsc0454 or rs04446 SWALL:Q8Y282 (EMBL:AL646059) (1345 aa) fasta scores: E(): 0, 80.81% id in 1355 aa, and to Neisseria meningitidis oxidoreductase,  nmb0998 SWALL:Q9JZL6 (EMBL:AE002451) (1277 aa) fasta scores: E(): 3.5e-151, 61.01% id in 1326 aa. Possible alternative translational start site
YP_107264.1	Similar to Ralstonia solanacearum hypothetical protein rsc0455 or rs04445 SWALL:Q8Y281 (EMBL:AL646059) (147 aa) fasta scores: E(): 4.8e-24, 46.76% id in 139 aa, and to Pyrococcus horikoshii hypothetical protein PH1001 SWALL:O58729 (EMBL:AP000004) (150 aa) fasta scores: E(): 3.2e-10, 30.92% id in 152 aa
YP_107265.1	Similar to Ralstonia solanacearum hypothetical protein rsc0457 or rs04443 SWALL:Q8Y279 (EMBL:AL646059) (138 aa) fasta scores: E(): 1.2e-33, 60.87% id in 138 aa, and to Neisseria meningitidis hypothetical protein nma0955 SWALL:Q9JV84 (EMBL:AL162754) (130 aa) fasta scores: E(): 1.9e-20, 55.75% id in 113 aa
YP_107266.1	Catalyzes the carbon methylation reaction in the biosynthesis of ubiquinone
YP_107267.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein rsc0459 rsc0459 or rs04440 SWALL:Q8Y277 (EMBL:AL646059) (356 aa) fasta scores: E(): 2.6e-24, 52.13% id in 351 aa, and to Pseudomonas aeruginosa hypothetical protein Pa5528 pa5528 SWALL:Q9HT45 (EMBL:AE004965) (284 aa) fasta scores: E(): 6.7e-07, 35.19% id in 304 aa
YP_107268.1	Similar to Ralstonia solanacearum hypothetical protein rsc0460 or rs04439 SWALL:Q8Y276 (EMBL:AL646059) (203 aa) fasta scores: E(): 4.5e-23, 42.18% id in 211 aa, and to Xanthomonas campestris hypothetical protein xcc0223 SWALL:AAM39542 (EMBL:AE012118) (214 aa) fasta scores: E(): 6.2e-09, 30.94% id in 223 aa
YP_107269.1	an Escherichia coli mutant results in accumulation of octaprenylphenol and no ubiquinone; functions in the formation of 2-octaprenyl-6-hydroxy-phenol from 2-octaprenylphenol in ubiquinone (coenzyme Q) biosynthesis; similar to eukaryotic proteins that exhibit kinase functions
YP_107270.1	Similar to Ralstonia solanacearum hypothetical protein rsc0462 or rs04436 SWALL:Q8Y274 (EMBL:AL646059) (209 aa) fasta scores: E(): 3.2e-40, 56.5% id in 200 aa. Weakly similar to Arabidopsis thaliana AT2G43920 protein SWALL:O80562 (EMBL:AC004005) (227 aa) fasta scores: E(): 1.8e-10, 28.3% id in 212 aa. CDS is extended at the N-terminus in comparison to R. solanacearum protein
YP_107271.1	Similar to Ralstonia solanacearum hypothetical protein rsc0464 or rs04433 SWALL:Q8Y272 (EMBL:AL646059) (112 aa) fasta scores: E(): 1.2e-16, 63.96% id in 111 aa, and to Xanthomonas campestris hypothetical protein xcc3033 SWALL:AAM42304 (EMBL:AE012416) (99 aa) fasta scores: E(): 1.7e-07, 43.26% id in 104 aa
YP_107272.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0465 or rs04432 SWALL:Q8Y271 (EMBL:AL646059) (243 aa) fasta scores: E(): 9.8e-58, 74.17% id in 213 aa, and to Neisseria meningitidis hypothetical protein nmb0465 SWALL:Q9K0U6 (EMBL:AE002403) (233 aa) fasta scores: E(): 2.3e-32, 45.91% id in 196 aa
YP_107273.1	catalyzes a two-step reaction, first charging an aspartate molecule by linking its carboxyl group to the alpha-phosphate of ATP, followed by transfer of the aminoacyl-adenylate to its tRNA; contains discriminating and non-discriminating subtypes
YP_107274.1	converts dATP to dAMP and pyrophosphate
YP_107275.1	Similar to Ralstonia solanacearum hypothetical protein rsc0470 or rs04425 SWALL:Q8Y266 (EMBL:AL646059) (422 aa) fasta scores: E(): 6e-52, 45.25% id in 400 aa, and to the C-terminal region of Bacillus firmus cardiolipin synthetase Cls SWALL:CLS_BACFI (SWALL:O66043) (503 aa) fasta scores: E(): 2.2e-10, 28.32% id in 413 aa
YP_107276.1	Similar to Ralstonia solanacearum  transcription regulator protein rsc0472 or rs04423 SWALL:Q8Y264 (EMBL:AL646059) (213 aa) fasta scores: E(): 7.8e-60, 76.02% id in 196 aa, and to Agrobacterium tumefaciens transcriptional regulator, TetR family ATU5291 or AGR_PAT_419 SWALL:Q8UK32 (EMBL:AE008951) (221 aa) fasta scores: E(): 1.3e-14, 32.99% id in 194 aa. R. solanacearum protein is extended at the N-terminus in comparison to CDS
YP_107277.1	Similar to Ralstonia solanacearum  acyl-CoA dehydrogenase oxidoreductase rsc0473 or rs04422 SWALL:Q8Y263 (EMBL:AL646059) (595 aa) fasta scores: E(): 1.3e-205, 81.51% id in 595 aa, and to Pseudomonas aeruginosa probable acyl-CoA dehydrogenase PA0506 SWALL:Q9I612 (EMBL:AE004487) (601 aa) fasta scores: E(): 1.3e-147, 61.2% id in 598 aa
YP_107278.1	Similar to Ralstonia solanacearum 3-hydroxyacyl-CoA dehydrogenase oxidoreductase rsc0474 or rs04421 SWALL:Q8Y262 (EMBL:AL646059) (827 aa) fasta scores: E(): 0, 77.28% id in 810 aa. N-terminal region and to Homo sapiens short chain 3-hydroxyacyl-CoA dehydrogenase, mitochondrial precursor HADHSC or SCHAD SWALL:HCDH_HUMAN (SWALL:Q16836) (314 aa) fasta scores: E(): 1.6e-20, 34.57% id in 295 aa. R. solanacearum protein is extended at the N-terminus in comparison to CDS
YP_107279.1	Catalyzes the synthesis of acetoacetyl coenzyme A from two molecules of acetyl coenzyme A. It can also act as a thiolase, catalyzing the reverse reaction and generating two-carbon units from the four-carbon product of fatty acid oxidation
YP_107280.1	Catalyzes the reversible hydration of unsaturated fatty acyl-CoA to beta-hydroxyacyl-CoA
YP_107281.1	Similar to Alcaligenes eutrophus fdhD protein FdhD or FdsC SWALL:FDHD_ALCEU (SWALL:O87816) (288 aa) fasta scores: E(): 6e-39, 48.12% id in 266 aa, and to Ralstonia solanacearum probable formate dehydrogenase associated protein rsp1050 or rs02387 SWALL:Q8XR18 (EMBL:AL646082) (273 aa) fasta scores: E(): 2.5e-41, 49.62% id in 266 aa
YP_107282.1	Similar to Anabaena sp. hypothetical protein ALR0614 SWALL:Q8YZ73 (EMBL:AP003583) (153 aa) fasta scores: E(): 3.5e-11, 29.53% id in 149 aa, and to Synechocystis sp. hypothetical protein SLL1455 SWALL:P73447 (EMBL:D90906) (155 aa) fasta scores: E(): 8e-10, 28.75% id in 153 aa
YP_107283.1	Similar to Ralstonia solanacearum hypothetical protein rsc0477 or rs04418 SWALL:Q8Y259 (EMBL:AL646059) (139 aa) fasta scores: E(): 2.3e-34, 78.12% id in 128 aa, and to Escherichia coli  acyl-CoA thioester hydrolase YciA or b1253 SWALL:YCIA_ECOLI (SWALL:P04379) (132 aa) fasta scores: E(): 1.3e-16, 43.54% id in 124 aa
YP_107284.1	Similar to the C-terminal region of Homo sapiens ATP-binding cassette transporter 7, mitochondrial precursor ABCB7 or ABC7 SWALL:ABC7_HUMAN (SWALL:O75027) (752 aa) fasta scores: E(): 6.1e-95, 47.55% id in 614 aa, and to the full length Ralstonia solanacearum probable composite ATP-binding transmembrane ABC transporter protein rsc0478 or rs04417 SWALL:Q8Y258 (EMBL:AL646059) (592 aa) fasta scores: E(): 6.9e-141, 73.98% id in 592 aa. Similar to BPSS2259, 51.007% identity (53.427% ungapped) in 596 aa overlap. CDS is extended at the N-terminus in comparison to R. solanacearum protein
YP_107285.1	Similar to Ralstonia solanacearum mannose-1-phosphate guanyltransferase-related protein rsc0511 or rs04996 SWALL:Q8Y225 (EMBL:AL646059) (241 aa) fasta scores: E(): 3.2e-58, 70.08% id in 234 aaWeakly similar to Streptomyces griseus glucose-1-phosphate thymidylyltransferase StrD SWALL:STRD_STRGR (SWALL:P08075) (355 aa) fasta scores: E(): 9.8e-09, 26.16% id in 237 aa
YP_107286.1	Similar to Ralstonia solanacearum hypothetical protein rsc0514 or rs04986 SWALL:Q8Y222 (EMBL:AL646059) (352 aa) fasta scores: E(): 3.9e-76, 59.3% id in 344 aa, and to Pseudomonas aeruginosa hypothetical protein SWALL:Q9X4N9 (EMBL:AF116284) (338 aa) fasta scores: E(): 1.5e-56, 47.23% id in 343 aa
YP_107287.1	Similar to Ralstonia solanacearum probable organic solvent tolerance transmembrane protein rsc0515 or rs04980 SWALL:Q8Y221 (EMBL:AL646059) (811 aa) fasta scores: E(): 1.7e-126, 43.28% id in 811 aa. Weakly similar to Escherichia coli organic solvent tolerance protein precursor Imp or OstA SWALL:OSTA_ECOLI (SWALL:P31554) (784 aa) fasta scores: E(): 6.6e-18, 28.08% id in 794 aa
YP_107288.1	Similar to Escherichia coli survival protein (peptidyl-prolyl cis-trans isomerase) SurA SWALL:SURA_ECOLI (SWALL:P21202) (428 aa) fasta scores: E(): 2.1e-35, 32.93% id in 413 aa, and to Ralstonia solanacearum probable peptidyl-prolyl cis-trans isomerase rsc0516 or rs04977 SWALL:Q8Y220 (EMBL:AL646059) (498 aa) fasta scores: E(): 8.2e-61, 44.49% id in 427 aa. R. solanacearum is extended at the N-terminus in comparison to CDS
YP_107289.1	catalyzes oxidation of 4-(phosphohydroxy)-L-threonine into 2-amino-3-oxo-4-(phosphohydroxy)butyric acid which decarboxylates to form 1-amino-3-(phosphohydroxy)propan-2-one (3-amino-2-oxopropyl phosphate)
YP_107290.1	catalyzes the transfer of a total of four methyl groups from S-adenosyl-l-methionine (S-AdoMet) to two adjacent adenosine bases A1518 and A1519 in 16S rRNA; mutations in ksgA causes resistance to the translation initiation inhibitor kasugamycin
YP_107291.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein rsc0519 or rs04969 SWALL:Q8Y218 (EMBL:AL646059) (301 aa) fasta scores: E(): 2.8e-62, 60.59% id in 302 aa, and to Pseudomonas aeruginosa hypothetical protein pa1411 SWALL:Q9I3T3 (EMBL:AE004570) (303 aa) fasta scores: E(): 2.2e-47, 51.86% id in 295 aa
YP_107292.1	Similar to Neisseria meningitidis lactoylglutathione lyase GloA SWALL:LGUL_NEIMA (SWALL:O33393) (138 aa) fasta scores: E(): 1.4e-39, 75% id in 128 aa, and to Pseudomonas aeruginosa lactoylglutathione lyase PA3524 SWALL:Q9HY85 (EMBL:AE004773) (128 aa) fasta scores: E(): 6.3e-38, 71.87% id in 128 aa
YP_107293.1	Similar to Ralstonia solanacearum hypothetical protein rsc0521 or rs06095 SWALL:Q8Y216 (EMBL:AL646059) (288 aa) fasta scores: E(): 1.7e-59, 65.7% id in 277 aa, and to the C-terminal region of Agrobacterium tumefaciens hypothetical protein ATU0016 or AGR_C_25 SWALL:Q8UJB2 (EMBL:AE008976) (255 aa) fasta scores: E(): 1.5e-12, 29.36% id in 252 aa. CDS is extended at the N-terminus in comparison to many orthologues
YP_107294.1	Similar to Ralstonia solanacearum  acyltransferase transmembrane protein rsc0522 or rs04959 SWALL:Q8Y215 (EMBL:AL646059) (250 aa) fasta scores: E(): 9.8e-67, 65.59% id in 250 aa, and to Pseudomonas aeruginosa probable acyltransferase pa0005 SWALL:Q9I7C1 (EMBL:AE004440) (257 aa) fasta scores: E(): 6.3e-40, 43.8% id in 242 aa, and to Pseudomonas fluorescens N-acylhomoserine lactone synthase HdtS SWALL:Q9F728 (EMBL:AF286536) (259 aa) fasta scores: E(): 3.2e-37, 40.58% id in 239 aa
YP_107295.1	Converts the D-glycero-beta-D-manno-heptose 1,7-bisphosphate intermediate into D-glycero-beta-D-manno-heptose 1-phosphate
YP_107296.1	glycine--tRNA ligase beta chain; glyS; class II aminoacyl tRNA synthetase; tetramer of alpha(2)beta(2); catalyzes a two-step reaction; first charging a glycine molecule by linking the carboxyl group to the alpha-phosphate of ATP; second by transfer of the aminoacyl-adenylate to its tRNA
YP_107297.1	glycine--tRNA ligase alpha chain; GlyRS; class II aminoacyl tRNA synthetase; tetramer of alpha(2)beta(2); catalyzes a two-step reaction; first charging a glycine molecule by linking its carboxyl group to the alpha-phosphate of ATP; second by transfer of the aminoacyl-adenylate to its tRNA
YP_107298.1	Transfers the fatty acyl group on membrane lipoproteins
YP_107299.1	Similar to Salmonella typhimurium, and Salmonella typhi magnesium and cobalt efflux protein CorC or stm0667 or sty0712 SWALL:CORC_SALTY (SWALL:Q9R874) (292 aa) fasta scores: E(): 9.1e-41, 42.9% id in 289 aa, and to Ralstonia solanacearum hypothetical protein rsc0528 or rs04940 SWALL:Q8Y209 (EMBL:AL646059) (298 aa) fasta scores: E(): 1e-83, 77.43% id in 288 aa, and to Pseudomonas aeruginosa hypothetical protein Pa3983 pa3983 SWALL:Q9HX36 (EMBL:AE004816) (279 aa) fasta scores: E(): 2.4e-53, 53.02% id in 281 aa
YP_107300.1	Similar to Ralstonia solanacearum hypothetical protein rsc0782 or rs05056 SWALL:Q8Y1A8 (EMBL:AL646061) (248 aa) fasta scores: E(): 8.4e-32, 47.8% id in 205 aa; limited homology to cation transporters
YP_107301.2	contains unknown N-terminal domain/ metalloprotease C-terminal domain
YP_107302.1	Similar to Escherichia coli, and Escherichia coli O157:H7 phoH-like protein ybeZ or b0660 or z0809 or ecs0698 SWALL:PHOL_ECOLI (SWALL:P77349) (359 aa) fasta scores: E(): 1.3e-51, 53.46% id in 346 aa, and to Ralstonia solanacearum probable phoH-like protein rsc0530 or rs04938 SWALL:Q8Y207 (EMBL:AL646059) (325 aa) fasta scores: E(): 7.4e-72, 74.93% id in 355 aa, and to Neisseria meningitidis hypothetical protein Nma1056 nma1056 SWALL:Q9JV06 (EMBL:AL162755) (317 aa) fasta scores: E(): 1.7e-53, 54.14% id in 338 aa
YP_107303.1	catalyzes the formation of 2-methylthio-N6-(dimethylallyl)adenosine (ms(2)i(6)A) at position 37 in tRNAs that read codons beginning with uridine from N6-(dimethylallyl)adenosine (i(6)A)
YP_107304.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa3565 SWALL:Q9HY52 (EMBL:AE004777) (306 aa) fasta scores: E(): 9.4e-41, 40.41% id in 287 aa, and to Ralstonia solanacearum probable transcription regulator protein rsp0997 or rs02329 SWALL:Q8XR64 (EMBL:AL646082) (306 aa) fasta scores: E(): 3.7e-38, 37.71% id in 289 aa, and to Vibrio cholerae transcriptional regulator, lysR family vca0635 SWALL:Q9KLV6 (EMBL:AE004393) (313 aa) fasta scores: E(): 9e-35, 35.93% id in 295 aa
YP_107305.1	Similar to Streptomyces coelicolor  transmembrane efflux protein sco3915 or sch24.37 SWALL:Q9X8V1 (EMBL:AL049826) (404 aa) fasta scores: E(): 8.4e-76, 57.58% id in 389 aa, and to Pseudomonas aeruginosa probable MFS transporter pa4355 SWALL:Q9HW46 (EMBL:AE004851) (388 aa) fasta scores: E(): 1.1e-73, 56.18% id in 388 aa, and to Rhizobium loti  transmembrane efflux protein mlr2770 SWALL:Q98HP8 (EMBL:AP003000) (391 aa) fasta scores: E(): 4.7e-73, 56.12% id in 392 aa
YP_107306.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa2312 SWALL:Q9I1G3 (EMBL:AE004657) (193 aa) fasta scores: E(): 4.4e-32, 56.98% id in 186 aa, and to Streptomyces coelicolor transcriptional regulatory protein sco1312 or scbac36f5.23C SWALL:Q93IV8 (EMBL:AL592292) (201 aa) fasta scores: E(): 1.2e-11, 34.37% id in 192 aa, and to Bacillus halodurans hypothetical protein Bh2909 bh2909 SWALL:Q9K8U3 (EMBL:AP001517) (189 aa) fasta scores: E(): 2.4e-10, 31.18% id in 186 aa
YP_107307.1	Similar to Escherichia coli, and Escherichia coli O157:H7 3,4-dihydroxy-2-butanone 4-phosphate synthase ribB or htrP or b3041 or z4399 or ecs3929 SWALL:RIBB_ECOLI (SWALL:P24199) (217 aa) fasta scores: E(): 7.7e-44, 61.03% id in 213 aa, and to Ralstonia solanacearum probable 3,4-dihydroxy-2-butanone 4-phosphate synthase ribB or rsp1191 or rs04751 SWALL:Q8XQN1 (EMBL:AL646083) (227 aa) fasta scores: E(): 1.9e-50, 65.47% id in 223 aa, and to Vibrio cholerae 3,4-dihydroxy-2-butanone 4-phosphate synthase vca1060 SWALL:Q9KKP2 (EMBL:AE004431) (218 aa) fasta scores: E(): 2.8e-45, 63.5% id in 200 aa
YP_107308.1	Similar to Pseudomonas aeruginosa probable hydrolase pa0562 SWALL:Q9I5X4 (EMBL:AE004492) (224 aa) fasta scores: E(): 9.9e-33, 49.06% id in 214 aa, and to Xanthomonas campestris hydrolase xcc2720 SWALL:AAM41992 (EMBL:AE012385) (225 aa) fasta scores: E(): 1.8e-32, 49.52% id in 212 aa, and to Xanthomonas axonopodis hydrolase xac2883 SWALL:AAM37728 (EMBL:AE011930) (225 aa) fasta scores: E(): 2.3e-32, 48.57% id in 210 aa
YP_107309.1	Similar to Deinococcus radiodurans hypothetical protein Dr2437 SWALL:Q9RRQ1 (EMBL:AE002073) (278 aa) fasta scores: E(): 3.9e-10, 29.85% id in 278 aa, and to Streptomyces coelicolor  integral membrane protein sco1313 or scbac36f5.24 SWALL:Q93IV7 (EMBL:AL592292) (285 aa) fasta scores: E(): 1.3e-07, 27.91% id in 283 aa
YP_107310.1	Similar to Streptomyces coelicolor hypothetical protein Sco0993 or 2scg2.06 SWALL:Q9EX45 (EMBL:AL445963) (412 aa) fasta scores: E(): 6.2e-16, 28.35% id in 402 aa, and to Rhizobium loti fusion protein contains  ligase and probable arginosuccinate lyase msi203 SWALL:CAD31608 (EMBL:AL672113) (899 aa) fasta scores: E(): 1e-15, 26.36% id in 421 aa, and to Rhizobium loti hypothetical protein Mll5963 mll5963 SWALL:Q98AK8 (EMBL:AP003008) (408 aa) fasta scores: E(): 1.4e-15, 28.3% id in 325 aa
YP_107311.1	glutamine-hydrolyzing; Similar to Escherichia coli asparagine synthetase B [glutamine-hydrolyzing] asnB or b0674 SWALL:ASNB_ECOLI (SWALL:P22106) (553 aa) fasta scores: E(): 7.9e-21, 32.63% id in 524 aa, and to Lactococcus lactis asparagine synthetase B asnB or ll0352 SWALL:Q9CIK5 (EMBL:AE006272) (530 aa) fasta scores: E(): 4.7e-30, 30.04% id in 476 aa, and to Caenorhabditis elegans M02d8.4 protein m02d8.4 SWALL:Q21463 (EMBL:U41034) (567 aa) fasta scores: E(): 6e-28, 30.66% id in 525 aa
YP_107312.1	catalyzes the formation of 5-O-(1-carboxyvinyl)-3-phosphoshikimate from phosphoenolpyruvate and 3-phosphoshikimate in tryptophan biosynthesis
YP_107313.1	Similar to Pseudomonas sp. 3-phosphoshikimate 1-carboxyvinyltransferase aroA SWALL:AROA_PSES2 (SWALL:P56952) (449 aa) fasta scores: E(): 6.6e-08, 22.39% id in 460 aa, and to Methanosarcina mazei 3-phosphoshikimate 1-carboxyvinyltransferase mm1238 SWALL:AAM30934 (EMBL:AE013354) (430 aa) fasta scores: E(): 2.8e-14, 24.88% id in 442 aa, and to Methanosarcina acetivorans 3-phosphoshikimate 1-carboxyvinyltransferase aroa or ma4544 SWALL:Q8THH3 (EMBL:AE011175) (430 aa) fasta scores: E(): 2.9e-13, 25.57% id in 438 aa
YP_107314.1	Similar to Deinococcus radiodurans hypothetical protein Dr0033 SWALL:Q9RYB7 (EMBL:AE001867) (157 aa) fasta scores: E(): 5.1e-13, 41.6% id in 125 aa, and to Mycobacterium tuberculosis hypothetical protein Rv2704 rv2704 or mtcy05a6.25 or mt2777.1 SWALL:O07205 (EMBL:Z96072) (142 aa) fasta scores: E(): 1.4e-07, 35.93% id in 128 aa, and to Streptomyces coelicolor hypothetical protein sco2049 or sc4g6.18C SWALL:YK49_STRCO (SWALL:P16251) (134 aa) fasta scores: E(): 1.8e-07, 31.78% id in 129 aa
YP_107315.1	Similar to Thermus aquaticus glycerol facilitator glpF SWALL:Q93RA7 (EMBL:AB053202) (272 aa) fasta scores: E(): 7e-43, 50.64% id in 231 aa, and to Thermotoga maritima probable glycerol uptake facilitator protein GlpF or tm1429 SWALL:GLPF_THEMA (SWALL:Q9X1E3) (234 aa) fasta scores: E(): 1.1e-50, 56.83% id in 234 aa, and to Thermoanaerobacter tengcongensis glycerol uptake facilitator and related permeases GlpF or tte2003 SWALL:Q8R5R1 (EMBL:AE013151) (242 aa) fasta scores: E(): 2.3e-45, 52.11% id in 236 aa
YP_107316.1	Converts glycerol and ADP to glycerol-3-phosphate and ADP
YP_107317.1	in Escherichia coli this homodimeric enzyme is expressed under aerobic conditions; anaerobic expression is repressed by the arcAB system; converts sn-glycerol-3-phosphate and ubiquinone-8 to dihydroxy acetone phosphate and ubiquinol-8; associates with the cytoplasmic membrane
YP_107320.1	Similar to Pseudomonas aeruginosa glycerol-3-phosphate regulon repressor GlpR or pa3583 SWALL:GLPR_PSEAE (SWALL:Q51391) (251 aa) fasta scores: E(): 7.8e-46, 52.45% id in 244 aa, and to Xanthomonas axonopodis glycerol-3-phosphate regulon repressor GlpR or xac0361 SWALL:AAM35253 (EMBL:AE011662) (256 aa) fasta scores: E(): 1.1e-53, 58.16% id in 251 aa, and to Xanthomonas campestris glycerol-3-phosphate regulon repressor glpR or xcc0361 SWALL:AAM39680 (EMBL:AE012132) (259 aa) fasta scores: E(): 9.5e-53, 56.29% id in 254 aa
YP_107321.1	Similar to Ralstonia solanacearum gamma-glutamyltranspeptidase rsc2501 or rs01094 SWALL:Q8XWH3 (EMBL:AL646070) (552 aa) fasta scores: E(): 8.6e-156, 70.73% id in 557 aa, and to Deinococcus radiodurans cephalosporin acylase dr1524 SWALL:Q9RU70 (EMBL:AE001996) (535 aa) fasta scores: E(): 5.2e-90, 50.64% id in 547 aa, and to Bacillus halodurans cephalosporin acylase bh0867 SWALL:Q9KEI5 (EMBL:AP001510) (539 aa) fasta scores: E(): 3.7e-89, 49.36% id in 547 aa; possible alternative start site at codon 4
YP_107322.1	Similar to Ralstonia solanacearum hypothetical protein Rsc3135 or rs00468 SWALL:Q8XUQ1 (EMBL:AL646073) (284 aa) fasta scores: E(): 1.8e-54, 52.19% id in 274 aa
YP_107324.1	Similar to Escherichia coli  ATP-dependent RNA helicase RhlE or b0797 SWALL:RHLE_ECOLI (SWALL:P25888) (454 aa) fasta scores: E(): 7.1e-85, 64.73% id in 465 aa, and to Ralstonia solanacearum probable ATP-dependent RNA helicase rhlE1 or rsc0539 or rs06096 SWALL:Q8Y1Z8 (EMBL:AL646059) (540 aa) fasta scores: E(): 3.1e-97, 68.07% id in 498 aa
YP_107325.1	Similar to Acetobacter europaeus cytochrome c precursor AldF SWALL:O30327 (EMBL:Y08696) (444 aa) fasta scores: E(): 1.9e-44, 36.43% id in 398 aa, and to Pseudomonas aeruginosa probable c-type cytochrome pa4619 SWALL:Q9HVH2 (EMBL:AE004876) (415 aa) fasta scores: E(): 2.9e-55, 39.57% id in 427 aa, and to Pseudomonas aeruginosa probable cytochrome c pa4571 SWALL:Q9HVL3 (EMBL:AE004870) (675 aa) fasta scores: E(): 1.9e-49, 38.69% id in 398 aa
YP_107326.1	Similar to Thiobacillus ferrooxidans cytochrome c-552 precursor Cyc1 SWALL:C552_THIFE (SWALL:P74917) (230 aa) fasta scores: E(): 3.5e-07, 26.63% id in 229 aa, and to Pseudomonas aeruginosa probable cytochrome c pa2482 SWALL:Q9I100 (EMBL:AE004676) (217 aa) fasta scores: E(): 3.4e-15, 37.05% id in 170 aa, and to Ralstonia solanacearum  cytochrome c signal peptide protein rsc0197 or rs00629 SWALL:Q8Y2Y4 (EMBL:AL646058) (206 aa) fasta scores: E(): 6.3e-14, 37.71% id in 175 aa
YP_107327.1	Similar to Pseudomonas syringae copper resistance protein D copD SWALL:COPD_PSESF (SWALL:Q9KWM8) (311 aa) fasta scores: E(): 1.7e-06, 30.41% id in 263 aa, and to Ralstonia solanacearum probable copper resistance D transmembrane protein copD or rsp0659 or rs01790 SWALL:Q8XS22 (EMBL:AL646080) (309 aa) fasta scores: E(): 4.6e-08, 31.69% id in 306 aa, and to Xanthomonas campestris juglandis copper-resistance genes SWALL:Q56798 (EMBL:L19222) (307 aa) fasta scores: E(): 1.2e-06, 28.62% id in 283 aa
YP_107328.1	Similar to Rhizobium meliloti probable galactonate dehydratase dgoA or rb0492 or smb20510 SWALL:Q92W53 (EMBL:AL603643) (382 aa) fasta scores: E(): 3.3e-125, 78.27% id in 382 aa, and to Ralstonia solanacearum galactonate dehydratase dgoAB or rsc2751 or rs00103 SWALL:Q8XVS8 (EMBL:AL646071) (382 aa) fasta scores: E(): 4e-101, 64.92% id in 382 aa
YP_107329.1	Similar to Ralstonia solanacearum hypothetical protein Rsc3305 or rs02534 SWALL:Q8XU88 (EMBL:AL646074) (115 aa) fasta scores: E(): 4.9e-32, 63.15% id in 114 aa, and to Agrobacterium tumefaciens hypothetical protein atu2404 atu2404 or agr_c_4363 SWALL:Q8UCS9 (EMBL:AE009188) (118 aa) fasta scores: E(): 5e-21, 50.89% id in 112 aa, and to Xanthomonas axonopodis hypothetical protein Xac2795 xac2795 SWALL:AAM37640 (EMBL:AE011920) (132 aa) fasta scores: E(): 3.8e-19, 47.82% id in 115 aa
YP_107331.1	Similar to Mycobacterium tuberculosis hypothetical protein rv2577 or mt2654 or mtcy227.24C SWALL:YP77_MYCTU (SWALL:Q50644) (529 aa) fasta scores: E(): 1.5e-17, 39.55% id in 579 aa, and to Aspergillus ficuum acid phosphatase precursor aphA SWALL:Q12546 (EMBL:U18553) (614 aa) fasta scores: E(): 1.9e-06, 29.41% id in 204 aa, and to Lupinus albus acid phosphatase SWALL:Q9XJ24 (EMBL:AB023385) (638 aa) fasta scores: E(): 3.4e-06, 25.4% id in 370 aa
YP_107332.1	Similar to Xanthomonas campestris histidine kinase xcc1957 SWALL:AAM41246 (EMBL:AE012299) (408 aa) fasta scores: E(): 1.1e-42, 50.16% id in 297 aa, and to Xanthomonas axonopodis histidine kinase xac1991 SWALL:AAM36853 (EMBL:AE011834) (408 aa) fasta scores: E(): 1.3e-42, 49.49% id in 297 aa, and to Pseudomonas aeruginosa probable two-component sensor pa2571 SWALL:Q9I0R5 (EMBL:AE004685) (470 aa) fasta scores: E(): 1.4e-42, 46.93% id in 326 aa
YP_107333.1	Similar to Pseudomonas aeruginosa probable two-component response regulator pa2572 SWALL:Q9I0R4 (EMBL:AE004685) (447 aa) fasta scores: E(): 2.9e-47, 36.94% id in 425 aa, and to Vibrio cholerae response regulator vc1087 SWALL:Q9KT18 (EMBL:AE004189) (447 aa) fasta scores: E(): 9.8e-19, 32.33% id in 436 aa, and to Spirulina platensis adenylate cyclase cyaC SWALL:O32393 (EMBL:D49692) (1202 aa) fasta scores: E(): 4.7e-17, 38.02% id in 192 aa
YP_107334.1	Weakly similar to Pseudomonas aeruginosa hypothetical protein Pa2134 SWALL:Q9I1Y1 (EMBL:AE004641) (190 aa) fasta scores: E(): 0.002, 29.6% id in 152 aa; hits of low significance in the databases; alternative start site at codon 45
YP_107335.1	Similar to Escherichia coli aerotaxis receptor aer or air or b3072 SWALL:AER_ECOLI (SWALL:P50466) (506 aa) fasta scores: E(): 1.1e-73, 47.48% id in 516 aa, and to Ralstonia solanacearum probable aerotaxis sensor receptor aer or rsp1224 or rs03168 SWALL:Q8XQK0 (EMBL:AL646083) (514 aa) fasta scores: E(): 1.3e-103, 61.5% id in 517 aa, and to Yersinia pestis  methyl-accepting chemotaxis protein ypo1644 SWALL:Q8ZFP9 (EMBL:AJ414149) (526 aa) fasta scores: E(): 1e-86, 53.17% id in 519 aa
YP_107336.1	Similar to Burkholderia cepacia cholesterol oxidase ChoS SWALL:Q93RE1 (EMBL:AB051407) (582 aa) fasta scores: E(): 6.7e-158, 66.83% id in 579 aa, and to Pseudomonas aeruginosa hypothetical protein PA4140 SWALL:Q9HWP1 (EMBL:AE004830) (597 aa) fasta scores: E(): 4.3e-132, 56.02% id in 589 aa
YP_107337.1	Similar to Yersinia pestis  LysR-family transcriptional regulatory protein ypo2497 SWALL:Q8ZDQ9 (EMBL:AJ414152) (313 aa) fasta scores: E(): 1e-29, 39.68% id in 257 aa, and to Escherichia coli O157:H7 transcriptional regulator lysR-type yeaT or z2842 or ecs2508 SWALL:Q8XDS5 (EMBL:AE005402) (314 aa) fasta scores: E(): 5.7e-29, 40.66% id in 241 aa, and to Escherichia coli hypothetical transcriptional regulator YeaT yeaT or b1799 SWALL:YEAT_ECOLI (SWALL:P76250) (307 aa) fasta scores: E(): 1.8e-28, 40.24% id in 241 aa
YP_107338.1	catalyzes the selenophosphate-dependent transfer of selenium from selenophosphate for conversion of 2-thiouridine to 2-selenouridine at the wobble position in tRNA
YP_107340.1	Similar to Xylella fastidiosa nitrate ABC transporter ATP-binding protein xf0412 SWALL:Q9PG90 (EMBL:AE003892) (433 aa) fasta scores: E(): 1.2e-69, 52.6% id in 422 aa, and to Ralstonia solanacearum probable composite ATP-binding transmembrane ABC transporter protein rsc3372 or rs02647 SWALL:Q8XU22 (EMBL:AL646075) (449 aa) fasta scores: E(): 1.1e-57, 47.87% id in 424 aa, and to Pyrobaculum aerophilum taurine pae1066 SWALL:Q8ZXW3 (EMBL:AE009801) (254 aa) fasta scores: E(): 3.3e-31, 47.76% id in 224 aa
YP_107341.1	Similar to Xylella fastidiosa ABC transporter nitrate permease xf0411 SWALL:Q9PG91 (EMBL:AE003892) (584 aa) fasta scores: E(): 2.1e-123, 58.31% id in 583 aa, and to Ralstonia solanacearum  transmembrane ABC transporter protein rsc3371 or rs02646 SWALL:Q8XU23 (EMBL:AL646075) (586 aa) fasta scores: E(): 9.6e-115, 54.85% id in 556 aa, and to Sulfolobus solfataricus ABC transporter  sso2468 SWALL:Q97VY5 (EMBL:AE006845) (535 aa) fasta scores: E(): 1.6e-24, 24.09% id in 527 aa
YP_107342.1	Similar to Methanosarcina mazei hypothetical protein Mm1779 SWALL:AAM31475 (EMBL:AE013414) (226 aa) fasta scores: E(): 4.3e-41, 57.27% id in 213 aa, and to Mycobacterium tuberculosis hypothetical protein rv0571c rv0571c or mt0597 or mtv039.09C SWALL:O53768 (EMBL:AL021942) (451 aa) fasta scores: E(): 4.9e-40, 60.27% id in 219 aa, and to Agrobacterium tumefaciens hypothetical protein atu3651 atu3651 or agr_l_2363 SWALL:Q8U9S4 (EMBL:AE009293) (288 aa) fasta scores: E(): 3.2e-05, 31.13% id in 212 aa
YP_107343.1	catalyzes the formation of 5-phospho-alpha-D-ribose 1-diphosphate and nicotinate from nicotinate D-ribonucleotide and diphosphate
YP_107344.1	Similar to Anabaena sp. hypothetical protein All1995 all1995 SWALL:Q8YVI3 (EMBL:AP003587) (221 aa) fasta scores: E(): 5.2e-36, 52.8% id in 214 aa, and to Methanosarcina mazei hypothetical protein Mm1780 mm1780 SWALL:AAM31476 (EMBL:AE013414) (221 aa) fasta scores: E(): 2.3e-35, 50.47% id in 212 aa, and to Mycobacterium tuberculosis DNA sequence SWALL:Q50819 (EMBL:M93129) (385 aa) fasta scores: E(): 4e-34, 48.14% id in 243 aa
YP_107345.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc1476 or rs03830 SWALL:Q8XZC5 (EMBL:AL646064) (1035 aa) fasta scores: E(): 1.5e-175, 47.73% id in 1014 aa, and to Pseudomonas aeruginosa hypothetical protein Pa0788 pa0788 SWALL:Q9I5F0 (EMBL:AE004513) (1041 aa) fasta scores: E(): 1.1e-164, 46.06% id in 990 aa, and to Vibrio cholerae hypothetical protein Vc1321 vc1321 SWALL:Q9KSD7 (EMBL:AE004212) (1023 aa) fasta scores: E(): 5.9e-158, 44.92% id in 1004 aa
YP_107346.1	Similar to Acetobacter polyoxogenes, and Acetobacter europaeus alcohol dehydrogenase cytochrome c subunit precursor adhB SWALL:CYCA_ACEPO (SWALL:Q03318) (468 aa) fasta scores: E(): 2.7e-55, 44.49% id in 418 aa, and to Pseudomonas aeruginosa probable cytochrome c precursor pa2266 SWALL:Q9I1K7 (EMBL:AE004652) (439 aa) fasta scores: E(): 9.6e-56, 45.51% id in 424 aa
YP_107348.1	Similar to Rhizobium loti cytochrome c oxidase subunit I mll9630 SWALL:Q98P35 (EMBL:AP003017) (623 aa) fasta scores: E(): 4.7e-114, 49.91% id in 617 aa, and to Rhodobacter sphaeroides quinol oxidase subunit I QoxA SWALL:Q9Z605 (EMBL:AF111945) (825 aa) fasta scores: E(): 4.1e-101, 36.86% id in 898 aa, and to Rhizobium meliloti cytochrome c oxidase chain i protein rb0948 or smb21370 SWALL:Q92UY6 (EMBL:AL603645) (841 aa) fasta scores: E(): 4.3e-99, 36.39% id in 915 aa, and to Bacillus subtilis cytochrome c oxidase polypeptide I ctaD SWALL:COX1_BACSU (SWALL:P24010) (622 aa) fasta scores: E(): 5.4e-92, 42.45% id in 596 aa; possible pseudogene
YP_107349.1	Similar to Bacillus firmus cytochrome c oxidase polypeptide II precursor ctaC SWALL:COX2_BACFI (SWALL:Q04441) (342 aa) fasta scores: E(): 3e-28, 34.07% id in 314 aa, and to Rhizobium loti cytochrome oxidase subunit II mll9631 SWALL:Q98P34 (EMBL:AP003017) (330 aa) fasta scores: E(): 1.6e-39, 43.77% id in 297 aa, and to Rhizobium meliloti  cytochrome c oxidase chain II protein rb0946 or smb21368 SWALL:Q92UY8 (EMBL:AL603645) (327 aa) fasta scores: E(): 2e-35, 40.36% id in 327 aa; Possible alternative start at codon 70
YP_107350.1	catalyzes the formation of acetate from pyruvate
YP_107351.1	Similar to Pseudomonas putida mandelate racemase mdlA SWALL:MANR_PSEPU (SWALL:P11444) (359 aa) fasta scores: E(): 4.1e-16, 28.42% id in 380 aa, and to Streptomyces coelicolor  racemase sco7415 or sc6d11.11 SWALL:Q9L144 (EMBL:AL158061) (385 aa) fasta scores: E(): 1.4e-64, 49.04% id in 367 aa, and to Brucella melitensis mandelate racemase bmei1712 SWALL:Q8YF15 (EMBL:AE009605) (372 aa) fasta scores: E(): 2.4e-30, 36% id in 350 aa
YP_107354.1	Similar to Burkholderia cepacia glucose dehydrogenase gdhalphA SWALL:AAN39686 (EMBL:AF430844) (539 aa) fasta scores: E(): 5.8e-30, 29.76% id in 541 aa, and to Xanthomonas axonopodis 2-keto-gluconate dehydrogenase xac2128 SWALL:Q8PKP1 (EMBL:AE011848) (508 aa) fasta scores: E(): 5.4e-62, 41.53% id in 520 aa, and to Halobacterium sp. Vng1035C vng1035C SWALL:Q9HQR8 (EMBL:AE005037) (529 aa) fasta scores: E(): 2.8e-44, 35.97% id in 531 aa
YP_107355.1	Similar to Ralstonia solanacearum hypothetical protein rsp0747 or rs01961 SWALL:Q8XRT4 (EMBL:AL646080) (616 aa) fasta scores: E(): 1.6e-58, 45.23% id in 619 aa, and to Rhizobium leguminosarum ImpG SWALL:Q93EC7 (EMBL:AF361470) (593 aa) fasta scores: E(): 1.2e-25, 31.75% id in 611 aa, and to Pseudomonas aeruginosa hypothetical protein Pa0088 SWALL:Q9I744 (EMBL:AE004447) (619 aa) fasta scores: E(): 1.7e-25, 30.9% id in 631 aa
YP_107356.1	Similar to Pseudomonas sp. penicillin acylase II precursor AcyII SWALL:PAC2_PSES3 (SWALL:P15558) (773 aa) fasta scores: E(): 4.1e-30, 29.28% id in 782 aa, and to Xanthomonas campestris penicillin acylase II AcyII or xcc1392 SWALL:AAM40690 (EMBL:AE012238) (828 aa) fasta scores: E(): 5.1e-43, 40.81% id in 838 aa, and to Xanthomonas axonopodis penicillin acylase II acyII or xac1437 SWALL:AAM36308 (EMBL:AE011775) (569 aa) fasta scores: E(): 1e-41, 41.78% id in 572 aa; possible alternative start site at codon 71
YP_107357.1	Similar to previously sequenced Burkholderia cepacia  transcriptional regulator CeoR ceoR SWALL:Q8VL17 (EMBL:AY008288) (334 aa) fasta scores: E(): 1.1e-81, 64.39% id in 323 aa, and to Ralstonia solanacearum probable transcription regulator protein rsp1110 or rs02618 SWALL:Q8XQV8 (EMBL:AL646082) (315 aa) fasta scores: E(): 1.8e-59, 49.33% id in 300 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa2877 SWALL:Q9HZX0 (EMBL:AE004714) (297 aa) fasta scores: E(): 2.1e-49, 45.57% id in 294 aa
YP_107358.1	Similar to Rhodobacter sphaeroides DMSO/TMAO-sensor kinase dorS SWALL:O30740 (EMBL:AF016236) (815 aa) fasta scores: E(): 4.6e-25, 33.24% id in 385 aa, and to Caulobacter crescentus sensor histidine kinase / response regulator cc0723 SWALL:Q9AA83 (EMBL:AE005747) (591 aa) fasta scores: E(): 1.6e-27, 30.34% id in 412 aa, and to Xanthomonas campestris two-component system sensor protein xcc2360 SWALL:AAM41638 (EMBL:AE012344) (1364 aa) fasta scores: E(): 3.7e-26, 29.7% id in 404 aa
YP_107359.1	C-terminus is similar to the C-terminal region of Agrobacterium tumefaciens hypothetical protein atu3496 or agr_l_2662 SWALL:Q8UA78 (EMBL:AE009279) (168 aa) fasta scores: E(): 4.3e-11, 34.78% id in 138 aa. Weakly similar to to Pseudomonas aeruginosa hypothetical protein pa2869 SWALL:Q9HZX7 (EMBL:AE004713) (162 aa) fasta scores: E(): 2.8e-07, 28.48% id in 158 aa, and to Vibrio cholerae hypothetical protein vc1933 SWALL:Q9KQR5 (EMBL:AE004269) (156 aa) fasta scores: E(): 7e-06, 27.04% id in 159 aa, and to Vibrio cholerae hypothetical protein Vca0075 vca0075 SWALL:Q9KN90 (EMBL:AE004350) (155 aa) fasta scores: E(): 9.5e-06, 28.85% id in 149 aa
YP_107360.1	From codon 189-321 similar to Xanthomonas axonopodis two-component system regulatory protein colR or xac1221 SWALL:AAM36093 (EMBL:AE011752) (238 aa) fasta scores: E(): 0.0042, 24.21% id in 128 aa, and to Ralstonia solanacearum probable two-component system response regulator transcription regulator protein rsc1073 or rs04004 SWALL:Q8Y0H1 (EMBL:AL646062) (237 aa) fasta scores: E(): 0.0087, 30.46% id in 128 aa
YP_107361.1	Doubtful CDS. No significant database matches
YP_107362.1	No significant hits in the databases
YP_107363.1	Doubtful CDS. No significant hits in the databases
YP_107364.1	Weakly similar to Agrobacterium tumefaciens hypothetical protein atu5018 or agr_pat_24 SWALL:Q8UKT1 (EMBL:AE008927) (288 aa) fasta scores: E(): 0.00011, 27.24% id in 290 aa
YP_107365.1	Doubtful CDS. No significant database matches
YP_107367.1	Similar to Ralstonia solanacearum hypothetical protein rsc2611 or rs00860 SWALL:Q8XW64 (EMBL:AL646071) (187 aa) fasta scores: E(): 5.2e-12, 33.33% id in 183 aa, and to Anabaena sp. hypothetical protein all2200 SWALL:Q8YUY1 (EMBL:AP003588) (186 aa) fasta scores: E(): 8.2e-12, 32.54% id in 169 aa
YP_107368.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein rsc2612 or rs00912 SWALL:Q8XW63 (EMBL:AL646071) (282 aa) fasta scores: E(): 7e-12, 26.29% id in 270 aa, and to Streptomyces coelicolor  regulatory protein sco3291 or sce15.08 SWALL:Q9X883 (EMBL:AL049707) (477 aa) fasta scores: E(): 2.3e-07, 26.53% id in 196 aa
YP_107369.1	Similar to Vibrio cholerae hypothetical protein vca0396 SWALL:Q9KMG2 (EMBL:AE004375) (276 aa) fasta scores: E(): 1.4e-43, 44.2% id in 276 aa
YP_107370.1	Similar to Xanthomonas axonopodis integrase xac3298 SWALL:AAM38142 (EMBL:AE011975) (505 aa) fasta scores: E(): 9.7e-19, 28.48% id in 488 aa, and to Xanthomonas axonopodis phage-related integrase int or xac1510 SWALL:AAM36380 (EMBL:AE011783) (510 aa) fasta scores: E(): 3.2e-13, 28.09% id in 363 aa, and to Escherichia coli O157:H7  integrase z5878 or ecs5242 SWALL:Q8XC99 (EMBL:AE005658) (649 aa) fasta scores: E(): 6.8e-13, 27.9% id in 319 aa
YP_107375.1	No significant database matches to the full length CDS. N-terminal region is similar to Escherichia coli O157:H7 hypothetical protein z0325 or ecs0290 SWALL:Q8X7K6 (EMBL:AE005203) (138 aa) fasta scores: E(): 7.4e-11, 37.98% id in 129 aa, and the C-terminal region is similar to Escherichia coli O157:H7 hypothetical protein z0326 or ecs0291 SWALL:Q8X7K5 (EMBL:AE005203) (205 aa) fasta scores: E(): 7e-12, 31.25% id in 192 aa. CDS is a possible fusion protein
YP_107376.1	Similar to Escherichia coli O157:H7 hypothetical protein z0327 or ecs0292 SWALL:Q8X7K4 (EMBL:AE005203) (152 aa) fasta scores: E(): 6.8e-05, 22.44% id in 147 aa
YP_107377.1	C-terminal region is similar to Escherichia coli O157:H7 hypothetical protein z0331 or ecs0295 SWALL:Q8X7J2 (EMBL:AE005203) (188 aa) fasta scores: E(): 4.3e-09, 27.52% id in 178 aa
YP_107381.1	Similar to Salmonella enterica, and Salmonella paratyphi-A regulatory protein SbaIC SWALL:Q9EZ27 (EMBL:AF508974) (78 aa) fasta scores: E(): 1.8e-08, 49.33% id in 75 aa, and to Proteus vulgaris transcriptional activator for bicistronic pvuIICR operon PvuIIC SWALL:Q52622 (EMBL:AF305615) (84 aa) fasta scores: E(): 6e-06, 41.25% id in 80 aa, and to Escherichia coli O157:H7 z5888 protein z5888 or ecs5252 SWALL:Q8XC87 (EMBL:AE005659) (154 aa) fasta scores: E(): 6.4e-06, 40.26% id in 77 aa
YP_107383.1	Similar to Pseudomonas aeruginosa hypothetical protein pa0544 SWALL:Q9I5Z2 (EMBL:AE004490) (247 aa) fasta scores: E(): 4e-32, 40% id in 255 aa, and to Microscilla sp. PRE1 ms153 SWALL:Q93P78 (EMBL:AF339846) (253 aa) fasta scores: E(): 1.5e-10, 28.62% id in 248 aa, and to Microscilla sp. PRE1 ms158, hypothetical protein SWALL:Q93P73 (EMBL:AF339846) (252 aa) fasta scores: E(): 5.7e-09, 27.12% id in 247 aa
YP_107384.1	No significant database matches. Similar to BPSL0551, 75.904% identity (76.829% ungapped) in 166 aa overlap
YP_107387.1	Similar to Escherichia coli RNA 2'-phosphotransferase KptA or b4331 SWALL:KPTA_ECOLI (SWALL:P39380) (184 aa) fasta scores: E(): 7.1e-26, 45.93% id in 172 aa, and to Streptomyces coelicolor probable RNA 2'-phosphotransferase sco3953 or scd78.20C SWALL:KPTA_STRCO (SWALL:Q9ZBX9) (182 aa) fasta scores: E(): 5.9e-37, 56.89% id in 174 aa
YP_107388.1	Similar to Bacteroides nodosus  DEAH ATP-dependent helicase SWALL:O32494 (EMBL:U20246) (965 aa) fasta scores: E(): 2.4e-28, 28.84% id in 780 aa, and to Xanthomonas campestris helicase xcc0524 SWALL:AAM39840 (EMBL:AE012150) (967 aa) fasta scores: E(): 1.8e-11, 25.36% id in 962 aa, and to Halobacterium sp. similar to Escherichia coli vng5141g or vng6139G SWALL:O52003 (EMBL:AF016485) (979 aa) fasta scores: E(): 1.9e-10, 27.33% id in 995 aa. Possible alternative translational start site
YP_107389.1	Weakly similar to Borrelia burgdorferi hypothetical protein bbh09 SWALL:O50667 (EMBL:AE000784) (1278 aa) fasta scores: E(): 5.5e-09, 23.87% id in 490 aa, and Borrelia burgdorferi hypothetical protein bbe02 SWALL:O50698 (EMBL:AE000785) (1277 aa) fasta scores: E(): 1.1e-08, 23.82% id in 491 aa
YP_107390.1	Similar to Methanosarcina mazei superfamily II DNA and RNA helicase mm0276 SWALL:AAM29972 (EMBL:AE013252) (1275 aa) fasta scores: E(): 2.2e-29, 29.29% id in 1205 aa, and to Methanobacterium thermoautotrophicum hypothetical protein MTH497 SWALL:O26597 (EMBL:AE000833) (1235 aa) fasta scores: E(): 4.5e-15, 29.16% id in 1310 aa
YP_107391.1	Weakly similar to Methanobacterium thermoautotrophicum hypothetical protein mth498 SWALL:O26598 (EMBL:AE000833) (578 aa) fasta scores: E(): 9e-26, 26.06% id in 637 aa, and Methanosarcina mazei hypothetical protein mm0275 SWALL:AAM29971 (EMBL:AE013252) (600 aa) fasta scores: E(): 8e-07, 25.03% id in 643 aa
YP_107392.1	No significant database matches to the full length CDS. C-terminal region is weakly similar to internal region of Xanthomonas campestris cardiolipin synthase xcc2706 SWALL:Q8P7A5 (EMBL:AE012383) (520 aa) fasta scores: E(): 0.048, 31.94% id in 144 aa, and to Yersinia enterocolitica  endonuclease Nuc SWALL:Q9ZA69 (EMBL:AF102990) (180 aa) fasta scores: E(): 0.79, 28.99% id in 169 aa
YP_107393.1	Similar to Xanthomonas campestris hypothetical protein xcc1600 SWALL:AAM40894 (EMBL:AE012261) (404 aa) fasta scores: E(): 3.9e-52, 37.92% id in 385 aa, and to Agrobacterium tumefaciens Ti plasmid hypothetical protein Ymg SWALL:O52296 (EMBL:AF242881) (388 aa) fasta scores: E(): 3.6e-09, 27.12% id in 424 aa, and to Vibrio cholerae hypothetical protein vc0492 SWALL:Q9KUM3 (EMBL:AE004135) (388 aa) fasta scores: E(): 5.3e-07, 20.9% id in 397 aa
YP_107394.1	Weakly similar to Agrobacterium tumefaciens Ti plasmid hypothetical protein Ymf SWALL:O52295 (EMBL:AF242881) (168 aa) fasta scores: E(): 0.43, 28.14% id in 167 aa; No significant database matches
YP_107395.1	Similar to Xanthomonas campestris plasmid-related protein xcc1599 SWALL:AAM40893 (EMBL:AE012261) (659 aa) fasta scores: E(): 9.2e-77, 36.67% id in 649 aa, and to Agrobacterium tumefaciens Ti plasmid hypothetical protein Yme SWALL:O52294 (EMBL:AF242881) (660 aa) fasta scores: E(): 2.1e-40, 28.83% id in 652 aa, and to Vibrio cholerae hypothetical protein vc0490 SWALL:Q9KUM5 (EMBL:AE004135) (653 aa) fasta scores: E(): 1.8e-29, 26.52% id in 671 aa
YP_107396.1	No significant hits in the databases. Possible alternative start at codon 10
YP_107397.1	Possible gene remnant. From codon 361 similar to Xanthomonas campestris phage-related integrase Int or xcc1642 SWALL:Q8PA51 (EMBL:AE012265) (182 aa) fasta scores: E(): 0.029, 32.39% id in 142 aa, and to Xanthomonas axonopodis integrase xac1107 SWALL:Q8PNG3 (EMBL:AE011739) (485 aa) fasta scores: E(): 0.088, 27.41% id in 383 aa
YP_107398.1	Similar to Caulobacter crescentus major facilitator family transporter cc0980 SWALL:Q9A9K0 (EMBL:AE005775) (567 aa) fasta scores: E(): 1.3e-141, 66.97% id in 548 aa, and to Bradyrhizobium japonicum integral inner membrane metabolite transport protein MtbA SWALL:Q9JMW8 (EMBL:U33883) (555 aa) fasta scores: E(): 3.5e-115, 58.71% id in 562 aa, and to Ralstonia solanacearum  sugar transporter transmembrane protein rsc0547 or rs04914 SWALL:Q8Y1Z0 (EMBL:AL646059) (567 aa) fasta scores: E(): 1.3e-113, 71.4% id in 556 aa
YP_107399.1	Similar to Ralstonia solanacearum probable transmembrane sensor histidine kinase transcription regulator protein rsc0549 or rs04917 SWALL:Q8Y1Y8 (EMBL:AL646059) (513 aa) fasta scores: E(): 3.9e-104, 58.77% id in 507 aa, and to Ralstonia solanacearum probable two-component transmembrane sensor kinase transcription regulator protein rsc1735 or rs02923 SWALL:Q8XYM3 (EMBL:AL646066) (471 aa) fasta scores: E(): 2e-49, 37.69% id in 451 aa, and to Rhizobium loti two-component system, sensor protein mll7952 SWALL:Q984L4 (EMBL:AP003013) (452 aa) fasta scores: E(): 9.4e-48, 38.28% id in 444 aa
YP_107400.1	Similar to Bordetella pertussis transcriptional regulatory protein,  BasR SWALL:Q9S3M3 (EMBL:AJ132741) (223 aa) fasta scores: E(): 3.2e-37, 53.6% id in 222 aa, and to Ralstonia solanacearum probable response regulator transcription regulator protein rsc0550 or rs04916 SWALL:Q8Y1Y7 (EMBL:AL646059) (232 aa) fasta scores: E(): 2.1e-63, 78.94% id in 228 aa, and to Agrobacterium tumefaciens two component response regulator TctD SWALL:Q8UCL7 (EMBL:AE009193) (245 aa) fasta scores: E(): 1.7e-37, 51.81% id in 220 aa
YP_107401.1	catalyzes the hydrolysis of ATP in the presence of single-stranded DNA, the ATP-dependent uptake of single-stranded DNA by duplex DNA, and the ATP-dependent hybridization of homologous single-stranded DNAs
YP_107402.1	binds RecA and inhibits RecA-mediated DNA strand exchange and ATP hydrolysis and coprotease activities
YP_107403.1	Similar to Ralstonia solanacearum hypothetical protein rsc0553 or rs04912 SWALL:Q8Y1Y4 (EMBL:AL646059) (208 aa) fasta scores: E(): 4.5e-48, 60.51% id in 195 aa; alternative start site at codon 11
YP_107404.1	catalyzes the interconversion of succinyl-CoA and succinate
YP_107405.1	Catalyzes the only substrate-level phosphorylation in the TCA cycle
YP_107406.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa1170 pa1170 SWALL:Q9I4G7 (EMBL:AE004547) (244 aa) fasta scores: E(): 3.1e-40, 54.05% id in 222 aa, and to Ralstonia solanacearum hypothetical transmembrane protein Rsc0556 rsc0556 or rs04909 SWALL:Q8Y1Y1 (EMBL:AL646060) (232 aa) fasta scores: E(): 1e-36, 48.66% id in 224 aa, and to Ralstonia solanacearum probable transmembrane protein rsc0949 or rs04438 SWALL:Q8Y0U4 (EMBL:AL646061) (230 aa) fasta scores: E(): 3.2e-28, 42.24% id in 232 aa
YP_107407.1	Similar to Ralstonia solanacearum type 4 fimbrial pilin signal peptide protein pilA or rsc0558 or rs04907 SWALL:Q8Y1X9 (EMBL:AL646060) (168 aa) fasta scores: E(): 8.6e-15, 45.9% id in 183 aa, and to Ralstonia solanacearum probable type 4 fimbrial pilin signal peptide protein pilA1 or rsc0557 or rs04908 SWALL:Q8Y1Y0 (EMBL:AL646060) (173 aa) fasta scores: E(): 1.2e-19, 46.89% id in 177 aa, and to Xanthomonas campestris pilin xcc3098 SWALL:AAM42369 (EMBL:AE012425) (144 aa) fasta scores: E(): 3.8e-10, 40% id in 145 aa
YP_107408.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein Rsc0559 rsc0559 or rs04906 SWALL:Q8Y1X8 (EMBL:AL646060) (569 aa) fasta scores: E(): 3.4e-42, 33.27% id in 526 aa, and to Neisseria meningitidis possible integral membrane protein nma0800 SWALL:Q9JVK5 (EMBL:AL162754) (604 aa) fasta scores: E(): 1.1e-14, 23.06% id in 594 aa, and to Neisseria meningitidis hypothetical protein Nmb0596 nmb0596 SWALL:Q9K0K0 (EMBL:AE002415) (604 aa) fasta scores: E(): 1.4e-14, 23.07% id in 598 aa
YP_107409.1	Similar to Yersinia pestis  exported protein ypo0406 SWALL:Q8ZIT2 (EMBL:AJ414142) (163 aa) fasta scores: E(): 4e-07, 35.15% id in 165 aa; Hits of low significance in the database; upstream repeat region (cggacaccggacac)3 and (catcgga)3
YP_107410.1	Weakly similar to the C-terminal region of Ralstonia solanacearum probable TonB transmembrane protein rsc1963 or rs03537 SWALL:Q8XY00 (EMBL:AL646067) (221 aa) fasta scores: E(): 0.0082, 26.92% id in 104 aa; Hits of low significance in the databases
YP_107411.1	MoaC; along with MoaA is involved in conversion of a guanosine derivative into molybdopterin precursor Z; involved in molybdenum cofactor biosynthesis
YP_107412.1	Similar to Ralstonia solanacearum hypothetical signal peptide protein rsc0561 or rs04904 SWALL:Q8Y1X6 (EMBL:AL646060) (561 aa) fasta scores: E(): 1.5e-79, 49.27% id in 550 aa. C-terminal region is similar to Pseudomonas aeruginosa hypothetical protein pa1005 SWALL:Q9I4W8 (EMBL:AE004533) (477 aa) fasta scores: E(): 9.1e-33, 34.7% id in 487 aa. Possible alternative translational start site
YP_107413.1	Similar to Ralstonia solanacearum hypothetical protein rsc0562 or rs04903 SWALL:Q8Y1X5 (EMBL:AL646060) (195 aa) fasta scores: E(): 1.8e-34, 50.99% id in 202 aa; downstream repeat region(acagcacaa)3
YP_107414.1	Similar to Ralstonia solanacearum hypothetical protein rsc0563 or rs04902 SWALL:Q8Y1X4 (EMBL:AL646060) (371 aa) fasta scores: E(): 1.5e-76, 58.43% id in 332 aa, and to Neisseria meningitidis hypothetical protein nmb0276 SWALL:Q9K191 (EMBL:AE002384) (318 aa) fasta scores: E(): 3.2e-44, 47.66% id in 321 aa, and to Neisseria meningitidis hypothetical protein nma2211 SWALL:Q9JSN5 (EMBL:AL162758) (318 aa) fasta scores: E(): 3.7e-44, 47.17% id in 318 aa
YP_107415.1	Similar to Ralstonia solanacearum hypothetical protein rsc0564 or rs04901 SWALL:Q8Y1X3 (EMBL:AL646060) (146 aa) fasta scores: E(): 2.4e-19, 43.75% id in 144 aa
YP_107416.1	Previously sequenced as Burkholderia pseudomallei heptosyl transferase WaaF SWALL:Q9ZFN3 (EMBL:AF097748) (346 aa) fasta scores: E(): 6.5e-139, 99.42% id in 346 aa. Similar to Escherichia coli ADP-heptose--LPS heptosyltransferase II RfaF or Waaf SWALL:RFAF_ECOLI (SWALL:P37692) (348 aa) fasta scores: E(): 1.8e-49, 44.03% id in 352 aa
YP_107417.1	Similar to Ralstonia solanacearum hypothetical protein rsc0566 or rs04899 SWALL:Q8Y1X1 (EMBL:AL646060) (65 aa) fasta scores: E(): 6.7e-12, 57.62% id in 59 aa, and to Neisseria meningitidis hypothetical protein nmb0542 SWALL:Q9K0P3 (EMBL:AE002410) (67 aa) fasta scores: E(): 4.1e-07, 44.06% id in 59 aa
YP_107418.1	catalyzes the transamination of the branched-chain amino acids to their respective alpha-keto acids
YP_107419.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein rsc0568 or rs04897 SWALL:Q8Y1W9 (EMBL:AL646060) (265 aa) fasta scores: E(): 2.7e-49, 59.18% id in 245 aa. Weakly similar to Ralstonia solanacearum hypothetical transmembrane protein rsc0513 or rs04992 SWALL:Q8Y223 (EMBL:AL646059) (242 aa) fasta scores: E(): 3.5e-15, 28.2% id in 234 aa
YP_107420.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0569 or rs04896 SWALL:Q8Y1W8 (EMBL:AL646060) (107 aa) fasta scores: E(): 8.6e-16, 50.47% id in 105 aa
YP_107421.1	Converts 3-phospho-D-glycerate to 3-phospho-D-glyceroyl phosphate during the glycolysis pathway
YP_107422.1	catalyzes the formation of phosphoenolpyruvate from pyruvate
YP_107423.1	class II aldolase; catalyzes the reversible aldol condensation of dihydroxyacetonephosphate and glyceraldehyde 3-phosphate in the Calvin cycle, glycolysis and gluconeogenesis
YP_107424.1	catalyzes the formation of (S)-2-(5-amino-1-(5-phospho-D-ribosyl)imidazole-4- carboxamido)succinate from 5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxylate and L-aspartate in purine biosynthesis; SAICAR synthase
YP_107425.1	Similar to Bacillus subtilis phosphoribosylaminoimidazole carboxylase catalytic subunit PurE SWALL:PUR6_BACSU (SWALL:P12044) (162 aa) fasta scores: E(): 1.2e-32, 67.58% id in 145 aa, and to Ralstonia solanacearum probable phosphoribosylaminoimidazole carboxylase catalytic subunit protein rsc0575 or rs04890 SWALL:Q8Y1W2 (EMBL:AL646060) (169 aa) fasta scores: E(): 6.3e-42, 74.07% id in 162 aa
YP_107426.1	With PurE catalyzes the conversion of aminoimidazole ribonucleotide to carboxyaminoimidazole ribonucleotide in the de novo purine nucleotide biosynthetic pathway
YP_107427.1	Similar to Ralstonia solanacearum hypothetical protein rsc0577 or rs04888 SWALL:Q8Y1W0 (EMBL:AL646060) (336 aa) fasta scores: E(): 3e-68, 64.16% id in 346 aa, and to Thermomonospora fusca hypothetical protein SWALL:Q9XCD2 (EMBL:AF144563) (335 aa) fasta scores: E(): 4.4e-41, 49.24% id in 331 aa
YP_107428.1	Similar to Ralstonia solanacearum  lipase / esterase rsc0580 or rs04885 SWALL:Q8Y1V9 (EMBL:AL646060) (347 aa) fasta scores: E(): 0.00034, 44.07% id in 363 aa. C-terminal region is similar to the N-terminal region of Acidiphilium sp. AIU409 esterase estA SWALL:Q9WXJ8 (EMBL:AB026254) (627 aa) fasta scores: E(): 0.00055, 29.79% id in 339 aa
YP_107429.1	Similar to Caulobacter crescentus hypothetical protein cc1444 SWALL:Q9A8B0 (EMBL:AE005819) (300 aa) fasta scores: E(): 6e-41, 40.79% id in 277 aa, and to Rhizobium loti hypothetical protein mll1065 SWALL:Q98LE0 (EMBL:AP002996) (317 aa) fasta scores: E(): 7.1e-40, 43.38% id in 272 aa; Upstream repeat region (cggcgagggaaacggcgagggaaacggcgagggaaa)3
YP_107430.1	Weakly similar to Escherichia coli penicillin-binding protein 4 precursor DacB or b3182 SWALL:PBP4_ECOLI (SWALL:P24228) (477 aa) fasta scores: E(): 2.3e-23, 26.06% id in 422 aa. Similar to Ralstonia solanacearum probable D-alanyl-D-alanine carboxypeptidase signal peptide protein rsc0584 or rs04879 SWALL:Q8Y1V5 (EMBL:AL646060) (514 aa) fasta scores: E(): 1.3e-86, 54.25% id in 494 aa; Downstream repeat region (cggcgagggaaacggcgagggaaacggcgagggaaa)3
YP_107431.1	Two-component regulatory system family, response regulator protein. Similar to Escherichia coli transcriptional regulatory protein QseB SWALL:QSEB_ECOLI (SWALL:P52076) (219 aa) fasta scores: E(): 9.3e-39, 53.27% id in 214 aa, and to Ralstonia solanacearum probable response regulator transcription regulator protein rsc3404 or rs01713 SWALL:Q8XTZ1 (EMBL:AL646075) (221 aa) fasta scores: E(): 2.9e-46, 60.73% id in 219 aa
YP_107432.1	Similar to Escherichia coli sensor protein QseC SWALL:QSEC_ECOLI (SWALL:P40719) (449 aa) fasta scores: E(): 4.1e-30, 31.04% id in 451 aa, and to Ralstonia solanacearum probable transmembrane two-component sensor kinase transcription regulator protein rsp1553 or rs02109 SWALL:Q8XPT4 (EMBL:AL646085) (438 aa) fasta scores: E(): 3e-69, 50.22% id in 438 aa
YP_107433.1	Similar to Pseudomonas aeruginosa serine protease MucD or pa0766 SWALL:Q57155 (EMBL:U49151) (474 aa) fasta scores: E(): 1.8e-70, 47.43% id in 468 aa, and to Ralstonia solanacearum probable protease signal peptide protein rsp1552 or rs02108 SWALL:Q8XPT5 (EMBL:AL646085) (490 aa) fasta scores: E(): 2.4e-89, 58.99% id in 478 aa
YP_107434.1	Similar to Ralstonia solanacearum  signal peptide protein rsc1315 or rs02837 SWALL:Q8XZT0 (EMBL:AL646063) (141 aa) fasta scores: E(): 3.6e-06, 33.57% id in 137 aa
YP_107435.1	Similar to Ralstonia solanacearum hypothetical protein rsc0235 or rs00667 SWALL:Q8Y2U7 (EMBL:AL646058) (118 aa) fasta scores: E(): 4.1e-11, 40.9% id in 110 aa, and to Rhizobium meliloti hypothetical protein rb0957 rb0957 or smb21379 SWALL:Q92UX8 (EMBL:AL603645) (124 aa) fasta scores: E(): 7.2e-10, 39.28% id in 112 aa
YP_107436.1	Hits of low significance from the databases. Weakly similar to Ralstonia solanacearum probable transmembrane protein rsc1464 or rs03843 SWALL:Q8XZD7 (EMBL:AL646064) (213 aa) fasta scores: E(): 0.0012, 30.25% id in 238 aa
YP_107437.1	Similar to Escherichia coli potential acrAB operon repressor AcrR SWALL:ACRR_ECOLI (SWALL:P34000) (215 aa) fasta scores: E(): 1.2e-22, 38.75% id in 209 aa, and to Ralstonia solanacearum  acrAB operon repressor transcription regulator protein rsc0012 or rs01834 SWALL:Q8Y3G8 (EMBL:AL646057) (219 aa) fasta scores: E(): 6e-34, 47.84% id in 209 aa
YP_107438.1	Similar to Escherichia coli, and Escherichia coli O157:H7 acriflavine resistance protein A precursor acrA or MtcA or Lir SWALL:ACRA_ECOLI (SWALL:P31223) (397 aa) fasta scores: E(): 5.5e-60, 53.76% id in 385 aa, and to Ralstonia solanacearum probable acriflavin resistance lipoprotein A precursor rsc0011 or rs01833 SWALL:Q8Y3G9 (EMBL:AL646057) (398 aa) fasta scores: E(): 6.6e-61, 55.22% id in 402 aa
YP_107439.1	Similar to Escherichia coli acriflavine resistance protein B AcrB or AcrE or b0462 SWALL:ACRB_ECOLI (SWALL:P31224) (1049 aa) fasta scores: E(): 0, 66.63% id in 1049 aa, and to Klebsiella pneumoniae AcrB protein SWALL:Q93K40 (EMBL:AJ318073) (1048 aa) fasta scores: E(): 0, 66.79% id in 1048 aa
YP_107440.1	Similar to Pseudomonas aeruginosa outer membrane protein OprM precursor pa0427 SWALL:OPRM_PSEAE (SWALL:Q51487) (485 aa) fasta scores: E(): 4.1e-85, 55.67% id in 476 aa, and to Xanthomonas axonopodis outer membrane protein xac2842 SWALL:AAM37687 (EMBL:AE011925) (503 aa) fasta scores: E(): 5.8e-84, 53.72% id in 497 aa
YP_107441.1	Similar to Bacillus subtilis xanthine permease PbuX SWALL:PBUX_BACSU (SWALL:P42086) (438 aa) fasta scores: E(): 3.3e-72, 48.67% id in 415 aa, and to Escherichia coli purine permease YgfU or b2888 SWALL:YGFU_ECOLI (SWALL:Q46821) (482 aa) fasta scores: E(): 9.1e-97, 59.03% id in 437 aa
YP_107442.1	Similar to Escherichia coli xylulose kinase XylB or b3564 SWALL:XYLB_ECOLI (SWALL:P09099) (484 aa) fasta scores: E(): 2.8e-24, 34.3% id in 481 aa, and to Rhizobium meliloti  sugar kinase r02569 or smc02341 SWALL:Q92MP4 (EMBL:AL591791) (477 aa) fasta scores: E(): 2.7e-37, 41.5% id in 477 aa
YP_107443.1	Similar to Streptomyces griseus A-factor-responsive transcriptional activator AdpA SWALL:Q9S166 (EMBL:AB023785) (405 aa) fasta scores: E(): 2.1e-30, 36.33% id in 322 aa, and to Streptomyces coelicolor transcriptional regulator sco6746 or sc5f2a.29 SWALL:Q9X7Q2 (EMBL:AL049587) (325 aa) fasta scores: E(): 2.9e-43, 41.94% id in 329 aa; Alternative start site at codon 33; upstream repeat region (ggcgc)3
YP_107444.1	Similar to Paracoccus denitrificans glutathione-dependent formaldehyde dehydrogenase FlhA SWALL:FADH_PARDE (SWALL:P45382) (375 aa) fasta scores: E(): 1e-108, 75.2% id in 375 aa, and to Ralstonia solanacearum probable bifunctional: glutathione-dependent formaldehyde dehydrogenase and alcohol dehydrogenase class III oxidoreductase AdhC1 or rsp0069 or rs02044 SWALL:Q8XTN7 (EMBL:AL646076) (368 aa) fasta scores: E(): 4e-128, 88.04% id in 368 aa; Upstream repeat region (ggcgc)3
YP_107445.1	Similar to Paracoccus denitrificans S-formylglutathione hydrolase FghA SWALL:Q51671 (EMBL:U34346) (279 aa) fasta scores: E(): 5.9e-55, 52.29% id in 283 aa, and to Ralstonia solanacearum probable hydrolase oxidoreductase rsc0604 or rs04840 SWALL:Q8Y1T5 (EMBL:AL646060) (289 aa) fasta scores: E(): 2.9e-77, 69.03% id in 281 aa
YP_107446.1	Similar to Mycobacterium leprae  ABC-transporter transmembrane protein ml0335 SWALL:Q9CCW1 (EMBL:AL583918) (286 aa) fasta scores: E(): 6.6e-22, 35.63% id in 261 aa, and to Thermoanaerobacter tengcongensis ABC-type Mn2+/Zn2+ transport systems, permease components znuB or tte0361 SWALL:Q8RCQ5 (EMBL:AE013009) (263 aa) fasta scores: E(): 2.3e-20, 32.03% id in 256 aa
YP_107447.1	Similar to Mycobacterium leprae  ABC-tranporter ATP-binding protein ml0336 SWALL:Q9CCW0 (EMBL:AL583918) (275 aa) fasta scores: E(): 4.4e-25, 43.6% id in 250 aa, and to Pyrococcus horikoshii hypothetical protein ph1653 SWALL:O59348 (EMBL:AP000006) (260 aa) fasta scores: E(): 1.1e-19, 33.2% id in 256 aa
YP_107448.1	Similar to Yersinia pestis periplasmic chelated iron-binding protein YfeA or ypo2439 or y1897 SWALL:YFEA_YERPE (SWALL:Q56952) (311 aa) fasta scores: E(): 3.9e-08, 31.05% id in 219 aa, and to Mycobacterium tuberculosis hypothetical protein rv2059 or mtcy63a.01c or mt2119 SWALL:O07257 (EMBL:Z97984) (511 aa) fasta scores: E(): 2.2e-19, 34.41% id in 247 aa
YP_107449.1	Similar to Escherichia coli zinc uptake regulation protein Zur or b4046 SWALL:ZUR_ECOLI (SWALL:P32692) (171 aa) fasta scores: E(): 2.7e-12, 33.57% id in 137 aa, and to Pseudomonas aeruginosa transcriptional regulator Np20 or pa5499 SWALL:Q9HT74 (EMBL:AE004962) (167 aa) fasta scores: E(): 6e-21, 42.17% id in 147 aa. Possible alternative translational start sites
YP_107450.1	Converts D-sorbitol to L-sorbose
YP_107451.1	Similar to Klebsiella pneumoniae fructokinase ScrK SWALL:SCRK_KLEPN (SWALL:P26420) (307 aa) fasta scores: E(): 9e-17, 33.91% id in 286 aa, and to Ralstonia solanacearum probable fructokinase CscK or rsc2146 or rs01457 SWALL:Q8XXG8 (EMBL:AL646068) (318 aa) fasta scores: E(): 3.1e-86, 74.52% id in 318 aa, and to Rhizobium loti fructokinase mll7216 SWALL:Q986T6 (EMBL:AP003011) (317 aa) fasta scores: E(): 1.6e-41, 42.81% id in 320 aa
YP_107452.1	Similar to Escherichia coli  tagatose 6-phosphate kinase agaZ or KbaZ or b3132 SWALL:AGAZ_ECOLI (SWALL:P42903) (426 aa) fasta scores: E(): 5.8e-30, 47.4% id in 481 aa, and to Ralstonia solanacearum  tagatose 6-phosphate kinase rsc2145 or rs01458 SWALL:Q8XXG9 (EMBL:AL646068) (451 aa) fasta scores: E(): 1.7e-61, 65.85% id in 495 aa. Possible alternative translational start site
YP_107453.1	Similar to Ralstonia solanacearum probable sugar-binding periplasmic signal peptide protein rsc2144 or rs01459 SWALL:Q8XXH0 (EMBL:AL646068) (441 aa) fasta scores: E(): 6.6e-158, 89.14% id in 442 aa, and to Agrobacterium tumefaciens ABC transporter substrate binding protein atu3165 or agr_l_3289 SWALL:Q8UB52 (EMBL:AE009246) (450 aa) fasta scores: E(): 2.2e-105, 61.15% id in 417 aa
YP_107454.1	Similar to Ralstonia solanacearum probable transmembrane ABC transporter protein rsc2143 or rs01460 SWALL:Q8XXH1 (EMBL:AL646068) (317 aa) fasta scores: E(): 1.5e-103, 84.12% id in 315 aa, and to Pseudomonas aeruginosa probable binding-protein-dependent maltose/mannitol transport protein pa2339 SWALL:Q9I1D9 (EMBL:AE004660) (310 aa) fasta scores: E(): 2.1e-70, 61.67% id in 287 aa, and to Rhodobacter capsulatus maltose transport inner membrane protein SWALL:O68115 (EMBL:AF010496) (290 aa) fasta scores: E(): 1.6e-69, 62.5% id in 280 aa
YP_107455.1	Similar to Ralstonia solanacearum probable transmembrane ABC transporter protein rsc2142 or rs01461 SWALL:Q8XXH2 (EMBL:AL646068) (286 aa) fasta scores: E(): 1.1e-101, 90.62% id in 288 aa, and to Pseudomonas fluorescens probable ABC transporter permease MtlG SWALL:O30493 (EMBL:AF007800) (276 aa) fasta scores: E(): 3e-70, 65.67% id in 268 aa, and to Pseudomonas aeruginosa probable binding-protein-dependent maltose/mannitol transport protein pa2340 SWALL:Q9I1D8 (EMBL:AE004660) (277 aa) fasta scores: E(): 7.3e-70, 66.41% id in 268 aa
YP_107456.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc2141 or rs01462 SWALL:Q8XXH3 (EMBL:AL646068) (232 aa) fasta scores: E(): 2.1e-58, 70.25% id in 232 aa, and to Pseudomonas aeruginosa probable hydrolase pa0562 SWALL:Q9I5X4 (EMBL:AE004492) (224 aa) fasta scores: E(): 9.9e-30, 47.08% id in 223 aa, and to Xanthomonas axonopodis hydrolase xac2883 SWALL:AAM37728 (EMBL:AE011930) (225 aa) fasta scores: E(): 2.4e-27, 45.87% id in 218 aa
YP_107457.1	Similar to Salmonella typhimurium maltose/maltodextrin transport ATP-binding protein MalK or stm4230 SWALL:MALK_SALTY (SWALL:P19566) (369 aa) fasta scores: E(): 2.6e-62, 54.14% id in 362 aa, and to Ralstonia solanacearum probable sugar ATP-binding ABC transporter protein rsc2140 or rs01463 SWALL:Q8XXH4 (EMBL:AL646068) (369 aa) fasta scores: E(): 1.1e-101, 83.51% id in 370 aa, and to Vibrio cholerae maltose/maltodextrin ABC transporter ATP-binding protein vca0946 SWALL:Q9KL04 (EMBL:AE004421) (373 aa) fasta scores: E(): 1.2e-64, 56.35% id in 362 aa; downstream repeat region (cccgccgc)3 and (cccgccgg)3; Alternative start site at codon 20
YP_107458.1	Similar to Clostridium perfringens hypothetical protein CPE0251 SWALL:Q8XNT1 (EMBL:AP003186) (440 aa) fasta scores: E(): 5e-55, 37.67% id in 422 aa. C-terminal region is similar to Fusobacterium nucleatum phosphoserine phosphatase FN0091 SWALL:Q8RH24 (EMBL:AE010523) (366 aa) fasta scores: E(): 2.5e-38, 35.69% id in 381 aa; downstream repeat region (cccgccgc)3 and (cccgccgg)3
YP_107459.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa2316 SWALL:Q9I1F9 (EMBL:AE004657) (297 aa) fasta scores: E(): 1.4e-77, 68.02% id in 294 aa, and to Agrobacterium tumefaciens transcriptional regulator, LysR family atu4271 or agr_l_1183 SWALL:Q8U828 (EMBL:AE009356) (295 aa) fasta scores: E(): 4.5e-54, 50% id in 294 aa, and to Rhizobium loti transcriptional regulator mll2784 SWALL:Q98HN8 (EMBL:AP003000) (307 aa) fasta scores: E(): 4.1e-53, 50.5% id in 295 aa; downstream repeat region (gcg)4
YP_107460.1	Similar to Pseudomonas aeruginosa hypothetical protein pa2315 SWALL:Q9I1G0 (EMBL:AE004657) (391 aa) fasta scores: E(): 6.8e-89, 67.63% id in 380 aa. C-terminal region is similar to Pseudomonas sp triacylglycerol lipase Lip-1 SWALL:Q9KX30 (EMBL:X61673) (333 aa) fasta scores: E(): 3.2e-76, 66.06% id in 333 aa
YP_107461.1	Similar to Erwinia chrysanthemi sugar efflux transporter B SotB SWALL:SOTB_ERWCH (SWALL:Q9S3J9) (395 aa) fasta scores: E(): 5e-23, 29.59% id in 392 aa, and to Pseudomonas aeruginosa probable MFS transporter pa2314 SWALL:Q9I1G1 (EMBL:AE004657) (417 aa) fasta scores: E(): 5.6e-69, 55.52% id in 389 aa; downstream repeat region (gtccgtccggc)3
YP_107462.1	Similar to Bacillus subtilis deoxyribonucleoside regulator DeoR SWALL:DEOR_BACSU (SWALL:P39140) (313 aa) fasta scores: E(): 2.3e-15, 29.74% id in 316 aa, and to Ralstonia solanacearum  transcriptional regulator rsc2127 or rs01506 SWALL:Q8XXI6 (EMBL:AL646068) (315 aa) fasta scores: E(): 7.7e-100, 84.98% id in 313 aa, and to Yersinia pestis  transcriptional regulatory protein ypo2324 SWALL:Q8ZE59 (EMBL:AJ414152) (318 aa) fasta scores: E(): 6.9e-63, 54.6% id in 315 aa; downstream repeat region (gtccgtccggc)3
YP_107463.1	Similar to Klebsiella pneumoniae D-xylulose-kinase DalK SWALL:O52719 (EMBL:AF045245) (487 aa) fasta scores: E(): 1.5e-108, 60.87% id in 478 aa, and to Ralstonia solanacearum  D-arabinitol kinase rsc2128 or rs01476 SWALL:Q8XXI5 (EMBL:AL646068) (491 aa) fasta scores: E(): 1.7e-154, 82.15% id in 493 aa, and to Escherichia coli xylulose kinase xylB or b3564 SWALL:XYLB_ECOLI (SWALL:P09099) (484 aa) fasta scores: E(): 1.4e-92, 53.68% id in 488 aa
YP_107464.1	Similar to Klebsiella pneumoniae D-arabinitol 4-dehydrogenase DalD SWALL:DALD_KLEPN (SWALL:O52720) (455 aa) fasta scores: E(): 4.8e-98, 55.95% id in 445 aa, and to Ralstonia solanacearum D-arabinitol 4-dehydrogenase rsc2129 or rs01475 SWALL:DALD_RALSO (SWALL:P58708) (465 aa) fasta scores: E(): 2.5e-147, 78.66% id in 464 aa, and to Yersinia pestis D-arabinitol 4-dehydrogenase ypo2325 or y2008 SWALL:DALD_YERPE (SWALL:P58709) (463 aa) fasta scores: E(): 2.2e-102, 56.58% id in 463 aa. Possible alternative translational start site after codon 17
YP_107465.1	Similar to Bacillus subtilis transcriptional regulatory protein GltC SWALL:GLTC_BACSU (SWALL:P20668) (300 aa) fasta scores: E(): 3.6e-16, 28.32% id in 286 aa, and to Streptomyces coelicolor  LysR-family transcriptional regulator sco0925 or scm10.13 SWALL:Q9RCY5 (EMBL:AL133469) (294 aa) fasta scores: E(): 4.1e-18, 33.33% id in 300 aa
YP_107466.1	catalyzes the formation of benzaldehyde from benzoylformate
YP_107467.1	Similar to previously sequenced Burkholderia sp. RP007 dehydrogenase PhnF SWALL:Q9ZHH7 (EMBL:AF061751) (483 aa) fasta scores: E(): 1.1e-103, 61.41% id in 482 aa. Similar to Rhizobium loti dehydrogenase mll7197 SWALL:Q986V2 (EMBL:AP003011) (481 aa) fasta scores: E(): 1.7e-114, 66.73% id in 481 aa, and to Ralstonia solanacearum probable vanillin dehydrogenase oxidoreductase Vdh or rsp0226 or rs05197 SWALL:Q8XT89 (EMBL:AL646077) (484 aa) fasta scores: E(): 2.7e-111, 65.63% id in 483 aa; Alternative start site at codon 11
YP_107468.1	Similar to Escherichia coli 2-dehydropantoate 2-reductase PanE or ApbA or b0425 SWALL:PANE_ECOLI (SWALL:P77728) (303 aa) fasta scores: E(): 2.8e-07, 27.77% id in 306 aa, and to Salmonella typhimurium  ketopantoate reductase stm2573 SWALL:Q8ZN23 (EMBL:AE008817) (305 aa) fasta scores: E(): 1.1e-30, 38.33% id in 313 aa, and to Salmonella typhi  oxidoreductase sty2819 SWALL:Q8Z4L0 (EMBL:AL627275) (305 aa) fasta scores: E(): 1.8e-30, 39.17% id in 314 aa
YP_107469.1	Doubtful CDS. No significant database matches
YP_107470.1	Similar to Pseudomonas putida 4-hydroxybenzoate transporter PcaK SWALL:PCAK_PSEPU (SWALL:Q51955) (448 aa) fasta scores: E(): 6.3e-43, 36.14% id in 451 aa, and to Ralstonia solanacearum  4-hydroxybenzoate transporter transmembrane protein rsc1093 or rs04094 SWALL:Q8Y0F1 (EMBL:AL646062) (454 aa) fasta scores: E(): 6.2e-47, 36.02% id in 458 aa, and to Pseudomonas aeruginosa probable MFS transporter pa2472 SWALL:Q9I110 (EMBL:AE004675) (448 aa) fasta scores: E(): 1.7e-45, 37.13% id in 439 aa
YP_107471.1	Similar to Ralstonia solanacearum  oxygenase oxidoreductase rsc0758 or rs05095 SWALL:Q8Y1D2 (EMBL:AL646060) (294 aa) fasta scores: E(): 1.2e-83, 71.13% id in 291 aa. Weakly similar to the N-terminal region of Homo sapiens tryptophan 2,3-dioxygenase TDO2 or TDO SWALL:T23O_HUMAN (SWALL:P48775) (406 aa) fasta scores: E(): 0.011, 28.15% id in 373 aa
YP_107472.1	Similar to Pseudomonas aeruginosa hypothetical protein pa2080 SWALL:Q9I235 (EMBL:AE004635) (416 aa) fasta scores: E(): 3.6e-112, 66.58% id in 416 aa, and to Ralstonia solanacearum probable hydrolase rsc0759 or rs05094 SWALL:Q8Y1D1 (EMBL:AL646060) (417 aa) fasta scores: E(): 1.3e-111, 67.95% id in 415 aa, and to Rattus norvegicus Kynureninase KynU SWALL:KYNU_RAT (SWALL:P70712) (464 aa) fasta scores: E(): 1.7e-13, 27.98% id in 436 aa, and to Streptomyces clavuligerus isopenicillin N epimerase CefD SWALL:CEFD_STRCL (SWALL:P18549) (397 aa) fasta scores: E(): 2.3e-07, 24.37% id in 402 aa
YP_107473.1	Similar to Ralstonia solanacearum hypothetical protein rsc0760 or rs05093 SWALL:Q8Y1D0 (EMBL:AL646060) (209 aa) fasta scores: E(): 5.8e-59, 74.87% id in 207 aa, and to Pseudomonas aeruginosa hypothetical protein pa2081 SWALL:Q9I234 (EMBL:AE004635) (213 aa) fasta scores: E(): 5.4e-52, 67.15% id in 207 aa, and to Synechocystis sp. hypothetical protein slr2121 SWALL:P73988 (EMBL:D90911) (215 aa) fasta scores: E(): 4.9e-14, 29.32% id in 208 aa
YP_107474.1	Similar to Rhizobium meliloti leucine-responsive regulatory protein Lrp or r01568 or smc01223 SWALL:LRP_RHIME (SWALL:P56901) (156 aa) fasta scores: E(): 5.9e-19, 41.78% id in 146 aa, and to Ralstonia solanacearum probable transcription regulator protein rsc0761 or rs05092 SWALL:Q8Y1C9 (EMBL:AL646060) (176 aa) fasta scores: E(): 4.1e-37, 65.1% id in 149 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa2082 SWALL:Q9I233 (EMBL:AE004636) (158 aa) fasta scores: E(): 1.7e-32, 62.06% id in 145 aa
YP_107475.1	Similar to Ralstonia solanacearum  monooxygenase oxidoreductase rsc0763 or rs05090 SWALL:Q8Y1C7 (EMBL:AL646060) (191 aa) fasta scores: E(): 2.6e-42, 66.47% id in 170 aa, and to Agrobacterium tumefaciens nitrilotriacetate monooxygenase atu3277 or agr_l_3083 SWALL:Q8UAU0 (EMBL:AE009257) (175 aa) fasta scores: E(): 1.9e-23, 47.23% id in 163 aa. Similar to the N-terminal region of Chelatobacter heintzii nitrilotriacetate monooxygenase component B NtaB or NmoB SWALL:NTAB_CHEHE (SWALL:P54990) (322 aa) fasta scores: E(): 9.3e-20, 41.21% id in 165 aa.
YP_107476.1	Similar to Erwinia chrysanthemi peptide methionine sulfoxide reductase MsrA SWALL:MSRA_ERWCH (SWALL:Q9ZEQ8) (213 aa) fasta scores: E(): 1.7e-25, 46.87% id in 160 aa, and to Ralstonia solanacearum peptide methionine sulfoxide reductase rsc0764 or rs05089 SWALL:MSRA_RALSO (SWALL:Q8Y1C6) (191 aa) fasta scores: E(): 2.9e-43, 60.21% id in 186 aa, and to Deinococcus radiodurans peptide methionine sulfoxide reductase dr1849 SWALL:MSRA_DEIRA (SWALL:Q9RTB6) (206 aa) fasta scores: E(): 8.3e-40, 56.18% id in 178 aa
YP_107477.1	Similar to Ralstonia solanacearum hypothetical protein rsc0765 or rs05088 SWALL:Q8Y1C5 (EMBL:AL646060) (355 aa) fasta scores: E(): 3.2e-54, 53.46% id in 346 aa. Alternative start at codon 80
YP_107478.1	Similar to Ralstonia solanacearum cyclopropane-fatty-acyl-phospholipid synthase Cfa2 or rsc0766 or rs05087 SWALL:Q8Y1C4 (EMBL:AL646060) (406 aa) fasta scores: E(): 1.5e-111, 68.84% id in 398 aa, and to Pseudomonas aeruginosa hypothetical protein pa5546 SWALL:Q9HT28 (EMBL:AE004967) (394 aa) fasta scores: E(): 1.6e-73, 49.11% id in 397 aa, and to Pseudomonas putida hypothetical protein SWALL:YLP3_PSEPU (SWALL:P31049) (394 aa) fasta scores: E(): 7.8e-67, 45.83% id in 384 aa; Upstream repeat (ccgc)3 and downstream repeat (gcg)4
YP_107479.2	catalyzes the formation of pyridoxal 5'-phosphate from pyridoxamine 5'-phosphate
YP_107480.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0774 or rs05080 SWALL:Q8Y1B6 (EMBL:AL646061) (300 aa) fasta scores: E(): 4.9e-51, 60.48% id in 291 aa, and to Salmonella typhimurium paral enzyme stm2987 SWALL:Q8ZMC1 (EMBL:AE008837) (268 aa) fasta scores: E(): 7.7e-50, 53.33% id in 270 aa
YP_107481.1	Similar to Ralstonia solanacearum  thioredoxin protein rsc0779 or rs05075 SWALL:Q8Y1B1 (EMBL:AL646061) (280 aa) fasta scores: E(): 2.9e-54, 55.51% id in 281 aa, and to Pseudomonas aeruginosa probable thioredoxin pa4061 SWALL:Q9HWW7 (EMBL:AE004822) (289 aa) fasta scores: E(): 1e-32, 42.1% id in 285 aa, and to Xanthomonas axonopodis thioredoxin xac2783 SWALL:AAM37628 (EMBL:AE011919) (286 aa) fasta scores: E(): 9.5e-32, 41.07% id in 280 aa
YP_107482.1	Similar to Streptomyces coelicolor hypothetical protein sco0881 or scm1.14C SWALL:Q9RD29 (EMBL:AL133422) (321 aa) fasta scores: E(): 3.4e-32, 38.98% id in 295 aa, and to Pseudomonas aeruginosa hypothetical protein pa1205 SWALL:YC05_PSEAE (SWALL:Q9I4D3) (315 aa) fasta scores: E(): 8e-32, 40.07% id in 257 aa, and to Streptomyces coelicolor hypothetical protein sco7729 or sc8d11.20 SWALL:Q9AJZ9 (EMBL:AL512944) (332 aa) fasta scores: E(): 1.7e-28, 37.36% id in 281 aa, and to Mus musculus pirin PIR SWALL:PIR_MOUSE (SWALL:Q9D711) (290 aa) fasta scores: E(): 8e-18, 31.14% id in 289 aa
YP_107483.1	Similar to Salmonella typhimurium probable amino acid metabolite efflux pump EamA or stm1517 SWALL:EAMA_SALTY (SWALL:Q56072) (299 aa) fasta scores: E(): 1.4e-53, 53.92% id in 293 aa, and to Ralstonia solanacearum hypothetical transmembrane protein rsc3261 or rs02490 SWALL:Q8XUD0 (EMBL:AL646074) (308 aa) fasta scores: E(): 5.3e-65, 63.54% id in 299 aa, and to Salmonella typhi  membrane protein sty1543 SWALL:Q8Z701 (EMBL:AL627270) (300 aa) fasta scores: E(): 1.2e-53, 53.92% id in 293 aa
YP_107484.1	Similar to Escherichia coli N-acetylmuramoyl-L-alanine amidase AmiC or b2817 SWALL:AMIC_ECOLI (SWALL:Q46929) (417 aa) fasta scores: E(): 1.3e-34, 42.85% id in 490 aa, and to Ralstonia solanacearum probable N-acetylmuramoyl-L-alanine amidase rsc2539 or rs00715 SWALL:Q8XWD5 (EMBL:AL646070) (507 aa) fasta scores: E(): 2.1e-52, 57.39% id in 521 aa, and to Yersinia pestis N-acetylmuramoyl-L-alanine amidase ypo1023 SWALL:Q8ZH85 (EMBL:AJ414146) (416 aa) fasta scores: E(): 4.9e-36, 41.36% id in 498 aa
YP_107485.1	Similar to Ralstonia solanacearum hypothetical protein rsc2540 or rs00716 SWALL:Q8XWD4 (EMBL:AL646070) (198 aa) fasta scores: E(): 8.5e-29, 58.28% id in 163 aa, and to Salmonella typhi hypothetical protein sty4714 SWALL:Q8Z189 (EMBL:AL627283) (153 aa) fasta scores: E(): 5.3e-20, 48.79% id in 166 aa, and to Salmonella typhimurium  nucleotide-binding protein stm4357 SWALL:Q8ZKA6 (EMBL:AE008904) (153 aa) fasta scores: E(): 8.1e-20, 48.19% id in 166 aa, and to Escherichia coli, and Escherichia coli O157:H7 hypothetical protein b4168 or z5775 or ecs5144 SWALL:YJEE_ECOLI (SWALL:P31805) (153 aa) fasta scores: E(): 2.2e-19, 48.79% id in 166 aa
YP_107486.1	Similar to Pseudomonas aeruginosa hypothetical protein pa4950 SWALL:Q9HUL4 (EMBL:AE004908) (361 aa) fasta scores: E(): 7.6e-57, 59.15% id in 377 aa, and to Yersinia pestis  iron-sulfur cluster-binding protein ypo0367 SWALL:Q8ZIW8 (EMBL:AJ414142) (411 aa) fasta scores: E(): 1e-42, 47.18% id in 409 aa, and to Ralstonia solanacearum iron-sulfur 4Fe-4S ferredoxin protein rsc2541 or rs00718 SWALL:Q8XWD3 (EMBL:AL646070) (360 aa) fasta scores: E(): 8.8e-39, 64.45% id in 377 aa. Possible alternative translational start site
YP_107487.1	Similar to Salmonella typhimurium, and Salmonella typhi methylated-DNA--protein-cysteine methyltransferase Ogt or stm1659 or sty1405 SWALL:OGT_SALTY (SWALL:P37429) (171 aa) fasta scores: E(): 2.7e-12, 43.18% id in 132 aa, and to Ralstonia solanacearum probable methylated-DNA--protein-cysteine methyltransferase rsc2543 or rs00722 SWALL:Q8XWD1 (EMBL:AL646070) (173 aa) fasta scores: E(): 2.6e-38, 57.31% id in 164 aa, and to Chlorobium tepidum methylated-DNA-protein-cysteine methyltransferase ct1289 SWALL:AAM72519 (EMBL:AE012888) (165 aa) fasta scores: E(): 1.2e-15, 39.86% id in 148 aa
YP_107488.2	site-specific tyrosine recombinase which cuts and rejoins DNA molecules; binds cooperatively to specific DNA consensus sites; forms a heterotetrameric complex with XerC; XerCD exhibit similar sequences; essential to convert chromosome dimers to monomers during cell division and functions during plasmid segregation; XerD specifically exchanges the bottom strands; cell division protein FtsK may regulate the XerCD complex; enzyme from Streptococcus group has unusual active site motifs
YP_107489.1	Similar to Streptomyces coelicolor probable long-chain-fatty-acid-CoA ligase sco6968 or sc6f7.21 SWALL:Q9KZC1 (EMBL:AL353870) (511 aa) fasta scores: E(): 2.7e-47, 37.37% id in 511 aa, and to Thermoanaerobacter tengcongensis acyl-CoA synthetases tte1960 SWALL:Q8R8N5 (EMBL:AE013147) (495 aa) fasta scores: E(): 2.8e-44, 33.53% id in 489 aa
YP_107490.1	Similar to Ralstonia solanacearum hypothetical protein rsc2545 or rs00724 SWALL:Q8XWC9 (EMBL:AL646070) (163 aa) fasta scores: E(): 7.9e-50, 76.39% id in 161 aa, and to Neisseria meningitidis hypothetical protei nma1462 SWALL:Q9JU74 (EMBL:AL162756) (159 aa) fasta scores: E(): 3.5e-30, 49.36% id in 158 aa, and to Neisseria meningitidis hypothetical protein nmb1026 SWALL:Q9JZJ3 (EMBL:AE002453) (159 aa) fasta scores: E(): 4.8e-30, 49.36% id in 158 aa
YP_107491.1	involved in acylation of glycerol-3-phosphate to form 1-acyl-glycerol-3 phosphate for use in phospholipid biosynthesis; functions with PlsX
YP_107492.1	nucleotide binding property based on structural studies of Haemophilus influenzae crystallized protein in PDB Accession Number 1IN0 and NMR studies of Escherichia coli YajQ; the YajQ protein from Pseudomonas synringae appears to play a role in activation of bateriophage phi6 segment L transcription
YP_107493.1	catalyzes the reduction of UDP-N-acetylglucosamine enolpyruvate to form UDP-N-acetylmuramate in peptidoglycan biosynthesis
YP_107494.1	catalyzes the formation of L-citrulline from carbamoyl phosphate and L-ornithine in arginine biosynthesis and degradation
YP_107495.1	Similar to Ralstonia solanacearum hypothetical protein rsc2555 or rs00734 SWALL:Q8XWB9 (EMBL:AL646070) (117 aa) fasta scores: E(): 4.7e-20, 56.25% id in 96 aa, and to Neisseria meningitidis hypothetical protein nma0169 SWALL:Q9JWY5 (EMBL:AL162752) (280 aa) fasta scores: E(): 1e-11, 45.16% id in 93 aa, and to Neisseria meningitidis phno-related protein nmb0105 SWALL:Q9K1L0 (EMBL:AE002369) (280 aa) fasta scores: E(): 1.2e-11, 45.16% id in 93 aa
YP_107496.1	binds directly to the 16S rRNA and is involved in post-translational inhibition of arginine and ornithine decarboxylase
YP_107497.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc2557 or rs00736 SWALL:Q8XWB7 (EMBL:AL646070) (517 aa) fasta scores: E(): 2.3e-128, 65.69% id in 516 aa, and to Yersinia pestis  membrane protein ypo2043 SWALL:Q8ZEW0 (EMBL:AJ414151) (511 aa) fasta scores: E(): 9.6e-97, 52.7% id in 518 aa, and to Escherichia coli, and Escherichia coli O157:H7 virulence factor MviN homolog b1069 or z1707 or ecs1447 SWALL:MVIN_ECOLI (SWALL:P75932) (511 aa) fasta scores: E(): 2.6e-96, 52.23% id in 515 aa
YP_107498.1	Similar to Ralstonia solanacearum hypothetical protein rsc2558 or rs00740 SWALL:Q8XWB6 (EMBL:AL646070) (281 aa) fasta scores: E(): 4.2e-61, 58.27% id in 278 aa, and to Xylella fastidiosa hypothetical protein xf1494 SWALL:YE94_XYLFA (SWALL:Q9PD85) (281 aa) fasta scores: E(): 4.3e-33, 38.84% id in 278 aa, and to Xanthomonas campestris hypothetical protein xcc3267 SWALL:AAM42537 (EMBL:AE012443) (293 aa) fasta scores: E(): 8.7e-32, 39.06% id in 279 aa
YP_107499.1	Similar to Ralstonia solanacearum probable 3-hydroxyacyl-CoA dehydrogenase type II oxidoreductase rsc2534 or rs05766 SWALL:Q8XWE0 (EMBL:AL646070) (252 aa) fasta scores: E(): 2.2e-67, 77.77% id in 252 aa, and to Pseudomonas aeruginosa probable short-chain dehydrogenase pa2554 SWALL:Q9I0T0 (EMBL:AE004683) (255 aa) fasta scores: E(): 1.4e-56, 66.66% id in 255 aa, and to Brucella melitensis 3-oxoacyl-(acyl-carrier protein) reductase bmeii0816 SWALL:Q8YBS0 (EMBL:AE009715) (255 aa) fasta scores: E(): 7e-56, 65.88% id in 255 aa
YP_107500.1	essential enzyme that recycles AMP in active cells; converts ATP and AMP to two molecules of ADP
YP_107501.2	CMP-2-keto-3-deoxyoctulosonic acid synthetase; catalyzes the formation of CMP-3-deoxy-D-manno-octulosonate from CTP and 3-deoxy-D-manno-octulosonate which is incorporated into LPS
YP_107502.1	Similar to Ralstonia solanacearum hypothetical protein rsc2531 or rs05763 SWALL:Q8XWE3 (EMBL:AL646070) (62 aa) fasta scores: E(): 1.9e-19, 82.25% id in 62 aa, and to Caulobacter crescentus hypothetical protein cc0108 SWALL:Q9ABW2 (EMBL:AE005685) (65 aa) fasta scores: E(): 3.4e-11, 62.5% id in 56 aa, and to Vibrio cholerae hypothetical protein vc1876 SWALL:Q9KQX1 (EMBL:AE004263) (59 aa) fasta scores: E(): 4.4e-11, 64.7% id in 51 aa
YP_107503.1	Transfers the gamma-phosphate of ATP to the 4' position of a tetraacyldisaccharide 1-phosphate intermediate to form tetraacyldisaccharide 1,4'-bis-phosphate
YP_107504.1	bidirectionally degrades single-stranded DNA into large acid-insoluble oligonucleotides
YP_107505.1	Similar to Bordetella pertussis superoxide dismutase [Fe] SodB SWALL:SODF_BORPE (SWALL:P37369) (192 aa) fasta scores: E(): 6.4e-69, 83.33% id in 192 aa, and to Ralstonia solanacearum probable superoxide dismutase rsc2526 or rs01055 SWALL:Q8XWE8 (EMBL:AL646070) (192 aa) fasta scores: E(): 1.2e-70, 85.41% id in 192 aa
YP_107507.1	Similar to Pseudomonas aeruginosa chromate transport protein ChrA SWALL:CHRA_PSEAE (SWALL:P14285) (416 aa) fasta scores: E(): 1.4e-19, 29% id in 400 aa, and to Pseudomonas aeruginosa probable transporter pa4289 SWALL:Q9HWB1 (EMBL:AE004845) (401 aa) fasta scores: E(): 2.8e-88, 65.23% id in 397 aa, and to Agrobacterium tumefaciens chromate transport protein atu3079 or agr_l_3461 SWALL:Q8UBD7 (EMBL:AE009239) (409 aa) fasta scores: E(): 6.2e-75, 55.61% id in 392 aa; downstream repeat region
YP_107508.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa0275 SWALL:Q9I6L5 (EMBL:AE004465) (228 aa) fasta scores: E(): 1.1e-40, 56.3% id in 222 aa, and to Ralstonia solanacearum  transcription regulator protein rsp0805 or rs01902 SWALL:Q8XRM6 (EMBL:AL646081) (239 aa) fasta scores: E(): 3.7e-38, 52.21% id in 226 aa
YP_107509.1	Similar to Pseudomonas aeruginosa hypothetical protein pa0276 SWALL:Q9I6L4 (EMBL:AE004465) (171 aa) fasta scores: E(): 7e-44, 69.71% id in 175 aa, and to Pseudomonas putida Prs2-like protein SWALL:Q9WWZ6 (EMBL:AF031417) (174 aa) fasta scores: E(): 3.2e-40, 62.85% id in 175 aa
YP_107510.1	catalyzes the formation of 2-dehydropantoate from (R)-pantoate
YP_107511.1	Similar to Ralstonia solanacearum hypothetical protein rsc3026 or rs04731 SWALL:Q8XV06 (EMBL:AL646073) (196 aa) fasta scores: E(): 1e-40, 58.67% id in 196 aa; upstream repeat region (tgccgagt)3
YP_107512.1	Weakly similar to Clostridium acetobutylicum sensory protein, containing EAL-domain cac0322 SWALL:Q97M76 (EMBL:AE007546) (412 aa) fasta scores: E(): 4.5e-19, 25.76% id in 392 aa, and to Rhizobium loti hypothetical protein mll2537 SWALL:Q98I70 (EMBL:AP002999) (282 aa) fasta scores: E(): 2.8e-14, 31.22% id in 237 aa; upstream repeat region (cccgaacgcccgaacgcccgaacg)3 and (cccgaaca)3
YP_107513.1	Similar to Ralstonia solanacearum probable transporter transmembrane protein rsp1278 or rs05323 SWALL:Q8XQE9 (EMBL:AL646083) (476 aa) fasta scores: E(): 1.2e-105, 61.7% id in 470 aa, and to Xanthomonas campestris MFS transporter EmrA or xcc2845 SWALL:AAM42117 (EMBL:AE012397) (473 aa) fasta scores: E(): 9.4e-98, 58.35% id in 461 aa; downstream repeat region (cccgaacgcccgaacgcccgaacg)3 and (cccgaaca)3
YP_107514.1	Doubtful CDS. No significant hits in the databases
YP_107515.1	C-terminal region is similar to Agrobacterium tumefaciens citrate synthase CisZ or atu4851 or agr_l_71 SWALL:Q8U6F6 (EMBL:AE009414) (335 aa) fasta scores: E(): 6.7e-14, 42.68% id in 335 aa, and to Staphylococcus aureus citrate synthase II CitZ SWALL:Q99TG7 (EMBL:AP003363) (373 aa) fasta scores: E(): 4.7e-13, 27.36% id in 391 aa. Possible alternative translational start site
YP_107516.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa3757 SWALL:Q9HXN8 (EMBL:AE004794) (247 aa) fasta scores: E(): 2.5e-56, 63.71% id in 248 aa, and to Xanthomonas campestris transcriptional regulator GntR family xcc3414 SWALL:AAM42684 (EMBL:AE012460) (255 aa) fasta scores: E(): 9.6e-47, 52.67% id in 243 aa
YP_107517.1	Similar to Rhizobium loti probable oxidoreductase mlr5327 SWALL:Q98C22 (EMBL:AP003006) (281 aa) fasta scores: E(): 1.6e-58, 55.16% id in 281 aa, and to Rhizobium meliloti  oxidoreductase r02112 or smc01429 SWALL:Q92NR7 (EMBL:AL591789) (281 aa) fasta scores: E(): 4.6e-56, 56.22% id in 281 aa, and to Agrobacterium tumefaciens aldo/keto reductase atu2032 or agr_c_3682 SWALL:Q8UDT7 (EMBL:AE009154) (281 aa) fasta scores: E(): 2.4e-52, 51.95% id in 281 aa
YP_107518.1	No significant database matches. C-terminal region of the CDS in glycine rich and contains contains repeat regions
YP_107519.1	EF-G; promotes GTP-dependent translocation of the ribosome during translation; many organisms have multiple copies of this gene
YP_107520.1	Similar to Ralstonia solanacearum hypothetical signal peptide protein rsc2494 or rs01102 SWALL:Q8XWI0 (EMBL:AL646070) (150 aa) fasta scores: E(): 4.3e-26, 53.37% id in 148 aa, and to Rhizobium meliloti hypothetical signal peptide protein r01717 or smc00288 SWALL:Q92PM3 (EMBL:AL591788) (163 aa) fasta scores: E(): 5.6e-10, 36.25% id in 160 aa
YP_107521.1	Similar to Escherichia coli O157:H7 orf, hypothetical protein YmfC or z1864 or ecs1607 SWALL:Q8X724 (EMBL:AE005329) (217 aa) fasta scores: E(): 1.8e-30, 51.41% id in 177 aa, and to Salmonella typhimurium ribosomal large subunit pseudouridine synthase YmfC or stm1237 SWALL:Q8ZPZ1 (EMBL:AE008754) (221 aa) fasta scores: E(): 1.8e-30, 50.56% id in 178 aa
YP_107522.1	Converts isocitrate to alpha ketoglutarate
YP_107523.1	Similar to Escherichia coli blue copper oxidase CueO SWALL:CUEO_ECOLI (SWALL:P36649) (516 aa) fasta scores: E(): 1.1e-20, 32.62% id in 472 aa, and to Pasteurella multocida hypothetical protein pm1938 SWALL:Q9CJQ6 (EMBL:AE006230) (515 aa) fasta scores: E(): 2.8e-65, 45.83% id in 504 aa, and to Campylobacter jejuni periplasmic oxidoreductase cj1516 SWALL:Q9PME8 (EMBL:AL139078) (513 aa) fasta scores: E(): 2e-36, 38.89% id in 545 aa
YP_107524.1	Similar to Bordetella pertussis cold shock-like protein CspA SWALL:CSPA_BORPE (SWALL:Q9Z5R4) (67 aa) fasta scores: E(): 4.1e-15, 64.61% id in 65 aa, and to Myxococcus xanthus CspB SWALL:Q9ZFK8 (EMBL:AF098529) (66 aa) fasta scores: E(): 1.1e-15, 68.18% id in 66 aa, and to Shewanella violacea cold shock-like protein CspA SWALL:Q9S1B7 (EMBL:AB015429) (70 aa) fasta scores: E(): 1.4e-15, 70.31% id in 64 aa
YP_107525.1	involved in the modulation of the specificity of the ClpAP-mediated ATP-dependent protein degradation; binds to the N-terminal domain of the chaperone ClpA
YP_107526.1	Similar to Escherichia coli, and Escherichia coli O157:H7 ATP-dependent Clp protease ATP-binding subunit ClpA or LopD or b0882 or z1119 or ecs0968 SWALL:CLPA_ECOLI (SWALL:P15716) (758 aa) fasta scores: E(): 2.4e-163, 61.6% id in 750 aa, and to Ralstonia solanacearum probable ATP-dependent protease ClpA or rsc2464 or rs01141 SWALL:Q8XWL0 (EMBL:AL646070) (762 aa) fasta scores: E(): 0, 87.53% id in 762 aa, and to Pseudomonas aeruginosa ATP-binding protease component ClpA or pa2620 SWALL:Q9I0L8 (EMBL:AE004690) (758 aa) fasta scores: E(): 4.2e-175, 65.74% id in 762 aa
YP_107527.1	Similar to Escherichia coli phenylalanine-specific permease PheP or b0576 SWALL:PHEP_ECOLI (SWALL:P24207) (458 aa) fasta scores: E(): 6.1e-58, 38.06% id in 444 aa, and to Pseudomonas aeruginosa probable amino acid permease pa2079 SWALL:Q9I236 (EMBL:AE004635) (468 aa) fasta scores: E(): 2.1e-101, 65.16% id in 445 aa, and to Pseudomonas aeruginosa probable amino acid permease pa0789 SWALL:Q9I5E9 (EMBL:AE004514) (471 aa) fasta scores: E(): 5.8e-59, 38.68% id in 442 aa
YP_107528.1	C-terminal region is weakly similar to Xanthomonas campestris hypothetical protein xcc0131 SWALL:AAM39450 (EMBL:AE012108) (223 aa) fasta scores: E(): 0.042, 24.61% id in 195 aa
YP_107529.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc3405 or rs01714 SWALL:Q8XTZ0 (EMBL:AL646075) (261 aa) fasta scores: E(): 1.9e-55, 64.87% id in 242 aa, and to Chlorobium tepidum hypothetical protein ct0197 SWALL:AAM71445 (EMBL:AE012799) (263 aa) fasta scores: E(): 1e-44, 53.08% id in 243 aa. CDS is truncated at the N-terminus in comparison to orthologues; Repeat motif found as four tandem repeats with two transmembrane regions and a conserved Trp
YP_107530.1	catalyzes the formation of dUMP from dUTP
YP_107531.1	catalyzes the conjugation of cysteine to 4'-phosphopantothenate to form 4-phosphopantothenoylcysteine, which is then decarboxylated to form 4'-phosphopantotheine
YP_107532.1	lipoprotein signal peptidase; integral membrane protein that removes signal peptides from prolipoproteins during lipoprotein biosynthesis
YP_107533.1	IleRS; catalyzes the formation of isoleucyl-tRNA(Ile) from isoleucine and tRNA(Ile); since isoleucine and other amino acids such as valine are similar, there are additional editing function in this enzyme; one is involved in hydrolysis of activated valine-AMP and the other is involved in deacylation of mischarged Val-tRNA(Ile); there are two active sites, one for aminoacylation and one for editing; class-I aminoacyl-tRNA synthetase type 1 subfamily; some organisms carry two different copies of this enzyme
YP_107534.1	catalyzes the formation of FMN from riboflavin and the formation of FAD from FMN; in Bacillus the ribC gene has both flavokinase and FAD synthetase activities
YP_107535.1	glycinamide ribonucleotide transformylase; GAR Tfase; catalyzes the synthesis of 5'-phosphoribosylformylglycinamide from 5'-phosphoribosylglycinamide and 10-formyltetrahydrofolate; PurN requires formyl folate for the reaction unlike PurT which uses formate
YP_107536.1	Similar to Ralstonia solanacearum hypothetical protein rsc2453 or rs01153 SWALL:Q8XWM1 (EMBL:AL646070) (417 aa) fasta scores: E(): 1.6e-101, 63.78% id in 417 aa, and to Neisseria meningitidis Fmu and Fmv protein, nmb1351 SWALL:Q9JZ03 (EMBL:AE002483) (418 aa) fasta scores: E(): 5.9e-75, 52.54% id in 413 aa, and to Neisseria meningitidis sun-family protein nma1563 SWALL:Q9JTZ9 (EMBL:AL162756) (418 aa) fasta scores: E(): 6.5e-73, 51.09% id in 413 aa
YP_107537.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein rsc2451 or rs01155 SWALL:Q8XWM3 (EMBL:AL646070) (447 aa) fasta scores: E(): 3.2e-71, 47.19% id in 445 aa, and to Rhizobium meliloti hypothetical protein ra0860 or sma1582 SWALL:Q92YL3 (EMBL:AE007272) (432 aa) fasta scores: E(): 2e-33, 32.18% id in 435 aa
YP_107538.1	Similar to Azotobacter vinelandii stearoyl-CoA desaturase SWALL:Q59162 (EMBL:U37517) (367 aa) fasta scores: E(): 7.9e-71, 50.56% id in 356 aa, and to Ralstonia solanacearum  stearoyl-CoA desaturase oxidoreductase rsc2450 or rs01156 SWALL:Q8XWM4 (EMBL:AL646070) (398 aa) fasta scores: E(): 3.6e-116, 68.17% id in 399 aa, and to Pseudomonas aeruginosa probable fatty acid desaturase pa0286 SWALL:Q9I6K4 (EMBL:AE004466) (392 aa) fasta scores: E(): 6.1e-85, 54.49% id in 389 aa
YP_107539.1	3 different subfamilies; catalyzes the formation of quinolinate from iminoaspartate and dihydroxyacetone phosphate
YP_107540.1	catalyzes the formation of pyridine-2,3-dicarboxylate and 5-phospho-alpha-D-ribose 1-diphosphate from nictinate D-ribonucleotide
YP_107541.1	catalyzes the formation of oxaloacetate from L-aspartate
YP_107542.1	in Escherichia coli BM108, a mutation that results in lack of L33 synthesis had no effect on ribosome synthesis or function; there are paralogous genes in several bacterial genomes, and a CXXC motif for zinc binding and an upstream regulation region of the paralog lacking this motif that are regulated by zinc similar to other ribosomal proteins like L31; the proteins in this group lack the CXXC motif
YP_107543.1	required for 70S ribosome assembly
YP_107544.1	Involved in DNA double-strand break repair and recombination. Promotes the annealing of complementary single-stranded DNA and by simulation of RAD51 recombinase
YP_107545.1	Similar to Escherichia coli, and Escherichia coli O157:H7 FkbP-type peptidyl-prolyl cis-trans isomerase FkpB or SlpA or b0028 or z0033 or ecs0031 SWALL:FKBX_ECOLI (SWALL:P22563) (148 aa) fasta scores: E(): 2.3e-14, 40.55% id in 143 aa, and to Ralstonia solanacearum probable FkbP-type peptidyl-prolyl cis-trans isomerase FkpB or rsc2443 or rs01351 SWALL:Q8XWN1 (EMBL:AL646070) (144 aa) fasta scores: E(): 1.4e-38, 71.32% id in 143 aa, and to Pseudomonas fluorescens probable FkbP-type peptidyl-prolyl cis-trans isomerase YaaD SWALL:FKBX_PSEFL (SWALL:P21863) (150 aa) fasta scores: E(): 8.1e-15, 39.45% id in 147 aa
YP_107546.1	catalyzes the conversion of 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate into isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP); functions in the nonmevalonate isoprenoid biosynthesis pathway
YP_107547.1	Doubtful CDS. No significant database matches
YP_107548.1	Similar to Pseudomonas aeruginosa high-affinity branched-chain amino acid transport system permease BraD or pa1073 SWALL:BRAD_PSEAE (SWALL:P21627) (307 aa) fasta scores: E(): 3.1e-45, 49.18% id in 307 aa, and to Ralstonia solanacearum  amino-acid transmembrane ABC transporter protein rsc2440 or rs01355 SWALL:Q8XWN3 (EMBL:AL646070) (311 aa) fasta scores: E(): 4.7e-81, 75.94% id in 316 aa
YP_107549.1	Similar to the C-terminal region of Pseudomonas aeruginosa high-affinity branched-chain amino acid transport system permease BraE or pa1072 SWALL:BRAE_PSEAE (SWALL:P21628) (417 aa) fasta scores: E(): 3.3e-41, 44.56% id in 359 aa. Full length CDS is similar to and to Ralstonia solanacearum probable amino-acid transmembrane ABC transporter protein rsc2439 or rs02663 SWALL:Q8XWN4 (EMBL:AL646070) (378 aa) fasta scores: E(): 1.2e-100, 68.08% id in 376 aa
YP_107550.1	Similar to Streptococcus pneumoniae R6 ABC transporter ATP-binding protein-branched chain amino acid transport LivG SWALL:AAK99466 (EMBL:AE008443) (254 aa) fasta scores: E(): 8.6e-36, 50.4% id in 248 aa, and to Ralstonia solanacearum probable amino acid ATP-binding ABC transporter protein rsc2438 or rs02664 SWALL:Q8XWN5 (EMBL:AL646070) (257 aa) fasta scores: E(): 1.4e-64, 81.71% id in 257 aa, and to Ralstonia solanacearum probable amino-acid ATP-binding ABC transporter protein rsp0016 or rs01988 SWALL:Q8XTT8 (EMBL:AL646076) (265 aa) fasta scores: E(): 2.6e-40, 54.25% id in 247 aa; Possible branched-chain amino acid transporter
YP_107551.1	Similar to Pseudomonas aeruginosa high-affinity branched-chain amino acid transport ATP-binding protein BraG or pa1070 SWALL:BRAG_PSEAE (SWALL:P21630) (233 aa) fasta scores: E(): 1e-36, 49.14% id in 234 aa, and to Ralstonia solanacearum probable amino acid ATP-binding ABC transporter protein rsc2437 or rs02666 SWALL:Q8XWN6 (EMBL:AL646070) (244 aa) fasta scores: E(): 5.1e-61, 78.99% id in 238 aa, and to Thermotoga maritima branched chain amino acid ABC transporter ATP-binding protein tm1139 SWALL:Q9X0M3 (EMBL:AE001771) (239 aa) fasta scores: E(): 1.1e-41, 54.43% id in 237 aa
YP_107552.1	Poor database matches. Weakly similar to Ralstonia solanacearum hypothetical protein rsc1547 or rs05234 SWALL:Q8XZ57 (EMBL:AL646065) (242 aa) fasta scores: E(): 0.71, 25.4% id in 248 aa
YP_107553.1	Similar to Yersinia pestis  acetyltransferase ypo3031 SWALL:Q8ZCG0 (EMBL:AJ414155) (141 aa) fasta scores: E(): 5e-16, 41.25% id in 143 aa, and to Escherichia coli O157:H7 hypothetical protein Z3699 z3699 or ecs3305 SWALL:Q8XBI6 (EMBL:AE005473) (178 aa) fasta scores: E(): 1.8e-15, 41.49% id in 147 aa
YP_107554.1	DapATase; functions in arginine biosynthetic pathway; catalyzes the formation of N-acetyl-L-glutamate 5-semialdehyde from 2-oxoglutarate and N(2)-acetyl-L-ornithine
YP_107555.1	catalyzes the formation of 3,6-dideoxy-D-glycero-D-glycero-4-hexulose
YP_107556.1	Similar to Ralstonia solanacearum  oxidoreductase rsc2433 or rs02671 SWALL:Q8XWP0 (EMBL:AL646070) (341 aa) fasta scores: E(): 6.2e-62, 59.69% id in 330 aa, and to Rhizobium loti hypothetical protein mlr4637 SWALL:Q98DM4 (EMBL:AP003004) (299 aa) fasta scores: E(): 1.2e-12, 32.39% id in 321 aa
YP_107558.1	Similar to Escherichia coli, and Escherichia coli O157:H7 ribosomal small subunit pseudouridine synthase A RsuA or b2183 or z3442 or ecs3075 SWALL:RSUA_ECOLI (SWALL:P33918) (231 aa) fasta scores: E(): 1.3e-22, 37.44% id in 235 aa, and to Ralstonia solanacearum probable ribosomal small subunit pseudouridine synthase A protein RsuA or rsc0674 or rs01579 SWALL:Q8Y1L6 (EMBL:AL646060) (252 aa) fasta scores: E(): 5.2e-50, 58.12% id in 234 aa, and to Neisseria meningitidis  ribosomal small subunit pseudouridine synthase nma1508 or nmb1298 SWALL:Q9JQL5 (EMBL:AL162756) (230 aa) fasta scores: E(): 2.4e-34, 43.91% id in 230 aa
YP_107559.1	Similar to Escherichia coli copper resistance protein C precursor PcoC SWALL:PCOC_ECOLI (SWALL:Q47454) (126 aa) fasta scores: E(): 1.7e-07, 35.15% id in 128 aa, and to Salmonella typhimurium  homolog of Cu resistance protein CopC yobA or stm1875 SWALL:Q8ZNX1 (EMBL:AE008783) (124 aa) fasta scores: E(): 8.2e-10, 37.09% id in 124 aa
YP_107560.1	Similar to Neisseria meningitidis LysR family transcriptional regulator CrgA SWALL:Q9JPU9 (EMBL:AF190471) (299 aa) fasta scores: E(): 9.6e-35, 39.72% id in 292 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa3124 SWALL:Q9HZA0 (EMBL:AE004736) (303 aa) fasta scores: E(): 4.9e-63, 57.96% id in 295 aa, and to Rhizobium loti transcriptional regulator mll4082 SWALL:Q98EU3 (EMBL:AP003003) (301 aa) fasta scores: E(): 3.6e-62, 56.56% id in 297 aa
YP_107561.1	Similar to Pectobacterium carotovorum subsp. atrosepticum regulator of exoenzyme virulence factors HexA SWALL:O85276 (EMBL:AF057064) (316 aa) fasta scores: E(): 1.1e-24, 32.54% id in 298 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa3995 SWALL:Q9HX26 (EMBL:AE004817) (297 aa) fasta scores: E(): 5.9e-77, 71.23% id in 292 aa, and to Streptomyces coelicolor LysR-type transcriptional regulator sco6555 or sc4b5.05C SWALL:Q9ZBW3 (EMBL:AL034443) (292 aa) fasta scores: E(): 5.8e-31, 41.42% id in 280 aa
YP_107562.1	Similar to Streptomyces antibioticus hydrolase SWALL:Q93F92 (EMBL:AF322256) (302 aa) fasta scores: E(): 1.3e-12, 29.56% id in 274 aa, and to Pseudomonas aeruginosa probable epoxide hydrolase pa3994 SWALL:Q9HX27 (EMBL:AE004817) (296 aa) fasta scores: E(): 8.8e-91, 71.18% id in 295 aa
YP_107563.1	Similar to Ralstonia solanacearum hypothetical protein rsc1157 or rs04594 SWALL:Q8Y087 (EMBL:AL646063) (241 aa) fasta scores: E(): 7.8e-50, 56.08% id in 230 aa, and to Xanthomonas axonopodis hypothetical protein xac1859 SWALL:AAM36721 (EMBL:AE011819) (237 aa) fasta scores: E(): 3.3e-46, 52.21% id in 226 aa
YP_107564.1	Similar to Methanopyrus kandleri dihydrodipicolinate synthase DapA or mk1607 SWALL:Q8TUZ4 (EMBL:AE010450) (300 aa) fasta scores: E(): 1.7e-25, 31.48% id in 289 aa, and to Pseudomonas aeruginosa probable dihydrodipicolinate synthetase pa0223 SWALL:Q9I6R5 (EMBL:AE004460) (293 aa) fasta scores: E(): 4e-68, 61.43% id in 293 aa, and to Vibrio sp. CH-291 hypothetical protein SWALL:Q93IK7 (EMBL:AJ314791) (295 aa) fasta scores: E(): 9.2e-63, 57.58% id in 290 aa
YP_107565.1	Similar to Pseudomonas aeruginosa probable aldolase pa0224 SWALL:Q9I6R4 (EMBL:AE004460) (260 aa) fasta scores: E(): 1e-76, 69.49% id in 259 aa, and to Vibrio sp. CH-291 hypothetical protein SWALL:Q93IK8 (EMBL:AJ314791) (259 aa) fasta scores: E(): 2e-71, 65.63% id in 259 aa, and to Streptomyces sphaeroides NovR SWALL:Q9L9F0 (EMBL:AF170880) (270 aa) fasta scores: E(): 2.1e-15, 33.62% id in 232 aa
YP_107566.1	Similar to Ralstonia solanacearum  transcription regulator protein rsc1159 or rs04592 SWALL:Q8Y085 (EMBL:AL646063) (182 aa) fasta scores: E(): 3e-34, 62.35% id in 170 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa0225 SWALL:Q9I6R3 (EMBL:AE004460) (179 aa) fasta scores: E(): 3e-31, 55.17% id in 174 aa
YP_107567.1	Doubtful CDS. No significant database matches
YP_107568.1	Similar to Xanthomonas axonopodis hypothetical protein xac0625 SWALL:AAM35514 (EMBL:AE011690) (321 aa) fasta scores: E(): 1.4e-42, 39.62% id in 323 aa, and to Xanthomonas campestris hypothetical protein xcc3509 SWALL:AAM42779 (EMBL:AE012470) (321 aa) fasta scores: E(): 2.9e-42, 39.62% id in 323 aa
YP_107569.1	Similar to Methanosarcina mazei conserved protein mm3163 SWALL:AAM32859 (EMBL:AE013574) (53 aa) fasta scores: E(): 2.3e-06, 51.78% id in 56 aa
YP_107572.1	Similar to the C-terminal region of Xanthomonas campestris insertion element IS476 hypothetical 39.2 kDa protein SWALL:YI61_XANCV (SWALL:P25438) (346 aa) fasta scores: E(): 1.9e-46, 46.59% id in 264 aa, and to the full length Ralstonia solanacearum ISRso14-transposase OrfB protein SWALL:Q8XF72 (EMBL:AL646083) (275 aa) fasta scores: E(): 5.6e-57, 53.96% id in 252 aa
YP_107573.1	Similar to Rhizobium loti probable integrase mlr0958 SWALL:Q98LN1 (EMBL:AP002996) (417 aa) fasta scores: E(): 2.4e-12, 27.34% id in 267 aa, and to Caulobacter crescentus integrase/recombinase, phage integrase cc2681 SWALL:Q9A4Z1 (EMBL:AE005935) (432 aa) fasta scores: E(): 5.4e-10, 25.92% id in 270 aa
YP_107574.1	Internal region is similar to an internal region of Escherichia coli type I restriction enzyme EcoR124II R protein HsdR or Hsr SWALL:T1R1_ECOLI (SWALL:P10486) (1033 aa) fasta scores: E(): 0.00016, 22.65% id in 693 aa. Full length CDS is similar to Xanthomonas axonopodis type I restriction-modification system endonuclease xac2898 SWALL:AAM37743 (EMBL:AE011932) (1084 aa) fasta scores: E(): 2e-86, 41.17% id in 1059 aa
YP_107575.1	Similar to Brucella melitensis transporter bmeii0447 SWALL:Q8YCT1 (EMBL:AE009681) (309 aa) fasta scores: E(): 8.9e-63, 54.04% id in 309 aa, and to Streptomyces coelicolor hypothetical protein sco3509 or sce134.10 SWALL:Q9X865 (EMBL:AL049661) (320 aa) fasta scores: E(): 5.2e-43, 42.44% id in 311 aa
YP_107576.1	N-terminus is similar to the C-terminal region of Escherichia coli type I restriction enzyme EcoEI specificity protein HsdS or Hss SWALL:T1SE_ECOLI (SWALL:P19705) (594 aa) fasta scores: E(): 6.4e-07, 27.55% id in 196 aa. Full length CDS is similar to Methanosarcina mazei type I restriction-modification system specificity subunit mm2703 SWALL:AAM32399 (EMBL:AE013517) (440 aa) fasta scores: E(): 5.9e-20, 37.64% id in 178 aa
YP_107577.1	N-terminus is similar to the N-terminal region of Escherichia coli type I restriction enzyme ecoprrI M protein HsdM SWALL:T1MP_ECOLI (SWALL:Q47163) (520 aa) fasta scores: E(): 6.5e-09, 26.65% id in 469 aa. Full length CDS is similar to Caulobacter crescentus type I restriction-modification system, M subunit,  cc0620 SWALL:Q9AAH8 (EMBL:AE005738) (611 aa) fasta scores: E(): 6.7e-183, 75.36% id in 613 aa
YP_107578.1	Possible gene remnant. Weakly similar to the C-terminal region of Corynebacterium glutamicum integrase cgl1419 SWALL:BAB98812 (EMBL:AP005278) (304 aa) fasta scores: E(): 0.42, 28.71% id in 101 aa
YP_107579.1	Identical to Burkholderia cepacia insertion element IS407 hypothetical 10.0 kDa protein SWALL:YI74_BURCE (SWALL:P24580) (87 aa) fasta scores: E(): 3.7e-32, 100% id in 87 aa. Similar to Ralstonia solanacearum ISRso14-transposase orfA protein SWALL:Q8XGL4 (EMBL:AL646083) (87 aa) fasta scores: E(): 2.1e-29, 93.1% id in 87 aa
YP_107580.1	Similar to Bacteroides nodosus plasmid replication protein C RepC SWALL:Q9ETY6 (EMBL:Y19120) (283 aa) fasta scores: E(): 3e-31, 38.76% id in 276 aa, and to Salmonella typhi  plasmid replication protein HCM1.221 SWALL:Q935I4 (EMBL:AL513383) (283 aa) fasta scores: E(): 1.4e-30, 38.62% id in 277 aa
YP_107581.1	Similar to an internal region of Bbcteriophage P4 hypothetical protein SWALL:Y9K_BPP4 (SWALL:P12552) (88 aa) fasta scores: E(): 0.0049, 47.36% id in 38 aa
YP_107582.1	Doubtful CDS. No significant database matches
YP_107583.1	Similar to Escherichia coli, and Escherichia coli O157:H7 cys regulon transcriptional activator CysB or b1275 or z2535 or ecs1847 SWALL:CYSB_ECOLI (SWALL:P06613) (324 aa) fasta scores: E(): 1.8e-49, 44.73% id in 304 aa, and to Ralstonia solanacearum  cys regulon transcriptional activator-related transcription regulator protein CysB2 or rsc2427 or rs02682 SWALL:Q8XWP6 (EMBL:AL646070) (313 aa) fasta scores: E(): 5.8e-88, 73.48% id in 313 aa, and to Neisseria meningitidis cys regulon transcriptional activator nmb0381 SWALL:Q9K116 (EMBL:AE002394) (316 aa) fasta scores: E(): 3.9e-58, 51.3% id in 306 aa
YP_107584.1	Similar to Pseudomonas aeruginosa sulfite reductase CysI SWALL:O31037 (EMBL:AF026066) (552 aa) fasta scores: E(): 9.2e-145, 64.91% id in 553 aa, and to Ralstonia solanacearum probable sulfite reductase oxidoreductase CysI1 or rsc2425 or rs02684 SWALL:Q8XWP8 (EMBL:AL646070) (553 aa) fasta scores: E(): 3.4e-169, 73.65% id in 558 aa, and to Pseudomonas aeruginosa sulfite reductase CysI or pa1838 SWALL:Q9I2Q7 (EMBL:AE004609) (552 aa) fasta scores: E(): 9.9e-152, 67.26% id in 553 aa
YP_107585.1	Similar to Ralstonia solanacearum hypothetical protein rsc2424 or rs02687 SWALL:Q8XWP9 (EMBL:AL646070) (194 aa) fasta scores: E(): 1.3e-33, 57.39% id in 169 aa, and to Pseudomonas aeruginosa hypothetical protein Pa1837 pa1837 SWALL:Q9I2Q8 (EMBL:AE004609) (165 aa) fasta scores: E(): 9.1e-32, 55.23% id in 172 aa
YP_107586.1	catalyzes the reduction of 3'-phosphoadenylyl sulfate into sulfite
YP_107587.1	with CysN catalyzes the formation of adenylylsulfate from sulfate and ATP
YP_107588.1	Similar to Escherichia coli sulfate adenylyltransferase subunit 1 CysN or b2751 SWALL:CYSN_ECOLI (SWALL:P23845) (475 aa) fasta scores: E(): 3.4e-47, 49.06% id in 426 aa, and to Ralstonia solanacearum probable sulfate adenylyltransferase subunit 1 protein rsc2421 or rs02692 SWALL:Q8XWQ2 (EMBL:AL646070) (435 aa) fasta scores: E(): 2.3e-111, 71.69% id in 431 aa
YP_107589.1	catalyzes 2 sequential methylations, the formation of precorrin-1 and S-adenosyl-L-homocysteine from S-adenosyl-L-methionine and uroporphyrin III, and the formation of precorrin-2 and S-adenosyl-L-homocysteine from S-adenosyl-L-methionine and precorrin-1
YP_107590.1	Similar to Ralstonia solanacearum hypothetical protein rsc2418 or rs02695 SWALL:Q8XWQ5 (EMBL:AL646070) (123 aa) fasta scores: E(): 8.2e-27, 64.46% id in 121 aa
YP_107591.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc2417 or rs02697 SWALL:Q8XWQ6 (EMBL:AL646070) (401 aa) fasta scores: E(): 3.2e-38, 58.83% id in 396 aa, and to Neisseria meningitidis hypothetical protein nmb1571 SWALL:Q9JYI5 (EMBL:AE002507) (356 aa) fasta scores: E(): 1.1e-14, 33.5% id in 382 aa, and to Escherichia coli hypothetical protein b4262 SWALL:YJGQ_ECOLI (SWALL:P39341) (360 aa) fasta scores: E(): 2.9e-09, 27.96% id in 379 aa
YP_107592.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc2416 or rs02698 SWALL:Q8XWQ7 (EMBL:AL646070) (372 aa) fasta scores: E(): 3.6e-68, 50.71% id in 349 aa, and to Neisseria meningitidis hypothetical protein nmb1570 SWALL:Q9JYI6 (EMBL:AE002507) (371 aa) fasta scores: E(): 1.6e-40, 34.27% id in 356 aa, and to Escherichia coli, and Escherichia coli O157:H7 hypothetical protein YjgP or b4261 or z5873 or ecs5238 SWALL:YJGP_ECOLI (SWALL:P39340) (366 aa) fasta scores: E(): 1.8e-26, 29.15% id in 367 aa
YP_107593.1	catalyzes the removal of N-terminal amino acids preferably leucine from various peptides
YP_107594.1	binds to single-strand binding (SSB) protein and acts as a bridge between the DnaX clamp loader complex and the SSB
YP_107596.1	Similar to Nitrosomonas europaea cytochrome c-552 precursor Cyt SWALL:C552_NITEU (SWALL:P95339) (103 aa) fasta scores: E(): 5e-12, 44.86% id in 107 aa, and to Ralstonia solanacearum probable cytochrome c transmembrane protein rsc3260 or rs02489 SWALL:Q8XUD1 (EMBL:AL646074) (141 aa) fasta scores: E(): 8.7e-12, 35.83% id in 120 aa. Possible alternative translational start site
YP_107597.1	catalyzes the dehydration of 2,3-dihydroxy-3-methylbutanoate to 3-methyl-2-oxobutanoate in valine and isoleucine biosynthesis
YP_107598.1	Similar to Caulobacter crescentus isoleucine biosynthesis transcriptional activator IlvR or cc3045 SWALL:ILVR_CAUCR (SWALL:P52670) (296 aa) fasta scores: E(): 4.4e-49, 53.52% id in 312 aa, and to Ralstonia solanacearum probable transcription regulator protein rsc2411 or rs02707 SWALL:Q8XWR2 (EMBL:AL646070) (311 aa) fasta scores: E(): 2.7e-57, 61.93% id in 310 aa, and to Bacillus subtilis als operon regulatory protein AlsR SWALL:ALSR_BACSU (SWALL:Q04778) (302 aa) fasta scores: E(): 2.1e-30, 38.18% id in 309 aa
YP_107599.1	transfers the N-acyl diglyceride moiety to the prospective N-terminal cysteine in prolipoprotein
YP_107600.1	Similar to Ralstonia solanacearum hypothetical signal peptide protein rsc2404 or rs02714 SWALL:Q8XWR6 (EMBL:AL646070) (221 aa) fasta scores: E(): 4.5e-24, 53.37% id in 163 aa, and to Pseudomonas aeruginosa hypothetical protein pa4495 SWALL:Q9HVS6 (EMBL:AE004863) (236 aa) fasta scores: E(): 2.3e-19, 36.29% id in 248 aa; Downstream repeat region(cggagca)4 and (cggacacggaca)3
YP_107601.1	Similar to Ralstonia solanacearum hypothetical protein rsc2403 or rs02715 SWALL:Q8XWR7 (EMBL:AL646070) (168 aa) fasta scores: E(): 2.2e-43, 72.84% id in 151 aa, and to Xanthomonas campestris hypothetical protein xcc3264 SWALL:Q8P5S2 (EMBL:AE012443) (147 aa) fasta scores: E(): 2.9e-30, 59.31% id in 145 aa. Possible alternative translational start site
YP_107602.1	Similar to Ralstonia solanacearum hypothetical protein rsc2402 or rs02716 SWALL:Q8XWR8 (EMBL:AL646070) (105 aa) fasta scores: E(): 1.1e-11, 44.55% id in 101 aa, and to Pasteurella multocida hypothetical protein pm1722 SWALL:Q9CKA3 (EMBL:AE006208) (100 aa) fasta scores: E(): 8.4e-06, 32% id in 100 aa
YP_107603.1	Similar to Ralstonia solanacearum hypothetical protein rsc2401 or rs02717 SWALL:Q8XWR9 (EMBL:AL646070) (106 aa) fasta scores: E(): 2.9e-06, 45.21% id in 115 aa; Upstream repeat region (cgc)4
YP_107604.1	Similar to Ralstonia solanacearum probable outer membrane receptor protein rsc2400 or rs02718 SWALL:Q8XWS0 (EMBL:AL646070) (621 aa) fasta scores: E(): 5.2e-91, 49.1% id in 615 aa, and to Salmonella typhimurium vitamin B12 receptor precursor BtuB or stm4130 SWALL:BTUB_SALTY (SWALL:P37409) (614 aa) fasta scores: E(): 2.7e-32, 28.52% id in 603 aa. CDS is extended at the N-terminus in comparison to orthologues
YP_107605.1	Similar to Pseudomonas aeruginosa ABC-type permease PhuU SWALL:O68878 (EMBL:AF055999) (326 aa) fasta scores: E(): 5.1e-33, 45.06% id in 324 aa, and to Ralstonia solanacearum probable transmembrane ABC transporter protein rsc2399 or rs02719 SWALL:Q8XWS1 (EMBL:AL646070) (335 aa) fasta scores: E(): 1.4e-60, 58.51% id in 323 aa
YP_107606.1	Similar to Ralstonia solanacearum probable ATP-binding ABC transporter protein rsc2398 or rs02720 SWALL:Q8XWS2 (EMBL:AL646070) (279 aa) fasta scores: E(): 3.4e-40, 52.45% id in 265 aa, and to Yersinia enterocolitica ferric enterochelin transport ATP-binding protein FepC SWALL:Q9X3S3 (EMBL:AF082879) (272 aa) fasta scores: E(): 2.4e-20, 35.71% id in 266 aa
YP_107607.1	catalyzes the synthesis of alpha-ribazole-5'-phosphate from nicotinate mononucleotide and 5,6-dimethylbenzimidazole
YP_107608.1	catalyzes the formation of adenosylcobalamin from Ado-cobinamide-GDP and alpha-ribazole
YP_107609.1	Similar to Ralstonia solanacearum hypothetical protein rsc2395 or rs02727 SWALL:Q8XWS5 (EMBL:AL646069) (192 aa) fasta scores: E(): 1.3e-22, 43.09% id in 181 aa, and to Rhodobacter capsulatus BluF protein SWALL:O68088 (EMBL:AF010496) (195 aa) fasta scores: E(): 2.5e-06, 38.33% id in 180 aa, and to Escherichia coli alpha-ribazole-5'-phosphate phosphatase CobC or PhpB or b0638 SWALL:COBC_ECOLI (SWALL:P52086) (203 aa) fasta scores: E(): 7.1e-05, 29.94% id in 187 aa
YP_107611.1	Similar to Salmonella typhimurium vitamin B12 transport protein BtuF or stm0206 SWALL:BTUF_SALTY (SWALL:Q8ZRP7) (266 aa) fasta scores: E(): 1.3e-20, 38.03% id in 255 aa, and to Ralstonia solanacearum probable substrate-binding periplasmic rsc2394 or rs02728 SWALL:Q8XWS6 (EMBL:AL646069) (313 aa) fasta scores: E(): 6.9e-67, 59.54% id in 309 aa, and to Escherichia coli vitamin B12 transport protein BtuF or b0158 SWALL:BTUF_ECOLI (SWALL:P37028) (266 aa) fasta scores: E(): 2.8e-22, 38.03% id in 255 aa
YP_107612.1	cobalamin biosynthesis protein; decarboxylates L-threonine-O-3-phosphate to yield (R)-1-amino-2-propanol O-2-phosphate, the precursor for the linkage between the nucleotide loop and the corrin ring in cobalamin; structurally similar to histidinol phosphate aminotransferase
YP_107613.1	CobD; CbiD in Salmonella; converts cobyric acid to cobinamide by the addition of aminopropanol on the F carboxylic group
YP_107614.1	Similar to Pseudomonas denitrificans bifunctional cobalamin biosynthesis protein [includes: cobinamide kinase; cobinamide phosphate guanylyltransferase] CobP SWALL:COBP_PSEDE (SWALL:P29931) (173 aa) fasta scores: E(): 1.1e-25, 46.78% id in 171 aa, and to Ralstonia solanacearum probable cobalamin biosynthesis bifunctional protein: cobinamide kinase and cobinamide phosphate guanylyltransferase CobP or rsc2391 or rs02758 SWALL:Q8XWS9 (EMBL:AL646069) (193 aa) fasta scores: E(): 1.8e-31, 55.49% id in 191 aa, and to Escherichia coli, and Escherichia coli O157:H7 bifunctional cobalamin biosynthesis protein [includes: cobinamide kinase; cobinamide phosphate guanylyltransferase] b1993 or z3153 or ecs2788 SWALL:COBU_ECOLI (SWALL:P46886) (181 aa) fasta scores: E(): 1.8e-19, 41.98% id in 181 aa; Upstream repeat region (gccaacgccaac)4
YP_107615.1	catalyzes amidations at positions B, D, E, and G on adenosylcobyrinic A,C-diamide. NH(2) groups are provided by glutamine, and one molecule of ATP is hydrogenolyzed for each amidation
YP_107616.1	Similar to Xanthomonas axonopodis hypothetical protein xac3707 SWALL:Q8PGB0 (EMBL:AE012020) (136 aa) fasta scores: E(): 3.2e-20, 55.28% id in 123 aa
YP_107617.1	Similar to Pseudomonas alcaligenes plasmid pRA2 ParA homolog SWALL:Q9XAW8 (EMBL:U88088) (212 aa) fasta scores: E(): 3.8e-09, 32.1% id in 190 aa, and to Ralstonia solanacearum  partition-related protein rsc2389 or rs02760 SWALL:Q8XWT1 (EMBL:AL646069) (217 aa) fasta scores: E(): 2e-48, 65.68% id in 204 aa, and to Xanthomonas campestris partition protein xcc0174 SWALL:AAM39493 (EMBL:AE012113) (210 aa) fasta scores: E(): 9.4e-17, 32.86% id in 213 aa
YP_107618.1	Converts L-aspartate to beta-alanine and provides the major route of beta-alanine production in bacteria. Beta-alanine is essential for the biosynthesis of pantothenate (vitamin B5)
YP_107619.1	catalyzes the formation of (R)-pantothenate from pantoate and beta-alanine
YP_107620.1	Similar to Ralstonia solanacearum hypothetical protein rsc2386 or rs02764 SWALL:Q8XWT4 (EMBL:AL646069) (293 aa) fasta scores: E(): 5.2e-85, 81.52% id in 276 aa, and to Neisseria meningitidis hypothetical protein nmb1504 SWALL:Q9JYN0 (EMBL:AE002500) (284 aa) fasta scores: E(): 3.6e-49, 54.44% id in 270 aa. CDS is extended at the N-terminus in comparison to some orthologues
YP_107621.1	Similar to Ralstonia solanacearum hypothetical protein rsc2385 or rs02765 SWALL:Q8XWT5 (EMBL:AL646069) (62 aa) fasta scores: E(): 3.3e-11, 64.28% id in 56 aa, and to Neisseria meningitidis hypothetical protein nma1654 SWALL:Q9JTS3 (EMBL:AL162756) (61 aa) fasta scores: E(): 3.1e-06, 45.76% id in 59 aa
YP_107622.1	C-terminal region is similar to Ralstonia solanacearum  lipoprotein rsc2384 or rs02766 SWALL:Q8XWT6 (EMBL:AL646069) (589 aa) fasta scores: E(): 7.4e-108, 48.16% id in 571 aa, and to the C-terminal region of Neisseria meningitidis  outer membrane protein nma0296 SWALL:Q9JWM5 (EMBL:AL162752) (615 aa) fasta scores: E(): 3.7e-43, 28.26% id in 566 aa
YP_107623.1	Similar to Ralstonia solanacearum  signal peptide protein rsc2383 or rs06185 SWALL:Q8XWT7 (EMBL:AL646069) (1299 aa) fasta scores: E(): 3.6e-120, 42.81% id in 1371 aa, and to Neisseria meningitidis hypothetical protein nmb2135 SWALL:Q9JXB6 (EMBL:AE002561) (1405 aa) fasta scores: E(): 8.4e-29, 26.91% id in 1475 aa
YP_107624.1	Similar to Anabaena sp. hypothetical protein all0326 SWALL:Q8YZX8 (EMBL:AP003582) (224 aa) fasta scores: E(): 1.4e-07, 26.14% id in 218 aa
YP_107625.1	Similar to Streptomyces argillaceus O-methyltransferase MtmMI SWALL:Q9R6R8 (EMBL:AF077869) (345 aa) fasta scores: E(): 1.6e-15, 29.54% id in 308 aa, and to Streptomyces sp. JP95  methyltransferase GrhL SWALL:AAM33664 (EMBL:AF509565) (343 aa) fasta scores: E(): 1.8e-20, 30.35% id in 313 aa, and to Bos taurus hydroxyindole O-methyltransferase ASMT SWALL:HIOM_BOVIN (SWALL:P10950) (345 aa) fasta scores: E(): 1.3e-19, 30.44% id in 335 aa
YP_107626.1	methionine--tRNA ligase; MetRS; adds methionine to tRNA(Met) with cleavage of ATP to AMP and diphosphate; some MetRS enzymes form dimers depending on a C-terminal domain that is also found in other proteins such as Trbp111 in Aquifex aeolicus and the cold-shock protein CsaA from Bacillus subtilis while others do not; four subfamilies exist based on sequence motifs and zinc content
YP_107627.1	Similar to Pseudomonas syringae outer membrane porin F precursor OprF SWALL:PORF_PSESY (SWALL:P22263) (344 aa) fasta scores: E(): 1.4e-08, 36.57% id in 175 aa, and to Ralstonia solanacearum probable transmembrane protein rsc2380 or rs01165 SWALL:Q8XWU0 (EMBL:AL646069) (209 aa) fasta scores: E(): 2.2e-33, 57.69% id in 208 aa
YP_107628.1	Similar to Escherichia coli Mrp protein or b2113 SWALL:MRP_ECOLI (SWALL:P21590) (369 aa) fasta scores: E(): 1.5e-62, 54% id in 337 aa, and to Ralstonia solanacearum probable ATP-binding protein Mrp or rsc2379 or rs01166 SWALL:Q8XWU1 (EMBL:AL646069) (362 aa) fasta scores: E(): 2e-93, 72.65% id in 362 aa
YP_107629.1	Similar although longer in its N-terminal region than Xanthomonas campestris pv. campestris str. ATCC33913 superoxide dismutase SodC2 SWALL:AAM39510 (EMBL:AE012115) (165 aa) fasta scores: E(): 7.1e-15, 43.44% id in 145 aa, and to Ovis aries superoxide dismutase [Cu-Zn] Sod1 SWALL:SODC_SHEEP (SWALL:P09670) (151 aa) fasta scores: E(): 1.4e-08, 37.03% id in 135 aa
YP_107630.1	Catalyzes the formation of dUTP from dCTP in thymidylate biosynthesis
YP_107631.1	Similar to, although longer in its N-terminal region than, Escherichia coli ornithine decarboxylase, inducible SpeF or b0693 SWALL:DCOS_ECOLI (SWALL:P24169) (732 aa) fasta scores: E(): 4.5e-73, 32.64% id in 680 aa, and to Ralstonia solanacearum probable biodegradative arginine decarboxylase rsc2365 or rs01181 SWALL:Q8XWV5 (EMBL:AL646069) (759 aa) fasta scores: E(): 1.1e-198, 79.68% id in 768 aa
YP_107633.1	Similar to Vibrio cholerae CbbY family protein vca0102 SWALL:Q9KN63 (EMBL:AE004353) (219 aa) fasta scores: E(): 2.9e-21, 39.81% id in 211 aa, and to Escherichia coli protein YfbT or b2293 SWALL:YFBT_ECOLI (SWALL:P77625) (216 aa) fasta scores: E(): 5.4e-11, 34.29% id in 207 aa
YP_107634.1	catalyzes the formation of arginine from (N-L-arginino)succinate
YP_107635.1	Similar, although shorter in its N-terminal region, to Escherichia coli outer membrane usher protein precursor FanD SWALL:FAND_ECOLI (SWALL:P12050) (783 aa) fasta scores: E(): 7.7e-14, 23.63% id in 732 aa, and to Ralstonia solanacearum probable signal peptide protein rsp1498 or rs03043 SWALL:Q8XPY8 (EMBL:AL646085) (786 aa) fasta scores: E(): 2.6e-122, 46.55% id in 769 aa. Possible gene remnant
YP_107636.1	Similar to, although shorted in its N-terminal region than, Escherichia coli chaperone protein precursor EcpD or b0140 SWALL:ECPD_ECOLI (SWALL:P33128) (246 aa) fasta scores: E(): 0.00033, 30.58% id in 206 aa, and to Ralstonia solanacearum  pili assembly chaperone transmembrane protein rsp1499 or rs03042 SWALL:Q8XPY7 (EMBL:AL646085) (241 aa) fasta scores: E(): 7.3e-28, 44% id in 225 aa
YP_107637.1	Similar to Ralstonia solanacearum probable signal peptide protein rsp1500 or rs03041 SWALL:Q8XPY6 (EMBL:AL646085) (173 aa) fasta scores: E(): 1e-30, 62.65% id in 166 aa, and to Agrobacterium tumefaciens hypothetical protein atu4733 or agr_l_295 SWALL:Q8U6S3 (EMBL:AE009401) (177 aa) fasta scores: E(): 1.4e-20, 43.01% id in 186 aa
YP_107638.1	Similar to Agrobacterium tumefaciens hypothetical protein atu4730 or agr_l_303 SWALL:Q8U6S6 (EMBL:AE009401) (316 aa) fasta scores: E(): 8e-32, 39.75% id in 327 aa, and to Xanthomonas axonopodis pv. citri str. 306 conserved hypothetical protein xac1424 SWALL:AAM36295 (EMBL:AE011774) (342 aa) fasta scores: E(): 1.1e-16, 35.04% id in 351 aa
YP_107639.1	Similar to Rhizobium loti hypothetical protein mll1636 SWALL:Q98K51 (EMBL:AP002997) (290 aa) fasta scores: E(): 1.1e-36, 43.13% id in 262 aa, and to Rhizobium loti probable DNA-binding protein mlr2155 SWALL:Q98J14 (EMBL:AP002999) (276 aa) fasta scores: E(): 2.6e-27, 39.92% id in 253 aa
YP_107640.1	Similar to Serratia marcescens biotin synthesis protein BioC SWALL:BIOC_SERMA (SWALL:P36571) (255 aa) fasta scores: E(): 2.9e-07, 34.13% id in 167 aa, and to Salmonella typhimurium  methyltransferase in menaquinone/biotin biosynthesis YafE or stm0259 SWALL:Q8ZRM3 (EMBL:AE008706) (256 aa) fasta scores: E(): 7.8e-44, 52.77% id in 252 aa
YP_107641.1	catalyzes the formation of oxaloacetate from phosphoenolpyruvate
YP_107642.1	Doubtful CDS. No significant database matches
YP_107643.1	transformation of porphobilinogen to hydroxymethylbilane in porphyrin biosynthesis
YP_107644.1	catalyzes the formation of uroporphyrinogen-III from hydroxymethylbilane and the formation of precorrin-2 from uroporphyrin III and S-adenosyl-L-methionine by two sequential methylation reactions; functions in tetrapyrrole and heme biosynthesis
YP_107645.1	Similar to Escherichia coli, and Escherichia coli O157:H7 HemY protein or b3802 or z5316 or ecs4732 SWALL:HEMY_ECOLI (SWALL:P09128) (398 aa) fasta scores: E(): 3.8e-08, 23.27% id in 391 aa, and to Ralstonia solanacearum  protein porphyrin biosynthesis rsc2355 or rs01191 SWALL:Q8XWW5 (EMBL:AL646069) (397 aa) fasta scores: E(): 2e-69, 50.63% id in 393 aa
YP_107646.1	Similar to Agrobacterium vitis  tartrate transporter TtuB SWALL:TUB3_AGRVI (SWALL:P70786) (449 aa) fasta scores: E(): 4.4e-75, 48.32% id in 418 aa, and to Ralstonia solanacearum probable permease transmembrane protein rsc2352 or rs01194 SWALL:Q8XWW8 (EMBL:AL646069) (442 aa) fasta scores: E(): 1.2e-121, 72.1% id in 441 aa
YP_107647.1	Catalyzes the first of the two reduction steps in the elongation cycle of fatty acid synthesis
YP_107648.1	Similar to Escherichia coli  aldehyde dehydrogenase AldH or b1300 SWALL:DHAL_ECOLI (SWALL:P23883) (495 aa) fasta scores: E(): 2.3e-61, 41.12% id in 479 aa, and to Ralstonia solanacearum probable aldehyde dehydrogenase oxidoreductase rsc2350 or rs01196 SWALL:Q8XWX0 (EMBL:AL646069) (478 aa) fasta scores: E(): 5.1e-138, 73.31% id in 476 aa
YP_107649.1	catalyzes the hydrolysis of pyrophosphate to phosphate
YP_107650.1	Possible gene remnant. Only N-terminal region similar to Xanthomonas axonopodis pv. citri str. 306 conserved hypothetical protein xac3202 SWALL:AAM38046 (EMBL:AE011966) (102 aa) fasta scores: E(): 3.9e-06, 49.46% id in 93 aa, and to Escherichia coli hypothetical protein YhbQ or b3155 SWALL:YHBQ_ECOLI (SWALL:P45472) (100 aa) fasta scores: E(): 0.00018, 44.89% id in 98 aa. C-terminal region presents no database matches
YP_107651.1	Similar to Ralstonia solanacearum hypothetical protein rsc2348 or rs01198 SWALL:Q8XWX2 (EMBL:AL646069) (408 aa) fasta scores: E(): 1.1e-98, 62.43% id in 394 aa, and to Pseudomonas aeruginosa hypothetical protein pa3230 SWALL:Q9HZ10 (EMBL:AE004746) (374 aa) fasta scores: E(): 2.4e-63, 47.48% id in 377 aa
YP_107652.1	NH(3)-dependent; catalyzes the formation of nicotinamide adenine dinucleotide (NAD) from nicotinic acid adenine dinucleotide (NAAD) using either ammonia or glutamine as the amide donor and ATP; ammonia-utilizing enzymes include the ones from Bacillus and Escherichia coli while glutamine-utilizing enzymes include the Mycobacterial one; forms homodimers
YP_107653.1	Similar to Escherichia coli, Escherichia coli O157:H7, Salmonella typhimurium, and Salmonella typhi nitrogen regulatory protein P-II 1 GlnB or b2553 or z3829 or ecs3419 or stm2561 or sty2808 SWALL:GLNB_ECOLI (SWALL:P05826) (112 aa) fasta scores: E(): 3.1e-30, 77.67% id in 112 aa, and to Ralstonia solanacearum probable nitrogen regulatory P-II transcription regulator protein rsc2345 or rs01201 SWALL:Q8XWX5 (EMBL:AL646069) (112 aa) fasta scores: E(): 6.7e-32, 83.92% id in 112 aa
YP_107654.1	Highly similar to to Bordetella parapertussis transposase for insertion sequence element IS1001 TnpA SWALL:TNPA_BORPA (SWALL:Q06126) (406 aa) fasta scores: E(): 2.5e-139, 78.57% id in 406 aa, and to Tnp SWALL:Q9FDC1 (EMBL:AF285635) (386 aa) fasta scores: E(): 1.5e-161, 99.22% id in 386 aa. CDS is extended at the N-terminus in comparison to B. mallei protein
YP_107655.1	Similar to Bordetella pertussis outer membrane porin protein precursor SWALL:OMP_BORPE (SWALL:Q04064) (385 aa) fasta scores: E(): 3.9e-11, 29.97% id in 387 aa, and to Ralstonia solanacearum probable porin signal peptide protein rsc2136 or rs01467 SWALL:Q8XXH8 (EMBL:AL646068) (352 aa) fasta scores: E(): 3.6e-43, 41.22% id in 376 aa
YP_107656.1	Similar to Escherichia coli histidine transport ATP-binding protein HisP or b2306 SWALL:HISP_ECOLI (SWALL:P07109) (257 aa) fasta scores: E(): 4.6e-62, 70.86% id in 254 aa, and to Pseudomonas aeruginosa arginine/ornithine transport ATP-binding protein pa0892 SWALL:AOTP_PSEAE (SWALL:O30506) (254 aa) fasta scores: E(): 4e-62, 71.76% id in 255 aa
YP_107657.1	Similar to Escherichia coli, and Escherichia coli O157:H7 histidine transport system permease HisM or b2307 or z3569 or ecs3191 SWALL:HISM_ECOLI (SWALL:P20091) (238 aa) fasta scores: E(): 3.6e-64, 67.09% id in 234 aa, and to Pseudomonas aeruginosa histidine transport system permease pa2925 SWALL:Q9HZS2 (EMBL:AE004718) (237 aa) fasta scores: E(): 6.9e-66, 68.93% id in 235 aa
YP_107658.1	Similar to Escherichia coli histidine transport system permease HisQ or b2308 SWALL:HISQ_ECOLI (SWALL:P52094) (228 aa) fasta scores: E(): 5.8e-53, 62.11% id in 227 aa, and to Pseudomonas aeruginosa histidine transport system permease pa2924 SWALL:Q9HZS3 (EMBL:AE004718) (229 aa) fasta scores: E(): 2.8e-57, 68.14% id in 226 aa
YP_107659.1	Similar to Escherichia coli, and Escherichia coli O157:H7 histidine-binding periplasmic protein precursor HisJ or b2309 or z3571 or ecs3193 SWALL:HISJ_ECOLI (SWALL:P39182) (260 aa) fasta scores: E(): 3.2e-55, 55.81% id in 258 aa, and to Salmonella typhi histidine-binding periplasmic protein sty2584 SWALL:Q8Z510 (EMBL:AL627274) (260 aa) fasta scores: E(): 7.6e-55, 55.81% id in 258 aa
YP_107660.1	Similar to Ralstonia solanacearum  pirin-like protein rsc2208 or rs01391 SWALL:Q8XXA8 (EMBL:AL646068) (232 aa) fasta scores: E(): 1.8e-53, 58.44% id in 231 aa, and to Lycopersicon esculentum pirin-like protein SWALL:PIRL_LYCES (SWALL:Q9SEE4) (291 aa) fasta scores: E(): 2.3e-09, 33.33% id in 171 aa
YP_107662.1	Similar to Escherichia coli, Escherichia coli O157:H7, Salmonella typhimurium, and Salmonella typhi transcriptional regulatory protein OmpR SWALL:OMPR_ECOLI (SWALL:P03025) (239 aa) fasta scores: E(): 5.3e-42, 52.15% id in 232 aa, and to Ralstonia solanacearum probable two component response regulator transcription regulator protein rsp1196 or rs03140 SWALL:Q8XQM6 (EMBL:AL646083) (245 aa) fasta scores: E(): 7.1e-56, 63.33% id in 240 aa
YP_107663.1	Similar to Escherichia coli osmolarity sensor protein EnvZ or OmpB or PerA or Tpo or b3404 SWALL:ENVZ_ECOLI (SWALL:P02933) (450 aa) fasta scores: E(): 1.9e-24, 29.69% id in 431 aa, and to Ralstonia solanacearum probable two component transmembrane sensor kinase transcription regulator protein rsp1195 or rs03139 SWALL:Q8XQM7 (EMBL:AL646083) (431 aa) fasta scores: E(): 2.2e-59, 44.86% id in 428 aa
YP_107665.1	Doubtful CDS. No significant database matches
YP_107666.1	Similar to Xylella fastidiosa ABC transporter nitrate permease xf0411 SWALL:Q9PG91 (EMBL:AE003892) (584 aa) fasta scores: E(): 9.1e-137, 58.16% id in 588 aa, and to Ralstonia solanacearum  transmembrane ABC transporter protein rsc3371 or rs02646 SWALL:Q8XU23 (EMBL:AL646075) (586 aa) fasta scores: E(): 1.6e-124, 53.6% id in 569 aa
YP_107667.1	Similar to Xylella fastidiosa nitrate ABC transporter ATP-binding protein xf0412 SWALL:Q9PG90 (EMBL:AE003892) (433 aa) fasta scores: E(): 4.1e-86, 61.79% id in 424 aa, and to Ralstonia solanacearum probable composite ATP-binding transmembrane ABC transporter protein rsc3372 or rs02647 SWALL:Q8XU22 (EMBL:AL646075) (449 aa) fasta scores: E(): 1.9e-67, 50.7% id in 426 aa
YP_107671.1	UDP-forming; Similar to Escherichia coli alpha,alpha-trehalose-phosphate synthase [UDP-forming] OtsA or b1896 SWALL:OTSA_ECOLI (SWALL:P31677) (473 aa) fasta scores: E(): 3.6e-95, 51.94% id in 464 aa, and to Ralstonia solanacearum probable alpha,alpha-trehalose-phosphate synthase rsp1105 or rs02613 SWALL:Q8XQW3 (EMBL:AL646082) (465 aa) fasta scores: E(): 2.4e-118, 63.93% id in 463 aa
YP_107672.1	Similar to Rhizobium loti hypothetical protein mlr1469 SWALL:Q98KH7 (EMBL:AP002997) (183 aa) fasta scores: E(): 4.1e-37, 59.64% id in 171 aa, and to Chlorobium tepidum TLS conserved hypothetical protein ct0928 SWALL:AAM72163 (EMBL:AE012858) (197 aa) fasta scores: E(): 3.2e-24, 45.97% id in 174 aa
YP_107675.1	Similar to Streptomyces glaucescens tetracenomycin C resistance and export protein TcmA SWALL:TCMA_STRGA (SWALL:P39886) (538 aa) fasta scores: E(): 6.1e-33, 31.17% id in 417 aa, and to Yersinia pestis  transport protein ypo1712 SWALL:Q8ZFJ1 (EMBL:AJ414150) (455 aa) fasta scores: E(): 1.7e-100, 61.77% id in 450 aa
YP_107676.1	Similar to Escherichia coli protein YbcL precursor or b0545 SWALL:YBCL_ECOLI (SWALL:P77368) (183 aa) fasta scores: E(): 5.1e-29, 49.39% id in 166 aa, and to Salmonella typhimurium  outer membrane protein stm1081 SWALL:Q8ZQ63 (EMBL:AE008747) (182 aa) fasta scores: E(): 3.1e-24, 47.2% id in 161 aa
YP_107678.1	No significant database matches. Rich in glycine amino acid residues
YP_107679.1	serine protease inhibitor, inhibits trypsin and other proteases
YP_107680.1	Similar to Escherichia coli penicillin-binding protein 7 precursor PbpG or b2134 SWALL:PBP7_ECOLI (SWALL:P33364) (313 aa) fasta scores: E(): 1.8e-32, 44.35% id in 257 aa, and to Ralstonia solanacearum D-alanyl-D-alanine-endopeptidase rsc1609 or rs03972 SWALL:Q8XYZ7 (EMBL:AL646065) (375 aa) fasta scores: E(): 7.6e-44, 45.56% id in 338 aa
YP_107681.1	Similar to Pseudomonas aeruginosa inhibitor of vertebrate lysozyme precursor Ivy or pa3902 SWALL:IVY_PSEAE (SWALL:Q9HXB1) (153 aa) fasta scores: E(): 2.1e-16, 33.55% id in 152 aa, and to Yersinia pestis hypothetical protein precursor ypo2857 SWALL:YS57_YERPE (SWALL:P58483) (154 aa) fasta scores: E(): 1.4e-19, 34.64% id in 153 aa
YP_107682.1	Similar to, although shorter in its N-terminal region than, Ralstonia solanacearum hypothetical protein rsc2240 or rs01359 SWALL:Q8XX76 (EMBL:AL646069) (96 aa) fasta scores: E(): 5e-05, 35.52% id in 76 aa
YP_107684.1	Very low similarity to the C-terminal region of Rhizobium loti hypothetical protein msl2450 SWALL:Q98ID6 (EMBL:AP002999) (97 aa) fasta scores: E(): 6.7, 35.41% id in 48 aa
YP_107685.1	stimulates the activities of the other two initiation factors, IF-2 and IF-3
YP_107687.1	Similar to the N-terminal region of Pseudomonas aeruginosa probable short-chain dehydrogenase pa3324 SWALL:Q9HYS1 (EMBL:AE004754) (592 aa) fasta scores: E(): 7.6e-35, 35.19% id in 304 aa, and to Mycobacterium tuberculosis probable oxidoreductase rv2214c or mt2270 or mtcy190.25c SWALL:EPHD_MYCTU (SWALL:Q10402) (592 aa) fasta scores: E(): 7.3e-26, 32.78% id in 302 aa
YP_107689.1	Similar to Acinetobacter calcoaceticus rubredoxin RubA SWALL:RUBR_ACICA (SWALL:P42453) (54 aa) fasta scores: E(): 4.1e-12, 55.76% id in 52 aa, and to Ralstonia solanacearum probable rubredoxin protein rsc0667 or rs01572 SWALL:Q8Y1M3 (EMBL:AL646060) (60 aa) fasta scores: E(): 3.6e-15, 55.93% id in 59 aa
YP_107690.1	Similar to Pseudomonas aeruginosa hypothetical protein pa0315 SWALL:Q9I6H6 (EMBL:AE004469) (145 aa) fasta scores: E(): 2.8e-15, 48.85% id in 131 aa
YP_107691.1	Similar to Escherichia coli ABC transporter ATP-binding protein Uup or b0949 SWALL:UUP_ECOLI (SWALL:P43672) (635 aa) fasta scores: E(): 8.9e-80, 47.9% id in 643 aa, and to Ralstonia solanacearum probable ATP-binding ABC transporter protein rsc0975 or rs04385 SWALL:Q8Y0R8 (EMBL:AL646062) (636 aa) fasta scores: E(): 3e-119, 70.74% id in 646 aa
YP_107692.1	decatenates newly replicated chromosomal DNA and relaxes positive and negative DNA supercoiling
YP_107693.1	decatenates newly replicated chromosomal DNA and relaxes positive and negative DNA supercoiling
YP_107694.1	Similar to Pseudomonas aeruginosa hypothetical protein pa1044 SWALL:Q9I4T0 (EMBL:AE004536) (154 aa) fasta scores: E(): 9.5e-16, 43.91% id in 148 aa
YP_107695.1	Similar to Pseudomonas aeruginosa transcriptional regulator PtxR or pa2258 SWALL:PTXR_PSEAE (SWALL:P72131) (312 aa) fasta scores: E(): 3.1e-10, 32.36% id in 275 aa, and to Ralstonia solanacearum  transcription regulator protein rsp1514 or rs04791 SWALL:Q8XPX2 (EMBL:AL646085) (294 aa) fasta scores: E(): 2.1e-79, 73.72% id in 293 aa
YP_107696.1	Similar to, although longer in its N-terminal region than, Ralstonia solanacearum hypothetical transmembrane protein rsp1513 or rs04790 SWALL:Q8XPX3 (EMBL:AL646085) (145 aa) fasta scores: E(): 7.6e-33, 62.06% id in 145 aa, and to Pseudomonas aeruginosa hypothetical protein pa2880 SWALL:Q9HZW7 (EMBL:AE004714) (171 aa) fasta scores: E(): 6.1e-28, 53.42% id in 146 aa (although BPSL10073 is shorter in its N-terminal region)
YP_107697.1	Similar to Rhizobium meliloti  transcriptional regulator, LysR family protein rb0846 or smb21180 SWALL:Q92V68 (EMBL:AL603645) (317 aa) fasta scores: E(): 2.4e-35, 37.83% id in 296 aa, and to Escherichia coli cyn operon transcriptional activator CynR or b0338 SWALL:CYNR_ECOLI (SWALL:P27111) (311 aa) fasta scores: E(): 1.8e-12, 28.01% id in 282 aa. Note: This CDS is longer in its N-terminal region than the database matches
YP_107698.1	Similar to Escherichia coli shikimate transporter ShiA or b1981 SWALL:SHIA_ECOLI (SWALL:P76350) (438 aa) fasta scores: E(): 2.5e-54, 40% id in 420 aa, and to Pseudomonas aeruginosa probable MFS transporter pa3595 SWALL:Q9HY31 (EMBL:AE004780) (469 aa) fasta scores: E(): 1.6e-65, 46.24% id in 413 aa
YP_107699.1	allantoate amidohydrolase and N-carbamoyl-L-amino acid amidohydrolase are very similar; the allantoate amidohydrolase from Escherichia coli forms a dimer and binds zinc ions for catalytic activity and catalyzes the conversion of allantoate to (S)-ureidoglycolate and ammonia; carbamoyl amidohydrolase from Bacillus sp. converts N-carbamoyl amino acids to amino acids, ammonia, and carbon dioxide
YP_107700.1	Similar to Rhizobium loti acetylpolyamine aminohydrolase mll0103 SWALL:Q98NK3 (EMBL:AP002994) (342 aa) fasta scores: E(): 3.1e-63, 48.67% id in 339 aa, and to Pseudomonas aeruginosa acetylpolyamine aminohydrolase pa1409 SWALL:Q9I3T5 (EMBL:AE004570) (346 aa) fasta scores: E(): 5.6e-47, 42.57% id in 350 aa
YP_107701.1	Similar to Alcaligenes eutrophus chromate transport protein ChrA SWALL:CHRA_ALCEU (SWALL:P17551) (401 aa) fasta scores: E(): 9.9e-12, 24.8% id in 387 aa, and to Bacillus halodurans chromate transporter bh0574 SWALL:Q9KFB1 (EMBL:AP001509) (397 aa) fasta scores: E(): 5.1e-19, 26.14% id in 394 aa
YP_107702.1	Similar in its C-terminal region to the C-terminal region of Ralstonia solanacearum hypothetical protein rsp1155 or rs05432 SWALL:Q8XQR6 (EMBL:AL646083) (915 aa) fasta scores: E(): 3.9e-66, 44.51% id in 447 aa, and similar in its full length to the C-terminal region of Pseudomonas aeruginosa hypothetical protein pa4601 SWALL:Q9HVI8 (EMBL:AE004874) (1415 aa) fasta scores: E(): 1.7e-59, 31.6% id in 753 aa
YP_107703.1	Similar to Erwinia chrysanthemi  antibiotic biosynthesis protein Pab SWALL:Q93KB5 (EMBL:AJ310612) (293 aa) fasta scores: E(): 2.4e-43, 50.5% id in 295 aa, and to Xanthomonas axonopodis pv. citri str. 306 conserved hypothetical protein xac2912 SWALL:AAM37757 (EMBL:AE011933) (292 aa) fasta scores: E(): 1.3e-33, 45.39% id in 293 aa
YP_107704.1	Similar to Ralstonia solanacearum hypothetical protein rsc0986 or rs04306 SWALL:Q8Y0Q7 (EMBL:AL646062) (156 aa) fasta scores: E(): 1.9e-40, 73.71% id in 156 aa, and to Mycobacterium leprae hypothetical protein ml2304 SWALL:Q9CB89 (EMBL:AL583925) (174 aa) fasta scores: E(): 3e-21, 50.66% id in 150 aa
YP_107705.1	Similar to Ralstonia solanacearum probable aminotransferase rsc0985 or rs04307 SWALL:Q8Y0Q8 (EMBL:AL646062) (406 aa) fasta scores: E(): 1.9e-100, 64.97% id in 394 aa, and to Xanthomonas axonopodis pv. citri str. 306 valine-pyruvate aminotransferase AvtA SWALL:AAM36720 (EMBL:AE011819) (427 aa) fasta scores: E(): 1e-95, 64.24% id in 386 aa
YP_107706.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0987 or rs04305 SWALL:Q8Y0Q6 (EMBL:AL646062) (313 aa) fasta scores: E(): 3.2e-49, 53.69% id in 298 aa, and to Agrobacterium tumefaciens conserved hypothetical protein, membrane protein atu0234 or agr_c_394 SWALL:Q8UIQ9 (EMBL:AE008996) (291 aa) fasta scores: E(): 9.9e-38, 45.42% id in 295 aa
YP_107707.1	Similar to Deinococcus radiodurans hypothetical protein dr2014 SWALL:Q9RSV8 (EMBL:AE002038) (207 aa) fasta scores: E(): 1.6e-14, 48.4% id in 219 aa
YP_107708.1	Similar to Ralstonia solanacearum  transcription regulator protein rsc0989 or rs04303 SWALL:Q8Y0Q4 (EMBL:AL646062) (490 aa) fasta scores: E(): 1.5e-129, 68.66% id in 485 aa, and to Brucella melitensis transcriptional regulator, GntR family / aminotransferase class-I bmei0169 SWALL:Q8YJB7 (EMBL:AE009459) (484 aa) fasta scores: E(): 2.9e-65, 43.75% id in 464 aa
YP_107709.1	molecular chaperone
YP_107710.1	Similar to Ralstonia solanacearum hypothetical protein rsc2780 or rs00067 SWALL:Q8XVQ0 (EMBL:AL646071) (176 aa) fasta scores: E(): 2.8e-10, 37.58% id in 157 aa, and to Pseudomonas aeruginosa hypothetical protein pa5357 SWALL:Q9HTK1 (EMBL:AE004947) (178 aa) fasta scores: E(): 3e-05, 34.8% id in 181 aa
YP_107711.1	Similar to Ralstonia solanacearum hypothetical protein rsc0991 or rs04301 SWALL:Q8Y0Q2 (EMBL:AL646062) (166 aa) fasta scores: E(): 7.6e-34, 60.51% id in 157 aa, and to Methanosarcina mazei Goe1 conserved protein mm1651 SWALL:AAM31347 (EMBL:AE013399) (158 aa) fasta scores: E(): 6.7e-25, 51.4% id in 142 aa
YP_107712.1	Similar to Ralstonia solanacearum hypothetical protein rsc0995 or rs04297 SWALL:Q8Y0P8 (EMBL:AL646062) (295 aa) fasta scores: E(): 7e-62, 58.36% id in 305 aa, and to Neisseria meningitidis  transferase nma1087 or nmb0869 SWALL:Q9JQL8 (EMBL:AL162755) (263 aa) fasta scores: E(): 1.4e-21, 31.83% id in 245 aa
YP_107713.1	Similar to Thermoplasma volcanium hypothetical protein tv1324 or tvg1365320 SWALL:Q978U1 (EMBL:AP000996) (66 aa) fasta scores: E(): 3.5e-06, 46.15% id in 52 aa, and to Thermoplasma acidophilum hypothetical membrane protein ta0299 SWALL:Q9HLC9 (EMBL:AL445063) (86 aa) fasta scores: E(): 6.1e-06, 44.23% id in 52 aa
YP_107714.1	Similar to Streptomyces coelicolor  permease sco5229 or Sc7E4.26c SWALL:Q9K494 (EMBL:AL359214) (532 aa) fasta scores: E(): 5.9e-102, 58.25% id in 527 aa, and to Sulfolobus solfataricus metabolite permease,  sso2476 SWALL:Q97VX6 (EMBL:AE006846) (505 aa) fasta scores: E(): 1.9e-75, 45.11% id in 501 aa
YP_107715.1	Similar to Ralstonia solanacearum hypothetical protein rsp0601 or rs03878 SWALL:Q8XS80 (EMBL:AL646079) (143 aa) fasta scores: E(): 2e-23, 52.38% id in 147 aa, and to Escherichia coli PhnB protein b4107 SWALL:PHNB_ECOLI (SWALL:P16681) (147 aa) fasta scores: E(): 6e-15, 39.16% id in 143 aa
YP_107716.1	Maintains the balance of metabolites in the pentose-phosphate pathway
YP_107717.1	Similar to, although longer in its N-terminal region than, Acinetobacter calcoaceticus benzoate membrane transport protein BenE SWALL:BENE_ACICA (SWALL:P07775) (394 aa) fasta scores: E(): 9.6e-57, 43.38% id in 378 aa, and to Pseudomonas putida BenE SWALL:Q9L7Y0 (EMBL:AF218267) (399 aa) fasta scores: E(): 6.5e-66, 48.83% id in 385 aa
YP_107718.1	Similar to Ralstonia solanacearum hypothetical protein rsc0996 or rs04296 SWALL:Q8Y0P7 (EMBL:AL646062) (391 aa) fasta scores: E(): 1.1e-126, 78.57% id in 392 aa, and to Pseudomonas aeruginosa hypothetical protein pa2705 SWALL:Q9I0D7 (EMBL:AE004698) (393 aa) fasta scores: E(): 8.7e-96, 59.03% id in 393 aa
YP_107719.1	Similar to, although shorter in its N-terminal region than, Ralstonia solanacearum hypothetical protein rsc0998 or rs04294 SWALL:Q8Y0P5 (EMBL:AL646062) (290 aa) fasta scores: E(): 5.8e-87, 84.94% id in 279 aa, and to Pseudomonas aeruginosa hypothetical protein pa2707 SWALL:Q9I0D5 (EMBL:AE004698) (281 aa) fasta scores: E(): 3.6e-73, 71.84% id in 277 aa
YP_107720.1	Similar to Ralstonia solanacearum  periplasmic cytochrome type-C oxidoreductase signal peptide protein rsc0999 or rs04293 SWALL:Q8Y0P4 (EMBL:AL646062) (115 aa) fasta scores: E(): 1.5e-21, 58.77% id in 114 aa, and to Marinobacter hydrocarbonoclasticus cytochrome C-552 SWALL:C552_MARHY (SWALL:P82903) (88 aa) fasta scores: E(): 2.1e-06, 41.11% id in 90 aa
YP_107721.1	Similar to Ralstonia solanacearum  periplasmic cytochrome type-C oxidoreductase signal peptide protein rsc1000 or rs04292 SWALL:Q8Y0P3 (EMBL:AL646062) (133 aa) fasta scores: E(): 2.3e-12, 49.58% id in 121 aa, and to Marinobacter hydrocarbonoclasticus cytochrome C-552 SWALL:C552_MARHY (SWALL:P82903) (88 aa) fasta scores: E(): 3.7e-05, 38.63% id in 88 aa
YP_107722.1	Similar to Ralstonia solanacearum hypothetical protein rsc1001 or rs04291 SWALL:Q8Y0P2 (EMBL:AL646062) (170 aa) fasta scores: E(): 1.1e-36, 63.12% id in 141 aa, and to Neisseria meningitidis hypothetical protein nma1720 SWALL:Q9JTL8 (EMBL:AL162756) (156 aa) fasta scores: E(): 2.9e-18, 43.57% id in 140 aa. Note: Similarity in both cases starts in residue no. 40
YP_107723.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc1002 or rs04290 SWALL:Q8Y0P1 (EMBL:AL646062) (312 aa) fasta scores: E(): 8.7e-50, 57.6% id in 309 aa, and to Aeropyrum pernix hypothetical protein ape0076 SWALL:Q9YG25 (EMBL:AP000058) (296 aa) fasta scores: E(): 8.3e-14, 34.23% id in 295 aa
YP_107724.1	Similar to Escherichia coli endonuclease III Nth or b1633 SWALL:END3_ECOLI (SWALL:P20625) (211 aa) fasta scores: E(): 7.6e-52, 68.26% id in 208 aa, and to Ralstonia solanacearum probable endonuclease III protein rsc1005 or rs04287 SWALL:Q8Y0N8 (EMBL:AL646062) (214 aa) fasta scores: E(): 1.9e-64, 78.77% id in 212 aa
YP_107725.1	Involved in the electron transport chain
YP_107726.1	Similar to Ralstonia solanacearum probable transcription regulator protein rsc1007 or rs04285 SWALL:Q8Y0N6 (EMBL:AL646062) (239 aa) fasta scores: E(): 1.6e-45, 54.9% id in 204 aa, and to Agrobacterium tumefaciens transcriptional regulator, TetR family atu3115 or agr_l_1690gM SWALL:Q8UBA1 (EMBL:AE009242) (232 aa) fasta scores: E(): 8.1e-30, 48.12% id in 187 aa
YP_107727.1	N-terminal region similar to Alcaligenes eutrophus intracellular PHB depolymerase PhaZRE SWALL:O87189 (EMBL:AB017612) (419 aa) fasta scores: E(): 3.9e-118, 77.91% id in 412 aa, and to Ralstonia solanacearum probable poly[D(-)-3-hydroxybutyrate] depolymerase PhaZ or rsc1008 or rs04284 SWALL:Q8Y0N5 (EMBL:AL646062) (422 aa) fasta scores: E(): 3.7e-119, 76.73% id in 417 aa, and C-terminal region similar to Trypanosoma cruzi histone h1.c8/h1.m1 SWALL:H1C8_TRYCR (SWALL:P40270) (74 aa) fasta scores: E(): 2.8, 44.06% id in 59 aa
YP_107728.1	Similar to Streptomyces coelicolor hypothetical protein sco1830 or sci8.15 SWALL:Q9RJ38 (EMBL:AL132644) (595 aa) fasta scores: E(): 6e-137, 57.52% id in 598 aa, and to Ralstonia solanacearum hypothetical protein rsc1458 or rs03849 SWALL:Q8XZE3 (EMBL:AL646064) (619 aa) fasta scores: E(): 1.4e-118, 62% id in 608 aa
YP_107729.1	Similar to Pseudomonas aeruginosa hypothetical protein pa4204 SWALL:Q9HWH7 (EMBL:AE004837) (388 aa) fasta scores: E(): 1.8e-55, 46.01% id in 389 aa, and to Ralstonia solanacearum  hemagglutinin-related protein rsp0183 or rs04695 SWALL:Q8XTD0 (EMBL:AL646077) (410 aa) fasta scores: E(): 1.2e-33, 35.28% id in 411 aa
YP_107730.1	C-terminal region similar to Escherichia coli cell division protein FtsK or b0890 SWALL:FTSK_ECOLI (SWALL:P46889) (1329 aa) fasta scores: E(): 3.4e-64, 39.91% id in 1125 aa, and N-terminal region to Streptococcus pneumoniae cell wall surface anchor family protein sp1772 SWALL:Q97P71 (EMBL:AE007470) (4776 aa) fasta scores: E(): 3.1e-25, 26.32% id in 1189 aa. Note: Also contains a repeat region (7x TSAET(A/V)AP(D/N)(D/G/S)H(A/V)(P/S))
YP_107731.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0694 or rs01599 SWALL:Q8Y1J6 (EMBL:AL646060) (246 aa) fasta scores: E(): 1.6e-07, 32.12% id in 165 aa, and to Deinococcus radiodurans hypothetical protein dr1940 SWALL:Q9RT29 (EMBL:AE002033) (403 aa) fasta scores: E(): 1.7e-05, 33.55% id in 152 aa
YP_107732.1	non-folate utilizing enzyme, catalyzes the production of beta-formyl glycinamide ribonucleotide from formate, ATP, and beta-GAR and a side reaction producing acetyl phosphate and ADP from acetate and ATP; involved in de novo purine biosynthesis
YP_107733.1	Similar to Ralstonia solanacearum probable lipoprotein rsp0401 or rs00829 SWALL:Q8XSR6 (EMBL:AL646078) (55 aa) fasta scores: E(): 7.9e-11, 75.51% id in 49 aa
YP_107734.1	Similar to Ralstonia solanacearum hypothetical signal peptide protein rsc2496 rsc2496 or rs01100 SWALL:Q8XWH8 (EMBL:AL646070) (151 aa) fasta scores: E(): 2.2e-07, 41.57% id in 89 aa, and to Brucella melitensis hypothetical protein bmei1494 SWALL:Q8YFM6 (EMBL:AE009586) (113 aa) fasta scores: E(): 8.3e-07, 32.75% id in 116 aa
YP_107735.1	Similar to Escherichia coli  ATP-dependent RNA helicase RhlE or b0797 SWALL:RHLE_ECOLI (SWALL:P25888) (454 aa) fasta scores: E(): 3e-74, 52.16% id in 462 aa, and to Ralstonia solanacearum probable ATP-dependent RNA helicase rsc2211 or rs01388 SWALL:Q8XXA5 (EMBL:AL646068) (495 aa) fasta scores: E(): 4.1e-102, 65.59% id in 497 aa
YP_107736.1	this tRNA synthetase lacks the tRNA anticodon interaction domain; instead this enzyme modifies tRNA(Asp) with glutamate by esterifying glutamate to the 2-amino-5-(4,5-dihydroxy-2-cyclopenten-1-yl) moiety of queosine generating a modified nucleoside at the first anticodon position of tRNAAsp; the modified tRNA does not bind elongation factor Tu
YP_107737.1	Similar to Ralstonia solanacearum hypothetical protein rsc2206 or rs01393 SWALL:Q8XXB0 (EMBL:AL646068) (282 aa) fasta scores: E(): 5.6e-65, 63.53% id in 277 aa, and to Rhizobium loti hypothetical protein mll2992 SWALL:YT92_RHILO (SWALL:Q98H78) (309 aa) fasta scores: E(): 8.2e-27, 43.79% id in 274 aa
YP_107738.1	catalyzes DNA-template-directed extension of the 3'- end of a DNA strand by one nucleotide at a time; main replicative polymerase
YP_107739.1	Similar to Escherichia coli, and Escherichia coli O157:H7 probable transport ATP-binding protein MsbA or b0914 or z1260 or ecs0997 SWALL:MSBA_ECOLI (SWALL:P27299) (582 aa) fasta scores: E(): 4.9e-78, 42.05% id in 573 aa, and to Ralstonia solanacearum probable composite ATP-binding transmembrane ABC transporter protein rsc2200 or rs01399 SWALL:Q8XXB6 (EMBL:AL646068) (592 aa) fasta scores: E(): 1e-124, 65.23% id in 581 aa
YP_107740.1	Similar to Neisseria meningitidis LgtG SWALL:AAM33532 (EMBL:AF470675) (351 aa) fasta scores: E(): 2.6e-49, 40.57% id in 350 aa, and to Neisseria gonorrhoeae lipooligosaccharide glycosyl transferase G LgtG SWALL:O85795 (EMBL:AF076919) (351 aa) fasta scores: E(): 1.4e-48, 40.28% id in 350 aa
YP_107741.1	Similar to Streptomyces coelicolor  transferase sco6183 or sc2g5.04 SWALL:Q9Z5B9 (EMBL:AL035478) (335 aa) fasta scores: E(): 6.7e-12, 31.41% id in 312 aa, and to Pseudomonas aeruginosa heptosyl transferase I RfaC SWALL:O05195 (EMBL:U70982) (355 aa) fasta scores: E(): 2.8e-10, 28.87% id in 374 aa
YP_107742.1	Similar to Anabaena sp. hypothetical protein all5073 SWALL:Q8YM67 (EMBL:AP003598) (475 aa) fasta scores: E(): 7.4e-05, 22.01% id in 418 aa
YP_107743.1	Similar to Bacillus halodurans lipopolysaccharide biosynthesis bh3663 SWALL:Q9K6R4 (EMBL:AP001519) (373 aa) fasta scores: E(): 8.7e-19, 29.17% id in 401 aa, and to Fusobacterium nucleatum glycosyl transferase fn1245 SWALL:Q8R631 (EMBL:AE010630) (381 aa) fasta scores: E(): 2.6e-17, 27.19% id in 364 aa
YP_107744.1	Similar to Escherichia coli lipopolysaccharide core biosynthesis glycosyl transferase RfaQ or WaaQ or b3632 SWALL:RFAQ_ECOLI (SWALL:P25742) (344 aa) fasta scores: E(): 1.8e-16, 26.62% id in 323 aa, and to Yersinia pestis lipopolysaccharide core biosynthesis protein ypo0416 SWALL:Q8ZIS3 (EMBL:AJ414142) (346 aa) fasta scores: E(): 5.2e-21, 32.66% id in 300 aa
YP_107745.1	Doubtful CDS. No significant database matches
YP_107746.1	Similar to Serratia marcescens lipopolysaccharide core biosynthesis glycosyl transferase KdtX SWALL:KDTX_SERMA (SWALL:Q54435) (257 aa) fasta scores: E(): 1.8e-33, 41.66% id in 252 aa, and to Ralstonia solanacearum probable glycosyl transferase rsc2202 or rs01397 SWALL:Q8XXB4 (EMBL:AL646068) (256 aa) fasta scores: E(): 1.2e-41, 50.59% id in 251 aa
YP_107747.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0815 or rs05007 SWALL:Q8Y175 (EMBL:AL646061) (132 aa) fasta scores: E(): 1.5e-17, 47.72% id in 132 aa, and to Rhizobium meliloti hypothetical transmembrane signal peptide protein r01916 or smc04246 SWALL:Q92K77 (EMBL:AL591788) (126 aa) fasta scores: E(): 1.1e-05, 36.66% id in 120 aa
YP_107749.1	Similar to Mycobacterium tuberculosis transmembrane transport protein rv2456c or mtv008.12c or mt2531 SWALL:O53183 (EMBL:AL021246) (418 aa) fasta scores: E(): 6.3e-41, 36.74% id in 411 aa, and to Xanthomonas axonopodis pv. citri str. 306 MFS transporter xac0229 SWALL:AAM35121 (EMBL:AE011647) (409 aa) fasta scores: E(): 2.4e-34, 36.13% id in 393 aa
YP_107751.1	Similar to Escherichia coli O157:H7 hypothetical protein z3974 or ecs3535 SWALL:Q8X921 (EMBL:AE005496) (143 aa) fasta scores: E(): 6.1e-23, 48.55% id in 138 aa, and to Pseudomonas aeruginosa hypothetical protein a0269 SWALL:Q9I6M1 (EMBL:AE004465) (145 aa) fasta scores: E(): 4.8e-21, 44.44% id in 135 aa
YP_107752.1	Similar to Caulobacter crescentus  RNA polymerase sigma factor cc3266 SWALL:Q9A3D8 (EMBL:AE005990) (291 aa) fasta scores: E(): 9.8e-42, 44.84% id in 281 aa, and to Streptomyces coelicolor  RNA polymerase sigma factor sco1263 or 2scg18.10C SWALL:Q9K3H7 (EMBL:AL390188) (295 aa) fasta scores: E(): 1.5e-41, 45.93% id in 283 aa
YP_107753.1	Similar to Ralstonia solanacearum hypothetical protein rsc2198 or rs01401 SWALL:Q8XXB8 (EMBL:AL646068) (96 aa) fasta scores: E(): 1.5e-25, 68.04% id in 97 aa
YP_107757.1	Similar to Bacillus subtilis uric acid permease PucJ SWALL:PUCJ_BACSU (SWALL:O32139) (449 aa) fasta scores: E(): 2.7e-34, 37.02% id in 424 aa, and to Pseudomonas aeruginosa probable transporter pa0352 SWALL:Q9I6E1 (EMBL:AE004473) (461 aa) fasta scores: E(): 1.1e-134, 82.65% id in 444 aa
YP_107758.1	Very low similarity to Xanthomonas campestris pv. campestris str. ATCC 33913 phage-related regulatory protein cII SWALL:AAM43407 (EMBL:AE012545) (339 aa) fasta scores: E(): 7.8e-10, 28.01% id in 332 aa
YP_107759.1	Very low similarity to the C-terminal regions of Clostridium perfringens hypothetical protein cpe1605 SWALL:Q8XJZ8 (EMBL:AP003191) (269 aa) fasta scores: E(): 1.6e-15, 32.86% id in 216 aa, and of Bacillus anthracis pxo1-131 SWALL:Q9X388 (EMBL:AF065404) (349 aa) fasta scores: E(): 6.8e-13, 32.67% id in 202 aa
YP_107761.1	Similar to Escherichia coli O157:H7  portal protein for prophage cp-933v z3328 SWALL:Q8X3L1 (EMBL:AE005441) (861 aa) fasta scores: E(): 1.2e-60, 43.4% id in 417 aa, and to Bacteriophage phiE125 gp4 4 SWALL:Q8W6U7 (EMBL:AF447491) (419 aa) fasta scores: E(): 1.5e-19, 27.34% id in 384 aa
YP_107763.1	Similar to Escherichia coli O157:H7 hypothetical protein z1804 SWALL:Q8X3S4 (EMBL:AE005324) (645 aa) fasta scores: E(): 3.9e-63, 42.81% id in 647 aa, and to Bacteriophage phiE125 gp6 6 SWALL:Q8W6U5 (EMBL:AF447491) (435 aa) fasta scores: E(): 3.9e-15, 27.29% id in 447 aa
YP_107764.1	Similar to Bacteriophage HK97 terminase large subunit 2 SWALL:Q9MCT1 (EMBL:AF069529) (504 aa) fasta scores: E(): 3.5e-82, 46.76% id in 494 aa, and to Escherichia coli O157:H7  terminase large subunit ecs1598 SWALL:Q8X2A3 (EMBL:AP002555) (553 aa) fasta scores: E(): 1e-27, 29.3% id in 488 aa
YP_107766.1	Similar to Bacteriophage P27 hypothetical 13.0 kDa protein SWALL:Q8W633 (EMBL:AJ298298) (116 aa) fasta scores: E(): 4.5e-10, 53.52% id in 71 aa, and to Haemophilus influenzae phage phi-105 holin-like protein SWALL:Q9L8N1 (EMBL:AF198256) (128 aa) fasta scores: E(): 6.5e-07, 36.17% id in 94 aa
YP_107772.1	Very low similarity in the C-terminal region to Ralstonia solanacearum hypothetical protein rsc2485 or rs01110 SWALL:Q8XWI9 (EMBL:AL646070) (106 aa) fasta scores: E(): 7, 36.5% id in 63 aa
YP_107777.1	Similar to Ralstonia solanacearum hypothetical protein rsc2487 or rs05745 SWALL:Q8XWI7 (EMBL:AL646070) (68 aa) fasta scores: E(): 3.4e-13, 60.6% id in 66 aa
YP_107779.1	Similar to Xanthomonas axonopodis pv. citri str. 306 phage-related integrase IntS SWALL:AAM37139 (EMBL:AE011866) (408 aa) fasta scores: E(): 1.4e-17, 27.46% id in 426 aa, and to Bacteriophage phi-80 Integrase Int SWALL:VINT_BPPH8 (SWALL:P06155) (402 aa) fasta scores: E(): 1.6e-15, 23.07% id in 403 aa
YP_107780.1	Similar to Escherichia coli, and Escherichia coli O157:H7 ribonuclease G CafA or Rng or b3247 or z4605 or ecs4119 SWALL:RNG_ECOLI (SWALL:P25537) (488 aa) fasta scores: E(): 7.6e-103, 56.21% id in 491 aa, and to Ralstonia solanacearum probable ribonuclease G rsc2197 or rs01402 SWALL:Q8XXB9 (EMBL:AL646068) (489 aa) fasta scores: E(): 4.7e-152, 81.83% id in 490 aa
YP_107781.1	Maf; overexpression in Bacillus subtilis inhibits septation in the dividing cell
YP_107782.1	SPOUT methyltransferase; crystal structure shows homodimer; in Escherichia coli this protein methylates pseudouridine at position 1915 of the 23S ribosomal RNA
YP_107783.1	Similar to, although shorter in its C-terminal region than, Ralstonia solanacearum hypothetical protein rsc2194 or rs01405 SWALL:Q8XXC1 (EMBL:AL646068) (203 aa) fasta scores: E(): 6.6e-39, 72.43% id in 156 aa, and to, although longer in its C-terminal region than, Escherichia coli hypothetical protein YbeB or b0637 SWALL:YBEB_ECOLI (SWALL:P05848) (105 aa) fasta scores: E(): 1.1e-09, 33.65% id in 104 aa
YP_107784.1	catalyzes the formation of deamido-NAD(+) from nicotinate ribonucleotide and ATP
YP_107785.1	catalyzes the conversion of the propionic acid groups of rings I and III to vinyl groups during heme synthesis
YP_107786.1	catalyzes the formation of N(1)-(5-phospho-D-ribosyl)glycinamide from 5-phospho-D-ribosylamine and glycine in purine biosynthesis
YP_107787.1	Similar to Ralstonia solanacearum hypothetical protein rsc2190 or rs01409 SWALL:Q8XXC5 (EMBL:AL646068) (241 aa) fasta scores: E(): 3.5e-75, 84.64% id in 241 aa, and to Escherichia coli protein YebC or b1864 SWALL:YEBC_ECOLI (SWALL:P24237) (246 aa) fasta scores: E(): 7.5e-53, 61.57% id in 242 aa
YP_107788.1	Catalyzes the formation of uracil and 5-phospho-alpha-D-ribosy 1-diphosphate from UMP and diphosphate
YP_107789.1	Similar to Xanthomonas axonopodis pv. citri str. 306 oxidoreductase xac0384 SWALL:AAM35276 (EMBL:AE011664) (260 aa) fasta scores: E(): 1.7e-66, 71.53% id in 260 aa, and to Ralstonia solanacearum probable dehydrogenase/reductase oxidoreductase rsc2186 or rs01413 SWALL:Q8XXC9 (EMBL:AL646068) (263 aa) fasta scores: E(): 3e-61, 67.3% id in 263 aa
YP_107790.1	catalyzes the formation of methylglyoxal from glycerone phosphate
YP_107791.1	Similar to Escherichia coli quinone oxidoreductase Qor or Hcz or b4051 SWALL:QOR_ECOLI (SWALL:P28304) (327 aa) fasta scores: E(): 1.6e-53, 47.7% id in 327 aa, and to Ralstonia solanacearum probable NADPH:quinone reductase, zeta-crystallin homolog oxidoreductase rsc2184 or rs01415 SWALL:Q8XXD1 (EMBL:AL646068) (324 aa) fasta scores: E(): 7.2e-86, 70.67% id in 324 aa
YP_107792.1	Similar to Xanthomonas campestris pv. campestris str. ATCC 33913 conserved hypothetical protein xcc0701 SWALL:AAM40017 (EMBL:AE012169) (30 aa) fasta scores: E(): 0.11, 44.44% id in 27 aa, and to Escherichia coli protein KdpF or b0698.1 SWALL:KDPF_ECOLI (SWALL:P36937) (29 aa) fasta scores: E(): 4.4, 73.33% id in 15 aa
YP_107793.1	catalyzes the hydrolysis of ATP coupled with the exchange of hydrogen and potassium ions
YP_107794.1	One of the components of the high-affinity ATP-driven potassium transport (or KDP) system, which catalyzes the hydrolysis of ATP coupled with the exchange of hydrogen and potassium ions
YP_107795.1	One of the components of the high-affinity ATP-driven potassium transport (or KDP)system, which catalyzes the hydrolysis of ATP coupled with the exchange of hydrogen and potassium ions. The C subunit may be involved in assembly of the KDP complex
YP_107796.1	Similar to Escherichia coli sensor protein KdpD or b0695 SWALL:KDPD_ECOLI (SWALL:P21865) (894 aa) fasta scores: E(): 8.8e-93, 49.39% id in 913 aa, and to Salmonella typhi sensor protein sty0744 SWALL:Q8Z8E7 (EMBL:AL627267) (902 aa) fasta scores: E(): 3.5e-97, 48.91% id in 924 aa. Note: This CDS is longer in its C-terminal region than most of its database matches
YP_107797.1	Similar to Escherichia coli kdp operon transcriptional regulatory protein KdpE or b0694 SWALL:KDPE_ECOLI (SWALL:P21866) (225 aa) fasta scores: E(): 3.6e-56, 65.31% id in 222 aa, and to Salmonella typhimurium response regulator in two-component regulatory system with KdpD, regulates kdp operon encoding a high-affinity K translocating ATPase stm0702 SWALL:Q8ZQW5 (EMBL:AE008728) (225 aa) fasta scores: E(): 2.8e-55, 63.51% id in 222 aa
YP_107798.1	Similar to Rhizobium loti hypothetical protein msl2463 SWALL:Q98IC7 (EMBL:AP002999) (89 aa) fasta scores: E(): 1.5e-07, 40.22% id in 87 aa
YP_107799.1	Similar to Escherichia coli SugE protein or b4148 SWALL:SUGE_ECOLI (SWALL:P30743) (105 aa) fasta scores: E(): 5e-20, 61.53% id in 104 aa, and to Yersinia pestis chaperone ypo0355 SWALL:Q8ZIX9 (EMBL:AJ414142) (104 aa) fasta scores: E(): 1.3e-20, 63.46% id in 104 aa
YP_107800.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc2467 or rs01138 SWALL:Q8XWK7 (EMBL:AL646070) (206 aa) fasta scores: E(): 7.7e-39, 60.98% id in 182 aa, and to Xanthomonas campestris pv. campestris str. ATCC 33913 conserved hypothetical protein xcc0485 SWALL:AAM39801 (EMBL:AE012145) (208 aa) fasta scores: E(): 3.8e-24, 48.88% id in 180 aa
YP_107801.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc2091 or rs03656 SWALL:Q8XXM2 (EMBL:AL646068) (843 aa) fasta scores: E(): 1.3e-140, 54.94% id in 859 aa, and to Escherichia coli hypothetical protein YbbP or b0496 SWALL:YBBP_ECOLI (SWALL:P77504) (804 aa) fasta scores: E(): 1.4e-29, 32.15% id in 852 aa
YP_107802.1	Identical to the C-terminal region of the previously sequenced Burkholderia pseudomallei  globin SWALL:Q93SP0 (EMBL:AY030274) (170 aa) fasta scores: E(): 1.3e-64, 99.32% id in 148 aa, and to Ralstonia solanacearum  oxygen-binding protein rsc2090 or rs03655 SWALL:Q8XXM3 (EMBL:AL646068) (134 aa) fasta scores: E(): 1.1e-41, 74.43% id in 133 aa, and to Mycobacterium tuberculosis, and Mycobacterium bovis hemoglobin-like protein hbo GlbO or rv2470 or mt2546 or mtv008.26 SWALL:GLBO_MYCTU (SWALL:O53197) (128 aa) fasta scores: E(): 1.5e-10, 37.2% id in 129 aa. Note: The N-terminal region of the previously sequenced database match (SWALL:Q93SP0) does not coincide with the one in BPSL1180, being the first one longer than this CDS. Also this CDS is longer in its N-terminal region than most of its database matches
YP_107803.1	Similar to Rhizobium loti alanyl-tRNA synthetase mlr0354 SWALL:Q98N10 (EMBL:AP002994) (248 aa) fasta scores: E(): 5e-35, 47.71% id in 241 aa, and to parts of Escherichia coli alanyl-tRNA synthetase AlaS or LovB or b2697 SWALL:SYA_ECOLI (SWALL:P00957) (876 aa) fasta scores: E(): 5.5e-08, 34.61% id in 234 aa
YP_107804.1	Similar to Ralstonia solanacearum  transmembrane protein rsc2089 or rs03654 SWALL:Q8XXM4 (EMBL:AL646068) (192 aa) fasta scores: E(): 1e-31, 53.15% id in 190 aa, and to Brucella melitensis hypothetical protein bmei0803 SWALL:Q8YHJ5 (EMBL:AE009522) (208 aa) fasta scores: E(): 2.3e-22, 38.61% id in 202 aa. Note: Has a posibble alternative start codon at residue 28
YP_107805.1	catalyzes the hydrolysis of a monocarboxylic acid amid to form a monocarboxylate and ammonia
YP_107806.1	Similar to Pseudomonas aeruginosa probable MFS transporter pa0703 SWALL:Q9I5M3 (EMBL:AE004506) (438 aa) fasta scores: E(): 3.5e-108, 69.92% id in 419 aa, and to Escherichia coli citrate-proton symporter CitA or Cit SWALL:CIT1_ECOLI (SWALL:P07661) (431 aa) fasta scores: E(): 4.3e-48, 36.79% id in 405 aa
YP_107807.1	Similar to Ralstonia solanacearum probable inner membrane transmembrane protein rsc1181 or rs05713 SWALL:Q8Y063 (EMBL:AL646063) (598 aa) fasta scores: E(): 1.1e-27, 26.4% id in 625 aa, and to Neisseria meningitidis hypothetical protein nmb1954 SWALL:Q9JXN7 (EMBL:AE002543) (553 aa) fasta scores: E(): 0.0026, 27.36% id in 570 aa. Note: This CDS is longer in its N-terminal region than most of its database matches
YP_107808.1	Converts glucose to D-glucono-1,5 lactone
YP_107809.1	Similar to Pseudomonas aeruginosa hypothetical protein pa4923 SWALL:YDC3_PSEAE (SWALL:P48636) (195 aa) fasta scores: E(): 2.6e-39, 56.68% id in 187 aa, and to Rhodococcus fascians hypothetical 21.1 kDa protein in fasciation locus Fas6 SWALL:FAS6_RHOFA (SWALL:P46378) (198 aa) fasta scores: E(): 2.1e-28, 53.89% id in 154 aa. Note: This CDS is shorter in its N-terminal region than some of its database matches
YP_107810.1	Similar to Ralstonia solanacearum  transcription regulator protein rsc2086 or rs03651 SWALL:Q8XXM7 (EMBL:AL646068) (231 aa) fasta scores: E(): 3.1e-60, 65.45% id in 220 aa, and to Alcanivorax borkumensis PhaD SWALL:Q9F9H1 (EMBL:AF193866) (233 aa) fasta scores: E(): 4.6e-17, 33.03% id in 221 aa
YP_107811.1	Similar to Escherichia coli, and Escherichia coli O157:H7 diacylglycerol kinase DgkA or b4042 or z5641 or ecs5025 SWALL:KDGL_ECOLI (SWALL:P00556) (121 aa) fasta scores: E(): 3.7e-13, 45.94% id in 111 aa, and to Ralstonia solanacearum probable diacylglycerol kinase transmembrane protein rsc2085 or rs03650 SWALL:Q8XXM8 (EMBL:AL646068) (153 aa) fasta scores: E(): 1.2e-26, 56.29% id in 151 aa. Note: This CDS is longer in its N-terminal region than most of its database matches
YP_107812.1	Similar to Ralstonia solanacearum hypothetical protein rsc2084 or rs03649 SWALL:Q8XXM9 (EMBL:AL646068) (356 aa) fasta scores: E(): 1.2e-103, 76.47% id in 340 aa, and to Agrobacterium tumefaciens glycosyltransferase atu2297 or agr_c_4173 SWALL:Q8UD31 (EMBL:AE009179) (363 aa) fasta scores: E(): 1.9e-67, 53.37% id in 326 aa
YP_107813.1	Similar to Ralstonia solanacearum hypothetical protein rsc2083 or rs03648 SWALL:Q8XXN0 (EMBL:AL646068) (314 aa) fasta scores: E(): 5.4e-89, 70.45% id in 308 aa, and to Caulobacter crescentus hypothetical protein cc3344 SWALL:Q9A362 (EMBL:AE005996) (281 aa) fasta scores: E(): 1.3e-66, 61.06% id in 262 aa. Note: This CDS is longer in its N-terminal region than most of its database matches
YP_107814.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc2081 or rs03646 SWALL:Q8XXN2 (EMBL:AL646068) (176 aa) fasta scores: E(): 2.6e-19, 46.75% id in 154 aa, and to Neisseria meningitidis hypothetical protein nmb0710 SWALL:Q9K0A5 (EMBL:AE002425) (188 aa) fasta scores: E(): 2.3e-08, 35.18% id in 162 aa. Note: This CDS is shorter in its N-terminal region than most of its database matches
YP_107815.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc2080 or rs03645 SWALL:Q8XXN3 (EMBL:AL646068) (283 aa) fasta scores: E(): 9.2e-19, 39.68% id in 257 aa. Note: This CDS is shorter in its N-terminal region than the database match
YP_107816.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc2079 or rs03644 SWALL:Q8XXN4 (EMBL:AL646068) (146 aa) fasta scores: E(): 2.5e-16, 50% id in 140 aa
YP_107817.1	DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates
YP_107818.1	acetolactate synthase large subunit; catalyzes the formation of 2-acetolactate from pyruvate
YP_107819.1	with IlvI catalyzes the formation of 2-acetolactate from pyruvate, the small subunit is required for full activity and valine sensitivity; E.coli produces 3 isoenzymes of acetolactate synthase which differ in specificity to substrates, valine sensitivity and affinity for cofactors; also known as acetolactate synthase 3 small subunit
YP_107820.1	catalyzes the formation of (R)-2,3-dihydroxy-3-methylbutanoate from (S)-2-hydroxy-2-methyl-3-oxobutanoate in valine and isoleucine biosynthesis
YP_107821.1	catalyzes the decarboxylaton of phospatidyl-L-sering to phosphatidylethanolamine
YP_107822.1	Similar to Ralstonia solanacearum CDP-diacylglycerol--serine O-phosphatidyltransferase PssA or rsc2073 or rs03638 SWALL:Q8XXP0 (EMBL:AL646068) (291 aa) fasta scores: E(): 3.3e-79, 71.67% id in 286 aa, and to Helicobacter pylori CDP-diacylglycerol--serine O-phosphatidyltransferase PssA or Ptr or hp1071 SWALL:PSS_HELPY (SWALL:Q48269) (237 aa) fasta scores: E(): 2.9e-23, 35.14% id in 239 aa
YP_107823.1	catalyzes the formation of 2-isopropylmalate from acetyl-CoA and 2-oxoisovalerate in leucine biosynthesis
YP_107824.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein rsp0113 or rs03009 SWALL:Q8XTJ5 (EMBL:AL646076) (520 aa) fasta scores: E(): 2.4e-111, 65.7% id in 487 aa, and to Xanthomonas campestris pv. campestris str. ATCC 33913 sulfate transporter YchM SWALL:AAM40826 (EMBL:AE012254) (519 aa) fasta scores: E(): 3.5e-43, 35.16% id in 529 aa
YP_107825.1	Similar to Escherichia coli, and Escherichia coli O157:H7 carbonic anhydrase CynT or b0339 or z0435 or ecs0392 SWALL:CYNT_ECOLI (SWALL:P17582) (219 aa) fasta scores: E(): 6e-14, 31.25% id in 192 aa, and to Ralstonia solanacearum  carbonic anhydrase rsp0112 or rs03010 SWALL:Q8XTJ6 (EMBL:AL646076) (214 aa) fasta scores: E(): 9.9e-56, 68.39% id in 212 aa
YP_107826.1	Similar to Ralstonia solanacearum probable lipoprotein transmembrane rsc1480 or rs03826 SWALL:Q8XZC1 (EMBL:AL646064) (177 aa) fasta scores: E(): 7.6e-32, 54.32% id in 162 aa, and to Ralstonia solanacearum probable transmembrane protein rsc2071 or rs03636 SWALL:Q8XXP2 (EMBL:AL646068) (173 aa) fasta scores: E(): 6.8e-26, 48.07% id in 156 aa
YP_107827.1	Similar to Ralstonia solanacearum probable transporter signal peptide protein rsc2070 or rs03635 SWALL:Q8XXP3 (EMBL:AL646068) (418 aa) fasta scores: E(): 4.2e-94, 62.2% id in 418 aa, and to Brucella melitensis leucine-, isoleucine-, valine-, threonine-, and alanine-binding protein precursor bmeii0069 SWALL:Q8YDV5 (EMBL:AE009645) (228 aa) fasta scores: E(): 6.7e-14, 30.97% id in 226 aa
YP_107828.1	primary rRNA binding protein; helps nucleate assembly of 30S; binds directly to the 16S rRNA and an intersubunit bridge to the 23S rRNA; autoregulates translation through interactions with the mRNA leader sequence
YP_107829.1	Similar to Escherichia coli polyribonucleotide nucleotidyltransferase Pnp or b3164 SWALL:PNP_ECOLI (SWALL:P05055) (711 aa) fasta scores: E(): 4.3e-169, 64.18% id in 712 aa, and to Ralstonia solanacearum probable polyribonucleotide nucleotidyltransferase rsc2067 or rs03632 SWALL:Q8XXP6 (EMBL:AL646068) (717 aa) fasta scores: E(): 3.6e-213, 81.12% id in 710 aa
YP_107830.1	Similar to Ralstonia solanacearum  NADPH quinone oxidoreductase rsc2065 or rs03630 SWALL:Q8XXP8 (EMBL:AL646068) (334 aa) fasta scores: E(): 2e-88, 70.83% id in 336 aa, and to Rhizobium meliloti  oxidoreductase r00953 or smc00034 SWALL:Q92RD5 (EMBL:AL591785) (327 aa) fasta scores: E(): 7.1e-48, 54.59% id in 337 aa
YP_107831.1	Reversibly isomerizes the ketone sugar dihydroxyacetone phosphate to the aldehyde sugar glyceraldehyde-3-phosphate
YP_107832.1	Similar to Escherichia coli, and Escherichia coli O157:H7 protein-export membrane protein SecG or b3175 or z4537 or ecs4054 SWALL:SECG_ECOLI (SWALL:P33582) (110 aa) fasta scores: E(): 6.1e-10, 43.59% id in 117 aa, and to Ralstonia solanacearum -export membrane protein rsc2063 or rs03461 SWALL:Q8XXQ0 (EMBL:AL646068) (115 aa) fasta scores: E(): 2.2e-20, 76.78% id in 112 aa
YP_107833.1	Catalyzes the transfer of electrons from NADH to quinone
YP_107834.1	The point of entry for the majority of electrons that traverse the respiratory chain eventually resulting in the reduction of oxygen
YP_107835.1	Catalyzes the transfer of electrons from NADH to quinone
YP_107836.1	Catalyzes the transfer of electrons from NADH to quinone
YP_107837.1	Catalyzes the transfer of electrons from NADH to quinone
YP_107838.1	Similar to Rhodobacter capsulatus NADH dehydrogenase I chain F NuoF SWALL:NUOF_RHOCA (SWALL:O07948) (431 aa) fasta scores: E(): 1.3e-77, 48.4% id in 440 aa, and to Ralstonia solanacearum probable NADH dehydrogenase I chain F rsc2057 or rs03622 SWALL:Q8XXQ6 (EMBL:AL646068) (431 aa) fasta scores: E(): 1.4e-159, 88.75% id in 427 aa
YP_107839.1	Catalyzes the transfer of electrons from NADH to ubiquinone
YP_107840.1	Catalyzes the transfer of electrons from NADH to quinone
YP_107841.1	Catalyzes the transfer of electrons from NADH to quinone
YP_107842.1	Catalyzes the transfer of electrons from NADH to quinone
YP_107843.1	Catalyzes the transfer of electrons from NADH to quinone
YP_107844.1	Catalyzes the transfer of electrons from NADH to ubiquinone
YP_107845.1	Catalyzes the transfer of electrons from NADH to quinone
YP_107846.1	Catalyzes the transfer of electrons from NADH to quinone
YP_107847.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc2048 or rs03613 SWALL:Q8XXR5 (EMBL:AL646068) (102 aa) fasta scores: E(): 2.5e-17, 53% id in 100 aa
YP_107848.1	Similar to Ralstonia solanacearum hypothetical protein rsc2047 or rs03612 SWALL:Q8XXR6 (EMBL:AL646068) (205 aa) fasta scores: E(): 2.2e-51, 69.73% id in 185 aa, and to Bacillus subtilis ADP-ribose pyrophosphatase NudF SWALL:ADPP_BACSU (SWALL:P54570) (185 aa) fasta scores: E(): 9.8e-20, 36.78% id in 174 aa
YP_107849.1	Similar to Agrobacterium tumefaciens hypothetical protein atu3509 or agr_l_2637 SWALL:Q8UA65 (EMBL:AE009281) (142 aa) fasta scores: E(): 3.1e-16, 42.74% id in 131 aa, and to Rhizobium meliloti hypothetical protein r02616 or smc02441 SWALL:Q92MK0 (EMBL:AL591791) (142 aa) fasta scores: E(): 9.8e-16, 44.85% id in 136 aa
YP_107850.1	Similar to Ralstonia solanacearum  acyl-CoA dehydrogenase oxidoreductase rsc2045 or rs03610 SWALL:Q8XXR8 (EMBL:AL646068) (398 aa) fasta scores: E(): 1.8e-135, 78.39% id in 398 aa, and to Caulobacter crescentus acyl-CoA dehydrogenase cc1310 SWALL:Q9A8P3 (EMBL:AE005806) (404 aa) fasta scores: E(): 1.5e-97, 60.24% id in 405 aa. Note: Also similar to BPSL0420 (403 aa) fasta scores: E(): 5.3e-88, 58.209% identity in 402 aa overlap
YP_107851.1	Similar to Ralstonia solanacearum  acyl-CoA dehydrogenase oxidoreductase rsc2044 or rs03609 SWALL:Q8XXR9 (EMBL:AL646068) (376 aa) fasta scores: E(): 4.4e-80, 60.63% id in 376 aa, and to Caulobacter crescentus acyl-CoA dehydrogenase cc1311 SWALL:Q9A8P2 (EMBL:AE005806) (401 aa) fasta scores: E(): 3.4e-52, 43.5% id in 377 aa
YP_107852.1	Similar to Ralstonia solanacearum hypothetical protein rsc2043 or rs03608 SWALL:Q8XXS0 (EMBL:AL646068) (156 aa) fasta scores: E(): 2.3e-27, 48.59% id in 142 aa, and to Agrobacterium tumefaciens hypothetical protein atu2234 or agr_c_4066 SWALL:Q8UD93 (EMBL:AE009173) (169 aa) fasta scores: E(): 7.1e-20, 41.42% id in 140 aa
YP_107853.1	Similar to Streptomyces coelicolor hypothetical protein sco1698 or sci30a.19 SWALL:Q9S254 (EMBL:AL096811) (153 aa) fasta scores: E(): 3.7e-27, 52.63% id in 152 aa, and to Ralstonia solanacearum hypothetical protein rsc2042 or rs03607 SWALL:Q8XXS1 (EMBL:AL646068) (162 aa) fasta scores: E(): 3.7e-23, 52.79% id in 161 aa
YP_107855.1	Similar to Ralstonia solanacearum probable acyl-CoA dehydrogenase oxidoreductase rsc2020 or rs03588 SWALL:Q8XXU3 (EMBL:AL646067) (420 aa) fasta scores: E(): 4.7e-135, 78.48% id in 409 aa, and to Deinococcus radiodurans acyl-CoA dehydrogenase,  dra0196 SWALL:Q9RYW0 (EMBL:AE001862) (415 aa) fasta scores: E(): 1.7e-111, 67.98% id in 406 aa
YP_107856.1	Similar to Ralstonia solanacearum hypothetical protein rsc2016 or rs03584 SWALL:Q8XXU7 (EMBL:AL646067) (358 aa) fasta scores: E(): 2e-103, 72.9% id in 358 aa, and to Rhizobium loti hypothetical protein mlr3099 SWALL:Q98GZ9 (EMBL:AP003001) (344 aa) fasta scores: E(): 2.1e-63, 51.89% id in 343 aa
YP_107857.1	Similar to Ralstonia solanacearum  phosphoglycerate mutase rsc2015 or rs03583 SWALL:Q8XXU8 (EMBL:AL646067) (244 aa) fasta scores: E(): 8e-50, 59.32% id in 236 aa, and to the N-terminal region of Escherichia coli, and Escherichia coli O157:H7 probable phosphoglycerate mutase 2 GpmB or b4395 or z5997 or ecs5353 SWALL:PMG2_ECOLI (SWALL:P36942) (215 aa) fasta scores: E(): 0.00031, 30.58% id in 170 aa
YP_107858.1	Catalyzes the reversible hydration of unsaturated fatty acyl-CoA to beta-hydroxyacyl-CoA
YP_107859.1	Similar to Ralstonia solanacearum probable GST-related protein rsc2012 or rs03580 SWALL:Q8XXV1 (EMBL:AL646067) (218 aa) fasta scores: E(): 7.8e-36, 50.71% id in 209 aa, and to Arabidopsis thaliana glutathione S-transferase 6 Gst6 or at2g47730 or f17a22.12 SWALL:GTH6_ARATH (SWALL:Q96266) (215 aa) fasta scores: E(): 3.3e-07, 27.67% id in 224 aa
YP_107860.1	catalyzes the transfer of an amino moiety
YP_107861.1	Similar to parts of Ralstonia solanacearum hypothetical protein rsc2010 or rs03578 SWALL:Q8XXV3 (EMBL:AL646067) (161 aa) fasta scores: E(): 8.7e-10, 37.91% id in 211 aa
YP_107862.1	Similar to Ralstonia solanacearum hypothetical protein rsc2009 or rs03577 SWALL:Q8XXV4 (EMBL:AL646067) (257 aa) fasta scores: E(): 9.5e-66, 67.82% id in 258 aa, and to Escherichia coli protein YaaA or b0006 SWALL:YAAA_ECOLI (SWALL:P11288) (258 aa) fasta scores: E(): 3.3e-56, 56.25% id in 256 aa
YP_107863.1	Similar to Ralstonia solanacearum hypothetical protein rsc2008 or rs03576 SWALL:Q8XXV5 (EMBL:AL646067) (381 aa) fasta scores: E(): 3.2e-102, 65.42% id in 376 aa, and to Neisseria meningitidis hypothetical protein nmb1073 SWALL:Q9JZF8 (EMBL:AE002458) (376 aa) fasta scores: E(): 3.8e-82, 55.46% id in 375 aa
YP_107864.1	Similar to Ralstonia solanacearum probable lipoprotein transmembrane rsc2007 or rs03575 SWALL:Q8XXV6 (EMBL:AL646067) (251 aa) fasta scores: E(): 6e-13, 34.85% id in 175 aa
YP_107865.1	Low similarity to Pseudomonas aeruginosa hypothetical protein pa4532 SWALL:Q9HVP5 (EMBL:AE004867) (229 aa) fasta scores: E(): 1.4e-09, 27.96% id in 211 aa, and to Vibrio cholerae hypothetical protein vc1870 SWALL:Q9KQX7 (EMBL:AE004263) (220 aa) fasta scores: E(): 3.7e-07, 25.52% id in 192 aa
YP_107866.1	Similar to Azospirillum brasilense FlcA SWALL:O05210 (EMBL:Y12363) (215 aa) fasta scores: E(): 3.4e-11, 31.19% id in 218 aa, and to Bacillus brevis transcriptional regulatory protein DegU SWALL:DEGU_BACBR (SWALL:P54662) (236 aa) fasta scores: E(): 8.4e-08, 25.11% id in 227 aa. Note: This CDS is longer in its C-terminal region than most of its database matches
YP_107867.1	Similar to Ralstonia solanacearum hypothetical protein rsc2005 or rs03573 SWALL:Q8XXV8 (EMBL:AL646067) (403 aa) fasta scores: E(): 1.2e-83, 52.97% id in 404 aa
YP_107868.1	Similar to Sus scrofa Xaa-Pro aminopeptidase precursor SWALL:Q95333 (EMBL:U55039) (673 aa) fasta scores: E(): 1.9e-26, 27.72% id in 642 aa, and to Agrobacterium tumefaciens aminopeptidase P atu2070 or agr_c_3749 SWALL:Q8UDQ1 (EMBL:AE009158) (613 aa) fasta scores: E(): 4.8e-26, 30.4% id in 615 aa. Note: Many of the database matches belong to eukaryotic proteins
YP_107870.1	Similar to Pseudomonas aeruginosa ornithine utilization regulator OruR or pa0831 SWALL:ORUR_PSEAE (SWALL:P72171) (339 aa) fasta scores: E(): 7.8e-32, 33.53% id in 331 aa, and to Mycobacterium tuberculosis hypothetical transcriptional regulator rv1395 or mt1440 or mtcy21b4.12 SWALL:YD95_MYCTU (SWALL:P71663) (344 aa) fasta scores: E(): 1.4e-28, 32.22% id in 332 aa
YP_107871.1	catalyzes the formation of 3-phosphonooxypyruvate from 3-phospho-D-glycerate in serine biosynthesis; can also reduce alpha ketoglutarate to form 2-hydroxyglutarate
YP_107872.1	Similar to Streptomyces coelicolor  transposase sc6g9.36c or scf12.06 or sc5e9.06C SWALL:Q9XAE6 (EMBL:AL079356) (136 aa) fasta scores: E(): 2.4e-07, 45.12% id in 82 aa, and to Ralstonia solanacearum probable TIS1421-transposase OrfA protein SWALL:Q8XGS3 (EMBL:AL646082) (134 aa) fasta scores: E(): 3.2e-07, 36.5% id in 126 aa
YP_107873.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa3445 pa3445 SWALL:Q9HYG1 (EMBL:AE004765) (323 aa) fasta scores: E(): 6.2e-65, 58.57% id in 309 aa, and to Escherichia coli  aliphatic sulfonates binding protein precursor SsuA or b0936 SWALL:SSUA_ECOLI (SWALL:P75853) (319 aa) fasta scores: E(): 4e-43, 43.23% id in 303 aa
YP_107874.1	N-terminal region similar to Ralstonia solanacearum probable transmembrane protein rsp0132 or rs02988 SWALL:Q8XTH8 (EMBL:AL646076) (478 aa) fasta scores: E(): 1.6e-45, 48.28% id in 292 aa, and C-terminal region similar to Erwinia amylovora sensor kinase HrpX SWALL:Q9X3S8 (EMBL:AF083877) (494 aa) fasta scores: E(): 6.6e-24, 41.35% id in 237 aa
YP_107877.1	Similar to Pseudomonas aeruginosa probable cytochrome c pa2482 SWALL:Q9I100 (EMBL:AE004676) (217 aa) fasta scores: E(): 1e-14, 32.71% id in 214 aa, and to Ralstonia solanacearum  cytochrome c signal peptide protein rsc0197 or rs00629 SWALL:Q8Y2Y4 (EMBL:AL646058) (206 aa) fasta scores: E(): 3.4e-14, 34.8% id in 204 aa
YP_107878.1	Similar to Pseudomonas aeruginosa probable cytochrome c pa4571 SWALL:Q9HVL3 (EMBL:AE004870) (675 aa) fasta scores: E(): 3.5e-49, 38.16% id in 414 aa, and to Gluconobacter oxydans alcohol dehydrogenase cytochrome c subunit precursor AdhB SWALL:CYCA_GLUOX (SWALL:Q47945) (478 aa) fasta scores: E(): 1.6e-38, 40.33% id in 424 aa
YP_107880.1	Similar to Thermus thermophilus cytochrome c oxidase polypeptide II CbaB or CtaC SWALL:COX2_THETH (SWALL:P98052) (168 aa) fasta scores: E(): 7.7e-16, 32.89% id in 152 aa, and to Bacillus halodurans cytochrome c oxidase subunit II bh0740 SWALL:Q9KEV9 (EMBL:AP001509) (157 aa) fasta scores: E(): 8.8e-14, 29.67% id in 155 aa
YP_107881.1	Identical to previously sequenced although longer in its N-terminal region than Burkholderia pseudomallei cytochrome c oxidase subunit 1 SWALL:Q9RQP4 (EMBL:AF087002) (512 aa) fasta scores: E(): 1.3e-201, 99.8% id in 512 aa, and to Thermus thermophilus cytochrome c oxidase polypeptide I CbaA SWALL:COX1_THETH (SWALL:Q56408) (562 aa) fasta scores: E(): 6.5e-67, 37.84% id in 547 aa
YP_107882.1	Similar in its C-terminal region to Pseudomonas aeruginosa cytochrome c4 precursor pa5490 SWALL:CYC4_PSEAE (SWALL:P00106) (201 aa) fasta scores: E(): 3.8e-12, 34.09% id in 176 aa, and to Rhizobium meliloti  cytochrome c class I protein, probably cytochrome c4 CycA or rb0945 or smb21367 SWALL:Q92UY9 (EMBL:AL603645) (374 aa) fasta scores: E(): 4.5e-08, 31.01% id in 187 aa. N-terminal region presents possible hydrophobic membrane spanning domains
YP_107883.1	N-terminal region similar to Vibrio cholerae hypothetical protein vca0034 SWALL:Q9KND1 (EMBL:AE004347) (290 aa) fasta scores: E(): 8e-10, 26.13% id in 264 aa, and to Xanthomonas campestris pv. campestris str. ATCC 33913 conserved hypothetical protein xcc1373 SWALL:AAM40671 (EMBL:AE012236) (266 aa) fasta scores: E(): 5.4e-08, 26.37% id in 254 aa
YP_107884.1	Similar to the C-terminal region of Pseudomonas aeruginosa hypothetical protein pa4601 SWALL:Q9HVI8 (EMBL:AE004874) (1415 aa) fasta scores: E(): 1.2e-59, 36.11% id in 540 aa, and to Rhizobium meliloti hypothetical protein r00959 or smc00038 SWALL:Q92KJ3 (EMBL:AL591785) (772 aa) fasta scores: E(): 6.1e-53, 37.36% id in 447 aa
YP_107885.1	Similar to Caulobacter crescentus bacterioferritin comigratory protein,  cc1673 SWALL:Q9A7P7 (EMBL:AE005842) (177 aa) fasta scores: E(): 1.4e-26, 51.16% id in 172 aa, and to Escherichia coli, and Escherichia coli O157:H7 bacterioferritin comigratory protein Bcp or b2480 or z3739 or ecs3342 SWALL:BCP_ECOLI (SWALL:P23480) (156 aa) fasta scores: E(): 2.9e-08, 29.74% id in 158 aa
YP_107886.1	Similar to Listeria monocytogenes hypothetical protein lmo2391 SWALL:Q8Y4P4 (EMBL:AL591983) (209 aa) fasta scores: E(): 2.5e-19, 37.98% id in 208 aa, and to Bacillus subtilis hypothetical protein YhfK SWALL:O07609 (EMBL:Y14083) (214 aa) fasta scores: E(): 5.7e-14, 30.37% id in 214 aa
YP_107887.1	Similar to Escherichia coli hypothetical protein YegO or b2076 SWALL:YEGO_ECOLI (SWALL:P76399) (1025 aa) fasta scores: E(): 4.3e-154, 56.87% id in 1076 aa, and to Ralstonia solanacearum probable drug efflux transmembrane protein rsp1199 or rs03143 SWALL:Q8XQM3 (EMBL:AL646083) (1033 aa) fasta scores: E(): 4.8e-165, 60.62% id in 1082 aa
YP_107888.1	Similar to Ralstonia solanacearum probable drug efflux pump transmembrane protein rsp1198 or rs03142 SWALL:Q8XQM4 (EMBL:AL646083) (1041 aa) fasta scores: E(): 0, 70.66% id in 1026 aa, and to Escherichia coli hypothetical protein YegN or b2075 SWALL:YEGN_ECOLI (SWALL:P76398) (1040 aa) fasta scores: E(): 0, 62.98% id in 1024 aa
YP_107889.1	Similar to Ralstonia solanacearum  resistance transmembrane protein rsp1197 or rs03141 SWALL:Q8XQM5 (EMBL:AL646083) (449 aa) fasta scores: E(): 4.6e-70, 53.22% id in 434 aa, and to Escherichia coli hypothetical protein YegM precursor or b2074 SWALL:YEGM_ECOLI (SWALL:P76397) (415 aa) fasta scores: E(): 1.3e-55, 44.96% id in 407 aa
YP_107890.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa1630 SWALL:Q9I392 (EMBL:AE004590) (288 aa) fasta scores: E(): 1.9e-27, 37.34% id in 241 aa, and to Escherichia coli MHP operon transcriptional activator MhpR or b0346 SWALL:MHPR_ECOLI (SWALL:P77569) (315 aa) fasta scores: E(): 2.2e-10, 28.51% id in 249 aa
YP_107891.1	Similar to Xanthomonas campestris pv. campestris str. ATCC 33913 alkaline phosphatase PhoX SWALL:AAM41064 (EMBL:AE012279) (661 aa) fasta scores: E(): 2e-184, 73.7% id in 658 aa
YP_107893.1	Similar to Ralstonia solanacearum hypothetical protein rsp0526 or rs00405 SWALL:Q8XSF0 (EMBL:AL646079) (143 aa) fasta scores: E(): 2.5e-23, 57.14% id in 140 aa, and to Streptomyces coelicolor hypothetical protein sco2652 or sc8e4a.22 SWALL:Q9L1Y3 (EMBL:AL138662) (144 aa) fasta scores: E(): 1.1e-14, 44.28% id in 140 aa. Note: This CDS is longer in its C-terminal region than most of its database matches
YP_107894.1	Similar to Pseudomonas aeruginosa hypothetical protein pa0741 SWALL:Q9I5I8 (EMBL:AE004509) (213 aa) fasta scores: E(): 3.7e-28, 46.47% id in 213 aa, and to Agrobacterium tumefaciens hypothetical protein atu1999 or agr_c_3633 SWALL:Q8UDW9 (EMBL:AE009151) (203 aa) fasta scores: E(): 2.1e-26, 48.09% id in 210 aa
YP_107896.1	Similar to Zymomonas mobilis glutamate uptake regulatory protein Grp SWALL:GRP_ZYMMO (SWALL:P74996) (164 aa) fasta scores: E(): 4.3e-25, 46.3% id in 149 aa, to Caulobacter crescentus transcriptional regulator, AsnC family cc0424 SWALL:Q9AB10 (EMBL:AE005714) (164 aa) fasta scores: E(): 2.1e-35, 63.75% id in 149 aa, and to Escherichia coli, and Escherichia coli O157:H7 hypothetical transcriptional regulator YbaO or b0447 or z0555 or ecs0501 SWALL:YBAO_ECOLI (SWALL:P54986) (152 aa) fasta scores: E(): 3.7e-32, 56.66% id in 150 aa
YP_107897.1	Similar to Escherichia coli putrescine transport ATP-binding protein PotG or b0855 SWALL:POTG_ECOLI (SWALL:P31134) (377 aa) fasta scores: E(): 1.8e-31, 46.66% id in 240 aa, and to Pseudomonas aeruginosa probable ATP-binding component of ABC transporter pa3538 SWALL:Q9HY73 (EMBL:AE004774) (360 aa) fasta scores: E(): 3.5e-43, 59.83% id in 239 aa. Note: This CDS is shorter in its C-terminal region than most of its database matches
YP_107898.1	Similar to Agrobacterium tumefaciens ABC transporter membrane spanning protein FbpA3 or atu0408 or agr_c_717 SWALL:Q8UI90 (EMBL:AE009011) (558 aa) fasta scores: E(): 1.1e-101, 55.91% id in 558 aa, and to Synechocystis sp. iron utilization protein HitB or slr0327 SWALL:Q55534 (EMBL:D63999) (557 aa) fasta scores: E(): 5.1e-65, 40.18% id in 535 aa. Note: this CDS is a few amino acid residues longer in its N-terminal region than most of its database matches
YP_107899.1	Similar to Serratia marcescens iron(III)-binding periplasmic protein precursor SfuA SWALL:SFUA_SERMA (SWALL:P21408) (338 aa) fasta scores: E(): 1.6e-15, 27.94% id in 340 aa, and to Brucella melitensis iron(III)-binding periplasmic protein precursor bmeii0584 SWALL:Q8YCE7 (EMBL:AE009695) (338 aa) fasta scores: E(): 4.7e-83, 64.77% id in 335 aa
YP_107901.1	Similar to Escherichia coli phenylalanine-specific permease PheP or b0576 SWALL:PHEP_ECOLI (SWALL:P24207) (458 aa) fasta scores: E(): 9.6e-71, 43.91% id in 444 aa, and to Escherichia coli, and Escherichia coli O157:H7 proline-specific permease ProY or b0402 or z0500 or ecs0452 SWALL:PROY_ECOLI (SWALL:P77327) (457 aa) fasta scores: E(): 7.1e-103, 61.77% id in 450 aa
YP_107902.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc2889 or rs00211 SWALL:Q8XVE2 (EMBL:AL646072) (740 aa) fasta scores: E(): 7.5e-60, 32.04% id in 752 aa, and to Salmonella typhi  membrane protein sty1095 SWALL:Q8Z7R8 (EMBL:AL627269) (717 aa) fasta scores: E(): 1.3e-24, 25.21% id in 694 aa
YP_107903.1	Similar to Chlorobium tepidum TLS exodeoxyribonuclease V, gamma subunit RecC SWALL:AAM72301 (EMBL:AE012870) (1065 aa) fasta scores: E(): 2.8e-63, 32.27% id in 1137 aa, and to Escherichia coli exodeoxyribonuclease V gamma chain RecC or b2822 SWALL:EX5C_ECOLI (SWALL:P07648) (1122 aa) fasta scores: E(): 3.2e-50, 29.65% id in 1177 aa
YP_107904.1	Similar to Escherichia coli exodeoxyribonuclease V beta chain RecB or RorA or b2820 SWALL:EX5B_ECOLI (SWALL:P08394) (1180 aa) fasta scores: E(): 2.5e-16, 33.74% id in 1292 aa, and to Neisseria meningitidis RecB SWALL:Q8RMG4 (EMBL:AF495855) (1204 aa) fasta scores: E(): 5.6e-41, 33.64% id in 1299 aa
YP_107905.1	Similar to Escherichia coli exodeoxyribonuclease V alpha chain RecD or b2819 SWALL:EX5A_ECOLI (SWALL:P04993) (608 aa) fasta scores: E(): 4.3e-28, 30.05% id in 845 aa, and to Salmonella typhimurium exonuclease V, alpha chain RecD or stm2993 SWALL:Q8ZMB7 (EMBL:AE008837) (611 aa) fasta scores: E(): 9.7e-28, 31.19% id in 856 aa. Note: This CDS contains an internal region (from approx. residue 330 to approx. residue 615) that presents little or no similarity to the database matches
YP_107906.1	Similar to Escherichia coli hypothetical protein YaeJ or b0191 SWALL:YAEJ_ECOLI (SWALL:P40711) (140 aa) fasta scores: E(): 2.4e-24, 62.3% id in 130 aa, and to Salmonella typhi  release factor sty0265 SWALL:Q8Z994 (EMBL:AL627266) (140 aa) fasta scores: E(): 7e-23, 57.48% id in 127 aa
YP_107907.1	Similar to Clostridium acetobutylicum sensory protein, containing EAL-domain cac0322 SWALL:Q97M76 (EMBL:AE007546) (412 aa) fasta scores: E(): 2.7e-21, 27.22% id in 393 aa, and to Pseudomonas aeruginosa hypothetical protein pa3258 SWALL:Q9HYY2 (EMBL:AE004748) (601 aa) fasta scores: E(): 2.1e-18, 34.97% id in 223 aa. Note: This CDS is shorter in its C-terminal region than most of its database matches
YP_107908.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc2507 or rs01075 SWALL:Q8XWG7 (EMBL:AL646070) (310 aa) fasta scores: E(): 3.3e-43, 51.85% id in 297 aa, and to Agrobacterium tumefaciens ABC transporter membrane spanning protein atu2079 or agr_c_3767 SWALL:Q8UDP2 (EMBL:AE009158) (329 aa) fasta scores: E(): 7.1e-25, 34.2% id in 307 aa
YP_107910.1	Similar to Escherichia coli, and Escherichia coli O157:H7 osmotically inducible lipoprotein B precursor OsmB or b1283 or z2523 or ecs1856 SWALL:OSMB_ECOLI (SWALL:P17873) (72 aa) fasta scores: E(): 7.1e-06, 54.83% id in 62 aa, and to Yersinia pestis osmotically inducible lipoprotein B ypo2229 SWALL:Q8ZEE4 (EMBL:AJ414151) (71 aa) fasta scores: E(): 2.4e-07, 51.51% id in 66 aa
YP_107911.1	required for the synthesis of the hydromethylpyrimidine moiety of thiamine
YP_107912.1	Doubtful CDS. No significant database matches
YP_107916.1	Similar to Ralstonia solanacearum hypothetical protein rsc0620 or rs01521 SWALL:Q8Y1R9 (EMBL:AL646060) (257 aa) fasta scores: E(): 3e-82, 73.01% id in 252 aa, and to Anabaena sp. hypothetical protein lr2944 SWALL:Q8YSY5 (EMBL:AP003591) (240 aa) fasta scores: E(): 3e-30, 39.2% id in 250 aa. Note: this CDS is longer in its N-terminal region than most of its database matches
YP_107917.1	Similar to Salmonella typhi  membrane protein sty2198 SWALL:Q8Z5Q8 (EMBL:AL627272) (306 aa) fasta scores: E(): 9.5e-30, 40.55% id in 286 aa, and to Yersinia pestis  membrane protein ypo1203 SWALL:Q8ZGS7 (EMBL:AJ414147) (296 aa) fasta scores: E(): 5.3e-29, 39% id in 300 aa. Note: this CDS is longer in its N-terminal region than most of its database matches
YP_107918.1	Similar to Clostridium acetobutylicum integral membrane protein similar to antibiotic resistance protein B.subtilis cac0560 SWALL:Q97LK0 (EMBL:AE007571) (441 aa) fasta scores: E(): 6.3e-55, 43.35% id in 376 aa, and to Escherichia coli hypothetical protein YgaY or b2680/b2681 SWALL:YGAY_ECOLI (SWALL:P76628) (394 aa) fasta scores: E(): 1.7e-48, 42.07% id in 385 aa
YP_107919.1	Similar to Ralstonia solanacearum probable transmembrane protein rsp0114 or rs03008 SWALL:Q8XTJ4 (EMBL:AL646076) (260 aa) fasta scores: E(): 1.5e-59, 69.44% id in 252 aa, and to Streptomyces coelicolor integral membrane protein sco6371 or sc4a2.07 SWALL:O86663 (EMBL:AL031182) (279 aa) fasta scores: E(): 1.5e-43, 54.43% id in 237 aa
YP_107920.1	Similar to Ralstonia solanacearum hypothetical signal peptide protein rsp0115 or rs03007 SWALL:Q8XTJ3 (EMBL:AL646076) (135 aa) fasta scores: E(): 1.2e-21, 58.2% id in 134 aa
YP_107921.1	Similar to Ralstonia solanacearum hypothetical protein rsc1795 or rs04195 SWALL:Q8XYG3 (EMBL:AL646066) (282 aa) fasta scores: E(): 2.8e-54, 53.54% id in 282 aa, and to Streptomyces avermitilis  cyclic nucleotide phosphodiesterase SWALL:Q93GX3 (EMBL:AB070957) (257 aa) fasta scores: E(): 5.3e-29, 38.99% id in 259 aa
YP_107922.1	Similar to Ralstonia solanacearum probable ATP-binding ABC transporter protein rsc1794 or rs04193 SWALL:Q8XYG4 (EMBL:AL646066) (359 aa) fasta scores: E(): 1.5e-68, 64.36% id in 348 aa, and to Escherichia coli ferric transport ATP-binding protein AfuC or b0262 SWALL:AFUC_ECOLI (SWALL:P37009) (348 aa) fasta scores: E(): 1.9e-36, 40.76% id in 341 aa
YP_107923.1	Similar to Ralstonia solanacearum probable permease transmembrane ABC transporter protein rsc1793 or rs04192 SWALL:Q8XYG5 (EMBL:AL646066) (265 aa) fasta scores: E(): 4.6e-63, 71.59% id in 250 aa, and to Escherichia coli hypothetical ABC transporter permease YdcV or b1443 SWALL:YDCV_ECOLI (SWALL:P77505) (264 aa) fasta scores: E(): 6.5e-12, 33.84% id in 263 aa. Note: this CDS is longer in its N-terminal region than most of its database matches
YP_107924.1	Similar to Escherichia coli, and Escherichia coli O157:H7 molybdenum transport system permease ModB or ChlJ or b0764 or z0934 or ecs0792 SWALL:MODB_ECOLI (SWALL:P09834) (229 aa) fasta scores: E(): 1.3e-13, 32.03% id in 206 aa, and to Ralstonia solanacearum probable transport system permease transmembrane ABC transporter protein rsc1792 or rs04191 SWALL:Q8XYG6 (EMBL:AL646066) (282 aa) fasta scores: E(): 4.1e-70, 70.58% id in 272 aa. Note: this CDS is longer in its N-terminal region than some of its database matches
YP_107925.1	Similar to Ralstonia solanacearum probable solute-binding periplasmic rsc1791 or rs04190 SWALL:Q8XYG7 (EMBL:AL646066) (343 aa) fasta scores: E(): 1.9e-99, 73.51% id in 336 aa, and to Campylobacter jejuni periplasmic solute-binding protein cj0727 SWALL:Q9PPI0 (EMBL:AL139076) (348 aa) fasta scores: E(): 1.6e-27, 34.33% id in 300 aa
YP_107926.1	Similar to Escherichia coli, and Escherichia coli O157:H7 ribose operon repressor RbsR or b3753 or z5254 or ecs4695 SWALL:RBSR_ECOLI (SWALL:P25551) (329 aa) fasta scores: E(): 6.4e-26, 33.64% id in 321 aa, and to Ralstonia solanacearum probable transcription regulator protein rsc1790 or rs04189 SWALL:Q8XYG8 (EMBL:AL646066) (360 aa) fasta scores: E(): 2.4e-62, 56.39% id in 344 aa
YP_107927.1	No significant database matches to the full length CDS. N-terminus is similar to the N-terminal regions of Burkholderia cepacia outer membrane protein OpcP1 SWALL:Q45106 (EMBL:D63823) (361 aa) fasta scores: E(): 0.0057, 44.59% id in 74 aa, and Ralstonia solanacearum probable porin transmembrane protein RS04105 SWALL:Q8Y0G2 (EMBL:AL646062) (394 aa) fasta scores: E(): 0.024, 42.85% id in 63 aa
YP_107928.1	Poor database matches. Weakly similar to an internal region of Mycobacterium tuberculosis, and Mycobacterium bovis  lipoprotein precursor LppW SWALL:LPPW_MYCTU (SWALL:Q10823) (314 aa) fasta scores: E(): 1.4, 34.74% id in 118 aa
YP_107930.1	C-terminus is similar to an internal region of Salmonella typhimurium  membrane domain involved in signal transduction, diguanylate cyclase/phosphodiesterase domain 1, diguanylate cyclase/phosphodiesterase domain 2 stm3388 SWALL:Q8ZLN7 (EMBL:AE008856) (699 aa) fasta scores: E(): 1.8e-18, 30.02% id in 393 aa. C-terminal region is similar to Rhizobium loti response regulator protein mll0859 SWALL:Q98LV6 (EMBL:AP002995) (408 aa) fasta scores: E(): 2.3e-20, 43.59% id in 195 aa
YP_107931.1	Similar to Ralstonia solanacearum hypothetical protein rsp0712 or rs01737 SWALL:Q8XRW9 (EMBL:AL646080) (200 aa) fasta scores: E(): 1.4e-48, 57.5% id in 200 aa, and to Rhizobium loti hypothetical protein mll4476 SWALL:Q98DZ5 (EMBL:AP003004) (209 aa) fasta scores: E(): 1.5e-16, 30.76% id in 195 aa
YP_107932.1	Similar to Ralstonia solanacearum probable transmembrane protein rsp0711 or rs01738 SWALL:Q8XRX0 (EMBL:AL646080) (277 aa) fasta scores: E(): 3.6e-60, 58.42% id in 267 aa, and to Rhizobium loti hypothetical protein mll0509 SWALL:Q98MN1 (EMBL:AP002995) (295 aa) fasta scores: E(): 2.1e-21, 35.61% id in 278 aa. Note: This CDS is shorter in its N-terminal region than most of its database matches
YP_107933.1	Similar to Ralstonia solanacearum hypothetical protein rsp0689 or rs01760 SWALL:Q8XRZ2 (EMBL:AL646080) (212 aa) fasta scores: E(): 4.2e-61, 71.69% id in 212 aa, and to Rhizobium loti transcriptional regulator mll0013 SWALL:Q98NS0 (EMBL:AP002994) (216 aa) fasta scores: E(): 6.3e-30, 42.78% id in 201 aa
YP_107934.1	Similar to Rhizobium meliloti probable rhizopine catabolism regulatory protein MocR SWALL:MOCR_RHIME (SWALL:P49309) (493 aa) fasta scores: E(): 6.7e-42, 36.41% id in 497 aa, to Rhizobium loti transcriptional regulator mlr6174 SWALL:Q98A34 (EMBL:AP003008) (489 aa) fasta scores: E(): 7.1e-51, 39.6% id in 500 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa5431 SWALL:Q9HTD5 (EMBL:AE004955) (491 aa) fasta scores: E(): 5.4e-50, 42.88% id in 499 aa
YP_107935.1	Similar to Pseudomonas putida bkd operon transcriptional regulator BkdR SWALL:BKDR_PSEPU (SWALL:P42179) (161 aa) fasta scores: E(): 2e-12, 30.92% id in 152 aa, to Ralstonia solanacearum probable transcription regulator protein rsc2801 or rs00304 SWALL:Q8XVM9 (EMBL:AL646071) (158 aa) fasta scores: E(): 1.6e-18, 39.61% id in 154 aa, and to Rhizobium loti transcription regulator protein msi248 SWALL:CAD31280 (EMBL:AL672114) (151 aa) fasta scores: E(): 9e-17, 42.46% id in 146 aa
YP_107936.1	Similar to Escherichia coli glucosamine--fructose-6-phosphate aminotransferase [isomerizing] GlmS or b3729 SWALL:GLMS_ECOLI (SWALL:P17169) (608 aa) fasta scores: E(): 6.3e-89, 48.27% id in 638 aa, and to Ralstonia solanacearum glucosamine--fructose-6-phosphate aminotransferase [isomerizing] rsc0178 or rs00609 SWALL:GLMS_RALSO (SWALL:Q8Y303) (611 aa) fasta scores: E(): 8e-118, 60.25% id in 639 aa
YP_107937.1	Similar to Anabaena sp. hypothetical protein all1106 SWALL:Q8YXV3 (EMBL:AP003584) (475 aa) fasta scores: E(): 4.6e-42, 38.52% id in 462 aa, and to Streptomyces antibioticus  dioxygenase SimC5 SWALL:Q9AMI1 (EMBL:AF324838) (456 aa) fasta scores: E(): 9.2e-42, 37.68% id in 467 aa
YP_107938.1	Similar to Pseudomonas aeruginosa hypothetical protein pa3765 SWALL:Q9HXN0 (EMBL:AE004795) (194 aa) fasta scores: E(): 9.9e-27, 56.1% id in 221 aa, and to Caulobacter crescentus hypothetical protein cc2024 SWALL:Q9A6R0 (EMBL:AE005875) (186 aa) fasta scores: E(): 1.6e-22, 44.39% id in 223 aa. Note: This CDS contains an internal region that has no similarities with the database matches, from residue 75 to residue 111
YP_107939.1	Similar to, although shorter in its N-terminal region than Agrobacterium tumefaciens transcriptional regulator, LysR family atu4367 or agr_l_999 SWALL:Q8U7T2 (EMBL:AE009365) (345 aa) fasta scores: E(): 2.2e-93, 75.25% id in 299 aa, and similar in its full length to Pseudomonas aeruginosa probable transcriptional regulator pa2877 SWALL:Q9HZX0 (EMBL:AE004714) (297 aa) fasta scores: E(): 2.3e-72, 61.74% id in 298 aa
YP_107940.1	Similar to Pseudomonas aeruginosa probable short-chain dehydrogenase pa2918 SWALL:Q9HZS9 (EMBL:AE004718) (257 aa) fasta scores: E(): 2.1e-76, 83.26% id in 257 aa, and to Rhizobium loti probable dehydrogenase/reductase mlr1583 SWALL:Q98K90 (EMBL:AP002997) (243 aa) fasta scores: E(): 1.5e-24, 40.23% id in 251 aa
YP_107941.1	Similar to Ralstonia solanacearum  lipoprotein transmembrane rsp0124 or rs02998 SWALL:Q8XTI4 (EMBL:AL646076) (276 aa) fasta scores: E(): 6.3e-37, 71.27% id in 282 aa, and to Xanthomonas axonopodis hypothetical protein xac0677 SWALL:AAM35566 (EMBL:AE011696) (271 aa) fasta scores: E(): 9.9e-12, 40.49% id in 284 aa. Note: this CDS is longer in its C-terminal region than most of its database matches and the region rich in Ala, Pro, Ser adn Thr amino acids residues has limited similarities with the database matches
YP_107942.1	Similar to Pseudomonas aeruginosa hypothetical protein pa1837 SWALL:Q9I2Q8 (EMBL:AE004609) (165 aa) fasta scores: E(): 4.8e-10, 42.27% id in 123 aa, and to Caulobacter crescentus hypothetical protein cc1120 SWALL:Q9A974 (EMBL:AE005790) (168 aa) fasta scores: E(): 4.6e-09, 38.58% id in 127 aa. Note: this CDS is longer in its N-terminal region than most of its database matches
YP_107943.1	Similar to Ralstonia solanacearum probable sulfite reductase oxidoreductase CysI2 or rsc1862 or rs03422 SWALL:Q8XYA0 (EMBL:AL646067) (577 aa) fasta scores: E(): 4.4e-50, 51.78% id in 616 aa, and to Phormidium laminosum ferredoxin--nitrite reductase NirA or Nir SWALL:NIR_PHOLA (SWALL:Q51879) (510 aa) fasta scores: E(): 6.6e-10, 26.8% id in 567 aa. Note: The region between residues 80 and 105 presents very low or none similarities with the database matches
YP_107944.1	Very low similarity to Ralstonia solanacearum probable transmembrane protein rsc0366 or rs03334 SWALL:Q8Y2H0 (EMBL:AL646058) (70 aa) fasta scores: E(): 0.0019, 42% id in 50 aa
YP_107945.1	Similar to Pseudomonas aeruginosa hypothetical protein pa4132 SWALL:Q9HWP9 (EMBL:AE004829) (471 aa) fasta scores: E(): 9.9e-93, 55.16% id in 484 aa, and to Salmonella typhimurium  regulatory protein, GntR family YdcR or stm1598 SWALL:Q8ZPC8 (EMBL:AE008770) (474 aa) fasta scores: E(): 6.7e-69, 47.21% id in 485 aa
YP_107946.1	Similar to Rhizobium loti small heat shock protein mlr4721 SWALL:Q98DG0 (EMBL:AP003004) (159 aa) fasta scores: E(): 9.2e-11, 40.15% id in 132 aa, and to Deinococcus radiodurans heat shock protein, Hsp20 family dr1114 SWALL:Q9RVB5 (EMBL:AE001961) (182 aa) fasta scores: E(): 1.3e-07, 32.45% id in 114 aa. Note: This CDS is shorter in its N-terminal region than most of its database matches. It is also similar to BPSL2917 (140 aa) fasta scores: E(): 9.5e-27, 57.576% identity in 132 aa overlap
YP_107947.1	Similar to Thermotoga maritima heat shock protein, class I tm0374 SWALL:Q9WYK7 (EMBL:AE001717) (147 aa) fasta scores: E(): 1e-11, 34.78% id in 138 aa, and to Chlamydomonas reinhardtii chloroplast heat shock 22 kDa protein SWALL:HS2C_CHLRE (SWALL:P12811) (157 aa) fasta scores: E(): 2.4e-09, 34.69% id in 147 aa. Note: Presents also similarity to BPSL2918 (181 aa) fasta scors: E(): 1.6e-32, 59.333% identity in 150 aa overlap
YP_107948.1	Similar to Pseudomonas putida hypothetical protein SWALL:O68643 (EMBL:AF052749) (109 aa) fasta scores: E(): 2.2e-18, 48.57% id in 105 aa, and to Salmonella typhimurium  cytoplasmic protein stm1261 SWALL:Q8ZPY1 (EMBL:AE008755) (108 aa) fasta scores: E(): 2.4e-19, 47.17% id in 106 aa
YP_107949.1	GTP; catalyzes the phosphorylation and decarboxylation of oxaloacetate to form phosphoenolpyruvate using GTP
YP_107950.1	Similar to Streptomyces coelicolor 3-hydroxyacyl-CoA dehydrogenase sco6297 or scbac8d1.10C SWALL:Q93RX5 (EMBL:AL591084) (318 aa) fasta scores: E(): 2e-47, 45.65% id in 311 aa, and to Bacillus subtilis probable 3-hydroxybutyryl-CoA dehydrogenase MmgB SWALL:HBD_BACSU (SWALL:P45856) (287 aa) fasta scores: E(): 2e-12, 32.14% id in 224 aa
YP_107951.1	Similar to Burkholderia cepacia 2,2-dialkylglycine decarboxylase repressor protein DgdR SWALL:DGDR_BURCE (SWALL:P16931) (293 aa) fasta scores: E(): 3.3e-22, 35.71% id in 252 aa, and to Streptomyces coelicolor LysR-type transcriptional regulator sco6555 or sc4b5.05C SWALL:Q9ZBW3 (EMBL:AL034443) (292 aa) fasta scores: E(): 2e-33, 43.32% id in 277 aa
YP_107952.1	Similar to Pseudomonas putida malonate transporter MdcL SWALL:Q9Z446 (EMBL:AB017138) (163 aa) fasta scores: E(): 5.7e-27, 66.15% id in 130 aa, and to Acinetobacter calcoaceticus malonate carrier protein MdcL SWALL:Q9RGM5 (EMBL:AF121266) (133 aa) fasta scores: E(): 3.3e-19, 51.9% id in 131 aa. Note: This CDS is shorter in its N-terminal region than most of its database matches
YP_107953.1	Similar to Pseudomonas putida malonate transporter MdcM SWALL:Q9Z445 (EMBL:AB017138) (254 aa) fasta scores: E(): 1.6e-59, 72.51% id in 251 aa, and to Malonomonas rubra MadM SWALL:O06932 (EMBL:U87980) (255 aa) fasta scores: E(): 2.3e-48, 61.53% id in 247 aa
YP_107954.1	Similar to Xanthomonas campestris alpha subunit of malonate decarboxylase xcc3609 SWALL:AAM42879 (EMBL:AE012482) (548 aa) fasta scores: E(): 2.1e-149, 69.78% id in 546 aa, and to Burkholderia cepacia malonate decarboxylase alpha-subunit MdcA SWALL:Q93L22 (EMBL:AF029344) (560 aa) fasta scores: E(): 3.2e-148, 69.55% id in 555 aa
YP_107955.1	acyl carrier protein of malonate decarboxylase
YP_107956.1	The beta subunit catalyzes the decarboxylation of the malonyl moiety on coenzyme A
YP_107957.1	Similar to Xanthomonas axonopodis malonate decarboxylase gamma subunit xac0563 SWALL:AAM35452 (EMBL:AE011683) (234 aa) fasta scores: E(): 2.1e-27, 44.63% id in 233 aa, and to Burkholderia cepacia malonate decarboxylase gamma-subunit MdcE SWALL:Q93L25 (EMBL:AF029344) (233 aa) fasta scores: E(): 2.8e-24, 42.6% id in 230 aa
YP_107958.2	catalyzes the transfer of 2-(5''-triphosphoribosyl)-3'-dephosphocoenzyme-A to the apo-acyl carrier protein of malonate dehydrogenase to form holo-acyl carrier protein
YP_107959.1	Possible pseudogene. Similar to the C-terminal region of Escherichia coli 2--(5''-triphosphoribosyl)-3'-dephosphocoenzyme-A synthase CitG or b0613 SWALL:CITG_ECOLI (SWALL:P77231) (292 aa) fasta scores: E(): 1.7e-15, 34.36% id in 259 aa, and to Xanthomonas campestris CitG protein or xcc3614 SWALL:AAM42884 (EMBL:AE012482) (279 aa) fasta scores: E(): 1.3e-29, 46.72% id in 244 aa. Similarity to orthologues extends beyond the predicted translational start site, however extended CDS lacks appropriate translational start. Upstream similarity ends at a repeat region
YP_107960.1	Similar to Escherichia coli malonyl CoA-acyl carrier protein transacylase FabD or TfpA or b1092 SWALL:FABD_ECOLI (SWALL:P25715) (308 aa) fasta scores: E(): 2.6e-14, 29.66% id in 300 aa, and to Xanthomonas campestris malonyl CoA-ACP transacylase MdcH or xcc3615 SWALL:AAM42885 (EMBL:AE012482) (306 aa) fasta scores: E(): 3.1e-40, 48.36% id in 306 aa, and to
YP_107961.1	Similar to Ralstonia solanacearum  endonuclease rsc2452 or rs01154 SWALL:Q8XWM2 (EMBL:AL646070) (189 aa) fasta scores: E(): 3.8e-06, 32.16% id in 171 aa, and to the plasmid borne Escherichia coli, and Salmonella typhimurium endonuclease Nuc SWALL:Q46707 (EMBL:U09868) (177 aa) fasta scores: E(): 1.1e-05, 28.47% id in 151 aa
YP_107962.1	Similar to Ralstonia solanacearum hypothetical protein rsp0795 or rs01912 SWALL:Q8XRN6 (EMBL:AL646080) (290 aa) fasta scores: E(): 1.3e-30, 37.63% id in 279 aa, and to Pseudomonas aeruginosa hypothetical protein pa1291 SWALL:Q9I453 (EMBL:AE004558) (279 aa) fasta scores: E(): 9.8e-27, 39.03% id in 269 aa. Note: this CDS is longer in its N-terminal region than most of its database matches
YP_107963.1	Similar to Ralstonia solanacearum hypothetical protein rsc0129 or rs00999 SWALL:Q8Y352 (EMBL:AL646057) (202 aa) fasta scores: E(): 2.1e-39, 58.09% id in 210 aa, and to Ralstonia solanacearum  glutathione S-transferase rsc2721 or rs00001 SWALL:Q8XVV6 (EMBL:AL646071) (202 aa) fasta scores: E(): 1.3e-10, 31.1% id in 209 aa
YP_107964.1	Similar to Escherichia coli, and Escherichia coli O157:H7 proline/betaine transporter ProP or b4111 or z5713 or ecs5093 SWALL:PROP_ECOLI (SWALL:P30848) (500 aa) fasta scores: E(): 3.7e-94, 52.62% id in 458 aa, and to Streptomyces coelicolor  integral membrane transport protein sco2336 or scc53.27 SWALL:Q9KXI4 (EMBL:AL357591) (462 aa) fasta scores: E(): 1.5e-111, 65.8% id in 465 aa
YP_107965.1	Similar to Ralstonia solanacearum probable transmembrane protein rsp1275 or rs05320 SWALL:Q8XQF2 (EMBL:AL646083) (110 aa) fasta scores: E(): 3.7e-31, 79.8% id in 104 aa, and to Xanthomonas campestris hypothetical protein xcc2880 SWALL:AAM42152 (EMBL:AE012401) (111 aa) fasta scores: E(): 1.8e-22, 66% id in 100 aa
YP_107966.1	3'-5' exonuclease of DNA polymerase III
YP_107967.1	Similar to Escherichia coli, and Escherichia coli O157:H7 ribonuclease HI RnhA or Rnh or DasF or HerA or sdrA or b0214 or z0239 or ecs0210 SWALL:RNH_ECOLI (SWALL:P00647) (155 aa) fasta scores: E(): 2.2e-36, 65.44% id in 136 aa, and to Caulobacter crescentus ribonuclease H cc3365 SWALL:RNH_CAUCR (SWALL:Q9A341) (149 aa) fasta scores: E(): 2.4e-42, 75.18% id in 137 aa
YP_107968.1	Similar to Ralstonia solanacearum hypothetical protein rsc1514 or rs03790 SWALL:Q8XZ90 (EMBL:AL646065) (257 aa) fasta scores: E(): 2e-52, 57.56% id in 238 aa, and to Neisseria meningitidis hypothetical protein nmb1296 SWALL:Q9JZ46 (EMBL:AE002478) (221 aa) fasta scores: E(): 4.1e-15, 33.62% id in 232 aa
YP_107969.1	Similar to Ralstonia solanacearum hydroxyacylglutathione hydrolase rsc1515 or rs03789 SWALL:Q8XZ89 (EMBL:AL646065) (284 aa) fasta scores: E(): 1.6e-51, 55.68% id in 264 aa, and to Synechocystis sp. probable hydroxyacylglutathione hydrolase sll1019 SWALL:GLO2_SYNY3 (SWALL:P72933) (257 aa) fasta scores: E(): 6.9e-32, 43.72% id in 263 aa
YP_107970.1	Similar to Escherichia coli membrane-bound lytic murein transglycosylase D precursor MltD or DniR or b0211 SWALL:MLTD_ECOLI (SWALL:P23931) (452 aa) fasta scores: E(): 5.4e-35, 34.26% id in 467 aa, and to Ralstonia solanacearum  membrane-bound lytic murein transglycosylase-like lipoprotein rsc1516 or rs03787 SWALL:Q8XZ88 (EMBL:AL646065) (451 aa) fasta scores: E(): 9.5e-99, 62.52% id in 451 aa
YP_107971.1	Similar to Archaeoglobus fulgidus hypothetical protein af0907 SWALL:O29355 (EMBL:AE001041) (419 aa) fasta scores: E(): 4.2e-27, 31.15% id in 398 aa, and to Escherichia coli bicyclomycin resistance protein Bcr or BicA or BicR or Sur or SuxA or b2182 SWALL:BCR_ECOLI (SWALL:P28246) (396 aa) fasta scores: E(): 4.6e-07, 23.78% id in 391 aa
YP_107973.1	Similar to Mycobacterium tuberculosis hypothetical transcriptional regulator rv1395 or mt1440 or mtcy21b4.12 SWALL:YD95_MYCTU (SWALL:P71663) (344 aa) fasta scores: E(): 1.4e-35, 36.74% id in 332 aa, and to Pseudomonas aeruginosa ornithine utilization regulator OruR or pa0831 SWALL:ORUR_PSEAE (SWALL:P72171) (339 aa) fasta scores: E(): 1.1e-25, 31.09% id in 328 aa
YP_107974.1	catalyzes production of carbamoyl phosphate from bicarbonate and glutamine in pyrimidine and arginine biosynthesis pathways; forms an octamer composed of four CarAB dimers
YP_107975.1	Similar to Pseudomonas aeruginosa hypothetical protein pa4757 SWALL:YBF7_PSEAE (SWALL:P38102) (216 aa) fasta scores: E(): 8.6e-56, 71.16% id in 215 aa, and to Escherichia coli hypothetical protein YeaS or b1798 SWALL:YEAS_ECOLI (SWALL:P76249) (212 aa) fasta scores: E(): 5.2e-34, 46.04% id in 215 aa
YP_107976.1	four CarB-CarA dimers form the carbamoyl phosphate synthetase holoenzyme that catalyzes the production of carbamoyl phosphate; CarB is responsible for the amidotransferase activity
YP_107977.1	necessary for efficient RNA polymerase transcription elongation past template-encoded arresting sites; arresting sites in DNA have the property of trapping a certain fraction of elongating RNA polymerases that pass through, resulting in locked ternary complexes. Cleavage of the nascent transcript by cleavage factors such as GreA or GreB allows the resumption of elongation from the new 3'terminus
YP_107978.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc1523 or rs03781 SWALL:Q8XZ81 (EMBL:AL646065) (155 aa) fasta scores: E(): 3.5e-30, 61.74% id in 149 aa
YP_107979.1	Similar to Ralstonia solanacearum hypothetical protein rsc1524 or rs03780 SWALL:Q8XZ80 (EMBL:AL646065) (165 aa) fasta scores: E(): 4.7e-20, 59.77% id in 179 aa, and to the N-terminal region of Neisseria meningitidis hypothetical protein nma1009 SWALL:Q9JV39 (EMBL:AL162754) (94 aa) fasta scores: E(): 3.7e-12, 50.56% id in 89 aa
YP_107980.1	Similar to Escherichia coli, and Escherichia coli O157:H7 ribosomal RNA large subunit methyltransferase J RrmJ or FtsJ or MrsF or b3179 or z4541 or ecs4058 SWALL:RRMJ_ECOLI (SWALL:P28692) (209 aa) fasta scores: E(): 9.2e-16, 43.96% id in 207 aa, and to Ralstonia solanacearum probable ribosomal RNA large subunit methyltransferase J rsc1525 or rs04752 SWALL:Q8XZ79 (EMBL:AL646065) (221 aa) fasta scores: E(): 3e-64, 78.02% id in 223 aa
YP_107981.1	Similar to Escherichia coli cell division protein HflB or FtsH or MrsC or TolZ or b3178 SWALL:FTSH_ECOLI (SWALL:P28691) (644 aa) fasta scores: E(): 2.3e-120, 58% id in 631 aa, and to Ralstonia solanacearum probable ATP-dependent zinc metallopeptidase rsc1526 or rs03778 SWALL:Q8XZ78 (EMBL:AL646065) (628 aa) fasta scores: E(): 2.4e-178, 82.06% id in 630 aa
YP_107982.1	Similar to Escherichia coli dihydropteroate synthase FolP or DhpS or b3177 SWALL:DHPS_ECOLI (SWALL:P26282) (282 aa) fasta scores: E(): 2.4e-41, 48.9% id in 274 aa, and to Haemophilus influenzae dihydropteroate synthase FolP SWALL:Q93T09 (EMBL:AF378241) (273 aa) fasta scores: E(): 3.1e-44, 50.74% id in 270 aa. Note: this CDS is longer in its N-terminal region than most of its database matches
YP_107983.1	catalyzes the conversion of glucosamine-6-phosphate to glucosamine-1-phosphate
YP_107984.1	Similar to Escherichia coli phosphate-binding periplasmic protein precursor PstS or PhoS or b3728 SWALL:PSTS_ECOLI (SWALL:P06128) (346 aa) fasta scores: E(): 2.5e-86, 63.26% id in 343 aa, and to Ralstonia solanacearum probable phosphate-binding periplasmic rsc1529 or rs03775 SWALL:Q8XZ75 (EMBL:AL646065) (343 aa) fasta scores: E(): 2.2e-97, 71.84% id in 341 aa
YP_107985.1	part of the ATP-dependent phosphate uptake system PstABCS responsible for inorganic phosphate (Pi) uptake under Pi starvation conditions
YP_107986.2	Part of the ABC transporter complex PstABCS responsible for inorganic phosphate (Pi) uptake under Pi starvation conditions
YP_107987.1	ATP-binding protein; PstABCS is an ATP dependent phosphate uptake system which is responsible for inorganic phosphate uptake during phosphate starvation
YP_107988.1	Similar to Escherichia coli phosphate transport system protein PhoU or NmpA or b3724 SWALL:PHOU_ECOLI (SWALL:P07656) (241 aa) fasta scores: E(): 7.3e-32, 46.28% id in 229 aa, and to Ralstonia solanacearum probable phosphate transport system protein rsc1533 or rs03771 SWALL:Q8XZ71 (EMBL:AL646065) (235 aa) fasta scores: E(): 6.6e-53, 67.09% id in 231 aa
YP_107989.1	Similar to Escherichia coli, and Escherichia coli O157:H7 phosphate regulon transcriptional regulatory protein PhoB or b0399 or z0497 or ecs0449 SWALL:PHOB_ECOLI (SWALL:P08402) (229 aa) fasta scores: E(): 3.8e-51, 57.82% id in 230 aa, and to Ralstonia solanacearum probable phosphate regulon two-component response regulator transcription regulator protein rsc1534 or rs03769 SWALL:Q8XZ70 (EMBL:AL646065) (237 aa) fasta scores: E(): 1.6e-75, 83.33% id in 234 aa
YP_107990.1	Similar to Escherichia coli phosphate regulon sensor protein PhoR or NmpB or b0400 SWALL:PHOR_ECOLI (SWALL:P08400) (431 aa) fasta scores: E(): 1.5e-50, 36.83% id in 429 aa, and to Ralstonia solanacearum probable phosphate regulon two-component sensor kinase transcription regulator protein rsc1535 or rs03768 SWALL:Q8XZ69 (EMBL:AL646065) (443 aa) fasta scores: E(): 1.5e-104, 61.89% id in 433 aa
YP_107991.2	catalyzes the reversible transfer of the terminal phosphate of ATP to form a long chain polyphosphate
YP_107992.1	Similar to Escherichia coli, and Escherichia coli O157:H7 exopolyphosphatase Ppx or b2502 or z3765 or ecs3364 SWALL:PPX_ECOLI (SWALL:P29014) (512 aa) fasta scores: E(): 1.7e-60, 37.7% id in 496 aa, and to Ralstonia solanacearum probable exopolyphosphatase rsc1537 or rs03765 SWALL:Q8XZ67 (EMBL:AL646065) (527 aa) fasta scores: E(): 5.1e-134, 67.64% id in 513 aa. Note: this CDS is longer in its N-terminal region than most of its database matches
YP_107994.1	Similar to Rhizobium loti hypothetical protein mll6491 SWALL:Q989C0 (EMBL:AP003009) (328 aa) fasta scores: E(): 1.2e-20, 32.48% id in 314 aa
YP_107995.1	Similar to Ralstonia solanacearum hypothetical protein rsc3377 or rs02651 SWALL:Q8XU17 (EMBL:AL646075) (170 aa) fasta scores: E(): 2.1e-09, 41.2% id in 182 aa. Note: this CDS is longer in its N-terminal region than most of its few database matches
YP_107998.1	Similar to Ralstonia solanacearum hypothetical protein rsc2888 or rs00212 SWALL:Q8XVE3 (EMBL:AL646072) (152 aa) fasta scores: E(): 4.4e-19, 44.03% id in 134 aa. Note: This CDS is shorter in its N-terminal region than its significant database match
YP_107999.1	Similar to Burkholderia thailandensis hypothetical protein SWALL:Q8VP92 (EMBL:AY063741) (153 aa) fasta scores: E(): 1.4e-53, 94.77% id in 153 aa, and to Ralstonia solanacearum probable hydrolase rsc1539 or rs03763 SWALL:Q8XZ65 (EMBL:AL646065) (157 aa) fasta scores: E(): 5.8e-27, 53.45% id in 159 aa
YP_108000.1	Similar to Burkholderia thailandensis hypothetical protein SWALL:Q8VP91 (EMBL:AY063741) (272 aa) fasta scores: E(): 1.5e-112, 98.89% id in 272 aa, and to Ralstonia solanacearum hypothetical protein rsc1538 or rs03764 SWALL:Q8XZ66 (EMBL:AL646065) (278 aa) fasta scores: E(): 7.1e-67, 65.7% id in 277 aa
YP_108003.1	Similar to Ralstonia solanacearum probable DNA-damage-inducible F transmembrane protein rsp0283 or rs03681 SWALL:Q8XT32 (EMBL:AL646077) (457 aa) fasta scores: E(): 6.8e-99, 61.35% id in 458 aa, and to Escherichia coli DNA-damage-inducible protein F DinF or b4044 SWALL:DINF_ECOLI (SWALL:P28303) (459 aa) fasta scores: E(): 2e-55, 42.99% id in 414 aa
YP_108004.1	Similar to Pseudomonas aeruginosa hypothetical protein pa1075 SWALL:Q9I4Q4 (EMBL:AE004539) (105 aa) fasta scores: E(): 1.1e-16, 54.25% id in 94 aa
YP_108005.1	Similar to Bacillus subtilis acetyl-coenzyme A synthetase AcsA SWALL:ACSA_BACSU (SWALL:P39062) (572 aa) fasta scores: E(): 5.7e-54, 34.63% id in 540 aa, and to Rhizobium loti acetyl-CoA synthetase mll6017 SWALL:Q98AG0 (EMBL:AP003008) (562 aa) fasta scores: E(): 8.3e-119, 55.51% id in 553 aa
YP_108006.1	Similar to Salmonella typhi possible lipoprotein sty3194 SWALL:Q8Z3Y0 (EMBL:AL627277) (250 aa) fasta scores: E(): 2.7e-27, 47.05% id in 221 aa, and to Pseudomonas aeruginosa lipoprotein NlpD/LppB homolog precursor pa3623 SWALL:NLPD_PSEAE (SWALL:P45682) (297 aa) fasta scores: E(): 1.1e-21, 43.98% id in 241 aa
YP_108007.1	Similar to Ralstonia solanacearum hypothetical protein rsc1585 or rs03937 SWALL:Q8XZ21 (EMBL:AL646065) (312 aa) fasta scores: E(): 5.3e-59, 51.75% id in 313 aa, and to Rhizobium loti hypothetical protein mlr0411 SWALL:Q98MW4 (EMBL:AP002994) (294 aa) fasta scores: E(): 3.7e-12, 30.71% id in 306 aa
YP_108008.1	phosphatase activity in Escherichia coli not kinase; involved in bacitracin resistance as bacitracin supposedly sequesters undecaprenyl disphosphate which reduces the pool of lipid carrier available to the cell
YP_108009.1	Low similarity to Pseudomonas aeruginosa hypothetical protein pa3908 SWALL:Q9HXA5 (EMBL:AE004808) (239 aa) fasta scores: E(): 6e-06, 24.46% id in 233 aa
YP_108010.1	Partially similar to Pseudomonas aeruginosa hypothetical protein pa3907 SWALL:Q9HXA6 (EMBL:AE004808) (261 aa) fasta scores: E(): 1.7e-05, 27.05% id in 170 aa. Note: 10 first residues overlap with the upstream CDS
YP_108011.1	Similar to the N-terminal part of Pseudomonas aeruginosa hypothetical protein pa3906 SWALL:Q9HXA7 (EMBL:AE004808) (127 aa) fasta scores: E(): 0.0096, 34.31% id in 102 aa. Note: Overlaps with the downstream CDS in 10 residues
YP_108012.1	Low similarity to Pseudomonas aeruginosa hypothetical protein pa3905 SWALL:Q9HXA8 (EMBL:AE004808) (175 aa) fasta scores: E(): 0.0056, 32.71% id in 107 aa
YP_108015.1	Similar to Streptomyces violaceus streptavidin V2 precursor SWALL:SAV2_STRVL (SWALL:Q53533) (183 aa) fasta scores: E(): 1e-07, 33.11% id in 154 aa, and to Streptomyces avidinii streptavidin precursor SWALL:SAV_STRAV (SWALL:P22629) (183 aa) fasta scores: E(): 4.6e-07, 30.48% id in 164 aa
YP_108016.1	Similar to the plasmid borne Pseudomonas putida nuclease SWALL:Q8VMF9 (EMBL:AJ344068) (185 aa) fasta scores: E(): 2.7e-30, 54.19% id in 155 aa, and to Escherichia coli, and Salmonella typhimurium endonuclease Nuc SWALL:Q46707 (EMBL:U09868) (177 aa) fasta scores: E(): 8e-28, 47.64% id in 170 aa
YP_108017.1	Similar to Pseudomonas aeruginosa probable acetylpolyamine aminohydrolase pa3774 SWALL:Q9HXM1 (EMBL:AE004796) (380 aa) fasta scores: E(): 2.2e-99, 66.12% id in 366 aa, and to Rhizobium loti hypothetical protein mlr7469 SWALL:Q985Y7 (EMBL:AP003011) (308 aa) fasta scores: E(): 6.8e-35, 39.86% id in 291 aa. Note: This CDS is longer in its N-terminal region than most of its database matches
YP_108018.1	Similar to Pseudomonas aeruginosa hypothetical protein pa3773 SWALL:Q9HXM2 (EMBL:AE004796) (385 aa) fasta scores: E(): 2e-54, 49.73% id in 374 aa, and to Streptomyces coelicolor  transmembrane efflux protein sco2545 or scc77.12 SWALL:Q9RDE6 (EMBL:AL136503) (449 aa) fasta scores: E(): 5.6e-12, 29.58% id in 382 aa
YP_108019.1	Similar to Ralstonia solanacearum  porin signal peptide protein rsc2760 or rs00094 SWALL:Q8XVR9 (EMBL:AL646071) (353 aa) fasta scores: E(): 2e-21, 31.74% id in 356 aa, and to Neisseria gonorrhoeae major outer membrane protein P.IA precursor PorA SWALL:OMA_NEIGO (SWALL:P05430) (326 aa) fasta scores: E(): 4.8e-08, 27.58% id in 319 aa
YP_108020.1	C-terminal region is similar to Pseudomonas aeruginosa probable transcriptional regulator pa3771 SWALL:Q9HXM4 (EMBL:AE004796) (325 aa) fasta scores: E(): 2.4e-19, 29.81% id in 332 aa, and to the C-terminal region to Xanthomonas axonopodis two-component system regulatory protein xac0136 SWALL:AAM35028 (EMBL:AE011636) (210 aa) fasta scores: E(): 0.011, 30.35% id in 112 aa. Possible alternative translational start site
YP_108021.1	ketopantoate reductase; catalyzes the NADPH reduction of ketopantoate to pantoate; functions in pantothenate (vitamin B5) biosynthesis
YP_108022.1	Similar to Rhizobium loti transcriptional regulator mll8302 SWALL:Q983J5 (EMBL:AP003013) (146 aa) fasta scores: E(): 1.7e-10, 35.2% id in 125 aa, and to Xanthomonas campestris transcriptional regulator MarR/EmrR family xcc0435 SWALL:AAM39753 (EMBL:AE012141) (162 aa) fasta scores: E(): 2.6e-10, 30.88% id in 136 aa, and weakly to Escherichia coli multiple antibiotic resistance protein MarR or SoxQ or CfxB or InaR or b1530 SWALL:MARR_ECOLI (SWALL:P27245) (144 aa) fasta scores: E(): 0.00063, 25.98% id in 127 aa
YP_108023.1	Similar to Pseudomonas aeruginosa hypothetical protein pa1052 SWALL:Q9I4S2 (EMBL:AE004537) (381 aa) fasta scores: E(): 5.2e-50, 50.13% id in 377 aa, and to Bacillus subtilis glycerate kinase GlxK or S14A SWALL:GRK_BACSU (SWALL:P42100) (382 aa) fasta scores: E(): 1.1e-38, 40.1% id in 379 aa
YP_108024.1	Tig; RopA; peptidyl-prolyl cis/trans isomerase; promotes folding of newly synthesized proteins; binds ribosomal 50S subunit; forms a homodimer
YP_108025.1	hydrolyzes proteins to small peptides; with the ATPase subunits ClpA or ClpX, ClpP degrades specific substrates
YP_108026.1	binds and unfolds substrates as part of the ClpXP protease
YP_108027.1	Similar to Escherichia coli ATP-dependent protease La Lon or CapR or Deg or Muc or LopA or b0439 SWALL:LON_ECOLI (SWALL:P08177) (784 aa) fasta scores: E(): 6.1e-180, 69.7% id in 779 aa, and to Ralstonia solanacearum probable ATP-dependent protease La protein rsc1713 or rs02903 SWALL:Q8XYP5 (EMBL:AL646066) (806 aa) fasta scores: E(): 0, 87.96% id in 806 aa
YP_108031.1	Very low similarity to the C-terminal region of Thermoanaerobacter tengcongensis hypothetical protein tte0299 SWALL:Q8RCV6 (EMBL:AE013003) (110 aa) fasta scores: E(): 0.53, 40.47% id in 42 aa
YP_108032.1	Similar to Escherichia coli peptidyl-prolyl cis-trans isomerase D PpiD or b0441 SWALL:PPID_ECOLI (SWALL:P77241) (623 aa) fasta scores: E(): 9.7e-16, 28.61% id in 650 aa, and to Ralstonia solanacearum probable peptidyl-prolyl cis-trans isomerase transmembrane protein rsc1715 or rs02886 SWALL:Q8XYP3 (EMBL:AL646066) (648 aa) fasta scores: E(): 7.9e-99, 46.59% id in 646 aa
YP_108033.1	Similar to Ralstonia solanacearum probable esterase signal peptide protein rsc1717 or rs02907 SWALL:Q8XYP1 (EMBL:AL646066) (216 aa) fasta scores: E(): 5.8e-41, 59.29% id in 199 aa, and to Escherichia coli acyl-CoA thioesterase I precursor TesA or ApeA or PldC or b0494 SWALL:TESA_ECOLI (SWALL:P29679) (208 aa) fasta scores: E(): 6.8e-21, 42.3% id in 182 aa
YP_108034.1	Similar to Ralstonia solanacearum probable ATP-binding ABC transporter protein rsc1718 or rs02908 SWALL:Q8XYP0 (EMBL:AL646066) (236 aa) fasta scores: E(): 6.9e-47, 69.81% id in 222 aa, and to Escherichia coli lipoprotein releasing system ATP-binding protein LolD or b1117 SWALL:LOLD_ECOLI (SWALL:P75957) (233 aa) fasta scores: E(): 2.9e-28, 45.9% id in 220 aa
YP_108035.1	functions in sugar metabolism in glycolysis and the Embden-Meyerhof pathways (EMP) and in gluconeogenesis; catalyzes reversible isomerization of glucose-6-phosphate to fructose-6-phosphate; member of PGI family
YP_108036.1	Similar to Ralstonia solanacearum hypothetical protein rsc1720 or rs02910 SWALL:Q8XYN8 (EMBL:AL646066) (531 aa) fasta scores: E(): 2.2e-50, 51.57% id in 508 aa, and to Pseudomonas aeruginosa hypothetical protein pa4949 SWALL:Q9HUL5 (EMBL:AE004907) (502 aa) fasta scores: E(): 1.4e-43, 40.94% id in 508 aa. Note: this CDS is longer in its N-terminal region than most of its database matches
YP_108037.1	Similar to Escherichia coli, and Escherichia coli O157:H7 D-amino acid dehydrogenase small subunit DadA or DadR or b1189 or z1952 or ecs1684 SWALL:DADA_ECOLI (SWALL:P29011) (432 aa) fasta scores: E(): 1.4e-17, 27.89% id in 441 aa, and to Rhizobium leguminosarum D-amino acid dehydrogenase small subunit DadA SWALL:DADA_RHILV (SWALL:Q9RAE6) (416 aa) fasta scores: E(): 5.2e-24, 31.33% id in 434 aa
YP_108038.1	catalyzes the formation of 2-(formamido)-N1-(5-phospho-D-ribosyl)acetamidine from N2-formyl-N1-(5-phospho-D-ribosyl)glycinamide and L-glutamine in purine biosynthesis
YP_108039.1	Similar to Rhizobium meliloti hypothetical protein r01655 or smc00230 SWALL:Q92PS5 (EMBL:AL591788) (165 aa) fasta scores: E(): 1.6e-23, 47.56% id in 164 aa, and to Brucella melitensis acetyltransferase bmei0466 SWALL:Q8YIH8 (EMBL:AE009489) (169 aa) fasta scores: E(): 2.4e-23, 48.52% id in 169 aa. Note: this CDS is longer in its N-terminal region than most of its database matches
YP_108040.1	Similar to Ralstonia solanacearum  isomerase rotamase signal peptide protein rsc1744 or rs02932 SWALL:Q8XYL4 (EMBL:AL646066) (255 aa) fasta scores: E(): 9.3e-38, 46.69% id in 257 aa, and to Brucella melitensis peptidyl-prolyl cis-trans isomerase bmei0123 SWALL:Q8YJG0 (EMBL:AE009455) (331 aa) fasta scores: E(): 4.7e-18, 33.46% id in 263 aa. Note: This CDS is shorter in its N-terminal region than most of its database matches
YP_108041.1	Similar to Ralstonia solanacearum hypothetical protein rsc1745 or rs02933 SWALL:Q8XYL3 (EMBL:AL646066) (94 aa) fasta scores: E(): 1.1e-14, 61.95% id in 92 aa, and to Xanthomonas axonopodis hypothetical protein xac2314 SWALL:AAM37167 (EMBL:AE011869) (89 aa) fasta scores: E(): 7.2e-13, 57.64% id in 85 aa
YP_108042.1	Involved in cell division; probably involved in intracellular septation
YP_108043.1	Similar to the C-terminal region of Streptococcus gordonii Challis peptide methionine sulfoxide reductase MsrA/MsrB MsrAB or MsrA SWALL:MSAB_STRGC (SWALL:Q9LAM9) (311 aa) fasta scores: E(): 1e-23, 55.22% id in 134 aa, and to Ralstonia solanacearum peptide methionine sulfoxide reductase rsc1747 or rs02935 SWALL:MSRB_RALSO (SWALL:Q8XYL1) (128 aa) fasta scores: E(): 1.9e-33, 69.1% id in 123 aa
YP_108044.1	Similar to Ralstonia solanacearum hypothetical protein rsc1748 or rs02936 SWALL:Q8XYL0 (EMBL:AL646066) (525 aa) fasta scores: E(): 1.8e-117, 62.35% id in 518 aa, and to Escherichia coli hypothetical protein YdiU or b1706 SWALL:YDIU_ECOLI (SWALL:P77649) (478 aa) fasta scores: E(): 6.1e-54, 48.35% id in 486 aa
YP_108045.1	activates fatty acids by binding to coenzyme A
YP_108046.1	Similar to Ralstonia solanacearum probable trifunctional: enoyl-CoA hydratase and delta3-cis-delta2-trans-enoyl-CoA isomerase and 3-hydroxyacyl-CoA dehydrogenase oxidoreductase rsc1759 or rs02946 SWALL:Q8XYJ9 (EMBL:AL646066) (706 aa) fasta scores: E(): 2.4e-192, 74.6% id in 693 aa, and to Escherichia coli fatty oxidation complex alpha subunit [includes: enoyl-CoA hydratase; delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase; 3-hydroxyacyl-CoA dehydrogenase; 3-hydroxybutyryl-CoA epimerase] FadB or OldB or b3846 SWALL:FADB_ECOLI (SWALL:P21177) (729 aa) fasta scores: E(): 2.1e-55, 32.98% id in 670 aa
YP_108047.1	Similar to Escherichia coli pyrazinamidase/nicotinamidase PncA or Nam or b1768 SWALL:PNCA_ECOLI (SWALL:P21369) (213 aa) fasta scores: E(): 2.6e-25, 43.07% id in 195 aa, and to Ralstonia solanacearum probable bifunctional protein: pyrazinamidase and nicotinamidase hydrolase rsc1760 or rs02947 SWALL:Q8XYJ8 (EMBL:AL646066) (210 aa) fasta scores: E(): 3e-60, 71.56% id in 204 aa
YP_108048.1	Catalyzes the synthesis of acetoacetyl coenzyme A from two molecules of acetyl coenzyme A. It can also act as a thiolase, catalyzing the reverse reaction and generating two-carbon units from the four-carbon product of fatty acid oxidation
YP_108050.1	Similar to Chlorobium tepidum TLS hypothetical protein ct1263 SWALL:AAM72493 (EMBL:AE012886) (100 aa) fasta scores: E(): 3.5e-15, 48.98% id in 98 aa, and to Clostridium perfringens hypothetical protein cpe0853 SWALL:Q8XM37 (EMBL:AP003188) (100 aa) fasta scores: E(): 1e-10, 44% id in 100 aa
YP_108051.1	Similar to Ralstonia solanacearum hypothetical protein rsc1764 or rs02951 SWALL:Q8XYJ4 (EMBL:AL646066) (144 aa) fasta scores: E(): 1.9e-25, 57.48% id in 127 aa, and to Pyrobaculum aerophilum hypothetical protein pae1329 SWALL:Q8ZXD8 (EMBL:AE009816) (147 aa) fasta scores: E(): 1.5e-10, 38.71% id in 124 aa
YP_108052.1	Similar to Escherichia coli  NADP-dependent oxidoreductase YncB or b1449 SWALL:YNCB_ECOLI (SWALL:P76113) (353 aa) fasta scores: E(): 4.1e-51, 46.56% id in 335 aa, and to Ralstonia solanacearum probable NADP-dependent oxidoreductase oxidoreductase rsc1766 or rs02953 SWALL:Q8XYJ2 (EMBL:AL646066) (336 aa) fasta scores: E(): 4.3e-82, 66.07% id in 336 aa
YP_108053.1	Similar to Alcaligenes eutrophus  esterase/lipase SWALL:Q44019 (EMBL:L36817) (364 aa) fasta scores: E(): 4.5e-74, 60.62% id in 320 aa, and to Ralstonia solanacearum probable esterase/lipase rsc1772 or rs02959 SWALL:Q8XYI6 (EMBL:AL646066) (344 aa) fasta scores: E(): 6e-69, 57.72% id in 317 aa
YP_108054.1	Similar to Ralstonia solanacearum hypothetical protein rsc1774 or rs02961 SWALL:Q8XYI4 (EMBL:AL646066) (148 aa) fasta scores: E(): 1.4e-16, 46.04% id in 139 aa, and to Halobacterium sp. vng1398C SWALL:Q9HPZ8 (EMBL:AE005058) (147 aa) fasta scores: E(): 1e-13, 45.11% id in 133 aa
YP_108055.1	Similar to Ralstonia solanacearum  signal peptide protein rsc1780 or rs04168 SWALL:Q8XYH8 (EMBL:AL646066) (272 aa) fasta scores: E(): 6.7e-31, 47.51% id in 261 aa, and to Pseudomonas aeruginosa hypothetical protein pa0339 SWALL:Q9I6F4 (EMBL:AE004471) (251 aa) fasta scores: E(): 2.2e-20, 51.25% id in 240 aa
YP_108056.1	Similar to Ralstonia solanacearum hypothetical protein rsc1782 or rs04173 SWALL:Q8XYH6 (EMBL:AL646066) (346 aa) fasta scores: E(): 1.2e-52, 54.04% id in 309 aa, and to Escherichia coli unknown protein from 2d-page YgfZ or b2898 SWALL:UP14_ECOLI (SWALL:P39179) (325 aa) fasta scores: E(): 5.8e-18, 28.33% id in 307 aa. Note: This CDS is shorter in its N-terminal region than some of its database matches
YP_108057.1	Similar to Ralstonia solanacearum hypothetical protein rsc1783 or rs06023 SWALL:Q8XYH5 (EMBL:AL646066) (377 aa) fasta scores: E(): 3.4e-76, 59.88% id in 339 aa, and to Yersinia pestis  exported protein ypo1604 SWALL:Q8ZFT1 (EMBL:AJ414149) (341 aa) fasta scores: E(): 4e-39, 38.73% id in 333 aa. Note: This CDS is shorter in its N-terminal region than some of its database matches
YP_108058.1	catalyzes the reversible phosphoryl transfer from adenosine triphosphate (ATP) to thymidine monophosphate (dTMP) to form thymidine diphosphate (dTDP)
YP_108059.1	catalyzes the DNA-template-directed extension of the 3'-end of a DNA strand; the delta' subunit seems to interact with the gamma subunit to transfer the beta subunit on the DNA
YP_108060.1	Similar to Anabaena sp. hypothetical protein alr4468 SWALL:Q8YNU3 (EMBL:AP003596) (163 aa) fasta scores: E(): 4e-35, 56.17% id in 162 aa, and to Escherichia coli hypothetical acetyltransferase YncA or b1448 SWALL:YNCA_ECOLI (SWALL:P76112) (172 aa) fasta scores: E(): 8.3e-11, 32.71% id in 162 aa
YP_108061.1	Similar to Ralstonia solanacearum hypothetical protein rsc1787 or rs04186 SWALL:Q8XYH1 (EMBL:AL646066) (267 aa) fasta scores: E(): 5.7e-67, 64.88% id in 262 aa, and to Escherichia coli, and Escherichia coli O157:H7 deoxyribonuclease YcfH or b1100 or z1739 or ecs1478 SWALL:YCFH_ECOLI (SWALL:P37346) (265 aa) fasta scores: E(): 2.1e-35, 45.48% id in 266 aa
YP_108062.1	Similar to Ralstonia solanacearum probable ankyrin repeat harboring signal peptide protein rsc1788 or rs04187 SWALL:Q8XYH0 (EMBL:AL646066) (291 aa) fasta scores: E(): 9.2e-29, 45.74% id in 223 aa, and to the N-terminal region of Oryza sativa  ankyrin osjnba0040e01.26 SWALL:Q9AUW0 (EMBL:AC079887) (252 aa) fasta scores: E(): 3.7e-09, 33% id in 203 aa. Note: Most of the database matches in this CDS are to the N-terminal region of ankyrin-related eukaryotic proteins
YP_108064.1	Similar to Xanthomonas axonopodis membrane protein xac1001 SWALL:AAM35884 (EMBL:AE011729) (375 aa) fasta scores: E(): 3.3e-62, 53.79% id in 329 aa, and to Streptomyces coelicolor  membrane protein sco2070 or sc4a10.03 SWALL:Q9S2Y1 (EMBL:AL109663) (382 aa) fasta scores: E(): 2.5e-43, 41.39% id in 302 aa
YP_108065.1	Similar to Pseudomonas aeruginosa hypothetical protein pa0787 SWALL:Q9I5F1 (EMBL:AE004513) (387 aa) fasta scores: E(): 2.7e-98, 69.92% id in 389 aa, and to Rhizobium meliloti hypothetical protein r03044 or smc02491 SWALL:Q92JU6 (EMBL:AL591792) (378 aa) fasta scores: E(): 2.5e-25, 35.45% id in 378 aa. Note: this CDS is longer in its N-terminal region than most of its database matches. Possible alternative start codon at residue 45
YP_108066.1	Similar to Rhizobium meliloti hypothetical sugar transferase smb20117 rb0117 or smb20117 SWALL:Q92X45 (EMBL:AL603642) (366 aa) fasta scores: E(): 3.5e-74, 59.94% id in 347 aa, and to Chlorobium tepidum TLS glycosyl transferase, group 1 family protein ct0839 SWALL:AAM72075 (EMBL:AE012851) (356 aa) fasta scores: E(): 2.2e-61, 47.95% id in 342 aa
YP_108067.1	Similar to Ralstonia solanacearum  lipoprotein rsc1878 or rs03438 SWALL:Q8XY85 (EMBL:AL646067) (200 aa) fasta scores: E(): 1.8e-34, 54.54% id in 198 aa, and to Xanthomonas axonopodis hypothetical protein xac4219 SWALL:AAM39054 (EMBL:AE012074) (301 aa) fasta scores: E(): 6.1e-06, 32.3% id in 130 aa
YP_108068.1	No significant database matches. C-terminal region with high content in proline residues
YP_108069.1	Similar to Pseudomonas aeruginosa hypothetical protein pa4874 SWALL:Q9HUT9 (EMBL:AE004901) (138 aa) fasta scores: E(): 5.3e-12, 60.24% id in 83 aa
YP_108070.1	Similar to Escherichia coli L-asparaginase II precursor AnsB or b2957 SWALL:ASG2_ECOLI (SWALL:P00805) (348 aa) fasta scores: E(): 3.5e-47, 47% id in 334 aa, and to Ralstonia solanacearum probable L-asparaginase II precursor signal peptide protein rsc1306 or rs02828 SWALL:Q8XZT9 (EMBL:AL646063) (367 aa) fasta scores: E(): 3.1e-56, 54.7% id in 351 aa
YP_108071.1	Similar to Ralstonia solanacearum hypothetical protein rsc2148 or rs01455 SWALL:Q8XXG6 (EMBL:AL646068) (160 aa) fasta scores: E(): 5e-19, 46.25% id in 160 aa, and to Escherichia coli unknown protein from 2D-PAGE YgaU or b2665 SWALL:UP04_ECOLI (SWALL:P39169) (148 aa) fasta scores: E(): 1.1e-12, 37.73% id in 159 aa
YP_108072.1	Similar to Escherichia coli 2-hydroxy-3-oxopropionate reductase GlxR or GlxB1 or b0509 SWALL:GLXR_ECOLI (SWALL:P77161) (292 aa) fasta scores: E(): 8.7e-65, 62.23% id in 286 aa, and to Rhizobium loti probable oxidoreductase mlr0254 SWALL:Q98N82 (EMBL:AP002994) (305 aa) fasta scores: E(): 8.4e-70, 65.3% id in 294 aa
YP_108073.1	Similar to Escherichia coli hydroxypyruvate isomerase Hyi or Gip or b0508 SWALL:HYI_ECOLI (SWALL:P30147) (258 aa) fasta scores: E(): 1.5e-54, 56.29% id in 254 aa, and to Ralstonia solanacearum probable hydroxypyruvate isomerase rsc3282 or rs02511 SWALL:Q8XUA9 (EMBL:AL646074) (260 aa) fasta scores: E(): 1.6e-69, 66.66% id in 261 aa
YP_108074.1	catalyzes the formation of 2-hydroxy-3-oxopropanoate (tartronate semialdehyde) from two molecules of glyoxylate
YP_108075.1	Similar to Ralstonia solanacearum probable transcription regulator protein rsc3280 or rs02509 SWALL:Q8XUB1 (EMBL:AL646074) (303 aa) fasta scores: E(): 1.9e-88, 69.96% id in 303 aa, and to Brucella melitensis transcriptional regulatory protein, LysR family bmeii1065 SWALL:Q8YB36 (EMBL:AE009739) (325 aa) fasta scores: E(): 8.3e-40, 40.39% id in 302 aa
YP_108076.1	Low similarity to Ralstonia solanacearum cytochrome C oxidase polypeptide II oxidoreductase rsp1653 or rs02212 SWALL:Q8XPI7 (EMBL:AL646086) (125 aa) fasta scores: E(): 3e-19, 58.47% id in 118 aa, and to Thermus thermophilus cytochrome C oxidase polypeptide II CbaB or CtaC SWALL:COX2_THETH (SWALL:P98052) (168 aa) fasta scores: E(): 0.00023, 30.23% id in 86 aa
YP_108077.1	Similar to Ralstonia solanacearum hypothetical protein rsp1652 or rs02211 SWALL:Q8XPI8 (EMBL:AL646086) (309 aa) fasta scores: E(): 1.5e-79, 69.9% id in 299 aa, and to Agrobacterium tumefaciens hypothetical protein atu2243 or agr_c_4081 SWALL:Q8UD84 (EMBL:AE009174) (291 aa) fasta scores: E(): 2.6e-08, 30.14% id in 209 aa
YP_108078.1	Bacteria have multiple sigma factors which are active under specific conditions; the sigma factor binds with the catalytic core of RNA polymerase to produce the holoenzyme and directs bacterial core RNA polymerase to specific promoter elements to initiate transcription
YP_108079.1	C-terminal region similar to Ralstonia solanacearum transmembrane protein rsp1650 or rs02209 SWALL:Q8XPJ0 (EMBL:AL646086) (276 aa) fasta scores: E(): 6.9e-20, 46.89% id in 209 aa, and to Rhizobium loti hypothetical protein mlr3808 SWALL:Q98FE7 (EMBL:AP003002) (301 aa) fasta scores: E(): 1.3e-15, 34.97% id in 243 aa. Note: Contains a 14xSD(V/M)PV repeat
YP_108080.1	binds cooperatively with S18 to the S15-16S complex, allowing platform assembly to continue with S11 and S21
YP_108081.1	Low similarity to Escherichia coli primosomal replication protein N PriB or b4201 SWALL:PRIB_ECOLI (SWALL:P07013) (103 aa) fasta scores: E(): 0.0042, 30.3% id in 99 aa and similar to Ralstonia solanacearum hypothetical protein rsc1308 or rs02830 SWALL:Q8XZT7 (EMBL:AL646063) (108 aa) fasta scores: E(): 5.2e-13, 46.46% id in 99 aa
YP_108082.1	binds as a heterodimer with protein S6 to the central domain of the 16S rRNA; helps stabilize the platform of the 30S subunit
YP_108083.1	in Escherichia coli this protein is wrapped around the base of the L1 stalk
YP_108084.1	unwinds double stranded DNA
YP_108085.1	Similar to Rhizobium meliloti  Pit accessory protein r00187 or smc02862 SWALL:PITX_RHIME (SWALL:O30498) (214 aa) fasta scores: E(): 1.8e-15, 30.95% id in 210 aa, and to Ralstonia solanacearum hypothetical protein rsc1312 rsc1312 or rs02834 SWALL:Q8XZT3 (EMBL:AL646063) (208 aa) fasta scores: E(): 2.5e-45, 67.3% id in 208 aa
YP_108086.1	Similar to Ralstonia solanacearum probable low-affinity phosphate transporter lipoprotein transmembrane rsc1313 or rs02835 SWALL:Q8XZT2 (EMBL:AL646063) (336 aa) fasta scores: E(): 2.5e-104, 80.95% id in 336 aa, and to Rhizobium meliloti probable low-affinity inorganic phosphate transporter Pit or r00186 or smc02861 SWALL:PIT_RHIME (SWALL:O30499) (334 aa) fasta scores: E(): 6.9e-75, 63.55% id in 321 aa
YP_108087.1	Only N-terminal region similar to Ralstonia solanacearum probable lipoprotein transmembrane rsc1314 or rs02836 SWALL:Q8XZT1 (EMBL:AL646063) (258 aa) fasta scores: E(): 1e-21, 48.23% id in 255 aa, and to Neisseria meningitidis outer membrane protein precursor gna2001 or nmb2001 SWALL:Q9JR56 (EMBL:AF226476) (251 aa) fasta scores: E(): 1.6e-08, 38.41% id in 151 aa. Note: From residue 175 this CDS has No significant database matches
YP_108088.1	Similar to Xanthomonas campestris hypothetical protein Xcc1737 xcc1737 SWALL:AAM41028 (EMBL:AE012275) (469 aa) fasta scores: E(): 8.8e-105, 61.4% id in 469 aa, and to Clostridium perfringens probable phosphate starvation inducible protein cpe1665 SWALL:Q8XJT8 (EMBL:AP003191) (459 aa) fasta scores: E(): 6.8e-39, 35.23% id in 474 aa, and C-terminal region similar to Escherichia coli, and Escherichia coli O157:H7 PhoH protein or PsiH or b1020 or z1522 or ecs1266 SWALL:PHOH_ECOLI (SWALL:P31544) (354 aa) fasta scores: E(): 1.3e-11, 37.17% id in 191 aa
YP_108089.1	Similar to Escherichia coli, and Escherichia coli O157:H7 bacterioferritin comigratory protein Bcp or b2480 or z3739 or ecs3342 SWALL:BCP_ECOLI (SWALL:P23480) (156 aa) fasta scores: E(): 2.1e-16, 39.28% id in 140 aa, and to Ralstonia solanacearum probable bacterioferritin comigratory oxidoreductase rsc1317 or rs02839 SWALL:Q8XZS8 (EMBL:AL646063) (154 aa) fasta scores: E(): 5e-41, 68.83% id in 154 aa
YP_108090.1	Similar to Ralstonia solanacearum hypothetical protein rsc1318 or rs02840 SWALL:Q8XZS7 (EMBL:AL646063) (297 aa) fasta scores: E(): 3.5e-91, 73.4% id in 297 aa, and to Yersinia pestis, and Yersinia pseudotuberculosis hypothetical protein ypo2419 SWALL:Q93PD7 (EMBL:AJ414152) (301 aa) fasta scores: E(): 7.3e-33, 34.89% id in 298 aa
YP_108091.1	Similar to Salmonella typhimurium polymixin resistance protein PmrF or stm2298 SWALL:O52324 (EMBL:AF036677) (327 aa) fasta scores: E(): 5.8e-55, 51.63% id in 306 aa, and to Bacteriophage Sfx bactoprenol glucosyl transferase GtrB SWALL:GTRB_BPSFX (SWALL:Q9T1D6) (305 aa) fasta scores: E(): 2e-26, 31.14% id in 305 aa
YP_108092.1	Similar to Escherichia coli lipopolysaccharide biosynthesis protein RffA or WecE or b3791 SWALL:RFFA_ECOLI (SWALL:P27833) (376 aa) fasta scores: E(): 4e-31, 35.09% id in 379 aa, and to Ralstonia solanacearum  aminotransferase rsc1322 or rs02844 SWALL:Q8XZS3 (EMBL:AL646063) (386 aa) fasta scores: E(): 2.2e-102, 67.01% id in 385 aa
YP_108093.1	Similar to Ralstonia solanacearum  small multidrug resistance transmembrane protein rsc1323 or rs02845 SWALL:Q8XZS2 (EMBL:AL646063) (123 aa) fasta scores: E(): 4.6e-35, 79.67% id in 123 aa, and to Brucella melitensis transporter DME family bmeii0439 SWALL:Q8YCT9 (EMBL:AE009680) (159 aa) fasta scores: E(): 2e-10, 40% id in 115 aa
YP_108094.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc1324 or rs02846 SWALL:Q8XZS1 (EMBL:AL646063) (556 aa) fasta scores: E(): 2e-106, 49.64% id in 564 aa, and to Escherichia coli hypothetical protein YfbI or b2257 SWALL:YFBI_ECOLI (SWALL:P76473) (550 aa) fasta scores: E(): 2.8e-28, 24.15% id in 563 aa
YP_108095.1	Similar to Ralstonia solanacearum hypothetical protein rsc1325 or rs02847 SWALL:Q8XZS0 (EMBL:AL646063) (126 aa) fasta scores: E(): 1.7e-32, 73.59% id in 125 aa, and to Xanthomonas campestris hypothetical protein xcc1710 SWALL:AAM41004 (EMBL:AE012272) (124 aa) fasta scores: E(): 5.3e-10, 35.29% id in 119 aa
YP_108096.1	broad specificity; family IV; in Corynebacterium glutamicum this protein can use glutamate, 2-aminobutyrate, and aspartate as amino donors and pyruvate as the acceptor
YP_108097.1	catalyzes the formation of L-aspartate 4-semialdehyde from L-homoserine
YP_108098.1	catalyzes the formation of L-threonine from O-phospho-L-homoserine
YP_108099.1	Similar to Escherichia coli molybdopterin biosynthesis protein MoeA or ChlE or BisB or NarE or b0827 SWALL:MOEA_ECOLI (SWALL:P12281) (411 aa) fasta scores: E(): 4.7e-42, 39.72% id in 433 aa, and to Alcaligenes eutrophus MoeA protein SWALL:Q8VMA0 (EMBL:AJ279073) (412 aa) fasta scores: E(): 1.4e-68, 66.2% id in 432 aa
YP_108100.1	Similar to Escherichia coli molybdopterin converting factor subunit 1 MoaD or ChlA4 or ChlM or b0784 SWALL:MOAD_ECOLI (SWALL:P30748) (81 aa) fasta scores: E(): 1.1e-05, 40.96% id in 83 aa, and to Ralstonia solanacearum probable molybdopterin converting factor rsc1331 or rs02853 SWALL:Q8XZR4 (EMBL:AL646064) (87 aa) fasta scores: E(): 7.8e-20, 65.88% id in 85 aa
YP_108101.1	Similar to Escherichia coli molybdopterin converting factor subunit 2 MoaE or ChlA5 or b0785 SWALL:MOAE_ECOLI (SWALL:P30749) (149 aa) fasta scores: E(): 3.2e-28, 52.74% id in 146 aa, and to Alcaligenes eutrophus molybdopterin synthase large subunit MoaE SWALL:Q8VM98 (EMBL:AJ279073) (172 aa) fasta scores: E(): 7.3e-41, 66.88% id in 154 aa
YP_108102.1	Similar to Brucella melitensis SEC-independent protein translocase bmeii0398 SWALL:Q8YCY0 (EMBL:AE009677) (141 aa) fasta scores: E(): 5.1e-13, 37.95% id in 137 aa, and to Agrobacterium tumefaciens hypothetical protein atu0250 or agr_c_428 SWALL:Q8UIP3 (EMBL:AE008997) (157 aa) fasta scores: E(): 1.4e-11, 42.34% id in 111 aa. Note: this CDS is longer in its C-terminal region than most of its database matches
YP_108103.1	Similar to Escherichia coli, Escherichia coli O157:H7, and Shigella flexneri hypothetical protein YjeB or b4178 or z5785 or ecs5154 SWALL:YJEB_ECOLI (SWALL:P21498) (141 aa) fasta scores: E(): 7.2e-18, 38.62% id in 145 aa, and to Ralstonia solanacearum hypothetical protein rsc3397 or rs01705 SWALL:Q8XTZ8 (EMBL:AL646075) (172 aa) fasta scores: E(): 2.9e-24, 47.61% id in 168 aa
YP_108104.1	Similar to Escherichia coli, and Escherichia coli O157:H7 ClpB protein or HtpM or b2592 or z3886 or ecs3455 SWALL:CLPB_ECOLI (SWALL:P03815) (857 aa) fasta scores: E(): 2e-185, 66.04% id in 860 aa, and to Ralstonia solanacearum probable ATP-dependent protease rsc1335 or rs02857 SWALL:Q8XZR0 (EMBL:AL646064) (862 aa) fasta scores: E(): 0, 80.2% id in 864 aa. Note: Also similar to BPSL0899 (773 aa) fasta scores: E(): 5.2e-47, 39.789% identity in 852 aa overlap and to BPSS1502 (Chromosome 2) (1013 aa) fasta scores: E(): 1.2e-48, 37.646% identity in 943 aa overlap
YP_108105.1	Similar to Escherichia coli hypothetical protein YidB or b3698 SWALL:YIDB_ECOLI (SWALL:P09996) (132 aa) fasta scores: E(): 1.1e-09, 37.39% id in 115 aa, and to Rhizobium loti hypothetical protein mlr4715 SWALL:Q98DG3 (EMBL:AP003004) (165 aa) fasta scores: E(): 1.9e-08, 33.85% id in 127 aa
YP_108106.1	Only central part similar to Ralstonia solanacearum COMEA-related signal peptide protein rsc0916 or rs04499 SWALL:Q8Y0X7 (EMBL:AL646061) (105 aa) fasta scores: E(): 1.5e-06, 51.92% id in 104 aa. Note: C-terminal region presents two regions of high hidrophilicity, high content in alanine amino acid residues, high G+C content and no databsse matches
YP_108107.1	Similar to Clostridium acetobutylicum transcriptional regulator, MerR family cac3507 SWALL:Q97DH0 (EMBL:AE007847) (126 aa) fasta scores: E(): 8.7e-14, 41.96% id in 112 aa, and to Streptomyces coelicolor  MerR-family transcriptional regulator sco2875 or sce6.12 SWALL:Q9KZS6 (EMBL:AL353832) (135 aa) fasta scores: E(): 2.3e-11, 41.88% id in 117 aa. Note: this CDS is longer in its C-terminal region than most of its database matches
YP_108108.1	Similar to Methanobacterium thermoautotrophicum gamma-carboxymuconolactone decarboxylase mth234 SWALL:O26336 (EMBL:AE000810) (125 aa) fasta scores: E(): 2.8e-20, 49.59% id in 123 aa, and to Acinetobacter calcoaceticus 4-carboxymuconolactone decarboxylase PcaC SWALL:DC4C_ACICA (SWALL:P20370) (134 aa) fasta scores: E(): 4.1e-09, 35.29% id in 119 aa. Note: N-terminal region overlaps in 17 residues with CDS upstream
YP_108109.1	Similar to Vibrio parahaemolyticus multidrug resistance protein NorM SWALL:NORM_VIBPA (SWALL:O82855) (456 aa) fasta scores: E(): 3.3e-43, 33.56% id in 438 aa, and to Ralstonia solanacearum probable inner membrane transmembrane protein rsc1180 or rs04529 SWALL:Q8Y064 (EMBL:AL646063) (448 aa) fasta scores: E(): 5.6e-91, 57.52% id in 445 aa
YP_108110.1	Similar to Ralstonia solanacearum probable inner membrane transmembrane protein rsc1181 or rs05713 SWALL:Q8Y063 (EMBL:AL646063) (598 aa) fasta scores: E(): 5e-135, 52.92% id in 582 aa, and to Neisseria meningitidis inner membrane protein nma0497 SWALL:Q9JW86 (EMBL:AL162753) (558 aa) fasta scores: E(): 2.1e-23, 26.95% id in 575 aa
YP_108111.1	RpmE2; there appears to be two types of ribosomal proteins L31 in bacterial genomes; some contain a CxxC motif while others do not; Bacillus subtilis has both types; the proteins in this cluster do not have the CXXC motif; RpmE is found in exponentially growing Bacilli while YtiA was found after exponential growth; expression of ytiA is controlled by a zinc-specific transcriptional repressor; RpmE contains one zinc ion and a CxxC motif is responsible for this binding; forms an RNP particle along with proteins L5, L18, and L25 and 5S rRNA; found crosslinked to L2 and L25 and EF-G; may be near the peptidyltransferase site of the 50S ribosome
YP_108112.1	Similar to Ralstonia solanacearum hypothetical protein rsc1184 or rs05716 SWALL:Q8Y060 (EMBL:AL646063) (288 aa) fasta scores: E(): 4.8e-57, 53.52% id in 284 aa, and to Escherichia coli hypothetical protein YeeI or b1976 SWALL:YEEI_ECOLI (SWALL:P76346) (265 aa) fasta scores: E(): 1.5e-16, 33.88% id in 242 aa
YP_108113.1	Similar to Ralstonia solanacearum  multidrug resistance-like transmembrane protein rsc1473 or rs03834 SWALL:Q8XZC8 (EMBL:AL646064) (517 aa) fasta scores: E(): 2.3e-40, 31.05% id in 512 aa, and to Xanthomonas campestris multidrug resistance membrane translocase xcc1400 SWALL:AAM40698 (EMBL:AE012239) (526 aa) fasta scores: E(): 3.5e-24, 24.95% id in 521 aa
YP_108114.1	Similar to Deinococcus radiodurans transcriptional regulator, MerR family dr2306 SWALL:Q9RS21 (EMBL:AE002062) (155 aa) fasta scores: E(): 7.3e-21, 50% id in 144 aa, and to the N-terminal region of Streptomyces coelicolor MerR-family transcriptional regulator sco7698 or sc1a4.06C SWALL:Q9EX58 (EMBL:AL450433) (380 aa) fasta scores: E(): 4.3e-06, 37.33% id in 150 aa
YP_108115.1	An RNA-DNA helicase that actively releases nascent mRNAs from paused transcription complexes
YP_108117.1	Similar to Escherichia coli, Salmonella typhimurium, and Salmonella typhi thioredoxin 1 TrxA or TsnC or FipA or b3781 or stm3915 or sty3639 SWALL:THIO_ECOLI (SWALL:P00274) (108 aa) fasta scores: E(): 1.2e-26, 64.48% id in 107 aa, and to Ralstonia solanacearum probable thioredoxin 1 rsc1188 or rs05720 SWALL:Q8Y056 (EMBL:AL646063) (108 aa) fasta scores: E(): 3.2e-37, 88.88% id in 108 aa
YP_108118.1	catalyzes the DNA-template-directed extension of the 3'-end of a DNA strand; the tau chain serves as a scaffold to help in the dimerizaton of the alpha,epsilon and theta core complex; the gamma chain seems to interact with the delta and delta' subunits to transfer the beta subunit on the DNA
YP_108119.1	Similar to Ralstonia solanacearum hypothetical protein rsc1192 or rs05724 SWALL:YB92_RALSO (SWALL:Q8Y052) (115 aa) fasta scores: E(): 5.6e-29, 79.13% id in 115 aa, and to Escherichia coli, Escherichia coli O157:H7, Salmonella typhimurium, and Salmonella typhi hypothetical protein YbaB or b0471 or z0588 or ecs0524 or stm0485 or sty0529 SWALL:YBAB_ECOLI (SWALL:P17577) (109 aa) fasta scores: E(): 9.6e-24, 67.92% id in 106 aa
YP_108120.1	involved in a recombinational process of DNA repair, independent of the recBC complex
YP_108121.1	Similar to Pseudomonas aeruginosa hypothetical protein pa3733 SWALL:Q9HXQ9 (EMBL:AE004792) (409 aa) fasta scores: E(): 4.9e-99, 65.92% id in 402 aa, to Caulobacter crescentus hypothetical protein cc3562 SWALL:Q9A2J9 (EMBL:AE006014) (433 aa) fasta scores: E(): 6.6e-76, 52.67% id in 393 aa, and to Escherichia coli crotonobetainyl-CoA:carnitine CoA-transferase CaiB or b0038 SWALL:CAIB_ECOLI (SWALL:P31572) (405 aa) fasta scores: E(): 9.8e-28, 29.52% id in 403 aa
YP_108122.1	catalyzes the conversion of a phosphate monoester to an alcohol and a phosphate
YP_108123.1	Similar to full length of Ralstonia solanacearum hypothetical protein rsc1205 or rs02685 SWALL:Q8Y039 (EMBL:AL646063) (321 aa) fasta scores: E(): 3.5e-30, 54.03% id in 335 aa, and C-terminal region similar to Escherichia coli, and Escherichia coli O157:H7 protein-L-isoaspartate O-methyltransferase Pcm or b2743 or z4051 or ecs3597 SWALL:PIMT_ECOLI (SWALL:P24206) (207 aa) fasta scores: E(): 4.3e-21, 45.19% id in 208 aa
YP_108124.1	Similar to full length of Rhodocyclus gelatinosus NlpD protein SWALL:Q9JP90 (EMBL:AB034704) (314 aa) fasta scores: E(): 5.3e-38, 51.91% id in 314 aa, and to C-terminal region of Escherichia coli lipoprotein NlpD precursor or b2742 SWALL:NLPD_ECOLI (SWALL:P33648) (379 aa) fasta scores: E(): 1.3e-18, 42.57% id in 256 aa
YP_108125.1	sigma factors are initiation factors that promote the attachment of RNA polymerase to specific initiation sites and are then released; this sigma factor controls a regulon of genes required for protection against external stresses
YP_108126.1	Similar to Neisseria meningitidis hypothetical protein nma1628 SWALL:Q9JTU6 (EMBL:AL162756) (264 aa) fasta scores: E(): 6.1e-65, 61.21% id in 263 aa, and to Campylobacter jejuni hypothetical protein cj1132C SWALL:Q9PNG2 (EMBL:AL139077) (264 aa) fasta scores: E(): 1.3e-26, 35.56% id in 239 aa
YP_108127.1	Similar to Ralstonia solanacearum hypothetical protein rsc1208 or rs02691 SWALL:Q8Y036 (EMBL:AL646063) (289 aa) fasta scores: E(): 2.4e-46, 50% id in 290 aa, and to Rhizobium loti hypothetical protein mll3063 SWALL:Q98H23 (EMBL:AP003001) (302 aa) fasta scores: E(): 2e-11, 30% id in 300 aa
YP_108128.1	in Escherichia coli this enzyme catalyzes the SAM-dependent methylation of U1939 in the 23S ribomal RNA; binds an iron-sulfur cluster [4Fe-4S]
YP_108129.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein rsc1210 or rs02699 SWALL:Q8Y034 (EMBL:AL646063) (233 aa) fasta scores: E(): 1.1e-60, 74% id in 227 aa, and to Escherichia coli hypothetical protein YccA or b0970 SWALL:YCCA_ECOLI (SWALL:P06967) (219 aa) fasta scores: E(): 9.2e-22, 37.68% id in 207 aa
YP_108130.1	catalyzes the formation of nucleoside triphosphate from ATP and nucleoside diphosphate
YP_108131.1	Similar to Ralstonia solanacearum hypothetical protein rsc1212 or rs02704 SWALL:Q8Y032 (EMBL:AL646063) (383 aa) fasta scores: E(): 2.6e-120, 80.96% id in 373 aa, and to Escherichia coli hypothetical protein YfgB or b2517 SWALL:YFGB_ECOLI (SWALL:P36979) (384 aa) fasta scores: E(): 1e-73, 53.33% id in 375 aa
YP_108132.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc1214 or rs02709 SWALL:Q8Y030 (EMBL:AL646063) (367 aa) fasta scores: E(): 5.1e-17, 34.87% id in 367 aa, and to Escherichia coli hypothetical protein YfgA or b2516 SWALL:YFGA_ECOLI (SWALL:P27434) (337 aa) fasta scores: E(): 3.3e-06, 27.85% id in 341 aa
YP_108133.1	catalyzes the conversion of 2C-methyl-D-erythritol 2,4-cyclodiphosphate into 4-hydroxy-3-methyl-2-en-1-yl diphosphate; involved in isoprenoid synthesis
YP_108134.1	catalyzes a two-step reaction, first charging a histidine molecule by linking its carboxyl group to the alpha-phosphate of ATP, followed by transfer of the aminoacyl-adenylate to its tRNA; class II aminoacyl-tRNA synthetase; forms homodimers; some organisms have a paralogous gene, hisZ, that is similar to hisS and produces a protein that performs the first step in histidine biosynthesis along with HisG
YP_108135.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein rsc1217 or rs02712 SWALL:Q8Y028 (EMBL:AL646063) (211 aa) fasta scores: E(): 2e-49, 67.61% id in 210 aa, and to Neisseria gonorrhoeae hypothetical 23.1 kDa protein in engA 5'region SWALL:YENG_NEIGO (SWALL:O87406) (209 aa) fasta scores: E(): 2.4e-13, 31.92% id in 213 aa
YP_108136.1	Similar to Ralstonia solanacearum probable lipoprotein transmembrane rsc1218 or rs02713 SWALL:Q8Y027 (EMBL:AL646063) (388 aa) fasta scores: E(): 1.5e-67, 48.78% id in 369 aa, and to Escherichia coli hypothetical protein YfgL or b2512 SWALL:YFGL_ECOLI (SWALL:P77774) (392 aa) fasta scores: E(): 7.5e-25, 31.41% id in 382 aa
YP_108137.1	EngA; essential Neisserial GTPase; synchronizes cellular events by interacting with multiple targets with tandem G-domains; overexpression in Escherichia coli suppresses rrmJ mutation; structural analysis of the Thermotoga maritima ortholog shows different nucleotide binding affinities in the two binding domains
YP_108138.1	Stimulates the elongation of poly(A) tails
YP_108139.1	Similar to Escherichia coli GTP-binding protein HflX or b4173 SWALL:HFLX_ECOLI (SWALL:P25519) (426 aa) fasta scores: E(): 1.1e-64, 56.06% id in 371 aa, and to Ralstonia solanacearum hypothetical protein rsc1221 or rs02723 SWALL:Q8Y024 (EMBL:AL646063) (417 aa) fasta scores: E(): 9.4e-83, 67.97% id in 356 aa, and to
YP_108140.1	Similar to Escherichia coli, and Escherichia coli O157:H7 HflK protein or HflA or b4174 or z5781 or ecs5150 SWALL:HFLK_ECOLI (SWALL:P25662) (419 aa) fasta scores: E(): 9.1e-23, 32.07% id in 424 aa, and to Ralstonia solanacearum hypothetical transmembrane protein rsc1222 or rs02724 SWALL:Q8Y023 (EMBL:AL646063) (447 aa) fasta scores: E(): 2.6e-49, 49.55% id in 450 aa
YP_108141.1	Similar to Escherichia coli, and Escherichia coli O157:H7 HflC protein or HflA or b4175 or z5782 or ecs5151 SWALL:HFLC_ECOLI (SWALL:P25661) (334 aa) fasta scores: E(): 3.3e-16, 35.45% id in 330 aa, and to Ralstonia solanacearum  serine protease transmembrane protein rsc1223 or rs02730 SWALL:Q8Y022 (EMBL:AL646063) (304 aa) fasta scores: E(): 5.7e-38, 44.07% id in 304 aa
YP_108142.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein rsc1224 or rs02731 SWALL:Q8Y021 (EMBL:AL646063) (66 aa) fasta scores: E(): 4.7e-06, 44.64% id in 56 aa, and to Yersinia pestis  membrane protein ypo0377 SWALL:Q8ZIV8 (EMBL:AJ414142) (66 aa) fasta scores: E(): 0.003, 33.33% id in 60 aa
YP_108143.1	May allow the feedback regulation of ATP phosphoribosyltransferase activity by histidine
YP_108144.1	catalyzes the formation of N6-(1,2,-dicarboxyethyl)-AMP from L-aspartate, inosine monophosphate and GTP in AMP biosynthesis
YP_108145.1	Similar to Ralstonia solanacearum  nucleotide phosphoribosyltransferase rsc1227 or rs02734 SWALL:Q8Y018 (EMBL:AL646063) (193 aa) fasta scores: E(): 4.9e-62, 82.77% id in 180 aa, and to Haemophilus influenzae xanthine-guanine phosphoribosyltransferase (GptA or XgpRT-A or hi0674) and (gptb or xgprt-b or hi0692) SWALL:XGPT_HAEIN (SWALL:P43859) (155 aa) fasta scores: E(): 0.0031, 31.41% id in 156 aa
YP_108146.1	Similar to Escherichia coli kup system potassium uptake protein Kup or TrkD or b3747 SWALL:KUP_ECOLI (SWALL:P30016) (622 aa) fasta scores: E(): 4.9e-119, 49.67% id in 624 aa, and to Ralstonia solanacearum probable potassium uptake transmembrane protein rsc1621 or rs03984 SWALL:Q8XYY5 (EMBL:AL646065) (633 aa) fasta scores: E(): 1.8e-167, 68.26% id in 624 aa
YP_108147.1	Similar to Bordetella pertussis Tex protein SWALL:TEX_BORPE (SWALL:Q45388) (791 aa) fasta scores: E(): 1.2e-179, 64.38% id in 775 aa, and to Ralstonia solanacearum  transcription accessory protein rsc1623 or rs03986 SWALL:Q8XYY3 (EMBL:AL646065) (779 aa) fasta scores: E(): 0, 78.16% id in 783 aa
YP_108148.1	Similar to Ralstonia solanacearum hypothetical protein RSC1624or RS03987 SWALL:Q8XYY2 (EMBL:AL646065) (253 aa) fasta scores: E(): 9.7e-23, 43.29% id in 231 aa
YP_108149.1	Similar to Ralstonia solanacearum hypothetical protein rsc1625 or rs03988 SWALL:Q8XYY1 (EMBL:AL646065) (67 aa) fasta scores: E(): 0.0064, 46.29% id in 54 aa, and to Xanthomonas axonopodis hypothetical protein xac4268 SWALL:AAM39103 (EMBL:AE012079) (72 aa) fasta scores: E(): 0.026, 36.98% id in 73 aa
YP_108150.1	Similar to Ralstonia solanacearum probable ATP-dependent DNA helicase-related protein rsc1626 or rs03989 SWALL:Q8XYY0 (EMBL:AL646065) (713 aa) fasta scores: E(): 1.2e-174, 71.71% id in 640 aa, and to Escherichia coli probable ATP-dependent helicase YoaA or b1808 SWALL:YOAA_ECOLI (SWALL:P76257) (636 aa) fasta scores: E(): 1.4e-41, 45.26% id in 623 aa
YP_108151.1	Similar to Neisseria meningitidis competence lipoprotein coml precursor ComL or nma0907 SWALL:COML_NEIMA (SWALL:Q9JVB7) (267 aa) fasta scores: E(): 5e-41, 44.35% id in 257 aa, and to Escherichia coli, and Escherichia coli O157:H7 hypothetical lipoprotein precursor YfiO or b2595 or z3889 or ecs3458 SWALL:YFIO_ECOLI (SWALL:P77146) (245 aa) fasta scores: E(): 1.7e-27, 36.13% id in 238 aa
YP_108152.1	Similar to Escherichia coli ribosomal large subunit pseudouridine synthase D RluD SWALL:RLUD_ECOLI (SWALL:P33643) (325 aa) fasta scores: E(): 1.1e-46, 48.57% id in 315 aa, and to Ralstonia solanacearum ribosomal large subunit pseudouridine synthase D RluD SWALL:RLUD_RALSO (SWALL:Q8XYX8) (358 aa) fasta scores: E(): 1.7e-76, 63.2% id in 356 aa. CDS is extended at the N-terminus in comparison to orthologues. Possible alternative translational start site after codon 60
YP_108153.1	Similar to Escherichia coli hypothetical protein YfiH or b2593 SWALL:YFIH_ECOLI (SWALL:P33644) (243 aa) fasta scores: E(): 9.1e-23, 50.74% id in 270 aa, and to Ralstonia solanacearum hypothetical protein rsc1629 or rs03992 SWALL:Q8XYX7 (EMBL:AL646065) (267 aa) fasta scores: E(): 5.1e-43, 59.55% id in 272 aa
YP_108154.1	Similar to Alcaligenes eutrophus poly-beta-hydroxybutyrate polymerase PhbC SWALL:PHBC_ALCEU (SWALL:P23608) (589 aa) fasta scores: E(): 7.2e-130, 61.63% id in 589 aa, and to Burkholderia sp. DSMZ 9242 PhaC SWALL:Q9RB82 (EMBL:AF153086) (625 aa) fasta scores: E(): 1.4e-188, 82.89% id in 602 aa
YP_108155.1	Catalyzes the synthesis of acetoacetyl coenzyme A from two molecules of acetyl coenzyme A. It can also act as a thiolase, catalyzing the reverse reaction and generating two-carbon units from the four-carbon product of fatty acid oxidation; in Rhizobia and Ralstonia is involved in PHB biosynthesis
YP_108156.1	catalyzes the formation of 3-hydroxybutyryl-CoA from acetoacetyl-CoA in polyhydroxyalkanoate synthesis
YP_108157.1	Similar to Burkholderia sp. DSMZ 9242 hypothetical 21.8 kDa protein SWALL:Q9RB79 (EMBL:AF153086) (188 aa) fasta scores: E(): 1e-61, 92.1% id in 190 aa, and to Thiocystis violacea hypothetical protein in phbA 5'region SWALL:YPH4_THIVI (SWALL:P45368) (138 aa) fasta scores: E(): 1.1e-19, 54.54% id in 132 aa
YP_108158.1	catalyzes the methylthiolation of an aspartic acid residue of the S12 protein of the 30S ribosomal subunit
YP_108159.1	Similar to Klebsiella pneumoniae fructokinase ScrK SWALL:SCRK_KLEPN (SWALL:P26420) (307 aa) fasta scores: E(): 4.2e-19, 31.49% id in 308 aa, and to Pseudomonas putida  fructokinase-like protein ORF5 SWALL:BAB96556 (EMBL:AB085816) (307 aa) fasta scores: E(): 5.3e-90, 78.07% id in 301 aa
YP_108160.1	catalyzes the formation of beta-ketovaleryl-CoA from acetyl-CoA and propionyl-CoA
YP_108161.1	Very low similarity to Ralstonia solanacearum signal peptide protein rsc1638 or rs04012 SWALL:Q8XYW8 (EMBL:AL646065) (245 aa) fasta scores: E(): 8.1e-06, 35.18% id in 162 aa
YP_108162.1	catalyzes the formation of L-homocysteine from cystathionine
YP_108163.1	Similar to Escherichia coli, and Escherichia coli O157:H7 phosphoserine phosphatase SerB or b4388 or z5989 or ecs5346 SWALL:SERB_ECOLI (SWALL:P06862) (322 aa) fasta scores: E(): 1.6e-26, 41.72% id in 266 aa, and to Neisseria meningitidis  phosphoserine phosphatase nma1179 SWALL:Q9JUR1 (EMBL:AL162755) (277 aa) fasta scores: E(): 2.1e-35, 47.6% id in 250 aa
YP_108165.1	Similar to Escherichia coli hypothetical protein YbbM or b0491 SWALL:YBBM_ECOLI (SWALL:P77307) (259 aa) fasta scores: E(): 1.3e-20, 28.3% id in 265 aa, and to Ralstonia solanacearum probable transmembrane protein rsc0748 or rs05105 SWALL:Q8Y1E2 (EMBL:AL646060) (272 aa) fasta scores: E(): 2.6e-63, 68.32% id in 262 aa
YP_108166.1	Similar to Ralstonia solanacearum probable ATP-binding ABC transporter protein rsc0749 or rs05104 SWALL:Q8Y1E1 (EMBL:AL646060) (230 aa) fasta scores: E(): 4.1e-34, 54.5% id in 222 aa, and to Salmonella typhi  ABC transporter ATP-binding protein sty0548 SWALL:Q8Z8S1 (EMBL:AL627267) (225 aa) fasta scores: E(): 2.5e-11, 33.04% id in 227 aa
YP_108167.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0773 or rs05081 SWALL:Q8Y1B7 (EMBL:AL646061) (740 aa) fasta scores: E(): 3e-79, 44.84% id in 814 aa, and to Yersinia pestis  exported protein ypo3987 SWALL:Q8ZA33 (EMBL:AJ414160) (740 aa) fasta scores: E(): 2.1e-69, 39.63% id in 820 aa. Note: It contains a region from approx. residue 200 to approx. residue 350 with very little or no similarities to database entries
YP_108168.1	Similar to Escherichia coli, and Escherichia coli O157:H7 hypothetical ABC transporter ATP-binding protein YbiT or b0820 or z1042 or ecs0897 SWALL:YBIT_ECOLI (SWALL:P75790) (530 aa) fasta scores: E(): 4.7e-115, 66.66% id in 531 aa, and to Salmonella typhi ABC transporter ATP-binding protein sty0879 SWALL:Q8Z870 (EMBL:AL627268) (531 aa) fasta scores: E(): 3.7e-115, 67.04% id in 531 aa
YP_108170.1	Similar to Bacillus subtilis betaine aldehyde dehydrogenase GbsA SWALL:DHAB_BACSU (SWALL:P71016) (490 aa) fasta scores: E(): 1.9e-59, 40.33% id in 476 aa, and to Ralstonia solanacearum  betaine aldehyde dehydrogenase rsc1456 or rs03851 SWALL:Q8XZE5 (EMBL:AL646064) (478 aa) fasta scores: E(): 1.1e-127, 71.3% id in 474 aa
YP_108171.1	Similar to Ralstonia solanacearum hypothetical protein rsc0114 or rs00984 SWALL:Q8Y367 (EMBL:AL646057) (402 aa) fasta scores: E(): 8.7e-90, 63.54% id in 384 aa, and to Fusobacterium nucleatum 2-nitropropane dioxygenase fn0664 SWALL:Q8RFM8 (EMBL:AE010577) (382 aa) fasta scores: E(): 3e-31, 37.22% id in 368 aa
YP_108172.1	Similar to Escherichia coli outer membrane protein W precursor OmpW or b1256 SWALL:OMPW_ECOLI (SWALL:P21364) (212 aa) fasta scores: E(): 7.9e-17, 38.27% id in 209 aa, to Vibrio cholerae outer membrane protein W precursor OmpW or vca0867 SWALL:OMPW_VIBCH (SWALL:P17266) (217 aa) fasta scores: E(): 2.7e-13, 32.55% id in 215 aa, and to Rhizobium sp. hypothetical outer-membrane protein Y4mB precursor SWALL:Y4MB_RHISN (SWALL:P55561) (229 aa) fasta scores: E(): 9.8e-22, 38.09% id in 231 aa
YP_108173.1	Similar to Ralstonia solanacearum hypothetical protein rsc1457 or rs03850 SWALL:Q8XZE4 (EMBL:AL646064) (91 aa) fasta scores: E(): 3.6e-18, 67.18% id in 64 aa, and to Pseudomonas aeruginosa hypothetical protein pa1788 SWALL:Q9I2V4 (EMBL:AE004604) (155 aa) fasta scores: E(): 3.7e-06, 50% id in 44 aa
YP_108174.1	Similar to Escherichia coli, and Escherichia coli O157:H7 manganese transport protein MntH or b2392 or z3658 or ecs3271 SWALL:MNTH_ECOLI (SWALL:P77145) (412 aa) fasta scores: E(): 1.6e-41, 37.82% id in 423 aa, and to Pseudomonas aeruginosa manganese transport protein pa0809 SWALL:MNT2_PSEAE (SWALL:Q9RPF2) (438 aa) fasta scores: E(): 6.3e-73, 51.28% id in 427 aa
YP_108175.1	Similar to Escherichia coli putrescine-binding periplasmic protein precursor PotF or b0854 SWALL:POTF_ECOLI (SWALL:P31133) (370 aa) fasta scores: E(): 8.8e-71, 51.93% id in 362 aa, and to Xanthomonas campestris periplasmic putrescine-binding protein, permease xcc2344 SWALL:AAM41622 (EMBL:AE012342) (371 aa) fasta scores: E(): 3e-73, 51.66% id in 360 aa
YP_108176.1	Similar to Escherichia coli putrescine transport ATP-binding protein PotG or b0855 SWALL:POTG_ECOLI (SWALL:P31134) (377 aa) fasta scores: E(): 5.1e-70, 55.4% id in 370 aa, and to Neisseria meningitidis spermidine/putrescine ABC transporter ATP-binding protein nmb0610 SWALL:Q9K0I9 (EMBL:AE002416) (419 aa) fasta scores: E(): 1e-73, 57.02% id in 356 aa
YP_108177.1	Similar to Escherichia coli putrescine transport system permease PotH or b0856 SWALL:POTH_ECOLI (SWALL:P31135) (317 aa) fasta scores: E(): 3.3e-68, 59.85% id in 284 aa, and to Xanthomonas axonopodis polyamine transport protein xac2471 SWALL:AAM37322 (EMBL:AE011884) (288 aa) fasta scores: E(): 2e-69, 62.1% id in 285 aa
YP_108178.1	Similar to Escherichia coli putrescine transport system permease PotI or b0857 SWALL:POTI_ECOLI (SWALL:P31136) (281 aa) fasta scores: E(): 6.8e-60, 59% id in 261 aa, and to Yersinia pestis putrescine transport system permease ypo1334 SWALL:Q8ZGG3 (EMBL:AJ414147) (281 aa) fasta scores: E(): 3.5e-59, 56.7% id in 261 aa
YP_108179.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc1541 or rs03761 SWALL:Q8XZ63 (EMBL:AL646065) (273 aa) fasta scores: E(): 2.3e-36, 49.62% id in 266 aa, and to Synechocystis sp. hypothetical protein slr1262 SWALL:P73802 (EMBL:D90909) (288 aa) fasta scores: E(): 6.1e-17, 32.45% id in 265 aa
YP_108180.1	C-terminal region similar to Pseudomonas aeruginosa hypothetical protein pa2345 SWALL:Q9I1D3 (EMBL:AE004660) (411 aa) fasta scores: E(): 2.1e-93, 59.66% id in 414 aa, and N-terminal region to Rhodobacter capsulatus hypothetical protein SWALL:O33514 (EMBL:U23145) (146 aa) fasta scores: E(): 1.6e-13, 42.17% id in 147 aa. Posible fusion protein
YP_108181.1	Similar to Ralstonia solanacearum hypothetical protein rsc1544 or rs05231 SWALL:Q8XZ60 (EMBL:AL646065) (286 aa) fasta scores: E(): 1.8e-36, 61.3% id in 292 aa, and to Caulobacter crescentus metallo-beta-lactamase cc2866 SWALL:Q9A4G8 (EMBL:AE005951) (267 aa) fasta scores: E(): 2.1e-28, 53.43% id in 277 aa
YP_108182.1	C-terminal region similar to Escherichia coli formate hydrogenlyase transcriptional activator FhlA or b2731 SWALL:FHLA_ECOLI (SWALL:P19323) (692 aa) fasta scores: E(): 8e-38, 41.69% id in 331 aa, and to Thiobacillus denitrificans  transcription regulator SWALL:AAM52226 (EMBL:AY112701) (302 aa) fasta scores: E(): 5e-43, 48% id in 300 aa. Note: N-terminal region (first 100 residues approx.) seems not to have similarities with any database entries
YP_108183.1	Similar to Pseudomonas aeruginosa hypothetical protein pa2784 SWALL:Q9I059 (EMBL:AE004706) (185 aa) fasta scores: E(): 3e-30, 51.06% id in 188 aa
YP_108184.1	Similar to Pseudomonas aeruginosa hypothetical protein pa2785 SWALL:Q9I058 (EMBL:AE004706) (72 aa) fasta scores: E(): 3.1e-19, 78.26% id in 69 aa, and to Caulobacter crescentus transcriptional regulator, cro/ci family cc3270 SWALL:Q9A3D4 (EMBL:AE005990) (75 aa) fasta scores: E(): 4.1e-16, 67.56% id in 74 aa
YP_108185.1	Similar to Bradyrhizobium elkanii nodulation protein NolA SWALL:NOLA_BRAEL (SWALL:P50329) (219 aa) fasta scores: E(): 2.1e-14, 31.27% id in 227 aa, and to Streptomyces coelicolor  transcriptional regulator sco5962 or sc7h1.32C SWALL:O54191 (EMBL:AL021411) (196 aa) fasta scores: E(): 7.9e-14, 39.32% id in 178 aa, and C-terminal region similar to full length of Klebsiella oxytoca albicidin resistance protein SWALL:ALBR_KLEOX (SWALL:P10488) (218 aa) fasta scores: E(): 7e-13, 30.66% id in 212 aa
YP_108186.1	Similar to Pseudomonas aeruginosa outer membrane protein precursor OprM or OprK or pa0427 SWALL:OPRM_PSEAE (SWALL:Q51487) (485 aa) fasta scores: E(): 3.4e-21, 30.43% id in 483 aa, and to Ralstonia solanacearum probable outer membrane channel lipoprotein rsc0166 or rs01036 SWALL:Q8Y315 (EMBL:AL646057) (480 aa) fasta scores: E(): 1.1e-51, 45.2% id in 480 aa. Note: This CDS is longer in its C-terminal region than most of its database matches
YP_108187.1	Similar to Ralstonia solanacearum probable transmembrane drug efflux protein rsc1654 or rs05828 SWALL:Q8XYV2 (EMBL:AL646065) (1039 aa) fasta scores: E(): 2.4e-160, 51.37% id in 1057 aa, and to Escherichia coli acriflavine resistance protein F AcrF or EnvD or b3266 SWALL:ACRF_ECOLI (SWALL:P24181) (1034 aa) fasta scores: E(): 3.3e-45, 24.55% id in 1071 aa
YP_108188.1	Similar to Rhizobium loti component of multidrug efflux system mlr7297 SWALL:Q986M0 (EMBL:AP003011) (380 aa) fasta scores: E(): 2.8e-29, 35.97% id in 353 aa, and to Rhizobium loti rnd efflux membrane fusion protein mll5519 SWALL:Q98BL6 (EMBL:AP003006) (356 aa) fasta scores: E(): 1.4e-28, 35.53% id in 363 aa
YP_108189.1	Similar to Caulobacter crescentus transcriptional regulator, TetR family cc0732 SWALL:Q9AA74 (EMBL:AE005748) (215 aa) fasta scores: E(): 1.3e-06, 38.46% id in 91 aa, and to Streptomyces coelicolor  TetR-family regulator sco7303 or sc5f8.13 SWALL:Q9K4L1 (EMBL:AL357613) (193 aa) fasta scores: E(): 3.2e-05, 30.5% id in 177 aa
YP_108190.1	Similar to Salmonella typhimurium voltage-gated clc-type chloride channel EriC or stm0203 SWALL:ERIC_SALTY (SWALL:Q8ZRP8) (473 aa) fasta scores: E(): 1.8e-25, 28.38% id in 458 aa, and to Ralstonia solanacearum  chloride channel protein eric-like rsp0020 or rs01992 SWALL:ERIL_RALSO (SWALL:Q8XTT4) (461 aa) fasta scores: E(): 2.9e-85, 54.56% id in 438 aa. Note: this CDS is longer in its C-terminal region than most of its database matches
YP_108191.1	Similar to Escherichia coli, and Escherichia coli O157:H7 hypothetical protein YeiH or b2158 or z3415 or ecs3050 SWALL:YEIH_ECOLI (SWALL:P33019) (349 aa) fasta scores: E(): 1.1e-39, 37.79% id in 336 aa, and to Pseudomonas aeruginosa hypothetical protein pa5383 SWALL:Q9HTI1 (EMBL:AE004951) (355 aa) fasta scores: E(): 3.7e-44, 44.51% id in 328 aa
YP_108192.1	Similar to Thiobacillus denitrificans CbbR SWALL:Q9APD4 (EMBL:AF307090) (316 aa) fasta scores: E(): 1e-21, 32.65% id in 297 aa, and to Chromatium vinosum rubisco operon transcriptional regulator RbcR SWALL:RBCR_CHRVI (SWALL:P25544) (302 aa) fasta scores: E(): 1e-20, 32.99% id in 297 aa
YP_108194.1	Similar to Pseudomonas aeruginosa hypothetical protein pa2260 or KguE SWALL:Q9I1L3 (EMBL:AE004652) (260 aa) fasta scores: E(): 2.3e-17, 36.36% id in 253 aa
YP_108195.1	Similar to Pseudomonas aeruginosa probable 2-ketogluconate kinase pa2261 SWALL:Q9I1L2 (EMBL:AE004652) (316 aa) fasta scores: E(): 3.5e-65, 61.81% id in 309 aa, and to Klebsiella pneumoniae fructokinase ScrK SWALL:SCRK_KLEPN (SWALL:P26420) (307 aa) fasta scores: E(): 1.4e-14, 33.1% id in 287 aa
YP_108196.1	Similar to Pseudomonas aeruginosa probable 2-ketogluconate transporter pa2262 or KguT SWALL:Q9I1L1 (EMBL:AE004652) (435 aa) fasta scores: E(): 5.4e-116, 73.2% id in 403 aa, and to Yersinia pestis  sugar transporter ypo2535 SWALL:Q8ZDM7 (EMBL:AJ414152) (443 aa) fasta scores: E(): 1.4e-45, 34.53% id in 417 aa
YP_108197.1	Similar to Erwinia herbicola 2-ketogluconate reductase TkrA SWALL:TKRA_ERWHE (SWALL:P58000) (323 aa) fasta scores: E(): 3.7e-57, 54.79% id in 323 aa, and to Yersinia pestis  D-isomer specific 2-hydroxyacid dehydrogenase ypo4078 SWALL:Q8Z9W1 (EMBL:AJ414160) (326 aa) fasta scores: E(): 5.6e-64, 58.51% id in 323 aa
YP_108198.1	Similar to Bacillus subtilis kdg operon repressor KdgR SWALL:KDGR_BACSU (SWALL:P50844) (339 aa) fasta scores: E(): 2.6e-32, 33.83% id in 334 aa, and to Clostridium acetobutylicum kdg operon repressor cac0393 SWALL:Q97M07 (EMBL:AE007554) (344 aa) fasta scores: E(): 1.8e-28, 32.94% id in 343 aa
YP_108199.1	Similar to Ralstonia solanacearum  lipoprotein transmembrane rsp0010 or rs01982 SWALL:Q8XTU4 (EMBL:AL646076) (265 aa) fasta scores: E(): 1.8e-29, 39.39% id in 264 aa, and to Streptococcus pneumoniae R6 conserved hypothetical protein spr1248 SWALL:AAL00052 (EMBL:AE008496) (250 aa) fasta scores: E(): 2.3e-12, 28.95% id in 259 aa
YP_108201.1	Similar to Ralstonia solanacearum hypothetical protein rsp1250 or rs03194 SWALL:Q8XQH5 (EMBL:AL646083) (147 aa) fasta scores: E(): 1.6e-40, 79.72% id in 143 aa
YP_108202.1	Similar to Comamonas acidovorans polyhydroxybutyrate depolymerase PhaZ SWALL:O05527 (EMBL:AB003186) (494 aa) fasta scores: E(): 7.1e-45, 45.69% id in 302 aa, and to Streptomyces exfoliatus poly PhaZ SWALL:Q54070 (EMBL:U58990) (488 aa) fasta scores: E(): 8.4e-32, 35.35% id in 297 aa
YP_108204.1	Similar to Pseudomonas putida  transcriptional regulator SWALL:Q93FY6 (EMBL:AF302763) (153 aa) fasta scores: E(): 9.5e-33, 64% id in 150 aa, and to Rhizobium loti transcriptional regulator mll4468 SWALL:Q98E02 (EMBL:AP003004) (142 aa) fasta scores: E(): 9.4e-19, 46.8% id in 141 aa
YP_108207.1	Similar to Agrobacterium tumefaciens dehydrogenase atu0946 or agr_c_1727 SWALL:Q8UGT9 (EMBL:AE009059) (366 aa) fasta scores: E(): 1.7e-70, 54.77% id in 356 aa, and to Rhizobium meliloti hypothetical protein r03032 or smc02503 SWALL:Q92LL0 (EMBL:AL591792) (367 aa) fasta scores: E(): 2.7e-68, 52.52% id in 356 aa
YP_108208.1	Similar to Clostridium acetobutylicum predicted P-loop ATPase cac1583 SWALL:Q97IQ7 (EMBL:AE007668) (187 aa) fasta scores: E(): 3.2e-09, 32.44% id in 188 aa
YP_108209.1	Similar to Ralstonia solanacearum probable magnesium and cobalt transport transmembrane protein rsp0665 or rs01784 SWALL:Q8XS16 (EMBL:AL646080) (323 aa) fasta scores: E(): 4.6e-51, 44.61% id in 325 aa, and to Xanthomonas campestris magnesium and cobalt transport protein CorA or xcc2335 SWALL:AAM41613 (EMBL:AE012341) (332 aa) fasta scores: E(): 2.5e-44, 40.79% id in 326 aa
YP_108210.2	unknown function; YciI from Haemophilus influenzae presents crystal structure similarity to a muconolactone isomerase, but does not seem to catalyze any of the predicted reactions based on sequence and structure similarity
YP_108214.1	Similar to Pseudomonas aeruginosa hypothetical protein pa1408 SWALL:Q9I3T6 (EMBL:AE004570) (807 aa) fasta scores: E(): 1.7e-101, 44.54% id in 806 aa, and to Rhizobium meliloti hypothetical transmembrane protein r00938 or smc00028 SWALL:Q92RE2 (EMBL:AL591785) (871 aa) fasta scores: E(): 8.9e-50, 30.95% id in 814 aa, and to parts of Escherichia coli potassium efflux system KefA or AefA or b0465 SWALL:KEFA_ECOLI (SWALL:P77338) (1120 aa) fasta scores: E(): 8.4e-19, 26.16% id in 711 aa
YP_108215.1	Similar to Pseudomonas aeruginosa regulatory protein pa3391 SWALL:NSR1_PSEAE (SWALL:Q9HYL3) (715 aa) fasta scores: E(): 7.3e-71, 39.01% id in 692 aa, and to Pseudomonas stutzeri regulatory protein NosR SWALL:NOSR_PSEST (SWALL:Q00790) (724 aa) fasta scores: E(): 1e-67, 38.32% id in 694 aa
YP_108216.1	Similar to Xanthomonas axonopodis cytochrome c5 xac0273 SWALL:AAM35165 (EMBL:AE011652) (172 aa) fasta scores: E(): 2.8e-10, 42.85% id in 147 aa, and C-terminal region highly similar to Chlorobium limicola f.sp. thiosulfatophilum cytochrome c-555 SWALL:C555_CHLLT (SWALL:P00123) (86 aa) fasta scores: E(): 3.2e-07, 43.75% id in 80 aa
YP_108217.1	Very low similarity to Streptomyces coelicolor hypothetical protein sco1549 or scl11.05C SWALL:Q9L1D3 (EMBL:AL157953) (312 aa) fasta scores: E(): 6.6, 31.09% id in 119 aa
YP_108218.1	Very low similarity to Streptomyces coelicolor hypothetical protein sco6897 or sc1b2.03 SWALL:Q9KYD3 (EMBL:AL356812) (103 aa) fasta scores: E(): 4.7, 36.48% id in 74 aa
YP_108219.1	Similar to Ralstonia solanacearum probable NosL lipoprotein rsp1373 or rs02085 SWALL:Q8XQB3 (EMBL:AL646084) (176 aa) fasta scores: E(): 3.7e-29, 48.58% id in 177 aa, and to Pseudomonas stutzeri NosL protein precursor SWALL:Q52529 (EMBL:Z69589) (190 aa) fasta scores: E(): 2.6e-13, 36.47% id in 170 aa
YP_108220.1	Similar to Ralstonia solanacearum probable NosY transmembrane protein or rsp1372 or rs02086 SWALL:Q8XQB4 (EMBL:AL646084) (274 aa) fasta scores: E(): 9e-58, 62.26% id in 265 aa, and to Pseudomonas stutzeri membrane protein NosY precursor SWALL:NOSY_PSEST (SWALL:P19845) (276 aa) fasta scores: E(): 5.1e-37, 46.88% id in 273 aa
YP_108221.1	Similar to Ralstonia solanacearum probable copper ATP-binding ABC transporter protein rsp1371 or rs02087 SWALL:Q8XQB5 (EMBL:AL646084) (314 aa) fasta scores: E(): 4.5e-50, 55.77% id in 303 aa, and to Pseudomonas stutzeri copper transport ATP-binding protein NosF SWALL:NOSF_PSEST (SWALL:P19844) (308 aa) fasta scores: E(): 9.8e-35, 43.47% id in 299 aa
YP_108222.1	Similar to Ralstonia solanacearum probable copper-binding periplasmic signal peptide protein rsp1370 or rs02088 SWALL:Q8XQB6 (EMBL:AL646084) (423 aa) fasta scores: E(): 2.5e-73, 59.36% id in 406 aa, and to Pseudomonas stutzeri copper-binding periplasmic protein precursor NosD SWALL:NOSD_PSEST (SWALL:P19843) (436 aa) fasta scores: E(): 6.3e-24, 38.71% id in 372 aa
YP_108223.1	reduces nitrous oxide to nitrogen
YP_108224.1	Similar to Ralstonia solanacearum probable thiamine biosynthesis ApbE transmembrane protein rsp1366 or rs02092 SWALL:Q8XQC0 (EMBL:AL646084) (340 aa) fasta scores: E(): 5.6e-20, 33.13% id in 335 aa, and to Salmonella typhimurium thiamine biosynthesis lipoprotein ApbE precursor or stm2266 SWALL:APBE_SALTY (SWALL:P41780) (350 aa) fasta scores: E(): 7.7e-16, 27.21% id in 316 aa
YP_108225.1	Similar to Methanosarcina acetivorans multidrug ABC transporter ATP-binding protein ma2689 SWALL:Q8TMH0 (EMBL:AE010965) (323 aa) fasta scores: E(): 7.2e-24, 32% id in 325 aa, and to Rhizobium meliloti  ABC transporter ATP-binding protein rb0184 or smb20184 SWALL:Q92WX8 (EMBL:AL603642) (242 aa) fasta scores: E(): 6.6e-23, 41.78% id in 213 aa. Note: this CDS is longer in its N-terminal region than most of its database matches
YP_108226.1	Similar to Methanosarcina acetivorans multidrug ABC transporter permease ma2109 SWALL:Q8TP17 (EMBL:AE010897) (250 aa) fasta scores: E(): 1.5e-22, 34.67% id in 248 aa, and to Pyrococcus furiosus daunorubicin resistance membrane protein pf0582 SWALL:Q8U388 (EMBL:AE010180) (254 aa) fasta scores: E(): 2.8e-18, 32.08% id in 240 aa
YP_108227.1	Similar to Escherichia coli methyl-accepting chemotaxis protein I Tsr or CheD or b4355 SWALL:MCP1_ECOLI (SWALL:P02942) (551 aa) fasta scores: E(): 8.7e-45, 38.66% id in 538 aa, and to Ralstonia solanacearum methyl-accepting chemotaxis transmembrane protein rsc0606 or rs06104 SWALL:Q8Y1T3 (EMBL:AL646060) (617 aa) fasta scores: E(): 1.6e-46, 44.98% id in 429 aa
YP_108229.1	in some organisms the DhaK and DhaL subunits are encoded by separate genes; in others they are fused; functions along with DhaM to phosphorylate dihydroxyacetone
YP_108230.1	No significant database matches to the full length CDS. C-terminus is is weakly similar to C-terminal region of Pseudomonas sp. vanillate O-demethylase oxygenase subunit VanA SWALL:VANA_PSES9 (SWALL:P12609) (329 aa) fasta scores: E(): 2.9e-05, 26.1% id in 272 aa
YP_108231.1	No significant database matches to the full length CDS. N-terminus is weakly similar to the N-terminal region of Pseudomonas putida phthalate 4,5-dioxygenase oxygenase subunit Pht3 SWALL:PHT3_PSEPU (SWALL:Q05183) (439 aa) fasta scores: E(): 2e-06, 29.46% id in 207 aa
YP_108232.1	Similar to Streptomyces viridochromogenes transporter AviJ SWALL:Q93KW8 (EMBL:AF333038) (476 aa) fasta scores: E(): 3.6e-37, 35.1% id in 433 aa, and to Actinosynnema pretiosum Na+/H+ antiporter Asm5 SWALL:AAM54083 (EMBL:AF453501) (416 aa) fasta scores: E(): 5.2e-31, 35.55% id in 405 aa
YP_108233.1	Similar to Amycolatopsis orientalis hypothetical hydroxylase A SWALL:P96563 (EMBL:U84350) (491 aa) fasta scores: E(): 1.1e-44, 35.74% id in 414 aa, and to Amycolatopsis mediterranei halogenase BhaA SWALL:O87676 (EMBL:Y16952) (491 aa) fasta scores: E(): 1.5e-43, 34.78% id in 414 aa
YP_108237.1	Similar to Rhizobium loti polyhydroxybutyrate depolymerase mlr2444 SWALL:Q98IE0 (EMBL:AP002999) (371 aa) fasta scores: E(): 5.5e-17, 30.51% id in 331 aa, and to Alcaligenes faecalis poly(3-hydroxybutyrate) depolymerase precursor(PHB depolymerase) SWALL:PHB_ALCFA (SWALL:P12625) (488 aa) fasta scores: E(): 7.9e-08, 27.11% id in 295 aa
YP_108239.1	Similar to Xanthomonas axonopodis hypothetical protein xac1124 SWALL:AAM35997 (EMBL:AE011741) (146 aa) fasta scores: E(): 1.5e-24, 50% id in 146 aa, and to Synechocystis sp. hypothetical protein slr0325 SWALL:Q55530 (EMBL:D63999) (161 aa) fasta scores: E(): 5.2e-22, 45.07% id in 142 aa
YP_108240.1	Similar to Salmonella typhimurium type-1 fimbrial protein, A chain precursor FimA or stm0543 SWALL:FM1A_SALTY (SWALL:P37921) (185 aa) fasta scores: E(): 1.8e-12, 32.44% id in 188 aa, and to Klebsiella pneumoniae fimbrial subunit type 1 precursor Fim SWALL:FM12_KLEPN (SWALL:P12903) (182 aa) fasta scores: E(): 3e-12, 35.67% id in 185 aa
YP_108241.1	Similar to Pseudomonas aeruginosa probable pili assembly chaperone pa0993 SWALL:Q9I4X6 (EMBL:AE004532) (237 aa) fasta scores: E(): 5.8e-28, 42.14% id in 242 aa, and to Escherichia coli chaperone protein precursor EcpD or b0140 SWALL:ECPD_ECOLI (SWALL:P33128) (246 aa) fasta scores: E(): 1.2e-21, 33.19% id in 232 aa
YP_108242.1	Similar to Salmonella typhimurium  fimbrial usher StiC or stm0175 SWALL:Q8ZRR6 (EMBL:AE008702) (848 aa) fasta scores: E(): 1.6e-89, 34.28% id in 872 aa, and to Escherichia coli outer membrane usher protein AfaC precursor SWALL:AFAC_ECOLI (SWALL:P53517) (859 aa) fasta scores: E(): 9.4e-79, 32% id in 881 aa
YP_108243.1	Similar to Escherichia coli type-1 fimbrial protein, A chain precursor FimA or PilA or b4314 SWALL:FM1A_ECOLI (SWALL:P04128) (182 aa) fasta scores: E(): 4.9e-09, 35.32% id in 167 aa, and to Xylella fastidiosa fimbrial adhesin precursor xf0077 SWALL:Q9PH69 (EMBL:AE003862) (356 aa) fasta scores: E(): 3.5e-10, 34.14% id in 246 aa. Note: This CDS has no similarities to any database matches in its N-terminal region
YP_108245.1	Similar to the N-terminal region of Xanthomonas axonopodis outer membrane protein XadA or xac3546 SWALL:AAM38389 (EMBL:AE012003) (2190 aa) fasta scores: E(): 5.2e-56, 36.63% id in 1111 aa, and to full length of Xanthomonas oryzae pv. oryzae  outer membrane protein XadA SWALL:Q9FDA0 (EMBL:AF288222) (1265 aa) fasta scores: E(): 1.8e-37, 29.89% id in 1278 aa. Note: Contains a repeat region between approx. residue 436 and residue 862, containing the repeat: NSTA(N/S)GTN(ST/AS)A(S/T)G(D/E). It is also similar to BPSS0088 (646 aa) fasta scores: E(): 2.9e-64, 56.604% identity in 636 aa overlap over the mentioned repeat region
YP_108247.1	Similar to Escherichia coli, and Escherichia coli O157:H7 capsular synthesis regulator component B RcsB or b2217 or z3476 or ecs3106 SWALL:RCSB_ECOLI (SWALL:P14374) (216 aa) fasta scores: E(): 6.4e-17, 32.21% id in 208 aa, and to Pseudomonas aeruginosa probable two-component response regulator pa3714 SWALL:Q9HXS7 (EMBL:AE004790) (213 aa) fasta scores: E(): 1.2e-19, 36.15% id in 213 aa
YP_108248.1	Similar to Escherichia coli sensor protein RcsC or b2218 SWALL:RCSC_ECOLI (SWALL:P14376) (949 aa) fasta scores: E(): 7.1e-44, 27.18% id in 986 aa, and to Ralstonia solanacearum probable capsular synthesis regulatory rsp1622 or rs02179 SWALL:Q8XPL6 (EMBL:AL646086) (1098 aa) fasta scores: E(): 2.9e-52, 28.9% id in 993 aa.Note: This CDS appears to have a histidine kinase domain and a response regulator domain also
YP_108249.1	Similar to the C-terminal region of Xanthomonas axonopodis GGDEF family protein xac1938 SWALL:AAM36800 (EMBL:AE011829) (695 aa) fasta scores: E(): 1.3e-22, 33.57% id in 280 aa, and of Escherichia coli hypothetical protein YddU or b1489 SWALL:YDDU_ECOLI (SWALL:P76129) (799 aa) fasta scores: E(): 3.1e-21, 31.07% id in 251 aa
YP_108250.1	Similar to Ralstonia solanacearum  HNS-like transcription regulator protein rsp0029 or rs02004 SWALL:Q8XTS5 (EMBL:AL646076) (95 aa) fasta scores: E(): 5.8e-08, 37.63% id in 93 aa, and to Rhodobacter capsulatus trans-acting regulatory protein HvrA SWALL:HVRA_RHOCA (SWALL:P42505) (102 aa) fasta scores: E(): 0.025, 30.12% id in 83 aa
YP_108251.1	Only very low similarity to the central region of Arabidopsis thaliana lipase,  t4k22.3 SWALL:Q9C8G6 (EMBL:AC025295) (529 aa) fasta scores: E(): 0.37, 31.77% id in 107 aa
YP_108252.1	Similar to Agrobacterium tumefaciens transcriptional regulator, GntR family atu4232 or agr_l_1259 SWALL:Q8U867 (EMBL:AE009352) (245 aa) fasta scores: E(): 6.6e-30, 45.7% id in 221 aa, and to Rhizobium loti transcriptional regulator mll6786 SWALL:Q988D5 (EMBL:AP003010) (223 aa) fasta scores: E(): 2.3e-19, 37.15% id in 218 aa
YP_108253.1	Similar to Rhizobium meliloti hypothetical protein ra0427 or sma0791 SWALL:Q92ZM8 (EMBL:AE007233) (200 aa) fasta scores: E(): 7.8e-54, 71.05% id in 190 aa, and to Agrobacterium tumefaciens hypothetical protein atu4237 or agr_l_1248 SWALL:Q8U862 (EMBL:AE009353) (200 aa) fasta scores: E(): 1.2e-53, 69.74% id in 195 aa
YP_108254.1	Similar to Agrobacterium tumefaciens hydrolase atu4238 or agr_l_1247 SWALL:Q8U861 (EMBL:AE009353) (286 aa) fasta scores: E(): 7.7e-32, 42.22% id in 270 aa, and to Bacillus subtilis  esterase YtxM SWALL:YTXM_BACSU (SWALL:P23974) (274 aa) fasta scores: E(): 2.4e-12, 25.84% id in 267 aa
YP_108255.1	Similar to Agrobacterium tumefaciens nitrilotriacetate monooxygenase component B atu5229 or agr_pat_322 SWALL:Q8UK94 (EMBL:AE008945) (323 aa) fasta scores: E(): 2.9e-40, 41.66% id in 312 aa, and N-terminal region to Chelatobacter heintzii nitrilotriacetate monooxygenase component B NtaB or NmoB SWALL:NTAB_CHEHE (SWALL:P54990) (322 aa) fasta scores: E(): 1.3e-25, 50.58% id in 172 aa
YP_108256.1	Similar to Rhizobium meliloti hypothetical protein ra0430 or sma0794 SWALL:Q92ZM5 (EMBL:AE007233) (346 aa) fasta scores: E(): 1.2e-85, 58.67% id in 346 aa, and to Agrobacterium tumefaciens alkanal monooxygenase alpha chain atu4240 or agr_l_1243 SWALL:Q8U859 (EMBL:AE009353) (346 aa) fasta scores: E(): 6.8e-84, 58.38% id in 346 aa
YP_108257.1	Similar to Bacillus subtilis betaine aldehyde dehydrogenase GbsA SWALL:DHAB_BACSU (SWALL:P71016) (490 aa) fasta scores: E(): 3.8e-66, 40.74% id in 481 aa, and to Agrobacterium tumefaciens aldehyde dehydrogenase DhaS or atu4241 or agr_l_1241 SWALL:Q8U858 (EMBL:AE009353) (493 aa) fasta scores: E(): 2.8e-137, 70.87% id in 491 aa
YP_108258.1	Similar to Rhizobium meliloti hypothetical protein ra0432 or sma0797 SWALL:Q92ZM3 (EMBL:AE007233) (108 aa) fasta scores: E(): 1.7e-27, 69.6% id in 102 aa, and to Agrobacterium tumefaciens hypothetical protein atu4242 or agr_l_1239 SWALL:Q8U857 (EMBL:AE009353) (104 aa) fasta scores: E(): 2.9e-26, 67.96% id in 103 aa
YP_108259.1	Similar to Escherichia coli spermidine/putrescine-binding periplasmic protein precursor PotD or b1123 SWALL:POTD_ECOLI (SWALL:P23861) (348 aa) fasta scores: E(): 5.8e-12, 26.25% id in 320 aa, to Agrobacterium tumefaciens ABC transporter substrate binding protein atu4243 or agr_l_1237 SWALL:Q8U856 (EMBL:AE009353) (336 aa) fasta scores: E(): 6.2e-86, 63.09% id in 336 aa, and to Rhizobium meliloti  ABC transporter periplasmic solute-binding protein ra0433 or sma0799 SWALL:Q92ZM2 (EMBL:AE007234) (319 aa) fasta scores: E(): 2.4e-82, 64.57% id in 319 aa
YP_108260.1	Similar to Escherichia coli spermidine/putrescine transport system permease PotB or b1125 SWALL:POTB_ECOLI (SWALL:P23860) (275 aa) fasta scores: E(): 8.4e-25, 35.57% id in 253 aa, and to Rhizobium meliloti  ABC transporter permease ra0434 or sma0800 SWALL:Q92ZM1 (EMBL:AE007234) (291 aa) fasta scores: E(): 1.5e-66, 66.07% id in 280 aa
YP_108261.1	Similar to Escherichia coli, and Escherichia coli O157:H7 spermidine/putrescine transport system permease PotC or b1124 or z1763 or ecs1500 SWALL:POTC_ECOLI (SWALL:P23859) (264 aa) fasta scores: E(): 5.5e-19, 29.13% id in 254 aa, and to Rhizobium meliloti  ABC transporter permease ra0435 or sma0802 SWALL:Q92ZM0 (EMBL:AE007234) (266 aa) fasta scores: E(): 1.5e-64, 66.41% id in 262 aa
YP_108262.1	Similar to Escherichia coli putrescine transport ATP-binding protein PotG or b0855 SWALL:POTG_ECOLI (SWALL:P31134) (377 aa) fasta scores: E(): 7.7e-42, 41.14% id in 350 aa, and to Rhizobium meliloti  ABC-transporter ATP-binding protein ra0436 or sma0803 SWALL:Q92ZL9 (EMBL:AE007234) (359 aa) fasta scores: E(): 1.6e-71, 60.27% id in 360 aa
YP_108263.1	Similar to Agrobacterium tumefaciens transcriptional regulator, GntR family atu4232 or agr_l_1259 SWALL:Q8U867 (EMBL:AE009352) (245 aa) fasta scores: E(): 1.1e-32, 47.59% id in 229 aa, and to Yersinia pestis  GntR-family transcriptional regulatory protein ypo3651 SWALL:Q8ZAY1 (EMBL:AJ414158) (220 aa) fasta scores: E(): 3.7e-20, 37.08% id in 213 aa
YP_108264.1	NADP+; Similar to Escherichia coli succinate-semialdehyde dehydrogenase [NADP+] GabD or b2661 SWALL:GABD_ECOLI (SWALL:P25526) (482 aa) fasta scores: E(): 2e-126, 66.45% id in 480 aa, and to Pseudomonas aeruginosa succinate-semialdehyde dehydrogenase pa0265 SWALL:Q9I6M5 (EMBL:AE004464) (483 aa) fasta scores: E(): 1e-130, 69.03% id in 478 aa
YP_108265.1	Similar to Ralstonia solanacearum probable porin signal peptide protein rsp0051 or rs02026 SWALL:Q8XTQ5 (EMBL:AL646076) (382 aa) fasta scores: E(): 6.4e-45, 42.89% id in 387 aa, and to Bordetella pertussis outer membrane porin protein precursor SWALL:OMP_BORPE (SWALL:Q04064) (385 aa) fasta scores: E(): 2.4e-17, 31.11% id in 376 aa. Note: Also similar to BPSL3036 (387 aa) fasta scores: E(): 1.4e-51, 45.503% identity in 378 aa overlap
YP_108267.1	Similar to the C-terminal region of Xanthomonas campestris insertion element IS476 hypothetical protein SWALL:YI61_XANCV (SWALL:P25438) (346 aa) fasta scores: E(): 1.3e-63, 61.5% id in 265 aa, and to the full length Ralstonia solanacearum ISRso14-transposase OrfB protein SWALL:Q8XF72 (EMBL:AL646083) (275 aa) fasta scores: E(): 5.9e-98, 86.86% id in 274 aa
YP_108268.1	Identical to Burkholderia cepacia insertion element IS407 hypothetical protein SWALL:YI74_BURCE (SWALL:P24580) (87 aa) fasta scores: E(): 3.7e-32, 100% id in 87 aa, and higly similar to to Ralstonia solanacearum ISRso14-transposase orfA protein SWALL:Q8XGL4 (EMBL:AL646083) (87 aa) fasta scores: E(): 2.1e-29, 93.1% id in 87 aa
YP_108269.1	Similar to Alcaligenes eutrophus HNS-like protein phg180 SWALL:Q7WXF4 (EMBL:AY305378) (103 aa) fasta scores: E(): 1.6e-07, 35% id in 100 aa, and to Ralstonia solanacearum  HNS-like transcription regulator protein rsp0029 or rs02004 SWALL:Q8XTS5 (EMBL:AL646076) (95 aa) fasta scores: E(): 2.5e-10, 41.05% id in 95 aa. Possible alternative translational start site
YP_108270.1	C-terminal region similar to C-terminal region of Escherichia coli, and Escherichia coli O157:H7 outer membrane protein A precursor OmpA or TolG or Tut or Con or b0957 or z1307 or ecs1041 SWALL:OMPA_ECOLI (SWALL:P02934) (346 aa) fasta scores: E(): 2.1e-12, 38.36% id in 159 aa. N-terminal region has low similarities to exported proteins/lipoproteins
YP_108271.1	Similar to Xanthomonas maltophilia SmeC SWALL:Q9RBY7 (EMBL:AF173226) (471 aa) fasta scores: E(): 2.3e-06, 23.89% id in 477 aa, and to Caulobacter crescentus outer membrane protein RsaF SWALL:Q9RQV0 (EMBL:AF062345) (527 aa) fasta scores: E(): 1.4e-05, 23.3% id in 532 aa
YP_108272.1	Similar to the C-terminal region of Ralstonia solanacearum  hemagglutinin/hemolysin-related protein rsp1180 or rs05070 SWALL:Q8XQP2 (EMBL:AL646083) (4106 aa) fasta scores: E(): 6.4e-92, 30.67% id in 3218 aa, and also to the C-terminal region of Escherichia coli O157:H7  RTX family exoprotein z0615 SWALL:Q8X4H5 (EMBL:AE005229) (5188 aa) fasta scores: E(): 4e-38, 26.08% id in 3209 aa. Note: Contains a repeat region between residue 538 and residue 1362
YP_108274.1	Similar to Ralstonia solanacearum hypothetical protein rsp0167 rsp0167 or rs04679 SWALL:Q8XTE6 (EMBL:AL646076) (304 aa) fasta scores: E(): 7.2e-38, 42.43% id in 271 aa
YP_108275.1	Similar to the C-terminal region of Vibrio cholerae toxin secretion ATP-binding protein vca1084 SWALL:Q9KKL9 (EMBL:AE004433) (704 aa) fasta scores: E(): 1.4e-62, 34.99% id in 563 aa, and of Pasteurella haemolytica-like sp. leukotoxin secretion ATP-binding protein LktB SWALL:HLYB_PASSP (SWALL:P55122) (708 aa) fasta scores: E(): 5.3e-37, 27.82% id in 575 aa, and to the full length of Ralstonia solanacearum  composite ATP-binding transmembrane ABC transporter protein rsp1182 or rs05072 SWALL:Q8XQP0 (EMBL:AL646083) (739 aa) fasta scores: E(): 1.6e-45, 28.65% id in 719 aa
YP_108276.1	Similar to Rhizobium meliloti  toxin secretion transmembrane protein r02036 or smc04208 SWALL:Q92NX2 (EMBL:AL591789) (436 aa) fasta scores: E(): 1.6e-27, 33.25% id in 439 aa, and to Vibrio cholerae secretion protein, HlyD family vca1080 SWALL:Q9KKM3 (EMBL:AE004433) (481 aa) fasta scores: E(): 6.4e-27, 34.25% id in 435 aa
YP_108277.1	Very low similarities to any database matches to the full length of the CDS. The matches are reduced to the TPR domains that this CDS contains, e.g. Methanosarcina acetivorans TPR-domain containing protein ma1613 SWALL:Q8TQD1 (EMBL:AE010832) (1885 aa) fasta scores: E(): 1.6e-07, 21.22% id in 1164 aa
YP_108278.1	Similar in the C-terminal region to Ralstonia solanacearum hypothetical protein rsc3164 or rs00434 SWALL:Q8XUM3 (EMBL:AL646074) (387 aa) fasta scores: E(): 1.1e-31, 36.16% id in 365 aa
YP_108279.1	Similar in its C-terminal region to Bacillus subtilis probable adenylylsulfate kinase CysC SWALL:CYC1_BACSU (SWALL:O34577) (197 aa) fasta scores: E(): 6.5e-37, 51.81% id in 193 aa, and similar to the C-terminal region (where the adenylylsulfate kinase activity has been mapped) Arabidopsis thaliana adenylylsulfate kinase 1, chloroplast precursor Akn1 or at2g14750 or f26c24.11 or t6b13.1 SWALL:KAP1_ARATH (SWALL:Q43295) (276 aa) fasta scores: E(): 3.1e-33, 43.61% id in 227 aa
YP_108280.1	Similar to Ralstonia solanacearum probable two-component system response regulator transcription regulator protein rsc1073 or rs04004 SWALL:Q8Y0H1 (EMBL:AL646062) (237 aa) fasta scores: E(): 3.5e-28, 40.69% id in 231 aa, and to Mycobacterium bovis sensory transduction protein Regx3 SWALL:RGX3_MYCBO (SWALL:O07130) (227 aa) fasta scores: E(): 1.4e-21, 34.51% id in 226 aa
YP_108281.1	Similar to the N-terminal region of Streptomyces coelicolor  transposase sco0083 or scj11.12 SWALL:Q9RI92 (EMBL:AL109949) (282 aa) fasta scores: E(): 4.8e-27, 44.63% id in 233 aa, and to the central part of Burkholderia cepacia insertion element IS402 hypothetical 16.2 kDa protein SWALL:YI22_BURCE (SWALL:P24537) (147 aa) fasta scores: E(): 3.6e-26, 64.17% id in 134 aa
YP_108284.1	Similar to Bordetella pertussis outer membrane porin protein precursor SWALL:OMP_BORPE (SWALL:Q04064) (385 aa) fasta scores: E(): 9.4e-12, 30.14% id in 408 aa, and to Ralstonia solanacearum probable porin signal peptide protein rsp0051 or rs02026 SWALL:Q8XTQ5 (EMBL:AL646076) (382 aa) fasta scores: E(): 3.2e-44, 40.66% id in 391 aa
YP_108285.1	Similar to the C-terminal region of Ralstonia solanacearum transposase Tnp SWALL:Q9RBZ6 (EMBL:AF167984) (321 aa) fasta scores: E(): 1.4e-06, 44.04% id in 84 aa, and of Burkholderia cepacia  transposase SWALL:Q93L07 (EMBL:AF029344) (327 aa) fasta scores: E(): 2.1e-05, 43.21% id in 81 aa
YP_108286.1	Similar to Rhizobium meliloti  histidine ammonia-lyase ra0165 or sma0306 SWALL:Q930N0 (EMBL:AE007210) (546 aa) fasta scores: E(): 1.8e-108, 55.01% id in 538 aa, and to Rhizobium loti histidine ammonia-lyase mll7124 SWALL:Q987B4 (EMBL:AP003011) (498 aa) fasta scores: E(): 2.8e-21, 32.15% id in 510 aa. Note: Similar also to many eukaryotic proteins
YP_108287.1	Similar to Escherichia coli citrate-proton symporter CitA or Cit SWALL:CIT1_ECOLI (SWALL:P07661) (431 aa) fasta scores: E(): 1.9e-51, 36.72% id in 422 aa, and to Ralstonia solanacearum probable sugar-proton symporter transmembrane protein rsp0536 or rs00416 SWALL:Q8XSE0 (EMBL:AL646079) (441 aa) fasta scores: E(): 1.6e-63, 44.55% id in 404 aa
YP_108288.1	catalyzes the formation of 4-imidazolone-5-propanoate from urocanate during histidine metabolism
YP_108289.1	Similar to Agrobacterium tumefaciens hypothetical protein atu3042 or agr_l_3523 SWALL:Q8UBH4 (EMBL:AE009235) (358 aa) fasta scores: E(): 6.2e-11, 25.13% id in 366 aa, and to Rhizobium loti hypothetical protein mll9130 SWALL:Q982D2 (EMBL:AP003015) (361 aa) fasta scores: E(): 4.6e-10, 26.03% id in 338 aa
YP_108290.1	Similar to Escherichia coli transcriptional activator protein LysR or b2839 SWALL:LYSR_ECOLI (SWALL:P03030) (311 aa) fasta scores: E(): 1.7e-28, 35.95% id in 292 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa5085 SWALL:Q9HU98 (EMBL:AE004921) (318 aa) fasta scores: E(): 6.5e-30, 38.72% id in 297 aa
YP_108291.1	Similar to Bacillus subtilis allantoinase PucH SWALL:ALN_BACSU (SWALL:O32137) (446 aa) fasta scores: E(): 6.1e-31, 29.27% id in 444 aa, and to Streptomyces coelicolor probable allantoinase sco6247 or scah10.12 or stah10.12 SWALL:ALN_STRCO (SWALL:Q9RKU5) (445 aa) fasta scores: E(): 9.5e-31, 31.62% id in 449 aa
YP_108292.1	allantoate amidohydrolase and N-carbamoyl-L-amino acid amidohydrolase are very similar; the allantoate amidohydrolase from Escherichia coli forms a dimer and binds zinc ions for catalytic activity and catalyzes the conversion of allantoate to (S)-ureidoglycolate and ammonia; carbamoyl amidohydrolase from Bacillus sp. converts N-carbamoyl amino acids to amino acids, ammonia, and carbon dioxide
YP_108293.1	Bacteria have multiple sigma factors which are active under specific conditions; the sigma factor binds with the catalytic core of RNA polymerase to produce the holoenzyme and directs bacterial core RNA polymerase to specific promoter elements to initiate transcription
YP_108294.1	Similar to Agrobacterium tumefaciens hypothetical protein atu2267 or agr_c_4120 SWALL:Q8UD60 (EMBL:AE009176) (214 aa) fasta scores: E(): 1.2e-18, 37.55% id in 213 aa, and to Caulobacter crescentus hypothetical protein cc3252 SWALL:Q9A3F2 (EMBL:AE005989) (214 aa) fasta scores: E(): 5e-18, 33.17% id in 214 aa
YP_108295.1	Similar to Agrobacterium tumefaciens hypothetical protein atu2267 or agr_c_4120 SWALL:Q8UD60 (EMBL:AE009176) (214 aa) fasta scores: E(): 3.7e-15, 33.8% id in 213 aa, and to Brucella melitensis extracytoplasmic function alternative sigma factor bmeii0072 SWALL:Q8YDV2 (EMBL:AE009645) (413 aa) fasta scores: E(): 4.7e-14, 36.03% id in 247 aa
YP_108296.1	Similar to Rhizobium meliloti hypothetical protein rb0506 or smb20527 SWALL:Q92W39 (EMBL:AL603643) (144 aa) fasta scores: E(): 8.5e-37, 69.63% id in 135 aa, and to Ralstonia solanacearum probable transmembrane protein rsp1037 or rs02374 SWALL:Q8XR31 (EMBL:AL646082) (162 aa) fasta scores: E(): 5.4e-06, 31.64% id in 158 aa
YP_108297.1	Similar to Rhizobium meliloti hypothetical protein rb0507 or smb20528 SWALL:Q92W38 (EMBL:AL603643) (266 aa) fasta scores: E(): 1.2e-48, 54% id in 250 aa, and to Caulobacter crescentus hypothetical protein cc3256 SWALL:Q9A3E8 (EMBL:AE005989) (254 aa) fasta scores: E(): 4.5e-14, 30.69% id in 215 aa
YP_108298.1	Similar to Rhizobium meliloti hypothetical protein rb0508 or smb20529 SWALL:Q92W37 (EMBL:AL603643) (309 aa) fasta scores: E(): 2.8e-72, 65.2% id in 273 aa, and to Caulobacter crescentus hypothetical protein cc3255 SWALL:Q9A3E9 (EMBL:AE005989) (280 aa) fasta scores: E(): 1.5e-46, 46.64% id in 268 aa
YP_108299.1	Similar to Rhizobium meliloti hypothetical protein rb0509 or smb20530 SWALL:Q92W36 (EMBL:AL603643) (112 aa) fasta scores: E(): 1.2e-23, 66.33% id in 101 aa, and to Caulobacter crescentus hypothetical protein cc3254 SWALL:Q9A3F0 (EMBL:AE005989) (150 aa) fasta scores: E(): 2.4e-12, 52.94% id in 85 aa
YP_108300.1	Similar to Agrobacterium tumefaciens transcriptional regulator, GntR family atu3908 or agr_l_1876 SWALL:Q8U922 (EMBL:AE009321) (249 aa) fasta scores: E(): 1.6e-41, 51.62% id in 215 aa, and to Streptomyces coelicolor  GntR-family transcriptional regulator sco1410 or sc6d7.29 SWALL:Q9RKW9 (EMBL:AL133213) (231 aa) fasta scores: E(): 2.1e-29, 47.29% id in 203 aa. Note: This CDS is shorter in its N-terminal region than most of its database matches
YP_108301.1	Similar to Xylella fastidiosa recombinase xfa0019 SWALL:Q9PHI6 (EMBL:AE003851) (188 aa) fasta scores: E(): 5.3e-29, 49.73% id in 189 aa, and to Bacteriophage Mu DNA-invertase Gin or 51 SWALL:DNIV_BPMU (SWALL:P03015) (193 aa) fasta scores: E(): 6.8e-28, 48.96% id in 194 aa
YP_108303.1	Similar to Shigella boydii PinB gene product SWALL:Q57343 (EMBL:D00660) (195 aa) fasta scores: E(): 2.3e-29, 50.81% id in 185 aa, and to Salmonella typhi DNA-invertase sty3695 SWALL:Q8Z339 (EMBL:AL627279) (188 aa) fasta scores: E(): 2.5e-29, 52.24% id in 178 aa
YP_108304.1	Similar to Escherichia coli transposase InsC for insertion element IS2 SWALL:INSC_ECOLI (SWALL:P19776) (121 aa) fasta scores: E(): 5.7e-20, 54.31% id in 116 aa, and to Ralstonia solanacearum ISRso10-transposase OrfA protein rsp0461 or rsc1434 or rs00949 or rs05904 SWALL:Q8XGI6 (EMBL:AL646078) (122 aa) fasta scores: E(): 2.5e-29, 69.67% id in 122 aa
YP_108306.1	Similar to Rhizobium loti hypothetical protein mll2848 SWALL:Q98HJ2 (EMBL:AP003000) (1953 aa) fasta scores: E(): 1.8e-60, 33.27% id in 1677 aa, and to Staphylococcus aureus hypothetical protein sav2654 or sa2447 SWALL:Q99QY4 (EMBL:AP003366) (2271 aa) fasta scores: E(): 3.4e-49, 29.2% id in 1589 aa. Note: High content in alanine, glycine, serine and threonine amino acid residues. Contains also three regions with repeats. Possible alternative translational start sites
YP_108307.1	Similar to Ralstonia solanacearum  HNS-like transcription regulator protein rsp0029 or rs02004 SWALL:Q8XTS5 (EMBL:AL646076) (95 aa) fasta scores: E(): 6.8e-07, 32.25% id in 93 aa, and to Escherichia coli ORF1 SWALL:O52122 (EMBL:AF022236) (129 aa) fasta scores: E(): 7.7e-05, 30.7% id in 114 aa
YP_108308.1	Similar to Dactylium dendroides galactose oxidase precursor GaoA SWALL:GAOA_DACDE (SWALL:Q01745) (680 aa) fasta scores: E(): 2.4e-20, 29.25% id in 523 aa, and to Stigmatella aurantiaca  copper-dependent oxidase Ox SWALL:Q938A2 (EMBL:AY055804) (779 aa) fasta scores: E(): 4.2e-08, 28.26% id in 750 aa
YP_108310.1	Similar to Escherichia coli penicillin G acylase precursor Pac SWALL:PAC_ECOLI (SWALL:P06875) (846 aa) fasta scores: E(): 3.6e-08, 25.62% id in 636 aa, and to Pseudomonas sp. penicillin acylase II precursor AcyII SWALL:PAC2_PSES3 (SWALL:P15558) (773 aa) fasta scores: E(): 6.1e-35, 28.93% id in 788 aa
YP_108311.1	Similar to Rhizobium sp. nodulation protein NolNO NolO or Y4hd SWALL:NOLO_RHISN (SWALL:P55474) (680 aa) fasta scores: E(): 6.7e-58, 39.07% id in 581 aa, and to Ralstonia solanacearum  transferase rsp0788 or rs01919 SWALL:Q8XRP3 (EMBL:AL646080) (581 aa) fasta scores: E(): 1.2e-41, 30.76% id in 598 aa
YP_108312.1	Similar to Pseudomonas syringae syringomycin synthetase SyrE SWALL:O85168 (EMBL:AF047828) (9376 aa) fasta scores: E(): 1.5e-105, 31.93% id in 6198 aa, and to all the domains of Bacillus brevis tyrocidine synthetase III TycC SWALL:TYCC_BACBR (SWALL:O30409) blast scores: E(): 0.0, score: 4799 27% id. Note: Taking into consideration the blastp similarities and all the similarities to the domains in Bacillus brevis TycC, it could be proposed that BSPL1712 possibly incorporates six amino acids (Asn, Gln, Tyr, Val, Orn and Leu) into the peptide chain (as counts on five condensation domains) although it lacks the thioesterase domain at the C-terminal region
YP_108313.1	Similar to Anabaena sp. hypothetical protein alr7095 SWALL:Q8YL40 (EMBL:AP003600) (186 aa) fasta scores: E(): 3.3e-21, 38.2% id in 178 aa, and to Agrobacterium tumefaciens acetyltransferase atu4764 or agr_l_237 SWALL:Q8U6P3 (EMBL:AE009405) (186 aa) fasta scores: E(): 1.3e-19, 39.54% id in 177 aa. Note: this CDS is longer in its C-terminal region than most of its database matches
YP_108314.1	Similar to Aeromonas jandaei L-allo-threonine aldolase LtaA SWALL:LTAA_AERJA (SWALL:O07051) (338 aa) fasta scores: E(): 4.2e-54, 50.59% id in 334 aa, and to Escherichia coli low-specificity L-threonine aldolase LtaE or b0870 SWALL:LTAE_ECOLI (SWALL:P75823) (333 aa) fasta scores: E(): 6.7e-41, 40.58% id in 340 aa. Note: this CDS is longer in its N-terminal region than most of its database matches
YP_108315.1	Similar to full length of Rhizobium loti fusion protein contains  ligase and probable arginosuccinate lyase msi203 SWALL:CAD31608 (EMBL:AL672113) (899 aa) fasta scores: E(): 5.4e-96, 38.52% id in 911 aa, and C-terminal region similar to Escherichia coli argininosuccinate lyase ArgH or b3960 SWALL:ARLY_ECOLI (SWALL:P11447) (457 aa) fasta scores: E(): 1.2e-25, 32.44% id in 376 aa
YP_108316.1	Similar to Rhizobium loti cysteine synthase mll9227 SWALL:Q981U9 (EMBL:AP003015) (351 aa) fasta scores: E(): 4.2e-53, 45.74% id in 341 aa, and to Alcaligenes eutrophus cysteine synthase CysM SWALL:CYSM_ALCEU (SWALL:Q44004) (339 aa) fasta scores: E(): 9.2e-16, 31.35% id in 303 aa
YP_108318.1	Similar to Streptomyces coelicolor  transport protein sco1457 or scl6.14C SWALL:Q9L102 (EMBL:AL159139) (413 aa) fasta scores: E(): 7.1e-12, 26.75% id in 385 aa, and to Escherichia coli hypothetical protein YfcJ or b2322 SWALL:YFCJ_ECOLI (SWALL:P77549) (392 aa) fasta scores: E(): 1.7e-05, 23.7% id in 405 aa
YP_108319.1	Similar to Rhizobium loti hypothetical protein mll9228 SWALL:Q981U8 (EMBL:AP003015) (329 aa) fasta scores: E(): 7.2e-31, 38.46% id in 299 aa, and to Bacillus thuringiensis possible kinase pbt101 SWALL:CAD30141 (EMBL:AL731825) (299 aa) fasta scores: E(): 1.4e-17, 30.03% id in 283 aa
YP_108320.1	Similar to Escherichia coli argininosuccinate lyase ArgH or b3960 SWALL:ARLY_ECOLI (SWALL:P11447) (457 aa) fasta scores: E(): 7.9e-63, 43.26% id in 453 aa, and to Bacillus subtilis argininosuccinate lyase ArgH SWALL:ARLY_BACSU (SWALL:O34858) (461 aa) fasta scores: E(): 1.8e-70, 44.13% id in 460 aa
YP_108321.1	Similar to Streptomyces clavuligerus argininosuccinate synthase ArgG SWALL:ASSY_STRCL (SWALL:P50986) (397 aa) fasta scores: E(): 8.4e-49, 35.78% id in 394 aa, and to Thermoanaerobacter tengcongensis argininosuccinate synthase tte2494 SWALL:Q8R7C2 (EMBL:AE013190) (410 aa) fasta scores: E(): 1.9e-70, 44.92% id in 394 aa
YP_108322.1	Similar to Bordetella bronchiseptica  formyl transferase bblps1.05 SWALL:O87978 (EMBL:AJ007747) (274 aa) fasta scores: E(): 2.8e-08, 24.21% id in 256 aa, and to Streptomyces coelicolor  formyltransferase sco0499 or scf34.18 SWALL:Q9RK07 (EMBL:AL109974) (315 aa) fasta scores: E(): 1e-07, 26.14% id in 218 aa
YP_108324.1	Similar to Anabaena sp. histidinol-phosphate aminotransferase 1 HisC1 or alr2092 SWALL:HI81_ANASP (SWALL:Q8YV89) (353 aa) fasta scores: E(): 3.1e-20, 31.17% id in 324 aa, and to Halobacterium volcanii histidinol-phosphate aminotransferase HisC SWALL:HIS8_HALVO (SWALL:P17736) (361 aa) fasta scores: E(): 7.6e-18, 30.74% id in 322 aa
YP_108325.1	Full length similar to C-terminal region of Drosophila melanogaster CG13902 protein SWALL:Q9W0M3 (EMBL:AE003469) (394 aa) fasta scores: E(): 7.6e-16, 28.68% id in 244 aa, and C-terminal region similar to C-terminal region of Caulobacter crescentus PasS1-related protein cc1001 SWALL:Q9A9H9 (EMBL:AE005778) (344 aa) fasta scores: E(): 8.7e-08, 29.95% id in 207 aa. Note: Most of the database hits are to eukaryotic entries
YP_108326.1	Similar to Pseudomonas aeruginosa hypothetical protein pa2412 SWALL:Q9I169 (EMBL:AE004668) (72 aa) fasta scores: E(): 1.5e-09, 43.07% id in 65 aa, and to Ralstonia solanacearum hypothetical protein rsp0640 or rs03727 SWALL:Q8XS41 (EMBL:AL646079) (68 aa) fasta scores: E(): 7.4e-08, 44.44% id in 54 aa
YP_108327.1	Full length similar to the C-terminal regions of Amycolatopsis mediterranei peptide synthetase BpsC SWALL:Q939Y9 (EMBL:Y16952) (1858 aa) fasta scores: E(): 3.3e-07, 25.55% id in 626 aa, and of Streptomyces pristinaespiralis pristinamycin I synthase 3 and 4 SnbDE SWALL:O07944 (EMBL:Y11548) (4848 aa) fasta scores: E(): 3.7e-07, 26.49% id in 585 aa
YP_108328.1	Similar to Bordetella pertussis outer membrane porin protein precursor SWALL:OMP_BORPE (SWALL:Q04064) (385 aa) fasta scores: E(): 2.1e-21, 30.44% id in 404 aa, and to Comamonas acidovorans outer membrane porin protein 32 precursor Omp32 SWALL:OM32_COMAC (SWALL:P24305) (351 aa) fasta scores: E(): 2.1e-09, 28.32% id in 399 aa
YP_108329.1	Similar to Rhizobium meliloti  transcription regulator protein r00348 or smc00429 SWALL:Q92SM3 (EMBL:AL591783) (269 aa) fasta scores: E(): 3.1e-35, 44.52% id in 265 aa, and to Ralstonia solanacearum probable transcription regulator protein rsp0686 or rs01763 SWALL:Q8XRZ5 (EMBL:AL646080) (274 aa) fasta scores: E(): 5.5e-35, 47.05% id in 255 aa
YP_108330.1	Similar to Rhizobium meliloti  transmembrane protein r00347 or smc00428 SWALL:Q92SM4 (EMBL:AL591783) (298 aa) fasta scores: E(): 5.2e-43, 48.51% id in 303 aa, and to Ralstonia solanacearum probable transmembrane protein rsc1953 or rs03527 SWALL:Q8XY10 (EMBL:AL646067) (336 aa) fasta scores: E(): 9e-20, 31.93% id in 310 aa
YP_108331.1	Similar to Escherichia coli, and Escherichia coli O157:H7 chemotaxis protein CheW or b1887 or z2941 or ecs2597 SWALL:CHEW_ECOLI (SWALL:P07365) (167 aa) fasta scores: E(): 4.1e-30, 59.86% id in 147 aa, and to Burkholderia pseudomallei chemotaxis protein CheW SWALL:O05183 (EMBL:U92493) (175 aa) fasta scores: E(): 9.4e-32, 57.31% id in 164 aa. Note: Also similar to BPSL3305 cheW (176 aa) fasta scores: E(): 9.3e-31, 60.131% identity in 153 aa overlap
YP_108332.1	Similar to Ralstonia solanacearum probable methyl-accepting chemotaxis I MCP-I serine chemoreceptor protein transmembrane CheD1 or rsp0507 or rs00386 SWALL:Q8XSG9 (EMBL:AL646079) (600 aa) fasta scores: E(): 3e-52, 43.88% id in 613 aa, and to Salmonella typhimurium methyl-accepting chemotaxis citrate transducer Tcp or stm3577 SWALL:MCPC_SALTY (SWALL:Q02755) (547 aa) fasta scores: E(): 9.1e-47, 40.85% id in 563 aa
YP_108333.1	Similar to Ralstonia solanacearum hypothetical protein rsc3311 or rs02540 SWALL:Q8XU82 (EMBL:AL646074) (65 aa) fasta scores: E(): 0.015, 40.67% id in 59 aa
YP_108334.1	activates fatty acids by binding to coenzyme A
YP_108335.1	Similar to Xanthomonas campestris drug resistance translocase YieO or xcc2362 SWALL:AAM41640 (EMBL:AE012345) (476 aa) fasta scores: E(): 3.5e-67, 44.58% id in 462 aa, and to Rhizobium loti multidrug efflux protein mll8348 SWALL:Q983F7 (EMBL:AP003013) (473 aa) fasta scores: E(): 1.5e-63, 42.29% id in 461 aa
YP_108336.1	Similar to Escherichia coli biotin synthesis protein BioC or b0777 SWALL:BIOC_ECOLI (SWALL:P12999) (251 aa) fasta scores: E(): 1.2e-05, 36.36% id in 110 aa, and to Brucella melitensis ubiquinone/menaquinone biosynthesis methyltransferase UbiE bmei1834 SWALL:Q8YEP4 (EMBL:AE009616) (262 aa) fasta scores: E(): 2e-40, 47.69% id in 239 aa. Note: this CDS is longer in its N-terminal region than most of its database matches
YP_108337.1	Similar to Brucella melitensis glycine betaine-binding protein precursor bmei1725 SWALL:Q8YF02 (EMBL:AE009606) (304 aa) fasta scores: E(): 1.3e-70, 64.35% id in 303 aa, and to Agrobacterium tumefaciens ABC transporter substrate binding protein atu0199 or agr_c_337 SWALL:Q8UIU3 (EMBL:AE008993) (303 aa) fasta scores: E(): 3.7e-68, 63.48% id in 304 aa
YP_108338.1	Similar to Rhizobium loti ABC transporter permease mlr8414 SWALL:Q983A6 (EMBL:AP003014) (387 aa) fasta scores: E(): 1.5e-64, 52.63% id in 380 aa, and to Brucella melitensis glycine betaine/L-proline transport system permease bmei1726 SWALL:Q8YF01 (EMBL:AE009606) (386 aa) fasta scores: E(): 4.9e-58, 50.65% id in 381 aa
YP_108339.1	Similar to Rhizobium meliloti  choline uptake ABC transporter ATP-binding protein rb0812 or smb21146 SWALL:Q92V97 (EMBL:AL603645) (312 aa) fasta scores: E(): 2e-61, 61.93% id in 310 aa, and to Escherichia coli hypothetical ABC transporter ATP-binding protein YehX or b2129 SWALL:YEHX_ECOLI (SWALL:P33360) (308 aa) fasta scores: E(): 6.3e-44, 48.54% id in 309 aa
YP_108340.1	Similar to Rhizobium loti ABC transporter permease mlr8416 SWALL:Q983A4 (EMBL:AP003014) (249 aa) fasta scores: E(): 1.2e-46, 61.6% id in 237 aa, and to Yersinia pestis  ABC transport integral membrane subunit ypo1199 SWALL:Q8ZGT0 (EMBL:AJ414147) (278 aa) fasta scores: E(): 5.9e-29, 49.32% id in 223 aa. Note: this CDS is longer in its N-terminal region than most of its database matches
YP_108341.1	No significant database matches. Very low and limited similarity to parts of Oryza sativa hypothetical 20.6 kDa protein osjnba0015i18.3 SWALL:Q8S7C0 (EMBL:AC090482) (191 aa) fasta scores: E(): 6.9, 51.72% id in 29 aa
YP_108342.1	Similar to Pseudomonas aeruginosa arginine/ornithine antiporter ArcD or pa5170 SWALL:ARCD_PSEAE (SWALL:P18275) (482 aa) fasta scores: E(): 5.3e-140, 78.58% id in 481 aa, and to Clostridium perfringens arginine/ornithine antiporter cpe0170 SWALL:ARCD_CLOPE (SWALL:Q46170) (478 aa) fasta scores: E(): 2.4e-89, 51.8% id in 471 aa
YP_108343.1	catalyzes the degradation of arginine to citruline and ammonia
YP_108344.1	catalyzes the formation of ornithine and carbamylphosphate from citrulline in the arginine catabolic pathway
YP_108345.1	reversible synthesis of carbamate and ATP from carbamoyl phosphate and ADP
YP_108346.1	Similar to Pseudomonas aeruginosa probable short-chain dehydrogenase pa1330 SWALL:Q9I414 (EMBL:AE004562) (259 aa) fasta scores: E(): 1.3e-57, 61.62% id in 258 aa, and to Methanosarcina acetivorans short chain dehydrogenase ma1321 SWALL:Q8TR63 (EMBL:AE010801) (269 aa) fasta scores: E(): 1.2e-41, 46.66% id in 255 aa
YP_108347.1	Similar to Pseudomonas aeruginosa hypothetical protein pa1329 SWALL:Q9I415 (EMBL:AE004562) (143 aa) fasta scores: E(): 5.2e-18, 53.73% id in 134 aa, and to Burkholderia sp. RP007 hypothetical 15.7 kDa protein PhnX SWALL:Q9RB84 (EMBL:AF112137) (149 aa) fasta scores: E(): 1.5e-09, 42.33% id in 137 aa. Note: This CDS is shorter in its N-terminal region than most of its database matches
YP_108348.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa1328 SWALL:Q9I416 (EMBL:AE004562) (302 aa) fasta scores: E(): 3.2e-75, 67.79% id in 295 aa, and to Rhizobium meliloti transcription regulator protein r00290 or smc00370 SWALL:Q92SS5 (EMBL:AL591783) (296 aa) fasta scores: E(): 9.7e-34, 38.3% id in 295 aa
YP_108349.1	Similar to Rhizobium loti glutathione S-transferase mlr4954 SWALL:Q98CX9 (EMBL:AP003005) (234 aa) fasta scores: E(): 5.3e-65, 68.67% id in 233 aa, and to Burkholderia cepacia hypothetical 23.3 kDa protein SWALL:Q45073 (EMBL:U19883) (205 aa) fasta scores: E(): 5.4e-35, 50.95% id in 210 aa, and to Escherichia coli hypothetical GST-like protein YfcG or b2302 SWALL:YFCG_ECOLI (SWALL:P77526) (215 aa) fasta scores: E(): 3.3e-29, 45.71% id in 210 aa
YP_108350.1	Similar to Xanthomonas campestris transcriptional regulator MarR/EmrR family xcc0435 SWALL:AAM39753 (EMBL:AE012141) (162 aa) fasta scores: E(): 2.2e-15, 33.33% id in 156 aa, and to Caulobacter crescentus transcriptional regulator, MarR family cc2188 SWALL:Q9A6A6 (EMBL:AE005891) (144 aa) fasta scores: E(): 3.8e-08, 33.57% id in 140 aa. Note: this CDS is longer in its N-terminal region than most of its database matches
YP_108351.1	Similar to Ralstonia solanacearum  amino-acid transport signal peptide protein rsc3300 or rs02529 SWALL:Q8XU93 (EMBL:AL646074) (377 aa) fasta scores: E(): 1.4e-50, 43.92% id in 362 aa, and to Rhizobium meliloti leucine-specific binding protein precursor LivK or r02480 or smc01946 SWALL:Q926C5 (EMBL:AL591790) (372 aa) fasta scores: E(): 1.2e-33, 34.07% id in 361 aa
YP_108352.1	Similar to Erwinia chrysanthemi regulatory protein PecS SWALL:PECS_ERWCH (SWALL:P42195) (166 aa) fasta scores: E(): 6.9e-23, 45.86% id in 157 aa, and to Ralstonia solanacearum probable transcription regulator protein rsc2325 or rs01223 SWALL:Q8XWZ3 (EMBL:AL646069) (165 aa) fasta scores: E(): 4e-47, 80.36% id in 163 aa
YP_108353.1	Similar to Pseudomonas aeruginosa probable MFS transporter pa0273 SWALL:Q9I6L7 (EMBL:AE004465) (404 aa) fasta scores: E(): 5e-48, 46.15% id in 377 aa, and to Escherichia coli cyanate transport protein CynX or b0341 SWALL:CYNX_ECOLI (SWALL:P17583) (384 aa) fasta scores: E(): 6.8e-41, 38.66% id in 375 aa
YP_108354.1	Similar to Bacillus subtilis YngK SWALL:Q9R9I7 (EMBL:AF184956) (510 aa) fasta scores: E(): 3.3e-96, 50.4% id in 494 aa, and to Escherichia coli, and Escherichia coli O157:H7 hypothetical lipoprotein YddW precursor or b1491 or z2217 or ecs2096 SWALL:YDDW_ECOLI (SWALL:P76130) (439 aa) fasta scores: E(): 5.7e-43, 37.64% id in 433 aa
YP_108355.1	Similar to Rhodococcus erythropolis precorrin-4 C11-methyltransferase CobM SWALL:COBM_RHOER (SWALL:Q53138) (249 aa) fasta scores: E(): 3.3e-43, 52.69% id in 241 aa, and to Pseudomonas denitrificans precorrin-4 C11-methyltransferase CobM SWALL:COBM_PSEDE (SWALL:P21922) (253 aa) fasta scores: E(): 1.1e-41, 52.43% id in 246 aa
YP_108356.1	CobK/CbiJ; there are 2 pathways for cobalamin (vitamin B12) production, one aerobic (ex. P. denitrificans), the other anaerobic (ex. S. typhimurium); the CobK/CbiJ perform similar reactions in both; the anaerobic pathway includes the use of a chelated cobalt ion in order for ring contraction to occur; CobK thus converts precorrin 6 into dihydro-precorrin 6 while CbiJ converts cobalt-precorrin 6 into cobalt-deihydro-precorrin 6
YP_108357.1	Catalyzes the methylation of C-1 in cobalt-precorrin-5 and the subsequent extrusion of acetic acid from the resulting intermediate to form cobalt-precorrin-6A
YP_108358.1	decarboxylating; Similar to Pseudomonas denitrificans precorrin-6Y C5,15-methyltransferase [decarboxylating] cobL SWALL:COBL_PSEDE (SWALL:P21921) (413 aa) fasta scores: E(): 7.9e-67, 49.62% id in 401 aa, and to Brucella melitensis precorrin-6Y C5,15-methyltransferase bmei0716 SWALL:Q8YHT0 (EMBL:AE009513) (401 aa) fasta scores: E(): 1.9e-90, 61.71% id in 397 aa
YP_108359.1	Similar to Pseudomonas aeruginosa probable oxidoreductase pa2906 SWALL:Q9HZU1 (EMBL:AE004716) (486 aa) fasta scores: E(): 2.4e-32, 50.53% id in 465 aa, and to Physcomitrella patens ferredoxin-nitrite reductase Nii1 SWALL:BAB92078 (EMBL:AB074427) (602 aa) fasta scores: E(): 8.9e-13, 27.57% id in 417 aa. Note : This CDS has most of its database hits to eukaryotic entries
YP_108360.1	catalyzes the interconversion of precorrin-8X and hydrogenobyrinate
YP_108361.1	catalyzes the formation of precorrin-3 from precorrin-2
YP_108362.1	Similar to Pseudomonas denitrificans precorrin-3b C17-methyltransferase CobJ SWALL:COBJ_PSEDE (SWALL:P21640) (254 aa) fasta scores: E(): 1.1e-35, 52.2% id in 249 aa, and to C-terminal region to Mycobacterium tuberculosis cobalamin biosynthesis protein rv2066 or mt2126 or mtcy49.05 SWALL:COBI_MYCTU (SWALL:Q10677) (508 aa) fasta scores: E(): 1.8e-31, 40% id in 365 aa
YP_108363.1	Similar to Aeromonas sp chitinase II precursor SWALL:Q59145 (EMBL:D31818) (542 aa) fasta scores: E(): 1.7e-30, 34.61% id in 468 aa, and to the C-terminal region of Escherichia coli probable bifunctional chitinase/lysozyme precursor ChiA or b3338 SWALL:CHIA_ECOLI (SWALL:P13656) (897 aa) fasta scores: E(): 9.3e-30, 40.25% id in 318 aa. Note: In the C-terminal region of the E. coli entry is where the chitinase activity resides
YP_108365.1	Similar to Xanthomonas axonopodis carboxylesterase xac0619 SWALL:AAM35508 (EMBL:AE011690) (222 aa) fasta scores: E(): 6.3e-39, 50.69% id in 217 aa, and to Pseudomonas fluorescens carboxylesterase 2 EstB SWALL:EST2_PSEFL (SWALL:Q53547) (218 aa) fasta scores: E(): 1.2e-22, 38.53% id in 218 aa
YP_108366.1	Similar to Pseudomonas aeruginosa hypothetical protein PA2941 SWALL:Q9HZQ6 (EMBL:AE004720) (214 aa) fasta scores: E(): 9.7e-15, 37.43% id in 187 aa
YP_108367.1	C-terminal region is similar to Pseudomonas putida magnesium chelatase, subunit CHII PP3506 SWALL:Q88H59 (EMBL:AE016787) (337 aa) fasta scores: E(): 1.9e-40, 53.43% id in 335 aa. Full length CDS is similar to Chromobacterium violaceum probable chelatase CV1570 SWALL:Q7NXQ6 (EMBL:AE016915) (635 aa) fasta scores: E(): 2.8e-28, 44.29% id in 438 aa
YP_108368.1	with CobST catalyzes the formation of cobyrinic acid a,c-diamide from hydrogenobyrinic acid a,c-diamide in an ATP-dependent manner; involved in porphyrin and chlorophyll metabolism; vitamin B12 metabolism
YP_108369.1	Similar to Pseudomonas denitrificans CobW protein SWALL:COBW_PSEDE (SWALL:P29937) (353 aa) fasta scores: E(): 2.1e-62, 50% id in 348 aa, and to Agrobacterium tumefaciens cobalamin synthesis related protein atu2805 or agr_c_5088 SWALL:Q8UBP6 (EMBL:AE009228) (345 aa) fasta scores: E(): 1.1e-58, 49.85% id in 335 aa
YP_108370.1	Similar to Alcaligenes eutrophus high-affinity nickel transport protein HoxN SWALL:HOXN_ALCEU (SWALL:P23516) (351 aa) fasta scores: E(): 4.3e-78, 58.11% id in 339 aa, and to Bradyrhizobium japonicum hydrogenase nickel incorporation protein HupN SWALL:HUPN_BRAJA (SWALL:Q45247) (381 aa) fasta scores: E(): 1e-61, 54.23% id in 319 aa
YP_108371.1	catalyzes the formation of cobalt-precorrin 4 from cobalt-precorrin 3
YP_108372.1	catalyzes the formation of adenosylcob(III)yrinic acid a,c-diamide from cob(I)yrinic acid a,c-diamide
YP_108373.1	Similar to Pseudomonas aeruginosa cobyrinic acid A,C-diamide synthase CobB or pa1273 SWALL:COBB_PSEAE (SWALL:Q9I471) (435 aa) fasta scores: E(): 2.8e-48, 49.81% id in 528 aa, and to Bacillus megaterium cobyrinic acid A,C-diamide synthase CobB or CbiA SWALL:COBB_BACME (SWALL:O87698) (460 aa) fasta scores: E(): 4.4e-16, 29.29% id in 536 aa. Note: This CDS contains an unique region from approximately residue 225 to approximately residue 340 that has no similarity to any of the database matches
YP_108374.1	Similar to Pseudomonas aeruginosa pyoverdine synthetase F PvdF SWALL:P72114 (EMBL:U07359) (275 aa) fasta scores: E(): 2.5e-78, 73.89% id in 272 aa, and to Burkholderia cepacia ornibactin synthetase F PvdF SWALL:Q9F479 (EMBL:AF013993) (279 aa) fasta scores: E(): 9.5e-68, 67.64% id in 272 aa
YP_108375.1	Similar to Burkholderia cepacia ornibactin receptor precursor OrbA SWALL:Q9F480 (EMBL:AF013993) (755 aa) fasta scores: E(): 5e-203, 68.7% id in 754 aa, and to Erwinia chrysanthemi ferrichrysobactin receptor precursor Ftc SWALL:FCT_ERWCH (SWALL:Q47162) (735 aa) fasta scores: E(): 4.2e-76, 34.5% id in 713 aa
YP_108376.1	Similar to Pseudomonas aeruginosa L-ornithine 5-monooxygenase PvdA or Pvd-1 or pa2386 SWALL:PVDA_PSEAE (SWALL:Q51548) (443 aa) fasta scores: E(): 2.3e-63, 48.01% id in 454 aa, and to the C-terminal region of Burkholderia cepacia L-ornithine 5-monooxygenase PvdA SWALL:PVDA_BURCE (SWALL:O51940) (444 aa) fasta scores: E(): 4.6e-124, 77.85% id in 411 aa
YP_108377.1	Similar to Pseudomonas putida siderophore non-ribosomal peptide synthetase PpsD SWALL:Q9AKS6 (EMBL:AJ310530) (2246 aa) fasta scores: E(): 8.6e-57, 36.03% id in 1751 aa, and to Pseudomonas aeruginosa probable non-ribosomal peptide synthetase pa2402 SWALL:Q9I179 (EMBL:AE004667) (5149 aa) fasta scores: E(): 9e-57, 36.04% id in 1670 aa
YP_108378.1	Similar to Xenorhabdus bovienii peptide synthetase XpsB SWALL:Q8VQF8 (EMBL:AF455810) (3316 aa) fasta scores: E(): 1.7e-106, 29.31% id in 3350 aa, and to Pseudomonas aeruginosa pyoverdine synthetase D PvdD or pa2399 SWALL:Q9I182 (EMBL:AE004666) (2448 aa) fasta scores: E(): 9.9e-93, 36.1% id in 1770 aa
YP_108379.1	Similar to Pseudomonas aeruginosa pyoverdine synthetase E PvdE SWALL:Q51340 (EMBL:U07359) (548 aa) fasta scores: E(): 1.4e-59, 37.7% id in 557 aa, and to Pseudomonas syringae ATP-binding protein SyrD SWALL:SYRD_PSESY (SWALL:P33951) (566 aa) fasta scores: E(): 7.7e-51, 36.92% id in 539 aa
YP_108380.1	Similar to Pseudomonas aeruginosa hypothetical protein pa0055 SWALL:Q9I777 (EMBL:AE004445) (168 aa) fasta scores: E(): 3.3e-05, 37.5% id in 168 aa
YP_108381.1	Similar to Escherichia coli iron FecB or b4290 SWALL:FECB_ECOLI (SWALL:P15028) (300 aa) fasta scores: E(): 7.5e-10, 30.06% id in 306 aa, and to Anabaena sp. periplasmic iron-compound-binding protein of iron all0388 SWALL:Q8YZR9 (EMBL:AP003582) (300 aa) fasta scores: E(): 9.4e-20, 33.44% id in 296 aa. Note: this CDS is longer in its N-terminal region than most of its database matches
YP_108382.1	Similar to Escherichia coli ferric iron reductase FhuF or b4367 SWALL:FHUF_ECOLI (SWALL:P39405) (262 aa) fasta scores: E(): 4.7e-06, 27.27% id in 242 aa, and to Rhizobium meliloti  transport protein r02270 or smc01658 SWALL:Q92ND8 (EMBL:AL591790) (243 aa) fasta scores: E(): 1.2e-06, 27.31% id in 238 aa
YP_108383.1	part of the FhuBCD ATP-dependent iron (III) hydroxamate transporter involved in the high-affinity transport of Fe(3+)-ferrichrome
YP_108384.1	Similar to Escherichia coli ferric enterobactin transport ATP-binding protein FepC or b0588 SWALL:FEPC_ECOLI (SWALL:P23878) (271 aa) fasta scores: E(): 1.7e-33, 44.57% id in 258 aa, and to Synechocystis sp. iron slr1318 SWALL:P72592 (EMBL:D90899) (268 aa) fasta scores: E(): 8.8e-38, 48.65% id in 261 aa
YP_108385.1	Similar to Pseudomonas aeruginosa hypothetical protein pa2304 SWALL:Q9I1H1 (EMBL:AE004656) (362 aa) fasta scores: E(): 3.8e-48, 46.47% id in 312 aa, and to Streptomyces verticillus SyrP-like protein SWALL:Q9FB16 (EMBL:AF210249) (339 aa) fasta scores: E(): 4e-43, 44.05% id in 311 aa
YP_108386.1	Similar to Pseudomonas aeruginosa hypothetical protein pa2412 SWALL:Q9I169 (EMBL:AE004668) (72 aa) fasta scores: E(): 1.5e-15, 63.07% id in 65 aa, and to Mycobacterium tuberculosis MbtH protein or rv2377c or mt2445.1 or mtcy27.03 SWALL:MBTH_MYCTU (SWALL:O05821) (71 aa) fasta scores: E(): 2.8e-10, 46.87% id in 64 aa
YP_108387.1	RNA polymerase sigma factor involved in the synthesis of the siderophores pyoverdine in Pseudomonas and malleobactin in Burkholderia; also involved in the synthesis of exotoxin and PrpL protease
YP_108388.1	Similar to Gallus gallus D-erythrulose reductase Der SWALL:BAB97210 (EMBL:AB049356) (246 aa) fasta scores: E(): 4e-35, 48.78% id in 246 aa, and to Rhizobium meliloti oxidoreductase r02525 or smc01991 SWALL:Q92MT5 (EMBL:AL591791) (241 aa) fasta scores: E(): 1.1e-34, 46.91% id in 243 aa. Note: The majoroty of the databse matches belong to eukayotic organisms
YP_108389.1	Similar to Yersinia pestis  zinc-binding dehydrogenase ypo3352 SWALL:Q8ZBQ5 (EMBL:AJ414156) (371 aa) fasta scores: E(): 2.3e-66, 49.43% id in 356 aa, and to Bacillus halodurans sorbitol dehydrogenase bh0189 SWALL:DHSO_BACHD (SWALL:Q9Z9U1) (343 aa) fasta scores: E(): 1.7e-28, 34.35% id in 358 aa
YP_108390.1	Similar to Agrobacterium tumefaciens ABC transporter membrane spanning protein atu4322 or agr_l_1078 SWALL:Q8U7X7 (EMBL:AE009360) (327 aa) fasta scores: E(): 1.3e-63, 64.72% id in 309 aa, and to Escherichia coli, and Escherichia coli O157:H7 ribose transport system permease RbsC or b3750 or z5251 or ecs4692 SWALL:RBSC_ECO57 (SWALL:P04984) (321 aa) fasta scores: E(): 3.4e-43, 47.41% id in 310 aa. Note: this CDS is longer in its N-terminal region than most of its database matches
YP_108391.1	Low similarity to parts of Microbacterium ammoniaphilum hypothetical 58.7 kDa protein SWALL:P94909 (EMBL:X79027) (529 aa) fasta scores: E(): 5.6e-09, 33.58% id in 396 aa, and to Homo sapiens hypothetical protein dkfzp434d1812 SWALL:Q9H0L6 (EMBL:AL136745) (1170 aa) fasta scores: E(): 7.4e-07, 25.18% id in 552 aa. Note: Most of the database matches belong to eukaryotic entries
YP_108392.1	Similar to Agrobacterium tumefaciens ABC transporter substrate binding protein atu4320 or agr_l_1084 SWALL:Q8U7X9 (EMBL:AE009360) (303 aa) fasta scores: E(): 1e-69, 67.79% id in 295 aa, and to Escherichia coli D-ribose-binding periplasmic protein precursor RbsB or RbsP or PrlB or b3751 SWALL:RBSB_ECOLI (SWALL:P02925) (296 aa) fasta scores: E(): 1.1e-20, 32.33% id in 300 aa
YP_108393.1	Similar to Agrobacterium tumefaciens transcriptional regulator, AraC family atu4319 or agr_l_1086 SWALL:Q8U7Y0 (EMBL:AE009360) (305 aa) fasta scores: E(): 1e-58, 48.96% id in 290 aa, and to Pseudomonas aeruginosa transcriptional regulator MtlR or pa2337 SWALL:Q9I1E1 (EMBL:AE004660) (301 aa) fasta scores: E(): 1.5e-39, 37.5% id in 280 aa. Note: this CDS is longer in its C-terminal region than most of its database matches
YP_108395.1	Low similarity to Caulobacter crescentus hypothetical protein cc2711 SWALL:Q9A4W4 (EMBL:AE005937) (585 aa) fasta scores: E(): 4.1e-10, 25.84% id in 530 aa
YP_108396.1	Similar to Caulobacter crescentus ABC transporter HlyB/MsbA family cc1314 SWALL:Q9A8N9 (EMBL:AE005806) (643 aa) fasta scores: E(): 2.1e-27, 27.76% id in 587 aa, and to Yersinia pestis  ABC transport protein ypo2588 SWALL:Q8ZDI0 (EMBL:AJ414152) (631 aa) fasta scores: E(): 8.3e-26, 26.18% id in 569 aa
YP_108397.1	Similar to Pseudomonas aeruginosa hypothetical protein pa0498 SWALL:Q9I620 (EMBL:AE004487) (335 aa) fasta scores: E(): 1.1e-13, 23.79% id in 332 aa, and to Yersinia pestis  exported protein ypo4040 SWALL:Q8Z9Y9 (EMBL:AJ414160) (328 aa) fasta scores: E(): 2.2e-10, 28.4% id in 345 aa
YP_108398.1	Similar to Escherichia coli O157:H7  fimbrial chaperone YfcS or z3599 or ecs3220 SWALL:Q8XCP6 (EMBL:AE005465) (252 aa) fasta scores: E(): 1.2e-32, 39.59% id in 245 aa, and to Proteus mirabilis chaperone protein PmfD precursor WALL:PMFD_PROMI (SWALL:P53520) (254 aa) fasta scores: E(): 4.4e-29, 36.63% id in 232 aa
YP_108399.1	Similar to Escherichia coli outer membrane usher protein PapC precursor SWALL:PAPC_ECOLI (SWALL:P07110) (836 aa) fasta scores: E(): 1e-85, 38.1% id in 824 aa, and to Proteus mirabilis outer membrane usher protein PmfC precursor SWALL:PMFC_PROMI (SWALL:P53514) (828 aa) fasta scores: E(): 1.1e-66, 33.66% id in 799 aa
YP_108400.1	Similar to Escherichia coli type-1 fimbrial protein, A chain precursor FimA or PilA or b4314 SWALL:FM1A_ECOLI (SWALL:P04128) (182 aa) fasta scores: E(): 3.2e-17, 42.62% id in 183 aa, and to Klebsiella pneumoniae fimbrial subunit type 1 precursor SWALL:FM11_KLEPN (SWALL:P12266) (182 aa) fasta scores: E(): 3.2e-17, 42.62% id in 183 aa
YP_108401.1	Similar to Pseudomonas aeruginosa outer membrane protein precursor OprM or OprK or pa0427 SWALL:OPRM_PSEAE (SWALL:Q51487) (485 aa) fasta scores: E(): 2.3e-59, 46.39% id in 485 aa, and to Xanthomonas axonopodis outer membrane protein OprM or xac2842 SWALL:AAM37687 (EMBL:AE011925) (503 aa) fasta scores: E(): 9.5e-65, 47.54% id in 488 aa
YP_108402.1	MexY; AmrB; involved in resistance to antibiotics; inner membrane protein; belongs to RND (resistance, nodulation, cell division) family of transporters; functions along with MexX and OprM; part of an inducible system that appears to respond to interference with the cellular translation machinery
YP_108403.1	MexX; AmrA; involved in resistance to antibiotics; periplasmic membrane fusion protein; functions along with MexY and OprM; part of an inducible system that appears to respond to interference with the cellular translation machinery
YP_108404.1	Almost identical to Burkholderia pseudomallei regulator AmrR SWALL:O87934 (EMBL:AF072887) (187 aa) fasta scores: E(): 1e-64, 99.42% id in 173 aa. Similar to Ralstonia solanacearum  AcrAB operon repressor transcription regulator protein AcrR or rsc0012 or rs01834 SWALL:Q8Y3G8 (EMBL:AL646057) (219 aa) fasta scores: E(): 4.2e-21, 38.22% id in 225 aa. Note: This CDS is longer than the previously sequenced AmrR in its C-terminal region, it is possible that the previous sequence submitted to the databases had a sequencing error that led to a frameshift after residue 173
YP_108405.1	C-terminal region similar to C-terminal region of Brucella melitensis lysostaphin bmei1268 SWALL:Q8YG93 (EMBL:AE009565) (472 aa) fasta scores: E(): 3e-18, 35.1% id in 245 aa, and to Rickettsia prowazekii hypothetical protein rp407 SWALL:Q9ZDC5 (EMBL:AJ235271) (458 aa) fasta scores: E(): 3.4e-18, 29.6% id in 277 aa
YP_108406.1	Similar to Pseudomonas aeruginosa probable amino acid permease pa2202 SWALL:Q9I1R5 (EMBL:AE004646) (225 aa) fasta scores: E(): 1.7e-53, 67.11% id in 225 aa, and to Ralstonia solanacearum probable amino acid transmembrane ABC transporter protein rsp0933 or rs05400 SWALL:Q8XRC5 (EMBL:AL646081) (248 aa) fasta scores: E(): 2.2e-28, 41.52% id in 236 aa
YP_108407.1	Similar to Yersinia pestis ABC transporter permease ypo4110 SWALL:Q8Z9T5 (EMBL:AJ414160) (245 aa) fasta scores: E(): 5.8e-51, 59.3% id in 231 aa, and to Pseudomonas aeruginosa probable amino acid permease pa2203 SWALL:Q9I1R4 (EMBL:AE004646) (238 aa) fasta scores: E(): 3.3e-48, 62.23% id in 233 aa
YP_108408.1	Similar to Pseudomonas aeruginosa probable binding protein component of ABC transporter pa2204 SWALL:Q9I1R3 (EMBL:AE004647) (268 aa) fasta scores: E(): 1.2e-70, 68.88% id in 270 aa, and to Escherichia coli cystine-binding periplasmic protein precursor FliY or b1920 SWALL:FLIY_ECOLI (SWALL:P39174) (266 aa) fasta scores: E(): 2e-20, 32.8% id in 253 aa
YP_108409.1	Similar to Ralstonia solanacearum  transmembrane protein rsc0648 or rs01552 SWALL:Q8Y1P2 (EMBL:AL646060) (347 aa) fasta scores: E(): 1.6e-41, 41.64% id in 329 aa
YP_108410.1	Similar to Ralstonia solanacearum  transmembrane protein rsc0649 or rs01553 SWALL:Q8Y1P1 (EMBL:AL646060) (144 aa) fasta scores: E(): 3.7e-14, 40.58% id in 138 aa
YP_108411.1	Similar to the central parts of Agrobacterium tumefaciens hypothetical protein atu0215 or agr_c_369 SWALL:Q8UIS7 (EMBL:AE008995) (289 aa) fasta scores: E(): 5.6e-08, 28.62% id in 255 aa, and of Rhizobium loti hypothetical protein mll5605 SWALL:Q98BF1 (EMBL:AP003007) (275 aa) fasta scores: E(): 7e-07, 25.76% id in 260 aa
YP_108412.1	Similar to Ralstonia solanacearum  tight adherence TadC-related transmembrane protein rsc0650 or rs01554 SWALL:Q8Y1P0 (EMBL:AL646060) (315 aa) fasta scores: E(): 1.8e-20, 32.23% id in 304 aa, and to Agrobacterium tumefaciens components of type IV pilus CtpI or atu0216 or agr_c_371 SWALL:Q8UIS6 (EMBL:AE008995) (328 aa) fasta scores: E(): 4.1e-19, 30.4% id in 319 aa
YP_108413.1	Similar to Rhizobium loti hypothetical protein mlr5603 SWALL:Q98BF3 (EMBL:AP003007) (337 aa) fasta scores: E(): 4e-21, 32.46% id in 308 aa, and C-terminal region similar to C-terminal region of Agrobacterium tumefaciens components of type IV pilus CtpH or atu0217 or agr_c_372 SWALL:Q8UIS5 (EMBL:AE008995) (334 aa) fasta scores: E(): 8.8e-20, 32.46% id in 231 aa
YP_108414.1	Similar to Caulobacter crescentus pilus assembly protein CpaF cc2942 SWALL:Q9A496 (EMBL:AE005958) (501 aa) fasta scores: E(): 6.6e-65, 47.03% id in 523 aa, and to Agrobacterium tumefaciens component of type IV pilus CtpG or atu0218 or agr_c_373 SWALL:Q8UIS4 (EMBL:AE008995) (491 aa) fasta scores: E(): 3.4e-60, 45.69% id in 464 aa
YP_108415.1	Similar to Caulobacter crescentus pilus assembly protein CpaE cc2943 SWALL:Q9A495 (EMBL:AE005958) (517 aa) fasta scores: E(): 1.4e-25, 31.34% id in 386 aa, and to Agrobacterium tumefaciens components of type IV pilus CtpF or atu0219 or agr_c_376 SWALL:Q8UIS3 (EMBL:AE008995) (462 aa) fasta scores: E(): 9.4e-20, 28.64% id in 412 aa
YP_108416.1	Very low similarity to C-terminal region of Agrobacterium tumefaciens components of type IV pilus CtpE or atu0220 or agr_c_378 SWALL:Q8UIS2 (EMBL:AE008995) (250 aa) fasta scores: E(): 0.47, 45.09% id in 51 aa
YP_108417.1	Similar to Rhizobium sp. hypothetical 44.3 kDa protein Y4xJ WALL:Y4XJ_RHISN (SWALL:P55702) (423 aa) fasta scores: E(): 4e-52, 39.54% id in 440 aa, and to Escherichia coli protein transport protein precursor HofQ or HopQ or b3391 SWALL:HOFQ_ECOLI (SWALL:P34749) (412 aa) fasta scores: E(): 1.1e-14, 28.42% id in 380 aa
YP_108418.1	Similar to Caulobacter crescentus hypothetical 29.8 kDa protein cc2946 SWALL:Q9L718 (EMBL:AF229646) (297 aa) fasta scores: E(): 3.8e-11, 31.46% id in 267 aa, and to Rhizobium loti pilus assembly protein, CpaB mlr5595 SWALL:Q98BF8 (EMBL:AP003007) (271 aa) fasta scores: E(): 9.7e-08, 30.04% id in 253 aa. Note: this CDS is longer in its C-terminal region than most of its database matches
YP_108419.1	Similar to Caulobacter crescentus PilD or cc2947 SWALL:Q9L719 (EMBL:AF229646) (170 aa) fasta scores: E(): 3.4e-05, 36.41% id in 173 aa, and to Rhizobium meliloti probable pilus assembly protein CpaA2 or ra0857 or sma1578 SWALL:Q92YL6 (EMBL:AE007272) (170 aa) fasta scores: E(): 0.038, 30.28% id in 142 aa
YP_108420.1	Similar to Ralstonia solanacearum  pilin protein rsp1092 or rs02598 SWALL:Q8XQX6 (EMBL:AL646082) (58 aa) fasta scores: E(): 0.46, 32.72% id in 55 aa, and to Actinobacillus actinomycetemcomitans Flp-1 protein SWALL:Q8RMW9 (EMBL:AF487931) (75 aa) fasta scores: E(): 0.94, 33.33% id in 57 aa
YP_108421.1	Similar to Xanthomonas axonopodis permease NrtB or xac0827 SWALL:AAM35715 (EMBL:AE011714) (294 aa) fasta scores: E(): 3.2e-63, 63.43% id in 320 aa, and almost full length to Escherichia coli  aliphatic sulfonates transport permease SsuC or b0934 SWALL:SSUC_ECOLI (SWALL:P75851) (263 aa) fasta scores: E(): 7.2e-17, 30.15% id in 252 aa
YP_108422.1	Similar to Pseudomonas aeruginosa probable ATP-binding component of ABC transporter pa2308 SWALL:Q9I1G7 (EMBL:AE004657) (282 aa) fasta scores: E(): 9.4e-60, 68.47% id in 276 aa, and to Synechococcus sp. nitrate transport ATP-binding protein NrtD SWALL:NRTD_SYNP7 (SWALL:P38046) (274 aa) fasta scores: E(): 1.2e-27, 43.29% id in 231 aa
YP_108423.1	Similar to Pseudomonas aeruginosa hypothetical protein pa2309 SWALL:Q9I1G6 (EMBL:AE004657) (340 aa) fasta scores: E(): 5.5e-85, 66.37% id in 339 aa, and to Xanthomonas campestris ABC transporter substrate binding protein xcc0774 SWALL:AAM40089 (EMBL:AE012177) (347 aa) fasta scores: E(): 5.6e-85, 68.51% id in 324 aa
YP_108424.1	Similar to Ralstonia solanacearum alpha-ketoglutarate permease transmembrane protein rsp0075 or rs05546 SWALL:Q8XTN1 (EMBL:AL646076) (437 aa) fasta scores: E(): 2.2e-144, 84.68% id in 431 aa, and to Escherichia coli alpha-ketoglutarate permease KgtP or WitA or b2587 SWALL:KGTP_ECOLI (SWALL:P17448) (432 aa) fasta scores: E(): 4.9e-116, 71.49% id in 414 aa
YP_108425.1	Similar to Pseudomonas aeruginosa hypothetical protein pa0586 SWALL:Q9I5V1 (EMBL:AE004494) (517 aa) fasta scores: E(): 1.3e-141, 67.69% id in 486 aa, and to Escherichia coli hypothetical protein YcgB or b1188 SWALL:YCGB_ECOLI (SWALL:P29013) (510 aa) fasta scores: E(): 8.4e-137, 64.12% id in 499 aa
YP_108426.1	Similar to Pseudomonas aeruginosa hypothetical protein pa0587 SWALL:Q9I5V0 (EMBL:AE004494) (423 aa) fasta scores: E(): 1.6e-89, 55.1% id in 421 aa, and to Escherichia coli hypothetical protein YeaH or b1784 SWALL:YEAH_ECOLI (SWALL:P76235) (427 aa) fasta scores: E(): 2.6e-86, 53.81% id in 420 aa
YP_108427.1	Similar to Pseudomonas aeruginosa hypothetical protein pa0588 SWALL:Q9I5U9 (EMBL:AE004495) (640 aa) fasta scores: E(): 1.2e-195, 79.03% id in 639 aa, and to Escherichia coli, and Escherichia coli O157:H7 hypothetical protein YeaG or b1783 or z2823 or ecs2492 SWALL:YEAG_ECOLI (SWALL:P77391) (644 aa) fasta scores: E(): 3.9e-189, 75.15% id in 644 aa
YP_108428.1	Similar to Escherichia coli methyl-accepting chemotaxis protein I Tsr or CheD or b4355 SWALL:MCP1_ECOLI (SWALL:P02942) (551 aa) fasta scores: E(): 1.5e-48, 44.32% id in 546 aa, and to Ralstonia solanacearum probable methyl-accepting chemotaxis I Mcp-I serine chemoreceptor protein transmembrane CheD1 or rsp0507 or rs00386 SWALL:Q8XSG9 (EMBL:AL646079) (600 aa) fasta scores: E(): 4e-66, 50.95% id in 628 aa. Note: Possible alternative start codon at residue 9
YP_108429.1	Similar to Escherichia coli, and Escherichia coli O157:H7 ribokinase RbsK or b3752 or z5253 or ecs4694 SWALL:RBSK_ECOLI (SWALL:P05054) (309 aa) fasta scores: E(): 1.2e-33, 44.4% id in 304 aa, and to Pseudomonas aeruginosa ribokinase RbsK or pa1950 SWALL:Q9I2F4 (EMBL:AE004621) (308 aa) fasta scores: E(): 2.9e-50, 58.49% id in 306 aa
YP_108430.1	Similar to Escherichia coli, and Escherichia coli O157:H7 ribose operon repressor RbsR or b3753 or z5254 or ecs4695 SWALL:RBSR_ECOLI (SWALL:P25551) (329 aa) fasta scores: E(): 5.6e-41, 40.3% id in 330 aa, and to Pseudomonas aeruginosa ribose operon repressor pa1949 SWALL:Q9I2F5 (EMBL:AE004621) (337 aa) fasta scores: E(): 3e-80, 67.16% id in 332 aa
YP_108431.1	Similar to Escherichia coli, and Escherichia coli O157:H7 ribose transport system permease RbsC or b3750 or z5251 or ecs4692 SWALL:RBSC_ECOLI (SWALL:P04984) (321 aa) fasta scores: E(): 5.3e-31, 39.33% id in 300 aa, and to Pseudomonas aeruginosa membrane protein component of ABC ribose transporter pa1948 SWALL:Q9I2F6 (EMBL:AE004621) (332 aa) fasta scores: E(): 1e-84, 78.59% id in 327 aa
YP_108432.1	Similar to Escherichia coli ribose transport ATP-binding protein RbsA or b3749 SWALL:RBSA_ECOLI (SWALL:P04983) (501 aa) fasta scores: E(): 1.9e-55, 41.24% id in 497 aa, and to Pseudomonas aeruginosa ribose transport protein pa1947 SWALL:Q9I2F7 (EMBL:AE004621) (510 aa) fasta scores: E(): 9.6e-112, 70.35% id in 506 aa
YP_108433.1	Similar to Escherichia coli D-ribose-binding periplasmic protein precursor RbsB or RbsP or PrlB or b3751 SWALL:RBSB_ECOLI (SWALL:P02925) (296 aa) fasta scores: E(): 9.3e-15, 31.49% id in 308 aa, and to Pseudomonas aeruginosa binding protein component precursor of ABC ribose transporter pa1946 SWALL:Q9I2F8 (EMBL:AE004621) (319 aa) fasta scores: E(): 1.6e-78, 75.47% id in 314 aa
YP_108434.1	Similar to Escherichia coli transcriptional regulator Cbl or b1987 SWALL:CBL_ECOLI (SWALL:Q47083) (316 aa) fasta scores: E(): 2.1e-60, 54.22% id in 308 aa, and to Ralstonia solanacearum  cys regulon transcriptional activator transcription regulator protein rsc1348 or rs02871 SWALL:Q8XZP7 (EMBL:AL646064) (327 aa) fasta scores: E(): 1.8e-65, 58.8% id in 301 aa
YP_108435.1	Similar to Escherichia coli sulfate transport ATP-binding protein CysA or b2422 SWALL:CYSA_ECOLI (SWALL:P16676) (365 aa) fasta scores: E(): 2.9e-55, 58.65% id in 283 aa, and to Ralstonia solanacearum probable sulfate transport ATP-binding ABC transporter protein rsc1347 or rs02870 SWALL:Q8XZP8 (EMBL:AL646064) (372 aa) fasta scores: E(): 2.3e-69, 62.92% id in 356 aa
YP_108436.1	Similar to Escherichia coli sulfate transport system permease CysW or b2423 SWALL:CYSW_ECOLI (SWALL:P16702) (291 aa) fasta scores: E(): 4.2e-56, 54.65% id in 258 aa, and to Burkholderia cepacia CysW SWALL:Q93DX9 (EMBL:AF374458) (314 aa) fasta scores: E(): 5e-98, 90.31% id in 289 aa. Note: This CDS is shorter in its N-terminal region than most of its database matches
YP_108437.1	Similar to Escherichia coli sulfate transport system permease CysT or CysU or b2424 SWALL:CYST_ECOLI (SWALL:P16701) (277 aa) fasta scores: E(): 1.1e-50, 48.52% id in 272 aa, and to Ralstonia solanacearum  sulfate transport ABC transporter protein rsc1345 or rs02868 SWALL:Q8XZQ0 (EMBL:AL646064) (304 aa) fasta scores: E(): 1.2e-72, 68.38% id in 291 aa
YP_108438.1	Similar to Escherichia coli sulfate-binding protein precursor Sbp or b3917 SWALL:SUBI_ECOLI (SWALL:P06997) (329 aa) fasta scores: E(): 8.9e-85, 65.01% id in 323 aa, and to Ralstonia solanacearum probable sulfate-binding precursor signal peptide protein rsc1336 or rs02858 SWALL:Q8XZQ9 (EMBL:AL646064) (336 aa) fasta scores: E(): 2.2e-92, 70.76% id in 325 aa
YP_108439.1	Represses a number of genes involved in the response to DNA damage
YP_108442.1	Similar to Sulfolobus solfataricus hypothetical protein sso2778 SWALL:Q97V57 (EMBL:AE006871) (139 aa) fasta scores: E(): 9.9e-07, 25.36% id in 138 aa, and to Methanosarcina acetivorans universal stress protein ma2512 SWALL:Q8TMY3 (EMBL:AE010945) (154 aa) fasta scores: E(): 2.4e-06, 24.63% id in 138 aa. Note: Possible alternative start codon 10 residues upstream of annotated one
YP_108443.1	involved in the export of lipooligosaccharides during nodulation
YP_108444.1	Similar to Ralstonia solanacearum  transmembrane permease ABC transporter protein rsc1975 or rs03549 SWALL:Q8XXY8 (EMBL:AL646067) (274 aa) fasta scores: E(): 2.5e-62, 63.6% id in 272 aa, and to Rhizobium sp. nodulation protein J NodJ SWALL:NODJ_RHIS3 (SWALL:P72336) (262 aa) fasta scores: E(): 3.9e-61, 64.72% id in 258 aa
YP_108446.1	Similar to Escherichia coli hypothetical protein YraQ or b3151 SWALL:YRAQ_ECOLI (SWALL:P45468) (346 aa) fasta scores: E(): 1.7e-59, 52.45% id in 347 aa, and to Methanosarcina mazei conserved protein mm2245 SWALL:AAM31941 (EMBL:AE013466) (299 aa) fasta scores: E(): 1e-10, 27.94% id in 272 aa
YP_108447.1	Similar to Pseudomonas aeruginosa probable oxidoreductase pa4434 SWALL:Q9HVY1 (EMBL:AE004857) (345 aa) fasta scores: E(): 2.3e-78, 58% id in 350 aa, and to Escherichia coli Tas protein or b2834 SWALL:TAS_ECOLI (SWALL:Q46933) (346 aa) fasta scores: E(): 4.6e-75, 56.28% id in 350 aa
YP_108448.1	Similar to Ralstonia solanacearum hypothetical protein rsc3389 or rs05670 SWALL:Q8XU05 (EMBL:AL646075) (182 aa) fasta scores: E(): 1.9e-22, 63.3% id in 109 aa, and to Deinococcus radiodurans hypothetical protein dra0017 SWALL:Q9RZD5 (EMBL:AE001862) (168 aa) fasta scores: E(): 3.8e-16, 41.25% id in 143 aa
YP_108449.1	Similar to Pseudomonas aeruginosa hypothetical protein pa2713 SWALL:Q9I0C9 (EMBL:AE004699) (159 aa) fasta scores: E(): 1.4e-39, 62.41% id in 149 aa, and to Ralstonia solanacearum hypothetical protein rsp1119 or rs05500 SWALL:Q8XQU9 (EMBL:AL646083) (162 aa) fasta scores: E(): 2.9e-28, 45.62% id in 160 aa
YP_108450.1	Similar to Ralstonia solanacearum  glutamate symport transmembrane protein rsc1957 or rs03531 SWALL:Q8XY06 (EMBL:AL646067) (428 aa) fasta scores: E(): 7.2e-90, 57.34% id in 429 aa, and to Caulobacter crescentus sodium:dicarboxylate symporter family protein cc0263 SWALL:Q9ABG4 (EMBL:AE005699) (417 aa) fasta scores: E(): 9e-89, 60.04% id in 418 aa, and to Bacillus subtilis C4-dicarboxylate transport protein DctA or DctP SWALL:DCTA_BACSU (SWALL:P96603) (421 aa) fasta scores: E(): 6e-52, 37.01% id in 416 aa
YP_108451.1	Similar to Ralstonia solanacearum hypothetical protein rsc1299 or rs02821 SWALL:Q8XZU6 (EMBL:AL646063) (344 aa) fasta scores: E(): 3.1e-97, 72.61% id in 336 aa, and to Salmonella typhi hypothetical protein sty4439 SWALL:Q8Z1T1 (EMBL:AL627282) (332 aa) fasta scores: E(): 3.9e-73, 58.56% id in 321 aa
YP_108454.1	Similar to Clostridium pasteurianum molybdenum-pterin binding protein II MopII SWALL:MOP2_CLOPA (SWALL:P08854) (68 aa) fasta scores: E(): 2.8e-05, 47.82% id in 69 aa, and to Ralstonia solanacearum molybdopterin-binding protein rsc1342 or rs02864 SWALL:Q8XZQ3 (EMBL:AL646064) (71 aa) fasta scores: E(): 6.9e-19, 80.28% id in 71 aa
YP_108455.1	Similar to Escherichia coli, and Escherichia coli O157:H7  aliphatic sulfonates transport ATP-binding protein SsuB or b0933 or z1281 or ecs1016 SWALL:SSUB_ECOLI (SWALL:P38053) (255 aa) fasta scores: E(): 4.6e-42, 62% id in 229 aa, and to Ralstonia solanacearum  aliphatic sulfonates ATP-binding ABC transporter protein rsc1341 or rs02863 SWALL:Q8XZQ4 (EMBL:AL646064) (284 aa) fasta scores: E(): 2.8e-48, 58.3% id in 283 aa. Note: this CDS is longer in its N-terminal region than most of its database matches. Possible alternative start codon at residue 55
YP_108456.1	Similar to Escherichia coli  aliphatic sulfonates transport permease SsuC or b0934 SWALL:SSUC_ECOLI (SWALL:P75851) (263 aa) fasta scores: E(): 4.1e-63, 66.66% id in 246 aa, and to Ralstonia solanacearum  aliphatic sulfonates transmembrane ABC transporter protein rsc1340 or rs02862 SWALL:Q8XZQ5 (EMBL:AL646064) (264 aa) fasta scores: E(): 5.8e-67, 71.82% id in 252 aa
YP_108457.1	catalyzes the release of sulfite from alkanesulfonates
YP_108459.1	catalyzes the formation of 3-hydroxy-2-methylpropanoate from 3-hydroxy-2-methylpropanoyl-CoA
YP_108460.1	Similar to Escherichia coli, Salmonella typhimurium, and Pseudomonas aeruginosa  ethidium bromide resistance protein Ebr or E1 SWALL:EBR_ECOLI (SWALL:P14502) (115 aa) fasta scores: E(): 1.7e-16, 53% id in 100 aa, and to the plasmid borne Escherichia coli, and Klebsiella aerogenes quaternary ammonium compound-resistance protein QacE SWALL:QACE_ECOLI (SWALL:Q57225) (110 aa) fasta scores: E(): 1.3e-20, 58.18% id in 110 aa
YP_108461.1	Similar to Rhizobium meliloti hypothetical protein r02983 or smc03110 SWALL:YT83_RHIME (SWALL:P29953) (164 aa) fasta scores: E(): 3.3e-26, 51.85% id in 162 aa, and to Streptomyces coelicolor hypothetical protein sco2848 or sce20.22 SWALL:Q9RDA3 (EMBL:AL136058) (158 aa) fasta scores: E(): 1.1e-20, 50% id in 142 aa
YP_108462.1	Similar to Ralstonia solanacearum hypothetical protein rsc1618 or rs03981 SWALL:Q8XYY8 (EMBL:AL646065) (195 aa) fasta scores: E(): 2.6e-54, 71.19% id in 184 aa, and to Pseudomonas aeruginosa hypothetical protein pa3755 SWALL:Q9HXP0 (EMBL:AE004794) (184 aa) fasta scores: E(): 4.4e-46, 65.08% id in 169 aa
YP_108463.1	leucyltransferase; phenylalanyltransferse; functions in the N-end rule pathway; transfers Leu, Phe, Met, from aminoacyl-tRNAs to N-terminal of proteins with Arg or Lys
YP_108464.1	Conjugates Arg from its aminoacyl-tRNA to the N-termini of proteins containing an N-terminal aspartate or glutamate
YP_108465.1	catalyzes the conversion of dihydroorotate to orotate in the pyrimidine biosynthesis pathway; uses a flavin nucleotide as an essential cofactor; class 2 enzymes are monomeric and compared to the class 1 class 2 possess an extended N terminus, which plays a role in the membrane association of the enzyme and provides the binding site for the respiratory quinones that serve as physiological electron acceptors
YP_108466.1	Similar to Escherichia coli cystine-binding periplasmic protein precursor FliY or b1920 SWALL:FLIY_ECOLI (SWALL:P39174) (266 aa) fasta scores: E(): 5.1e-35, 42.1% id in 266 aa, and to Pseudomonas aeruginosa probable binding protein component of ABC transporter pa0314 SWALL:Q9I6H7 (EMBL:AE004469) (256 aa) fasta scores: E(): 8.7e-54, 57.97% id in 257 aa, and to
YP_108467.1	Similar to Brucella suis 1330 amino acid ABC transporter permease bra0683 SWALL:AAN33870 (EMBL:AE014564) (226 aa) fasta scores: E(): 1.1e-34, 51.62% id in 215 aa, and to Caulobacter crescentus cystine ABC tranporter, permease,  cc1440 SWALL:Q9A8B4 (EMBL:AE005818) (219 aa) fasta scores: E(): 3.9e-34, 54.46% id in 213 aa
YP_108468.1	Similar to Bacillus subtilis hypothetical oxidoreductase YulF SWALL:YULF_BACSU (SWALL:O05265) (328 aa) fasta scores: E(): 2.3e-25, 33.84% id in 328 aa, and to Streptomyces coelicolor  oxidoreductase sco2285 or scc75a.31 SWALL:Q9RKP3 (EMBL:AL133220) (351 aa) fasta scores: E(): 5.8e-21, 31.49% id in 327 aa. Note: This CDS is longer in its N-terminal region than most of its database matches
YP_108469.1	Similar to Caulobacter crescentus transcriptional regulator, GntR family cc0783 SWALL:Q9AA25 (EMBL:AE005754) (242 aa) fasta scores: E(): 4.1e-18, 36.53% id in 219 aa, and to Streptomyces coelicolor  GntR-famly transcriptional regulator sco1177 or scg11a.08 SWALL:Q9RJZ3 (EMBL:AL133210) (246 aa) fasta scores: E(): 3e-16, 34.07% id in 226 aa. Note: This CDS is shorter in its N-terminal region than most of its database matches
YP_108470.1	Catalyzes D-ribose 5-phosphate --> D-ribulose 5-phosphate in the nonoxidative branch of the pentose phosphate pathway
YP_108471.1	Similar to Escherichia coli probable N-acetylmuramoyl-L-alanine amidase YbjR or b0867 SWALL:YBJR_ECOLI (SWALL:P75820) (276 aa) fasta scores: E(): 4.4e-49, 52.57% id in 272 aa, and to Salmonella typhi N-acetylmuramoyl-L-alanine amidase sty0927 SWALL:Q8Z834 (EMBL:AL627268) (276 aa) fasta scores: E(): 1.6e-45, 49.62% id in 268 aa
YP_108472.1	Similar to Ralstonia solanacearum  tRNA/rRNA methyltransferase rsc1229 or rs02736 SWALL:Q8Y016 (EMBL:AL646063) (249 aa) fasta scores: E(): 3.6e-64, 74.07% id in 243 aa, and to Escherichia coli, and Escherichia coli O157:H7 hypothetical tRNA/rRNA methyltransferase YjfH or b4180 or z5787 or ecs5156 SWALL:YJFH_ECOLI (SWALL:P39290) (243 aa) fasta scores: E(): 2.8e-41, 52.69% id in 241 aa
YP_108473.1	Similar to Escherichia coli ribonuclease R Rnr or VacB or b4179 SWALL:RNR_ECOLI (SWALL:P21499) (813 aa) fasta scores: E(): 7.6e-100, 46.25% id in 828 aa, and to Ralstonia solanacearum probable exoribonuclease RNAse R Rnr or rsc1228 or rs02877 SWALL:Q8Y017 (EMBL:AL646063) (871 aa) fasta scores: E(): 1.3e-208, 69.3% id in 808 aa. Note: Possible alternative start codon at residue 16
YP_108474.1	Similar to Ralstonia solanacearum  methyl-accepting chemotaxis transducer transmembrane protein rsp1027 or rs02364 SWALL:Q8XR41 (EMBL:AL646082) (524 aa) fasta scores: E(): 2.6e-50, 41.45% id in 550 aa, and C-terminail region similar to C-terminal region of Escherichia coli methyl-accepting chemotaxis protein I Tsr or CheD or b4355 SWALL:MCP1_ECOLI (SWALL:P02942) (551 aa) fasta scores: E(): 9.8e-47, 50% id in 338 aa. Note: C-terminal region also smilar to C-terminal region of BPSL1829 (635 aa) fasta scores: E(): 1.7e-48, 49.231% identity in 390 aa overlap
YP_108475.1	Similar to Arabidopsis thaliana  phospholipase t12j13.18 or t21p5.4 SWALL:Q9S816 (EMBL:AC009327) (521 aa) fasta scores: E(): 3.4e-32, 30.87% id in 502 aa, and to Sulfolobus solfataricus acid phosphatase,  sso2789 SWALL:Q97V43 (EMBL:AE006873) (511 aa) fasta scores: E(): 5.1e-08, 25.63% id in 476 aa
YP_108476.1	Similar to Rhizobium etli hypothetical protein yh037 SWALL:AAM54971 (EMBL:U80928) (540 aa) fasta scores: E(): 4.9e-19, 30.4% id in 500 aa
YP_108477.1	Similar to Ralstonia solanacearum  sulfate transporter transmembrane protein rsp1519 or rs04796 SWALL:Q8XPW7 (EMBL:AL646085) (567 aa) fasta scores: E(): 5e-146, 73.22% id in 564 aa, and to Corynebacterium glutamicum sulfate permease and related transporters cgl1051 SWALL:BAB98444 (EMBL:AP005277) (579 aa) fasta scores: E(): 1.4e-38, 28.59% id in 514 aa
YP_108478.1	Similar to Rhizobium loti hypothetical protein mlr0735 SWALL:Q98M47 (EMBL:AP002995) (207 aa) fasta scores: E(): 1.3e-36, 50.77% id in 193 aa, and to Ralstonia solanacearum hypothetical protein rsc0706 or rs05147 SWALL:Q8Y1I4 (EMBL:AL646060) (218 aa) fasta scores: E(): 1.4e-33, 47.64% id in 191 aa
YP_108479.1	Similar to Caulobacter crescentus acetyltransferase, GNAT family cc0213 SWALL:Q9ABL4 (EMBL:AE005695) (182 aa) fasta scores: E(): 1e-12, 37.74% id in 151 aa, and to Bacillus subtilis hypothetical protein YkkB SWALL:YKKB_BACSU (SWALL:P49855) (172 aa) fasta scores: E(): 4.1e-08, 33.33% id in 150 aa
YP_108480.1	Similar to Salmonella typhi  metabolite transport protein sty0387 SWALL:Q8Z914 (EMBL:AL627266) (417 aa) fasta scores: E(): 7.5e-95, 58.35% id in 401 aa, and to Escherichia coli hypothetical metabolite transport protein YjhB or b4279 SWALL:YJHB_ECOLI (SWALL:P39352) (405 aa) fasta scores: E(): 5.1e-29, 27.91% id in 394 aa
YP_108481.1	Similar to Ralstonia solanacearum  transcription regulator protein rsc0538 or rs04928 SWALL:Q8Y1Z9 (EMBL:AL646059) (340 aa) fasta scores: E(): 2.4e-36, 48.06% id in 310 aa, and to the N-terminal region of Xanthomonas campestris transcriptional regulator TetR family PsrA or xcc1980 SWALL:AAM41269 (EMBL:AE012302) (210 aa) fasta scores: E(): 5.7e-15, 45.5% id in 167 aa
YP_108482.1	Similar to Escherichia coli long-chain-fatty-acid--CoA ligase FadD or OldD or b1805 SWALL:LCFA_ECOLI (SWALL:P29212) (561 aa) fasta scores: E(): 1e-118, 55.59% id in 563 aa, and to Yersinia pestis KIM acyl-CoA synthetase FadD SWALL:AAM85796 (EMBL:AE013826) (579 aa) fasta scores: E(): 4.9e-120, 57.7% id in 558 aa
YP_108483.1	Similar to Ralstonia solanacearum probable lipoprotein transmembrane rsc0534 or rs04934 SWALL:Q8Y203 (EMBL:AL646059) (298 aa) fasta scores: E(): 1.2e-37, 39.31% id in 290 aa
YP_108484.1	Similar to Ralstonia solanacearum probable signal peptide protein rsp0708 or rs01741 SWALL:Q8XRX3 (EMBL:AL646080) (106 aa) fasta scores: E(): 0.00013, 41.12% id in 107 aa
YP_108485.1	N-terminal region is similar to Escherichia coli, and Escherichia coli O157:H7 Hfq protein or b4172 or z5779 or ecs5148 SWALL:HFQ_ECOLI (SWALL:P25521) (101 aa) fasta scores: E(): 1.5e-07, 50.66% id in 75 aa, and to Pseudomonas syringae Hfq protein PSPTO4942 SWALL:HFQ_PSESM (SWALL:Q87VJ4) (86 aa) fasta scores: E(): 0.0038, 46.98% id in 83 aa. CDS lacks an appropriate stop codon and is extended at the the C-terminus in comparison to orthologues. C-terminal region of the CDS contains a repeat region. Possible pseudogene, the effect the sequence extension on the function of the protein is not known
YP_108486.1	Similar to Ralstonia solanacearum  lipoprotein rsp1078 or rs02585 SWALL:Q8XQZ0 (EMBL:AL646082) (248 aa) fasta scores: E(): 4.3e-20, 42.62% id in 251 aa
YP_108487.1	Similar to Ralstonia solanacearum probable sigma-54 interacting transcription regulator protein rsp1079 or rs02586 SWALL:Q8XQY9 (EMBL:AL646082) (467 aa) fasta scores: E(): 2.4e-101, 58.35% id in 461 aa, and C-terminal region to the C-terminal region of Pseudomonas aeruginosa type 4 fimbriae expression regulatory protein PilR or pa4547 SWALL:PILR_PSEAE (SWALL:Q00934) (445 aa) fasta scores: E(): 2e-36, 40.05% id in 352 aa
YP_108488.1	Similar to Ralstonia solanacearum probable transmembrane protein rsp1080 or rs02587 SWALL:Q8XQY8 (EMBL:AL646082) (541 aa) fasta scores: E(): 1e-35, 34.76% id in 584 aa, and to Agrobacterium tumefaciens hypothetical protein atu1609 or agr_c_2962 SWALL:Q8UEZ4 (EMBL:AE009118) (579 aa) fasta scores: E(): 3.8e-06, 25.71% id in 599 aa
YP_108490.1	Similar to Ralstonia solanacearum probable lipoprotein transmembrane rsp1082 or rs02589 SWALL:Q8XQY6 (EMBL:AL646082) (305 aa) fasta scores: E(): 1.6e-10, 44.28% id in 271 aa, and to Pseudomonas aeruginosa hypothetical protein pa4299 SWALL:Q9HWA1 (EMBL:AE004846) (245 aa) fasta scores: E(): 3.5e-05, 33.33% id in 222 aa
YP_108491.1	Similar to Ralstonia solanacearum  tight adherence TadC related transmembrane protein rsp1083 or rs02590 SWALL:Q8XQY5 (EMBL:AL646082) (326 aa) fasta scores: E(): 1.2e-44, 47.18% id in 337 aa, and to Rhizobium meliloti hypothetical transmembrane protein r00146 or smc02822 SWALL:Q92T37 (EMBL:AL591782) (327 aa) fasta scores: E(): 1e-06, 24.52% id in 318 aa
YP_108492.1	Similar to Ralstonia solanacearum probable pilus assembly transmembrane protein rsp1084 or rs02591 SWALL:Q8XQY4 (EMBL:AL646082) (308 aa) fasta scores: E(): 1.5e-31, 38.62% id in 334 aa, and to Chlorobium tepidum TadD protein or ct0435 SWALL:AAM71681 (EMBL:AE012821) (305 aa) fasta scores: E(): 2.3e-09, 25.48% id in 259 aa
YP_108493.1	Similar to Ralstonia solanacearum probable secretion ATPase CpaF2 or rsp1085 or rs02592 SWALL:Q8XQY3 (EMBL:AL646082) (450 aa) fasta scores: E(): 7.2e-134, 78.54% id in 452 aa, and to Agrobacterium tumefaciens component of type IV pilus CtpG or atu0218 or agr_c_373 SWALL:Q8UIS4 (EMBL:AE008995) (491 aa) fasta scores: E(): 6.2e-62, 42.48% id in 426 aa
YP_108494.1	Similar to the plasmid borne Ralstonia solanacearum probable pilus assembly protein rsp1086 or rs02593 SWALL:Q8XQY2 (EMBL:AL646082) (439 aa) fasta scores: E(): 8.5e-50, 43% id in 400 aa, and to Caulobacter crescentus pilus assembly protein cc2943 SWALL:Q9A495 (EMBL:AE005958) (517 aa) fasta scores: E(): 5e-10, 24.4% id in 377 aa
YP_108495.1	Similar to Ralstonia solanacearum probable outer membrane channel signal peptide protein rsp1087 or rs02594 SWALL:Q8XQY1 (EMBL:AL646082) (454 aa) fasta scores: E(): 1.6e-75, 52.21% id in 452 aa, and to Rhizobium loti pilus assembly protein mll6479 SWALL:Q989D0 (EMBL:AP003009) (481 aa) fasta scores: E(): 1.7e-27, 32.5% id in 400 aa
YP_108496.1	Similar to the palsmid borne Ralstonia solanacearum probable signal peptide protein rsp1089 or rs02596 SWALL:Q8XQX9 (EMBL:AL646082) (208 aa) fasta scores: E(): 2.2e-15, 40.9% id in 198 aa, and to Rhizobium meliloti probable CpaB2 pilus assembly protein or ra0856 or sma1576 SWALL:Q92YL7 (EMBL:AE007272) (263 aa) fasta scores: E(): 2e-05, 29.83% id in 238 aa
YP_108497.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein rsp1090 or rs02595 SWALL:Q8XQX8 (EMBL:AL646082) (163 aa) fasta scores: E(): 1.9e-14, 43.5% id in 154 aa, and to Pseudomonas aeruginosa hypothetical protein pa4294 SWALL:Q9HWA6 (EMBL:AE004845) (168 aa) fasta scores: E(): 2.6e-05, 33.11% id in 151 aa
YP_108498.1	Similar to the plasmid borne Ralstonia solanacearum probable prepilin peptidase transmembrane protein CpaA2 or rsp1091 or rs02612 SWALL:Q8XQX7 (EMBL:AL646082) (168 aa) fasta scores: E(): 8.9e-11, 38.88% id in 162 aa, and to the C-terminal region of Escherichia coli type 4 prepilin-like proteins leader peptide processing enzyme [includes: leader peptidase (prepilin peptidase); n- methyltransferase HofD or HopD or HopO or b3335 SWALL:LEP4_ECOLI (SWALL:P25960) (225 aa) fasta scores: E(): 0.0086, 25.67% id in 148 aa
YP_108499.1	Similar to Rhizobium meliloti probable pilus assembly protein PilA2 or ra0853 or sma1570 SWALL:Q92YM0 (EMBL:AE007272) (56 aa) fasta scores: E(): 2.4e-07, 54.71% id in 53 aa, and to Caulobacter crescentus PilA or cc2948 SWALL:Q9L720 (EMBL:AF229646) (59 aa) fasta scores: E(): 1.2e-05, 48.21% id in 56 aa
YP_108501.1	Similar to Ralstonia solanacearum hemagglutinin-related transmembrane protein rsp1094 or rs02600 SWALL:Q8XQX4 (EMBL:AL646082) (459 aa) fasta scores: E(): 9.5e-39, 45.26% id in 517 aa. Note: Contains a high glycine and serine amino acid residues content region in the N-terminal region and 3x repeat in the C-terminal region (VSTVTGALSGATGG). Also similar to BPSS1974 (573 aa) fasta scores: E(): 3.2e-43, 48.289% identity in 526 aa overlap
YP_108502.1	Similar to Ralstonia solanacearum hemagglutinin-related transmembrane protein rsp1094 or rs02600 SWALL:Q8XQX4 (EMBL:AL646082) (459 aa) fasta scores: E(): 6.2e-32, 43.89% id in 426 aa. Note: Also similar to BPSL1901 (558 aa) fasta scores: E(): 1.6e-34, 45.366% identity in 410 aa overlap
YP_108503.1	Similar to Ralstonia solanacearum probable activation/secretion signal peptide protein rsp1095 or rs02601 SWALL:Q8XQX3 (EMBL:AL646082) (557 aa) fasta scores: E(): 1.8e-89, 45.21% id in 564 aa, and to Haemophilus influenzae heme/hemopexin utilization protein B precursor HxuB SWALL:HXB2_HAEIN (SWALL:P45356) (565 aa) fasta scores: E(): 7.5e-11, 20.52% id in 531 aa
YP_108504.1	Similar to Ralstonia solanacearum hypothetical signal peptide protein rsc2798 or rs05621 SWALL:Q8XVN2 (EMBL:AL646071) (152 aa) fasta scores: E(): 3.8e-26, 58.04% id in 143 aa, and to Xanthomonas campestris hypothetical protein xcc1341 SWALL:AAM40639 (EMBL:AE012233) (159 aa) fasta scores: E(): 1.5e-24, 50.99% id in 151 aa
YP_108505.1	Similar to Rhizobium loti transposase mlr9643 SWALL:Q98P22 (EMBL:AP003017) (127 aa) fasta scores: E(): 1.8e-11, 34.82% id in 112 aa, and to Agrobacterium tumefaciens hypothetical 15.7 kDa protein SWALL:Q44424 (EMBL:M55562) (137 aa) fasta scores: E(): 2e-11, 35.71% id in 112 aa
YP_108506.1	Similar to Ralstonia solanacearum hypothetical protein rsc1272 or rs02810 SWALL:Q8XZX3 (EMBL:AL646063) (365 aa) fasta scores: E(): 1.1e-121, 80% id in 365 aa, and to Neisseria meningitidis  nucleotide-binding protein nma1520 or nmb1306 SWALL:Q9JRK2 (EMBL:AL162756) (383 aa) fasta scores: E(): 1.7e-64, 47.72% id in 352 aa
YP_108507.1	E3 component of 2-oxoglutarate dehydrogenase complex; catalyzes the oxidation of dihydrolipoamide to lipoamide
YP_108508.1	component of 2-oxoglutarate dehydrogenase complex; catalyzes the transfer of succinyl coenzyme A to form succinyl CoA as part of the conversion of 2-oxoglutarate to succinyl-CoA
YP_108509.1	SucA; E1 component of the oxoglutarate dehydrogenase complex which catalyzes the formation of succinyl-CoA from 2-oxoglutarate; SucA catalyzes the reaction of 2-oxoglutarate with dihydrolipoamide succinyltransferase-lipoate to form dihydrolipoamide succinyltransferase-succinyldihydrolipoate and carbon dioxide
YP_108510.1	Similar to Thermoanaerobacter tengcongensis transposase TTE0846 SWALL:Q8RBH2 (EMBL:AE013051) (492 aa) fasta scores: E(): 4.3e-74, 43.54% id in 457 aa, and to Pseudomonas sp.  transposase TnpA SWALL:Q936Y1 (EMBL:U66917) (456 aa) fasta scores: E(): 1.5e-32, 30.88% id in 476 aa
YP_108511.1	Similar to Escherichia coli GTP-binding protein TypA or BipA or b3871 SWALL:TYPA_ECOLI (SWALL:P32132) (591 aa) fasta scores: E(): 3.3e-139, 65.7% id in 592 aa, and to Ralstonia solanacearum probable GTP-binding elongation factor protein rsc1296 or rs02818 SWALL:Q8XZU9 (EMBL:AL646063) (606 aa) fasta scores: E(): 3.2e-185, 84.71% id in 602 aa
YP_108512.1	Similar to Ralstonia solanacearum  transcription regulator protein rsc1295 or rs02817 SWALL:Q8XZV0 (EMBL:AL646063) (147 aa) fasta scores: E(): 8.6e-20, 48.5% id in 134 aa, and to Burkholderia pseudomallei hypothetical 18.0 kDa protein SWALL:Q9ZF73 (EMBL:AF110185) (163 aa) fasta scores: E(): 4.1e-13, 34.02% id in 144 aa
YP_108513.1	Similar to Ralstonia solanacearum  outer membrane chanel lipoprotein rsc1294 or rs02807 SWALL:Q8XZV1 (EMBL:AL646063) (489 aa) fasta scores: E(): 1.9e-77, 48.72% id in 470 aa, and to Xanthomonas axonopodis outer membrane efflux protein YjcP or xac1444 SWALL:AAM36315 (EMBL:AE011776) (496 aa) fasta scores: E(): 6.1e-56, 38.46% id in 481 aa
YP_108514.1	Similar to Escherichia coli multidrug resistance protein A EmrA or b2685 SWALL:EMRA_ECOLI (SWALL:P27303) (390 aa) fasta scores: E(): 1e-62, 49.74% id in 390 aa, and to Ralstonia solanacearum probable multidrug resistance A EmrA or rsc1293 or rs02806 SWALL:Q8XZV2 (EMBL:AL646063) (428 aa) fasta scores: E(): 1.2e-87, 63.48% id in 408 aa
YP_108515.1	Similar to Escherichia coli, and Escherichia coli O157:H7 multidrug resistance protein B EmrB or b2686 or z3987 or ecs3548 SWALL:EMRB_ECOLI (SWALL:P27304) (512 aa) fasta scores: E(): 7.5e-110, 54.54% id in 506 aa, and to Ralstonia solanacearum probable multidrug resistance B EmrB or rsc1292 or rs02805 SWALL:Q8XZV3 (EMBL:AL646063) (518 aa) fasta scores: E(): 6.8e-144, 67.95% id in 518 aa
YP_108516.1	catalyzes isomerization of specific uridines in RNA to pseudouridine; responsible for residues in T loops of many tRNAs
YP_108517.1	associates with free 30S ribosomal subunits; essential for efficient processing of 16S rRNA; in Escherichia coli rbfA is induced by cold shock
YP_108518.1	Protects formylmethionyl-tRNA from spontaneous hydrolysis and promotes its binding to the 30S ribosomal subunits during initiation of protein synthesis. Also involved in the hydrolysis of GTP during the formation of the 70S ribosomal complex
YP_108519.1	modifies transcription through interactions with RNA polymerase affecting elongation, readthrough, termination, and antitermination
YP_108520.1	in Streptococcus pneumoniae this gene was found to be essential; structure determination of the Streptococcus protein shows that it is similar to a number of other proteins
YP_108521.1	Similar to Ralstonia solanacearum hypothetical protein rsc1286 rsc1286 or rs02799 SWALL:Q8XZV9 (EMBL:AL646063) (598 aa) fasta scores: E(): 5.5e-61, 52.25% id in 576 aa, and central to C-terminal parts to the rest of the database matches, e.g. Escherichia coli O157:H7 orf, hypothetical protein YciL or z2541 or ecs1841 SWALL:Q8X4Q8 (EMBL:AE005380) (290 aa) fasta scores: E(): 4.8e-34, 57.2% id in 250 aa
YP_108522.1	Similar to Ralstonia solanacearum hypothetical protein rsc1285 or rs02798 SWALL:Q8XZW0 (EMBL:AL646063) (304 aa) fasta scores: E(): 5.4e-48, 58.73% id in 315 aa, and to Xanthomonas axonopodis hypothetical protein xac2317 SWALL:Q8PK59 (EMBL:AE011869) (412 aa) fasta scores: E(): 2.4e-25, 36.71% id in 444 aa. Note: From approximately residue 180 this CDS does not present any significant database matches appart from the two described above
YP_108523.1	Similar to Bacillus subtilis transcriptional regulatory protein GltC SWALL:GLTC_BACSU (SWALL:P20668) (300 aa) fasta scores: E(): 4.3e-19, 28.76% id in 299 aa, and to Ralstonia solanacearum probable transcription regulator transcription regulator protein rsc2537 or rs00708 SWALL:Q8XWD7 (EMBL:AL646070) (297 aa) fasta scores: E(): 8.5e-64, 59.45% id in 296 aa
YP_108524.1	Possible gene remnant. No significant database matches to the full length CDS. N-terminus is similar to the N-terminal regions of Shigella flexneri IS1650 protein orfA S0204 SWALL:Q9AFP3 (EMBL:AF348706) (149 aa) fasta scores: E(): 3.7e-07, 38.27% id in 81 aa, and Pantoea agglomerans  transposase A SWALL:Q9AM92 (EMBL:AF327444) (149 aa) fasta scores: E(): 1e-06, 38.27% id in 81 aa
YP_108527.1	Similar to Ralstonia solanacearum probable lipoprotein transmembrane rsc0146 or rs01016 SWALL:Q8Y335 (EMBL:AL646057) (251 aa) fasta scores: E(): 1e-22, 37.71% id in 236 aa, and to Xanthomonas axonopodis hypothetical protein xac1712 SWALL:AAM36579 (EMBL:AE011803) (253 aa) fasta scores: E(): 1.5e-20, 37.13% id in 237 aa
YP_108528.1	Very low similarities to database matches. Similar to Ralstonia solanacearum probable signal peptide protein rsc2280 or rs01277 SWALL:Q8XX38 (EMBL:AL646069) (91 aa) fasta scores: E(): 2.1, 40.44% id in 89 aa
YP_108530.1	Similar to Neisseria meningitidis hypothetical protein nmb1575 SWALL:Q9JYI1 (EMBL:AE002508) (97 aa) fasta scores: E(): 5.4e-11, 38.54% id in 96 aa, and to Yersinia pestis hypothetical protein ypo1588 SWALL:Q8ZFU3 (EMBL:AJ414149) (95 aa) fasta scores: E(): 5e-09, 38.29% id in 94 aa
YP_108531.1	Similar to Bordetella parapertussis transposase for insertion sequence element IS1001 TnpA SWALL:TNPA_BORPA (SWALL:Q06126) (406 aa) fasta scores: E(): 3.6e-138, 78.32% id in 406 aa, and to Burkholderia mallei transposase Tnp SWALL:Q9FDC1 (EMBL:AF285635) (386 aa) fasta scores: E(): 3.8e-162, 99.22% id in 386 aa. CDS is extended at the N-terminus in comparison to B. mallei protein
YP_108532.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc1146 or rs04607 SWALL:Q8Y098 (EMBL:AL646062) (398 aa) fasta scores: E(): 1e-27, 38.98% id in 395 aa, and to Neisseria meningitidis hypothetical protein nmb0928 SWALL:Q9JZR5 (EMBL:AE002444) (398 aa) fasta scores: E(): 9.5e-23, 30.93% id in 417 aa
YP_108535.1	Similar to Pseudomonas aeruginosa hypothetical protein pa5458 SWALL:Q9HTB2 (EMBL:AE004958) (380 aa) fasta scores: E(): 7e-50, 43.84% id in 390 aa, and to Rhizobium loti probable lipopolysaccharide modification acyltransferase mlr0739 SWALL:Q98M44 (EMBL:AP002995) (375 aa) fasta scores: E(): 3.7e-48, 39.84% id in 374 aa
YP_108536.1	Low similarities to database matches. C-terminal region similar to Pseudomonas aeruginosa hypothetical protein pa0349 SWALL:Q9I6E4 (EMBL:AE004472) (346 aa) fasta scores: E(): 4.1e-30, 33.97% id in 362 aa, and N-terminal region to Pseudomonas aeruginosa hypothetical protein pa0348 SWALL:Q9I6E5 (EMBL:AE004472) (364 aa) fasta scores: E(): 1.1e-22, 28.77% id in 344 aa
YP_108537.1	Similar to Ralstonia solanacearum  transcription regulator protein rsc1584 or rs03946 SWALL:Q8XZ22 (EMBL:AL646065) (146 aa) fasta scores: E(): 1e-31, 68.84% id in 138 aa, and to Xanthomonas axonopodis hypothetical protein xac2587 SWALL:AAM37436 (EMBL:AE011899) (118 aa) fasta scores: E(): 2.3e-23, 63.71% id in 113 aa
YP_108538.1	This protein is one of the two subunits of integration host factor, a specific DNA-binding protein that functions in genetic recombination as well as in transcriptional and translational control
YP_108539.1	catalyzes a two-step reaction, first charging a phenylalanine molecule by linking its carboxyl group to the alpha-phosphate of ATP, followed by transfer of the aminoacyl-adenylate to its tRNA; forms a tetramer of alpha(2)beta(2); binds two magnesium ions per tetramer; type 2 subfamily
YP_108540.2	catalyzes a two-step reaction, first charging a phenylalanine molecule by linking its carboxyl group to the alpha-phosphate of ATP, followed by transfer of the aminoacyl-adenylate to its tRNA; forms a heterotetramer of alpha(2)beta(2); binds two magnesium ions per tetramer; type 1 subfamily
YP_108541.1	binds directly to 23S ribosomal RNA prior to in vitro assembly of the 50S ribosomal subunit
YP_108542.1	Similar to Escherichia coli, Escherichia coli O157:H7, Salmonella typhimurium, and Salmonella typhi 50S ribosomal protein L35 RpmI or b1717 or z2746 or ecs2424 or stm1335 or sty1776 SWALL:RL35_ECOLI (SWALL:P07085) (64 aa) fasta scores: E(): 1.1e-07, 53.12% id in 64 aa, and to Ralstonia solanacearum 50S ribosomal protein L35 rsc1579 or rs03941 SWALL:RL35_RALSO (SWALL:Q8XZ27) (65 aa) fasta scores: E(): 9.7e-21, 78.46% id in 65 aa
YP_108543.1	Similar to Escherichia coli, and Escherichia coli O157:H7 translation initiation factor IF-3 InfC or Fit or b1718 or z2747 or ecs2425 SWALL:IF3_ECOLI (SWALL:P02999) (180 aa) fasta scores: E(): 5.5e-41, 69.64% id in 168 aa, and to Ralstonia solanacearum translation initiation factor IF-3 InfC or rsc1578 or rs05788 SWALL:IF3_RALSO (SWALL:Q8XZ28) (178 aa) fasta scores: E(): 3.4e-51, 80.89% id in 178 aa. Note: The initiation codon does not transcribe for a M/V nor for a L
YP_108544.1	catalyzes a two-step reaction, first charging a threonine molecule by linking its carboxyl group to the alpha-phosphate of ATP, followed by transfer of the aminoacyl-adenylate to its tRNA; catalyzes the formation of threonyl-tRNA(Thr) from threonine and tRNA(Thr)
YP_108545.1	Similar to Escherichia coli, and Escherichia coli O157:H7 GTP pyrophosphokinase RelA or b2784 or z4099 or ecs3644 SWALL:RELA_ECOLI (SWALL:P11585) (744 aa) fasta scores: E(): 2.2e-60, 40.99% id in 705 aa, and to Ralstonia solanacearum probable GTP pyrophosphokinase rsc1576 or rs05786 SWALL:Q8XZ30 (EMBL:AL646065) (746 aa) fasta scores: E(): 1.1e-173, 67.96% id in 746 aa, and to Streptomyces coelicolor GTP pyrophosphokinase RelA or sco1513 or scl2.03C SWALL:RELA_STRCO (SWALL:P52560) (847 aa) fasta scores: E(): 1.6e-89, 39.49% id in 747 aa
YP_108546.1	Similar to Xanthomonas campestris hypothetical protein xcc1325 SWALL:AAM40623 (EMBL:AE012231) (115 aa) fasta scores: E(): 1.4e-23, 59.09% id in 110 aa, and to Pseudomonas aeruginosa hypothetical protein pa5303 SWALL:Q9HTQ1 (EMBL:AE004943) (117 aa) fasta scores: E(): 5e-22, 54.78% id in 115 aa
YP_108547.1	Similar to Ralstonia solanacearum  hydrolase rsc1574 or rs05784 SWALL:Q8XZ32 (EMBL:AL646065) (289 aa) fasta scores: E(): 1.5e-71, 64.45% id in 287 aa, and to Acidovorax sp. SA1 d-(-)-3-hydroxybutyrate oligomer hydrolase SWALL:Q9F1T8 (EMBL:AB044565) (291 aa) fasta scores: E(): 1.4e-26, 36.82% id in 296 aa
YP_108548.1	Similar to Brucella melitensis transcriptional regulatory protein, LysR family bmeii1065 SWALL:Q8YB36 (EMBL:AE009739) (325 aa) fasta scores: E(): 5e-45, 47.4% id in 289 aa, and to Agrobacterium tumefaciens transcriptional regulator, LysR family atu0664 or agr_c_1186 SWALL:Q8UHL6 (EMBL:AE009035) (299 aa) fasta scores: E(): 3.6e-40, 42.61% id in 298 aa
YP_108550.1	Similar to Synechocystis sp. hypothetical protein sll1306 SWALL:P73597 (EMBL:D90907) (335 aa) fasta scores: E(): 1.2e-45, 47.55% id in 307 aa, and to Brucella melitensis chitooligosaccharide deacetylase bmei1577 SWALL:Q8YFE5 (EMBL:AE009593) (475 aa) fasta scores: E(): 8.8e-16, 30.32% id in 277 aa
YP_108551.1	Similar to Rhizobium loti probable acyl-carrier protein reductase mlr2047 SWALL:Q98J89 (EMBL:AP002998) (242 aa) fasta scores: E(): 4.3e-28, 42.85% id in 238 aa, and to Streptomyces coelicolor  oxidoreductase sco1831 or sci8.16 SWALL:Q9RJ37 (EMBL:AL132644) (251 aa) fasta scores: E(): 7.2e-15, 36.14% id in 249 aa
YP_108552.1	Similar to Helicobacter pylori succinyl-CoA:3-ketoacid-coenzyme A transferase subunit C ScoB or hp0692 SWALL:SCOB_HELPY (SWALL:P56007) (207 aa) fasta scores: E(): 3.2e-47, 63.41% id in 205 aa, and to Xanthomonas campestris succinyl-CoA:3-ketoacid-coenzyme A transferase subunit B LpsJ or WxcJ or xcc0628 SWALL:SCOB_XANCP (SWALL:O34263) (213 aa) fasta scores: E(): 9.1e-60, 77.51% id in 209 aa
YP_108553.1	Similar to Helicobacter pylori succinyl-CoA:3-ketoacid-coenzyme A transferase subunit A ScoA or hp0691 SWALL:SCOA_HELPY (SWALL:P56006) (232 aa) fasta scores: E(): 6.8e-52, 60.17% id in 231 aa, and to Xanthomonas campestris succinyl-CoA:3-ketoacid-coenzyme A transferase subunit A LpsI or WxcI or xcc0627 SWALL:SCOA_XANCP (SWALL:O34264) (242 aa) fasta scores: E(): 8.2e-73, 80.6% id in 232 aa
YP_108554.1	Similar to Ralstonia solanacearum  transcription regulator protein rsc1569 or rs05256 SWALL:Q8XZ37 (EMBL:AL646065) (181 aa) fasta scores: E(): 5.4e-49, 67.95% id in 181 aa, and to Bradyrhizobium japonicum hypothetical 22.5 kDa protein SWALL:Q93SH9 (EMBL:AJ311165) (206 aa) fasta scores: E(): 0.00023, 28.48% id in 165 aa, and high similarity to the DNA-binding domain of Escherichia coli, and Escherichia coli O157:H7 transcriptional regulatory protein UhpA or b3669 or z5159 or ecs4606 SWALL:UHPA_ECOLI (SWALL:P10940) (196 aa) fasta scores: E(): 0.0076, 42.85% id in 56 aa
YP_108556.1	No significant database matches. Note: Contains the following variable repeat throughout the full length of the CDS: 6x[AASNQFGIPNQTDVFAVXXS/NGA/SLXVA/SWVVSAXXWNGPXXIXXAGXFPA/ S XAXV]
YP_108557.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa2801 pa2801 SWALL:Q9I042 (EMBL:AE004707) (134 aa) fasta scores: E(): 1.2e-18, 41.79% id in 134 aa, and to Xanthomonas campestris hypothetical protein Xcc1147 xcc1147 SWALL:AAM40446 (EMBL:AE012213) (134 aa) fasta scores: E(): 1.6e-12, 35.6% id in 132 aa
YP_108558.1	Similar to Gluconobacter oxydans gluconate 5-dehydrogenase Gno SWALL:GNO_GLUOX (SWALL:P50199) (256 aa) fasta scores: E(): 3.4e-24, 36.9% id in 252 aa, and to Rhodobacter sphaeroides sorbitol dehydrogenase PolS or SmoS SWALL:DHSO_RHOSH (SWALL:Q59787) (256 aa) fasta scores: E(): 6.8e-24, 36.78% id in 261 aa
YP_108559.1	Similar to Acinetobacter calcoaceticus probable electron transfer flavoprotein-ubiquinone oxidoreductase SWALL:ETFD_ACICA (SWALL:P94132) (570 aa) fasta scores: E(): 1.6e-93, 61.97% id in 568 aa, and to Ralstonia solanacearum probable electron transfer flavoprotein-ubiquinone oxidoreductase rsc1567 or rs05254 SWALL:Q8XZ39 (EMBL:AL646065) (562 aa) fasta scores: E(): 4.8e-157, 69.75% id in 562 aa
YP_108560.1	catalyzes the formation of chorismate from 5-O-(1-carboxyvinyl)-3-phosphoshikimate in aromatic amino acid biosynthesis
YP_108561.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc1564 or rs05251 SWALL:Q8XZ42 (EMBL:AL646065) (635 aa) fasta scores: E(): 1.2e-164, 65.45% id in 634 aa, and to Neisseria meningitidis transporter  nmb1515 SWALL:Q9JYM2 (EMBL:AE002501) (436 aa) fasta scores: E(): 2.8e-58, 40.32% id in 429 aa. Note: This CDS is longer in its N-terminal region than most of its database matches
YP_108562.1	Similar to Ralstonia solanacearum hypothetical protein rsc1563 or rs05250 SWALL:Q8XZ43 (EMBL:AL646065) (151 aa) fasta scores: E(): 6.6e-39, 70.66% id in 150 aa, and to Rhizobium loti hypothetical protein mlr0188 SWALL:Q98ND5 (EMBL:AP002994) (143 aa) fasta scores: E(): 1.1e-09, 33.33% id in 141 aa
YP_108563.1	Similar to Ralstonia solanacearum  transmembrane protein rsc1560 or rs05247 SWALL:Q8XZ46 (EMBL:AL646065) (105 aa) fasta scores: E(): 3e-25, 67% id in 100 aa, and to Caulobacter crescentus hypothetical protein cc3163 SWALL:Q9A3N9 (EMBL:AE005980) (208 aa) fasta scores: E(): 2.8e-18, 57.44% id in 94 aa
YP_108564.1	N-terminal region similar to Escherichia coli, and Escherichia coli O157:H7 tRNA processing exoribonuclease BN Rbn or b3886 or z5425 or ecs4809 SWALL:RBN_ECOLI (SWALL:P32146) (290 aa) fasta scores: E(): 9.6e-33, 40.07% id in 257 aa and full length to Ralstonia solanacearum tRNA processing exoribonuclease BN transmembrane protein rsc1559 or rs05246 SWALL:Q8XZ47 (EMBL:AL646065) (441 aa) fasta scores: E(): 6.2e-63, 45.34% id in 430 aa
YP_108565.1	Similar to Escherichia coli flavoprotein (Trp repressor binding protein) WrbA or b1004 SWALL:WRBA_ECOLI (SWALL:P30849) (197 aa) fasta scores: E(): 5.2e-19, 40.3% id in 196 aa, and to Ralstonia solanacearum probable Trp repressor binding protein rsc1558 or rs05245 SWALL:Q8XZ48 (EMBL:AL646065) (201 aa) fasta scores: E(): 3.9e-54, 72.86% id in 199 aa
YP_108566.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc1557 or rs05244 SWALL:Q8XZ49 (EMBL:AL646065) (129 aa) fasta scores: E(): 5.4e-20, 54.76% id in 126 aa, and to Neisseria meningitidis hypothetical protein nma0801 SWALL:Q9JVK4 (EMBL:AL162754) (117 aa) fasta scores: E(): 2.4e-12, 44.54% id in 110 aa. Note: This CDS is longer in its C-terminal region than most of its database matches
YP_108567.1	Similar to Ralstonia solanacearum probable oxidoreductase rsc1556 or rs05243 SWALL:Q8XZ50 (EMBL:AL646065) (470 aa) fasta scores: E(): 1.1e-123, 71.73% id in 467 aa, and to Rhizobium loti  oxidoreductase mlr7440 SWALL:Q986B0 (EMBL:AP003011) (476 aa) fasta scores: E(): 1.7e-87, 52.24% id in 467 aa
YP_108568.1	Similar to Pseudomonas aeruginosa hypothetical protein pa0544 SWALL:Q9I5Z2 (EMBL:AE004490) (247 aa) fasta scores: E(): 1.9e-09, 36.27% id in 317 aa. Note: the central region of BPSL1970 does not present any similarities in the databases
YP_108569.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa3895 SWALL:Q9HXB8 (EMBL:AE004807) (317 aa) fasta scores: E(): 7.9e-76, 63.39% id in 306 aa, and to Klebsiella pneumoniae probable transcriptional regulator LtrA SWALL:LTRA_KLEPN (SWALL:P52689) (309 aa) fasta scores: E(): 3.1e-29, 32.67% id in 303 aa
YP_108570.1	Similar to Burkholderia cepacia fusaric acid resistance protein precursor FusA SWALL:FUSA_BURCE (SWALL:P24126) (530 aa) fasta scores: E(): 5.8e-82, 62.82% id in 538 aa, and to Pseudomonas aeruginosa outer membrane protein OprM precursor or OprK or pa0427 SWALL:OPRM_PSEAE (SWALL:Q51487) (485 aa) fasta scores: E(): 1.2e-19, 28.84% id in 475 aa. Note: Contains a highly conserved repeat at the C-terminal region (from residue 496) that has no similarities to database entries
YP_108571.1	N-terminal region similar to Burkholderia cepacia fusaric acid resistance protein FusB SWALL:FUSB_BURCE (SWALL:P24127) (142 aa) fasta scores: E(): 5.2e-11, 71.23% id in 73 aa, central region to Burkholderia cepacia fusaric acid resistance protein FusC SWALL:FUSC_BURCE (SWALL:P24128) (346 aa) fasta scores: E(): 2.5e-99, 78.77% id in 344 aa, and C-terminal region to Burkholderia cepacia fusaric acid resistance protein FusD fusD SWALL:FUSD_BURCE (SWALL:P24129) (208 aa) fasta scores: E(): 7.6e-54, 75.59% id in 209 aa. Note: Seems to be a fusion of the three CDSs from Burkholderia cepacia
YP_108572.1	Similar to Brucella melitensis hypothetical membrane associated protein bmeii0532 SWALL:Q8YCJ6 (EMBL:AE009689) (69 aa) fasta scores: E(): 0.00012, 40.67% id in 59 aa, and to Salmonella typhimurium, and Salmonella typhi  inner membrane protein YhcR or stm3366 or sty3546A SWALL:Q8XEK3 (EMBL:AE008855) (67 aa) fasta scores: E(): 0.0019, 30.76% id in 52 aa
YP_108573.1	Full length similar to Pseudomonas aeruginosa hypothetical protein pa3892 SWALL:Q9HXC1 (EMBL:AE004806) (302 aa) fasta scores: E(): 3.2e-74, 67.59% id in 287 aa, and to Escherichia coli multidrug resistance protein K EmrK or b2368 SWALL:EMRK_ECOLI (SWALL:P52599) (387 aa) fasta scores: E(): 4.6e-09, 28.35% id in 335 aa, and C-terminal region to Burkholderia cepacia fusaric acid resistance protein FusE SWALL:FUSE_BURCE (SWALL:P24130) (168 aa) fasta scores: E(): 7.1e-46, 81.65% id in 169 aa
YP_108574.1	Similar to Escherichia coli methyl-accepting chemotaxis protein II Tar or CheM or b1886 SWALL:MCP2_ECOLI (SWALL:P07017) (553 aa) fasta scores: E(): 3.5e-50, 41.28% id in 528 aa, and to Ralstonia solanacearum  methyl-accepting chemotaxis transmembrane protein rsc2799 or rs05622 SWALL:Q8XVN1 (EMBL:AL646071) (515 aa) fasta scores: E(): 4.2e-61, 47.82% id in 529 aa. Note: This CDS is longer in its N-terminal region than most of its database matches
YP_108575.1	Similar to Escherichia coli fosmidomycin resistance protein Fsr or b0479 SWALL:FSR_ECOLI (SWALL:P52067) (406 aa) fasta scores: E(): 1.1e-99, 67.48% id in 406 aa, and to Ralstonia solanacearum  fosmidomycin resistance antibiotic resistance transmembrane protein Fsr or rsp0412 or rs00869 SWALL:Q8XSQ5 (EMBL:AL646078) (411 aa) fasta scores: E(): 3.8e-103, 70.85% id in 398 aa
YP_108576.1	enables the cleavage of the glycosidic bond in both 5'-methylthioadenosine and S-adenosylhomocysteine
YP_108577.1	Similar to Escherichia coli DNA helicase II UvrD or MutU or PdeB or Rad or RecL or b3813 SWALL:UVRD_ECOLI (SWALL:P03018) (720 aa) fasta scores: E(): 8.9e-94, 45.2% id in 792 aa, and to Ralstonia solanacearum probable DNA helicase II protein rsc2235 or rs01364 SWALL:Q8XX81 (EMBL:AL646069) (829 aa) fasta scores: E(): 4.8e-211, 68.44% id in 805 aa
YP_108578.1	valine--tRNA ligase; ValRS; converts valine ATP and tRNA(Val) to AMP PPi and valyl-tRNA(Val); class-I aminoacyl-tRNA synthetase type 1 subfamily; has a posttransfer editing process to hydrolyze mischarged Thr-tRNA(Val) which is done by the editing domain
YP_108579.1	Similar to Escherichia coli, Escherichia coli O157:H7, and Shigella flexneri UTP--glucose-1-phosphate uridylyltransferase GalU or b1236 or z2012 or ecs1738 SWALL:GALU_ECOLI (SWALL:P25520) (301 aa) fasta scores: E(): 5.6e-51, 54.82% id in 290 aa, and to Burkholderia pseudomallei  UTP-glucose-1-phosphate uridylyltransferase SWALL:Q9F5N4 (EMBL:AF312223) (295 aa) fasta scores: E(): 2.7e-92, 83.91% id in 286 aa
YP_108580.1	Low similarity to Ralstonia solanacearum probable lipoprotein transmembrane rsc2124 or rs01480 SWALL:Q8XXI9 (EMBL:AL646068) (213 aa) fasta scores: E(): 0.00015, 31.94% id in 216 aa
YP_108581.1	Similar to Pseudomonas aeruginosa probable two-component sensor pa4036 SWALL:Q9HWZ1 (EMBL:AE004820) (766 aa) fasta scores: E(): 1.4e-49, 39.2% id in 806 aa, and to Caulobacter crescentus sensory box histidine kinase,  cc3327 SWALL:Q9A377 (EMBL:AE005994) (761 aa) fasta scores: E(): 1.3e-22, 35.7% id in 801 aa
YP_108582.1	Similar to Caulobacter crescentus peptidoglycan binding domain protein cc3326 SWALL:Q9A378 (EMBL:AE005994) (457 aa) fasta scores: E(): 9.1e-42, 36.19% id in 442 aa, and to Ralstonia solanacearum probable signal peptide protein rsc1074 or rs04113 SWALL:Q8Y0H0 (EMBL:AL646062) (568 aa) fasta scores: E(): 1.1e-24, 30.58% id in 425 aa
YP_108583.1	Similar to Caulobacter crescentus DNA-binding response regulator cc3325 SWALL:Q9A379 (EMBL:AE005994) (236 aa) fasta scores: E(): 1.3e-36, 43.36% id in 226 aa, and to Rhizobium meliloti phosphate regulon transcriptional regulatory protein PhoB or r00515 or smc02140 SWALL:PHOB_RHIME (SWALL:Q52990) (227 aa) fasta scores: E(): 2.8e-20, 34.66% id in 225 aa
YP_108585.1	Similar to Escherichia coli, and Escherichia coli O157:H7 SirA protein or b3470 or z4844 or ecs4319 SWALL:SIRA_ECOLI (SWALL:P37618) (81 aa) fasta scores: E(): 0.00021, 31.88% id in 69 aa, and to Ralstonia solanacearum hypothetical protein rsc0810 or rs05012 SWALL:Q8Y180 (EMBL:AL646061) (75 aa) fasta scores: E(): 3e-20, 73.68% id in 76 aa
YP_108586.1	Similar to Clostridium perfringens probable dehydrogenase cpe0093 SWALL:Q8XP72 (EMBL:AP003185) (349 aa) fasta scores: E(): 5.5e-46, 39.05% id in 338 aa, and to Rhizobium meliloti myo-inositol 2-dehydrogenase IdhA or rb1194 or smb20899 SWALL:MI2D_RHIME (SWALL:O68965) (330 aa) fasta scores: E(): 2.5e-27, 34.21% id in 342 aa. Note: Also similar to the upstream CDS, BPSL1989 (344 aa) fasta scores: E(): 7.2e-29, 35.362% identity in 345 aa overlap
YP_108587.1	Similar to Caulobacter crescentus myo-inositol 2-dehydrogenase cc1296 SWALL:Q9A8Q7 (EMBL:AE005804) (328 aa) fasta scores: E(): 2.1e-58, 49.54% id in 327 aa, and to Rhizobium meliloti myo-inositol 2-dehydrogenase IdhA or rb1194 or smb20899 SWALL:MI2D_RHIME (SWALL:O68965) (330 aa) fasta scores: E(): 1.1e-51, 46.64% id in 328 aa. Note: Also similar to the downstream CDS, BPSL1988 (346 aa) fasta scores: E(): 4.5e-27, 35.362% identity in 345 aa overlap
YP_108588.1	Similar to Ralstonia solanacearum hypothetical protein rsc1249 or rs02757 SWALL:Q8XZZ6 (EMBL:AL646063) (302 aa) fasta scores: E(): 1.1e-44, 47.2% id in 286 aa, and to Caulobacter crescentus sis domain protein cc1297 SWALL:Q9A8Q6 (EMBL:AE005804) (291 aa) fasta scores: E(): 1e-32, 35.88% id in 287 aa
YP_108589.1	Similar to Rhizobium loti probable secreted solute binding protein mll1004 SWALL:Q98LI9 (EMBL:AP002996) (316 aa) fasta scores: E(): 5.6e-29, 32.74% id in 342 aa, and to Escherichia coli D-ribose-binding periplasmic protein precursor RbsB or RbsP or PrlB or b3751 SWALL:RBSB_ECOLI (SWALL:P02925) (296 aa) fasta scores: E(): 3.8e-07, 24.81% id in 270 aa
YP_108590.1	Similar to Rhizobium loti permease of sugar ABC transporter mll1003 SWALL:Q98LJ0 (EMBL:AP002996) (373 aa) fasta scores: E(): 1e-65, 52.86% id in 367 aa, and to Brucella melitensis sugar transport system permease bmei0664 SWALL:Q8YHY1 (EMBL:AE009508) (387 aa) fasta scores: E(): 5.9e-64, 52.39% id in 376 aa
YP_108591.1	Similar to Brucella melitensis sugar transport ATP-binding protein bmei0665 SWALL:Q8YHY0 (EMBL:AE009508) (259 aa) fasta scores: E(): 1.3e-50, 58.55% id in 263 aa, and to Rhizobium loti ATP-binding protein of sugar ABC transporter mlr2442 SWALL:Q98IE2 (EMBL:AP002999) (264 aa) fasta scores: E(): 6.2e-50, 63.05% id in 249 aa
YP_108592.1	Similar to Ralstonia solanacearum probable transferase kinase rsc1240 or rs02748 SWALL:Q8Y005 (EMBL:AL646063) (650 aa) fasta scores: E(): 3.1e-139, 57.25% id in 655 aa, and N-trminal region to Bacillus subtilis protein IolC or e83c SWALL:IOLC_BACSU (SWALL:P42414) (325 aa) fasta scores: E(): 2.1e-17, 28.57% id in 343 aa
YP_108593.1	Similar to Ralstonia solanacearum  acetolactate synthase rsc1239 or rs02747 SWALL:Q8Y006 (EMBL:AL646063) (627 aa) fasta scores: E(): 4e-135, 62.88% id in 625 aa, and to Bacillus subtilis probable malonic semialdehyde oxidative decarboxylase IolD or e83d SWALL:IOLD_BACSU (SWALL:P42415) (580 aa) fasta scores: E(): 3.4e-43, 40.82% id in 583 aa, and to Spirulina platensis acetolactate synthase IlvY SWALL:ILVB_SPIPL (SWALL:P27868) (579 aa) fasta scores: E(): 3.1e-22, 28.51% id in 540 aa
YP_108594.1	Similar to Yersinia pestis hypothetical protein ypo2586 SWALL:Q8ZDI2 (EMBL:AJ414152) (306 aa) fasta scores: E(): 3e-62, 56.94% id in 288 aa, and to Rhizobium meliloti rhizopine catabolism protein MocC SWALL:MOCC_RHIME (SWALL:P49304) (325 aa) fasta scores: E(): 1.1e-54, 50.85% id in 291 aa
YP_108595.1	Similar to Ralstonia solanacearum  myo-inositol catabolism protein rsc1237 or rs02745 SWALL:Q8Y008 (EMBL:AL646063) (271 aa) fasta scores: E(): 1.6e-60, 60.83% id in 263 aa, and to Bacillus subtilis protein IolB or e83b SWALL:IOLB_BACSU (SWALL:P42413) (271 aa) fasta scores: E(): 2.3e-41, 46.61% id in 251 aa
YP_108596.1	Similar to Pseudomonas aeruginosa high-affinity branched-chain amino acid transport ATP-binding protein BraG or pa1070 SWALL:BRAG_PSEAE (SWALL:P21630) (233 aa) fasta scores: E(): 2.1e-19, 36.36% id in 220 aa, and to Brucella melitensis high-affinity branched-chain amino acid transport ATP-binding protein bmeii0065 SWALL:Q8YDV9 (EMBL:AE009645) (238 aa) fasta scores: E(): 3.4e-28, 45.29% id in 234 aa
YP_108597.1	N-terminal region similar to Ralstonia solanacearum probable amino acid transport system permease lipoprotein transmembrane rsc1752 or rs02940 SWALL:Q8XYK6 (EMBL:AL646066) (440 aa) fasta scores: E(): 1.9e-34, 46.79% id in 421 aa, and C-terminal region similar to Ralstonia solanacearum probable amino-acid ATP-binding ABC transporter protein rsc1753 or rs02941 SWALL:Q8XYK5 (EMBL:AL646066) (266 aa) fasta scores: E(): 8.2e-34, 53.57% id in 252 aa, and to Escherichia coli, and Escherichia coli O157:H7 high-affinity branched-chain amino acid transport ATP-binding protein LivG or b3455 or z4825 or ecs4302 SWALL:LIVG_ECOLI (SWALL:P22730) (255 aa) fasta scores: E(): 5.2e-16, 36.29% id in 259 aa. Note: This CDS appears to be a funsion of a membrane transport related protein and an ATP-binding transport related protein
YP_108598.1	Similar to Ralstonia solanacearum  amino acid transmembrane transmembrane protein rsc1751 or rs02939 SWALL:Q8XYK7 (EMBL:AL646066) (315 aa) fasta scores: E(): 1.4e-58, 58.59% id in 314 aa, and to Brucella melitensis high-affinity branched-chain amino acid transport system permease bmeii0068 SWALL:Q8YDV6 (EMBL:AE009645) (332 aa) fasta scores: E(): 9e-42, 44.79% id in 317 aa
YP_108599.1	Similar to Pseudomonas aeruginosa hypothetical protein pa5185 SWALL:Q9HU04 (EMBL:AE004931) (147 aa) fasta scores: E(): 1.6e-34, 60.95% id in 146 aa, and to Mycobacterium tuberculosis hypothetical protein rv0163 or mt0172 or mtci28.03 SWALL:O07408 (EMBL:Z97050) (151 aa) fasta scores: E(): 4.2e-22, 45.32% id in 139 aa
YP_108600.1	Similar to Citrobacter freundii 1,3-propanediol dehydrogenase DhaT SWALL:DHAT_CITFR (SWALL:P45513) (387 aa) fasta scores: E(): 5.4e-34, 36.79% id in 375 aa, to Bacillus subtilis alcohol dehydrogenase GbsB SWALL:GBSB_BACSU (SWALL:P71017) (402 aa) fasta scores: E(): 1e-28, 33.42% id in 371 aa, and to Ralstonia solanacearum probable NAD-dependent 4-hydroxybutyrate dehydrogenase oxidoreductase rsc1771 or rs02958 SWALL:Q8XYI7 (EMBL:AL646066) (382 aa) fasta scores: E(): 5.7e-117, 80.89% id in 382 aa
YP_108601.1	Similar to Sulfolobus tokodaii hypothetical protein st1080 SWALL:Q972Q3 (EMBL:AP000984) (114 aa) fasta scores: E(): 1.5e-14, 44.76% id in 105 aa, and to Thermotoga maritima hypothetical protein tm0763 SWALL:Y763_THEMA (SWALL:Q9WZM2) (106 aa) fasta scores: E(): 4.3e-13, 44.55% id in 101 aa
YP_108602.1	Similar to Ralstonia solanacearum hypothetical protein rsc0809 or rs05013 SWALL:Q8Y181 (EMBL:AL646061) (193 aa) fasta scores: E(): 3.4e-45, 64.24% id in 179 aa, and to Pseudomonas aeruginosa NADH pyrophosphatase NudC or pa1823 SWALL:NUDC_PSEAE (SWALL:O86062) (278 aa) fasta scores: E(): 2.1e-05, 27.1% id in 166 aa
YP_108604.1	Similar to Ralstonia solanacearum probable protease signal peptide protein rsp1552 or rs02108 SWALL:Q8XPT5 (EMBL:AL646085) (490 aa) fasta scores: E(): 2.9e-37, 45.17% id in 518 aa, and to Pseudomonas aeruginosa serine protease MucD or pa0766 SWALL:Q57155 (EMBL:U49151) (474 aa) fasta scores: E(): 4.1e-25, 38.26% id in 473 aa
YP_108605.1	Similar to Ralstonia solanacearum hypothetical protein rsc0805 or rs05564 SWALL:Q8Y185 (EMBL:AL646061) (409 aa) fasta scores: E(): 1.3e-25, 38.04% id in 552 aa, and to Pseudomonas aeruginosa hypothetical protein pa1412 SWALL:Q9I3T2 (EMBL:AE004570) (397 aa) fasta scores: E(): 2.8e-11, 30.25% id in 542 aa. Note: The similarities annotated comprise the N-terminal and the C-terminal region of this CDS and the database matches, leaving the central part, where the repeats are, with no similarities to any of the database matches
YP_108606.1	Similar to Bacillus subtilis transcriptional regulatory protein GltR SWALL:GLTR_BACSU (SWALL:P94501) (296 aa) fasta scores: E(): 1.6e-32, 37.93% id in 290 aa, and to Ralstonia solanacearum probable transcription regulator protein rsc0804 or rs05024 SWALL:Q8Y186 (EMBL:AL646061) (302 aa) fasta scores: E(): 3.4e-55, 56.16% id in 292 aa. Note: This CDS is longer in its C-terminal region than most of its database matches
YP_108607.1	Catalyzes a two-step reaction, first charging an alanyl molecule by linking its carboxyl group to the alpha-phosphate of ATP, followed by transfer of the aminoacyl-adenylate to its tRNA
YP_108608.1	Similar to Ralstonia solanacearum  transmembrane protein rsc0796 or rs05041 SWALL:Q8Y194 (EMBL:AL646061) (420 aa) fasta scores: E(): 7.9e-124, 76.1% id in 406 aa, and to Pseudomonas aeruginosa hypothetical protein pa0446 SWALL:Q9I672 (EMBL:AE004482) (407 aa) fasta scores: E(): 8e-103, 64.44% id in 405 aa
YP_108609.1	Similar to Escherichia coli, and Escherichia coli O157:H7 osmotically inducible lipoprotein B precursor OsmB or b1283 or z2523 or ecs1856 SWALL:OSMB_ECOLI (SWALL:P17873) (72 aa) fasta scores: E(): 0.0073, 45.9% id in 61 aa, and to Ralstonia solanacearum  osmotically inducible lipoprotein transmembrane rsc1973 or rs03547 SWALL:Q8XXZ0 (EMBL:AL646067) (66 aa) fasta scores: E(): 0.00021, 51.85% id in 54 aa
YP_108610.1	catalyzes a two-step reaction, first charging a glutamine molecule by linking its carboxyl group to the alpha-phosphate of ATP, followed by transfer of the aminoacyl-adenylate to its tRNA
YP_108611.1	Similar to Ralstonia solanacearum hypothetical protein rsc0747 or rs05106 SWALL:Q8Y1E3 (EMBL:AL646060) (153 aa) fasta scores: E(): 1.7e-30, 57.71% id in 149 aa, and to Bacteriophage T4 hypothetical 17.7 kDa protein in e-segB intergenic region Y06l or E.1 or Msp8 SWALL:Y06L_BPT4 (SWALL:P32271) (151 aa) fasta scores: E(): 1.2e-10, 41.12% id in 124 aa
YP_108613.1	Similar to Alteromonas sp. beta-hexosaminidase A precursor Cht60 SWALL:HEXA_ALTSO (SWALL:P48823) (598 aa) fasta scores: E(): 2.1e-59, 35.98% id in 628 aa, and to Ralstonia solanacearum  hydrolase glycosidase rsc0769 or rs05085 SWALL:Q8Y1C1 (EMBL:AL646060) (734 aa) fasta scores: E(): 3.1e-152, 61.84% id in 684 aa
YP_108615.1	Similar to Methylobacterium extorquens methylamine utilization protein MauG SWALL:MAUG_METEX (SWALL:Q49128) (353 aa) fasta scores: E(): 0.051, 28.6% id in 451 aa, and to Ralstonia solanacearum probable lipoprotein transmembrane rsp1173 or rs05063 SWALL:Q8XQP8 (EMBL:AL646083) (441 aa) fasta scores: E(): 4.2e-76, 53.88% id in 451 aa. CDS is extended at the N-terminus in comparison to some orthologues
YP_108616.1	Similar to Burkholderia pseudomallei acid phosphatase AcpA SWALL:Q9L5C5 (EMBL:AF252862) (577 aa) fasta scores: E(): 5.5e-101, 55.68% id in 537 aa, and to Ralstonia solanacearum  acid phosphatase rsp1174 or rs05064 SWALL:Q8XQP7 (EMBL:AL646083) (715 aa) fasta scores: E(): 1.1e-96, 63.1% id in 515 aa
YP_108617.1	enzyme from Treponema denticola exhibits NADH-dependent trans-2-enoyl-CoA reductase activity
YP_108618.1	Similar to Escherichia coli multidrug resistance protein K EmrK or b2368 SWALL:EMRK_ECOLI (SWALL:P52599) (387 aa) fasta scores: E(): 1.7e-18, 31.65% id in 357 aa, and to Rhizobium meliloti hypothetical protein rb1406 or smb20699 SWALL:Q92TT9 (EMBL:AL603647) (365 aa) fasta scores: E(): 5.4e-33, 38.71% id in 372 aa, and to Pseudomonas putida TrpB trpB SWALL:Q8RPR5 (EMBL:AF360362) (353 aa) fasta scores: E(): 3.2e-32, 38.75% id in 338 aa. Note: This CDS is longer in its N-terminal region than most of its database matches
YP_108619.1	Similar to Escherichia coli, and Escherichia coli O157:H7 multidrug resistance protein B EmrB or b2686 or z3987 or ecs3548 SWALL:EMRB_ECOLI (SWALL:P27304) (512 aa) fasta scores: E(): 2.7e-61, 36.14% id in 509 aa, and to Chlorobium tepidum multidrug resistance protein ct0104 SWALL:AAM71352 (EMBL:AE012789) (533 aa) fasta scores: E(): 2e-66, 37.71% id in 533 aa
YP_108620.1	Similar to Pseudomonas aeruginosa outer membrane protein precursor OprM or OprK or pa0427 SWALL:OPRM_PSEAE (SWALL:Q51487) (485 aa) fasta scores: E(): 2.9e-27, 33.87% id in 496 aa, and to Ralstonia solanacearum probable channel-forming component of a multidrug resistance efflux pump protein rsp0442 or rs00901 SWALL:Q8XSM5 (EMBL:AL646078) (495 aa) fasta scores: E(): 2.8e-39, 37.09% id in 496 aa
YP_108621.1	Similar to Escherichia coli, and Escherichia coli O157:H7 capsular synthesis regulator component B RcsB or b2217 or z3476 or ecs3106 SWALL:RCSB_ECOLI (SWALL:P14374) (216 aa) fasta scores: E(): 3.1e-21, 37.18% id in 199 aa, and to Pseudomonas aeruginosa probable two-component response regulator pa3714 SWALL:Q9HXS7 (EMBL:AE004790) (213 aa) fasta scores: E(): 1.3e-26, 43.12% id in 211 aa
YP_108622.1	Similar to the C-terminal region of Escherichia coli sensor protein RcsC or b2218 SWALL:RCSC_ECOLI (SWALL:P14376) (949 aa) fasta scores: E(): 2e-37, 32.94% id in 513 aa, and of Salmonella typhi sensor protein RcsC or sty2496 SWALL:RCSC_SALTI (SWALL:Q56128) (948 aa) fasta scores: E(): 1.2e-35, 32.82% id in 521 aa
YP_108623.1	Similar to Acinetobacter baumannii hypothetical secreted protein CsuE SWALL:AAP43040 (EMBL:AY241696) (339 aa) fasta scores: E(): 1e-06, 31.08% id in 341 aa
YP_108624.1	Similar to Escherichia coli outer membrane usher protein precursor FocD SWALL:FOCD_ECOLI (SWALL:P46009) (875 aa) fasta scores: E(): 3.7e-11, 23.57% id in 755 aa, and to Vibrio parahaemolyticus CsuD SWALL:Q9AG84 (EMBL:AF339087) (802 aa) fasta scores: E(): 5.1e-86, 35.48% id in 789 aa
YP_108625.1	Similar to Yersinia pestis  chaperone protein ypo1697 SWALL:Q8ZFK6 (EMBL:AJ414150) (250 aa) fasta scores: E(): 1.8e-33, 46.08% id in 230 aa, and to Xanthomonas campestris pili assembly chaperone EcpD or xcc1380 SWALL:AAM40678 (EMBL:AE012237) (251 aa) fasta scores: E(): 1.6e-11, 32.31% id in 263 aa
YP_108626.1	Similar to Pseudomonas aeruginosa hypothetical protein pa4648 SWALL:Q9HVE4 (EMBL:AE004879) (182 aa) fasta scores: E(): 5.7e-10, 36.93% id in 176 aa, and to Vibrio parahaemolyticus CsuA SWALL:Q9AG87 (EMBL:AF339087) (181 aa) fasta scores: E(): 4.2e-07, 32.36% id in 173 aa. Note: Also similar to the upstream CDS BPSL2030 (187 aa) fasta scores: E(): 1.5e-09, 43.949% identity in 157 aa overlap
YP_108627.1	Similar to Pseudomonas aeruginosa hypothetical protein pa4648 SWALL:Q9HVE4 (EMBL:AE004879) (182 aa) fasta scores: E(): 9.2e-10, 34.46% id in 177 aa, and to Vibrio parahaemolyticus CsuA SWALL:Q9AG87 (EMBL:AF339087) (181 aa) fasta scores: E(): 5.2e-09, 30.17% id in 169 aa. Note: Also smilar to BPSL2031 (200 aa) fasta scores: E(): 1.3e-13, 37.576% identity in 165 aa overlap and to BPSL2029 (175 aa) fasta scores: E(): 3.9e-11, 43.949% identity in 157 aa overlap
YP_108628.1	Similar to Pseudomonas aeruginosa hypothetical protein pa4648 SWALL:Q9HVE4 (EMBL:AE004879) (182 aa) fasta scores: E(): 1.7e-07, 30.22% id in 182 aa, and to Yersinia pestis  exported protein ypo1699 SWALL:Q8ZFK4 (EMBL:AJ414150) (176 aa) fasta scores: E(): 1.7e-06, 30.4% id in 171 aa. Note: Also similar to BPSL2030 (187 aa) fasta scores: E(): 6.4e-14, 37.576% identity in 165 aa overlap and to BPSL2029 (175 aa) fasta scores: E(): 2.6e-05, 34.118% identity in 170 aa overlap
YP_108629.1	Similar to Bacillus subtilis als operon regulatory protein AlsR SWALL:ALSR_BACSU (SWALL:Q04778) (302 aa) fasta scores: E(): 1.2e-22, 31.63% id in 294 aa, and to Rhizobium meliloti  transcriptional regulator protein rb0012 or smb20009 SWALL:Q92XF0 (EMBL:AL603642) (309 aa) fasta scores: E(): 3.5e-38, 44.21% id in 285 aa
YP_108630.1	Similar to Alcaligenes eutrophus probable 4-methylmuconolactone transporter MmlH SWALL:MMLH_ALCEU (SWALL:O51798) (428 aa) fasta scores: E(): 5.4e-40, 43.51% id in 416 aa, and to Ralstonia solanacearum probable metabolite transport transmembrane protein rsp0234 or rs05189 SWALL:Q8XT81 (EMBL:AL646077) (416 aa) fasta scores: E(): 1.7e-106, 66.26% id in 412 aa
YP_108631.1	Similar to Ralstonia solanacearum probable hydrolase transmembrane protein rsp0233 or rs05190 SWALL:Q8XT82 (EMBL:AL646077) (302 aa) fasta scores: E(): 1.6e-52, 50.55% id in 269 aa, and to Campylobacter jejuni hypothetical protein cj0556 SWALL:Q9PHV9 (EMBL:AL139075) (265 aa) fasta scores: E(): 4.1e-24, 30.48% id in 269 aa
YP_108632.1	Similar to the plasmid borne Ralstonia solanacearum HNS-like transcription regulator protein rsp0029 or rs02004 SWALL:Q8XTS5 (EMBL:AL646076) (95 aa) fasta scores: E(): 6.6e-11, 45.26% id in 95 aa, and to Ralstonia solanacearum  HNS-like transcription regulator protein rsp0335 or rs00711 SWALL:Q8XSY2 (EMBL:AL646078) (96 aa) fasta scores: E(): 1.7e-10, 42.42% id in 99 aa
YP_108636.1	Similar to Ralstonia solanacearum  transmembrane protein rsp0752 or rs01956 SWALL:Q8XRS9 (EMBL:AL646080) (925 aa) fasta scores: E(): 4.2e-08, 21.03% id in 989 aa
YP_108638.1	Similar to Salmonella enterica subsp. enterica serovar Typhimurium VrgS protein SWALL:Q93IR3 (EMBL:AJ320483) (729 aa) fasta scores: E(): 1.8e-11, 26.08% id in 552 aa, and to Ralstonia solanacearum VGR-related protein rsp0750 or rs01958 SWALL:Q8XRT1 (EMBL:AL646080) (918 aa) fasta scores: E(): 1.4e-57, 40.27% id in 961 aa. Note: Also similar to BPSL2050 (933 aa) fasta scores: E(): 3.5e-32, 30.665% identity in 962 aa overlap
YP_108639.1	Low similarity to Escherichia coli, and Escherichia coli O157:H7 cell division protein FtsL or MraR or b0083 or z0093 or ecs0087 SWALL:FTSL_ECOLI (SWALL:P22187) (121 aa) fasta scores: E(): 0.89, 33.33% id in 93 aa
YP_108644.1	Similar to Ralstonia solanacearum  VGR-related protein rsp0738 or rs01970 SWALL:Q8XRU3 (EMBL:AL646080) (898 aa) fasta scores: E(): 4.6e-55, 40.98% id in 893 aa, and to Pseudomonas aeruginosa hypothetical protein pa5090 SWALL:Q9HU93 (EMBL:AE004921) (790 aa) fasta scores: E(): 2.3e-15, 25.98% id in 812 aa
YP_108645.1	Similar to the N-terminal region of Ralstonia solanacearum hypothetical protein rsp0177 or rs04689 SWALL:Q8XTD6 (EMBL:AL646077) (740 aa) fasta scores: E(): 8.9e-16, 38.02% id in 760 aa
YP_108646.1	Similar to Pseudomonas sp. CA10 hypothetical 18.9 kDa protein SWALL:Q9AQM6 (EMBL:AB047548) (170 aa) fasta scores: E(): 2.1e-11, 35.92% id in 167 aa
YP_108647.1	Similar to Pseudomonas sp. CA10 hypothetical 18.9 kDa protein SWALL:Q9AQM6 (EMBL:AB047548) (170 aa) fasta scores: E(): 4.1e-08, 31.88% id in 138 aa
YP_108648.1	Similar to Ralstonia solanacearum hypothetical protein rsp0176 rsp0176 or rs06148 SWALL:Q8XTD7 (EMBL:AL646077) (278 aa) fasta scores: E(): 5.8e-23, 38.8% id in 268 aa
YP_108649.1	Similar to Ralstonia solanacearum  VGR-related protein rsp0750 or rs01958 SWALL:Q8XRT1 (EMBL:AL646080) (918 aa) fasta scores: E(): 1.7e-37, 30.16% id in 968 aa, and to Pseudomonas aeruginosa hypothetical protein pa0262 SWALL:Q9I6M7 (EMBL:AE004464) (1019 aa) fasta scores: E(): 3.9e-07, 26.49% id in 902 aa. Note: Also similar to BPSL2041 (947 aa) fasta scores: E(): 1.1e-34, 30.489% identity in 961 aa overlap
YP_108650.1	Similar to Ralstonia solanacearum hypothetical protein rsp0765 or rs01943 SWALL:Q8XRR6 (EMBL:AL646080) (89 aa) fasta scores: E(): 2e-13, 52.87% id in 87 aa, and to the N-terminal region of Burkholderia thailandensis gp29 SWALL:Q8VP97 (EMBL:AY063741) (186 aa) fasta scores: E(): 3.1e-07, 42.16% id in 83 aa
YP_108651.1	Similar to Ralstonia solanacearum probable transmembrane protein rsp0764 or rs01944 SWALL:Q8XRR7 (EMBL:AL646080) (495 aa) fasta scores: E(): 1.4e-18, 33.26% id in 487 aa
YP_108652.1	Similar to Ralstonia solanacearum hypothetical protein rsp0747 or rs01961 SWALL:Q8XRT4 (EMBL:AL646080) (616 aa) fasta scores: E(): 4.6e-108, 47.43% id in 624 aa, and to Escherichia coli O157:H7 hypothetical protein z0260 or ecs0229 SWALL:Q8X7U6 (EMBL:AE005198) (616 aa) fasta scores: E(): 1e-25, 25.39% id in 626 aa
YP_108654.1	Similar to Rhizobium loti hypothetical protein mll0618 SWALL:Q98ME0 (EMBL:AP002995) (284 aa) fasta scores: E(): 4.1e-18, 33.68% id in 288 aa, and to Deinococcus radiodurans hypothetical protein dra0340 SWALL:Q9RYH3 (EMBL:AE001863) (276 aa) fasta scores: E(): 1.3e-17, 35.76% id in 274 aa
YP_108655.1	C-terminal region similar to C-terminal region of Dactylium dendroides galactose oxidase precursor GaoA SWALL:GAOA_DACDE (SWALL:Q01745) (680 aa) fasta scores: E(): 5.7e-72, 44.69% id in 490 aa
YP_108657.1	Similar to Ralstonia solanacearum  transmembrane protein rsc2292 or rs01263 SWALL:Q8XX26 (EMBL:AL646069) (207 aa) fasta scores: E(): 1.3e-05, 27.89% id in 190 aa
YP_108659.1	Similar to Ralstonia solanacearum  HNS-like transcription regulator protein rsp0335 or rs00711 SWALL:Q8XSY2 (EMBL:AL646078) (96 aa) fasta scores: E(): 9.1e-05, 36.55% id in 93 aa
YP_108660.1	Similar to the C-terminal region of Caulobacter crescentus FlbA protein or cc1457 SWALL:FLBA_CAUCR (SWALL:P21296) (596 aa) fasta scores: E(): 3.1e-20, 30.36% id in 494 aa, and to Ralstonia solanacearum hypothetical protein rsc3164 rsc3164 or rs00434 SWALL:Q8XUM3 (EMBL:AL646074) (387 aa) fasta scores: E(): 5.2e-11, 34.16% id in 322 aa
YP_108661.1	Similar to Escherichia vulneris outer membrane protein II OmpA SWALL:Q47880 (EMBL:M63350) (244 aa) fasta scores: E(): 1.3e-14, 35% id in 220 aa. C-terminal region is similar to the C-terminus of Klebsiella pneumoniae outer membrane protein a precursor OmpA SWALL:OMPA_KLEPN (SWALL:P24017) (344 aa) fasta scores: E(): 1.3e-15, 38.69% id in 199 aa
YP_108662.1	Weakly similar to Rhizobium meliloti hypothetical protein r00458 r00458 or smc01708 SWALL:Q92KQ7 (EMBL:AL591783) (1291 aa) fasta scores: E(): 4.5e-25, 29.01% id in 1282 aa, and to and internal region of Rhizobium loti hypothetical protein Mll2848 mll2848 SWALL:Q98HJ2 (EMBL:AP003000) (1953 aa) fasta scores: E(): 6.9e-31, 31.24% id in 1258 aa
YP_108664.1	Similar to Bacillus subtilis alkaline phosphatase synthesis transcriptional regulatory protein PhoP SWALL:PHOP_BACSU (SWALL:P13792) (240 aa) fasta scores: E(): 2.7e-21, 34.91% id in 232 aa, and to Ralstonia solanacearum probable two-component system response regulator transcription regulator protein rsc1073 or rs04004 SWALL:Q8Y0H1 (EMBL:AL646062) (237 aa) fasta scores: E(): 4.6e-29, 39.91% id in 228 aa
YP_108665.1	Similar to Salmonella typhimurium LT2 fels-1 prophage hypothetical protein stm0905 SWALL:Q8ZQH6 (EMBL:AE008737) (132 aa) fasta scores: E(): 1.4e-23, 54.16% id in 120 aa, and to Escherichia coli hypothetical protein precursor YcgJ or b1177 SWALL:YCGJ_ECOLI (SWALL:P76001) (122 aa) fasta scores: E(): 2.2e-19, 49.55% id in 113 aa
YP_108667.1	Similar to Escherichia coli, and Escherichia coli O157:H7 phosphate regulon transcriptional regulatory protein PhoB or b0399 or z0497 or ecs0449 SWALL:PHOB_ECOLI (SWALL:P08402) (229 aa) fasta scores: E(): 6.6e-19, 31.41% id in 226 aa, and to Ralstonia solanacearum probable two-component system response regulator transcription regulator protein rsc1073 or rs04004 SWALL:Q8Y0H1 (EMBL:AL646062) (237 aa) fasta scores: E(): 4.2e-24, 34.97% id in 223 aa. Note: Also similar to the downstream CDS BPSL2065 (237 aa) fasta scores: E(): 7.1e-34, 45.455% identity in 231 aa overlap
YP_108668.1	Similar to Escherichia coli  transcriptional regulator AbgR or b1339 SWALL:ABGR_ECOLI (SWALL:P77744) (302 aa) fasta scores: E(): 6.1e-13, 24.73% id in 287 aa, and to Xanthomonas axonopodis transcriptional regulator YbhD or xac3476 SWALL:Q8PGY6 (EMBL:AE011995) (300 aa) fasta scores: E(): 2.8e-19, 32.46% id in 308 aa
YP_108672.1	Similar to Alcaligenes faecalis PolY poly(3-hydroxybutyrate) depolymerase precursor (EC 3.1.1.75) (PHB depolymerase) SWALL:PHB_ALCFA (SWALL:P12625) (488 aa) fasta scores: E(): 5.8e-152, 80.28% id in 487 aa, and to Burkholderia pickettii PolY SWALL:Q9XDX7 (EMBL:AB022287) (492 aa) fasta scores: E(): 5.8e-152, 81.19% id in 484 aa
YP_108673.1	Similar to the full length of Ralstonia solanacearum  alpha-amylase-related protein rsp0241 or rs05182 SWALL:Q8XT74 (EMBL:AL646077) (1201 aa) fasta scores: E(): 4.5e-145, 51.26% id in 1151 aa, and C-terminal region to Chlorobium tepidum alpha-amylase ct2089 SWALL:AAM73306 (EMBL:AE012958) (670 aa) fasta scores: E(): 2.7e-102, 44.68% id in 658 aa
YP_108674.1	Similar to Thermus thermophilus trehalose synthase TreS SWALL:TRES_THETH (SWALL:O06458) (963 aa) fasta scores: E(): 2.6e-123, 49.86% id in 736 aa, and to Pseudomonas aeruginosa probable trehalose synthase pa2152 SWALL:Q9I1W3 (EMBL:AE004642) (1100 aa) fasta scores: E(): 0, 59.06% id in 1114 aa. Note: This CDS is longer in its N-terminal region than most of its database matches
YP_108675.1	catalyzes the transfer of a segment of a 1,4-alpha-D-glucan chain to a primary hydroxy group in a similar glucan chain
YP_108676.1	Similar to Escherichia coli glycogen operon protein GlgX or GlyX or b3431 SWALL:GLGX_ECOLI (SWALL:P15067) (657 aa) fasta scores: E(): 1.8e-99, 46.11% id in 657 aa, and to Ralstonia solanacearum probable glycogen operon protein rsp0238 or rs05185 SWALL:Q8XT77 (EMBL:AL646077) (754 aa) fasta scores: E(): 6.3e-199, 65.58% id in 709 aa, and to
YP_108677.1	Similar to Rhizobium sp. malto-oligosyltrehalose trehalohydrolase TreZ SWALL:TREZ_RHISP (SWALL:Q53238) (596 aa) fasta scores: E(): 2.9e-35, 40.48% id in 573 aa, and to Ralstonia solanacearum  maltooligosyl trehalose trehalohydrolase rsp0237 or rs05186 SWALL:Q8XT78 (EMBL:AL646077) (622 aa) fasta scores: E(): 6.4e-131, 60% id in 620 aa
YP_108678.1	Similar to Escherichia coli 4-alpha-glucanotransferase MalQ or MalA or b3416 SWALL:MALQ_ECOLI (SWALL:P15977) (694 aa) fasta scores: E(): 8.2e-51, 31.39% id in 739 aa, and to Ralstonia solanacearum  4-alpha-glucanotransferase rsp0236 or rs05187 SWALL:Q8XT79 (EMBL:AL646077) (774 aa) fasta scores: E(): 1.3e-81, 47.12% id in 783 aa
YP_108679.1	Similar to Pseudomonas aeruginosa probable glycosyl hydrolase pa2162 SWALL:Q9I1V3 (EMBL:AE004643) (926 aa) fasta scores: E(): 7.5e-143, 47.62% id in 947 aa, and to Salmonella typhimurium  glycosyl hydrolase stm1559 SWALL:Q8ZPF1 (EMBL:AE008768) (842 aa) fasta scores: E(): 2.1e-23, 36.76% id in 914 aa
YP_108680.1	Similar in its C-terminal region to the C-terminal region in Xylella fastidiosa tryptophan repressor binding protein xf1133 SWALL:Q9PE95 (EMBL:AE003949) (189 aa) fasta scores: E(): 2.1e-16, 52.83% id in 106 aa, and also in Escherichia coli hypothetical 19.6 kDa protein SWALL:Q9F7X7 (EMBL:AF270497) (183 aa) fasta scores: E(): 7.5e-09, 40% id in 105 aa
YP_108681.1	Similar to Caulobacter crescentus hypothetical protein cc2974 SWALL:Q9A469 (EMBL:AE005961) (123 aa) fasta scores: E(): 8.2e-11, 36.6% id in 112 aa
YP_108682.1	Similar to Rhizobium meliloti probable rhizopine catabolism regulatory protein MocR SWALL:MOCR_RHIME (SWALL:P49309) (493 aa) fasta scores: E(): 6.5e-50, 36.92% id in 474 aa, and to Ralstonia solanacearum probable transcription regulator protein rsc3119 or rs00574 SWALL:Q8XUR6 (EMBL:AL646073) (488 aa) fasta scores: E(): 2.6e-47, 40.55% id in 466 aa
YP_108683.1	N-terminal region similar to Bradyrhizobium sp. nodulation protein NolA SWALL:NOLA_BRASN (SWALL:P50330) (237 aa) fasta scores: E(): 1e-11, 31.78% id in 236 aa, and C-terminal region similar to Rhizobium loti hypothetical protein mlr0915 SWALL:Q98LR1 (EMBL:AP002996) (299 aa) fasta scores: E(): 6.8e-31, 41.69% id in 271 aa. Note: There is a region of approx. 100 residues in between these two regions of similarity that presents no matches to the databases entries. Possible fusion protein
YP_108685.1	Very low and partial similarity to Pseudomonas aeruginosa hypothetical protein pa3907 SWALL:Q9HXA6 (EMBL:AE004808) (261 aa) fasta scores: E(): 0.00015, 30.87% id in 149 aa
YP_108686.1	Very low and partial similarity to Pseudomonas aeruginosa hypothetical protein pa3908 SWALL:Q9HXA5 (EMBL:AE004808) (239 aa) fasta scores: E(): 0.001, 25.43% id in 228 aa
YP_108687.1	Similar to Ralstonia solanacearum  phytoene synthase crtb or rsc1652 or rs04029 SWALL:Q8XYV4 (EMBL:AL646065) (290 aa) fasta scores: E(): 3.7e-43, 47.65% id in 277 aa, and to Neisseria meningitidis poly-isoprenyl transferase nma1339 SWALL:Q9JUF5 (EMBL:AL162755) (290 aa) fasta scores: E(): 7.4e-27, 35.53% id in 273 aa
YP_108688.1	Similar to Ralstonia solanacearum hypothetical protein rsc1651 or rs04028 SWALL:Q8XYV5 (EMBL:AL646065) (394 aa) fasta scores: E(): 7e-83, 56.45% id in 418 aa, and to Caulobacter crescentus hypothetical protein cc1979 SWALL:Q9A6V4 (EMBL:AE005871) (407 aa) fasta scores: E(): 3.5e-23, 31.48% id in 432 aa
YP_108689.1	Similar to Ralstonia solanacearum probable signal peptide protein rsc1650 or rs04027 SWALL:Q8XYV6 (EMBL:AL646065) (538 aa) fasta scores: E(): 1.1e-84, 51.62% id in 492 aa, and to Xanthomonas campestris hypothetical protein xcc3941 SWALL:AAM43162 (EMBL:AE012514) (529 aa) fasta scores: E(): 8e-11, 32.78% id in 427 aa. Note: This CDS is shorter in its N-terminal region than most of its database matches
YP_108691.1	part of two-component system EnvZ/OmpR; regulates transcription of outer membrane porin genes ompC/F; under high osmolarity EnvZ functions as kinase/phosphotransferase and phosphorylates OmpR; the result is increased expression of ompC and repression of ompF; also functions in regulation of other genes; forms dimers upon phosphorylation
YP_108692.1	Similar to Escherichia coli osmolarity sensor protein EnvZ or OmpB or PerA or Tpo or b3404 SWALL:ENVZ_ECOLI (SWALL:P02933) (450 aa) fasta scores: E(): 7.8e-31, 32.3% id in 452 aa, and to Ralstonia solanacearum probable oxidative stress resistance two-component transmembrane sensor histidine kinase transcription regulator protein RisS or rsc1647 or rs04023 SWALL:Q8XYV9 (EMBL:AL646065) (453 aa) fasta scores: E(): 9.1e-95, 57.53% id in 438 aa
YP_108693.1	Similar to Brucella melitensis alkyl hydroperoxide reductase C22 protein bmeii0577 SWALL:Q8YCF3 (EMBL:AE009694) (184 aa) fasta scores: E(): 6.4e-53, 70.33% id in 182 aa, and to Streptomyces viridosporus alkyl hydroperoxide reductase AhpC SWALL:Q9X5V0 (EMBL:AF127576) (194 aa) fasta scores: E(): 1.2e-30, 50.55% id in 180 aa
YP_108694.1	Similar to Ralstonia solanacearum  antioxidant protein rsc1645 or rs04020 SWALL:Q8XYW1 (EMBL:AL646065) (175 aa) fasta scores: E(): 7.9e-49, 76.87% id in 173 aa, and to Mycobacterium tuberculosis, and Mycobacterium bovis AhpD protein or rv2429 or mt2504 or mtcy428.17C SWALL:AHPD_MYCTU (SWALL:Q57353) (177 aa) fasta scores: E(): 1.6e-11, 37.93% id in 174 aa
YP_108695.1	catalyzes the conversion of 4-diphosphocytidyl-2-C-methyl-D-erythritol 2-phosphate into 2-C-methyl-D-erythritol 2,4-cyclodiphosphate
YP_108696.1	4-diphosphocytidyl-2C-methyl-D-erythritol synthase; MEP cytidylyltransferase; MCT; catalyzes the formation of 4-diphosphocytidyl-2-C-methyl-D-erythritol from CTP and 2-C-methyl-D-erythritol 4-phosphate; involved in isoprenoid and isopentenyl-PP biosynthesis; forms homodimers
YP_108697.1	Similar to Escherichia coli transcription-repair coupling factor Mfd or b1114 SWALL:MFD_ECOLI (SWALL:P30958) (1148 aa) fasta scores: E(): 4.3e-213, 51.04% id in 1152 aa, and to Ralstonia solanacearum probable transcription-repair coupling factor protein rsc1642 or rs04017 SWALL:Q8XYW4 (EMBL:AL646065) (1157 aa) fasta scores: E(): 0, 74.78% id in 1150 aa. Note: This CDS is longer in its N-terminal region than most of its database matches and has two possible alternative start codons at residues 15 and 33
YP_008992008.1	oxidoreductase
YP_108698.2	catalyzes the formation of L-ornithine from N(2)-acetyl-L-ornithine
YP_108699.1	Similar to Escherichia coli, and Escherichia coli O157:H7 threonine dehydratase catabolic TdcB or b3117 or z4469 or ecs3997 SWALL:THD2_ECOLI (SWALL:P05792) (329 aa) fasta scores: E(): 1.8e-29, 36.9% id in 317 aa, and to Streptomyces coelicolor  threonine dehydratase sco0821 or scf43a.11C SWALL:Q9XAA4 (EMBL:AL096837) (325 aa) fasta scores: E(): 8.4e-34, 37.81% id in 320 aa
YP_108700.1	Similar to Xanthomonas campestris hypothetical protein xcc3078 SWALL:AAM42349 (EMBL:AE012422) (146 aa) fasta scores: E(): 1.8e-06, 37.24% id in 145 aa
YP_108701.1	Similar to Ralstonia solanacearum probable penicillin-binding 1 rsc2976 or rs01357 SWALL:Q8XV55 (EMBL:AL646073) (801 aa) fasta scores: E(): 2.2e-183, 61.61% id in 805 aa, and to Neisseria lactamica penicillin-binding protein 1A MrcA or PonA SWALL:PBPA_NEILA (SWALL:O87579) (798 aa) fasta scores: E(): 4.3e-129, 47.4% id in 791 aa. Note: This CDS is longer in its N-terminal region than most of its database matches
YP_108702.1	Similar to Synechocystis sp. hypothetical protein sll0617 SWALL:Y617_SYNY3 (SWALL:Q55707) (267 aa) fasta scores: E(): 7.6e-11, 30.49% id in 223 aa, and to Deinococcus radiodurans phage shock protein A dr1473 SWALL:Q9RUB7 (EMBL:AE001992) (223 aa) fasta scores: E(): 6.3e-10, 27.87% id in 226 aa
YP_108704.1	homopentamer; channel that opens in response to pressure or hypoosmotic shock
YP_108706.1	Similar to Escherichia coli 2-hydroxy-3-oxopropionate reductase GlxR or GlxB1 or b0509 SWALL:GLXR_ECOLI (SWALL:P77161) (292 aa) fasta scores: E(): 2.7e-23, 34.7% id in 291 aa, and to Ralstonia solanacearum probable oxidoreductase rsc2429 or rs02679 SWALL:Q8XWP4 (EMBL:AL646070) (298 aa) fasta scores: E(): 3.1e-23, 33.21% id in 292 aa
YP_108707.1	Similar to Ralstonia solanacearum hypothetical protein rsp1175 or rs05065 SWALL:Q8XQP6 (EMBL:AL646083) (83 aa) fasta scores: E(): 1.2e-14, 58.82% id in 68 aa, and to Pseudomonas aeruginosa hypothetical protein pa0038 SWALL:Q9I794 (EMBL:AE004443) (71 aa) fasta scores: E(): 5.2e-14, 60.29% id in 68 aa
YP_108708.1	Similar to Pseudomonas putida transcriptional activator protein NahR SWALL:NAHR_PSEPU (SWALL:P10183) (300 aa) fasta scores: E(): 4.1e-26, 31.39% id in 293 aa, and to Ralstonia solanacearum probable transcription regulator protein rsc2094 or rs03659 SWALL:Q8XXL9 (EMBL:AL646068) (316 aa) fasta scores: E(): 2.1e-68, 54.63% id in 302 aa
YP_108709.1	catalyzes the transformation of hydroxyatrazine to N-isopropylammelide and ethylamine in the atrazine degradation pathway.
YP_108710.1	Similar to Bacillus subtilis transthyretin-like protein PucM SWALL:PUCM_BACSU (SWALL:O32142) (121 aa) fasta scores: E(): 2.4e-22, 49.57% id in 117 aa, and to Ralstonia solanacearum hypothetical transthyretin-like protein rsc2116 or rs01488 SWALL:YL16_RALSO (SWALL:Q8XXJ7) (117 aa) fasta scores: E(): 6.7e-30, 64.95% id in 117 aa
YP_108711.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc2115 or rs01489 SWALL:Q8XXJ8 (EMBL:AL646068) (414 aa) fasta scores: E(): 2.5e-80, 59.46% id in 412 aa, and to Rhizobium meliloti hypothetical membrane protein rb0796 or smb21292 SWALL:Q92VB2 (EMBL:AL603644) (412 aa) fasta scores: E(): 2.3e-66, 45.54% id in 404 aa
YP_108712.1	catalyzes the formation of glyoxylate from (S)-ureidoglycolate
YP_108713.1	catalyzes the formation of S-ureidoglycolate and urea from allantoate
YP_108714.1	Similar to Bacillus subtilis uricase PucL SWALL:URIC_BACSU (SWALL:O32141) (494 aa) fasta scores: E(): 2.4e-21, 43.97% id in 166 aa, and to Ralstonia solanacearum hypothetical protein rsc2121 or rs01483 SWALL:Q8XXJ2 (EMBL:AL646068) (173 aa) fasta scores: E(): 8.6e-38, 67.68% id in 164 aa
YP_108715.1	Similar to Ralstonia solanacearum hypothetical protein rsc2120 or rs01484 SWALL:Q8XXJ3 (EMBL:AL646068) (328 aa) fasta scores: E(): 3.2e-100, 73.46% id in 309 aa, and to Pseudomonas aeruginosa hypothetical protein pa1517 SWALL:Q9I3J6 (EMBL:AE004580) (308 aa) fasta scores: E(): 1e-77, 61.18% id in 304 aa
YP_108716.1	Similar to Agrobacterium sp. IP I-671 hydantoin-racemase HyuA SWALL:Q8VT63 (EMBL:AF335479) (247 aa) fasta scores: E(): 6e-34, 53.9% id in 243 aa, and to Pseudomonas sp. hydantoin racemase HyuE SWALL:HYUE_PSESN (SWALL:Q00924) (249 aa) fasta scores: E(): 2.2e-28, 48.96% id in 241 aa. Note: The database matches finish at approximately residue 245 and the C-terminal region of this CDS has a high content in Ala and Pro amino acid residues
YP_108717.1	Similar to Bacillus subtilis probable allantoin permease PucI SWALL:ALLP_BACSU (SWALL:P94575) (490 aa) fasta scores: E(): 1.3e-56, 33.97% id in 471 aa, and to Yersinia pestis  permease ypo1083 SWALL:Q8ZH28 (EMBL:AJ414146) (494 aa) fasta scores: E(): 6.7e-114, 59.66% id in 481 aa. Note: This CDS has possible alternative start codons at residues 15 or 43
YP_108718.1	Similar to Ralstonia solanacearum probable transcription regulator protein rsc2117 or rs01487 SWALL:Q8XXJ6 (EMBL:AL646068) (250 aa) fasta scores: E(): 2.7e-31, 44.2% id in 233 aa, and to Agrobacterium tumefaciens transcriptional regulator, GntR family atu4702 or agr_l_357 SWALL:Q8U6V4 (EMBL:AE009398) (225 aa) fasta scores: E(): 3.1e-26, 41.36% id in 220 aa
YP_108719.1	catalyzes the release of D-alanine from L-alanyl-D-glutamyl-meso-diaminopimelyl-D-alanine
YP_108720.1	Similar to Azoarcus evansii hypothetical protein SWALL:CAD21697 (EMBL:AJ428571) (154 aa) fasta scores: E(): 1.6e-38, 69.86% id in 146 aa, and to Salmonella typhimurium, and Salmonella typhi  cytosine/adenosine deaminase stm2568 or sty2814 SWALL:Q8XGY4 (EMBL:AE008817) (183 aa) fasta scores: E(): 2.9e-29, 51.8% id in 166 aa
YP_108721.1	Similar to Bacillus halodurans hypothetical protein bh0859 SWALL:Q9KEJ3 (EMBL:AP001510) (123 aa) fasta scores: E(): 1.5e-08, 35.71% id in 126 aa, and to Salmonella typhimurium  cytoplasmic protein YhdN or stm3413 SWALL:Q8ZLM2 (EMBL:AE008857) (122 aa) fasta scores: E(): 1.7e-08, 35.53% id in 121 aa
YP_108722.1	Similar to Pseudomonas aeruginosa hypothetical protein pa0055 SWALL:Q9I777 (EMBL:AE004445) (168 aa) fasta scores: E(): 1.5e-35, 60.47% id in 167 aa, and to Ralstonia solanacearum hypothetical protein rsp1548 or rs02104 SWALL:Q8XPT9 (EMBL:AL646085) (170 aa) fasta scores: E(): 5.5e-27, 52.14% id in 163 aa
YP_108723.1	Similar to Pseudomonas aeruginosa hypothetical protein pa1352 SWALL:Q9I3Z2 (EMBL:AE004564) (403 aa) fasta scores: E(): 1.9e-79, 62.28% id in 403 aa, and to Escherichia coli hypothetical protein YgaY or b2680/b2681 SWALL:YGAY_ECOLI (SWALL:P76628) (394 aa) fasta scores: E(): 2.3e-49, 40.21% id in 373 aa
YP_108724.1	glutamine-hydrolyzing; contains glutamine-hydrolyzing domain and glutamine amidotransferase; GMP-binding domain; functions to produce GMP from XMP in the IMP pathway
YP_108725.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc1430 or rs05261 SWALL:Q8XZG5 (EMBL:AL646064) (192 aa) fasta scores: E(): 1.5e-09, 35.71% id in 196 aa
YP_108726.1	catalyzes the synthesis of xanthosine monophosphate by the NAD+ dependent oxidation of inosine monophosphate
YP_108727.1	Similar to Rhizobium meliloti hypothetical protein r00748 or smc00803 SWALL:Q92RU4 (EMBL:AL591784) (271 aa) fasta scores: E(): 2.8e-49, 67.79% id in 267 aa, and to Ralstonia solanacearum hypothetical protein rsc1113 or rs04007 SWALL:Q8Y0D1 (EMBL:AL646062) (244 aa) fasta scores: E(): 1.1e-36, 53.15% id in 254 aa
YP_108728.1	Similar to Rhizobium meliloti hypothetical protein r00750 or smc00805 SWALL:Q92KM4 (EMBL:AL591784) (214 aa) fasta scores: E(): 1.3e-66, 79.9% id in 214 aa. Note: This CDS is longer in its C-terminal region than most of its database match
YP_108729.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc1428 or rs05264 SWALL:Q8XZG7 (EMBL:AL646064) (313 aa) fasta scores: E(): 4.7e-60, 54.14% id in 314 aa, and to Caulobacter crescentus integral membrane protein cc0848 SWALL:Q9A9W3 (EMBL:AE005761) (312 aa) fasta scores: E(): 1.3e-47, 49.17% id in 303 aa
YP_108730.1	Similar to Yersinia pestis hypothetical protein ypo1103/y3077 ypo1103 or y3077 SWALL:YB03_YERPE (SWALL:Q8ZH12) (94 aa) fasta scores: E(): 5.6e-12, 50% id in 94 aa, and to Escherichia coli protein YfjF or b2618 SWALL:YFJF_ECOLI (SWALL:P52119) (96 aa) fasta scores: E(): 8.8e-12, 54.02% id in 87 aa. Note: This CDS is longer in its C-terminal region than most of its database matches
YP_108731.1	Similar to Ralstonia solanacearum hypothetical protein rsc1425 or rs05267 SWALL:Q8XZH0 (EMBL:AL646064) (145 aa) fasta scores: E(): 9.4e-46, 73.61% id in 144 aa, and to Escherichia coli hypothetical protein YfjG or b2619 SWALL:YFJG_ECOLI (SWALL:P52121) (158 aa) fasta scores: E(): 1.4e-21, 42.25% id in 142 aa
YP_108732.1	binds to ssrA RNA (tmRNA) and is required for its successful binding to ribosomes; also appears to function in the trans-translation step by promoting accommodation of tmRNA into the ribosomal A site; SmpB protects the tmRNA from RNase R degradation in Caulobacter crescentus; both the tmRNA and SmpB are regulated in cell cycle-dependent manner; functions in release of stalled ribosomes from damaged mRNAs and targeting proteins for degradation
YP_108733.1	Similar to Ralstonia solanacearum  transmembrane protein rsc1423 or rs05269 SWALL:Q8XZH2 (EMBL:AL646064) (308 aa) fasta scores: E(): 1.4e-87, 84% id in 300 aa, and to Neisseria meningitidis  periplasmic protein nma1382 or gna1220 SWALL:Q9JR80 (EMBL:AL162755) (315 aa) fasta scores: E(): 4.6e-54, 65.58% id in 308 aa
YP_108734.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc1422 or rs05270 SWALL:Q8XZH3 (EMBL:AL646064) (142 aa) fasta scores: E(): 9.8e-20, 47.88% id in 142 aa, and low similarity to Neisseria meningitidis  membrane protein nma1383 SWALL:Q9JUC5 (EMBL:AL162755) (135 aa) fasta scores: E(): 0.00044, 32.37% id in 139 aa
YP_108735.1	catalyzes the formation of phosphoenolpyruvate from pyruvate
YP_108736.1	Similar to Anabaena sp. hypothetical protein alr0975 SWALL:Q8YY76 (EMBL:AP003584) (242 aa) fasta scores: E(): 4.8e-35, 49.53% id in 216 aa, and to Athyrium yokoscense phytochelatin synthase AypCS1 SWALL:Q948S0 (EMBL:AB057412) (488 aa) fasta scores: E(): 6.6e-18, 36.44% id in 214 aa. Note: Appart from the first match quoted, the rest of the significant matches are to N-terminal regions of eukaryotic proteins
YP_108737.1	Similar to the N-terminal region of Xanthomonas sp. xanthomonapepsin precursor SWALL:XANP_XANS2 (SWALL:Q60106) (827 aa) fasta scores: E(): 4.6e-65, 46.42% id in 644 aa, and to the full length Pseudomonas sp. pseudomonapepsin precursor Pcp SWALL:PICP_PSESR (SWALL:P42790) (587 aa) fasta scores: E(): 2.5e-24, 48.07% id in 624 aa
YP_108738.1	Similar to Ralstonia solanacearum  ATP-binding protein rsc1420 or rs05272 SWALL:Q8XZH5 (EMBL:AL646064) (279 aa) fasta scores: E(): 3.8e-78, 76.49% id in 268 aa, and to Neisseria meningitidis hypothetical protein nmb0619 SWALL:Q9K0I1 (EMBL:AE002417) (273 aa) fasta scores: E(): 2.1e-47, 50.18% id in 267 aa
YP_108739.1	Similar to Ralstonia solanacearum  trna/rRNA methyltransferase rsc1419 or rs05273 SWALL:Q8XZH6 (EMBL:AL646064) (259 aa) fasta scores: E(): 2.2e-52, 55.03% id in 258 aa, and to Neisseria meningitidis  RNA methyltransferase nma1351 SWALL:Q9JUE8 (EMBL:AL162755) (261 aa) fasta scores: E(): 7.7e-30, 41.44% id in 263 aa
YP_108740.1	RNH2; RNase HII; binds manganese; endonuclease which specifically degrades the RNA of RNA-DNA hybrids
YP_108741.1	catalyzes the formation of lipid A disaccharide from UDP-2,3-diacylglucosamine and 2,3-diacylglucosamine-1-phosphate, lipid A disaccharide is a precursor of lipid A that anchors LPS to the OM
YP_108742.1	catalyzes the addition of (R)-3-hydroxytetradecanoyl to the glucosamine disaccharide in lipid A biosynthesis
YP_108743.1	in Pseudomonas aeruginosa this enzyme is a trimer of dimers; essential for membrane formation; performs third step of type II fatty acid biosynthesis; catalyzes dehydration of (3R)-hydroxyacyl-ACP to trans-2-acyl-ACP
YP_108744.1	adds the O-linked and N-linked 3(R)-hydroxy fatty acids to the glucosamine disaccharide during lipid A biosynthesis
YP_108745.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc1413 or rs05279 SWALL:Q8XZI2 (EMBL:AL646064) (184 aa) fasta scores: E(): 6.5e-32, 71.25% id in 160 aa, and to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 histone-like protein HLP-1 precursor HlpA or Skp or OmpH or b0178 or c0215 or z0190 or ecs0180 SWALL:HLPA_ECOLI (SWALL:P11457) (161 aa) fasta scores: E(): 1.3e-05, 35.44% id in 158 aa
YP_108746.1	Similar to Ralstonia solanacearum  outer membrane signal peptide protein rsc1412 or rs05280 SWALL:Q8XZI3 (EMBL:AL646064) (765 aa) fasta scores: E(): 4e-194, 63.84% id in 769 aa, and to Pseudomonas aeruginosa probable outer membrane protein pa3648 SWALL:Q9HXY4 (EMBL:AE004784) (797 aa) fasta scores: E(): 3.6e-94, 38% id in 800 aa
YP_108747.1	Similar to Escherichia coli, and Escherichia coli O157:H7 protease EcfE or b0176 or z0187 or ecs0178 SWALL:ECFE_ECOLI (SWALL:P37764) (450 aa) fasta scores: E(): 1.2e-37, 39.48% id in 466 aa, and to Ralstonia solanacearum hypothetical zinc metalloprotease rsc1411 or rs05281 SWALL:YE11_RALSO (SWALL:Q8XZI4) (462 aa) fasta scores: E(): 1.2e-66, 45.25% id in 464 aa
YP_108748.1	catalyzes the NADP-dependent rearrangement and reduction of 1-deoxy-D-xylulose-5-phosphate (DXP) to 2-C-methyl-D-erythritol 4-phosphate
YP_108749.1	Similar to Escherichia coli, and Escherichia coli O157:H7 phosphatidate cytidylyltransferase CdsA or Cds or b0175 or z0186 or ecs0177 SWALL:CDSA_ECOLI (SWALL:P06466) (249 aa) fasta scores: E(): 9.8e-07, 36.18% id in 257 aa, and to Ralstonia solanacearum probable phosphatidate cytidylyltransferase transmembrane protein rsc1409 or rs05283 SWALL:Q8XZI6 (EMBL:AL646064) (271 aa) fasta scores: E(): 1.5e-42, 54.15% id in 277 aa
YP_108750.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 undecaprenyl pyrophosphate synthetase UppS or Rth or b0174 or c0211 or z0185 or ecs0176 SWALL:UPPS_ECOLI (SWALL:Q47675) (253 aa) fasta scores: E(): 1.4e-47, 54.82% id in 228 aa, and to Ralstonia solanacearum probable undecaprenyl pyrophosphate synthetase rsc1408 or rs05284 SWALL:Q8XZI7 (EMBL:AL646064) (258 aa) fasta scores: E(): 1.9e-68, 67.57% id in 256 aa
YP_108751.1	Rrf; Frr; ribosome-recycling factor; release factor 4; RF4; recycles ribosomes upon translation termination along with release factor RF-3 and elongation factor EF-G; A GTPase-dependent process results in release of 50S from 70S; inhibited by release factor RF-1; essential for viability; structurally similar to tRNAs
YP_108752.1	Catalyzes the phosphorylation of UMP to UDP
YP_108753.1	EF-Ts; functions during elongation stage of protein translation; forms a dimer; associates with EF-Tu-GDP complex and promotes exchange of GDP to GTP resulting in regeneration of the active form of EF-Tu
YP_108754.1	one of the last subunits in the assembly of the 30S subunit; absence of S2 does not inhibit assembly but results in an inactive subunit
YP_008992009.1	methionine aminopeptidase
YP_108755.1	catalyzes the removal of N-terminal amino acids from peptides and arylamides; generally Co(II) however activity has been shown for some methionine aminopeptidases with Zn, Fe, or Mn
YP_108756.1	catalyzes the uridylylation or deuridylylation of the PII nitrogen regulatory protein
YP_108757.1	Similar to Neisseria meningitidis hypothetical protein nmb0806 SWALL:Q9K020 (EMBL:AE002434) (252 aa) fasta scores: E(): 2.5e-34, 64.25% id in 249 aa, and to Thermoanaerobacter tengcongensis 16S rRNA uridine-516 pseudouridylate synthase and related pseudouridylate synthase RsuA2 or tte1332 SWALL:Q8R5S6 (EMBL:AE013093) (236 aa) fasta scores: E(): 1.6e-11, 32.14% id in 252 aa. Note: Most of the database macthes have a longer N-terminal region that this CDS
YP_108758.1	cleaves off formyl group from N-terminal methionine residues of newly synthesized proteins; binds iron(2+)
YP_108759.1	Similar to Escherichia coli DNA ligase LigA or Lig or DnaI or PdeC or Lop or b2411 SWALL:DNLJ_ECOLI (SWALL:P15042) (671 aa) fasta scores: E(): 4.8e-141, 57.84% id in 669 aa, and to Yersinia pestis DNA ligase LigA or ypo2989 SWALL:Q8ZCJ6 (EMBL:AJ414154) (670 aa) fasta scores: E(): 6e-139, 57.33% id in 668 aa. Note: This CDS is longer in its N-terminal region than most of its database matches
YP_108760.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein rsc1397 or rs05761 SWALL:Q8XZJ8 (EMBL:AL646064) (408 aa) fasta scores: E(): 5.9e-54, 47.34% id in 433 aa, and to Neisseria meningitidis hypothetical protein nma0866 SWALL:Q9JVF0 (EMBL:AL162754) (428 aa) fasta scores: E(): 5.2e-08, 25.92% id in 432 aa
YP_108761.1	Similar to Bacillus subtilis chromosome partition protein Smc SWALL:SMC_BACSU (SWALL:P51834) (1186 aa) fasta scores: E(): 7.4e-30, 29.27% id in 1206 aa, and to Burkholderia cepacia chromosome partition protein Smc SWALL:Q8VVA2 (EMBL:AJ417689) (1172 aa) fasta scores: E(): 0, 88.88% id in 1170 aa
YP_108762.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc1395 or rs05759 SWALL:Q8XZK0 (EMBL:AL646064) (306 aa) fasta scores: E(): 2.2e-46, 48.65% id in 298 aa, and to Bacillus halodurans hypothetical protein bh1937 SWALL:Q9KBJ0 (EMBL:AP001513) (298 aa) fasta scores: E(): 9e-05, 21.66% id in 300 aa
YP_108763.1	catalyzes the formation of succinyldiaminopimelate from N-succinyl-2-amino-6-ketopimelate
YP_108764.1	catalyzes the formation of N-succinyl-2-amino-6-ketopimelate from succinyl-CoA and tetrahydrodipicolinate in the lysine biosynthetic pathway
YP_108765.1	Similar to Escherichia coli protein YffB or b2471 SWALL:YFFB_ECOLI (SWALL:P24178) (118 aa) fasta scores: E(): 3.3e-16, 41.96% id in 112 aa, and to Ralstonia solanacearum hypothetical protein rsc1391 or rs04674 SWALL:Q8XZK4 (EMBL:AL646064) (118 aa) fasta scores: E(): 4.7e-27, 66.37% id in 113 aa. Note: This CDS is longer in its N-terminal region than most of its database matches
YP_108766.1	dapE-encoded N-succinyl-L,L-diaminopimelic acid desuccinylase (DapE), catalyzes the hydrolysis of N-succinyl-L,Ldiaminopimelate L,L-SDAP to L,L-diaminopimelate and succinate. It is a metalloprotease containing dinuclear active sites. Its structure is similar to the carboxypeptidase G2 from Pseudomonas sp. strain RS-16 and the aminopeptidase from Aeromonas proteolytica.
YP_108767.1	involved in methylation of ribosomal protein L3
YP_108768.1	Doubtful CDS. No significant database matches. Contains a repeat at the N-terminal region
YP_108769.1	catalyzes the transfer of a phosphatidyl group to phosphodidylglycerol to form cardiolipin (diphosphatidylglycerol)
YP_108770.1	Full length similarity to Saccharomyces cerevisiae glutathione peroxidase Hyr1 SWALL:GSHJ_YEAST (SWALL:P40581) (163 aa) fasta scores: E(): 1.2e-33, 50.94% id in 159 aa, and to Synechocystis sp.  glutathione peroxidase slr1171 SWALL:GPO_SYNY3 (SWALL:P74250) (169 aa) fasta scores: E(): 4.3e-40, 62.11% id in 161 aa
YP_108771.1	Similar to Escherichia coli, and Escherichia coli O157:H7 hypothetical ABC transporter ATP-binding protein YheS or b3352 or z4713 or ecs4203 SWALL:YHES_ECOLI (SWALL:P45535) (637 aa) fasta scores: E(): 4.1e-97, 53.48% id in 645 aa, and to Pasteurella multocida hypothetical protein pm1582 SWALL:Q9CKM9 (EMBL:AE006195) (640 aa) fasta scores: E(): 2e-101, 52.01% id in 646 aa
YP_108773.1	Sms; stabilizes the strand-invasion intermediate during the DNA repair; involved in recombination of donor DNA and plays an important role in DNA damage repair after exposure to mutagenic agents
YP_108774.1	converts L-alanine to D-alanine which is used in cell wall biosynthesis; binds one pyridoxal phosphate per monomer; forms a homodimer
YP_108775.1	Similar to Escherichia coli hypothetical protein YgeD or b2835 SWALL:YGED_ECOLI (SWALL:P39196) (397 aa) fasta scores: E(): 5.7e-21, 38.18% id in 419 aa, and to Ralstonia solanacearum probable transmembrane protein rsc1370 or rs04653 SWALL:Q8XZM5 (EMBL:AL646064) (438 aa) fasta scores: E(): 3.4e-123, 74.88% id in 438 aa
YP_108776.1	Similar to Escherichia coli phosphomethylpyrimidine kinase ThiD or b2103 SWALL:THID_ECOLI (SWALL:P76422) (266 aa) fasta scores: E(): 6.5e-54, 60.45% id in 263 aa, and to Salmonella typhimurium phosphomethylpyrimidine kinase ThiD or stm2146 SWALL:THID_SALTY (SWALL:P55882) (266 aa) fasta scores: E(): 3.4e-53, 59.69% id in 263 aa
YP_108777.1	Similar to Pseudomonas aeruginosa hypothetical protein pa3089 SWALL:Q9HZB9 (EMBL:AE004733) (321 aa) fasta scores: E(): 5.5e-20, 36.9% id in 317 aa, and to Neisseria meningitidis hypothetical protein nma1561 SWALL:Q9JU01 (EMBL:AL162756) (292 aa) fasta scores: E(): 2.3e-05, 30.59% id in 304 aa
YP_108778.1	Similar to Chlorobium tepidum DNA polymerase, bacteriophage-type ct0206 SWALL:AAM71454 (EMBL:AE012800) (208 aa) fasta scores: E(): 7.4e-28, 43.06% id in 209 aa, and to Thermoanaerobacter tengcongensis uracil-DNA glycosylase tte0077 SWALL:Q8RDF7 (EMBL:AE012981) (186 aa) fasta scores: E(): 3.2e-25, 48.86% id in 176 aa. Note: This CDS has an alternative start codon at residue 65
YP_108779.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 ribosomal-protein-alanine acetyltransferase RimI or b4373 or c5453 or z5974 or ecs5331 SWALL:RIMI_ECOLI (SWALL:P09453) (148 aa) fasta scores: E(): 3.1e-12, 35.61% id in 146 aa, and to Pseudomonas aeruginosa peptide N-acetyltransferase pa4678 SWALL:Q9HVB7 (EMBL:AE004881) (150 aa) fasta scores: E(): 2.8e-20, 46.71% id in 152 aa
YP_108780.1	Similar to Escherichia coli hypothetical protease YeaZ or b1807 SWALL:YEAZ_ECOLI (SWALL:P76256) (231 aa) fasta scores: E(): 1.4e-15, 37.28% id in 236 aa, and to Pseudomonas aeruginosa hypothetical protein pa3685 SWALL:Q9HXV5 (EMBL:AE004788) (226 aa) fasta scores: E(): 4e-19, 43.69% id in 238 aa
YP_108781.1	Similar to Homo sapiens acyl-CoA-binding protein Dbi SWALL:ACBP_HUMAN (SWALL:P07108) (86 aa) fasta scores: E(): 3.1e-11, 45.57% id in 79 aa, and to Ralstonia solanacearum probable acyl-CoA-binding protein rsc1366 or rs04648 SWALL:Q8XZM9 (EMBL:AL646064) (105 aa) fasta scores: E(): 1.2e-23, 66.29% id in 89 aa
YP_108782.1	Similar to Escherichia coli  ATP-dependent RNA helicase RhlE or b0797 SWALL:RHLE_ECOLI (SWALL:P25888) (454 aa) fasta scores: E(): 1e-39, 43.29% id in 455 aa, and to Ralstonia solanacearum  ATP-dependent RNA helicase rsc0952 or rs04426 SWALL:Q8Y0U1 (EMBL:AL646061) (608 aa) fasta scores: E(): 3.9e-74, 58.07% id in 458 aa. CDS is extended at the N-terminus in comparison to orthologues
YP_108783.1	Catalyzes the first step in the glyoxalate cycle, which converts lipids to carbohydrates
YP_108784.1	Similar to Ralstonia solanacearum hypothetical protein rsp1159 or rs05426 SWALL:Q8XQR2 (EMBL:AL646083) (146 aa) fasta scores: E(): 2.1e-22, 50% id in 146 aa, and to Brucella melitensis universal stress protein family bmei0102 SWALL:Q8YJI1 (EMBL:AE009453) (149 aa) fasta scores: E(): 3.5e-13, 37.58% id in 149 aa
YP_108785.1	Similar to Escherichia coli hypothetical transcriptional regulator YeaT or b1799 SWALL:YEAT_ECOLI (SWALL:P76250) (307 aa) fasta scores: E(): 2.8e-33, 35.51% id in 290 aa, and to Ralstonia solanacearum probable transcription regulator protein rsc1360 or rs04642 SWALL:Q8XZN5 (EMBL:AL646064) (309 aa) fasta scores: E(): 9.6e-97, 78.93% id in 299 aa
YP_108786.1	Similar to Ralstonia solanacearum  2-haloalkanoic acid dehalogenase rsc1362 or rs04644 SWALL:Q8XZN3 (EMBL:AL646064) (233 aa) fasta scores: E(): 2.6e-49, 61.94% id in 226 aa, and to Pseudomonas sp. 2-haloalkanoic acid dehalogenase SWALL:HAD_PSESP (SWALL:Q53464) (232 aa) fasta scores: E(): 1.1e-30, 44.06% id in 236 aa
YP_108787.1	Catalyzes the aldol condensation of glyoxylate with acetyl-CoA to form malate as part of the second step of the glyoxylate bypass and an alternative to the tricarboxylic acid cycle
YP_108788.1	Similar to Ralstonia solanacearum hypothetical protein rsc1355 or rs04637 SWALL:Q8XZP0 (EMBL:AL646064) (137 aa) fasta scores: E(): 1.1e-22, 54.96% id in 131 aa, and to Sulfolobus solfataricus hypothetical protein sso2192 SWALL:Q97WM2 (EMBL:AE006825) (276 aa) fasta scores: E(): 1.9e-09, 36.92% id in 130 aa
YP_108789.1	regulator of RNase E; increases half-life and abundance of RNAs; interacts with RNase E possibly inhibiting catalytic activity
YP_108790.1	Similar to Ralstonia solanacearum probable transcription regulator protein rsc3062 or rs00506 SWALL:Q8XUX1 (EMBL:AL646073) (268 aa) fasta scores: E(): 5.5e-56, 60.15% id in 251 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa3927 SWALL:Q9HX87 (EMBL:AE004810) (262 aa) fasta scores: E(): 4.3e-36, 43.47% id in 230 aa
YP_108791.1	Low similarity to Vibrio cholerae acetyltransferase,  vca0402 SWALL:Q9KMF8 (EMBL:AE004375) (172 aa) fasta scores: E(): 8.1e-12, 39.31% id in 117 aa
YP_108792.1	Charges one glutamine molecule and pairs it to its corresponding RNA trinucleotide during protein translation
YP_108793.1	Similar to Ralstonia solanacearum probable lipoprotein transmembrane rsc1178 or rs04543 SWALL:Q8Y066 (EMBL:AL646063) (319 aa) fasta scores: E(): 2.2e-55, 55.09% id in 314 aa, and to Xanthomonas axonopodis hypothetical protein xac0177 SWALL:AAM35069 (EMBL:AE011642) (345 aa) fasta scores: E(): 9.1e-49, 49.83% id in 303 aa
YP_108794.1	Similar to Ralstonia solanacearum  transmembrane protein rsc1177 or rs04548 SWALL:Q8Y067 (EMBL:AL646063) (222 aa) fasta scores: E(): 5.6e-32, 52.45% id in 204 aa, and to Neisseria meningitidis outer membrane protein precursor gna2001 SWALL:Q9JPN6 (EMBL:AF226478) (222 aa) fasta scores: E(): 9.3e-19, 34.8% id in 204 aa
YP_108795.1	Similar to Escherichia coli hypothetical ABC transporter ATP-binding protein YejF or b2180 SWALL:YEJF_ECOLI (SWALL:P33916) (529 aa) fasta scores: E(): 3.7e-79, 51.03% id in 533 aa, and to Ralstonia solanacearum probable ATP-binding ABC transporter protein rsc1176 or rs04549 SWALL:Q8Y068 (EMBL:AL646063) (551 aa) fasta scores: E(): 3.2e-109, 65.23% id in 535 aa
YP_108796.1	Similar to Escherichia coli hypothetical ABC transporter permease YejE or b2179 SWALL:YEJE_ECOLI (SWALL:P33915) (341 aa) fasta scores: E(): 9.3e-68, 50.74% id in 337 aa, and to Ralstonia solanacearum probable transmembrane ABC transporter protein rsc1175 or rs04550 SWALL:Q8Y069 (EMBL:AL646063) (374 aa) fasta scores: E(): 1.8e-98, 70.78% id in 356 aa
YP_108797.1	Similar to Escherichia coli, and Escherichia coli O157:H7 hypothetical ABC transporter permease YejB or b2178 or z3437 or ecs3070 SWALL:YEJB_ECOLI (SWALL:P33914) (364 aa) fasta scores: E(): 3.6e-65, 53.86% id in 362 aa, and to Ralstonia solanacearum probable transmembrane ABC transporter protein rsc1174 or rs04551 SWALL:Q8Y070 (EMBL:AL646063) (351 aa) fasta scores: E(): 6.7e-98, 72.93% id in 351 aa
YP_108798.1	Similar to Escherichia coli hypothetical protein precursor YejA or b2177 SWALL:YEJA_ECOLI (SWALL:P33913) (604 aa) fasta scores: E(): 7.1e-60, 38.03% id in 589 aa, and to Ralstonia solanacearum probable substrate-binding periplasmic rsc1173 or rs04555 SWALL:Q8Y071 (EMBL:AL646063) (625 aa) fasta scores: E(): 9e-140, 60.42% id in 619 aa. Note: This CDS has a possible alternative start codon at residue 84
YP_108799.1	NADH; Catalyzes a key regulatory step in fatty acid biosynthesis
YP_108800.1	Similar to Ralstonia solanacearum probable signal peptide protein rsc2910 or rs00185 SWALL:Q8XVC1 (EMBL:AL646072) (105 aa) fasta scores: E(): 5.4e-12, 57.69% id in 104 aa, and to Bordetella pertussis Vrg-6 SWALL:Q45395 (EMBL:M77374) (105 aa) fasta scores: E(): 1.8e-09, 49.55% id in 113 aa
YP_108802.1	Similar to Mycobacterium tuberculosis hypothetical protein rv0197 or mtv033.05 SWALL:O53648 (EMBL:AL021928) (762 aa) fasta scores: E(): 5.8e-57, 44.79% id in 768 aa, and to Klebsiella pneumoniae nitrate reductase NasA SWALL:NASA_KLEPN (SWALL:Q06457) (866 aa) fasta scores: E(): 7.7e-22, 27.12% id in 505 aa
YP_108803.1	Similar to Azotobacter vinelandii ferredoxin--NADP reductase Fpr SWALL:FENR_AZOVI (SWALL:Q44532) (257 aa) fasta scores: E(): 2.2e-66, 65.47% id in 252 aa, and to Escherichia coli ferredoxin--NADP reductase Fpr or MvrA or b3924 SWALL:FENR_ECOLI (SWALL:P28861) (247 aa) fasta scores: E(): 1.8e-24, 36.99% id in 246 aa
YP_108804.1	together with moaC, is involved in the conversion of a guanosine derivative (GXP) into molybdopterin precursor Z
YP_108805.1	Similar to Azotobacter vinelandii ferredoxin I FdxA SWALL:FER1_AZOVI (SWALL:P00214) (106 aa) fasta scores: E(): 1.2e-25, 63.55% id in 107 aa, and to Ralstonia solanacearum probable ferredoxin protein rsp0807 or rs01900 SWALL:Q8XRM4 (EMBL:AL646081) (112 aa) fasta scores: E(): 1.1e-27, 64.07% id in 103 aa
YP_108806.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa2766 SWALL:Q9I077 (EMBL:AE004704) (193 aa) fasta scores: E(): 3.9e-26, 46.32% id in 177 aa, and to Rhizobium loti probable transcriptional regulator mlr2120 SWALL:Q98J38 (EMBL:AP002999) (195 aa) fasta scores: E(): 4e-11, 32.77% id in 180 aa
YP_108807.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 methionine aminopeptidase Map or b0168 or c0203 or z0178 or ecs0170 SWALL:AMPM_ECOLI (SWALL:P07906) (264 aa) fasta scores: E(): 1.1e-51, 53.9% id in 256 aa, and to Yersinia pestis methionine aminopeptidase Map or ypo3337 SWALL:Q8ZBR7 (EMBL:AJ414156) (261 aa) fasta scores: E(): 9.4e-69, 67.45% id in 252 aa. Note: Also similar to BPSL2160, map (272 aa) fasta scores: E(): 6.7e-52, 52.963% identity in 270 aa overlap
YP_108808.1	Similar to Chromobacterium violaceum hypothetical protein cv2333 SWALL:Q7NVK9 (EMBL:AE016918) (75 aa) fasta scores: E(): 2.2e-14, 61.33% id in 75 aa, and to Pseudomonas syringae conserved domain protein pspto2361 SWALL:Q883J6 (EMBL:AE016864) (76 aa) fasta scores: E(): 2.6e-13, 73.58% id in 53 aa. Possible alternative translational start site
YP_108809.1	Similar to Rhizobium loti fusion protein contains ligase and probable arginosuccinate lyase msi203 SWALL:CAD31608 (EMBL:AL672113) (899 aa) fasta scores: E(): 7.9e-99, 38.19% id in 906 aa, N-terminal region to Rhizobium loti  ligase/carboxylase msi201 SWALL:CAD31606 (EMBL:AL672113) (425 aa) fasta scores: E(): 5.4e-25, 31.08% id in 415 aa and C-terminal region to Rhizobium loti argininosuccinate lyase mll9226 SWALL:Q981V0 (EMBL:AP003015) (927 aa) fasta scores: E(): 4.4e-94, 37.19% id in 898 aa
YP_108810.1	Similar to Alcaligenes eutrophus cysteine synthase CysM SWALL:CYSM_ALCEU (SWALL:Q44004) (339 aa) fasta scores: E(): 1.1e-17, 32.99% id in 291 aa, and to Rhizobium loti  cysteine synthase msi204 SWALL:CAD31609 (EMBL:AL672113) (355 aa) fasta scores: E(): 1.1e-47, 44.27% id in 332 aa
YP_108811.1	Similar to Rhizobium loti hypothetical protein mll9228 SWALL:Q981U8 (EMBL:AP003015) (329 aa) fasta scores: E(): 7.6e-27, 38.35% id in 279 aa, and to Bacillus thuringiensis possible kinase pbt101 SWALL:CAD30141 (EMBL:AL731825) (299 aa) fasta scores: E(): 5.4e-22, 34.74% id in 259 aa
YP_108812.1	with CysN catalyzes the formation of adenylylsulfate from sulfate and ATP
YP_108814.1	catalyzes the formation of 3-phosphonooxypyruvate and glutamate from O-phospho-L-serine and 2-oxoglutarate; required both in major phosphorylated pathway of serine biosynthesis and in the biosynthesis of pyridoxine
YP_108815.1	Similar to Rhizobium loti probable lipopolysaccharide modification acyltransferase mlr0739 SWALL:Q98M44 (EMBL:AP002995) (375 aa) fasta scores: E(): 1.7e-14, 25.84% id in 387 aa, and to Pseudomonas aeruginosa probable O-antigen acetylase pa5238 SWALL:Q9HTV2 (EMBL:AE004936) (662 aa) fasta scores: E(): 6.1e-13, 32.28% id in 381 aa
YP_108817.1	Similar to Thermoplasma acidophilum probable transketolase ta0617 SWALL:Q9HKI2 (EMBL:AL445064) (316 aa) fasta scores: E(): 2.6e-24, 32.67% id in 303 aa, and to Pyrococcus abyssi transketolase C-terminal section Tkt2 or pab0296 SWALL:Q9V1I1 (EMBL:AJ248284) (317 aa) fasta scores: E(): 9.6e-22, 32.65% id in 294 aa
YP_108818.1	Similar to Fusobacterium nucleatum transketolase subunit A fn0294 SWALL:Q8RGJ9 (EMBL:AE010542) (270 aa) fasta scores: E(): 2.2e-33, 42.53% id in 268 aa, and to Methanococcus jannaschii  transketolase N-terminal section mj0681 SWALL:TKTN_METJA (SWALL:Q58094) (274 aa) fasta scores: E(): 2.5e-29, 38.62% id in 277 aa
YP_108822.1	Similar to Escherichia coli alpha-ketoglutarate-dependent taurine dioxygenase TauD or SsiS or b0368 SWALL:TAUD_ECOLI (SWALL:P37610) (282 aa) fasta scores: E(): 1.6e-30, 35.58% id in 281 aa, and to Streptomyces coelicolor  dioxygenase sco7507 or scbac17a6.40C SWALL:Q93J90 (EMBL:AL596248) (315 aa) fasta scores: E(): 8.6e-36, 41.28% id in 281 aa
YP_108823.1	Very low similarity to Bacillus halodurans hypothetical protein bh3371 SWALL:Q9K7J0 (EMBL:AP001518) (255 aa) fasta scores: E(): 4.5e-06, 25.41% id in 244 aa
YP_108824.1	Similar to Pseudomonas putida siderophore non-ribosomal peptide synthetase PpsD SWALL:Q9AKS6 (EMBL:AJ310530) (2246 aa) fasta scores: E(): 4.8e-102, 28.54% id in 2659 aa, and to the C-terminal region of Pseudomonas syringae syringomycin synthetase SyrE SWALL:O85168 (EMBL:AF047828) (9376 aa) fasta scores: E(): 1.5e-94, 27.02% id in 3648 aa
YP_108825.1	Similar to Agrobacterium tumefaciens hypothetical protein atu3925 or agr_l_1841 SWALL:Q8U905 (EMBL:AE009323) (462 aa) fasta scores: E(): 6.5e-41, 33.47% id in 454 aa, and to Xanthomonas campestris hypothetical protein xcc4027 SWALL:AAM43248 (EMBL:AE012524) (463 aa) fasta scores: E(): 2.6e-40, 36.55% id in 465 aa
YP_108826.1	Similar to Rhizobium meliloti  transport transmembrane protein r00235 or smc02910 SWALL:Q92SW7 (EMBL:AL591783) (551 aa) fasta scores: E(): 2e-53, 42.99% id in 407 aa, and to Agrobacterium tumefaciens MFS permease atu0091 or agr_c_139 SWALL:Q8UJ47 (EMBL:AE008983) (542 aa) fasta scores: E(): 2.2e-51, 40.24% id in 410 aa. Note: This CDS is longer in its C-terminal region than most of its database matches
YP_108827.1	Similar to the C-terminal region of Ralstonia solanacearum probable peptide synthetase rsp0641 or rs05860 SWALL:Q8XS40 (EMBL:AL646079) (6889 aa) fasta scores: E(): 3.1e-51, 36.47% id in 584 aa, and to the N-terminal region of Agrobacterium tumefaciens peptide synthetase atu3072 or agr_l_3476 SWALL:Q8UBE4 (EMBL:AE009238) (1344 aa) fasta scores: E(): 2.1e-50, 36.73% id in 569 aa
YP_108828.1	Similar to the C-terminal region of Xylella fastidiosa CysN/CysC bifunctional enzyme CysNC or xf1501 SWALL:CYSN_XYLFA (SWALL:Q9PD78) (623 aa) fasta scores: E(): 9.4e-26, 52.19% id in 205 aa, and to in its C-terminal region similar to the full length of Escherichia coli, and Escherichia coli O157:H7 adenylylsulfate kinase CysC or b2750 or z4058 or ecs3604 SWALL:CYSC_ECOLI (SWALL:P23846) (200 aa) fasta scores: E(): 3.4e-23, 49.7% id in 167 aa
YP_108829.1	Similar to Escherichia coli hypothetical protein precursor YegM or b2074 SWALL:YEGM_ECOLI (SWALL:P76397) (415 aa) fasta scores: E(): 2.5e-37, 36.29% id in 405 aa, and to Rhizobium loti RND efflux membrane fusion protein mll5780 SWALL:Q98B05 (EMBL:AP003007) (417 aa) fasta scores: E(): 1.5e-35, 34.54% id in 414 aa
YP_108830.1	Weakly similar to Escherichia coli probable aminoglycoside efflux pump AcrD or b2470 SWALL:ACRD_ECOLI (SWALL:P24177) (1037 aa) fasta scores: E(): 8.3e-76, 28.27% id in 1054 aa. Similar to Rhizobium loti Rnd efflux transporter mll5779 SWALL:Q98B06 (EMBL:AP003007) (1038 aa) fasta scores: E(): 1.9e-187, 51.79% id in 1029 aa
YP_108831.1	Similar to Streptomyces coelicolor  integral membrane efflux protein sco1892 or sci7.10 SWALL:Q9X9Y0 (EMBL:AL096743) (415 aa) fasta scores: E(): 9.9e-07, 28.76% id in 379 aa, and to Thermotoga maritima permease, tm1336 SWALL:Q9X158 (EMBL:AE001788) (390 aa) fasta scores: E(): 6e-05, 19.3% id in 373 aa
YP_108832.1	Similar to Xanthomonas campestris lipase/esterase EstA or xcc3148 SWALL:Q8P634 (EMBL:AE012430) (594 aa) fasta scores: E(): 7e-14, 23.28% id in 627 aa, and to Xylella fastidiosa lipase/esterase xf0781 SWALL:Q9PF97 (EMBL:AE003919) (597 aa) fasta scores: E(): 1.3e-10, 23.29% id in 631 aa
YP_108833.1	Similar to Vibrio cholerae hypothetical protein vc0334 SWALL:Q9KV24 (EMBL:AE004122) (319 aa) fasta scores: E(): 1.8e-36, 38.48% id in 317 aa
YP_108834.1	catalyzes the formation of 4-phospho-L-aspartate from L-aspartate and ATP, in Bacillus, lysine sensitive; regulated by response to starvation.
YP_108835.1	Similar to Escherichia coli  cell cycle protein MesJ or b0188 SWALL:MESJ_ECOLI (SWALL:P52097) (432 aa) fasta scores: E(): 1.2e-30, 35.79% id in 447 aa, and to Ralstonia solanacearum  cell cycle protein rsc1170 or rs04559 SWALL:Q8Y074 (EMBL:AL646063) (462 aa) fasta scores: E(): 1.7e-42, 43.91% id in 485 aa
YP_108836.1	catalyzes the carboxylation of acetyl-CoA to malonyl-CoA; forms a tetramer composed of two alpha (AccA) and two beta (AccD) subunits; one of the two catalytic subunits that can form the acetyl CoA carboxylase enzyme together with a carrier protein
YP_108837.1	Similar to Ralstonia solanacearum hypothetical protein rsc1168 or rs04576 SWALL:Q8Y076 (EMBL:AL646063) (291 aa) fasta scores: E(): 1.1e-56, 62.62% id in 313 aa, and to Deinococcus radiodurans DNA-3-methyladenine glycosidase II,  dr2584 SWALL:Q9RRB0 (EMBL:AE002087) (225 aa) fasta scores: E(): 6.8e-15, 37.2% id in 215 aa
YP_108838.1	catalyzes a two-step reaction; charges a cysteine by linking its carboxyl group to the alpha-phosphate of ATP then transfers the aminoacyl-adenylate to its tRNA
YP_108839.1	Low similarity to Ralstonia solanacearum probable signal peptide protein rsc1166 or rs04578 SWALL:Q8Y078 (EMBL:AL646063) (219 aa) fasta scores: E(): 5.3e-19, 44.62% id in 186 aa
YP_108840.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 peptidyl-prolyl cis-trans isomerase A precursor PpiA or RotA or Rot or b3363 or c4138 or z4724 or ecs4214 SWALL:PPIA_ECOLI (SWALL:P20752) (190 aa) fasta scores: E(): 1.1e-30, 53.43% id in 189 aa, and to Ralstonia solanacearum probable peptidyl-prolyl cis-trans isomerase A rsc1165 or rs04579 SWALL:Q8Y079 (EMBL:AL646063) (190 aa) fasta scores: E(): 7.5e-37, 60.45% id in 177 aa. Note This CDS is also highly similar to the downstream CDS, BPSL2246 (164 aa) fasta scores: E(): 8.3e-33, 60.736% identity in 163 aa overlap
YP_108841.1	Similar to Escherichia coli peptidyl-prolyl cis-trans isomerase B PpiB or b0525 SWALL:PPIB_ECOLI (SWALL:P23869) (164 aa) fasta scores: E(): 1.9e-41, 66.66% id in 162 aa, and to Pseudomonas aeruginosa peptidyl-prolyl cis-trans isomerase B pa1793 SWALL:Q9I2U9 (EMBL:AE004605) (165 aa) fasta scores: E(): 3e-47, 72.39% id in 163 aa. Note: This CDS is higly similar to the upstream CDS, BPSL2245 (192 aa) fasta scores: E(): 9.4e-36, 60.736% identity in 163 aa overlap
YP_108842.1	catalyzes the formation of 2,3=diacylglucosamine 1-phosphate from UDP-2,3=diacylglucosamine
YP_108843.1	Similar to Bacillus subtilis serine acetyltransferase CysE or CysA SWALL:CYSE_BACSU (SWALL:Q06750) (217 aa) fasta scores: E(): 4.3e-31, 57.89% id in 171 aa, and to Pseudomonas aeruginosa O-acetylserine synthase pa3816 SWALL:Q9HXI6 (EMBL:AE004799) (258 aa) fasta scores: E(): 1.7e-46, 56.92% id in 267 aa
YP_108844.1	Similar to Escherichia coli, and Escherichia coli O6 hypothetical tRNA/rRNA methyltransferase YfhQ or b2532 or c3058 SWALL:YFHQ_ECOLI (SWALL:P77438) (246 aa) fasta scores: E(): 2.8e-30, 44.03% id in 243 aa, and to Ralstonia solanacearum  tRNA/rRNA methyltransferase rsc1161 or rs04590 SWALL:Q8Y083 (EMBL:AL646063) (287 aa) fasta scores: E(): 5.7e-47, 55.47% id in 283 aa
YP_108845.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 inositol-1-monophosphatase SuhB or SsyA SWALL:SUHB_ECOLI (SWALL:P22783) (267 aa) fasta scores: E(): 1.7e-47, 51.96% id in 254 aa, and to Ralstonia solanacearum probable inositol monophosphatase rsc1160 or rs04755 SWALL:Q8Y084 (EMBL:AL646063) (270 aa) fasta scores: E(): 2.7e-70, 68.16% id in 267 aa
YP_108846.1	Similar to Escherichia coli shiga-like toxin IIe variant B subunit SWALL:P71294 (EMBL:U72191) (87 aa) fasta scores: E(): 1, 29.54% id in 88 aa
YP_108847.1	This protein performs the mismatch recognition step during the DNA repair process
YP_108848.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc1150 or rs04601 SWALL:Q8Y094 (EMBL:AL646063) (354 aa) fasta scores: E(): 4.6e-33, 36.13% id in 357 aa. CDS is extended at the C-terminus in comparison to R. solanacearum protein
YP_108849.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 FkbP-type peptidyl-prolyl cis-trans isomerase SlyD SWALL:SLYD_ECOLI (SWALL:P30856) (196 aa) fasta scores: E(): 1.3e-16, 38.41% id in 177 aa, and to Ralstonia solanacearum probable FkbP-type peptidyl-prolyl cis-trans isomerase rsc1149 or rs04602 SWALL:Q8Y095 (EMBL:AL646063) (174 aa) fasta scores: E(): 7.1e-50, 77.34% id in 181 aa
YP_108850.1	Similar to Ralstonia solanacearum hypothetical protein rsc1148 or rs04604 SWALL:Q8Y096 (EMBL:AL646063) (409 aa) fasta scores: E(): 3.9e-79, 52.17% id in 391 aa, and to Salmonella typhimurium  cytoplasmic protein stm1229 SWALL:Q8ZPZ7 (EMBL:AE008753) (373 aa) fasta scores: E(): 5.6e-39, 35.5% id in 383 aa. Possible alternative translational start site
YP_108851.1	Similar to Neisseria gonorrhoeae outer membrane protein H.8 precursor SWALL:H82_NEIGO (SWALL:P11910) (88 aa) fasta scores: E(): 0.023, 43.9% id in 82 aa, and to Acinetobacter sp. hypothetical protein SWALL:Q6F875 (EMBL:CR543861) (88 aa) fasta scores: E(): 0.011, 47.56% id in 82 aa
YP_108852.1	Similar to Ralstonia solanacearum hypothetical protein rsc1147 or rs04606 SWALL:Q8Y097 (EMBL:AL646062) (261 aa) fasta scores: E(): 8.7e-53, 58.91% id in 258 aa, and to Pseudomonas aeruginosa hypothetical protein pa1012 SWALL:Q9I4W1 (EMBL:AE004533) (252 aa) fasta scores: E(): 6.8e-38, 46.85% id in 254 aa
YP_108853.1	Similar to Escherichia coli lipoprotein-34 precursor NlpB or DapX SWALL:NLPB_ECOLI (SWALL:P21167) (344 aa) fasta scores: E(): 0.11, 23.29% id in 395 aa, and to Ralstonia solanacearum probable transmembrane protein rsc1146 or rs04607 SWALL:Q8Y098 (EMBL:AL646062) (398 aa) fasta scores: E(): 4.9e-35, 42.21% id in 398 aa
YP_108854.1	catalyzes the formation of dihydrodipicolinate from L-aspartate 4-semialdehyde and pyruvate in lysine and diaminopimelate biosynthesis
YP_108855.1	Similar to Ralstonia solanacearum hypothetical protein rsc1144 or rs04609 SWALL:Q8Y0A0 (EMBL:AL646062) (190 aa) fasta scores: E(): 1.1e-37, 61.08% id in 185 aa
YP_108856.1	catalyzes a two-step reaction, first charging a tryptophan molecule by linking its carboxyl group to the alpha-phosphate of ATP, followed by transfer of the aminoacyl-adenylate to its tRNA
YP_108857.1	Similar to Ralstonia solanacearum probable integral membrane transmembrane protein rsc1142 or rs04611 SWALL:Q8Y0A2 (EMBL:AL646062) (225 aa) fasta scores: E(): 9.8e-49, 56.33% id in 213 aa, and to Neisseria meningitidis conserved hypothetical integral membrane protein nma1986 SWALL:Q9JT39 (EMBL:AL162757) (212 aa) fasta scores: E(): 1.6e-25, 40.67% id in 209 aa
YP_108858.1	Similar to Ralstonia solanacearum hypothetical protein rsc1141 or rs04612 SWALL:Q8Y0A3 (EMBL:AL646062) (207 aa) fasta scores: E(): 7.5e-57, 70.53% id in 207 aa, and to Pseudomonas aeruginosa hypothetical protein pa3199 SWALL:Q9HZ41 (EMBL:AE004744) (209 aa) fasta scores: E(): 3.7e-47, 60.97% id in 205 aa
YP_108859.1	Similar to Ralstonia solanacearum hypothetical protein rsc1140 or rs04613 SWALL:Q8Y0A4 (EMBL:AL646062) (286 aa) fasta scores: E(): 9.8e-76, 70.65% id in 276 aa, and to Neisseria meningitidis hypothetical protein nmb1824 SWALL:Q9JXZ5 (EMBL:AE002531) (278 aa) fasta scores: E(): 5.8e-44, 47.98% id in 273 aa
YP_108860.1	Similar to Ralstonia solanacearum  hydrolase rsc1135 or rs04618 SWALL:Q8Y0A9 (EMBL:AL646062) (307 aa) fasta scores: E(): 5e-79, 65.51% id in 290 aa, and to Xanthomonas campestris hydrolase xcc4096 SWALL:AAM43317 (EMBL:AE012532) (290 aa) fasta scores: E(): 2.8e-11, 30.99% id in 271 aa
YP_108861.1	Similar to Ralstonia solanacearum hypothetical protein rsc1134 or rs04619 SWALL:Q8Y0B0 (EMBL:AL646062) (268 aa) fasta scores: E(): 1.1e-64, 67.8% id in 264 aa, and to Xanthomonas axonopodis hypothetical protein xac1033 SWALL:AAM35916 (EMBL:AE011733) (274 aa) fasta scores: E(): 8.7e-50, 52.69% id in 260 aa. Possible alternative translational start site
YP_108862.1	Similar to Ralstonia solanacearum hypothetical protein rsc1133 or rs04620 SWALL:Q8Y0B1 (EMBL:AL646062) (175 aa) fasta scores: E(): 3.9e-46, 69.36% id in 173 aa, and to Caulobacter crescentus bacterial transferase cc2643 SWALL:Q9A526 (EMBL:AE005932) (176 aa) fasta scores: E(): 6e-33, 54.65% id in 161 aa
YP_108863.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 33 kDa chaperonin HslO SWALL:HSLO_ECOLI (SWALL:P45803) (292 aa) fasta scores: E(): 5.6e-13, 35.84% id in 318 aa, and to Ralstonia solanacearum  redox regulated molecular chaperone heat-shock-like protein rsc1132 or rs04621 SWALL:Q8Y0B2 (EMBL:AL646062) (338 aa) fasta scores: E(): 2.1e-46, 57.35% id in 340 aa
YP_108864.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc1131 or rs04622 SWALL:Q8Y0B3 (EMBL:AL646062) (137 aa) fasta scores: E(): 4.3e-08, 40% id in 130 aa. Possible alternative upstream translational start site
YP_108865.1	forms a complex with FtsL and FtsQ; colocalizes to the septal region of the dividing cell; membrane protein
YP_108866.1	enolase; catalyzes the formation of phosphoenolpyruvate from 2-phospho-D-glycerate in glycolysis
YP_108867.1	catalyzes the formation of 2-dehydro-3-deoxy-D-octonate 8-phosphate from phosphoenolpyruvate and D-arabinose 5-phosphate in LPS biosynthesis
YP_108868.1	CTP synthase; CTP synthase; cytidine triphosphate synthetase; catalyzes the ATP-dependent amination of UTP to CTP with either L-glutamine or ammonia as the source of nitrogen; in Escherichia coli this enzyme forms a homotetramer
YP_108869.1	Similar to Ralstonia solanacearum  hydrolase rsc1125 or rs04628 SWALL:Q8Y0B9 (EMBL:AL646062) (273 aa) fasta scores: E(): 1.6e-63, 58.88% id in 270 aa. Weakly similar to the C-terminal region of Mus musculus monoglyceride lipase MGLL SWALL:O35678 (EMBL:AJ001118) (303 aa) fasta scores: E(): 0.015, 25.96% id in 285 aa
YP_108870.1	C-terminal region is similar to Neisseria gonorrhoeae competence protein ComA SWALL:COMA_NEIGO (SWALL:P51973) (691 aa) fasta scores: E(): 3.6e-18, 35.73% id in 778 aa> Full length CDS is similar to Xanthomonas campestris DNA uptake/competence protein xcc2123 SWALL:AAM41408 (EMBL:AE012319) (796 aa) fasta scores: E(): 7.5e-29, 38.66% id in 869 aa
YP_108871.1	Similar to Ralstonia solanacearum probable deoxyribonuclease rsc1119 or rs04635 SWALL:Q8Y0C5 (EMBL:AL646062) (271 aa) fasta scores: E(): 1.3e-56, 58.64% id in 266 aa, and to Xanthomonas campestris hypothetical protein xcc1426 SWALL:AAM40723 (EMBL:AE012242) (255 aa) fasta scores: E(): 4.4e-33, 41.17% id in 255 aa
YP_108872.1	Similar to Escherichia coli lipoprotein releasing system ATP-binding protein LolD SWALL:LOLD_ECOLI (SWALL:P75957) (233 aa) fasta scores: E(): 4.5e-38, 56.75% id in 222 aa, and to Pseudomonas aeruginosa probable ATP-binding component of ABC transporter pa2987 SWALL:Q9HZL7 (EMBL:AE004724) (227 aa) fasta scores: E(): 6.6e-41, 62.55% id in 219 aa
YP_108873.1	Similar to Escherichia coli lipoprotein releasing system transmembrane protein LolE SWALL:LOLE_ECOLI (SWALL:P75958) (413 aa) fasta scores: E(): 1.3e-42, 34.54% id in 414 aa, and to Ralstonia solanacearum probable lipoprotein releasing system transmembrane rsc1117 or rs05757 SWALL:Q8Y0C7 (EMBL:AL646062) (416 aa) fasta scores: E(): 1.4e-112, 71.46% id in 417 aa
YP_108874.1	Similar to Ralstonia solanacearum hypothetical signal peptide protein rsc1116 or rs05756 SWALL:Q8Y0C8 (EMBL:AL646062) (359 aa) fasta scores: E(): 7.6e-36, 44.16% id in 351 aa, and to Xanthomonas campestris, and Xanthomonas campestris regulatory protein xcc1845 SWALL:AAM41134 (EMBL:AJ245997) (306 aa) fasta scores: E(): 7.8e-12, 32.01% id in 328 aa
YP_108875.1	Similar to Escherichia coli single-stranded-DNA-specific exonuclease RecJ SWALL:RECJ_ECOLI (SWALL:P21893) (577 aa) fasta scores: E(): 1.4e-93, 49.18% id in 555 aa, and to Ralstonia solanacearum probable single-stranded-DNA-specific exonuclease rsc1115 or rs05755 SWALL:Q8Y0C9 (EMBL:AL646062) (565 aa) fasta scores: E(): 4.1e-152, 69.13% id in 567 aa
YP_108876.1	recognizes the termination signals UGA and UAA during protein translation a specificity which is dependent on amino acid residues residing in loops of the L-shaped tRNA-like molecule of RF2; in some organisms control of PrfB protein levels is maintained through a +1 ribosomal frameshifting mechanism; this protein is similar to release factor 1
YP_108877.1	class II; LysRS2; catalyzes a two-step reaction, first charging a lysine molecule by linking its carboxyl group to the alpha-phosphate of ATP, followed by transfer of the aminoacyl-adenylate to its tRNA; in Methanosarcina barkeri, LysRS2 charges both tRNA molecules for lysine that exist in this organism and in addition can charge the tRNAPyl with lysine in the presence of LysRS1
YP_108878.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc1027 or rs04225 SWALL:Q8Y0L6 (EMBL:AL646062) (250 aa) fasta scores: E(): 5.2e-23, 48.29% id in 234 aa, and to Ralstonia solanacearum glycin-rich transmembrane protein rsp0506 or rs00385 SWALL:Q8XSH0 (EMBL:AL646079) (222 aa) fasta scores: E(): 1.1e-06, 29.69% id in 229 aa. Possible alternative translational start site
YP_108879.1	Similar to Vibrio cholerae hypothetical protein vc0754 SWALL:Q9KTX6 (EMBL:AE004160) (64 aa) fasta scores: E(): 3.2e-15, 64.51% id in 62 aa, and to Escherichia coli, and Escherichia coli O157:H7 hypothetical protein b2524 or z3791 or ecs3390 SWALL:YFHJ_ECOLI (SWALL:P37096) (66 aa) fasta scores: E(): 2.3e-14, 62.5% id in 64 aa
YP_108880.1	Similar to Escherichia coli, and Escherichia coli O157:H7 ferredoxin, 2Fe-2S Fdx SWALL:FER_ECOLI (SWALL:P25528) (110 aa) fasta scores: E(): 5.2e-30, 68.46% id in 111 aa, and to Ralstonia solanacearum probable ferredoxin rsc1025 or rs04229 SWALL:Q8Y0L8 (EMBL:AL646062) (112 aa) fasta scores: E(): 9.5e-33, 75.22% id in 113 aa
YP_108881.1	involved in the maturation of iron-sulfur cluster-containing proteins
YP_108882.1	J-type co-chaperone that regulates the ATPase and peptide-binding activity of Hsc66 chaperone; may function in biogenesis of iron-sulfur proteins
YP_108883.1	Similar to Ralstonia solanacearum hypothetical protein rsc1021 rsc1021 or rs04236 SWALL:Q8Y0M2 (EMBL:AL646062) (106 aa) fasta scores: E(): 4e-34, 84.76% id in 105 aa, and to Pasteurella multocida hypothetical protein Pm0320 pm0320 SWALL:Q9CNV4 (EMBL:AE006068) (107 aa) fasta scores: E(): 1.4e-31, 75.7% id in 107 aa
YP_108884.1	Similar to Ralstonia solanacearum probable NifU protein rsc1020 or rs04249 SWALL:Q8Y0M3 (EMBL:AL646062) (133 aa) fasta scores: E(): 1.5e-43, 88.06% id in 134 aa, and to Neisseria meningitidis NifU protein nmb1380 SWALL:Q9JYX9 (EMBL:AE002486) (128 aa) fasta scores: E(): 3.6e-41, 82.54% id in 126 aa
YP_108885.1	catalyzes the removal of elemental sulfur from cysteine to produce alanine; involved in NAD biosynthesis
YP_108886.1	Similar to Ralstonia solanacearum hypothetical protein rsc1018 or rs04257 SWALL:Q8Y0M5 (EMBL:AL646062) (193 aa) fasta scores: E(): 2.4e-48, 73.86% id in 199 aa, and to Pseudomonas aeruginosa hypothetical protein pa3815 SWALL:Q9HXI7 (EMBL:AE004799) (163 aa) fasta scores: E(): 2.2e-27, 55.26% id in 152 aa
YP_108887.1	Similar to Schizosaccharomyces pombe low molecular weight phosphotyrosine protein phosphatase STP1 or SPAC1071.12c or SPAC926.01c SWALL:PPAL_SCHPO (SWALL:P41893) (156 aa) fasta scores: E(): 3.1e-19, 44.85% id in 136 aa, and to Pseudomonas aeruginosa phosphotyrosine protein phosphatase pa2978 SWALL:Q9HZM6 (EMBL:AE004723) (154 aa) fasta scores: E(): 1.1e-26, 58.1% id in 148 aa
YP_108888.1	Weakly similar to the N-terminal region of Pseudomonas glumae lipase chaperone LipB SWALL:LICH_PSEGL (SWALL:Q05490) (353 aa) fasta scores: E(): 10, 40.78% id in 76 aa
YP_108889.1	Similar to Ralstonia solanacearum  iron-sulfur binding protein rsc1612 or rs03975 SWALL:Q8XYZ4 (EMBL:AL646065) (469 aa) fasta scores: E(): 7.4e-134, 75.31% id in 474 aa, and to Bacillus halodurans hypothetical protein bh1833 SWALL:Q9KBU1 (EMBL:AP001513) (485 aa) fasta scores: E(): 1.1e-65, 39.95% id in 488 aa
YP_108890.1	Similar to Escherichia coli hypothetical protein ykge ykge or b0306 SWALL:YKGE_ECOLI (SWALL:P77252) (239 aa) fasta scores: E(): 1.9e-28, 37.39% id in 238 aa, and to Ralstonia solanacearum hypothetical protein rsc1611 rsc1611 or rs03974 SWALL:Q8XYZ5 (EMBL:AL646065) (241 aa) fasta scores: E(): 2.7e-76, 78.75% id in 240 aa
YP_108891.1	Similar to Ralstonia solanacearum probable transcription regulator protein rsc1610 or rs03973 SWALL:Q8XYZ6 (EMBL:AL646065) (266 aa) fasta scores: E(): 1.3e-78, 84.73% id in 249 aa, and to the C-terminal region of Erwinia chrysanthemi pectin degradation repressor protein KdgR SWALL:KDGR_ERWCH (SWALL:P37728) (305 aa) fasta scores: E(): 3.6e-19, 32.68% id in 257 aa
YP_108892.1	Similar to Thermoanaerobacter tengcongensis transposase TTE0846 SWALL:Q8RBH2 (EMBL:AE013051) (492 aa) fasta scores: E(): 7e-74, 43.32% id in 457 aa, and to Pseudomonas sp.  transposase TnpA SWALL:Q936Y1 (EMBL:U66917) (456 aa) fasta scores: E(): 2.5e-32, 31.23% id in 477 aa
YP_108893.1	Similar to the C-terminus of Escherichia coli penicillin-binding protein 7 precursor PbpG SWALL:PBP7_ECOLI (SWALL:P33364) (313 aa) fasta scores: E(): 6.5e-40, 47.84% id in 278 aa, and to the full length Ralstonia solanacearum  D-alanyl-D-alanine-endopeptidase rsc1609 or rs03972 SWALL:Q8XYZ7 (EMBL:AL646065) (375 aa) fasta scores: E(): 5.4e-63, 55.52% id in 353 aa
YP_108894.1	Similar to Alcaligenes eutrophus granule-associated protein (phasin) PhaP SWALL:Q44013 (EMBL:X85729) (192 aa) fasta scores: E(): 1.7e-37, 71.82% id in 181 aa, and to Ralstonia solanacearum hypothetical protein rsc1605 or rs03967 SWALL:Q8XZ01 (EMBL:AL646065) (193 aa) fasta scores: E(): 2.9e-35, 68.5% id in 181 aa
YP_108895.1	C-terminal region is similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 dihydrolipoamide dehydrogenase LpdA or Lpd SWALL:DLDH_ECOLI (SWALL:P00391) (473 aa) fasta scores: E(): 1.9e-93, 65.75% id in 473 aa. Full length CDS is similar to Ralstonia solanacearum probable dihydrolipoamide dehydrogenase rsc1603 or rs03965 SWALL:Q8XZ03 (EMBL:AL646065) (594 aa) fasta scores: E(): 2.1e-142, 76.88% id in 597 aa
YP_108896.1	Catalyzes the transfer of acetyl from acetyldihydrolipoamide to coenzyme A to form acetyl CoA
YP_108897.1	E1 component; part of pyruvate dehydrogenase; forms a complex with DlaT and LpdC
YP_108898.1	Weakly similar to Rhodobacter capsulatus C4-dicarboxylate transport sensor protein DctS SWALL:DCTS_RHOCA (SWALL:P37739) (657 aa) fasta scores: E(): 3.1e-26, 30.07% id in 788 aa. Similar to Ralstonia solanacearum probable two-component transmembrane sensor histidine kinase transcription regulator protein rsc1598 or rs03960 SWALL:Q8XZ08 (EMBL:AL646065) (857 aa) fasta scores: E(): 1e-180, 57.72% id in 790 aa
YP_108899.1	Similar to Rhizobium meliloti transcriptional regulatory protein FixJ SWALL:FIXJ_RHIME (SWALL:P10958) (204 aa) fasta scores: E(): 1.7e-23, 45.45% id in 198 aa, and to Ralstonia solanacearum probable response regulator transcription regulator protein rsc1597 or rs03959 SWALL:Q8XZ09 (EMBL:AL646065) (210 aa) fasta scores: E(): 4.6e-49, 75.12% id in 205 aa
YP_108900.1	catalyzes the formation of 5,10-methenyltetrahydrofolate from 5,10-methylenetetrahydrofolate and subsequent formation of 10-formyltetrahydrofolate from 5,10-methenyltetrahydrofolate
YP_108901.1	Similar to Escherichia coli oligopeptidase A PrlC or OpdA SWALL:OPDA_ECOLI (SWALL:P27298) (680 aa) fasta scores: E(): 9.6e-133, 49.48% id in 685 aa, and to Ralstonia solanacearum probable oligopeptidase rsc1595 or rs03957 SWALL:Q8XZ11 (EMBL:AL646065) (706 aa) fasta scores: E(): 1.1e-203, 73.12% id in 692 aa. Simlar to BPSS1175, 50.366% identity (50.812% ungapped) in 683 aa overlap
YP_108902.2	involved in translesion DNA polymerization with beta clamp of polymerase III; belongs to Y family of polymerases; does not contain proofreading function
YP_108903.1	Similar to Bacillus subtilis nitrite extrusion protein NarK SWALL:NARK_BACSU (SWALL:P46907) (395 aa) fasta scores: E(): 2.2e-27, 29.13% id in 405 aa, and to Pseudomonas aeruginosa nitrate extrusion protein pa3877 SWALL:O54041 (EMBL:Y15252) (431 aa) fasta scores: E(): 8.7e-87, 52.28% id in 415 aa. Similar to BPSS1154, 56.404% identity (56.824% ungapped) in 406 aa overlap
YP_108904.1	Similar to Escherichia coli nitrite extrusion protein 1 NarK SWALL:NARK_ECOLI (SWALL:P10903) (463 aa) fasta scores: E(): 4.3e-94, 54.6% id in 456 aa, and to Ralstonia solanacearum probable nitrite/nitrate transporter transmembrane protein rsp0973 or rs02305 SWALL:Q8XR86 (EMBL:AL646082) (461 aa) fasta scores: E(): 8.2e-147, 79.17% id in 461 aa
YP_108905.1	Similar to Escherichia coli respiratory nitrate reductase 1 alpha chain NarG or NarC or BisD SWALL:NARG_ECOLI (SWALL:P09152) (1246 aa) fasta scores: E(): 0, 66.9% id in 1254 aa, and to Ralstonia solanacearum probable respiratory nitrate reductase alpha chain oxidoreductase rsp0974 or rs02306 SWALL:Q8XR85 (EMBL:AL646082) (1245 aa) fasta scores: E(): 0, 87.14% id in 1245 aa. Similar to BPSS1159, 66.534% identity (68.271% ungapped) in 1258 aa overlap
YP_108906.1	Similar to Escherichia coli respiratory nitrate reductase 1 beta chain NarH SWALL:NARH_ECOLI (SWALL:P11349) (512 aa) fasta scores: E(): 3.5e-147, 68.72% id in 502 aa, and to Ralstonia solanacearum probable respiratory nitrate reductase oxidoreductase rsp0975 or rs02307 SWALL:Q8XR84 (EMBL:AL646082) (515 aa) fasta scores: E(): 1.3e-182, 85.49% id in 517 aa. Similar to BPSS1158, 73.415% identity (73.415% ungapped) in 489 aa overlap
YP_108907.1	Similar to Escherichia coli, and Escherichia coli O157:H7 respiratory nitrate reductase 1 delta chain NarJ SWALL:NARJ_ECOLI (SWALL:P11351) (236 aa) fasta scores: E(): 3.6e-14, 37.28% id in 228 aa, and to Ralstonia solanacearum  respiratory nitrate reductase oxidoreductase narj or rsp0976 or rs02308 SWALL:Q8XR83 (EMBL:AL646082) (226 aa) fasta scores: E(): 7.3e-47, 64.57% id in 223 aa
YP_108908.1	Similar to Escherichia coli, and Escherichia coli O157:H7 respiratory nitrate reductase 2 gamma chain NarV SWALL:NARV_ECOLI (SWALL:P19316) (226 aa) fasta scores: E(): 4.3e-38, 47.82% id in 230 aa, and to Escherichia coli respiratory nitrate reductase 1 gamma chain NarI or ChlI SWALL:NARI_ECOLI (SWALL:P11350) (225 aa) fasta scores: E(): 1.4e-37, 45.81% id in 227 aa, and to Ralstonia solanacearum probable respiratory nitrate reductase transmembrane protein rsp0977 or rs02309 SWALL:Q8XR82 (EMBL:AL646082) (227 aa) fasta scores: E(): 1.9e-69, 75.77% id in 227 aa. Similar to BPSS1156, 53.097% identity (53.333% ungapped) in 226 aa overlap
YP_108909.1	Similar to Escherichia coli, and Escherichia coli O157:H7 nitrate/nitrite sensor protein NarX or NarR SWALL:NARX_ECOLI (SWALL:P10956) (598 aa) fasta scores: E(): 3.7e-15, 28.96% id in 618 aa, and to Ralstonia solanacearum  transmembrane nitrate/nitrite sensor kinase transcription regulator protein rsp0979 or rs02311 SWALL:Q8XR80 (EMBL:AL646082) (637 aa) fasta scores: E(): 3.3e-135, 58.93% id in 638 aa
YP_108910.1	Similar to Bacillus subtilis transcriptional regulatory protein DegU or Iep SWALL:DEGU_BACSU (SWALL:P13800) (229 aa) fasta scores: E(): 4.4e-22, 35.87% id in 223 aa, and to Ralstonia solanacearum probable nitrate/nitrite response regulator transcription regulator protein rsp0980 or rs02312 SWALL:Q8XR79 (EMBL:AL646082) (222 aa) fasta scores: E(): 8.1e-55, 76.21% id in 227 aa
YP_108911.1	Similar to Ralstonia solanacearum probable exodeoxyribonuclease III protein rsc1593 or rs03955 SWALL:Q8XZ13 (EMBL:AL646065) (269 aa) fasta scores: E(): 1.7e-67, 67.79% id in 267 aa, and to Xanthomonas axonopodis exodeoxyribonuclease III xac4171 SWALL:AAM39006 (EMBL:AE012067) (259 aa) fasta scores: E(): 2e-54, 55.03% id in 258 aa
YP_108912.1	Similar to Escherichia coli, and Escherichia coli O157:H7 nitrogen regulation protein NR(I) GlnG or NtrC or GlnT SWALL:NTRC_ECOLI (SWALL:P06713) (469 aa) fasta scores: E(): 7.5e-84, 55.51% id in 508 aa, and to Ralstonia solanacearum probable nitrogen assimilation regulatory response regulator transcription regulator protein rsc1261 or rs02778 SWALL:Q8XZY4 (EMBL:AL646063) (502 aa) fasta scores: E(): 1.3e-126, 74.75% id in 511 aa
YP_108913.1	Similar to Escherichia coli, and Escherichia coli O157:H7 nitrogen regulation protein NR(II) GlnL or NtrB or GlnR SWALL:NTRB_ECOLI (SWALL:P06712) (349 aa) fasta scores: E(): 1e-35, 42.45% id in 351 aa, and to Ralstonia solanacearum probable nitrogen regulation rsc1260 or rs02784 SWALL:Q8XZY5 (EMBL:AL646063) (361 aa) fasta scores: E(): 8.6e-86, 68.96% id in 348 aa
YP_108914.1	Similar to Escherichia coli glutamine synthetase GlnA SWALL:GLNA_ECOLI (SWALL:P06711) (468 aa) fasta scores: E(): 3.4e-133, 65.51% id in 464 aa, and to Ralstonia solanacearum probable glutamine synthetase rsc1258 or rs02774 SWALL:Q8XZY7 (EMBL:AL646063) (471 aa) fasta scores: E(): 2e-175, 85.77% id in 471 aa
YP_108915.1	Similar to Ralstonia solanacearum hypothetical protein rsc1257 or rs02773 SWALL:Q8XZY8 (EMBL:AL646063) (158 aa) fasta scores: E(): 1.2e-37, 65.78% id in 152 aa. C-terminal region is similar to Mycobacterium tuberculosis hypothetical protein rv0390 or MTCY04D9.02 SWALL:P95198 (EMBL:Z84725) (140 aa) fasta scores: E(): 2.9e-16, 45.32% id in 139 aa
YP_108916.1	Similar to Ralstonia solanacearum hypothetical protein rsc1256 or rs02772 SWALL:Q8XZY9 (EMBL:AL646063) (272 aa) fasta scores: E(): 6.5e-74, 72.18% id in 266 aa, and to Neisseria meningitidis CinA-related protein nmb2128 SWALL:Q9JXC2 (EMBL:AE002560) (266 aa) fasta scores: E(): 1.1e-42, 49.8% id in 257 aa
YP_108917.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc1255 or rs02771 SWALL:Q8XZZ0 (EMBL:AL646063) (285 aa) fasta scores: E(): 2.8e-55, 53.58% id in 265 aa
YP_108918.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc1254 or rs02770 SWALL:Q8XZZ1 (EMBL:AL646063) (324 aa) fasta scores: E(): 7.8e-63, 49.37% id in 318 aa. Weakly similar to Agrobacterium tumefaciens hypothetical protein atu0318 or AGR_C_556 SWALL:Q8UIH7 (EMBL:AE009003) (313 aa) fasta scores: E(): 2.3e-12, 28.57% id in 308 aa
YP_108919.1	Similar to Ralstonia solanacearum hypothetical signal peptide protein rsc1252 or rs02768 SWALL:Q8XZZ3 (EMBL:AL646063) (330 aa) fasta scores: E(): 1.1e-78, 63.57% id in 313 aa
YP_108920.1	Similar to C-terminal regions of Escherichia coli ATP-dependent helicase HrpA SWALL:HRPA_ECOLI (SWALL:P43329) (1300 aa) fasta scores: E(): 1.8e-126, 46.08% id in 1315 aa, and to Salmonella typhimurium helicase, ATP-dependent HrpA or stm1641 SWALL:Q8ZP95 (EMBL:AE008772) (1300 aa) fasta scores: E(): 7.2e-128, 46.3% id in 1313 aa. Poor translational start site, possible gene remnant
YP_108921.1	catalyzes the formation of N-acetyl-L-glutamate from L-glutamate and acetyl-CoA in arginine biosynthesis
YP_108922.1	Similar to Ralstonia solanacearum hypothetical protein rsc1235 or rs02742 SWALL:Q8Y010 (EMBL:AL646063) (91 aa) fasta scores: E(): 1.1e-29, 85.22% id in 88 aa, and to Neisseria meningitidis hypothetical protein nma0419 or nmb2021 SWALL:Q9JQP5 (EMBL:AL162753) (88 aa) fasta scores: E(): 1.8e-23, 67.81% id in 87 aa
YP_108923.1	Similar to Escherichia coli shikimate transporter ShiA SWALL:SHIA_ECOLI (SWALL:P76350) (438 aa) fasta scores: E(): 9e-48, 35.09% id in 416 aa, and to the N-terminal region of Pseudomonas aeruginosa probable MFS transporter pa3595 SWALL:Q9HY31 (EMBL:AE004780) (469 aa) fasta scores: E(): 1.1e-60, 44.6% id in 426 aa. Similar to BPSS1252, 65.176% identity (65.485% ungapped) in 425 aa overlap, and to BPSL1075, 66.914% identity (67.079% ungapped) in 405 aa overlap, and to BPSS2123, 61.893% identity (61.893% ungapped) in 412 aa overlap
YP_108924.1	Possible pseudogene. C-terminal region is similar to Pseudomonas aeruginosa hypothetical protein pa3592 SWALL:Q9HY34 (EMBL:AE004779) (395 aa) fasta scores: E(): 6.1e-98, 69.63% id in 359 aa, and Rhizobium meliloti conserved membrane-anchored protein rb0848 or smb21182 SWALL:Q92V66 (EMBL:AL603645) (394 aa) fasta scores: E(): 1.7e-51, 42.06% id in 359 aa. CDS is extended at the N-terminus in comparison to orthologues. Possible out of frame translational start after codon 56
YP_108925.1	Similar to Pseudomonas aeruginosa probable acyl-CoA dehydrogenase pa3593 SWALL:Q9HY33 (EMBL:AE004779) (575 aa) fasta scores: E(): 1.6e-146, 68.47% id in 571 aa, and to Escherichia coli aidb protein AidB SWALL:AIDB_ECOLI (SWALL:P33224) (541 aa) fasta scores: E(): 2.5e-31, 32.7% id in 526 aa. CDS is extended at the C-terminus in comparison to the E. coli protein and other orthologues. Possible alternative translational start sites
YP_108926.1	Similar to Escherichia coli xanthosine operon regulatory protein XapR or PndR SWALL:XAPR_ECOLI (SWALL:P23841) (294 aa) fasta scores: E(): 1.4e-28, 39.08% id in 261 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa3594 SWALL:Q9HY32 (EMBL:AE004780) (295 aa) fasta scores: E(): 5.7e-68, 61.97% id in 284 aa
YP_108928.1	Poor database matches. C-terminus is weakly similar to N-terminal region is of Neisseria meningitidis hypothetical protein Nma0724 nma0724 SWALL:Q9JVR9 (EMBL:AL162754) (1161 aa) fasta scores: E(): 2.4, 23.69% id in 249 aa
YP_108929.1	Similar to Escherichia coli O157:H7 hypothetical protein ecs1067 SWALL:Q8X2Z4 (EMBL:AP002554) (95 aa) fasta scores: E(): 7.4e-08, 40.96% id in 83 aa, and to Escherichia coli O157:H7 hypothetical protein ecs2281 SWALL:Q8X366 (EMBL:AP002557) (92 aa) fasta scores: E(): 1.4e-07, 43.37% id in 83 aa
YP_108930.1	Similar to Xylella fastidiosa hypothetical protein xf2068 SWALL:Q9PBS2 (EMBL:AE004023) (151 aa) fasta scores: E(): 1.5e-18, 42.1% id in 152 aa
YP_108931.1	Similar to Pseudomonas aeruginosa probable aminotransferase pa0299 SWALL:Q9I6J2 (EMBL:AE004467) (456 aa) fasta scores: E(): 3.5e-110, 57.78% id in 443 aa, and to Pseudomonas fluorescens component of putrescine transport system BioA SWALL:Q9AH00 (EMBL:AF323694) (453 aa) fasta scores: E(): 1.3e-109, 58.07% id in 446 aa. CDS is extended at the N-terminus in comparison to orthologues. Similar to BPSS0468, 96.218% identity (97.240% ungapped) in 476 aa overlap
YP_108932.1	Similar to Pseudomonas aeruginosa probable glutamine synthetase pa0298 SWALL:Q9I6J3 (EMBL:AE004467) (452 aa) fasta scores: E(): 1.2e-104, 55.35% id in 448 aa, and to Caulobacter crescentus glutamine synthetase cc3130 SWALL:Q9A3S2 (EMBL:AE005976) (465 aa) fasta scores: E(): 2.5e-109, 61.53% id in 442 aa. BPSS0469, 87.838% identity (87.838% ungapped) in 444 aa overlap
YP_108933.1	Similar to Pseudomonas aeruginosa probable glutamine amidotransferase pa0297 SWALL:Q9I6J4 (EMBL:AE004467) (250 aa) fasta scores: E(): 7.4e-50, 58.26% id in 242 aa, and to Xanthomonas campestris glutamine amidotransferase xcc2347 SWALL:AAM41625 (EMBL:AE012342) (251 aa) fasta scores: E(): 5.8e-43, 56.01% id in 241 aa. Similar to BPSS0470, 66.537% identity (67.857% ungapped) in 257 aa overlap
YP_108934.1	Similar to Pseudomonas aeruginosa N-formylglutamate amidohydrolase HutG or pa5091 SWALL:Q9HU92 (EMBL:AE004922) (266 aa) fasta scores: E(): 1.1e-50, 54.37% id in 263 aa, and to Pseudomonas putida N-formylglutamate amidohydrolase HutG SWALL:O31201 (EMBL:AF032970) (267 aa) fasta scores: E(): 2.3e-50, 51.56% id in 256 aa
YP_108935.1	catalyzes the deimination of N-formimino-L-glutamate to ammonia and N-formyl-L-glutamate
YP_108936.1	catalyzing the hydrolysis of 4-imidazolone-5-propionate to N-formimidoyl-L-glutamate, the third step in the histidine degradation pathway
YP_108937.1	Similar to Ralstonia solanacearum hypothetical protein rsc2522 or rs01060 SWALL:Q8XWF2 (EMBL:AL646070) (200 aa) fasta scores: E(): 1.6e-15, 42.48% id in 193 aa, and to Pseudomonas putida hypothetical protein in hutC 3'region SWALL:YHUT_PSEPU (SWALL:P24696) (190 aa) fasta scores: E(): 2.8e-15, 40.55% id in 180 aa
YP_108938.1	catalyzes the formation of 4-imidazolone-5-propanoate from urocanate during histidine metabolism
YP_108939.1	Similar to Klebsiella aerogenes histidine utilization repressor HutC SWALL:HUTC_KLEAE (SWALL:P12380) (241 aa) fasta scores: E(): 2e-38, 47.36% id in 228 aa, and to Ralstonia solanacearum probable histidine utilization repressor transcription regulator protein rsc2648 or rs04568 SWALL:Q8XW27 (EMBL:AL646071) (237 aa) fasta scores: E(): 2e-53, 59.38% id in 229 aa
YP_108940.1	catalyzes the degradation of histidine to urocanate and ammmonia
YP_108941.1	Weakly similar to Anabaena sp. 4'-phosphopantetheinyl transferase HetI or all5359 SWALL:HETI_ANASP (SWALL:P37695) (237 aa) fasta scores: E(): 9e-12, 31.57% id in 209 aa, and to the N-terminal region of Streptomyces venezuelae phosphopantetheinyl transferase JadM SWALL:Q9L7M4 (EMBL:AF222693) (262 aa) fasta scores: E(): 1.1e-10, 34.89% id in 235 aa
YP_108942.1	Similar to Ralstonia solanacearum hypothetical protein rsp0795 or rs01912 SWALL:Q8XRN6 (EMBL:AL646080) (290 aa) fasta scores: E(): 6.6e-18, 33.79% id in 290 aa, and to Pseudomonas aeruginosa hypothetical protein pa1239 SWALL:Q9I499 (EMBL:AE004553) (294 aa) fasta scores: E(): 2.9e-17, 31.68% id in 303 aa. CDS is extended at the C-terminus in comparison to orthologues
YP_108943.1	Similar to Escherichia coli regulatory protein SdiA SWALL:SDIA_ECOLI (SWALL:P07026) (240 aa) fasta scores: E(): 7.9e-24, 34.87% id in 238 aa, and to Ralstonia solanacearum probable transcriptional activator of quorum sensing autoinducer synthesis transcription regulator protein rsp0778 or rs01929 SWALL:Q8XRQ3 (EMBL:AL646080) (248 aa) fasta scores: E(): 8.1e-46, 51.03% id in 241 aa
YP_108944.1	Similar to the N-terminal region of Arabidopsis thaliana cryptochrome 1 apoprotein CRY1 or HY4 SWALL:CRY1_ARATH (SWALL:Q43125) (681 aa) fasta scores: E(): 9.1e-64, 39.91% id in 486 aa, and to the full length Caulobacter crescentus deoxyribodipyrimidine photolyase cc1428 SWALL:Q9A8C6 (EMBL:AE005817) (483 aa) fasta scores: E(): 2.6e-93, 50.72% id in 481 aa
YP_108945.1	Similar to Pseudomonas oleovorans plasmid-encoded alkane-1 monooxygenase AlkB SWALL:ALKB_PSEOL (SWALL:P12691) (401 aa) fasta scores: E(): 4.1e-75, 47.75% id in 379 aa, and to Burkholderia cepacia alkane hydroxylase AlkB SWALL:Q9AEN3 (EMBL:AJ293306) (386 aa) fasta scores: E(): 1.2e-132, 81.36% id in 381 aa
YP_108946.1	Similar to Ralstonia solanacearum probable nitric oxide reductase rsp1505 or rs03036 SWALL:Q8XPY1 (EMBL:AL646085) (756 aa) fasta scores: E(): 2.4e-213, 70.34% id in 762 aa. C-terminal region is similar to Pseudomonas aeruginosa nitric-oxide reductase subunit b norb or pa0524 SWALL:NORB_PSEAE (SWALL:Q59647) (466 aa) fasta scores: E(): 5.7e-22, 28.75% id in 480 aa
YP_108947.1	N-terminus is similar to the C-terminal region of Xanthomonas campestris hypothetical protein xcc2626 SWALL:AAM41898 (EMBL:AE012374) (295 aa) fasta scores: E(): 0.017, 32.3% id in 226 aa. C-terminus is weakly similar to the C-terminal region of Pyrobaculum aerophilum hypothetical protein pae3602 SWALL:Q8ZSS9 (EMBL:AE009940) (375 aa) fasta scores: E(): 0.0079, 28.39% id in 331 aa
YP_108948.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc3399 or rs01707 SWALL:Q8XTZ6 (EMBL:AL646075) (403 aa) fasta scores: E(): 5.1e-53, 43.76% id in 393 aa, and to Rhizobium meliloti hypothetical protein ra0682 or sma1252 SWALL:Q92Z28 (EMBL:AE007256) (403 aa) fasta scores: E(): 5.1e-34, 35.86% id in 382 aa. Similar to BPSL2368, 52.030% identity (52.564% ungapped) in 394 aa overlap
YP_108949.1	Catalyzes the reduction of nucleoside 5'-triphosphates to 2'-deoxynucleoside 5'-triphosphates
YP_108950.1	Similar to Ralstonia solanacearum hypothetical protein rsp0964 or rs02295 SWALL:Q8XR95 (EMBL:AL646082) (58 aa) fasta scores: E(): 4.1e-12, 70.45% id in 44 aa. Similar the C-terminal region of Thermoanaerobacter tengcongensis oxygen-sensitive ribonucleoside-triphosphate reductase NrdD or tte1850 SWALL:Q8R8Y4 (EMBL:AE013136) (692 aa) fasta scores: E(): 0.0037, 51.61% id in 31 aa. Possible gene remnant
YP_108951.1	Weakly similar to Clostridium pasteurianum pyruvate formate-lyase activating enzyme Act SWALL:PFLA_CLOPA (SWALL:Q46267) (238 aa) fasta scores: E(): 1e-05, 27.75% id in 209 aa. Similar to Pseudomonas aeruginosa probable radical-activating enzyme pa1919 SWALL:Q9I2I5 (EMBL:AE004618) (232 aa) fasta scores: E(): 3.2e-37, 50.21% id in 231 aa
YP_108952.1	Similar to Pseudomonas aeruginosa hypothetical protein pa3880 SWALL:Q9HXD2 (EMBL:AE004805) (131 aa) fasta scores: E(): 6.5e-23, 64.76% id in 105 aa, and to Ralstonia solanacearum  lipoprotein rsp0967 or rs02298 SWALL:Q8XR92 (EMBL:AL646082) (139 aa) fasta scores: E(): 2.3e-19, 52.99% id in 117 aa. Lower levels of similarity in the C-terminal regions
YP_108953.1	Similar to Ralstonia solanacearum hypothetical protein rsp0968 or rs02299 SWALL:Q8XR91 (EMBL:AL646082) (143 aa) fasta scores: E(): 1.5e-11, 41.42% id in 140 aa. C-terminus is similar to the C-terminal region of Yersinia pestis  lipid carrier protein ypo3477 SWALL:Q8ZBD9 (EMBL:AJ414157) (173 aa) fasta scores: E(): 1.3e-11, 47.17% id in 106 aa
YP_108954.1	Similar to Ralstonia solanacearum hypothetical protein rsp0969 or rs02300 SWALL:Q8XR90 (EMBL:AL646082) (294 aa) fasta scores: E(): 1.6e-53, 49.82% id in 291 aa, and to Yersinia pestis hypothetical protein ypo3480 SWALL:Q8ZBD6 (EMBL:AJ414157) (292 aa) fasta scores: E(): 2e-43, 41.52% id in 301 aa
YP_108955.1	Similar to Escherichia coli  protease YhbU or b3158 SWALL:YHBU_ECOLI (SWALL:P45527) (331 aa) fasta scores: E(): 8.9e-86, 62.84% id in 331 aa, and to Pseudomonas aeruginosa probable protease pa3913 SWALL:Q9HXA0 (EMBL:AE004808) (331 aa) fasta scores: E(): 1.1e-84, 62.53% id in 331 aa. CDS is extended at the N-terminus in comparison to orthologues. Possible alternative translational start site
YP_108956.1	Similar to Ralstonia solanacearum hypothetical protein rsc0114 or rs00984 SWALL:Q8Y367 (EMBL:AL646057) (402 aa) fasta scores: E(): 6.8e-91, 64.81% id in 378 aa, and to Neisseria meningitidis hypothetical protein nma1666 SWALL:Q9JTR4 (EMBL:AL162756) (391 aa) fasta scores: E(): 5.7e-81, 57.88% id in 387 aa. CDS is extended at the N-terminus in comparison to orthologues. Similar to BPSL1551, 62.141% identity (62.632% ungapped) in 383 aa overlap
YP_108957.1	Similar to Ralstonia solanacearum probable transmembrane protein rsp0971 or rs02303 SWALL:Q8XR88 (EMBL:AL646082) (406 aa) fasta scores: E(): 3.5e-25, 32.36% id in 411 aa, and to Rhizobium meliloti hypothetical protein ra0687 or sma1259 SWALL:Q92Z23 (EMBL:AE007256) (452 aa) fasta scores: E(): 1.2e-18, 30.42% id in 447 aa
YP_108958.1	Similar to Ralstonia solanacearum probable transcription regulator protein rsp0966 or rs02297 SWALL:Q8XR93 (EMBL:AL646082) (225 aa) fasta scores: E(): 8.1e-27, 38.59% id in 228 aa. Weakly similar to Synechococcus sp. global nitrogen regulator NtcA SWALL:NTCA_SYNP7 (SWALL:P29283) (222 aa) fasta scores: E(): 5.8e-08, 28.91% id in 211 aa
YP_108959.1	catalyzes the oxygen-independent formation of protoporphyrinogen-IX from coproporphyrinogen-III
YP_108960.1	C-terminal region is similar to the N-terminal region of Salmonella typhimurium methyl-accepting chemotaxis protein II Tar or CheM SWALL:MCP2_SALTY (SWALL:P02941) (553 aa) fasta scores: E(): 1.9e-45, 44.1% id in 390 aa, and to an internal region of Ralstonia solanacearum probable methyl-accepting chemotaxis I MCP-I serine chemoreceptor transmembrane protein rsp0507 or rs00386 SWALL:Q8XSG9 (EMBL:AL646079) (600 aa) fasta scores: E(): 5.3e-47, 39.06% id in 535 aa
YP_108961.1	Similar to Rhodobacter sphaeroides membrane-bound haem-copper protein NnrS SWALL:Q936J2 (EMBL:U62403) (397 aa) fasta scores: E(): 5.1e-40, 38.46% id in 403 aa, and to Ralstonia solanacearum probable transmembrane protein rsc3399 or rs01707 SWALL:Q8XTZ6 (EMBL:AL646075) (403 aa) fasta scores: E(): 5.8e-69, 51.51% id in 396 aa. Similar to BPSL2355, 52.030% identity (52.564% ungapped) in 394 aa overlap
YP_108962.1	with SufCD activates cysteine desulfurase SufS
YP_108963.1	Similar to Escherichia coli probable ATP-dependent transporter SufC SWALL:SUFC_ECOLI (SWALL:P77499) (248 aa) fasta scores: E(): 1.6e-31, 44.81% id in 241 aa, and to Xanthomonas axonopodis ABC transporter ATP-binding protein xac2936 SWALL:AAM37781 (EMBL:AE011935) (254 aa) fasta scores: E(): 3e-32, 44.81% id in 241 aa
YP_108964.1	Weakly similar to Escherichia coli SufD b1681 SWALL:SUFD_ECOLI (SWALL:P77689) (423 aa) fasta scores: E(): 9.9e-06, 21.84% id in 380 aa, and to Xanthomonas axonopodis ABC transporter permease xac2937 SWALL:AAM37782 (EMBL:AE011935) (420 aa) fasta scores: E(): 9.6e-13, 27.13% id in 387 aa
YP_108965.1	Similar to Escherichia coli selenocysteine lyase CsdB or SufS or b1680 SWALL:CSDB_ECOLI (SWALL:P77444) (406 aa) fasta scores: E(): 4.1e-54, 40% id in 410 aa, and to Vibrio cholerae probable cysteine desulfurase vc2309 SWALL:CSD_VIBCH (SWALL:Q9KPQ7) (404 aa) fasta scores: E(): 1.6e-61, 43.27% id in 409 aa
YP_108966.1	Similar to Bacillus halodurans nitrogen fixation protein bh3468 SWALL:Q9K7A1 (EMBL:AP001518) (146 aa) fasta scores: E(): 5.2e-18, 40% id in 135 aa, and to Bacillus subtilis NifU-like protein NifU SWALL:NIFU_BACSU (SWALL:O32163) (147 aa) fasta scores: E(): 4.6e-17, 37.98% id in 129 aa. CDS is extended at the N-terminus in comparison to orthologues
YP_108967.1	Similar to Xanthomonas axonopodis hypothetical protein xac0926 SWALL:AAM35814 (EMBL:AE011724) (184 aa) fasta scores: E(): 8.7e-26, 46.4% id in 181 aa, and to Xanthomonas campestris hypothetical protein xcc0849 SWALL:AAM40164 (EMBL:AE012184) (184 aa) fasta scores: E(): 2.3e-25, 45.85% id in 181 aa
YP_108968.1	Similar to Ralstonia solanacearum hypothetical protein rsp1504 or rs03037 SWALL:Q8XPY2 (EMBL:AL646085) (100 aa) fasta scores: E(): 3.2e-10, 40% id in 100 aa, and to Clostridium acetobutylicum hypothetical protein cac0072 SWALL:Q97MW8 (EMBL:AE007520) (77 aa) fasta scores: E(): 3.2e-12, 52.56% id in 78 aa. CDS is extended at the C-terminus in comparison to C. acetobutylicum protein
YP_108969.1	Possible gene remnant. N-terminus is similar to the N-terminal regions of Bacillus subtilis hypothetical protein YhdE SWALL:YHDE_BACSU (SWALL:O07573) (146 aa) fasta scores: E(): 1.9e-22, 50% id in 132 aa, and Neisseria meningitidis hypothetical protein nma2048 SWALL:Q9JT09 (EMBL:AL162758) (147 aa) fasta scores: E(): 6.6e-21, 47.76% id in 134 aa
YP_108970.1	Similar to Ralstonia solanacearum hemerythrin-like protein rsc0777 or rs05077 SWALL:HEMT_RALSO (SWALL:Q8Y1B3) (137 aa) fasta scores: E(): 7e-15, 43.1% id in 116 aa, and to Aquifex aeolicus hemerythrin-like protein AQ_1719 SWALL:HEMT_AQUAE (SWALL:O67614) (131 aa) fasta scores: E(): 0.0095, 28.33% id in 120 aa
YP_108971.1	Similar to Escherichia coli ubiquinol oxidase polypeptide II precursor CyoA SWALL:CYOA_ECOLI (SWALL:P18400) (315 aa) fasta scores: E(): 2.9e-63, 55.51% id in 290 aa, and to Acetobacter pasteurianus ubiquinol oxidase subunit II SWALL:BAB97173 (EMBL:AB086015) (308 aa) fasta scores: E(): 1.2e-72, 66.07% id in 280 aa. Similar to BPSS1897, 93.220% identity (93.537% ungapped) in 295 aa overlap
YP_108972.1	Similar to Escherichia coli, and Escherichia coli O157:H7 ubiquinol oxidase polypeptide I CyoB SWALL:CYOB_ECOLI (SWALL:P18401) (663 aa) fasta scores: E(): 6.3e-183, 66.2% id in 651 aa, and to Acetobacter pasteurianus ubiquinol oxidase subunit I SWALL:BAB97174 (EMBL:AB086015) (663 aa) fasta scores: E(): 4.4e-195, 69.38% id in 650 aa. Similar to BPSS1896, 84.179% identity (84.431% ungapped) in 670 aa overlap
YP_108973.1	Similar to Escherichia coli cytochrome o ubiquinol oxidase subunit III CyoC SWALL:CYOC_ECOLI (SWALL:P18402) (204 aa) fasta scores: E(): 2.7e-45, 56.65% id in 203 aa, and to Acetobacter pasteurianus ubiquinol oxidase subunit III SWALL:BAB97175 (EMBL:AB086015) (201 aa) fasta scores: E(): 1.3e-50, 62.56% id in 203 aa. Similar to BPSS1895, 87.500% identity (87.958% ungapped) in 192 aa overlap
YP_108974.1	Similar to Escherichia coli, and Escherichia coli O157:H7 cytochrome o ubiquinol oxidase CyoD SWALL:CYOD_ECOLI (SWALL:P18403) (109 aa) fasta scores: E(): 4.5e-16, 46.29% id in 108 aa, and to Yersinia pestis cytochrome o ubiquinol oxidase subunit ypo3167 SWALL:Q8ZC55 (EMBL:AJ414155) (110 aa) fasta scores: E(): 2.3e-18, 50% id in 108 aa. Similar to BPSS1894, 80.000% identity (80.000% ungapped) in 110 aa overlap
YP_108975.1	Internal region is weakly similar to Synechococcus sp. omega-3 desaturase DesB SWALL:O07872 (EMBL:U36389) (350 aa) fasta scores: E(): 4.4e-18, 26.3% id in 346 aa
YP_108976.1	Similar to Salmonella typhimurium histidine-binding periplasmic protein precursor HisJ SWALL:HISJ_SALTY (SWALL:P02910) (260 aa) fasta scores: E(): 1.1e-45, 47.26% id in 256 aa, and to Yersinia pestis histidine-binding periplasmic protein ypo2774 SWALL:Q8ZD19 (EMBL:AJ414153) (262 aa) fasta scores: E(): 1.1e-47, 50.95% id in 261 aa. Similar to BPSL3383, 55.636% identity (56.250% ungapped) in 275 aa overlap, and to BPSS0269, 51.953% identity (51.953% ungapped) in 256 aa overlap, and to BPSL1033, 51.575% identity (51.575% ungapped) in 254 aa overlap
YP_108977.1	catalyzes the formation of succinate and glutamate from N(2)-succinylglutamate in arginine catabolism
YP_108978.1	catalyzes the hydrolysis of 2-N-succinylarginine into 2-N-succinylornithine, ammonia and carbon dioxide in arginine degradation
YP_108979.1	a high throughput screen identified this enzyme as an aldehyde dehydrogenase with broad substrate specificity; converts succinylglutamate semialdehyde and NAD to succinylglutamate and NADH
YP_108980.1	Similar to Escherichia coli, and Escherichia coli O157:H7 arginine N-succinyltransferase AstA SWALL:ASTA_ECOLI (SWALL:P76218) (344 aa) fasta scores: E(): 7.4e-60, 46.74% id in 338 aa, and to Pseudomonas aeruginosa arginine N-succinyltransferase, beta chain AruA or pa0897 SWALL:ASTG_PSEAE (SWALL:P80358) (340 aa) fasta scores: E(): 3.9e-53, 42.22% id in 341 aa, and to Pseudomonas aeruginosa arginine N-succinyltransferase, alpha chain AstA or AruF or pa0896 SWALL:ASTA_PSEAE (SWALL:P80357) (338 aa) fasta scores: E(): 2e-39, 37.13% id in 342 aa
YP_108981.1	Similar to Pseudomonas aeruginosa arginine N-succinyltransferase, alpha chain AstA or AruF or pa0896 SWALL:ASTA_PSEAE (SWALL:P80357) (338 aa) fasta scores: E(): 1e-52, 44.34% id in 336 aa, and to Escherichia coli, and Escherichia coli O157:H7 arginine N-succinyltransferase AstA SWALL:ASTA_ECOLI (SWALL:P76218) (344 aa) fasta scores: E(): 1.1e-36, 35.5% id in 338 aa, and to Pseudomonas aeruginosa arginine N-succinyltransferase, beta chain AruG or pa0897 SWALL:ASTG_PSEAE (SWALL:P80358) (340 aa) fasta scores: E(): 2e-36, 36.41% id in 346 aa
YP_108982.1	DapATase; bifunctional enzyme that functions in arginine and lysine biosynthetic pathways; catalyzes the formation of N-acetyl-L-glutamate 5-semialdehyde from 2-oxoglutarate and N(2)-acetyl-L-ornithine or N-succinyl-2-L-amino-6-oxoheptanedioate from 2-oxoglutarate and N-succinyl-L-2,6-diaminoheptanedioate
YP_108983.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa5380 SWALL:Q9HTI4 (EMBL:AE004950) (367 aa) fasta scores: E(): 2.6e-41, 40.06% id in 322 aa, and to Ralstonia solanacearum probable transcriptional regulator transcription regulator protein rsp0054 or rs02029 SWALL:Q8XTQ2 (EMBL:AL646076) (343 aa) fasta scores: E(): 2.9e-35, 35.67% id in 328 aa
YP_108984.1	Similar to Salmonella typhimurium histidine transport ATP-binding protein HisP SWALL:HISP_SALTY (SWALL:P02915) (258 aa) fasta scores: E(): 1.5e-61, 70.35% id in 253 aa, and to Pseudomonas aeruginosa arginine/ornithine transport ATP-binding protein AotP or pa0892 SWALL:AOTP_PSEAE (SWALL:O30506) (254 aa) fasta scores: E(): 1.3e-61, 71.93% id in 253 aa. Similar to BPSL1030, 87.747% identity (87.747% ungapped) in 253 aa overlap, and to BPSS0983, 78.656% identity (78.656% ungapped) in 253 aa overlap, and to BPSS2335, 51.417% identity (54.043% ungapped) in 247 aa overlap, and to the C-terminal region of BPSS1671, 52.362% identity (53.629% ungapped) in 254 aa overlap
YP_108985.1	Similar to Salmonella typhimurium, and Salmonella typhi histidine transport system permease HisM SWALL:HISM_SALTY (SWALL:P02912) (235 aa) fasta scores: E(): 1.2e-59, 61.96% id in 234 aa, and to Yersinia pestis histidine transport system permease ypo2776 SWALL:Q8ZD17 (EMBL:AJ414153) (238 aa) fasta scores: E(): 1.9e-60, 63.36% id in 232 aa. Similar to BPSL1031, 74.138% identity (74.138% ungapped) in 232 aa overlap, and to BPSS0982, 67.511% identity (67.511% ungapped) in 237 aa overlap
YP_108986.1	Similar to Salmonella typhimurium, and Salmonella typhi histidine transport system permease HisQ SWALL:HISQ_SALTY (SWALL:P02913) (228 aa) fasta scores: E(): 7.6e-53, 65.19% id in 227 aa, and to Pseudomonas aeruginosa histidine transport system permease pa2924 SWALL:Q9HZS3 (EMBL:AE004718) (229 aa) fasta scores: E(): 8.1e-55, 68% id in 225 aa. Similar to BPSL1032, 79.039% identity (79.039% ungapped) in 229 aa overlap, and to BPSS0981, 77.293% identity (77.293% ungapped) in 229 aa overlap
YP_108987.1	Similar to Ralstonia solanacearum probable lipoprotein rsc2382 or rs01163 SWALL:Q8XWT8 (EMBL:AL646069) (180 aa) fasta scores: E(): 3.6e-28, 47.97% id in 173 aa. N-terminus is similar to the N-terminal region of Escherichia coli, and Escherichia coli O157:H7 acriflavine resistance protein A precursor acrA or MtcA or Lir SWALL:ACRA_ECOLI (SWALL:P31223) (397 aa) fasta scores: E(): 0.12, 30.15% id in 126 aa
YP_108988.1	Weakly similar to Synechococcus sp. hypothetical protein see0027 SWALL:AAM82702 (EMBL:AY120853) (316 aa) fasta scores: E(): 0.0072, 27.15% id in 313 aa, and to Chlorobium tepidum hypothetical protein ct1155 SWALL:AAM72388 (EMBL:AE012876) (354 aa) fasta scores: E(): 0.018, 27.35% id in 329 aa
YP_108989.1	Weakly similar to Mus musculus 1810015a11rik protein SWALL:Q9D8Z7 (EMBL:AK007503) (310 aa) fasta scores: E(): 6.5e-09, 30.69% id in 303 aa, and to Listeria innocua hypothetical protein lin2456 SWALL:Q928S6 (EMBL:AL596172) (248 aa) fasta scores: E(): 2.1e-07, 26.29% id in 270 aa
YP_108990.1	Similar to Methanopyrus kandleri predicted Fe-S oxidoreductase MK0992 SWALL:Q8TWP0 (EMBL:AE010388) (483 aa) fasta scores: E(): 1.8e-33, 31.3% id in 428 aa. Weakly similar to the N-terminal region of Rhodobacter capsulatus magnesium-protoporphyrin IX monomethyl ester oxidative cyclase subunit BchE SWALL:BCHE_RHOCA (SWALL:P26168) (575 aa) fasta scores: E(): 2.1e-10, 25.69% id in 471 aa
YP_108991.1	Similar to Homo sapiens ceramide glucosyltransferase UGCG SWALL:CEGT_HUMAN (SWALL:Q16739) (394 aa) fasta scores: E(): 1.1e-15, 26.7% id in 397 aa, and to Synechocystis sp. ceramide glucosyltransferase slr0813 SWALL:P74046 (EMBL:D90911) (389 aa) fasta scores: E(): 6.3e-25, 28.53% id in 375 aa
YP_108992.1	Similar to Caulobacter crescentus hypothetical protein cc1957 SWALL:Q9A6W9 (EMBL:AE005869) (337 aa) fasta scores: E(): 2e-79, 65.57% id in 337 aa, and to Yersinia pestis hypothetical protein ypo3484 SWALL:Q8ZBD2 (EMBL:AJ414157) (351 aa) fasta scores: E(): 4.6e-74, 63.22% id in 329 aa
YP_108993.1	Similar to Pseudomonas aeruginosa probable hydrolytic enzyme pa3053 SWALL:Q9HZF5 (EMBL:AE004730) (335 aa) fasta scores: E(): 2.2e-83, 68.06% id in 310 aa, and to Xanthomonas campestris hydrolase xcc2854 SWALL:AAM42126 (EMBL:AE012398) (331 aa) fasta scores: E(): 2.4e-75, 61.53% id in 312 aa. CDS is extended at the C-terminus in comparison to orthologues
YP_108994.1	Similar to Escherichia coli pyridoxamine kinase PdxY SWALL:PDXY_ECOLI (SWALL:P77150) (287 aa) fasta scores: E(): 4.5e-52, 52.98% id in 285 aa, and to Pseudomonas aeruginosa pyridoxamine kinase pa5516 SWALL:Q9HT57 (EMBL:AE004964) (288 aa) fasta scores: E(): 2.6e-53, 52.85% id in 280 aa
YP_108995.1	Highly similar to the previously sequenced Burkholderia pseudomallei non-hemolytic phospholipase C precursor PlcN SWALL:PHLN_BURPS (SWALL:Q9RGS8) (700 aa) fasta scores: E(): 0, 97.13% id in 699 aa. Similar to Ralstonia solanacearum probable non-hemolytic phospholipase C rsc0319 or rs03286 SWALL:Q8Y2L6 (EMBL:AL646058) (700 aa) fasta scores: E(): 4.6e-184, 65.57% id in 700 aa. Similar to BPSL0338, 52.705% identity (56.632% ungapped) in 721 aa overlap
YP_108996.1	Similar to Pseudomonas aeruginosa leucine-, isoleucine-, valine-, threonine-, and alanine-binding protein precursor BraC SWALL:BRAC_PSEAE (SWALL:P21175) (373 aa) fasta scores: E(): 6.5e-30, 34.59% id in 370 aa, and to Ralstonia solanacearum  amino-acid transport signal peptide protein rsc3300 or rs02529 SWALL:Q8XU93 (EMBL:AL646074) (377 aa) fasta scores: E(): 1.6e-58, 48.41% id in 378 aa
YP_108997.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein rsp1590 or rs02147 SWALL:Q8XPP8 (EMBL:AL646085) (398 aa) fasta scores: E(): 8.9e-91, 60.05% id in 388 aa, and to Rhizobium loti hypothetical protein mll4416 SWALL:Q98E45 (EMBL:AP003004) (388 aa) fasta scores: E(): 6.2e-68, 46.03% id in 391 aa
YP_108998.1	Similar to Pseudomonas aeruginosa hypothetical protein pa4828 SWALL:Q9HUY2 (EMBL:AE004896) (151 aa) fasta scores: E(): 6.7e-09, 32.43% id in 148 aa, and to Synechocystis sp. hypothetical protein slr1186 SWALL:P74715 (EMBL:D90917) (148 aa) fasta scores: E(): 8.4e-07, 30.46% id in 151 aa
YP_108999.1	No significant database matches to the full length CDS. C-terminus is similar to the C-terminal region of Pseudomonas chlororaphis protein PhaF SWALL:Q8VV54 (EMBL:AB049413) (275 aa) fasta scores: E(): 0.02, 33.53% id in 167 aa. CDS contains an alanine rich C-terminal region
YP_109000.1	Similar to Rhizobium meliloti hypothetical sugar transferase rb0117 or smb20117 SWALL:Q92X45 (EMBL:AL603642) (366 aa) fasta scores: E(): 1.1e-76, 61.76% id in 340 aa, and to Rhizobium meliloti glycosyltransferase rb1021 or smb21581 SWALL:Q92US1 (EMBL:AL603645) (363 aa) fasta scores: E(): 6.6e-72, 58.65% id in 341 aa. Similar to BPSL1444, 71.105% identity (71.307% ungapped) in 353 aa overlap, and to BPSL3312, 68.362% identity (68.362% ungapped) in 354 aa overlap
YP_109001.1	Similar to Xanthomonas axonopodis ATP binding transporter 1 xac3744 SWALL:AAM38587 (EMBL:AE012024) (591 aa) fasta scores: E(): 2.6e-89, 46.04% id in 582 aa, and to Agrobacterium tumefaciens ABC transporter nucleotide binding/ATPase ExsA or atu4728 or AGR_L_309 SWALL:Q8U6S8 (EMBL:AE009401) (600 aa) fasta scores: E(): 4.6e-55, 37.22% id in 583 aa
YP_109002.1	Similar to Escherichia coli alpha,alpha-trehalose-phosphate synthase [UDP-forming] OtsA SWALL:OTSA_ECOLI (SWALL:P31677) (473 aa) fasta scores: E(): 1.2e-97, 52.12% id in 470 aa, and to Ralstonia solanacearum probable alpha,alpha-trehalose-phosphate synthase rsp1105 or rs02613 SWALL:Q8XQW3 (EMBL:AL646082) (465 aa) fasta scores: E(): 1.5e-120, 62.39% id in 468 aa. Similar to BPSL1044, 61.864% identity (62.931% ungapped) in 472 aa overlap
YP_109003.1	Similar to Escherichia coli trehalose-phosphatase OtsB SWALL:OTSB_ECOLI (SWALL:P31678) (266 aa) fasta scores: E(): 5.8e-32, 45.49% id in 222 aa, and to Ralstonia solanacearum probable trehalose-phosphatase rsp1104 or rs02610 SWALL:Q8XQW4 (EMBL:AL646082) (262 aa) fasta scores: E(): 1.6e-38, 49.6% id in 254 aa. Possible alternative translational start site
YP_109004.1	Similar to Neisseria meningitidis  lipoprotein nma1767 SWALL:Q9JTI0 (EMBL:AL162757) (217 aa) fasta scores: E(): 7.2e-18, 31.79% id in 217 aa, and to Ralstonia solanacearum probable lipoprotein rsc0373 or rs03341 SWALL:Q8Y2G3 (EMBL:AL646058) (200 aa) fasta scores: E(): 1.2e-17, 35.53% id in 197 aa. CDS is extended at the N-terminus in comparison to R. solanacearum protein and some orthologues
YP_109005.1	Similar to Vibrio cholerae hypothetical protein vca0037 SWALL:Q9KNC8 (EMBL:AE004347) (150 aa) fasta scores: E(): 1.8e-06, 29.85% id in 134 aa, and to Caulobacter crescentus hypothetical protein cc3502 SWALL:Q9A2Q4 (EMBL:AE006008) (151 aa) fasta scores: E(): 1.8e-06, 31.94% id in 144 aa
YP_109006.1	Weakly similar to Streptomyces coelicolor  integral membrane protein sco1215 or 2scg58.15 SWALL:Q9FC98 (EMBL:AL391017) (316 aa) fasta scores: E(): 3.1e-10, 25.71% id in 280 aa, and to the C-terminal region of Mycobacterium leprae hypothetical protein ml1998 SWALL:Y102_MYCLE (SWALL:P53525) (659 aa) fasta scores: E(): 7e-09, 25.08% id in 291 aa
YP_109007.1	Similar to Xanthomonas campestris ElaA protein xcc3490 SWALL:AAM42760 (EMBL:AE012468) (166 aa) fasta scores: E(): 1.9e-20, 45.57% id in 147 aa, and to Pseudomonas aeruginosa hypothetical protein pa0115 SWALL:Q9I717 (EMBL:AE004449) (150 aa) fasta scores: E(): 4.1e-19, 44.21% id in 147 aa. CDS is extended at the N-terminus in comparison to orthologues
YP_109008.1	Similar to Homo sapiens Pirin, a novel highly conserved nuclear protein, Pir SWALL:PIR_HUMAN (SWALL:O00625) (290 aa) fasta scores: E(): 2.7e-24, 37.59% id in 258 aa, and to Yersinia pestis hypothetical protein ypo2149 SWALL:Q8ZEL5 (EMBL:AJ414151) (289 aa) fasta scores: E(): 7.2e-80, 67.48% id in 286 aa
YP_109009.1	Similar to Yersinia pestis LysR-family transcriptional regulatory protein ypo2150 SWALL:Q8ZEL4 (EMBL:AJ414151) (301 aa) fasta scores: E(): 2.4e-76, 66% id in 300 aa, and to Salmonella typhimurium, and Salmonella typhi  LysR family transcriptional regulator stm0952 or Act or sty0950 SWALL:Q8XET3 (EMBL:AE008740) (303 aa) fasta scores: E(): 1.9e-70, 61.61% id in 297 aa
YP_109010.1	Similar to Xanthomonas axonopodis hypothetical protein xac3617 SWALL:AAM38460 (EMBL:AE012012) (162 aa) fasta scores: E(): 4e-38, 65.4% id in 159 aa, and to Xylella fastidiosa hypothetical protein xf1230 SWALL:Q9PDZ8 (EMBL:AE003957) (162 aa) fasta scores: E(): 8.6e-38, 65.56% id in 151 aa
YP_109011.1	Similar to Escherichia coli, and Escherichia coli O157:H7 CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase PgsA SWALL:PGSA_ECOLI (SWALL:P06978) (181 aa) fasta scores: E(): 7.9e-28, 48.38% id in 186 aa, and to Ralstonia solanacearum probable CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase transmembrane protein rsc1072 or rs04115 SWALL:Q8Y0H2 (EMBL:AL646062) (191 aa) fasta scores: E(): 1.7e-56, 73.05% id in 193 aa
YP_109012.1	The UvrABC repair system catalyzes the recognition and processing of DNA lesions. UvrC both incises the 5' and 3' sides of the lesion. The N-terminal half is responsible for the 3' incision and the C-terminal half is responsible for the 5' incision
YP_109013.1	Similar to Ralstonia solanacearum hypothetical protein rsc1070 or rs04117 SWALL:Q8Y0H4 (EMBL:AL646062) (396 aa) fasta scores: E(): 5e-57, 52.95% id in 389 aa, and to Pseudomonas aeruginosa hypothetical protein pa2852 SWALL:Q9HZZ1 (EMBL:AE004711) (376 aa) fasta scores: E(): 2.5e-56, 47.45% id in 373 aa. CDS is extended at the N-terminus in comparison to orthologues
YP_109014.1	Involved in peptide bond synthesis; alters the affinity of the ribosome for aminoacyl-tRNA
YP_109015.1	Similar to Ralstonia solanacearum probable sigma-54 interacting response regulator transcription regulator protein rsp1667 or rs02226 SWALL:Q8XPH3 (EMBL:AL646086) (491 aa) fasta scores: E(): 1.1e-34, 48.91% id in 460 aa. C-terminus is similar to the C-terminal region of Escherichia coli propionate catabolism operon regulatory protein PrpR SWALL:PRPR_ECOLI (SWALL:P77743) (528 aa) fasta scores: E(): 3.3e-25, 35.19% id in 341 aa. R. solanacearum is extended at the N-terminus in comparison to CDS
YP_109016.1	hydrolyzes the terminal non-reducing N-acetyl-D-hexosamine residues in N-acetyl-beta-D-hexosaminides
YP_109017.1	Catalyzes the formation of holo-ACP, which mediates the essential transfer of acyl fatty acid intermediates during the biosynthesis of fatty acids and lipids
YP_109018.1	involved in the de novo synthesis of pyridoxine (Vitamin B6)
YP_109019.2	involved in DNA repair and RecFOR pathway recombination; RecFOR proteins displace ssDNA-binding protein and facilitate the production of RecA-coated ssDNA
YP_109020.1	Era; Escherichia coli Ras-like protein; Bex; Bacillus Era-complementing segment; essential protein in Escherichia coli that is involved in many cellular processes; GTPase; binds the cell membrane through apparent C-terminal domain; mutants are arrested during the cell cycle; Streptococcus pneumoniae Era binds to RNA and Escherichia coli Era binds 16S rRNA and 30S ribosome
YP_109021.1	cytoplasmic enzyme involved in processing rRNA and some mRNAs; substrates typically have dsRNA regions; forms a homodimer; have N-terminal nuclease and C-terminal RNA-binding domains; requires magnesium as preferred ion for activity
YP_109022.1	Similar to Escherichia coli signal peptidase I LepB SWALL:LEP_ECOLI (SWALL:P00803) (324 aa) fasta scores: E(): 4.5e-22, 43.43% id in 320 aa, and to Ralstonia solanacearum probable signal peptidase I rsc1061 or rs04147 SWALL:Q8Y0I3 (EMBL:AL646062) (305 aa) fasta scores: E(): 6.2e-77, 64.05% id in 306 aa
YP_109023.1	binds to the ribosome on the universally-conserved alpha-sarcin loop
YP_109024.1	Similar to Neisseria meningitidis  thioredoxin nma0966 SWALL:Q9JV75 (EMBL:AL162754) (77 aa) fasta scores: E(): 4.3e-08, 42.1% id in 76 aa. Weakly similar to Corynebacterium nephridii thioredoxin c-1 SWALL:THI1_CORNE (SWALL:P00275) (105 aa) fasta scores: E(): 1.6, 35.18% id in 54 aa
YP_109025.1	Similar to Pseudomonas aeruginosa serine protease MucD SWALL:Q57155 (EMBL:U49151) (474 aa) fasta scores: E(): 1.5e-72, 51.08% id in 460 aa, and to Ralstonia solanacearum probable periplasmic protease signal peptide protein rsc1058 or rs04156 SWALL:Q8Y0I6 (EMBL:AL646062) (505 aa) fasta scores: E(): 2.4e-101, 64.25% id in 470 aa
YP_109026.1	Similar to Pseudomonas aeruginosa sigma factor AlgU regulatory protein MucB or AlgN SWALL:MUCB_PSEAE (SWALL:P38108) (316 aa) fasta scores: E(): 1.4e-11, 30.31% id in 320 aa, and to Escherichia coli, and Escherichia coli O157:H7 sigma E factor regulatory protein rseb precursor RseB SWALL:RSEB_ECOLI (SWALL:P46186) (318 aa) fasta scores: E(): 0.016, 27.45% id in 306 aa
YP_109027.1	Similar to Pseudomonas aeruginosa sigma factor AlgU negative regulatory protein MucA SWALL:MUCA_PSEAE (SWALL:P38107) (194 aa) fasta scores: E(): 0.18, 30.61% id in 196 aa, and to Escherichia coli sigma E factor negative regulatory protein RseA or MclA SWALL:RSEA_ECOLI (SWALL:P38106) (216 aa) fasta scores: E(): 0.26, 28.95% id in 221 aa
YP_109028.1	Member of the extracytoplasmic function sigma factors which are active under specific conditions; binds with the catalytic core of RNA polymerase to produce the holoenzyme and directs bacterial core RNA polymerase to specific promoter elements to initiate transcription; this sigma factor is involved in heat shock and oxidative stress response
YP_109030.1	FabF; beta-ketoacyl-ACP synthase II, KASII; catalyzes a condensation reaction in fatty acid biosynthesis: addition of an acyl acceptor of two carbons from malonyl-ACP; required for the elongation of short-chain unsaturated acyl-ACP
YP_109031.1	carries the fatty acid chain in fatty acid biosynthesis
YP_109032.1	Catalyzes the first of the two reduction steps in the elongation cycle of fatty acid synthesis
YP_109033.1	Similar to Escherichia coli malonyl CoA-acyl carrier protein transacylase fabD or TfpA SWALL:FABD_ECOLI (SWALL:P25715) (308 aa) fasta scores: E(): 4.4e-56, 54.72% id in 307 aa, and to Ralstonia solanacearum probable malonyl CoA-[acyl-carrier-protein] transacylase rsc1051 or rs04178 SWALL:Q8Y0J3 (EMBL:AL646062) (309 aa) fasta scores: E(): 8.2e-89, 81.31% id in 305 aa
YP_109034.1	FabH; beta-ketoacyl-acyl carrier protein synthase III; catalyzes the condensation of acetyl-CoA with malonyl-ACP to initiate cycles of fatty acid elongation; differs from 3-oxoacyl-(acyl carrier protein) synthase I and II in that it utilizes CoA thioesters as primers rather than acyl-ACPs
YP_109035.1	involved in acylation of glycerol-3-phosphate to form 1-acyl-glycerol-3 phosphate for use in phospholipid biosynthesis; functions with PlsY
YP_109036.1	some L32 proteins have zinc finger motifs consisting of CXXC while others do not
YP_109037.1	Similar to Ralstonia solanacearum hypothetical protein rsc1047 or rs04197 SWALL:Q8Y0J7 (EMBL:AL646062) (179 aa) fasta scores: E(): 8e-22, 39.37% id in 193 aa, and to Pseudomonas aeruginosa hypothetical protein pa2971 SWALL:Q9HZN3 (EMBL:AE004723) (178 aa) fasta scores: E(): 1e-05, 27.83% id in 194 aa
YP_109038.1	Maf; overexpression in Bacillus subtilis inhibits septation in the dividing cell
YP_109039.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc1045 or rs04205 SWALL:Q8Y0J8 (EMBL:AL646062) (243 aa) fasta scores: E(): 1e-50, 63.26% id in 245 aa, and to Neisseria meningitidis hypothetical protein nmb1908 SWALL:Q9JXS3 (EMBL:AE002540) (241 aa) fasta scores: E(): 5.3e-38, 51.25% id in 240 aa
YP_109040.1	Similar to Pseudomonas aeruginosa probable peptidase pa2973 SWALL:Q9HZN1 (EMBL:AE004723) (326 aa) fasta scores: E(): 2.9e-53, 50.29% id in 338 aa, and to Neisseria meningitidis  protease nmb2127 SWALL:Q9JXC3 (EMBL:AE002560) (328 aa) fasta scores: E(): 1.4e-46, 45.88% id in 316 aa
YP_109041.1	Similar to Ralstonia solanacearum hypothetical protein rsc1043 or rs04207 SWALL:Q8Y0K0 (EMBL:AL646062) (138 aa) fasta scores: E(): 7.4e-30, 63.93% id in 122 aa. Weakly similar to Burkholderia cepacia biphenyl dioxygenase system ferredoxin component BphF SWALL:BPHF_BURCE (SWALL:P37332) (109 aa) fasta scores: E(): 2.8, 25.8% id in 93 aa
YP_109042.1	Similar to Alcaligenes eutrophus plasmid phosphoglycolate phosphatase CbbZp SWALL:GPHP_ALCEU (SWALL:P40853) (231 aa) fasta scores: E(): 5e-07, 31.94% id in 216 aa, and to Ralstonia solanacearum phosphoglycolate phosphatase rsc1042 or rs04208 SWALL:Q8Y0K1 (EMBL:AL646062) (219 aa) fasta scores: E(): 2.2e-53, 69.4% id in 219 aa
YP_109043.1	Similar to Escherichia coli ribosomal large subunit pseudouridine synthase C RluC SWALL:RLUC_ECOLI (SWALL:P23851) (319 aa) fasta scores: E(): 5.2e-54, 50.94% id in 318 aa, and to Ralstonia solanacearum probable ribosomal large subunit pseudouridine synthase C protein rsc1041 or rs04757 SWALL:Q8Y0K2 (EMBL:AL646062) (331 aa) fasta scores: E(): 2e-84, 70.28% id in 313 aa
YP_109044.1	Similar to Escherichia coli ribonuclease E Rne or Ams or Hmp1 or b1084 SWALL:RNE_ECOLI (SWALL:P21513) (1061 aa) fasta scores: E(): 8.5e-87, 44.09% id in 1100 aa, and to Ralstonia solanacearum probable ribonuclease E rsc1040 or rs04210 SWALL:Q8Y0K3 (EMBL:AL646062) (1014 aa) fasta scores: E(): 1.7e-134, 60.6% id in 1122 aa. CDS is extended at the C-terminus in comparison to E. coli protein
YP_109045.1	together with moaC, is involved in the conversion of a guanosine derivative (GXP) into molybdopterin precursor Z
YP_109046.1	in Escherichia coli MobA links a guanosine 5'-phosphate to molydopterin to form molybdopterin guanine dinucleotide during molybdenum cofactor biosynthesis
YP_109047.1	Similar to Escherichia coli molybdopterin biosynthesis protein MoeA or ChlE or BisB or NarE or b0827 SWALL:MOEA_ECOLI (SWALL:P12281) (411 aa) fasta scores: E(): 1.4e-55, 44.31% id in 413 aa, and to Ralstonia solanacearum probable molybdopterin biosynthesis protein rsc1037 or rs04213 SWALL:Q8Y0K6 (EMBL:AL646062) (429 aa) fasta scores: E(): 4.9e-79, 56.35% id in 433 aa
YP_109048.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc1036 or rs04214 SWALL:Q8Y0K7 (EMBL:AL646062) (101 aa) fasta scores: E(): 1.6e-15, 55.31% id in 94 aa
YP_109049.1	Similar to Sus scrofa diamine acetyltransferase SAT SWALL:ATDA_PIG (SWALL:Q28999) (171 aa) fasta scores: E(): 3.3e-17, 35.36% id in 164 aa, and to Ralstonia solanacearum  acetyltransferase rsc2565 or rs00758 SWALL:Q8XWA9 (EMBL:AL646070) (177 aa) fasta scores: E(): 1.2e-32, 56.86% id in 153 aa
YP_109050.1	No significant database matches to the full length CDS. C-terminal region is similar to Ralstonia solanacearum hypothetical protein rsc1035 or rs04215 SWALL:Q8Y0K8 (EMBL:AL646062) (457 aa) fasta scores: E(): 8.6e-103, 70.87% id in 460 aa, and Xanthomonas axonopodis hypothetical protein xac4348 SWALL:AAM39178 (EMBL:AE012089) (480 aa) fasta scores: E(): 2.1e-76, 55.12% id in 468 aa
YP_109051.1	Involved in the metabolism of aromatic amino acids
YP_109052.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc1033 or rs04217 SWALL:Q8Y0L0 (EMBL:AL646062) (478 aa) fasta scores: E(): 4.4e-116, 66.95% id in 454 aa, and to Neisseria meningitidis hypothetical protein nmb0570 SWALL:Q9K0M2 (EMBL:AE002413) (473 aa) fasta scores: E(): 5e-101, 58.51% id in 458 aa
YP_109053.1	Similar to Ralstonia solanacearum  transmembrane protein rsc1032 or rs04218 SWALL:Q8Y0L1 (EMBL:AL646062) (243 aa) fasta scores: E(): 6.5e-49, 60.96% id in 228 aa, and to Bacillus halodurans hypothetical protein bh1834 SWALL:Q9KBU0 (EMBL:AP001513) (230 aa) fasta scores: E(): 4.3e-08, 30.38% id in 237 aa
YP_109054.1	catalyzes the formation of nictonate and 5-phospho-alpha-D-ribose 1-diphosphate from nicotinate D-ribonucleotide and diphosphate
YP_109055.1	Similar to Pseudomonas stutzeri ferredoxin SWALL:FER_PSEST (SWALL:P08811) (106 aa) fasta scores: E(): 1.7e-27, 66.98% id in 106 aa, and to Ralstonia solanacearum probable ferredoxin protein rsc1114 or rs04001 SWALL:Q8Y0D0 (EMBL:AL646062) (108 aa) fasta scores: E(): 1.5e-33, 80.73% id in 109 aa. Similar to BPSL2210, 64.220% identity (65.421% ungapped) in 109 aa overlap
YP_109056.1	Similar to Ralstonia solanacearum  CreA signal peptide protein rsc1471 or rs03836 SWALL:Q8XZD0 (EMBL:AL646064) (169 aa) fasta scores: E(): 6.2e-42, 72.36% id in 152 aa, and to Pseudomonas aeruginosa hypothetical protein pa4564 SWALL:Q9HVM0 (EMBL:AE004870) (154 aa) fasta scores: E(): 6.4e-29, 55.4% id in 148 aa
YP_109058.1	No significant database matches. CDS is alanine rich and contains a polar C-terminal region
YP_109059.1	Similar to Ralstonia solanacearum hypothetical protein rsc0789 or rs05048 SWALL:Q8Y1A1 (EMBL:AL646061) (73 aa) fasta scores: E(): 5.3e-17, 66.66% id in 72 aa, and to Xanthomonas campestris hypothetical protein xcc2645 SWALL:AAM41917 (EMBL:AE012376) (80 aa) fasta scores: E(): 1.2e-12, 62.31% id in 69 aa
YP_109060.1	Similar to Burkholderia vietnamiensis probable multidrug resistance protein NorM SWALL:NORM_BURVI (SWALL:Q9F5N7) (462 aa) fasta scores: E(): 4.5e-140, 83.62% id in 458 aa, and to Rhizobium loti multidrug efflux protein mll4906 SWALL:Q98D15 (EMBL:AP003005) (467 aa) fasta scores: E(): 2.5e-52, 38.41% id in 453 aa
YP_109061.1	class II family (does not require metal); tetrameric enzyme; fumarase C; reversibly converts (S)-malate to fumarate and water; functions in the TCA cycle
YP_109062.1	Similar to Vibrio cholerae acyl-CoA thioester hydrolase-related protein vca0941 SWALL:Q9KL09 (EMBL:AE004421) (162 aa) fasta scores: E(): 3.7e-29, 54% id in 150 aa, and to Xanthomonas campestris acyl-CoA thioester hydrolase xcc2593 SWALL:AAM41865 (EMBL:AE012371) (163 aa) fasta scores: E(): 8.1e-28, 52.74% id in 146 aa
YP_109063.1	Similar to the N-terminal region of Streptomyces coelicolor  ABC transporter binding lipoprotein sc1a2.25C SWALL:Q9L216 (EMBL:AL939129) (290 aa) fasta scores: E(): 7.1, 62.5% id in 24 aa
YP_109064.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa0279 SWALL:Q9I6L1 (EMBL:AE004466) (232 aa) fasta scores: E(): 7.6e-45, 56.01% id in 216 aa, and to Rhizobium loti transcriptional regulator mlr4605 SWALL:Q98DP9 (EMBL:AP003004) (224 aa) fasta scores: E(): 7.2e-28, 41.96% id in 224 aa
YP_109065.1	Similar to Ralstonia solanacearum  prolin-rich transmembrane protein rsc3315 or rs02545 SWALL:Q8XU78 (EMBL:AL646074) (787 aa) fasta scores: E(): 3.3e-65, 45.09% id in 825 aa
YP_109066.1	ThyA; catalyzes formation of dTMP and 7,8-dihydrofolate from 5,10-methylenetetrahydrofolate and dUMP; involved in deoxyribonucleotide biosynthesis; there are 2 copies in some Bacilli, one of which appears to be phage-derived
YP_109067.1	Similar to Escherichia coli transcriptional regulatory protein ZraR or HydG or b4004 SWALL:ZRAR_ECOLI (SWALL:P14375) (441 aa) fasta scores: E(): 1.4e-48, 40% id in 430 aa, and to Ralstonia solanacearum  sigma-54 interacting transcription regulator protein rsc1186 or rs05718 SWALL:Q8Y058 (EMBL:AL646063) (458 aa) fasta scores: E(): 1.7e-88, 55.75% id in 443 aa. Similar to BPSL2475, 61.674% identity (62.780% ungapped) in 454 aa overlap, and to BPSL0609, 58.652% identity (60.277% ungapped) in 445 aa overlap
YP_109068.1	Poor database matches. Weakly similar to Rhizobium loti hypothetical protein MLL1184 SWALL:Q98L44 (EMBL:AP002996) (143 aa) fasta scores: E(): 6, 35.71% id in 70 aa
YP_109069.1	Poor database matches. Weakly similar to the C-terminal region of Streptomyces aureofaciens  synthase PhaC SWALL:Q8GFF3 (EMBL:AY032926) (813 aa) fasta scores: E(): 0.0036, 28.86% id in 433 aa
YP_109070.1	Similar to Escherichia coli transcriptional regulatory protein ZraR or HydG or b4004 SWALL:ZRAR_ECOLI (SWALL:P14375) (441 aa) fasta scores: E(): 2.3e-45, 39.39% id in 429 aa, and to Ralstonia solanacearum  sigma-54 interacting transcription regulator protein rsc1186 or rs05718 SWALL:Q8Y058 (EMBL:AL646063) (458 aa) fasta scores: E(): 2.3e-84, 53.62% id in 442 aa. Similar to BPSL2474,61.504% identity (62.054% ungapped) in 452 aa overlap, and to BPSL0609, 55.928% identity (57.208% ungapped) in 447 aa overlap. CDS is extended at the N-terminus in comparison to orthologuesand paralogues
YP_109071.1	Similar to Escherichia coli dihydrofolate reductase FolA or TmrA or b0048 SWALL:DYR_ECOLI (SWALL:P00379) (159 aa) fasta scores: E(): 4e-22, 45.34% id in 161 aa, and to Ralstonia solanacearum probable dihydrofolate reductase oxidoreductase rsc0946 or rs04449 SWALL:Q8Y0U7 (EMBL:AL646061) (167 aa) fasta scores: E(): 1.2e-42, 72.39% id in 163 aa
YP_109072.1	Similar to Thermoanaerobacter tengcongensis transposase TTE0846 SWALL:Q8RBH2 (EMBL:AE013051) (492 aa) fasta scores: E(): 3.2e-74, 43.54% id in 457 aa, and to Pseudomonas sp.  transposase TnpA SWALL:Q936Y1 (EMBL:U66917) (456 aa) fasta scores: E(): 1.6e-32, 31.09% id in 476 aa
YP_109073.1	Similar to Escherichia coli, and Escherichia coli O157:H7 PmbA protein b4235 or z5845 or ecs5212 SWALL:PMBA_ECOLI (SWALL:P24231) (450 aa) fasta scores: E(): 1e-74, 47.65% id in 426 aa, and to Ralstonia solanacearum  PmbA protein rsc0945 or rs04460 SWALL:Q8Y0U8 (EMBL:AL646061) (457 aa) fasta scores: E(): 1.3e-136, 75.71% id in 457 aa
YP_109074.1	Similar to Ralstonia solanacearum hypothetical protein rsc0944 or rs04461 SWALL:Q8Y0U9 (EMBL:AL646061) (208 aa) fasta scores: E(): 2.8e-32, 52.65% id in 207 aa, and to Vibrio cholerae hypothetical protein vc2536 SWALL:Q9KP43 (EMBL:AE004323) (193 aa) fasta scores: E(): 2.9e-18, 38.91% id in 203 aa
YP_109075.1	forms a trimer; related to eukaryotic protein gephyrin; functions during molybdenum cofactor biosynthesis
YP_109076.1	3'-5' exoribonuclease specific for small oligoribonuclotides
YP_109077.1	Similar to Arabidopsis thaliana CAAX processing zinc-metallo endoprotease STE24 SWALL:Q94FS8 (EMBL:AF353722) (424 aa) fasta scores: E(): 1.5e-35, 32.93% id in 413 aa, and to Ralstonia solanacearum probable integral membrane protease transmembrane protein rsc0941 or rs04465 SWALL:Q8Y0V2 (EMBL:AL646061) (418 aa) fasta scores: E(): 1.4e-106, 64.89% id in 413 aa
YP_109078.1	EngC; RsgA; CpgA; circularly permuted GTPase; ribosome small subunit-dependent GTPase A; has the pattern G4-G1-G3 as opposed to other GTPases; interacts strongly with 30S ribosome which stimulates GTPase activity
YP_109079.1	Similar to Ralstonia solanacearum hypothetical protein rsc0939 or rs04472 SWALL:Q8Y0V4 (EMBL:AL646061) (104 aa) fasta scores: E(): 1.5e-12, 40.4% id in 99 aa, and to Vibrio cholerae hypothetical protein vc1724 SWALL:Q9KRB8 (EMBL:AE004250) (103 aa) fasta scores: E(): 3.9e-06, 31.86% id in 91 aa
YP_109080.1	catalyzes the formation of adenosylcobinamide-phosphate from adenosylcobyric acid
YP_109081.1	Similar to Ralstonia solanacearum hypothetical protein rsc0937 or rs04477 SWALL:Q8Y0V6 (EMBL:AL646061) (202 aa) fasta scores: E(): 4.9e-42, 60.69% id in 201 aa, and to Brucella melitensis phosphohydrolase bmei0462 SWALL:Q8YII2 (EMBL:AE009489) (207 aa) fasta scores: E(): 8.2e-29, 48.5% id in 200 aa
YP_109083.1	Similar to Bordetella parapertussis transposase for insertion sequence element IS1001 TnpA SWALL:TNPA_BORPA (SWALL:Q06126) (406 aa) fasta scores: E(): 3.6e-138, 78.32% id in 406 aa, and to Burkholderia mallei transposase Tnp SWALL:Q9FDC1 (EMBL:AF285635) (386 aa) fasta scores: E(): 3.8e-162, 99.22% id in 386 aa. CDS is extended at the N-terminus in comparison to B. mallei protein
YP_109084.1	this protein is located at the 30S-50S ribosomal subunit interface and may play a role in the structure and function of the aminoacyl-tRNA binding site
YP_109085.1	methylates guanosine-37 in various tRNAs; uses S-adenosyl-L-methionine to transfer methyl group to tRNA
YP_109086.1	Essential for efficient processing of 16S rRNA
YP_109087.1	binds to lower part of 30S body where it stabilizes two domains; required for efficient assembly of 30S; in Escherichia coli this protein has nuclease activity
YP_109088.1	Similar to C-terminal region of Acetobacter liquefaciens L-sorbosone dehydrogenase SWALL:SNDH_ACELI (SWALL:Q44091) (449 aa) fasta scores: E(): 1.7e-22, 30.9% id in 385 aa, and to the full length Ralstonia solanacearum  membrane-bound dehydrogenase oxidoreductase rsc0932 or rs04482 SWALL:Q8Y0W1 (EMBL:AL646061) (357 aa) fasta scores: E(): 3e-99, 68.87% id in 347 aa
YP_109089.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0929 or rs04485 SWALL:Q8Y0W4 (EMBL:AL646061) (151 aa) fasta scores: E(): 1.1e-29, 56.66% id in 150 aa
YP_109090.1	Similar to Ralstonia solanacearum hypothetical protein rsc0928 or rs04486 SWALL:Q8Y0W5 (EMBL:AL646061) (375 aa) fasta scores: E(): 2.3e-86, 64.73% id in 363 aa, and to Xanthomonas campestris hypothetical protein xcc0015 SWALL:AAM39334 (EMBL:AE012094) (364 aa) fasta scores: E(): 1.2e-80, 58.37% id in 370 aa. Possible alternative translational start site
YP_109091.1	Similar to Escherichia coli, Escherichia coli O157:H7, and Enterobacter aerogenes leucine-responsive regulatory protein Lrp or AlsB or LivR or Ihb or OppI SWALL:LRP_ECOLI (SWALL:P19494) (163 aa) fasta scores: E(): 3.9e-31, 55.55% id in 153 aa, and to Ralstonia solanacearum probable leucine-responsive regulatory DNA-binding transcription regulator protein rsc0927 or rs04487 SWALL:Q8Y0W6 (EMBL:AL646061) (165 aa) fasta scores: E(): 1.8e-46, 77.3% id in 163 aa
YP_109092.1	catalyzes the oxidative deamination of D-amino acids
YP_109093.1	Similar to Solanum tuberosum isovaleryl-CoA dehydrogenase 1, mitochondrial precursor IVD1 SWALL:Q9FS88 (EMBL:AJ278987) (412 aa) fasta scores: E(): 4.5e-10, 26.66% id in 450 aa. N-terminal region is weakly similar to Solanum tuberosum isovaleryl-CoA dehydrogenase 1, mitochondrial precursor IVD1 SWALL:Q9FS88 (EMBL:AJ278987) (412 aa) fasta scores: E(): 4.5e-10, 26.66% id in 450 aa
YP_109094.1	Similar to Bradyrhizobium japonicum electron transfer flavoprotein alpha-subunit EtfA or EtfL SWALL:ETFA_BRAJA (SWALL:P53573) (314 aa) fasta scores: E(): 5.7e-63, 65.59% id in 311 aa, and to Ralstonia solanacearum probable electron transfer flavoprotein etfa or rsc0924 or rs04490 SWALL:Q8Y0W9 (EMBL:AL646061) (311 aa) fasta scores: E(): 2e-80, 81.34% id in 311 aa
YP_109095.1	Similar to Bradyrhizobium japonicum electron transfer flavoprotein beta-subunit EtfB or EtfS SWALL:ETFB_BRAJA (SWALL:P53575) (249 aa) fasta scores: E(): 3.4e-55, 69.47% id in 249 aa, and to Ralstonia solanacearum probable electron transfer flavoprotein EtfB or rsc0923 or rs04491 SWALL:Q8Y0X0 (EMBL:AL646061) (249 aa) fasta scores: E(): 1.4e-70, 85.14% id in 249 aa
YP_109096.1	Similar to Ralstonia solanacearum probable signal peptide protein rsc0922 or rs04493 SWALL:Q8Y0X1 (EMBL:AL646061) (266 aa) fasta scores: E(): 4.2e-62, 64.28% id in 266 aa and to Salmonella typhimurium D-methionine-binding lipoprotein MetQ precursor or stm0245 SWALL:METQ_SALTY (SWALL:Q8ZRN1) (271 aa) fasta scores: E(): 4.4e-42, 48.31% id in 267 aa
YP_109097.1	Similar to Vibrio cholerae probable D-methionine transport system permease MetI or vc0906 SWALL:METI_VIBCH (SWALL:Q9KTJ6) (225 aa) fasta scores: E(): 7.6e-42, 59.71% id in 211 aa, Ralstonia solanacearum probable transmembrane ABC transporter protein rsc0921 or rs04492 SWALL:Q8Y0X2 (EMBL:AL646061) (217 aa) fasta scores: E(): 5.3e-55, 77.41% id in 217 aa, and to Escherichia coli D-methionine transport system permease MetI or b0198 SWALL:METI_ECOLI (SWALL:P31547) (217 aa) fasta scores: E(): 1.6e-36, 54.83% id in 217 aa
YP_109098.1	part of the metNIQ transport system for methionine
YP_109099.1	Weakly similar to several Prokaryotic and Eukaryotic hydrolases including: Mycobacterium tuberculosis possibl oxidoreductase rv0183 or mtci28.23 or mt0192 SWALL:O07427 (EMBL:Z97050) (323 aa) fasta scores: E(): 4.9e-30, 41.01% id in 256 a and to Mus musculus monoglyceride lipase mglL SWALL:O35678 (EMBL:AJ001118) (303 aa) fasta scores: E(): 1.5e-23, 33.33% id in 282 aa
YP_109100.1	Similar to many histone deacetylase-family proteins including: Ralstonia solanacearum hypothetical protein rsc0919 or rs04494 SWALL:Q8Y0X4 (EMBL:AL646061) (307 aa) fasta scores: E(): 4.5e-88, 68.19% id in 305 aa and to Xanthomonas axonopodis acetoin utilization family protein xac0869 SWALL:AAM35757 (EMBL:AE011718) (303 aa) fasta scores: E(): 5.7e-52, 47.5% id in 301 aa
YP_109101.1	Similar in the C-terminus to several e.g. Ralstonia solanacearum  membrane-bound lytic murein transglycosylase B protein MltB or rsc0918 or rs04496 SWALL:Q8Y0X5 (EMBL:AL646061) (372 aa) fasta scores: E(): 9.6e-71, 62.57% id in 326 aa and to Escherichia coli membrane-bound lytic murein transglycosylase B protein MltB or b2701 SWALL:MLTB_ECOLI (SWALL:P41052) (361 aa) fasta scores: E(): 1.6e-26, 37.26% id in 373 aa. Note contains 4xqs and 7xqp repeats between codons 68-89
YP_109102.1	catalyzes the formation of cysteine from 3-O-acetyl-L-serine and hydrogen sulfide
YP_109103.1	Doubtful CDS. Poor database matches. Similar to Aeropyrum pernix hypothetical protein ape0269 SWALL:Q9YFH7 (EMBL:AP000058) (125 aa) fasta scores: E(): 1, 31.42% id in 105 aa
YP_109104.1	Similar to Neisseria gonorrhoeae hypothetical DNA-binding proein ComE SWALL:Q9EU10 (EMBL:AF268317) (99 aa) fasta scores: E(): 7.6e-06, 37.5% id in 104 aa and to Ralstonia solanacearum  ComEA-related signal peptide protein rsc0916 or rs04499 SWALL:Q8Y0X7 (EMBL:AL646061) (105 aa) fasta scores: E(): 8.4e-13, 50.94% id in 106 aa
YP_109105.1	Previously sequenced as Burkholderia pseudomallei ADP-glycero-mannoheptose epimerase GmhD SWALL:Q9WWX6 (EMBL:AF159428) (330 aa) fasta scores: E(): 3.6e-132, 99.09% id in 330 aa, and to Escherichia coli. Highly similar to Escherichia coli O157:H7 ADP-L-glycero-D-manno-heptose-6-epimerase RfaD or Htrm or b3619 or z5046 or ecs4497 SWALL:RFAD_ECOLI (SWALL:P17963) (310 aa) fasta scores: E(): 2.4e-52, 57.36% id in 326 aa
YP_109106.1	Previously sequenced as Burkholderia pseudomallei ADP-heptose synthase WaaE SWALL:Q9WWX7 (EMBL:AF159428) (307 aa) fasta scores: E(): 3.8e-113, 100% id in 307 aa, and to Haemophilus influenzae ADP-heptose synthase RfaE or WaaE or hi1526 SWALL:RFAE_HAEIN (SWALL:O05074) (476 aa) fasta scores: E(): 9.1e-47, 49% id in 302 aa and to Escherichia coli ADP-heptose synthase RfaE or waae or b3052 SWALL:RFAE_ECOLI (SWALL:P76658) (477 aa) fasta scores: E(): 8.8e-46, 49.19% id in 309 aa
YP_109107.1	Highly similar to the previously sequenced Burkholderia pseudomallei  UDP-glucose dehydrogenase Udg SWALL:Q9WWX8 (EMBL:AF159428) (466 aa) fasta scores: E(): 1.1e-178, 99.35% id in 466 aa, and to Pseudomonas aeruginosa UDP-glucose 6-dehydrogenase Udg or pa2022 SWALL:UDG_PSEAE (SWALL:O86422) (453 aa) fasta scores: E(): 2.6e-86, 53.39% id in 457 aa. Note: Also similar to BPSS1833 (474 aa) fasta scores: E(): 1.5e-121, 76.304% identity in 460 aa overlap
YP_109108.1	Similar to many including : Ralstonia solanacearum transmembrane protein rsc0912 or rs04503 SWALL:Q8Y0Y1 (EMBL:AL646061) (425 aa) fasta scores: E(): 1.8e-71, 56.62% id in 415 aa and Neisseria meningitidis periplasmic hypothetical protein Nma2148 SWALL:Q9JST2 (EMBL:AL162758) (389 aa) fasta scores: E(): 1.2e-49, 35.99% id in 389 aa
YP_109110.1	This protein is one of the two subunits of integration host factor, a specific DNA-binding protein that functions in genetic recombination as well as in transcriptional and translational control
YP_109111.1	in Escherichia coli this protein is involved in binding to the leader sequence of mRNAs and is itself bound to the 30S subunit; autoregulates expression via a C-terminal domain; in most gram negative organisms this protein is composed of 6 repeats of the S1 domain while in gram positive there are 4 repeats; the S1 nucleic acid-binding domain is found associated with other proteins
YP_109112.1	Catalyzes the formation of (d)CDP from ATP and (d)CMP
YP_109113.2	fusion of tyrA/aroA
YP_109114.1	Similar to many involved in Phenylalanine biosynthesis: Neisseria gonorrhoeae P-protein [includes: chorismate mutase (EC 5.4.99.5) (cm); prephenate dehydratase (EC 4.2.1.51) (pdt)] PheA SWALL:PHEA_NEIGO (SWALL:Q9ZHY3) (362 aa) fasta scores: E(): 1.8e-64, 50% id in 362 aa, Ralstonia solanacearum probable bifunctional protein: chorismate mutase and prephenate dehydratase PheA or rsc0904 or rs04511 SWALL:Q8Y0Y9 (EMBL:AL646061) (371 aa) fasta scores: E(): 9.6e-85, 61.45% id in 358 aa and to Pseudomonas stutzeri p-protein PheA SWALL:PHEA_PSEST (SWALL:P27603) (365 aa) fasta scores: E(): 3.4e-60, 47.2% id in 358 aa
YP_109115.1	catalyzes the formation of 3-phosphonooxypyruvate and glutamate from O-phospho-L-serine and 2-oxoglutarate; required both in major phosphorylated pathway of serine biosynthesis and in the biosynthesis of pyridoxine
YP_109116.1	Weakyl similar to several including: Ralstonia solanacearum probable signal peptide protein rsc0902 or rs04513 SWALL:Q8Y0Z1 (EMBL:AL646061) (190 aa) fasta scores: E(): 2e-24, 49.48% id in 194 aa and to Candidatus Tremblaya princeps hypothetical protein SWALL:AAM75970 (EMBL:AF481102) (343 aa) fasta scores: E(): 4.3e-07, 29.03% id in 155 aa
YP_109117.1	negatively supercoils closed circular double-stranded DNA
YP_109118.1	Similar to Bordetella avium outer membrane protein A precursor OmpA SWALL:OMPA_BORAV (SWALL:Q05146) (194 aa) fasta scores: E(): 4e-30, 50% id in 218 aa and to Escherichia coli, and Escherichia coli O157:H7 outer membrane protein a precursor OmpA or TolG or z1307 or ecs1041 SWALL:OMPA_ECOLI (SWALL:P02934) (346 aa) fasta scores: E(): 4.2e-22, 53.47% id in 144 aa
YP_109119.1	Involved in ubiquinone biosynthesis
YP_109120.1	Similar to Pseudomonas aeruginosa phosphoglycolate phosphatase 2 Gph2 or pa3172 SWALL:GPH2_PSEAE (SWALL:Q9HZ62) (226 aa) fasta scores: E(): 1.5e-25, 39.43% id in 213 aa, and to Ralstonia solanacearum probable hydrolase rsc0897 or rs04518 SWALL:Q8Y0Z6 (EMBL:AL646061) (229 aa) fasta scores: E(): 3.2e-47, 62.03% id in 216 aa
YP_109121.1	Similar to several including: Rhizobium loti hypothetical protein Mlr5374 SWALL:Q98BY6 (EMBL:AP003006) (199 aa) fasta scores: E(): 9.8e-26, 47.36% id in 190 aa and to Bradyrhizobium japonicum pPmtA protein pmtA SWALL:Q9LCT2 (EMBL:Y09633) (199 aa) fasta scores: E(): 9.8e-20, 42.28% id in 201 aa
YP_109123.1	Similar to Ralstonia solanacearum hypothetical protein rsc2092 or rs03657 SWALL:Q8XXM1 (EMBL:AL646068) (366 aa) fasta scores: E(): 9.6e-27, 33.14% id in 362 aa.Similar to the C-terminal region of Clostridium acetobutylicum molybdopterin biosynthesis enzyme, MoeA, fused to molibdopterin-binding domain cac2020 SWALL:Q97HJ1 (EMBL:AE007706) (636 aa) fasta scores: E(): 1.1e-16, 31.02% id in 303 aa. Note contains an N-terminal DNA-binding protein
YP_109124.1	Similar to Rhizobium meliloti NADH dehydrogenase I chain E 2 NuoE2 or ra0830 or sma1526 SWALL:NUE2_RHIME (SWALL:P56910) (168 aa) fasta scores: E(): 1.2e-08, 30.37% id in 135 aa and to Alcaligenes eutrophus NAD-dependent formate dehydrogenase gamma subunit FdsG SWALL:O87813 (EMBL:AJ223295) (176 aa) fasta scores: E(): 3.1e-22, 48.05% id in 154 aa
YP_109125.1	Similar to many including: Rhizobium loti NAD-dependent formate dehydrogenase beta subunit mll5397 SWALL:Q98BW8 (EMBL:AP003006) (518 aa) fasta scores: E(): 2.5e-125, 60.82% id in 508 aa, Alcaligenes eutrophus NAD-dependent formate dehydrogenase beta subunit FdsB SWALL:O87814 (EMBL:AJ223295) (520 aa) fasta scores: E(): 4.2e-139, 69.38% id in 516 aa and to Rhizobium meliloti NADH dehydrogenase I chain F 2 NuoF2 or ra0829 or sma1525 SWALL:NUF2_RHIME (SWALL:P56913) (421 aa) fasta scores: E(): 6.5e-64, 44.19% id in 405 aa
YP_109126.1	Similar to Rhizobium meliloti NAD-dependent formate dehydrogenase alpha subunit FdsA SWALL:Q9EZD3 (EMBL:AF298190) (959 aa) fasta scores: E(): 0, 71.47% id in 936 aa and to Alcaligenes eutrophus NAD-dependent formate dehydrogenase alpha subunit FdsA SWALL:O87815 (EMBL:AJ223295) (959 aa) fasta scores: E(): 0, 75.7% id in 955 aa
YP_109127.1	Weakly similar to Rhizobium loti NAD-dependent formate dehydrogenase delta subunit mll5393 SWALL:Q98BX1 (EMBL:AP003006) (102 aa) fasta scores: E(): 6e-07, 44.7% id in 85 aa
YP_109128.1	Similar to many oxygenases including: Streptomyces argillaceus oxygenase MtmOII SWALL:O86481 (EMBL:AJ007932) (531 aa) fasta scores: E(): 3.8e-43, 37.09% id in 558 aa and Flavobacterium sp. PcpB pcpB SWALL:Q53961 (EMBL:U60175) (538 aa) fasta scores: E(): 7.1e-40, 32.86% id in 563 aa, and to Flavobacterium sp. PcpB pcpB SWALL:AAF15368 (EMBL:U12290) (538 aa) fasta scores: E(): 1.5e-38, 32.78% id in 549 aa
YP_109130.1	Similar to several membrane transport proteins including: Escherichia coli citrate-proton symporter CitA or Cit SWALL:CIT1_ECOLI (SWALL:P07661) (431 aa) fasta scores: E(): 2.5e-99, 62.16% id in 415 aa, and to Ralstonia solanacearum probable sugar transporter transmembrane protein rsc3059 or rs06072 SWALL:Q8XUX4 (EMBL:AL646073) (431 aa) fasta scores: E(): 6.4e-117, 71.92% id in 431 aa
YP_109131.1	Weakly similar to Thermoanaerobacter tengcongensis predicted glutamine amidotransferases tte2700 SWALL:Q8R6T5 (EMBL:AE013209) (245 aa) fasta scores: E(): 2.2e-13, 40.44% id in 178 aa, and to Clostridium acetobutylicum predicted glutamine amidotransferase cac1764 SWALL:Q97I88 (EMBL:AE007685) (241 aa) fasta scores: E(): 4.2e-13, 38.62% id in 189 aa
YP_109132.1	catalyzes the hydrolysis of a monocarboxylic acid amid to form a monocarboxylate and ammonia
YP_109133.1	disulfide oxidoreductase; integral membrane protein; required for perioplasmic disulfide bond formation; oxidizes DsbA protein
YP_109134.1	Weakly similar to several including: Caulobacter crescentus chaperone XdhC,  cc2617 SWALL:Q9A547 (EMBL:AE005929) (338 aa) fasta scores: E(): 3.2e-35, 40.06% id in 332 aa, and to Pseudomonas aeruginosa hypothetical protein Pa1522 SWALL:Q9I3J1 (EMBL:AE004580) (279 aa) fasta scores: E(): 9.1e-27, 40.24% id in 323 aa
YP_109135.1	catalyzes the formation of inosine from adenosine
YP_109136.1	Similar to several membrane proteins including: Rhizobium meliloti  integral membrane transporter ra0943 or sma1717 SWALL:Q92YE1 (EMBL:AE007280) (475 aa) fasta scores: E(): 7.7e-107, 61.02% id in 449 aa, and to Xanthomonas axonopodis xanthine/uracil permease yieg or xac0309 SWALL:AAM35201 (EMBL:AE011656) (437 aa) fasta scores: E(): 5.1e-55, 39.9% id in 446 aa
YP_109137.1	Catalyzes the deamination of guanine
YP_109138.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc2100 or rs01504 SWALL:Q8XXL3 (EMBL:AL646068) (204 aa) fasta scores: E(): 1.6e-44, 63.83% id in 188 aa and to Pseudomonas aeruginosa hypothetical protein Pa4629 SWALL:Q9HVG2 (EMBL:AE004877) (192 aa) fasta scores: E(): 1.1e-34, 55.13% id in 185 aa
YP_109139.1	Similar to Ralstonia solanacearum probable lipoprotein rsc2124 or rs01480 SWALL:Q8XXI9 (EMBL:AL646068) (213 aa) fasta scores: E(): 2.4e-25, 46.26% id in 214 aa, and to Zymomonas mobilis hypothetical 23.9 kDa protein SWALL:Q9EZA0 (EMBL:AF300471) (220 aa) fasta scores: E(): 0.12, 25.48% id in 208 aa
YP_109140.1	Similar to Ralstonia solanacearum probable aminopeptidase N PepN or rsc2125 or rs01479 SWALL:Q8XXI8 (EMBL:AL646068) (905 aa) fasta scores: E(): 1.1e-170, 66.11% id in 906 aa and to Escherichia coli aminopeptidase N PepN or b0932 SWALL:AMPN_ECOLI (SWALL:P04825) (869 aa) fasta scores: E(): 9.5e-101, 48.6% id in 897 aa
YP_109141.1	catalyzes the transfer of a methyl group from 5-methyltetrahydrofolate to homocysteine to form methionine
YP_109142.1	Similar to Haemophilus influenzae transcriptional activator protein MetR or hi1739 SWALL:METR_HAEIN (SWALL:P45349) (309 aa) fasta scores: E(): 1.7e-64, 56.72% id in 305 aa, and to Pasteurella multocida metr metr or pm0421 SWALL:Q9CNK8 (EMBL:AE006078) (308 aa) fasta scores: E(): 1.9e-65, 56.39% id in 305 aa
YP_109143.1	catalyzes the formation of D-fructose 6-phosphate from fructose-1,6-bisphosphate
YP_109144.1	Doubtful CDS. No significant database matches
YP_109145.1	Doubtful CDS. No significant database matches
YP_109147.1	Similar in the C-terminus to: Rhizobium loti transglycosylase associated gene msl3293 SWALL:Q98GJ9 (EMBL:AP003001) (84 aa) fasta scores: E(): 7.3e-13, 62.02% id in 79 aa and Brucella melitensis hypothetical protein Bmei0216 SWALL:Q8YJ70 (EMBL:AE009464) (84 aa) fasta scores: E(): 2.9e-12, 55.69% id in 79 aa
YP_109148.1	Similar to Ralstonia solanacearum probable signal peptide protein rsp1269 or rs05314 SWALL:Q8XQF8 (EMBL:AL646083) (167 aa) fasta scores: E(): 1.9e-21, 51.22% id in 164 aa
YP_109149.1	Similar to Ralstonia solanacearum  signal peptide protein rsp1270 or rs05315 SWALL:Q8XQF7 (EMBL:AL646083) (417 aa) fasta scores: E(): 1.8e-93, 62.75% id in 392 aa
YP_109150.1	Similar to Pseudomonas aeruginosa fe(III)-pyochelin receptor precursor FptA or pa4221 SWALL:FPTA_PSEAE (SWALL:P42512) (720 aa) fasta scores: E(): 2.5e-07, 25.62% id in 558 aa, and to Ralstonia solanacearum ferrisiderophore receptor protein rsp1271 or rs05316 SWALL:Q8XQF6 (EMBL:AL646083) (779 aa) fasta scores: E(): 1.2e-172, 59.42% id in 769 aa
YP_109151.1	Similar to Ralstonia solanacearum probable transmembrane protein rsp1272 or rs05317 SWALL:Q8XQF5 (EMBL:AL646083) (155 aa) fasta scores: E(): 1.2e-14, 45.63% id in 149 aa
YP_109152.1	catalyzes the interconversion of chorismate to prephenate
YP_109153.1	Similar to Bacillus halodurans DNA polymerase III PolC-type PolC or bh2418 SWALL:DPO3_BACHD (SWALL:Q9KA72) (1433 aa) fasta scores: E(): 1.1e-12, 35.54% id in 166 aa, and to Neisseria meningitidis DNA polymerase III, epsilon subunit nmb1451 SWALL:Q9JYS6 (EMBL:AE002495) (470 aa) fasta scores: E(): 2.2e-27, 42.35% id in 229 aa, and to Bacillus subtilis probable ATP-dependent helicase DinG homolog dinG SWALL:DING_BACSU (SWALL:P54394) (931 aa) fasta scores: E(): 7.6e-14, 38.79% id in 183 aa
YP_109154.1	Similar to Bordetella pertussis cold shock-like protein CspA SWALL:CSPA_BORPE (SWALL:Q9Z5R4) (67 aa) fasta scores: E(): 1.1e-16, 67.16% id in 67 aa, and to Burkholderia multivorans cold-shock protein CspD SWALL:Q8RL32 (EMBL:AY089707) (68 aa) fasta scores: E(): 4.3e-25, 95.45% id in 66 aa
YP_109155.1	Doubtful CDS. No significant database matches
YP_109156.1	Similar to Bordetella pertussis outer membrane porin protein precursor SWALL:OMP_BORPE (SWALL:Q04064) (385 aa) fasta scores: E(): 1.5e-21, 34.94% id in 415 aa, and to Ralstonia solanacearum probable porin signal peptide protein rsp0051 or rs02026 SWALL:Q8XTQ5 (EMBL:AL646076) (382 aa) fasta scores: E(): 7e-58, 45.54% id in 393 aa
YP_109157.1	necessary for efficient RNA polymerase transcription elongation past template-encoded arresting sites; arresting sites in DNA have the property of trapping a certain fraction of elongating RNA polymerases that pass through, resulting in locked ternary complexes. Cleavage of the nascent transcript by cleavage factors such as GreA or GreB allows the resumption of elongation from the new 3'terminus
YP_109158.1	Similar to Escherichia coli, and Escherichia coli O157:H7 guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase (EC 3.1.7.2) SpoT or b3650 or z5076 or ecs4525 SWALL:SPOT_ECOLI (SWALL:P17580) (702 aa) fasta scores: E(): 6.7e-107, 45.63% id in 710 aa, and to Neisseria meningitidis guanosine-3',5'-bis SpoT or nma1917 SWALL:Q9JT97 (EMBL:AL162757) (725 aa) fasta scores: E(): 1.9e-118, 43.77% id in 731 aa
YP_109159.1	Promotes RNA polymerase assembly. Latches the N- and C-terminal regions of the beta' subunit thereby facilitating its interaction with the beta and alpha subunits
YP_109160.1	Essential for recycling GMP and indirectly, cGMP
YP_109161.1	Similar to many proteins of undefined function including: Ralstonia solanacearum hypothetical protein rsc2156 or rs01446 SWALL:Q8XXF8 (EMBL:AL646068) (311 aa) fasta scores: E(): 4.6e-64, 64.42% id in 312 aa, and to Haemophilus influenzae protein Hi0467 SWALL:YICC_HAEIN (SWALL:P44726) (287 aa) fasta scores: E(): 6.6e-13, 33.22% id in 307 aa
YP_109162.1	RNase PH; tRNA nucleotidyltransferase; forms hexamers in Bacillus subtilis; phosphoroltic 3'-5' exoribonuclease; involved in maturation of tRNA precursors and removes terminal nucleotides near CCA acceptor arms of mature tRNAs
YP_109163.1	HAM1-like protein; Rec-dependent growth; RgdB; yggV; it is suspected that this protein functions to remove misincorporated bases such as xanthine or hypoxanthine
YP_109164.1	catalyzes the oxygen-independent formation of protoporphyrinogen-IX from coproporphyrinogen-III
YP_109165.1	Weakly similar to Salmonella typhimurium LT2 gifsy-2 prophage lysozyme stm1028 SWALL:Q8ZQ99 (EMBL:AE008743) (150 aa) fasta scores: E(): 0.0078, 30.18% id in 159 aa
YP_109168.1	Doubtful CDS. No significant database matches
YP_109175.1	C-terminus is similar to the C-terminal region of Rhizobium loti hypothetical protein Msr8070 SWALL:Q984B8 (EMBL:AP003013) (87 aa) fasta scores: E(): 8.7, 34.88% id in 43 aa
YP_109176.1	Weakly similar to Lactococcus delbrueckii bacteriophage LL-H DnaA analog SWALL:Q8SDH3 (EMBL:L46883) (299 aa) fasta scores: E(): 9.6e-05, 24.9% id in 261 aa, and to Bacteriophage phi ETA orf22 SWALL:Q9G023 (EMBL:AP001553) (256 aa) fasta scores: E(): 0.00017, 22.77% id in 202 aa
YP_109177.1	Doubtful CDS. No significant database matches
YP_109178.1	Doubtful CDS. No significant database matches
YP_109179.1	Similar to Escherichia coli O157:H7  DNA binding protein z3946 or ecs3513 SWALL:Q8X969 (EMBL:AE005493) (68 aa) fasta scores: E(): 0.058, 29.5% id in 61 aa, and to Escherichia coli prophage cp4-57 regulatory protein alpa or alp or b2624 SWALL:ALPA_ECOLI (SWALL:P33997) (70 aa) fasta scores: E(): 0.28, 35.59% id in 59 aa
YP_109183.1	Similar to Ralstonia solanacearum  integrase prophage protein rsc1896 or rs03460 SWALL:Q8XY67 (EMBL:AL646067) (411 aa) fasta scores: E(): 6.6e-91, 56.55% id in 412 aa, and to Agrobacterium tumefaciens phage-related integrase int or atu3831 or agr_l_2007 SWALL:Q8U997 (EMBL:AE009314) (396 aa) fasta scores: E(): 2.5e-74, 52.4% id in 395 aa
YP_109184.1	Doubtful CDS. No significant database matches
YP_109186.1	Similar to many MFS-family membrane transport proteins including: Escherichia coli shikimate transporter ShiA or b1981 SWALL:SHIA_ECOLI (SWALL:P76350) (438 aa) fasta scores: E(): 2.2e-46, 36.36% id in 440 aa, Ralstonia solanacearum  metabolite transport transmembrane protein rsc2856 or rs00249 SWALL:Q8XVH5 (EMBL:AL646072) (439 aa) fasta scores: E(): 9.7e-135, 85.84% id in 438 aa and Pseudomonas aeruginosa probable MFS transporter pa3749 SWALL:Q9HXP5 (EMBL:AE004794) (437 aa) fasta scores: E(): 8.6e-119, 76.83% id in 436 aa
YP_109188.1	Similar to many proteins involved in LPS core biosynthesis: Escherichia coli lipopolysaccharide heptosyltransferase-1 RfaC or WaaC or rfa-2 or b3621 SWALL:RFAC_ECOLI (SWALL:P24173) (319 aa) fasta scores: E(): 9.2e-29, 36.54% id in 301 aa, Ralstonia solanacearum probable lipopolysaccharide heptosyltransferase RfaC2 or rsp0634 or rs03733 SWALL:Q8XS47 (EMBL:AL646079) (332 aa) fasta scores: E(): 1.5e-85, 69.41% id in 327 aa and to Burkholderia cepacia heptosyltransferase I WaaC SWALL:Q937V3 (EMBL:AJ302064) (331 aa) fasta scores: E(): 1.3e-31, 37% id in 327 aa
YP_109189.1	Similar to Salmonella typhi voltage-gated Clc-type chloride channel EriC or sty0225 SWALL:ERIC_SALTI (SWALL:Q8Z9B3) (473 aa) fasta scores: E(): 3.1e-19, 29.93% id in 471 aa, and to Burkholderia cepacia chloride-channel protein SWALL:Q93L19 (EMBL:AF029344) (443 aa) fasta scores: E(): 5e-51, 44.86% id in 428 aa, and to Xanthomonas campestris chloride channel yadq or xcc2655 SWALL:AAM41927 (EMBL:AE012377) (454 aa) fasta scores: E(): 3.3e-48, 41.44% id in 444 aa
YP_109191.1	works in conjunction with MinC and MinD to enable cell division at the midpoint of the long axis of the cell
YP_109192.1	Similar to Escherichia coli, and Escherichia coli O157:H7 septum site-determining protein MinD or b1175 or z1937 or ecs1669 SWALL:MIND_ECOLI (SWALL:P18197) (269 aa) fasta scores: E(): 1.6e-74, 74.34% id in 269 aa and to Ralstonia solanacearum probable septum site-determining protein MinD or rsc3365 or rs02640 SWALL:Q8XU29 (EMBL:AL646075) (271 aa) fasta scores: E(): 5e-87, 84.5% id in 271 aa
YP_109193.1	blocks the formation of polar Z-ring septums
YP_109196.1	catalyzes a two-step reaction, first charging a serine molecule by linking its carboxyl group to the alpha-phosphate of ATP, followed by transfer of the aminoacyl-adenylate to its tRNA
YP_109198.1	Similar to many proteins of undefined function including: Ralstonia solanacearum hypothetical protein rsc2338 or rs01208 SWALL:Q8XWY2 (EMBL:AL646069) blast scores: E(): e-171, score: 1537 72% id, and to Neisseria meningitidis hypothetical protein Nma1433 SWALL:Q9JU96 (EMBL:AL162755) blast scores: E(): e-170, score: 1529 68% id
YP_109199.1	participates with LolB in the incorporation of lipoprotein into the outer membrane
YP_109200.1	Similar to many involved in cell-division or sporulation: Coxiella burnetii cell division protein FtsK homolog or spoIIIE SWALL:FTSK_COXBU (SWALL:P39920) (778 aa) fasta scores: E(): 5.2e-130, 50.06% id in 765 aa, and to Ralstonia solanacearum probable cell division FtsK transmembrane protein or rsc2341 or rs01205 SWALL:Q8XWX9 (EMBL:AL646069) (781 aa) fasta scores: E(): 4.3e-202, 71.02% id in 780 aa
YP_109201.1	Similar to Escherichia coli, and Escherichia coli O157:H7 thioredoxin reductase TrxB or b0888 or z1232 or ecs0973 SWALL:TRXB_ECOLI (SWALL:P09625) (320 aa) fasta scores: E(): 4.2e-82, 67.39% id in 319 aa, and to Vibrio cholerae thioredoxin reductase TrxB or vc1182 SWALL:TRXB_VIBCH (SWALL:Q9KSS4) (318 aa) fasta scores: E(): 4.3e-85, 69.52% id in 315 aa
YP_109202.1	Similar in parts to severalm proteins of undefined function including: Ralstonia solanacearum hypothetical protein rsc2343 or rs01203 SWALL:Q8XWX7 (EMBL:AL646069) (221 aa) fasta scores: E(): 1.9e-34, 56.94% id in 216 aa and Xanthomonas campestris hypothetical protein Xcc1705 SWALL:AAM40999 (EMBL:AE012272) (181 aa) fasta scores: E(): 3.1e-10, 36.84% id in 171 aa
YP_109203.1	Similar to many membrane proteins including Salmonella typhimurium  inner membrane protein Yigc or stm3978 or stm3738 SWALL:Q8ZL43 (EMBL:AE008873) (205 aa) fasta scores: E(): 3.5e-20, 37.18% id in 199 aa and to Ralstonia solanacearum probable transmembrane protein rsc2344 or rs01202 SWALL:Q8XWX6 (EMBL:AL646069) (207 aa) fasta scores: E(): 1.3e-42, 53.88% id in 206 aa
YP_109204.1	Similar to Rhizobium loti ATP-binding component of ABC sugar transporter mlr3054 SWALL:Q98H30 (EMBL:AP003001) (371 aa) fasta scores: E(): 4.4e-70, 55.49% id in 373 aa and to Rhizobium loti ABC transporter ATP-binding component mlr6654 SWALL:Q988P3 (EMBL:AP003009) (366 aa) fasta scores: E(): 2.8e-69, 56.95% id in 374 aa. See BPSL261 as a possible indictation as to the substrate of this transport system.
YP_109205.1	Similar to many ABC-transport proteins including: Brucella melitensis sugar transport system permease bmeii0592 SWALL:Q8YCE0 (EMBL:AE009695) (293 aa) fasta scores: E(): 8.9e-75, 64.15% id in 279 aa, and to Rhizobium loti ABC transporter permease mlr6653 SWALL:Q988P4 (EMBL:AP003009) (292 aa) fasta scores: E(): 4.5e-70, 59.14% id in 279 aa. See BPSL261 as a possible indictation as to the substrate of this transport system.
YP_109206.1	Similar to Pseudomonas aeruginosa probable permease of ABC sugar transporter Pa3189 SWALL:Q9HZ49 (EMBL:AE004742) (310 aa) fasta scores: E(): 4e-77, 60.92% id in 302 aa, and to Rhizobium meliloti  transport system permease ABC transporter protein r03300 or smc04395 SWALL:Q92KZ8 (EMBL:AL591793) (292 aa) fasta scores: E(): 6e-73, 60.49% id in 281 aa. See BPSL261 as a possible indictation as to the substrate of this transport system.
YP_109207.1	Highly similar to Burkholderia pseudomallei maltose-binding protein MalE SWALL:Q9F7V0 (EMBL:AF274304) (416 aa) fasta scores: E(): 5.6e-161, 99.76% id in 416 aa. Also similar to many other ABC transporter solute-binding proteins e.g. Rhizobium loti ABC transporter substrate-binding protein mlr6651 SWALL:Q988P6 (EMBL:AP003009) (419 aa) fasta scores: E(): 2.3e-59, 41.7% id in 398 aa
YP_109208.1	catalyzes the formation of D-glucono-1,5-lactone 6-phosphate from D-glucose 6-phosphate
YP_109209.1	Similar to Pseudomonas aeruginosa 6-phosphogluconolactonase Pgl or DevB or pa3182 SWALL:6PGL_PSEAE (SWALL:Q9X2N2) (238 aa) fasta scores: E(): 4e-21, 41.66% id in 216 aa, and to Rhizobium meliloti 6-phosphogluconolactonase Pgl or DevB or r00703 or smc03069 SWALL:6PGL_RHIME (SWALL:Q9Z3S1) (232 aa) fasta scores: E(): 5e-25, 40.96% id in 227 aa
YP_109210.1	glucokinase catalyzes the conversion of ATP and D-glucose to ADP and D-glucose 6-phosphate
YP_109211.1	Similar to many membrane transport proteins including: Escherichia coli cystine-binding periplasmic protein precursor FliY or b1920 SWALL:FLIY_ECOLI (SWALL:P39174) (266 aa) fasta scores: E(): 4.2e-31, 40.23% id in 251 aa, and to Pseudomonas aeruginosa probable binding protein component of ABC transporter pa0314 SWALL:Q9I6H7 (EMBL:AE004469) (256 aa) fasta scores: E(): 1e-47, 53.22% id in 248 aa, and to Deinococcus radiodurans amino acid ABC transporter periplasmic amino acid-binding protein dr0564 SWALL:Q9RWV1 (EMBL:AE001914) (261 aa) fasta scores: E(): 1.5e-39, 47.69% id in 260 aa
YP_109212.1	Similar to Salmonella typhimurium, and Salmonella typhi  ABC-type amino acid transporter permease component YecS or stm1952 or sty2160 SWALL:Q8XET2 (EMBL:AE008786) (222 aa) fasta scores: E(): 3.7e-34, 45.49% id in 211 aa, and to Caulobacter crescentus cystine ABC tranporter, permease,  cc1440 SWALL:Q9A8B4 (EMBL:AE005818) (219 aa) fasta scores: E(): 6.6e-34, 48.81% id in 211 aa
YP_109213.1	Similar to Escherichia coli, and Escherichia coli O157:H7 glutamate/aspartate transport ATP-binding protein GltL or b0652 or z0802 or ecs0691 SWALL:GLTL_ECOLI (SWALL:P41076) (241 aa) fasta scores: E(): 8.5e-62, 75.93% id in 241 aa, and to Salmonella typhimurium, and Salmonella typhi ABC superfamily GltL or stm0662 or sty0707 SWALL:Q8XG42 (EMBL:AE008726) (241 aa) fasta scores: E(): 5.8e-62, 76.34% id in 241 aa
YP_109214.1	catalyzes the formation of pyruvate from D-cysteine
YP_109215.1	Weakly similar to Xanthomonas axonopodis hypothetical protein Xac4063 SWALL:Q8PFC0 (EMBL:AE012054) (154 aa) fasta scores: E(): 9.1e-10, 40.29% id in 134 aa
YP_109216.1	Similar to Salmonella typhimurium MFS family multidrug transport protein, bicyclomycin resistance protein Bcr or stm2221 SWALL:Q8ZNJ7 (EMBL:AE008799) (396 aa) fasta scores: E(): 6.2e-44, 34.5% id in 397 aa and to Escherichia coli bicyclomycin resistance protein Bcr or bica or bicr or sur or suxa or b2182 SWALL:BCR_ECOLI (SWALL:P28246) (396 aa) fasta scores: E(): 2e-43, 33.93% id in 386 aa
YP_109219.1	Converts (S)-4-amino-5-oxopentanoate to 5-aminolevulinate during the porphyrin biosynthesis pathway
YP_109220.1	Similar to Haemophilus influenzae riboflavin biosynthesis protein ribd [includes: diaminohydroxyphosphoribosylaminopyrimidine deaminase ribd or ribg or hi0944 SWALL:RIBD_HAEIN (SWALL:P44326) (372 aa) fasta scores: E(): 4.5e-54, 47.73% id in 375 aa, and to Ralstonia solanacearum probable riboflavin biosynthesis bifunctional ribd : diaminohydroxyphosphoribosylaminopyrimidine deaminase + 5-amino-6- ribd or rsc0715 or rs05138 SWALL:Q8Y1H5 (EMBL:AL646060) (370 aa) fasta scores: E(): 6.7e-94, 67.48% id in 369 aa
YP_109221.1	catalyzes the formation of riboflavin from 6,7-dimethyl-8-(1-D-ribityl)lumazine
YP_109222.1	bifunctional enzyme DHBP synthase/GTP cyclohydrolase II-like protein; functions in riboflavin synthesis
YP_109223.1	RibE; 6,7-diimethyl-8-ribityllumazine synthase; DMRL synthase; lumazine synthase; beta subunit of riboflavin synthase; condenses 5-amino-6-(1'-D)-ribityl-amino-2,4(1H,3H)-pyrimidinedione with L-3,4-dihydrohy-2-butanone-4-phosphate to generate 6,6-dimethyl-8-lumazine (DMRL); riboflavin synthase then uses 2 molecules of DMRL to produce riboflavin (vitamin B12); involved in the last steps of riboflavin biosynthesis; forms a 60mer (icosahedral shell) in both Bacillus subtilis and Escherichia coli; in Bacillus subtilis this 60mer is associated with the riboflavin synthase subunit (alpha) while in Escherichia coli it is not
YP_109224.1	Regulates rRNA biosynthesis by transcriptional antitermination
YP_109225.1	Similar to many aminotransferases including: Ralstonia solanacearum  aminotransferase rsc0710 or rs05143 SWALL:Q8Y1I0 (EMBL:AL646060) (394 aa) fasta scores: E(): 3.3e-108, 73.52% id in 389 aa and to Thermus thermophilus aspartate aminotransferase AspC SWALL:AAT_THETH (SWALL:Q56232) (385 aa) fasta scores: E(): 2.7e-36, 35.53% id in 394 aa
YP_109226.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0709 or rs05144 SWALL:Q8Y1I1 (EMBL:AL646060) (362 aa) fasta scores: E(): 7.5e-43, 48.54% id in 344 aa
YP_109227.1	highly similar to Neisseria meningitidis 3-octaprenyl-4-hydroxybenzoate carboxy-lyase UbiD or nmb1694 SWALL:UBID_NEIMB (SWALL:Q9JY86) (494 aa) fasta scores: E(): 7.1e-67, 72.65% id in 523 aa and to Salmonella typhimurium 3-octaprenyl-4-hydroxybenzoate carboxy-lyase ubid or stm3978 or stmd1.11 SWALL:UBID_SALTY (SWALL:Q9L6M0) (492 aa) fasta scores: E(): 6.1e-64, 67.95% id in 518 aa
YP_109228.1	Weakly similar to Pseudomonas aeruginosa chemotactic transduction protein ChpE or pa0417 SWALL:CHPE_PSEAE (SWALL:O87005) (203 aa) fasta scores: E(): 6.2e-09, 28.57% id in 203 aa, and to Bacillus subtilis hypothetical protein YcgF SWALL:P94381 (EMBL:Z99105) (209 aa) fasta scores: E(): 2.4e-08, 25.72% id in 206 aa
YP_109229.1	catalyzes the formation of 2-oxobutanoate from L-threonine or the formation of pyruvate from serine
YP_109230.1	Similar to the Bordetella pertussis virulence related protein of unknown function Vrg-6 SWALL:Q45395 (EMBL:M77374) (105 aa) fasta scores: E(): 3.2e-07, 47.22% id in 108 aa. Also similar to and to Ralstonia solanacearum probable transmembrane protein rsc1969 or rs03543 SWALL:Q8XXZ4 (EMBL:AL646067) (106 aa) fasta scores: E(): 1.1e-11, 59.59% id in 99 aa. Note that the product of this CDS is rich in the amino acids Pro, Ala, Val , Tyr and Gly
YP_109231.1	Weakly similar to Ralstonia solanacearum hypothetical protein rsp0668 or rs01781 SWALL:Q8XS13 (EMBL:AL646080) (294 aa) fasta scores: E(): 6.7e-34, 47.4% id in 289 aa and to Streptomyces coelicolor hypothetical protein sco3384 or sce126.02C SWALL:Q9X845 (EMBL:AL049630) (420 aa) fasta scores: E(): 9.1e-15, 31.34% id in 319 aa
YP_109232.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein rsp1385 or rs02073 SWALL:Q8XQA1 (EMBL:AL646084) (183 aa) fasta scores: E(): 9.1e-35, 51.12% id in 178 aa and to Vibrio cholerae hypothetical protein Vc0459 SWALL:Q9KUQ6 (EMBL:AE004132) (185 aa) fasta scores: E(): 3.6e-21, 39.87% id in 163 aa
YP_109233.1	Similar to Aquifex aeolicus hypothetical protein Aq_450 SWALL:Y450_AQUAE (SWALL:O66758) (105 aa) fasta scores: E(): 3e-07, 33.75% id in 80 aa and to Chlorobium tepidum hypothetical protein Ct2101 SWALL:AAM73317 (EMBL:AE012959) (110 aa) fasta scores: E(): 3.4e-06, 37.2% id in 86 aa
YP_109234.1	may be involved in chromosome condensation; overexpression in Escherichia coli protects against decondensation by camphor; overexpressing the protein results in an increase in supercoiling
YP_008992011.1	omega-amino acid: pyruvate aminotransferase
YP_109235.1	Similar to several including: Physarum polycephalum PhP protein Php SWALL:Q94704 (EMBL:X64708) (356 aa) fasta scores: E(): 4.7e-26, 37.32% id in 351 aa and to Xanthomonas sp. xanthomonapepsin precursor SWALL:XANP_XANS2 (SWALL:Q60106) (827 aa) fasta scores: E(): 1.3e-05, 27.86% id in 402 aa
YP_109236.1	Similar to many including: Stigmatella aurantiaca methyl transferase SWALL:Q8RJZ2 (EMBL:AJ421825) (242 aa) fasta scores: E(): 1.9e-61, 61.57% id in 242 aa, Rhizobium loti hypothetical protein Mll3908 SWALL:Q98F67 (EMBL:AP003003) (242 aa) fasta scores: E(): 2.6e-60, 61.98% id in 242 aa and to Brucella melitensis ubiquinone/menaquinone biosynthesis methyltransferase UbiE bmei1834 SWALL:Q8YEP4 (EMBL:AE009616) (262 aa) fasta scores: E(): 4.7e-57, 60.41% id in 240 aa
YP_109237.1	Weakly similar to many Prokaryotic and Eukaryotic proteins: Homo sapiens hypothetical protein flj20348 SWALL:Q9NXA8 (EMBL:AK000355) (299 aa) fasta scores: E(): 1.1e-09, 30% id in 190 aa, Pseudomonas aeruginosa probable cobalamin biosynthetic protein pa1125 SWALL:Q9I4L0 (EMBL:AE004542) (250 aa) fasta scores: E(): 3.2e-08, 31.83% id in 267 aa and to Leishmania major regulatory protein Sir2 homolog SWALL:SIR2_LEIMA (SWALL:Q25337) (381 aa) fasta scores: E(): 1.8e-07, 25.49% id in 302 aa
YP_109238.1	tRNA (guanine-N(7)-)-methyltransferase; catalyzes the formation of N(7)-methylguanine at position 46 (m7G46) in tRNA by transferring the methyl residue from S-adenosyl-L-methionine
YP_109239.1	BacA; phosphatase activity in Escherichia coli not kinase; involved in bacitracin resistance as bacitracin supposedly sequesters undecaprenyl disphosphate which reduces the pool of lipid carrier available to the cell
YP_109240.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0700 or rs01605 SWALL:Q8Y1J0 (EMBL:AL646060) (204 aa) fasta scores: E(): 1.3e-26, 46.39% id in 194 aa
YP_109241.1	Similar to Xanthomonas axonopodis proteinase inhibitor xac0347 SWALL:AAM35239 (EMBL:AE011660) (86 aa) fasta scores: E(): 2e-18, 71.08% id in 83 aa, and to Escherichia coli hypothetical protein YeiW or b2170.1 SWALL:YEIW_ECOLI (SWALL:P58039) (84 aa) fasta scores: E(): 2.9e-17, 63.41% id in 82 aa
YP_109242.1	catalyzes the oxygen-independent formation of protoporphyrinogen-IX from coproporphyrinogen-III
YP_109243.1	Doubtful CDS. No significant database matches
YP_109244.1	Similar to Aeropyrum pernix protein-L-isoaspartate O-methyltransferase Pcm or ape1011 SWALL:PIMT_AERPE (SWALL:Q9YDA1) (256 aa) fasta scores: E(): 2e-20, 42.26% id in 194 aa and to Ralstonia solanacearum probable protein-L-isoaspartate O-methyltransferase Pcm or rsc0697 or rs01602 SWALL:Q8Y1J3 (EMBL:AL646060) (216 aa) fasta scores: E(): 3.1e-52, 65.43% id in 217 aa
YP_109245.1	Similar to Ralstonia solanacearum hypothetical protein rsc0696 or rs01601 SWALL:Q8Y1J4 (EMBL:AL646060) (110 aa) fasta scores: E(): 1.6e-20, 53.63% id in 110 aa and to Neisseria meningitidis hypothetical protein Nma0573 SWALL:Q9JW28 (EMBL:AL162753) (107 aa) fasta scores: E(): 4.6e-14, 45.19% id in 104 aa
YP_109246.1	catalyze the conversion of beta amino acids to the corresponding beta keto acid with pyruvate as the amine acceptor
YP_109247.1	Similar to Ralstonia solanacearum  urea/short-chain amide-binding signal peptide protein rsc2041 or rs03606 SWALL:Q8XXS2 (EMBL:AL646067) (418 aa) fasta scores: E(): 7.9e-133, 82.61% id in 420 aa and to Yersinia pestis substrate-binding periplasmic transport protein ypo1187 SWALL:Q8ZGU0 (EMBL:AJ414147) (422 aa) fasta scores: E(): 8.5e-121, 76.42% id in 420 aa
YP_109248.1	Similar to Yersinia pestis  branched-chain amino acid transport system, permease component ypo1188 SWALL:Q8ZGT9 (EMBL:AJ414147) (533 aa) fasta scores: E(): 1.3e-79, 50.48% id in 515 aa and to Ralstonia solanacearum probable permease transporter transmembrane protein rsc2040 or rs03605 SWALL:Q8XXS3 (EMBL:AL646067) (538 aa) fasta scores: E(): 3.8e-109, 64.2% id in 542 aa
YP_109249.1	Similar to Yersinia pestis  branched-chain amino acid transport system, permease component ypo1189 SWALL:Q8ZGT8 (EMBL:AJ414147) (358 aa) fasta scores: E(): 2.4e-77, 62.17% id in 341 aa, and to Ralstonia solanacearum probable permease transporter transmembrane protein rsc2039 or rs03604 SWALL:Q8XXS4 (EMBL:AL646067) (396 aa) fasta scores: E(): 1.1e-100, 74.86% id in 362 aa
YP_109250.1	Similar to Yersinia pestis  ABC transport ATP-binding subunit ypo1190 SWALL:Q8ZGT7 (EMBL:AJ414147) (278 aa) fasta scores: E(): 8.5e-43, 61.22% id in 245 aa, and to Ralstonia solanacearum probable ATP-binding ABC transporter protein rsc2038 or rs03603 SWALL:Q8XXS5 (EMBL:AL646067) (287 aa) fasta scores: E(): 2e-63, 72.69% id in 282 aa
YP_109251.1	Similar to Yersinia pestis  ABC transport ATP-binding subunit ypo1191 SWALL:Q8ZGT6 (EMBL:AJ414147) (232 aa) fasta scores: E(): 1.6e-45, 60.94% id in 233 aa, and to Ralstonia solanacearum probable ATP-binding ABC transporter protein rsc2037 or rs03602 SWALL:Q8XXS6 (EMBL:AL646067) (230 aa) fasta scores: E(): 1.1e-56, 74.34% id in 230 aa
YP_109252.1	Similar to Alcaligenes eutrophus urease accessory protein UreD1 SWALL:URD1_ALCEU (SWALL:O30332) (289 aa) fasta scores: E(): 1.3e-53, 54% id in 287 aa, and to Ralstonia solanacearum probable urease accessory protein UreD or rsc2036 or rs03030 SWALL:Q8XXS7 (EMBL:AL646067) (295 aa) fasta scores: E(): 1.6e-54, 53.87% id in 284 aa
YP_109253.1	UreA, with UreB and UreC catalyzes the hydrolysis of urea into ammonia and carbon dioxide; nickel metalloenzyme; accessory proteins UreD, UreE, UreF, and UreG are necessary for assembly of the metallocenter
YP_109254.1	ureases catalyze the hydrolysis of urea into ammonia and carbon dioxide; in Helicobacter pylori and Yersinia enterocolitica the ammonia released plays a key role in bacterial survival by neutralizing acids when colonizing the gastric mucosa; the holoenzyme is composed of 3 UreC (alpha) and 3 UreAB (gamma/beta); in Brucella suis the urease encoded by this operon (one of two urease-encoding operons found in its genome) is involved with urease activity, optimum growth, resistance to low-pH killing in-vitro and persistence in-vivo, while the other operon does not seem to be active
YP_109255.1	ureases catalyze the hydrolysis of urea into ammonia and carbon dioxide; in Helicobacter pylori the ammonia released plays a key role in bacterial survival by neutralizing acids when colonizing the gastric mucosa; the holoenzyme is composed of 3 ureC (alpha) and 3 ureAB (gamma/beta) subunits
YP_109256.1	involved in the assembly of the urease metallocenter; possible nickel donor
YP_109257.1	Similar to Klebsiella aerogenes urease accessory protein UreF SWALL:UREF_KLEAE (SWALL:P18318) (224 aa) fasta scores: E(): 1.5e-15, 33.04% id in 233 aa, and to Ralstonia solanacearum probable urease accessory protein UreF or rsc2030 or rs03600 SWALL:Q8XXT3 (EMBL:AL646067) (229 aa) fasta scores: E(): 1.5e-40, 55.94% id in 227 aa
YP_109258.1	Similar to Bordetella bronchiseptica urease accessory protein UreG SWALL:UREG_BORBR (SWALL:O06709) (214 aa) fasta scores: E(): 2.3e-55, 77.83% id in 203 aa and to Ralstonia solanacearum probable urease accessory protein UreG or rsc2029 or rs03595 SWALL:Q8XXT4 (EMBL:AL646067) (210 aa) fasta scores: E(): 5.2e-60, 86.7% id in 203 aa
YP_109259.1	catalyzes the transfer of 2-keto-3-deoxy-D-manno-octulosonic acid to lipid A
YP_109260.1	Similar to Yersinia pestis hypothetical protein Ypo1650 SWALL:Q8ZFP4 (EMBL:AJ414149) (300 aa) fasta scores: E(): 2.3e-53, 51.86% id in 295 aa
YP_109261.1	Similar to Escherichia coli lipopolysaccharide heptosyltransferase-1 RfaC or WaaC or rfa-2 or b3621 SWALL:RFAC_ECOLI (SWALL:P24173) (319 aa) fasta scores: E(): 2.1e-16, 38.71% id in 310 aa, and to Burkholderia cepacia heptosyltransferase I WaaC SWALL:Q937V3 (EMBL:AJ302064) (331 aa) fasta scores: E(): 1.7e-117, 89.12% id in 331 aa
YP_109262.1	Similar to Neisseria meningitidis phosphoglucomutase Pgm or nmb0790 SWALL:PGMU_NEIMB (SWALL:P40391) (460 aa) fasta scores: E(): 1.2e-98, 56% id in 466 aa and to Ralstonia solanacearum phosphomannomutase or phosphoglucomutase rsc0691 or rs01596 SWALL:Q8Y1J9 (EMBL:AL646060) (461 aa) fasta scores: E(): 1.6e-123, 68.46% id in 463 aa
YP_109263.1	Similar to Escherichia coli lipopolysaccharide biosynthesis protein WzxC or Wzx or b2046 SWALL:WZXC_ECOLI (SWALL:P77377) (492 aa) fasta scores: E(): 0.012, 22.33% id in 412 aa, Ralstonia solanacearum  lipopolysaccharide O-side chain biosynthesis transmembrane protein rsc0686 or rs01591 SWALL:Q8Y1K4 (EMBL:AL646060) (422 aa) fasta scores: E(): 1.6e-26, 28.7% id in 425 aa and to Salmonella typhimurium O-antigen translocase in LPS biosyntesis WzxE or stm3926 SWALL:Q9L6Q9 (EMBL:AE008883) (416 aa) fasta scores: E(): 5.7e-08, 24.39% id in 410 aa
YP_109264.1	Weakly similar to Rhizobium loti probable glycosyl transferase mlr1944 SWALL:Q98JH2 (EMBL:AP002998) (368 aa) fasta scores: E(): 1.2e-09, 31.81% id in 220 aa and to Vibrio cholerae sugar transferase SWALL:O34234 (EMBL:Y07786) (337 aa) fasta scores: E(): 2e-09, 27.14% id in 210 aa
YP_109265.1	Similar to Rhizobium meliloti  glycosyltransferase rb0735 or smb21231 SWALL:Q92VG9 (EMBL:AL603644) (384 aa) fasta scores: E(): 1.3e-45, 42.26% id in 362 aa, and to Pseudomonas aeruginosa probable glycosyl transferase pa1385 SWALL:Q9I3V9 (EMBL:AE004568) (374 aa) fasta scores: E(): 4.1e-40, 36.61% id in 366 aa
YP_109266.1	Previously sequenced as Burkholderia pseudomallei UDP-glucose 4-epimerase SWALL:O69132 (EMBL:AF064070) (340 aa) fasta scores: E(): 3.1e-125, 100% id in 340 aa and similar to Bacillus subtilis UDP-glucose 4-epimerase GalE SWALL:GALE_BACSU (SWALL:P55180) (339 aa) fasta scores: E(): 6.8e-80, 65.16% id in 333 aa
YP_109267.1	Previously sequenced as Burkholderia pseudomallei undecaprenyl phosphate N-acetylglucosaminyltransferase SWALL:O69131 (EMBL:AF064070) (368 aa) fasta scores: E(): 1.8e-136, 100% id in 368 aa, and to Sulfolobus acidocaldarius UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase GnpTA SWALL:GPT_SULAC (SWALL:P39465) (328 aa) fasta scores: E(): 2.2e-12, 29.21% id in 291 aa
YP_109268.1	Previously sequenced as Burkholderia pseudomallei epimerase/dehydratase WbiI SWALL:O69130 (EMBL:AF064070) (637 aa) fasta scores: E(): 0, 99.68% id in 637 aa and similar to Staphylococcus aureus capsular polysaccharide biosynthesis protein CapD SWALL:CAPD_STAAU (SWALL:P39853) (599 aa) fasta scores: E(): 3.5e-77, 40.51% id in 580 aa and to Burkholderia mallei  epimerase/dehydratase WbiI SWALL:Q9AEU8 (EMBL:AY028370) (637 aa) fasta scores: E(): 0, 100% id in 637 aa
YP_109269.1	Previously sequenced as Burkholderia pseudomallei undecaprenyl phosphate N-acetylglucosaminyltransferase WbiH SWALL:O69129 (EMBL:AF064070) (336 aa) fasta scores: E(): 1e-130, 100% id in 336 aa. Also similar to Xanthomonas axonopodis lipopolysaccharide core biosynthesis protein rfb303 or xac2294 SWALL:AAM37147 (EMBL:AE011866) (322 aa) fasta scores: E(): 8.6e-23, 34.51% id in 310 aa
YP_109270.1	Previously sequenced as Burkholderia pseudomallei epimerase/dehydratase WbiG SWALL:O69128 (EMBL:AF064070) (321 aa) fasta scores: E(): 8.6e-126, 99.37% id in 321 aa. Also similar to Vibrio cholerae UDP-glucose 4-epimerase GalE or WbfT SWALL:GALE_VIBCH (SWALL:Q56623) (328 aa) fasta scores: E(): 5.1e-38, 37.57% id in 322 aa
YP_109271.1	Previously sequenced as Burkholderia pseudomallei glycosyl transferase WbiF SWALL:O69127 (EMBL:AF064070) (276 aa) fasta scores: E(): 2e-117, 99.63% id in 276 aa. Also similar to Burkholderia mallei  glycosyl transferase WbiF SWALL:Q9AEU9 (EMBL:AY028370) (276 aa) fasta scores: E(): 1.7e-116, 98.91% id in 276 aa and to Ralstonia solanacearum probable glycosyl transferase rsc0688 or rs01593 SWALL:Q8Y1K2 (EMBL:AL646060) (275 aa) fasta scores: E(): 7.4e-23, 32.46% id in 268 aa
YP_109272.1	Previously sequenced as Burkholderia pseudomallei glycosyl transferase WbiE SWALL:O69126 (EMBL:AF064070) (613 aa) fasta scores: E(): 0, 99.51% id in 613 aa.Also similar to Burkholderia mallei  glycosyl transferase WbiE SWALL:Q9AEV0 (EMBL:AY028370) (613 aa) fasta scores: E(): 0, 99.67% id in 613 aa
YP_109273.1	Previously sequenced as Burkholderia pseudomallei O-antigen methyl transferase WbiD SWALL:O69125 (EMBL:AF064070) (574 aa) fasta scores: E(): 0, 99.65% id in 574 aa. Also similar to Burkholderia mallei  O-antigen methyl transferase WbiD SWALL:Q9AEV1 (EMBL:AY028370) (574 aa) fasta scores: E(): 0, 99.47% id in 574 aa and to Rhizobium loti  O-antigen methyl transferase mlr7341 SWALL:Q986I5 (EMBL:AP003011) (664 aa) fasta scores: E(): 3.9e-75, 39.27% id in 555 aa
YP_109274.1	Previously sequenced as Burkholderia pseudomallei glycosyl transferase WbiC SWALL:O69124 (EMBL:AF064070) (307 aa) fasta scores: E(): 7e-121, 100% id in 307 aa. Also similar to Rhizobium loti  glycosyl transferase mlr7339 SWALL:Q986I6 (EMBL:AP003011) (296 aa) fasta scores: E(): 5.3e-54, 48.82% id in 297 aa
YP_109275.1	Previously sequenced as Burkholderia pseudomallei epimerase/dehydratase WbiB SWALL:O69123 (EMBL:AF064070) (363 aa) fasta scores: E(): 1e-138, 100% id in 363 aa. Also similar to Burkholderia mallei  epimerase/dehydratase WbiB SWALL:Q9AEV2 (EMBL:AY028370) (363 aa) fasta scores: E(): 2.1e-138, 99.72% id in 363 aa and to Rhizobium loti sugar nucleotide epimerase/dehydratase mlr7558 SWALL:Q985R8 (EMBL:AP003012) (352 aa) fasta scores: E(): 1.3e-76, 57.71% id in 350 aa
YP_109276.1	Previously sequenced as Burkholderia pseudomallei O-antigen acetylase WbiA SWALL:O69122 (EMBL:AF064070) (412 aa) fasta scores: E(): 3.9e-175, 100% id in 412 aa. Also similar to Burkholderia thailandensis O-antigen acetylase WbiA SWALL:Q93SI5 (EMBL:AY033501) (412 aa) fasta scores: E(): 4.5e-166, 94.9% id in 412 aa
YP_109277.1	Previously sequenced as Burkholderia pseudomallei ABC-2 transporter hydrophilic component Wzt SWALL:O69121 (EMBL:AF064070) (469 aa) fasta scores: E(): 2.1e-157, 100% id in 469 aa. Also similar to Burkholderia mallei  ABC-2 transporter hydrophilic component Wzt SWALL:Q9AEV3 (EMBL:AY028370) (469 aa) fasta scores: E(): 1.7e-156, 99.57% id in 469 aa and to Pseudomonas aeruginosa probable ATP-binding component of ABC transporter pa1386 SWALL:Q9I3V8 (EMBL:AE004568) (422 aa) fasta scores: E(): 5.3e-35, 40.04% id in 427 aa
YP_109278.1	Identical to Burkholderia mallei  ABC-2 transporter integral membrane component Wzm SWALL:Q9AEV4 (EMBL:AY028370) (277 aa) fasta scores: E(): 3.9e-105, 100% id in 277 aa. Similar to Serratia marcescens  ABC transporter system integral membrane protein SWALL:O52482 (EMBL:AF038816) (277 aa) fasta scores: E(): 2.5e-58, 57.46% id in 268 aa
YP_109279.1	Similar to Escherichia coli dTDP-4-dehydrorhamnose reductase RfbD or Rmld or b2040 SWALL:RBD1_ECOLI (SWALL:P37760) (299 aa) fasta scores: E(): 3.8e-46, 44.51% id in 301 aa. Previously sequenced as Burkholderia pseudomallei  dTDP-4-keto-L-rhamnose reductase RmlD SWALL:O69119 (EMBL:AF064070) (298 aa) fasta scores: E(): 4e-112, 100% id in 298 aa
YP_109280.1	Previously sequenced as Burkholderia pseudomallei dTDP-4-keto-6-deoxy-D-glucose 3,5-epimerase RmlC SWALL:O69118 (EMBL:AF064070) (183 aa) fasta scores: E(): 4.2e-74, 100% id in 183 aa and similar to Shigella boydii dTDP-6-deoxy-D-glucose-3,5 epimerase RmlC SWALL:Q93CV1 (EMBL:AF402312) (189 aa) fasta scores: E(): 6.3e-44, 61.79% id in 178 aa
YP_109281.1	Previously sequenced as Burkholderia pseudomallei glucose-1-phosphate thymidyltransferase RmlA SWALL:O69117 (EMBL:AF064070) (297 aa) fasta scores: E(): 1.6e-120, 100% id in 297 aa and similar to Salmonella anatum glucose-1-phosphate thymidylyltransferase RfbA SWALL:RFBA_SALAN (SWALL:P55254) (292 aa) fasta scores: E(): 8.8e-87, 73.07% id in 286 aa
YP_109282.1	Previously sequenced as Burkholderia pseudomallei dTDP-D-glucose 4,6-dehydratase RmlB SWALL:O69116 (EMBL:AF064070) (353 aa) fasta scores: E(): 5.6e-143, 100% id in 353 aa and similar to Xanthomonas campestris dTDP-glucose 4,6-dehydratase RfbB or RmlB or xcc0621 SWALL:RFBB_XANCP (SWALL:P55295) (351 aa) fasta scores: E(): 1.2e-88, 66.56% id in 341 aa
YP_109283.1	hydrolyzes P(1),P(4)-bis(5'-adenosyl) tetraphosphate to form 2 ADP
YP_109284.1	Previously sequenced as Burkholderia pseudomallei 1-acyl-SN-glycerol-3-phosphate acyltransferase PlsC SWALL:O69114 (EMBL:AF064070) (289 aa) fasta scores: E(): 1.5e-111, 100% id in 289 aa. Also highly similar to Neisseria meningitidis 1-acyl-SN-glycerol-3-phosphate acyltransferase Plsc or nmb1294 SWALL:PLSC_NEIMB (SWALL:Q9JZ47) (255 aa) fasta scores: E(): 3.4e-18, 33.88% id in 242 aa
YP_109285.1	Catalyzes the reversible hydrolysis of the amide bond within dihydroorotate. This metabolic intermediate is required for the biosynthesis of pyrimidine nucleotides
YP_109286.1	catalyzes the transfer of the carbamoyl moiety from carbamoyl phosphate to L- aspartate in pyrimidine biosynthesis
YP_109287.1	regulates pyrimidine biosynthesis by binding to the mRNA of the pyr genes, also has been shown to have uracil phosphoribosyltransferase activity
YP_109288.1	similar to RuvC resolvase with substantial differences; NMR structural information suggests this protein is monomeric; unknown cellular function
YP_109289.1	Similar to Ralstonia solanacearum hypothetical protein rsc0675 or rs01580 SWALL:Q8Y1L5 (EMBL:AL646060) (190 aa) fasta scores: E(): 6e-57, 76.04% id in 192 aa and to Pseudomonas aeruginosa hypothetical protein AlgH or pa0405 SWALL:Q9RQ16 (EMBL:AF137022) (189 aa) fasta scores: E(): 1.4e-35, 53.88% id in 193 aa
YP_109291.1	Highly similar to Acinetobacter calcoaceticus rubredoxin RubA SWALL:RUBR_ACICA (SWALL:P42453) (54 aa) fasta scores: E(): 1e-15, 60.37% id in 53 aa and to Ralstonia solanacearum probable rubredoxin protein rsc0667 or rs01572 SWALL:Q8Y1M3 (EMBL:AL646060) (60 aa) fasta scores: E(): 7.6e-23, 87.5% id in 56 aa
YP_109292.1	Weakly similar to many including: Pseudomonas aeruginosa phosphomethylpyrimidine kinase ThiD or pa3975 SWALL:Q9HX41 (EMBL:AE004815) (265 aa) fasta scores: E(): 2.1e-19, 34.1% id in 261 aa, and to Streptomyces coelicolor phosphomethylpyrimidine kinase ThiD or sco5563 or sc7a1.07 SWALL:THID_STRCO (SWALL:Q9ZBR6) (269 aa) fasta scores: E(): 6.8e-15, 33.96% id in 265 aa
YP_109293.1	60 kDa chaperone family; promotes refolding of misfolded polypeptides especially under stressful conditions; forms two stacked rings of heptamers to form a barrel-shaped 14mer; ends can be capped by GroES; misfolded proteins enter the barrel where they are refolded when GroES binds; many bacteria have multiple copies of the groEL gene which are active under different environmental conditions; the B.japonicum protein in this cluster is expressed constitutively; in Rhodobacter, Corynebacterium and Rhizobium this protein is essential for growth
YP_109294.1	10 kDa chaperonin; Cpn10; GroES; forms homoheptameric ring; binds to one or both ends of the GroEL double barrel in the presence of adenine nucleotides capping it; folding of unfolded substrates initiates in a GroEL-substrate bound and capped by GroES; release of the folded substrate is dependent on ATP binding and hydrolysis in the trans ring
YP_109295.1	Similar to Ralstonia solanacearum probable signal peptide protein rsp0803 or rs01904 SWALL:Q8XRM8 (EMBL:AL646081) (667 aa) fasta scores: E(): 4.3e-26, 34.31% id in 746 aa. Note the product of this CDS is highly repetitive with a 4.5 X STLQNAAANNPLSGVASNAVGTLTNLANNNPLPGALSNAVGTLQNAATNNPLSGVASN A VGTLTNLANNNPLPGALSNAV degenerate repeat sequence
YP_109296.1	Similar to several including: Bacillus halodurans cinnamoyl ester hydrolase bh0737 SWALL:Q9KEW2 (EMBL:AP001509) (118 aa) fasta scores: E(): 3.9e-22, 58.71% id in 109 aa and to Bacillus subtilis hypothetical protein YybR SWALL:YYBR_BACSU (SWALL:P37486) (125 aa) fasta scores: E(): 2.8e-21, 60.39% id in 101 aa
YP_109297.1	Similar to many alcohol dehydrogenases including: Xanthomonas campestris xcc2730 SWALL:Q8P783 (EMBL:AE012386) (335 aa) fasta scores: E(): 1.6e-86, 71.77% id in 333 aa and to Rhizobium loti alcohol dehydrogenase, NADPH quinone oxidoreductase mll3915 SWALL:Q98F62 (EMBL:AP003003) (338 aa) fasta scores: E(): 7.5e-43, 43.28% id in 335 aa
YP_109299.1	Similar to Pseudomonas fluorescens protein activator of alkane oxidation PraB SWALL:Q9AE74 (EMBL:AJ009579) (168 aa) fasta scores: E(): 1.8e-07, 30.67% id in 163 aa and to Pseudomonas aeruginosa protein activator precursor Pra or pa4590 SWALL:Q51428 (EMBL:L08966) (162 aa) fasta scores: E(): 2.8e-06, 30.28% id in 175 aa
YP_109300.1	Similar in part to Ralstonia solanacearum  outer membrane Wsignal peptide protein OmpW or rsc3350 or rs02625 SWALL:Q8XU43 (EMBL:AL646074) (241 aa) fasta scores: E(): 0.00076, 34.67% id in 274 aa
YP_109302.1	Weakly similar to Ralstonia solanacearum lipoprotein rsp0116 or rs03006 SWALL:Q8XTJ2 (EMBL:AL646076) (427 aa) fasta scores: E(): 0.00043, 25.05% id in 439 aa
YP_109303.1	Similar to Agrobacterium tumefaciens hypothetical protein Agr_c_1731p SWALL:Q8U5H0 (EMBL:AE008025) (190 aa) fasta scores: E(): 1.6e-23, 58.77% id in 114 aa, and to Xylella fastidiosa hypothetical protein Xf0240 SWALL:Q9PGQ8 (EMBL:AE003878) (142 aa) fasta scores: E(): 8.5e-18, 47.82% id in 115 aa
YP_109304.1	Similar to several proteins of undefined function including: Yersinia pestis  exported protein Ypo0800 SWALL:Q8ZHT4 (EMBL:AJ414144) (295 aa) fasta scores: E(): 4.4e-66, 59.58% id in 287 aa and Pseudomonas aeruginosa hypothetical protein Pa0057 SWALL:Q9I775 (EMBL:AE004445) (295 aa) fasta scores: E(): 1.1e-64, 60.2% id in 299 aa
YP_109305.1	Similar to Streptomyces coelicolor  DNA-binding protein Sco6802 or sc1a2.11 SWALL:Q9L230 (EMBL:AL138598) (192 aa) fasta scores: E(): 5.8e-21, 43.95% id in 182 aa and to Ralstonia solanacearum  transcription regulatory protein rsc3132 or rs00471 SWALL:Q8XUQ4 (EMBL:AL646073) (209 aa) fasta scores: E(): 8.6e-38, 58.33% id in 192 aa
YP_109306.1	Similar to Pseudomonas syringae acetyltransferase (tabtoxin resistance protein) Ttr SWALL:TTR_PSESZ (SWALL:P16966) (177 aa) fasta scores: E(): 6.6e-11, 32.95% id in 176 aa and to Pseudomonas aeruginosa hypothetical protein Pa1885 SWALL:Q9I2L2 (EMBL:AE004614) (177 aa) fasta scores: E(): 7.2e-39, 63.9% id in 169 aa, and to Agrobacterium tumefaciens acetyltransferase atu0246 or agr_c_420 SWALL:Q8UIP7 (EMBL:AE008997) (172 aa) fasta scores: E(): 1.1e-28, 50.88% id in 169 aa
YP_109307.1	Similar to Agrobacterium tumefaciens RhtB family transporter atu1170 or agr_c_2164 SWALL:Q8UG71 (EMBL:AE009080) (210 aa) fasta scores: E(): 5.3e-25, 39.28% id in 196 aa, Caulobacter crescentus efflux protein, lyse family cc0029 SWALL:Q9AC37 (EMBL:AE005677) (210 aa) fasta scores: E(): 3.1e-11, 31.03% id in 203 aa, and to Escherichia coli, Escherichia coli O6 and Escherichia coli O157:H7 homoserine/homoserine lactone efflux protein RhtB or b3824 or c4746 or z5345 or ecs4754 SWALL:RHTB_ECOLI (SWALL:P27847) (206 aa) fasta scores: E(): 1.3e-09, 27.58% id in 203 aa
YP_109308.1	Similar to Ralstonia solanacearum glycerophosphoryl diester phosphodiesterase, periplasmic precursor protein GlpQ or rsc0502 or rs05020 SWALL:Q8Y234 (EMBL:AL646059) (378 aa) fasta scores: E(): 4.4e-95, 68.66% id in 383 aa, and to Xanthomonas campestris glycerophosphoryl diester phosphodiesterase GlpQ or xcc4234 SWALL:AAM43450 (EMBL:AE012551) (370 aa) fasta scores: E(): 1.5e-65, 55.75% id in 339 aa
YP_109309.1	Similar to Streptomyces coelicolor  transmembrane transport protein Sco2309 or scc30.17C SWALL:Q9L004 (EMBL:AL352972) (489 aa) fasta scores: E(): 1.4e-58, 42.79% id in 458 aa, Streptomyces roseofulvus  antibiotic antiporter FrnF SWALL:O68912 (EMBL:AF058302) (517 aa) fasta scores: E(): 1.1e-57, 41.17% id in 476 aa and to Streptomyces lipmanii puromycin resistance protein Pur8 SWALL:PUR8_STRLP (SWALL:P42670) (503 aa) fasta scores: E(): 2.3e-53, 39.33% id in 478 aa
YP_109310.1	Similar to several including: Ralstonia solanacearum probable transmembrane protein rsc2426 or rs02683 SWALL:Q8XWP7 (EMBL:AL646070) (253 aa) fasta scores: E(): 5.2e-39, 49.4% id in 253 aa and to Bacillus subtilis hypothetical protein YjnA SWALL:O34578 (EMBL:AF015825) (254 aa) fasta scores: E(): 1.3e-28, 38.88% id in 252 aa
YP_109311.1	Similar to several proteins of unknown function including: Deinococcus radiodurans carboxypeptidase-related protein dr0964 SWALL:Q9RVQ8 (EMBL:AE001948) (500 aa) fasta scores: E(): 2.8e-24, 34.68% id in 542 aa, and to Caulobacter crescentus hypothetical protein Cc3418 cc3418 SWALL:Q9A2Y8 (EMBL:AE006002) (504 aa) fasta scores: E(): 1.6e-21, 31.11% id in 540 aa
YP_109312.1	Similar to Ralstonia solanacearum probable D--3-hydroxybutyrate oligomer hydrolase lipoprotein transmembrane rsc1334 or rs02856 SWALL:Q8XZR1 (EMBL:AL646064) (725 aa) fasta scores: E(): 6.5e-92, 49.58% id in 728 aa and to Alcaligenes eutrophus D--3-hydroxybutyrate oligomer hydrolase SWALL:O05992 (EMBL:AB003701) (757 aa) fasta scores: E(): 2.4e-111, 50.9% id in 715 aa
YP_109314.1	Weakly similar to Pseudomonas aeruginosa hypothetical protein Pa3848 SWALL:Q9HXF8 (EMBL:AE004802) (451 aa) fasta scores: E(): 1.9e-38, 34.45% id in 418 aa
YP_109315.1	Weakly similar to several including: Pseudomonas aeruginosa hypothetical protein Pa0118 SWALL:Q9I714 (EMBL:AE004450) (195 aa) fasta scores: E(): 1.4e-10, 29.1% id in 189 aa, and to Alcaligenes faecalis isomerase PhnD SWALL:Q9WXH0 (EMBL:AB024945) (196 aa) fasta scores: E(): 2.7e-08, 26.48% id in 185 aa
YP_109316.1	Similar to many LysR-family regultors: Ralstonia solanacearum probable transcription regulator protein rsc2094 or rs03659 SWALL:Q8XXL9 (EMBL:AL646068) (316 aa) fasta scores: E(): 3.3e-53, 47.98% id in 298 aa and to Pseudomonas putida transcriptional activator protein NahR SWALL:NAHR_PSEPU (SWALL:P10183) (300 aa) fasta scores: E(): 2.6e-25, 33.33% id in 294 aa
YP_109317.1	Similar to Pseudomonas aeruginosa probable permease of ABC transporter pa2914 SWALL:Q9HZT3 (EMBL:AE004717) (343 aa) fasta scores: E(): 1.2e-56, 55.78% id in 346 aa and to Rhizobium loti ABC transporter permease mlr8229 SWALL:Q983Q1 (EMBL:AP003013) (349 aa) fasta scores: E(): 6.5e-44, 46.7% id in 364 aa
YP_109318.1	Similar to Streptomyces coelicolor  iron transport lipoprotein Sco7218 or sc2h12.17 SWALL:Q9K467 (EMBL:AL359215) (345 aa) fasta scores: E(): 3.8e-41, 42.73% id in 337 aa and to Brucella melitensis iron transport protein bmeii0535 SWALL:Q8YCJ3 (EMBL:AE009689) (344 aa) fasta scores: E(): 4.8e-17, 28.69% id in 345 aa
YP_109319.1	Similar to Streptomyces coelicolor Fe uptake system permease FtrE or sco0998 or 2scg2.11 SWALL:Q9EX40 (EMBL:AL445963) (272 aa) fasta scores: E(): 2.4e-44, 53.51% id in 256 aa and to Bacillus halodurans iron (III) dicitrate transport system bh1587 SWALL:Q9KCI4 (EMBL:AP001512) (491 aa) fasta scores: E(): 1.5e-30, 42.08% id in 240 aa
YP_109320.1	Similar to Xanthomonas axonopodis TonB-dependent receptor FhuA or xac4062 SWALL:Q8PFC1 (EMBL:AE012054) (726 aa) fasta scores: E(): 8.7e-33, 30.99% id in 742 aa, Anabaena sp. ferrichrome-iron receptor all2148 SWALL:Q8YV33 (EMBL:AP003588) (863 aa) fasta scores: E(): 5.7e-28, 26.62% id in 725 aa and to Salmonella typhimurium ferrioxamine B receptor precursor FoxA or Stm0364 SWALL:FOXA_SALTY (SWALL:Q56145) (702 aa) fasta scores: E(): 7.4e-23, 24.6% id in 687 aa
YP_109322.1	Weakly similar to several solute-binding proteins including: Escherichia coli molybdate-binding periplasmic protein precursor ModA or b0763 SWALL:MODA_ECOLI (SWALL:P37329) (257 aa) fasta scores: E(): 0.0012, 23.55% id in 259 aa and to Pseudomonas aeruginosa molybdate-binding periplasmic protein precursor ModA or pa1863 SWALL:Q9I2N2 (EMBL:AE004612) (251 aa) fasta scores: E(): 9.4e-07, 30% id in 250 aa
YP_109323.1	Similar to many xanthine dehydrogenases including: Brucella melitensis xanthine dehydrogenase bmei1575 SWALL:Q8YFE7 (EMBL:AE009593) (781 aa) fasta scores: E(): 8.4e-158, 56.29% id in 778 aa and to Comamonas acidovorans xanthine dehydrogenase large subunit XdhB SWALL:Q8RLC0 (EMBL:AY082333) (808 aa) fasta scores: E(): 1.7e-212, 70.44% id in 785 aa
YP_109324.1	Similar to many  xanthine dehydrogenases including: Brucella melitensis bmei1576 SWALL:Q8YFE6 (EMBL:AE009593) (519 aa) fasta scores: E(): 1.3e-73, 48.18% id in 467 aa, and to Ralstonia solanacearum  XdhA or rsc2095 or rs03660 SWALL:Q8XXL8 (EMBL:AL646068) (516 aa) fasta scores: E(): 7.7e-127, 65.94% id in 505 aa
YP_109325.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa1993 SWALL:Q9I2B6 (EMBL:AE004625) (402 aa) fasta scores: E(): 9.3e-82, 60% id in 400 aa, and to Salmonella typhimurium hypothetical protein yhhs or stm3581 SWALL:Q8ZLE4 (EMBL:AE008865) (419 aa) fasta scores: E(): 6.7e-63, 53.26% id in 383 aa
YP_109326.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa3897 SWALL:Q9HXB6 (EMBL:AE004807) (300 aa) fasta scores: E(): 2.9e-56, 56.49% id in 285 aa and Ralstonia solanacearum  transmembrane protein rsc0151 or rs01021 SWALL:Q8Y330 (EMBL:AL646057) (309 aa) fasta scores: E(): 3.5e-16, 30.52% id in 285 aa. Note an alternative possible translational start site at codon 21.
YP_109327.1	Similar to many proposed transcriptional regulators including: Ralstonia solanacearum probable transcription regulator protein rsp1157 or rs05428 SWALL:Q8XQR4 (EMBL:AL646083) (324 aa) fasta scores: E(): 8.9e-51, 47.41% id in 310 aa and Pseudomonas aeruginosa probable transcriptional regulator pa3898 SWALL:Q9HXB5 (EMBL:AE004807) (293 aa) fasta scores: E(): 3.4e-49, 47.81% id in 297 aa
YP_109328.1	Similar to Vibrio cholerae aminotransferase, class V vc0392 SWALL:Q9KUW7 (EMBL:AE004127) (372 aa) fasta scores: E(): 7.1e-37, 34.53% id in 362 aa and to Anabaena sp. alanine--glyoxylate aminotransferase alr1004 SWALL:Q8YY48 (EMBL:AP003584) (381 aa) fasta scores: E(): 1.5e-34, 31.97% id in 369 aa
YP_109329.1	Similar to Ralstonia solanacearum probable transcription regulator protein rsc0065 or rs02244 SWALL:Q8Y3B5 (EMBL:AL646057) (312 aa) fasta scores: E(): 2.4e-34, 35.55% id in 315 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa0159 SWALL:Q9I6X3 (EMBL:AE004454) (312 aa) fasta scores: E(): 9.6e-32, 38.14% id in 291 aa
YP_109330.1	Catalyzes the reduction of sulfopyruvate to (R)-sulfolactate much more efficiently than the reverse reaction. Also catalyzes the reduction of oxaloacetate, alpha-ketoglutarate, and to a much lower extent, KHTCA, but not pyruvate. Involved in the biosynthes
YP_109331.1	Similar to many including: Ralstonia solanacearum probable oxidoreductase rsp0614 or rs03753 SWALL:Q8XS67 (EMBL:AL646079) (216 aa) fasta scores: E(): 7.4e-61, 71.15% id in 208 aa and to Thermus thermophilus NADH dehydrogenase Nox SWALL:NOX_THETH (SWALL:Q60049) (205 aa) fasta scores: E(): 0.00054, 29.7% id in 202 aa
YP_109332.1	Similar to many membrane transporters including: Rhizobium loti  transmembrane efflux protein mlr2770 SWALL:Q98HP8 (EMBL:AP003000) (391 aa) fasta scores: E(): 6.1e-77, 59.32% id in 386 aa and Pseudomonas aeruginosa probable mfs transporter pa4355 SWALL:Q9HW46 (EMBL:AE004851) (388 aa) fasta scores: E(): 2.8e-75, 58.29% id in 386 aa
YP_109333.1	Similar to many membrane transporters including: Pseudomonas aeruginosa probable MFS transporter pa5311 SWALL:Q9HTP3 (EMBL:AE004943) (387 aa) fasta scores: E(): 3.6e-36, 33.68% id in 383 aa and to Rhizobium meliloti transport transmembrane protein r01296 or smc01368 SWALL:Q92QM3 (EMBL:AL591786) (394 aa) fasta scores: E(): 2.4e-24, 28.61% id in 353 aa
YP_109334.1	Similar to Prokaryotic and Eukaryotic hydrolases including: Ralstonia solanacearum probable fumarylacetoacetase rsp0690 or rs01759 SWALL:Q8XRZ1 (EMBL:AL646080) (423 aa) fasta scores: E(): 7.1e-116, 69.23% id in 416 aa and to Homo sapiens fumarylacetoacetase Fah SWALL:FAAA_HUMAN (SWALL:P16930) (419 aa) fasta scores: E(): 2.1e-99, 57.17% id in 411 aa
YP_109335.1	An oxygenase that acts to open the ring of homogentisate formingmaleylacetoacetate as part of the catabolism of L-tyrosine and L-phenylalanine
YP_109336.1	Similar to Pseudomonas putida 4-hydroxybenzoate transporter PcaK SWALL:PCAK_PSEPU (SWALL:Q51955) (448 aa) fasta scores: E(): 3.4e-57, 38.87% id in 445 aa, and to Acinetobacter calcoaceticus 4-hydroxybenzoate transporter pcaK SWALL:PCAK_ACICA (SWALL:Q43975) (457 aa) fasta scores: E(): 2.7e-49, 35.08% id in 439 aa
YP_109337.1	Similar to Ralstonia solanacearum hypothetical protein rsp0701 rsp0701 or rs01748 SWALL:Q8XRY0 (EMBL:AL646080) (68 aa) fasta scores: E(): 3.1e-10, 55.4% id in 74 aa
YP_109338.1	Similar to many oxidoreductases including: Ralstonia solanacearum hypothetical oxidoreductase rsp0702 or rs01747 SWALL:Q8XRX9 (EMBL:AL646080) (563 aa) fasta scores: E(): 7e-141, 68.89% id in 553 aa, and to Escherichia coli 3-(3-hydroxy-phenyl)propionate mhpa or b0347 SWALL:MHPA_ECOLI (SWALL:P77397) (554 aa) fasta scores: E(): 9.2e-22, 26.78% id in 519 aa
YP_109339.1	Similar to many including: Ralstonia solanacearum hypothetical protein rsp0703 or rs01746 SWALL:Q8XRX8 (EMBL:AL646080) (319 aa) fasta scores: E(): 2.2e-80, 66.56% id in 317 aa, and to Streptomyces arenae cyclase ncnE SWALL:Q9X466 (EMBL:AF098966) (310 aa) fasta scores: E(): 3.7e-11, 28.8% id in 250 aa
YP_109340.1	Similar to Ralstonia solanacearum hypothetical protein rsc1343 or rs02865 SWALL:Q8XZQ2 (EMBL:AL646064) (301 aa) fasta scores: E(): 8.6e-14, 30.76% id in 247 aa
YP_109341.1	Similar to many proteins of undefined function including: Pseudomonas aeruginosa hypothetical protein Pa5465 SWALL:Q9HTA5 (EMBL:AE004959) (139 aa) fasta scores: E(): 1e-18, 40.62% id in 128 aa and to Rhizobium meliloti hypothetical protein r01113 r01113 or smc02549 SWALL:Q92R18 (EMBL:AL591786) (159 aa) fasta scores: E(): 6.2e-18, 41.73% id in 127 aa. Note the alternative possible translational start site at codon 17
YP_109342.1	Similar to many regulators including: Escherichia coli acetate operon repressor IclR or b4018 SWALL:ICLR_ECOLI (SWALL:P16528) (274 aa) fasta scores: E(): 5.8e-09, 28.13% id in 231 aa and to Ralstonia solanacearum  transcription regulator protein rsc0757 or rs05096 SWALL:Q8Y1D3 (EMBL:AL646060) (273 aa) fasta scores: E(): 3.7e-42, 52.59% id in 251 aa
YP_109343.1	Similar to Prokaryotic and Eukaryotic dehydrogenases including: Rhizobium meliloti  glutaryl-CoA dehydrogenase rb0847 or smb21181 SWALL:Q92V67 (EMBL:AL603645) (395 aa) fasta scores: E(): 7.9e-118, 72.98% id in 396 aa and to Homo sapiens glutaryl-CoA dehydrogenase, mitochondrial precursor GcdH SWALL:GCDH_HUMAN (SWALL:Q92947) (438 aa) fasta scores: E(): 1.9e-100, 64.6% id in 404 aa
YP_109344.1	Similar to Ralstonia solanacearum probable antioxidant rsc0754 or rs05099 SWALL:Q8Y1D6 (EMBL:AL646060) (212 aa) fasta scores: E(): 1.5e-73, 87.26% id in 212 aa, and to Pseudomonas putida thiol-specific antioxidant protein lsfA SWALL:BAC00970 (EMBL:AB086390) (212 aa) fasta scores: E(): 2.7e-71, 82.54% id in 212 aa
YP_109345.1	Similar to several including: Ralstonia solanacearum probable transmembrane protein rsc0753 or rs05100 SWALL:Q8Y1D7 (EMBL:AL646060) (108 aa) fasta scores: E(): 1e-21, 70.1% id in 97 aa and Pseudomonas aeruginosa hypothetical protein Pa3040 pa3040 SWALL:Q9HZG8 (EMBL:AE004729) (109 aa) fasta scores: E(): 1.6e-09, 43.43% id in 99 aa
YP_109346.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0752 or rs05101 SWALL:Q8Y1D8 (EMBL:AL646060) (125 aa) fasta scores: E(): 6.6e-25, 62.5% id in 112 aa, and to Pseudomonas aeruginosa hypothetical protein Pa3041 SWALL:Q9HZG7 (EMBL:AE004729) (126 aa) fasta scores: E(): 1.6e-10, 38.52% id in 122 aa
YP_109348.1	Similar to Bacteroides nodosus fimbrial protein precursor FimA SWALL:FMAI_BACNO (SWALL:P17827) (161 aa) fasta scores: E(): 0.00043, 29.45% id in 129 aa, and to Xylella fastidiosa pilE protein xf0033 SWALL:Q9PHB1 (EMBL:AE003857) (139 aa) fasta scores: E(): 2.9e-07, 35.87% id in 131 aa
YP_109350.1	Weakly similar to Ralstonia solanacearum probable transmembrane protein rsc0726 or rs05127 SWALL:Q8Y1G4 (EMBL:AL646060) (328 aa) fasta scores: E(): 0.0054, 32.7% id in 263 aa, and to Xylella fastidiosa hypothetical protein xf0030 SWALL:Q9PHB4 (EMBL:AE003857) (316 aa) fasta scores: E(): 0.068, 25.17% id in 282 aa
YP_109352.1	Similar to Xanthomonas campestris pre-pilin like leader sequence FimT or xcc2495 SWALL:AAM41769 (EMBL:AE012361) (171 aa) fasta scores: E(): 6.6e-05, 30.76% id in 169 aa
YP_109353.1	Similar to Ralstonia solanacearum hypothetical protein rsc0728 or rs05125 SWALL:Q8Y1G2 (EMBL:AL646060) (149 aa) fasta scores: E(): 6.9e-38, 65.1% id in 149 aa, and to Xanthomonas axonopodis hypothetical protein Xac0744 SWALL:AAM35633 (EMBL:AE011704) (174 aa) fasta scores: E(): 4.4e-32, 59.21% id in 152 aa, and to Xanthomonas campestris hypothetical protein Xcc0691 SWALL:AAM40007 (EMBL:AE012168) (174 aa) fasta scores: E(): 8e-32, 58.55% id in 152 aa
YP_109354.1	catalyzes the reaction of glycine with 5,10-methylenetetrahydrofolate to form L-serine and tetrahydrofolate
YP_109355.1	Similar to Streptomyces clavuligerus clavaldehyde dehydrogenase Cad SWALL:Q9LCV7 (EMBL:U87786) (247 aa) fasta scores: E(): 1.1e-22, 36.66% id in 240 aa, and to Ralstonia solanacearum probable oxidoreductase rsc0730 or rs05123 SWALL:Q8Y1G0 (EMBL:AL646060) (262 aa) fasta scores: E(): 9.5e-65, 69.23% id in 247 aa, and to Salmonella typhimurium, and Salmonella typhi hypothetical oxidoreductase YdfG or stm1511 or sty1550 SWALL:YDFG_SALTY (SWALL:P40864) (248 aa) fasta scores: E(): 3.8e-64, 68.42% id in 247 aa
YP_109356.1	Similar to Ralstonia solanacearum  thioesterase rsc0731 or rs05122 SWALL:Q8Y1F9 (EMBL:AL646060) (134 aa) fasta scores: E(): 2.1e-35, 66.4% id in 128 aa, and to Xanthomonas campestris hypothetical protein Xcc3022 SWALL:AAM42293 (EMBL:AE012415) (152 aa) fasta scores: E(): 4.1e-22, 47.01% id in 134 aa, and to Xanthomonas axonopodis hypothetical protein Xac3146 SWALL:AAM37990 (EMBL:AE011958) (152 aa) fasta scores: E(): 6.6e-22, 45.65% id in 138 aa
YP_109357.1	Similar to Pseudomonas aeruginosa protein TolQ or pa0969 SWALL:TOLQ_PSEAE (SWALL:P50598) (231 aa) fasta scores: E(): 4.9e-40, 52.23% id in 224 aa, and to Ralstonia solanacearum probable tolq-related transport transmembrane protein TolQ or rsc0732 or rs05121 SWALL:Q8Y1F8 (EMBL:AL646060) (230 aa) fasta scores: E(): 3.5e-65, 77.09% id in 227 aa; possible alternative start site at codon 38
YP_109358.1	Similar to Pseudomonas aeruginosa protein TolR or pa0970 SWALL:TOLR_PSEAE (SWALL:P50599) (146 aa) fasta scores: E(): 3.7e-11, 38.4% id in 138 aa, and to Ralstonia solanacearum  tolr-related transport transmembrane protein TolR or rsc0733 or rs05120 SWALL:Q8Y1F7 (EMBL:AL646060) (144 aa) fasta scores: E(): 1.4e-28, 63.3% id in 139 aa, and to Xanthomonas axonopodis TolR protein tolr or xac3144 SWALL:AAM37988 (EMBL:AE011958) (149 aa) fasta scores: E(): 4.4e-12, 43.38% id in 136 aa; possible alternative start site at codon 10
YP_109359.1	Similar to Pseudomonas aeruginosa TolA protein TolA or pa0971 SWALL:TOLA_PSEAE (SWALL:P50600) (347 aa) fasta scores: E(): 0.00074, 30.72% id in 319 aa, and to Ralstonia solanacearum probable TolA-related transport transmembrane protein TolA or rsc0734 or rs05119 SWALL:Q8Y1F6 (EMBL:AL646060) (345 aa) fasta scores: E(): 1.1e-22, 45.56% id in 338 aa, and to Xanthomonas campestris TolA protein TolA or xcc3019 SWALL:Q8P6F1 (EMBL:AE012415) (345 aa) fasta scores: E(): 1.4e-05, 26.95% id in 345 aa
YP_109360.1	forms dimers; may be involved in cell envelope integrity; interacts with outer membrane proteins and with the C-terminal domain of inner membrane protein TolA
YP_109361.1	Similar to Pseudomonas putida peptidoglycan-associated lipoprotein precursor Pal or Pal1 SWALL:PAL_PSEPU (SWALL:P43036) (166 aa) fasta scores: E(): 2.8e-17, 44.02% id in 159 aa, and to Ralstonia solanacearum probable peptidoglycan-associated lipoprotein precursor Pal or rsc0736 or rs05117 SWALL:Q8Y1F4 (EMBL:AL646060) (172 aa) fasta scores: E(): 5.7e-37, 68.07% id in 166 aa, and to Xylella fastidiosa outer membrane protein p6 precursor xf1896 SWALL:Q9PC85 (EMBL:AE004009) (186 aa) fasta scores: E(): 2.7e-18, 39.2% id in 176 aa
YP_109362.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0737 or rs05116 SWALL:Q8Y1F3 (EMBL:AL646060) (274 aa) fasta scores: E(): 5.9e-45, 53.3% id in 242 aa, and to Xanthomonas campestris hypothetical protein Xcc3016 SWALL:AAM42287 (EMBL:AE012414) (272 aa) fasta scores: E(): 5.5e-14, 32.84% id in 274 aa, and to Xanthomonas axonopodis hypothetical protein Xac3140 SWALL:AAM37984 (EMBL:AE011958) (272 aa) fasta scores: E(): 9.5e-14, 33.57% id in 274 aa
YP_109364.1	Similar to Xanthomonas campestris UDP-glucose pyrophosphorylase SWALL:P74969 (EMBL:U65532) (324 aa) fasta scores: E(): 5.2e-57, 57.72% id in 272 aa, and to previously sequenced Burkholderia pseudomallei UTP-glucose-1-phosphate uridylyltransferase SWALL:Q9F5N4 (EMBL:AF312223) (295 aa) fasta scores: E(): 9.6e-91, 78.15% id in 293 aa, and to Ralstonia solanacearum probable UTP-glucose-1-phosphate uridylyltransferase GalU1 or rsc2237 or rs01362 SWALL:Q8XX79 (EMBL:AL646069) (289 aa) fasta scores: E(): 2.3e-90, 77.16% id in 289 aa
YP_109365.1	Similar to Escherichia coli polysialic acid capsule expression protein KpsF SWALL:KSF5_ECOLI (SWALL:Q47334) (327 aa) fasta scores: E(): 3.5e-43, 43.61% id in 321 aa, and to Haemophilus influenzae hypothetical protein HI1678 SWALL:YRBH_HAEIN (SWALL:P45313) (337 aa) fasta scores: E(): 3e-51, 49.68% id in 320 aa
YP_109366.1	Similar to Ralstonia solanacearum hypothetical protein rsc0412 or rs03380 SWALL:Q8Y2C4 (EMBL:AL646059) (195 aa) fasta scores: E(): 5.2e-21, 46.34% id in 164 aa, and to Neisseria meningitidis hypothetical protein Nmb0353 SWALL:Q9K137 (EMBL:AE002392) (178 aa) fasta scores: E(): 2.3e-19, 39.24% id in 158 aa, and to Neisseria meningitidis hypothetical protein Nma2134 SWALL:Q9JSU3 (EMBL:AL162758) (178 aa) fasta scores: E(): 2.7e-19, 39.24% id in 158 aa
YP_109367.1	catalyzes the formation of 2-dehydro-3-deoxy-D-octonate 8-phosphate from phosphoenolpyruvate and D-arabinose 5-phosphate in LPS biosynthesis
YP_109368.1	Similar to Klebsiella pneumoniae glycosyltransferase in cps region SWALL:YC07_KLEPN (SWALL:Q48453) (358 aa) fasta scores: E(): 2e-08, 26.48% id in 370 aa, and to Lactobacillus delbrueckii glycosyltransferase EpsF SWALL:Q9F0C2 (EMBL:AF267127) (366 aa) fasta scores: E(): 9e-28, 30.63% id in 346 aa, and to Escherichia coli  galactosyltransferase WbgM SWALL:Q8VQ50 (EMBL:AF461121) (364 aa) fasta scores: E(): 1.7e-12, 27.36% id in 296 aa; possible alternative start site at codon 27
YP_109370.1	Similar to Escherichia coli, and Escherichia coli O157:H7  colanic acid biosynthesis acetyltransferase WcaB or b2058 or z3222 or ecs2863 SWALL:WCAB_ECOLI (SWALL:P77558) (162 aa) fasta scores: E(): 4.6e-15, 38.36% id in 159 aa, and to Salmonella typhimurium  acetyl transferase WcaB or stm2114 SWALL:Q9F7A9 (EMBL:AF285084) (162 aa) fasta scores: E(): 7.4e-16, 40% id in 160 aa, and to Salmonella typhi  acetyltransferase sty2327 SWALL:Q8Z5G7 (EMBL:AL627273) (162 aa) fasta scores: E(): 1.2e-15, 40% id in 160 aa
YP_109371.1	No significant database matches to the full length CDS. Internal region is similar to an internal region of Escherichia coli capsule polysaccharide export protein KpsS SWALL:KSS5_ECOLI (SWALL:P42218) (389 aa) fasta scores: E(): 0.0021, 29.75% id in 242 aa; Similar to Rhizobium sp. protein FixF or y4gK from codon 220 to 395 SWALL:FIXF_RHISN (SWALL:P55467) (402 aa) fasta scores: E(): 7.6e-06, 39.28% id in 112 aa
YP_109372.1	Similar to Pseudomonas aeruginosa O-antigen translocase Orf_11 SWALL:AAM27663 (EMBL:AF498408) (411 aa) fasta scores: E(): 2.5e-13, 24.69% id in 413 aa, and to Pseudomonas aeruginosa protein WbpF or Wzx or pa3153 SWALL:P72137 (EMBL:U50396) (411 aa) fasta scores: E(): 4.4e-13, 24.69% id in 413 aa, and to Rhizobium loti O-antigen translocase homolog mlr9725 SWALL:Q98NV4 (EMBL:AP003017) (449 aa) fasta scores: E(): 1.7e-11, 27.57% id in 417 aa
YP_109373.1	Similar to Acinetobacter johnsonii tyrosine-protein kinase Ptk SWALL:PTK_ACIJO (SWALL:O52788) (733 aa) fasta scores: E(): 1.3e-70, 34.27% id in 741 aa, and to Ralstonia solanacearum  tyrosine-protein kinase EpsB SWALL:EPB2_RALSO (SWALL:Q45409) (750 aa) fasta scores: E(): 1.4e-132, 53.65% id in 738 aa, and to Ralstonia solanacearum  tyrosine-protein kinase EpsB or rsp1018 or rs02356 SWALL:EPB1_RALSO (SWALL:P58593) (751 aa) fasta scores: E(): 1.4e-132, 53.77% id in 742 aa
YP_109374.1	Similar to Acinetobacter johnsonii low molecular weight protein-tyrosine-phosphatase Ptp SWALL:PTP_ACIJO (SWALL:O52787) (142 aa) fasta scores: E(): 2.5e-16, 36.69% id in 139 aa, and to Ralstonia solanacearum probable low molecular weight protein-tyrosine-phosphatase EpsP or rsp1019 or rs02353 SWALL:EPP1_RALSO (SWALL:P58596) (145 aa) fasta scores: E(): 1.6e-25, 50.7% id in 142 aa, and to Ralstonia solanacearum probable low molecular weight protein-tyrosine-phosphatase EpsP SWALL:EPP2_RALSO (SWALL:Q45408) (145 aa) fasta scores: E(): 1.6e-25, 51.4% id in 142 aa. Note: may be involved in EPS biosynthesis
YP_109375.1	Similar to Vibrio vulnificus capsular polysaccharide transport protein Wza SWALL:Q938A5 (EMBL:AY055488) (378 aa) fasta scores: E(): 1.4e-34, 40.98% id in 305 aa, and to Ralstonia solanacearum EPS I polysaccharide export outer membrane protein EpsA precursor SWALL:EPA2_RALSO (SWALL:Q45407) (377 aa) fasta scores: E(): 9.2e-49, 42.59% id in 385 aa, and to Ralstonia solanacearum EPS I polysaccharide export outer membrane protein EpsA precursor or rsp1020 or rs02354 SWALL:EPA1_RALSO (SWALL:P58597) (381 aa) fasta scores: E(): 3.1e-48, 43.04% id in 388 aa. CDS is extended at the N-terminus in comparison to orthologues. Possible alternative translational start site
YP_109376.1	Similar to Erwinia amylovora UDP-galactose-lipid carrier transferase AmsG SWALL:AMSG_ERWAM (SWALL:Q46628) (477 aa) fasta scores: E(): 1e-49, 62.21% id in 217 aa, and to Erwinia pyrifoliae sugar transferase CpsG from codon 162 to 374 SWALL:Q8VVI1 (EMBL:AJ300463) (477 aa) fasta scores: E(): 3e-50, 62.67% id in 217 aa, and to Erwinia stewartii undecaprenyl-phosphate galactose phosphotransferase homolog CpsA from codon 175 to 374 SWALL:O85804 (EMBL:AF077292) (476 aa) fasta scores: E(): 6.4e-50, 66% id in 200 aa
YP_109377.1	Similar to Mycobacterium smegmatis AdpA-like protein SWALL:Q9KX52 (EMBL:U20115) (308 aa) fasta scores: E(): 1.3e-11, 31.08% id in 222 aa, and to Caulobacter crescentus transcriptional regulator, AraC family cc3367 SWALL:Q9A339 (EMBL:AE005998) (324 aa) fasta scores: E(): 3.9e-09, 29.81% id in 322 aa, and to Streptomyces coelicolor  transcriptional regulator sco2329 or scc53.20C SWALL:Q9KXJ1 (EMBL:AL357591) (320 aa) fasta scores: E(): 4.5e-09, 29.44% id in 326 aa
YP_109378.1	Similar to Klebsiella pneumoniae hypothetical protein in cps region SWALL:YC02_KLEPN (SWALL:Q48448) (209 aa) fasta scores: E(): 1.7e-10, 31.86% id in 182 aa, and to Ralstonia solanacearum probable transmembrane protein rsp1005 or rs02338 SWALL:Q8XR56 (EMBL:AL646082) (223 aa) fasta scores: E(): 3.1e-10, 34.4% id in 186 aa, and to Aeromonas hydrophila hypothetical 28.2 kDa protein SWALL:Q9X647 (EMBL:AF131869) (264 aa) fasta scores: E(): 5.5e-10, 37.68% id in 207 aa
YP_109379.1	No significant database matches. Possible alternative translational start site
YP_109382.1	Similar to Escherichia coli, and Escherichia coli O157:H7 from codon 59 2-amino-3-ketobutyrate coenzyme A ligase Kbl or b3617 or z5044 or ecs4495 SWALL:KBL_ECOLI (SWALL:P07912) (398 aa) fasta scores: E(): 3.4e-37, 35.59% id in 354 aa. Identical to Burkholderia mallei  acyl-CoA transferase WcbT SWALL:Q9AI28 (EMBL:AF285636) (439 aa) fasta scores: E(): 1e-164, 100% id in 439 aa
YP_109383.1	zinc-dependent; catalyzes the deacetylation of UDP-(3-O-acyl)-N-acetylglucosamine to UDP-3-O-(3-hydroxytetradecanoyl)-glucosamine in the second step of lipid A biosynthesis
YP_109384.1	Similar to previously sequenced Burkholderia mallei type I polyketide synthase WcbR SWALL:Q9AI30 (EMBL:AF285636) (2546 aa) fasta scores: E(): 0, 99.64% id in 2546 aa, and to Rhizobium meliloti fatty acid synthase transmembrane protein RkpA or r00577 or smc02273 SWALL:Q92S51 (EMBL:AL591784) (2504 aa) fasta scores: E(): 1e-168, 36.88% id in 2592 aa, and to Stigmatella aurantiaca StiG protein SWALL:Q8RJY0 (EMBL:AJ421825) (1398 aa) fasta scores: E(): 7.7e-134, 39.09% id in 1279 aa
YP_109385.1	Similar to Rhizobium meliloti capsular polysaccharide biosynthesis protein from codon 21 RkpI or r00574 or smc02270 SWALL:RKPI_RHIME (SWALL:Q52938) (538 aa) fasta scores: E(): 1.8e-15, 30% id in 470 aa, and to Burkholderia mallei capsular polysaccharide biosynthesis protein WcbQ SWALL:Q9AI31 (EMBL:AF285636) (511 aa) fasta scores: E(): 2.9e-197, 95.89% id in 511 aa, and to Agrobacterium tumefaciens hypothetical protein atu1658 or agr_c_3053 SWALL:Q8UEU6 (EMBL:AE009122) (646 aa) fasta scores: E(): 2.4e-20, 27.36% id in 486 aa
YP_109386.1	Similar to Burkholderia mallei dehydrogenase/reductase WcbP SWALL:Q9AI32 (EMBL:AF285636) (262 aa) fasta scores: E(): 1.1e-97, 99.23% id in 262 aa, and to Dictyostelium discoideum  oxidoreductase SWALL:AAM43748 (EMBL:AC116989) (342 aa) fasta scores: E(): 7.9e-24, 36.4% id in 250 aa, and to Dictyostelium discoideum hypothetical protein SWALL:AAM43743 (EMBL:AC116989) (344 aa) fasta scores: E(): 9.2e-24, 36.26% id in 262 aa
YP_109387.1	Similar to Escherichia coli capsule polysaccharide export protein KpsS SWALL:KSS5_ECOLI (SWALL:P42218) (389 aa) fasta scores: E(): 2.7e-47, 37.46% id in 379 aa, and to Burkholderia mallei  capsule polysaccharide biosynthesis/export protein WcbO SWALL:Q9AI33 (EMBL:AF285636) (400 aa) fasta scores: E(): 1.3e-171, 99.75% id in 400 aa, and to Rhizobium meliloti capsular polysaccharide biosynthesis/export protein RkpJ or r00573 or smc02269 SWALL:Q92S54 (EMBL:AL591784) (441 aa) fasta scores: E(): 1.5e-48, 36.77% id in 397 aa
YP_109388.1	Similar to Aneurinibacillus thermoaerophilus D-glycero-d-manno-heptose 1,7-bisphosphate phosphatase GmhC SWALL:Q9AGY5 (EMBL:AF324836) (179 aa) fasta scores: E(): 3.6e-35, 60% id in 155 aa. Identical to Burkholderia mallei WcbN protein SWALL:Q9AI34 (EMBL:AF285636) (189 aa) fasta scores: E(): 9.5e-78, 100% id in 189 aa
YP_109389.1	Similar to Aneurinibacillus thermoaerophilus D-glycero-d-manno-heptose 1-phosphate guanosyltransferase GmhD SWALL:Q9AGY6 (EMBL:AF324836) (230 aa) fasta scores: E(): 4.6e-29, 39.55% id in 225 aa. Previously sequenced Burkholderia pseudomallei  capsular polysaccharide biosynthesis protein WcbM SWALL:Q93UJ1 (EMBL:AF228583) (230 aa) fasta scores: E(): 5e-89, 99.56% id in 230 aa
YP_109390.1	catalyzes the isomerization of sedoheptulose 7-phosphate to D-glycero-D-manno-heptose 7-phosphate
YP_109391.1	Similar to Aneurinibacillus thermoaerophilus D-glycero-d-manno-heptose 7-phosphate kinase GmhB SWALL:Q9AGY8 (EMBL:AF324836) (341 aa) fasta scores: E(): 1.6e-79, 55.84% id in 342 aa. Previously sequenced Burkholderia pseudomallei  sugar kinase WcbL SWALL:Q93UJ3 (EMBL:AF228583) (346 aa) fasta scores: E(): 5.3e-139, 100% id in 346 aa
YP_109392.1	Similar to Aneurinibacillus thermoaerophilus GDP-6-deoxy-D-lyxo-4-hexulose reductase Rmd SWALL:Q9EYP5 (EMBL:AF317224) (309 aa) fasta scores: E(): 4.3e-31, 35.4% id in 322 aa. Identical to Burkholderia mallei  GDP epimerase/dehydratase WcbK SWALL:Q9AI38 (EMBL:AF285636) (337 aa) fasta scores: E(): 1.2e-132, 100% id in 337 aa
YP_109393.1	Similar to Azorhizobium caulinodans  capsular polysaccharide biosynthesis protein Oac2 SWALL:Q06936 (EMBL:Z22611) (296 aa) fasta scores: E(): 1.7e-06, 27.13% id in 199 aa. Identical to Burkholderia mallei  capsular polysaccharide biosynthesis protein WcbJ SWALL:Q9AI39 (EMBL:AF285636) (280 aa) fasta scores: E(): 1.2e-109, 100% id in 280 aa
YP_109394.1	Similar to Burkholderia mallei  capsular polysaccharide biosynthesis protein WcbI SWALL:Q9AI40 (EMBL:AF285636) (311 aa) fasta scores: E(): 1.4e-128, 99.67% id in 311 aa, and to previously sequenced Burkholderia pseudomallei  capsular polysaccharide biosynthesis protein WcbI SWALL:Q93UJ4 (EMBL:AF228583) (395 aa) fasta scores: E(): 2.7e-128, 99.03% id in 312 aa
YP_109395.1	Similar to Caulobacter crescentus glycosyl transferase, group 1 family protein cc1003 or WbqX SWALL:Q9A9H7 (EMBL:AE005778) (434 aa) fasta scores: E(): 3e-10, 27.02% id in 433 aa. Previously sequenced Burkholderia pseudomallei  glycosyltransferase WcbH SWALL:Q93UJ5 (EMBL:AF228583) (598 aa) fasta scores: E(): 0, 99.66% id in 598 aa
YP_109396.1	Previously sequenced as Burkholderia pseudomallei capsular polysaccharide biosynthesis protein WcbG SWALL:Q93UJ6 (EMBL:AF228583) (313 aa) fasta scores: E(): 1e-116, 100% id in 313 aa. Highly similar to Burkholderia mallei  capsular polysaccharide biosynthesis protein WcbG SWALL:Q9AI42 (EMBL:AF285636) (313 aa) fasta scores: E(): 9e-116, 99.04% id in 313 aa
YP_109397.1	Previously sequenced Burkholderia pseudomallei capsule polysaccharide biosynthesis protein WcbF SWALL:Q93UJ7 (EMBL:AF228583) (459 aa) fasta scores: E(): 8e-185, 100% id in 440 aa. Highly similar to Burkholderia mallei  capsule polysaccharide biosynthesis protein WcbF SWALL:Q9AI43 (EMBL:AF285636) (440 aa) fasta scores: E(): 4e-184, 99.77% id in 440 aa
YP_109398.1	Similar to Pseudomonas aeruginosa glycosyltransferase WbpX or pa5449 SWALL:O84908 (EMBL:AF010181) (460 aa) fasta scores: E(): 1e-09, 34.83% id in 155 aa, and to previously sequenced Burkholderia pseudomallei  glycosyltransferase WcbE SWALL:Q93UJ8 (EMBL:AF228583) (507 aa) fasta scores: E(): 1e-206, 99.8% id in 507 aa, and to Burkholderia mallei glycosyltransferase WcbE SWALL:Q9AI44 (EMBL:AF285636) (507 aa) fasta scores: E(): 7.2e-206, 99.8% id in 507 aa, and to Actinobacillus actinomycetemcomitans glycosyltransferase SWALL:Q9JRN4 (EMBL:AB046360) (390 aa) fasta scores: E(): 4.8e-10, 34.53% id in 139 aa
YP_109399.1	Similar to Haemophilus influenzae ATP-binding protein BexA SWALL:BEXA_HAEIN (SWALL:P10640) (217 aa) fasta scores: E(): 2.7e-42, 58.98% id in 217 aa. Highly similar to Burkholderia mallei  ABC-2 transporter Wzt SWALL:Q9AI45 (EMBL:AF285636) (218 aa) fasta scores: E(): 5.1e-73, 100% id in 218 aa. Previously as sequenced Burkholderia pseudomallei  ATP-binding protein Wzt2 SWALL:Q93UJ9 (EMBL:AF228583) (248 aa) fasta scores: E(): 3.3e-70, 99.05% id in 211 aa
YP_109400.1	Similar to Haemophilus influenzae capsule polysaccharide export inner-membrane protein BexB bexB SWALL:BXB2_HAEIN (SWALL:P19391) (265 aa) fasta scores: E(): 1.8e-44, 42.47% id in 259 aa. Identical to Burkholderia mallei  ABC-2 transporter Wzm SWALL:Q9AI46 (EMBL:AF285636) (260 aa) fasta scores: E(): 6.2e-105, 100% id in 260 aa
YP_109401.1	Similar to Haemophilus influenzae capsule polysaccharide export inner-membrane protein BexC SWALL:BEXC_HAEIN (SWALL:P22930) (377 aa) fasta scores: E(): 7.1e-55, 41.99% id in 381 aa. Identical to Burkholderia mallei  capsule polysaccharide export inner-membrane protein WcbD SWALL:Q9AI47 (EMBL:AF285636) (382 aa) fasta scores: E(): 3.7e-135, 100% id in 382 aa
YP_109402.1	Similar to Actinobacillus pleuropneumoniae capsular polysaccharide biosynthesis/export protein CpxD precursor SWALL:Q44132 (EMBL:U36397) (394 aa) fasta scores: E(): 6.4e-52, 41.19% id in 386 aa, Identical to Burkholderia mallei capsular polysaccharide biosynthesis/export protein WcbC SWALL:Q9AI48 (EMBL:AF285636) (387 aa) fasta scores: E(): 5.8e-141, 100% id in 387 aa
YP_109403.1	Similar to Pseudomonas aeruginosa glycosyltransferase WbpX or pa5449 SWALL:O84908 (EMBL:AF010181) (460 aa) fasta scores: E(): 2.3e-16, 33.33% id in 267 aa, and to previously sequenced Burkholderia pseudomallei  glycosyltransferase WcbB SWALL:Q93UK1 (EMBL:AF228583) (365 aa) fasta scores: E(): 7e-147, 98.88% id in 357 aa, and to Burkholderia mallei glycosyltransferase WcbB SWALL:Q9AI49 (EMBL:AF285636) (280 aa) fasta scores: E(): 2.8e-116, 99.64% id in 280 aa, and to Burkholderia thailandensis  glycosyltransferase WcbB SWALL:Q9AI57 (EMBL:AF285634) (280 aa) fasta scores: E(): 1.2e-84, 72.76% id in 279 aa
YP_109404.1	Similar to Escherichia coli capsule polysaccharide export protein KpsC SWALL:KSC5_ECOLI (SWALL:P42217) (675 aa) fasta scores: E(): 4.4e-65, 35.75% id in 674 aa, and to Burkholderia mallei  capsular polysaccharide export protein WcbA SWALL:Q9AI50 (EMBL:AF285636) (671 aa) fasta scores: E(): 0, 99.85% id in 671 aa, and to previously sequenced Burkholderia pseudomallei  capsular polysaccharide export protein WcbA SWALL:Q93UK2 (EMBL:AF228583) (671 aa) fasta scores: E(): 0, 99.4% id in 671 aa, and to Burkholderia thailandensis  capsular polysaccharide export protein WcbA SWALL:Q9AI58 (EMBL:AF285634) (676 aa) fasta scores: E(): 6.5e-152, 60.12% id in 637 aa
YP_109405.1	Similar to Escherichia coli GDP-mannose pyrophosphorylase ManC SWALL:Q9EXX9 (EMBL:AY012191) (479 aa) fasta scores: E(): 9.4e-105, 56.63% id in 475 aa. Previously sequenced Burkholderia pseudomallei ManC protein SWALL:Q93UK3 (EMBL:AF228583) (475 aa) fasta scores: E(): 5.3e-190, 100% id in 475 aa. Highly similar to Burkholderia mallei  GDP-mannose pyrophosphorylase ManC SWALL:Q9AI51 (EMBL:AF285636) (475 aa) fasta scores: E(): 1.1e-189, 99.78% id in 475 aa, and to Burkholderia thailandensis  GDP-mannose pyrophosphorylase ManC SWALL:Q9AI59 (EMBL:AF285634) (476 aa) fasta scores: E(): 1.1e-160, 82.7% id in 474 aa
YP_109406.1	Identical to Burkholderia mallei hypothetical protein YafJ SWALL:Q9AI52 (EMBL:AF285636) (278 aa) fasta scores: E(): 5e-119, 100% id in 278 aa. Similar to Streptomyces coelicolor hypothetical protein sco7508 or scbac17a6.41C SWALL:Q93J89 (EMBL:AL596248) (277 aa) fasta scores: E(): 4e-64, 55.63% id in 275 aa, and to Rhizobium meliloti hypothetical protein r00357 or smc01162 SWALL:Q92SL4 (EMBL:AL591783) (271 aa) fasta scores: E(): 1.3e-33, 41.85% id in 270 aa
YP_109407.1	Identical to Burkholderia mallei hypothetical protein YggB SWALL:Q9AI53 (EMBL:AF285636) (290 aa) fasta scores: E(): 1.6e-105, 100% id in 290 aa. Previously sequenced Burkholderia pseudomallei hypothetical protein YggB SWALL:Q93UK4 (EMBL:AF228583) (271 aa) fasta scores: E(): 4e-91, 95.57% id in 271 aa
YP_109408.1	Similar to Burkholderia mallei DedA family transmembrane protein SWALL:Q9AI54 (EMBL:AF285636) (226 aa) fasta scores: E(): 6.3e-85, 99.11% id in 226 aa, and to Ralstonia solanacearum probable DedA dsg-1 protein transmembrane DedA or rsc2559 or rs00742 SWALL:Q8XWB5 (EMBL:AL646070) (218 aa) fasta scores: E(): 5.6e-52, 63.42% id in 216 aa, and to Escherichia coli, and Escherichia coli O157:H7 DedA protein DedA or b2317 or z3579 or ecs3201 SWALL:DEDA_ECOLI (SWALL:P09548) (219 aa) fasta scores: E(): 1.2e-39, 47.98% id in 223 aa; possible alternative start site at codon 22
YP_109409.1	This protein is involved in the repair of mismatches in DNA. It is required for dam-dependent methyl-directed DNA mismatch repair. Promotes the formation of a stable complex between two or more DNA-binding proteins in an ATP-dependent manner without itself being part of a final effector complex
YP_109410.1	IPP transferase; isopentenyltransferase; involved in tRNA modification; in Escherichia coli this enzyme catalyzes the addition of a delta2-isopentenyl group from dimethylallyl diphosphate to the N6-nitrogen of adenosine adjacent to the anticodon of tRNA species that read codons starting with uracil; further tRNA modifications may occur; mutations in miaA result in defects in translation efficiency and fidelity
YP_109411.1	Similar to Ralstonia solanacearum hypothetical protein rsc3100 or rs00553 SWALL:Q8XUT5 (EMBL:AL646073) (131 aa) fasta scores: E(): 2.2e-19, 50.38% id in 131 aa
YP_109412.1	Similar to Bordetella parapertussis transposase for insertion sequence element IS1001 TnpA SWALL:TNPA_BORPA (SWALL:Q06126) (406 aa) fasta scores: E(): 3.6e-138, 78.32% id in 406 aa, and to Burkholderia mallei transposase Tnp SWALL:Q9FDC1 (EMBL:AF285635) (386 aa) fasta scores: E(): 3.8e-162, 99.22% id in 386 aa. CDS is extended at the N-terminus in comparison to the B. mallei protein
YP_109413.1	catalyzes the formation of 1-(5-phosphoribosyl)-5-aminoimidazole from 2-(formamido)-N1-(5-phosphoribosyl)acetamidine and ATP in purine biosynthesis
YP_109414.1	Similar to Ralstonia solanacearum hypothetical protein rsc2625 or rs00929 SWALL:Q8XW50 (EMBL:AL646071) (233 aa) fasta scores: E(): 2.9e-43, 53.04% id in 230 aa, and to Neisseria meningitidis dnaA-related protein nmb1076 SWALL:Q9JZF5 (EMBL:AE002458) (222 aa) fasta scores: E(): 6.8e-22, 37.22% id in 231 aa, and to Neisseria meningitidis hypothetical protein Nma1279 SWALL:Q9JUJ9 (EMBL:AL162755) (243 aa) fasta scores: E(): 7.3e-22, 37.22% id in 231 aa
YP_109415.1	Similar to Ralstonia solanacearum  hydrolase rsc2626 or rs00930 SWALL:Q8XW49 (EMBL:AL646071) (224 aa) fasta scores: E(): 3.6e-62, 65.47% id in 223 aa, and to Neisseria meningitidis hypothetical protein Nmb1075 SWALL:Q9JZF6 (EMBL:AE002458) (222 aa) fasta scores: E(): 2.9e-40, 47.32% id in 224 aa, and to Neisseria meningitidis hypothetical protein Nma1278 SWALL:Q9JUK0 (EMBL:AL162755) (222 aa) fasta scores: E(): 4.6e-40, 46.87% id in 224 aa
YP_109416.1	Similar to Pseudomonas putida polynucleotide adenylyltransferase PcnB SWALL:O87789 (EMBL:Y18131) (463 aa) fasta scores: E(): 2.9e-55, 49.01% id in 455 aa, and to Ralstonia solanacearum probable polynucleotide adenylyltransferase PcnB or rsc2627 or rs00931 SWALL:Q8XW48 (EMBL:AL646071) (514 aa) fasta scores: E(): 9.5e-115, 64.36% id in 522 aa, and to Pseudomonas aeruginosa poly(A) polymerase PcnB or pa4727 SWALL:Q9HV72 (EMBL:AE004886) (467 aa) fasta scores: E(): 5.2e-52, 47.13% id in 471 aa
YP_109417.1	Similar to Escherichia coli 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase FolK or b0142 SWALL:HPPK_ECOLI (SWALL:P26281) (158 aa) fasta scores: E(): 1.7e-13, 39.35% id in 155 aa, and to Ralstonia solanacearum probable 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase, 7,8-dihydro-6-hydroxymethylpterin-pyrophosphokinase FolK or rsc2628 or rs00932 SWALL:Q8XW47 (EMBL:AL646071) (169 aa) fasta scores: E(): 2e-41, 62.13% id in 169 aa, and to Bacillus halodurans 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase FolK or bh0095 SWALL:Q9KGG7 (EMBL:AP001507) (174 aa) fasta scores: E(): 6.1e-19, 43.7% id in 135 aa
YP_109418.1	Similar to Lactobacillus acidophilus deoxyadenosine kinase SWALL:DGK1_LACAC (SWALL:Q59483) (214 aa) fasta scores: E(): 6.5e-08, 26.94% id in 193 aa, and to Ralstonia solanacearum  deoxyguanosine kinase rsc2629 or rs00933 SWALL:Q8XW46 (EMBL:AL646071) (214 aa) fasta scores: E(): 6.4e-27, 47.29% id in 203 aa, and to uncultured proteobacterium EBAC31A08 predicted deoxypurine kinase SWALL:Q9F7R4 (EMBL:AF279106) (221 aa) fasta scores: E(): 1.5e-24, 42.92% id in 205 aa, and to Deinococcus radiodurans subunit dr0299 SWALL:Q9RXL1 (EMBL:AE001891) (205 aa) fasta scores: E(): 1.1e-18, 38.54% id in 192 aa
YP_109419.1	catalyzes the formation of tetrahydrofolate and 2-dehydropantoate from 5,10-methylenetetrahydrofolate and 3-methyl-2-oxobutanoate
YP_109420.1	Similar to Ralstonia solanacearum para-aminobenzoate synthetase component I protein PabB or rsc2633 or rs05772 SWALL:Q8XW42 (EMBL:AL646071) (626 aa) fasta scores: E(): 1.4e-57, 50.88% id in 676 aa, and to Neisseria meningitidis para-aminobenzoate synthetase component i/4-amino-4-deoxychorismate lyase,  nmb1970 SWALL:Q9JXM6 (EMBL:AE002545) (593 aa) fasta scores: E(): 1e-42, 41.3% id in 661 aa, and to Neisseria meningitidis para-aminobenzoate synthase component I nma0477 SWALL:Q9JW99 (EMBL:AL162753) (598 aa) fasta scores: E(): 1.7e-42, 41.3% id in 661 aa, and to Rhizobium loti hypothetical protein Mlr3005 SWALL:Q98H70 (EMBL:AP003000) (381 aa) fasta scores: E(): 3.3e-30, 42.05% id in 321 aa
YP_109421.1	chaperone Hsp40; co-chaperone with DnaK; Participates actively in the response to hyperosmotic and heat shock by preventing the aggregation of stress-denatured proteins and by disaggregating proteins, also in an autonomous, dnaK-independent fashion
YP_109422.1	heat shock protein 70; assists in folding of nascent polypeptide chains; refolding of misfolded proteins; utilizes ATPase activity to help fold; co-chaperones are DnaJ and GrpE; multiple copies in some bacteria
YP_109423.1	with DnaK and DnaJ acts in response to hyperosmotic and heat shock by preventing the aggregation of stress-denatured proteins; may act as a thermosensor
YP_109424.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 heat shock protein 15 HslR or b3400 or c4171 or z4754 or ecs4242 SWALL:HSLR_ECOLI (SWALL:P45802) (133 aa) fasta scores: E(): 6.8e-10, 34.84% id in 132 aa, and to Ralstonia solanacearum  heat shock protein 15 HslR or rsc2642 or rs04574 SWALL:Q8XW33 (EMBL:AL646071) (131 aa) fasta scores: E(): 1.5e-28, 60.15% id in 128 aa, and to Neisseria meningitidis hypothetical protein (nma1348 or nmb1138) and nmb1176 SWALL:Q9JR17 (EMBL:AL162755) (133 aa) fasta scores: E(): 2.9e-16, 47.96% id in 123 aa
YP_109425.1	protoheme ferro-lyase; catalyzes the insertion of a ferrous ion into protoporphyrin IX to form protoheme; involved in protoheme biosynthesis; in some organisms this protein is membrane-associated while in others it is cytosolic
YP_109426.1	Negative regulator of class I heat shock genes (grpE-dnaK-dnaJ and groELS operons). Prevents heat-shock induction of these operons
YP_109427.1	catalyzes the phosphorylation of NAD to NADP
YP_109428.1	Similar to Escherichia coli DNA repair protein RecN or RadB or b2616 SWALL:RECN_ECOLI (SWALL:P05824) (553 aa) fasta scores: E(): 5.2e-71, 44.68% id in 555 aa, and to Ralstonia solanacearum probable DNA repair protein RecN or rsc2651 or rs04565 SWALL:Q8XW24 (EMBL:AL646071) (569 aa) fasta scores: E(): 3.3e-115, 64.9% id in 550 aa, and to Homo sapiens D-1 antigen SWALL:Q16490 (EMBL:S45570) (343 aa) from codon 67 to codon 410 fasta scores: E(): 4e-98, 86.29% id in 343 aa, and to Neisseria meningitidis  DNA repair protein RecN or nma0952 SWALL:Q9JV87 (EMBL:AL162754) (557 aa) fasta scores: E(): 6.1e-74, 47% id in 551 aa
YP_109429.1	catalyzes the ATP-dependent addition of AMP to a subunit of glutamine synthetase; also catalyzes the reverse reaction - deadenylation; adenylation/deadenylation of glutamine synthetase subunits is important for the regulation of this enzyme
YP_109430.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc2657 or rs04554 SWALL:Q8XW18 (EMBL:AL646071) (1426 aa) fasta scores: E(): 8.9e-140, 35.4% id in 1401 aa, and to Xanthomonas campestris hypothetical protein Xcc2608 SWALL:Q8P7K3 (EMBL:AE012372) (1296 aa) fasta scores: E(): 1e-24, 25.29% id in 1423 aa, and to Xanthomonas axonopodis hypothetical protein Xac2769 SWALL:Q8PIX6 (EMBL:AE011917) (1306 aa) fasta scores: E(): 2.7e-24, 25.55% id in 1444 aa
YP_109431.1	Similar to Ralstonia solanacearum  nitrilase rsc2658 or rs04553 SWALL:Q8XW17 (EMBL:AL646071) (289 aa) fasta scores: E(): 1.2e-72, 64.31% id in 269 aa, and to Neisseria meningitidis hypothetical protein Nma2044 SWALL:Q9JT13 (EMBL:AL162757) (270 aa) fasta scores: E(): 1.3e-51, 52.67% id in 262 aa, and to Neisseria meningitidis nitrilase nmb0441 SWALL:Q9K0W5 (EMBL:AE002400) (270 aa) fasta scores: E(): 1.8e-51, 53.43% id in 262 aa, and to Pseudomonas aeruginosa hypothetical protein Pa4475 SWALL:Q9HVU6 (EMBL:AE004861) (282 aa) fasta scores: E(): 3.5e-44, 46.06% id in 267 aa
YP_109432.1	Similar to Escherichia coli, and Escherichia coli O6 TldD DNA gyrase control protein or b3244 or c3999 SWALL:TLDD_ECOLI (SWALL:P46473) (481 aa) fasta scores: E(): 3.9e-104, 59.38% id in 485 aa, and to Ralstonia solanacearum probable TldD protein or rsc2659 or rs04552 SWALL:Q8XW16 (EMBL:AL646071) (486 aa) fasta scores: E(): 1.4e-146, 80.08% id in 487 aa, and to Xanthomonas campestris TldD protein or xcc2606 SWALL:AAM41878 (EMBL:AE012372) (481 aa) fasta scores: E(): 1.6e-113, 64.22% id in 478 aa
YP_109433.1	catalyzes the formation of 3-deoxy-D-arabino-hept-2-ulosonate 7 phosphate from phosphoenolpyruvate and D-erythrose 4-phosphate, phenylalanine sensitive
YP_109434.1	Similar to Alcaligenes eutrophus flavohemoprotein Fhp SWALL:HMPA_ALCEU (SWALL:P39662) (403 aa) fasta scores: E(): 1.9e-68, 52.68% id in 391 aa, and to Salmonella typhimurium flavohemoprotein Hmp or HmpA or FrsB or stm2556 SWALL:HMPA_SALTY (SWALL:P26353) (396 aa) fasta scores: E(): 4.6e-49, 41.85% id in 399 aa
YP_109435.1	Similar to Ralstonia solanacearum hypothetical protein rsc2663 or rs04544 SWALL:Q8XW12 (EMBL:AL646071) (185 aa) fasta scores: E(): 4.8e-55, 80.11% id in 181 aa, and to Xanthomonas campestris hypothetical protein Xcc0796 SWALL:AAM40111 (EMBL:AE012179) (185 aa) fasta scores: E(): 2.8e-38, 60% id in 185 aa, and to Xanthomonas axonopodis hypothetical protein Xac0870 SWALL:AAM35758 (EMBL:AE011718) (185 aa) fasta scores: E(): 1.6e-36, 57.83% id in 185 aa
YP_109436.1	Similar to Escherichia coli, and Escherichia coli O6 glycolate oxidase subunit GlcD or Gox or b2979 or c3709 SWALL:GLCD_ECOLI (SWALL:P52075) (499 aa) fasta scores: E(): 1.3e-37, 32.22% id in 419 aa, and to the C-terminal region of Saccharomyces cerevisiae D-lactate dehydrogenase [cytochrome], mitochondrial precursor Dld1 or Dld or ydl174C SWALL:DLD1_YEAST (SWALL:P32891) (587 aa) fasta scores: E(): 1.6e-60, 43.34% id in 436 aa
YP_109437.1	Similar to Escherichia coli, and Escherichia coli O6 glycolate oxidase subunit GlcD or Gox or b2979 or c3709 SWALL:GLCD_ECOLI (SWALL:P52075) (499 aa) fasta scores: E(): 4.2e-114, 59.91% id in 479 aa, and to Ralstonia solanacearum probable glycolate oxidase or rsc2666 or rs04539 SWALL:Q8XW09 (EMBL:AL646071) (497 aa) fasta scores: E(): 6e-152, 76.45% id in 497 aa, and to Pseudomonas aeruginosa glycolate oxidase subunit GlcD or pa5355 SWALL:Q9HTK3 (EMBL:AE004947) (499 aa) fasta scores: E(): 4.8e-115, 61.99% id in 471 aa
YP_109438.1	Similar to Escherichia coli glycolate oxidase subunit GlcE or Gox or b2977.1 SWALL:GLCE_ECOLI (SWALL:P52073) (350 aa) fasta scores: E(): 3e-54, 48.06% id in 362 aa, and to Ralstonia solanacearum probable glycolate oxidase subunit oxidoreductase GlcE or rsc2667 or rs04538 SWALL:Q8XW08 (EMBL:AL646071) (372 aa) fasta scores: E(): 3.3e-70, 56.13% id in 367 aa, and to Pseudomonas aeruginosa glycolate oxidase subunit GlcE or pa5354 SWALL:Q9HTK4 (EMBL:AE004947) (359 aa) fasta scores: E(): 4.3e-55, 50.57% id in 350 aa
YP_109439.1	Similar to Escherichia coli glycolate oxidase iron-sulfur subunit GlcF or Gox or b2978 SWALL:GLCF_ECOLI (SWALL:P52074) (407 aa) fasta scores: E(): 1.2e-88, 57% id in 407 aa, and to Ralstonia solanacearum probable glycolate oxidase GlcF or rsc2668 or rs04537 SWALL:Q8XW07 (EMBL:AL646071) (415 aa) fasta scores: E(): 3.7e-99, 60.09% id in 416 aa, and to Pseudomonas aeruginosa glycolate oxidase subunit GlcF or pa5353 SWALL:Q9HTK5 (EMBL:AE004947) (408 aa) fasta scores: E(): 5.7e-82, 52.56% id in 409 aa
YP_109440.1	Similar to Ralstonia solanacearum hypothetical protein rsc2683 or rs00038 SWALL:Q8XVZ2 (EMBL:AL646071) (240 aa) fasta scores: E(): 1.1e-53, 68.35% id in 237 aa, and to Pseudomonas aeruginosa hypothetical protein Pa0394 SWALL:Y394_PSEAE (SWALL:P24562) (230 aa) fasta scores: E(): 7.3e-52, 68.26% id in 230 aa, and to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 hypothetical protein YggS or b2951 or c3537 or z4296 or ecs3826 SWALL:YGGS_ECOLI (SWALL:P52054) (234 aa) fasta scores: E(): 7e-46, 60.34% id in 232 aa
YP_109441.1	catalyzes the formation of L-proline from pyrroline-5-carboxylate
YP_109442.1	Similar to Escherichia coli phosphonate transport system permease PhnE or b4013/b4104 SWALL:PHNE_ECOLI (SWALL:P16683) (276 aa) fasta scores: E(): 1.5e-61, 61.33% id in 269 aa, and to Escherichia coli O157:H7 membrane channel protein component of Phn transporter PhnE or z5706 or ecs5086 SWALL:Q8XDV9 (EMBL:AE005643) (276 aa) fasta scores: E(): 2.6e-61, 61.33% id in 269 aa, and to Pseudomonas aeruginosa phosphonate transport protein PhnE or pa3382 SWALL:Q9HYL9 (EMBL:AE004759) (264 aa) fasta scores: E(): 6.8e-61, 61.39% id in 259 aa
YP_109443.1	Similar to Escherichia coli phosphonates-binding periplasmic protein precursor PhnD or PsiD or b4105 SWALL:PHND_ECOLI (SWALL:P16682) (338 aa) fasta scores: E(): 1.3e-51, 46.2% id in 316 aa, and to Pseudomonas aeruginosa binding protein component of ABC phosphonate transporter pa3383 SWALL:Q9HYL8 (EMBL:AE004759) (334 aa) fasta scores: E(): 3.3e-53, 45.34% id in 333 aa
YP_109444.1	Similar to Escherichia coli phosphonates transport ATP-binding protein PhnC or b4106 SWALL:PHNC_ECOLI (SWALL:P16677) (262 aa) fasta scores: E(): 4.2e-38, 54.06% id in 246 aa, and to Pseudomonas aeruginosa ATP-binding component of ABC phosphonate transporter PhnC or pa3384 SWALL:Q9HYL7 (EMBL:AE004759) (278 aa) fasta scores: E(): 3.6e-39, 52.03% id in 271 aa, and to Escherichia coli O157:H7 ATP-binding component of phosphonate transport PhnC or z5708 or ecs5088 SWALL:Q8XDV7 (EMBL:AE005643) (262 aa) fasta scores: E(): 1.4e-38, 54.87% id in 246 aa; possible alternative start site at codon 18
YP_109445.1	Similar to Escherichia coli phosphonates metabolism protein PhnM or b4095 SWALL:PHNM_ECOLI (SWALL:P16689) (378 aa) fasta scores: E(): 1.1e-50, 42.69% id in 356 aa, and to Brucella melitensis PhnM protein bmei1106 SWALL:Q8YGQ2 (EMBL:AE009550) (379 aa) fasta scores: E(): 4.1e-64, 48.8% id in 377 aa, and to Pseudomonas aeruginosa hypothetical protein Pa3374 SWALL:Q9HYM7 (EMBL:AE004759) (387 aa) fasta scores: E(): 4.6e-63, 49.74% id in 384 aa
YP_109446.1	Similar to Escherichia coli phosphonates transport ATP-binding protein PhnL or b4096 SWALL:PHNL_ECOLI (SWALL:P16679) (226 aa) fasta scores: E(): 9e-35, 56% id in 225 aa, and to Rhizobium loti  phosphonate transport ATP-binding protein PhnL SWALL:CAD31337 (EMBL:AL672114) (239 aa) fasta scores: E(): 3.9e-39, 61.71% id in 222 aa, and to Rhizobium loti phosphonates transport ATP-binding protein, PhnL mlr9286 SWALL:Q981P7 (EMBL:AP003015) (244 aa) fasta scores: E(): 8.1e-39, 62.16% id in 222 aa; possible alternative start site at codon 26
YP_109447.1	Similar to Escherichia coli phosphonates transport ATP-binding protein PhnK or b4097 SWALL:PHNK_ECOLI (SWALL:P16678) (252 aa) fasta scores: E(): 3.8e-51, 65.07% id in 252 aa, and to Pseudomonas aeruginosa probable ATP-binding component of ABC transporter pa3376 SWALL:Q9HYM5 (EMBL:AE004759) (271 aa) fasta scores: E(): 8.1e-59, 71.03% id in 252 aa, and to Anabaena sp. phosphonate ABC transporter ATP-binding component PhnK or all2218 SWALL:Q8YUW3 (EMBL:AP003588) (257 aa) fasta scores: E(): 2.6e-54, 65.07% id in 252 aa
YP_109448.1	Similar to Escherichia coli protein PhnJ or b4098 SWALL:PHNJ_ECOLI (SWALL:P16688) (281 aa) fasta scores: E(): 1.2e-78, 71.16% id in 267 aa, and to Pseudomonas aeruginosa hypothetical protein Pa3377 SWALL:Q9HYM4 (EMBL:AE004759) (294 aa) fasta scores: E(): 2.5e-82, 69.72% id in 294 aa, and to Rhizobium loti phosphonate metabolism protein, PhnJ mlr9282 SWALL:Q981Q0 (EMBL:AP003015) (297 aa) fasta scores: E(): 4e-80, 68.98% id in 287 aa
YP_109449.1	Similar to Escherichia coli  phosphonate metabolism PhnI protein or b4099 SWALL:PHNI_ECOLI (SWALL:P16687) (354 aa) fasta scores: E(): 1.1e-28, 59.45% id in 370 aa, and to Anabaena sp. phosphonate metabolism protein PhnI or all2222 SWALL:Q8YUV9 (EMBL:AP003588) (415 aa) fasta scores: E(): 1.9e-54, 55.02% id in 398 aa, and to Pseudomonas aeruginosa hypothetical protein Pa3378 SWALL:Q9HYM3 (EMBL:AE004759) (366 aa) fasta scores: E(): 2.7e-33, 64.19% id in 377 aa
YP_109450.1	Similar to Escherichia coli PhnH protein or b4100 SWALL:PHNH_ECOLI (SWALL:P16686) (194 aa) fasta scores: E(): 1.4e-16, 39.37% id in 193 aa, and to Agrobacterium tumefaciens hypothetical protein PhnH or atu0180 or agr_c_302 SWALL:Q8UIW1 (EMBL:AE008992) (203 aa) fasta scores: E(): 1.5e-20, 41.23% id in 194 aa, and to Rhizobium loti hypothetical protein Mlr3343 SWALL:Q98GG3 (EMBL:AP003001) (203 aa) fasta scores: E(): 7e-20, 39.39% id in 198 aa, and to Rhizobium meliloti PhnH protein or rb1452 or smb20760 SWALL:PHNH_RHIME (SWALL:Q52985) (200 aa) fasta scores: E(): 4.8e-19, 42.13% id in 197 aa
YP_109451.1	Similar to Escherichia coli PhnG protein or b4101 SWALL:PHNG_ECOLI (SWALL:P16685) (150 aa) fasta scores: E(): 8.5e-06, 38.15% id in 173 aa, and to Rhizobium loti C-P lyase subunit phnJ protein phosphonate metabolism phnG SWALL:CAD31343 (EMBL:AL672114) (151 aa) fasta scores: E(): 1e-09, 43.19% id in 169 aa, and to Rhizobium loti phosphonate metabolism protein mll9155 SWALL:Q982B0 (EMBL:AP003015) (154 aa) fasta scores: E(): 2.1e-09, 42.3% id in 182 aa
YP_109452.1	Similar to Escherichia coli probable transcriptional regulator PhnF or b4102 SWALL:PHNF_ECOLI (SWALL:P16684) (241 aa) fasta scores: E(): 4.1e-11, 32.07% id in 212 aa, and to Rhizobium loti transcriptional regulator mll3341 SWALL:Q98GG5 (EMBL:AP003001) (249 aa) fasta scores: E(): 1.1e-24, 41.42% id in 239 aa, and to Rhizobium meliloti hypothetical transcriptional regulator Rb1450 or smb20758 SWALL:YPF0_RHIME (SWALL:O86029) (243 aa) fasta scores: E(): 1.7e-24, 38.23% id in 238 aa, and to Agrobacterium tumefaciens transcriptional regulator, GntR family atu0182 or agr_c_306 SWALL:Q8UIV9 (EMBL:AE008992) (245 aa) fasta scores: E(): 2.8e-22, 34.31% id in 239 aa
YP_109453.1	Similar to Brucella melitensis hypothetical cytosolic protein Bmei1107 SWALL:Q8YGQ1 (EMBL:AE009550) (243 aa) fasta scores: E(): 1.1e-18, 35.53% id in 242 aa, and to Agrobacterium tumefaciens hypothetical protein atu0170 or agr_c_280 SWALL:Q8UIX1 (EMBL:AE008991) (232 aa) fasta scores: E(): 1.4e-17, 36.2% id in 232 aa, and to Rhizobium meliloti hypothetical protein rb1170 or smb20876 SWALL:Q92UG1 (EMBL:AL603646) (265 aa) fasta scores: E(): 3.6e-16, 34.83% id in 244 aa
YP_109454.1	Similar to Escherichia coli ATP-binding protein PhnN or b4094 SWALL:PHNN_ECOLI (SWALL:P16690) (185 aa) fasta scores: E(): 9.5e-24, 48.58% id in 177 aa, and to Rhizobium loti ATP-binding component of phosphonate transport mll9141 SWALL:Q982C3 (EMBL:AP003015) (187 aa) fasta scores: E(): 1.3e-24, 48.85% id in 174 aa
YP_109455.1	catalyzes the conversion of 4-Hydroxybenzoate into 3-octaprenyl-4-hydroxybenzoate, as part of the ubiquinone biosynthesis pathway
YP_109456.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa1607 SWALL:Q9I3B4 (EMBL:AE004588) (146 aa) fasta scores: E(): 4.3e-28, 55.47% id in 146 aa, and to Rhizobium meliloti hypothetical protein ra1074 or sma1960 SWALL:Q92Y14 (EMBL:AE007293) (125 aa) fasta scores: E(): 1.8e-20, 54.83% id in 124 aa, and to Caulobacter crescentus hypothetical protein Cc0645 SWALL:Q9AAF6 (EMBL:AE005740) (188 aa) fasta scores: E(): 1.7e-17, 40.54% id in 148 aa
YP_109457.1	Similar to Bacillus anthracis miniferritin Dlp1 SWALL:Q8RPQ2 (EMBL:AF374268) (146 aa) fasta scores: E(): 3e-13, 38.73% id in 142 aa, and to Ralstonia solanacearum DNA protection during starvation or oxidative stress transcription regulator protein DPS or rsc2687 or rs00034 SWALL:Q8XVY8 (EMBL:AL646071) (166 aa) fasta scores: E(): 1.6e-48, 79.51% id in 166 aa, and to Anabaena sp. hypothetical protein All4145 SWALL:Q8YPP7 (EMBL:AP003595) (163 aa) fasta scores: E(): 1.3e-44, 77.01% id in 161 aa
YP_109458.1	No database matches. Doubtful CDS
YP_109459.1	Virtually identical to previously sequenced Burkholderia pseudomallei catalase-peroxidase KatG SWALL:Q939D2 (EMBL:AY040244) (619 aa) fasta scores: E(): 0, 97.26% id in 622 aa, and similar to Methanosarcina acetivorans catalase/peroxidase ma0972 SWALL:Q8TS34 (EMBL:AE010762) (736 aa) fasta scores: E(): 0, 77.62% id in 733 aa, and to Rhizobium loti catalase/peroxidase mlr6940 SWALL:Q987S0 (EMBL:AP003010) (756 aa) fasta scores: E(): 0, 73.61% id in 758 aa
YP_109460.1	Previously sequenced as Burkholderia pseudomallei oxidative stress regulatory protein OxyR SWALL:Q939D3 (EMBL:AY040244) (319 aa) fasta scores: E(): 7.7e-125, 100% id in 319 aa. Highly similar to Ralstonia solanacearum probable hydrogen peroxide-inducible genes activator transcription regulator protein oxyR or rsc2690 or rs00030 SWALL:Q8XVY5 (EMBL:AL646071) (317 aa) fasta scores: E(): 6.5e-94, 77.42% id in 319 aa
YP_109461.1	catalyzes branch migration in Holliday junction intermediates
YP_109462.1	Synthesizes oQ from preQ1 in a single S-adenosylmethionine-requiring step
YP_109463.1	Exchanges the guanine residue with 7-aminomethyl-7-deazaguanine in tRNAs with GU(N) anticodons (tRNA-Asp, -Asn, -His and -Tyr)
YP_109464.1	member of preprotein translocase; forms a heterotrimer with SecD and SecF; links the SecD/SecF/YajC/YidC complex with the SecY/SecE/SecG complex
YP_109465.1	part of the preprotein secretory system; when complexed with proteins SecF and YajC, SecDFyajC stimulates the proton motive force-driven protein translocation, and appears to be required for the release of mature proteins from the extracytoplasmic side of the membrane
YP_109466.1	forms a complex with SecD and YajC; SecDFyajC stimulates the proton motive force-driven protein translocation; seems to modulate the cycling of SecA by stabilizing its membrane-inserted state and appears to be required for the release of mature proteins from the extracytoplasmic side of the membrane; in some organisms, such as Bacillus subtilis, SecD is fused to SecF
YP_109467.1	Similar to Ralstonia solanacearum probable sugar-proton symporter transmembrane protein rsp0536 or rs00416 SWALL:Q8XSE0 (EMBL:AL646079) (441 aa) fasta scores: E(): 1.2e-21, 43.13% id in 204 aa, and to the C-terminal region of Escherichia coli citrate-proton symporter CitA or Cit SWALL:CIT1_ECOLI (SWALL:P07661) (431 aa) fasta scores: E(): 1.2e-14, 35.02% id in 177 aa
YP_109468.1	Similar to Ralstonia solanacearum probable signal peptide protein rsc2717 or rs00005 SWALL:Q8XVW0 (EMBL:AL646071) (198 aa) fasta scores: E(): 5.8e-48, 65.26% id in 190 aa, and to Salmonella typhi  exported protein sty1443 SWALL:Q8Z764 (EMBL:AL627270) (191 aa) fasta scores: E(): 4.7e-18, 36.59% id in 194 aa
YP_109469.1	Similar to Ralstonia solanacearum probable signal peptide protein rsc2718 or rs00003 SWALL:Q8XVV9 (EMBL:AL646071) (189 aa) fasta scores: E(): 1.9e-32, 53.51% id in 185 aa, and to Xanthomonas axonopodis hypothetical protein xac3034 SWALL:AAM37879 (EMBL:AE011945) (189 aa) fasta scores: E(): 7.4e-10, 32% id in 175 aa
YP_109470.1	Similar to Ralstonia solanacearum  cytochrome b-561 transmembrane protein rsc2719 or rs00083 SWALL:Q8XVV8 (EMBL:AL646071) (195 aa) fasta scores: E(): 5.8e-36, 55.08% id in 187 aa, and to Xanthomonas campestris cytochrome b561 xcc2850 SWALL:Q8P6W5 (EMBL:AE012398) (187 aa) fasta scores: E(): 8.8e-20, 41.56% id in 166 aa
YP_109471.1	Similar to Vibrio cholerae paraquat-inducible protein A vc1753 SWALL:Q9KR89 (EMBL:AE004252) (434 aa) fasta scores: E(): 1.5e-15, 31.22% id in 205 aa, and to the C-terminal region of Escherichia coli, and Escherichia coli O6 paraquat-inducible protein A PqiA or Pqi5A or b0950 or c1086 SWALL:PQIA_ECOLI (SWALL:P43670) (417 aa) fasta scores: E(): 2.1e-09, 26.02% id in 196 aa
YP_109472.1	Similar to Pseudomonas aeruginosa paraquat-inducible protein A SWALL:Q9APY1 (EMBL:AF241171) (237 aa) fasta scores: E(): 6.1e-35, 54.58% id in 207 aa, and to the C-terminal region of Escherichia coli, and Escherichia coli O6 paraquat-inducible protein A PqiA or Pqi5A or b0950 or c1086 SWALL:PQIA_ECOLI (SWALL:P43670) (417 aa) fasta scores: E(): 1.4e-24, 41.74% id in 218 aa
YP_109473.1	Identical to previously sequenced Burkholderia pseudomallei paraquat-inducible protein Lpw206-207 SWALL:Q93M60 (EMBL:AY027530) (553 aa) fasta scores: E(): 2.9e-200, 99.81% id in 553 aa, and to Escherichia coli paraquat-inducible protein B PqiB or Pqi5B or b0951 SWALL:PQIB_ECOLI (SWALL:P43671) (546 aa) fasta scores: E(): 2.5e-48, 33.72% id in 507 aa
YP_109474.1	Similar to Ralstonia solanacearum hypothetical protein rsc0600 or rs04845 SWALL:Q8Y1T9 (EMBL:AL646060) (211 aa) fasta scores: E(): 1.8e-16, 36.57% id in 216 aa
YP_109475.1	Similar to Ralstonia solanacearum  site-specific recombinase transmembrane protein rsc1012 or rs04272 SWALL:Q8Y0N1 (EMBL:AL646062) (696 aa) fasta scores: E(): 1.3e-121, 51.07% id in 695 aa, and to Neisseria meningitidis site-specific recombinase nmb1278 SWALL:Q9JZ60 (EMBL:AE002476) (668 aa) fasta scores: E(): 7.6e-36, 27.78% id in 583 aa
YP_109476.1	Similar to Ralstonia solanacearum hypothetical protein rsc2739 or rs00115 SWALL:Q8XVT8 (EMBL:AL646071) (471 aa) fasta scores: E(): 4.1e-74, 53.72% id in 456 aa, and to Neisseria meningitidis hypothetical protein nmb0455 SWALL:Q9K0V4 (EMBL:AE002401) (380 aa) fasta scores: E(): 2.6e-49, 43.06% id in 418 aa
YP_109477.1	Similar to Ralstonia solanacearum hypothetical protein rsc2671 or rs04534 SWALL:Q8XW04 (EMBL:AL646071) (131 aa) fasta scores: E(): 1.2e-12, 43.22% id in 118 aa, and to Salmonella typhimurium, and Salmonella typhi hypothetical protein stm0409 or sty0447 SWALL:Q8XFK5 (EMBL:AE008714) (121 aa) fasta scores: E(): 3.9e-11, 41.8% id in 122 aa. Note: This CDS is longer in its N-terminal region than most of its database matches
YP_109478.1	Similar to Ralstonia solanacearum  repressor transcription regulator protein rsc2673 or rs00048 SWALL:Q8XW02 (EMBL:AL646071) (232 aa) fasta scores: E(): 1.5e-40, 50.67% id in 223 aa, and to Rhizobium loti transcriptional regulator mlr3764 SWALL:Q98FI3 (EMBL:AP003002) (239 aa) fasta scores: E(): 3.4e-39, 48.63% id in 220 aa
YP_109479.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 NAD(P) transhydrogenase subunit beta (EC 1.6.1.2) PntB or b1602 or c1994 or z2597 or ecs2308 SWALL:PNTB_ECOLI (SWALL:P07002) (462 aa) fasta scores: E(): 1.3e-64, 50.3% id in 487 aa, and to Ralstonia solanacearum probable transmembrane NADP(P) transhydrogenase subunit beta rsc2733 or rs00121 SWALL:Q8XVU4 (EMBL:AL646071) (486 aa) fasta scores: E(): 1.7e-135, 80.16% id in 489 aa
YP_109480.1	Similar to the C-terminal region of Escherichia coli NAD(P) transhydrogenase subunit alpha (EC 1.6.1.2) PntA or b1603 SWALL:PNTA_ECOLI (SWALL:P07001) (510 aa) fasta scores: E(): 4.5e-12, 58.53% id in 82 aa, and to Ralstonia solanacearum probable transmembrane NAD(P) transhydrogenase subunit alpha rsc2732 or rs00122 SWALL:Q8XVU5 (EMBL:AL646071) (107 aa) fasta scores: E(): 9.1e-26, 80.61% id in 98 aa
YP_109481.1	Similar to the N-terminal region of Escherichia coli NAD(P) transhydrogenase subunit alpha (EC 1.6.1.2) PntA or b1603 SWALL:PNTA_ECOLI (SWALL:P07001) (510 aa) fasta scores: E(): 4.9e-42, 44.85% id in 379 aa, and to Ralstonia solanacearum probable NAD(P) transhydrogenase subunit alpha rsc2730 or rs00124 SWALL:Q8XVU7 (EMBL:AL646071) (379 aa) fasta scores: E(): 3.6e-92, 72.75% id in 378 aa
YP_109482.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7  NUDIX hydrolase YmfB or b1134 or c1513 or z1863 or ecs1606 SWALL:YMFB_ECOLI (SWALL:P75965) (153 aa) fasta scores: E(): 9e-13, 38.77% id in 147 aa, and to Ralstonia solanacearum hypothetical protein rsc2724 or rs00130 SWALL:Q8XVV3 (EMBL:AL646071) (168 aa) fasta scores: E(): 9.4e-37, 57.14% id in 161 aa
YP_109483.1	catalyzes a sulfuration reaction to synthesize 2-thiouridine at the U34 position of tRNAs
YP_109484.1	Similar to Leptospira interrogans glutamate synthase GltB2 or lb286 SWALL:AAN51845 (EMBL:AE011615) (550 aa) fasta scores: E(): 2.5e-55, 42.5% id in 487 aa, and to Pseudomonas putida glutamate synthase, large subunit,  pp1060 SWALL:AAN66685 (EMBL:AE016778) (539 aa) fasta scores: E(): 1.4e-141, 65.16% id in 534 aa
YP_109485.1	Similar to Escherichia coli, and Escherichia coli O6 hypothetical GST-like protein YibF or b3592 or c4413 SWALL:YIBF_ECOLI (SWALL:P32105) (202 aa) fasta scores: E(): 4.1e-20, 35.82% id in 201 aa, and to Ralstonia solanacearum  glutathione S-transferase rsc2721 or rs00001 SWALL:Q8XVV6 (EMBL:AL646071) (202 aa) fasta scores: E(): 1.2e-58, 66.33% id in 202 aa
YP_109486.1	Similar to Escherichia coli Xaa-Pro aminopeptidase PepP or b2908 SWALL:AMPP_ECOLI (SWALL:P15034) (440 aa) fasta scores: E(): 3.6e-54, 43.04% id in 446 aa, and to Ralstonia solanacearum probable Xaa-Pro aminopeptidase rsc0509 or rs04998 SWALL:Q8Y227 (EMBL:AL646059) (458 aa) fasta scores: E(): 1.8e-118, 67.62% id in 454 aa
YP_109487.1	Similar to Escherichia coli 2-octaprenyl-6-methoxyphenol hydroxylase UbiH or VisB or b2907 SWALL:UBIH_ECOLI (SWALL:P25534) (392 aa) fasta scores: E(): 6.8e-32, 35.36% id in 393 aa, and to Ralstonia solanacearum probable 2-octaprenyl-6-methoxyphenol hydroxylase oxidoreductase rsc0508 or rs04999 SWALL:Q8Y228 (EMBL:AL646059) (411 aa) fasta scores: E(): 9.9e-46, 54.8% id in 416 aa
YP_109488.1	Similar to Rhodobacter capsulatus nitrogen regulation protein NifR3 SWALL:NIR3_RHOCA (SWALL:Q08111) (324 aa) fasta scores: E(): 9.7e-44, 45.89% id in 329 aa, and to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 hypothetical protein YhdG or b3260 or c4026 or z4620 or ecs4132 SWALL:YHDG_ECOLI (SWALL:P25717) (321 aa) fasta scores: E(): 5e-63, 56.69% id in 321 aa
YP_109489.1	Similar to Escherichia coli, Escherichia coli O6, Escherichia coli O157:H7, Salmonella typhimurium, Salmonella typhi, and Serratia marcescens DNA-binding protein Fis or b3261 or c4027 or z4621 or ecs4133 or stm3385 or sty3565 SWALL:FIS_ECOLI (SWALL:P11028) (98 aa) fasta scores: E(): 1.5e-09, 40.78% id in 76 aa, and to Ralstonia solanacearum  fis-like DNA-binding protein rsc0505 or rs05017 SWALL:FISL_RALSO (SWALL:Q8Y231) (77 aa) fasta scores: E(): 1.1e-20, 70.13% id in 77 aa. Note: This CDS is shorter in its N-terminal region than most of its database matches
YP_109490.1	involved in de novo purine biosynthesis
YP_109491.1	endonuclease; resolves Holliday structures; forms a complex of RuvABC; the junction binding protein RuvA forms a hexameric ring along with the RuvB helicase and catalyzes branch migration; RuvC then interacts with RuvAB to resolve the Holliday junction by nicking DNA strands of like polarity
YP_109492.1	plays an essential role in ATP-dependent branch migration of the Holliday junction
YP_109493.1	promotes strand exchange during homologous recombination; RuvAB complex promotes branch migration; RuvABC complex scans the DNA during branch migration and resolves Holliday junctions at consensus sequences; forms hexameric rings around opposite DNA arms; requires ATP for branch migration and orientation of RuvAB complex determines direction of migration
YP_109494.1	Similar to Ralstonia solanacearum hypothetical protein rsp1255 or rs05298 SWALL:Q8XQH2 (EMBL:AL646083) (298 aa) fasta scores: E(): 1e-65, 60.33% id in 295 aa, and to Xanthomonas axonopodis hypothetical protein xac3714 SWALL:AAM38557 (EMBL:AE012021) (308 aa) fasta scores: E(): 7.5e-47, 48.23% id in 284 aa. Note: This CDS is longer in its N-terminal region than most of its database matches
YP_109495.1	Very low similarity to Pseudomonas aeruginosa hypothetical protein pa4384 SWALL:Q9HW18 (EMBL:AE004854) (228 aa) fasta scores: E(): 3.6e-05, 31.84% id in 157 aa
YP_109496.1	Similar to Escherichia coli, Escherichia coli O157:H7, and Shigella flexneri probable phosphoglycerate mutase GpmB or b4395 or z5997 or ecs5353 or sf4427 SWALL:GPMB_ECOLI (SWALL:P36942) (215 aa) fasta scores: E(): 1.7e-12, 36.19% id in 221 aa, and to Ralstonia solanacearum  phosphoglycerate mutase 2 protein rsc0499 or rs05023 SWALL:Q8Y237 (EMBL:AL646059) (227 aa) fasta scores: E(): 1.8e-33, 46.84% id in 222 aa
YP_109497.1	hydrolyzes D-tyrosyl-tRNA(Tyr) into D-tyrosine and free tRNA(Tyr); possible defense mechanism against a harmful effect of D-tyrosine
YP_109498.1	catalyzes the formation of tyrosyl-tRNA(Tyr) from tyrosine and tRNA(Tyr)
YP_109499.1	catalyzes hydrolysis of 1,6-anhydro bond of anyhydro-N-acetylmuramic acid (anhMurNAc) and phosphorylates anhMurNAc to produce N-acetyl-muramate-6-phosphate; involved in murein recycling
YP_109500.1	Similar to Escherichia coli hypothetical GST-like protein YfcG or b2302 SWALL:YFCG_ECOLI (SWALL:P77526) (215 aa) fasta scores: E(): 2.6e-47, 59.61% id in 208 aa, and to Xanthomonas campestris glutathione S-transferase xcc3962 SWALL:AAM43183 (EMBL:AE012517) (229 aa) fasta scores: E(): 7.8e-54, 60.69% id in 229 aa. Note: Also similar to the upstream CDS BPSL1749 (235 aa) fasta scores: E(): 1.5e-27, 44.231% identity in 208 aa overlap
YP_109501.1	Similar to Escherichia coli hypothetical GST-like protein YfcG or b2302 SWALL:YFCG_ECOLI (SWALL:P77526) (215 aa) fasta scores: E(): 6.6e-25, 41.7% id in 211 aa, and to Xanthomonas axonopodis glutathione S-transferase xac4047 SWALL:Q8PFD6 (EMBL:AE012053) (229 aa) fasta scores: E(): 5.2e-31, 45.45% id in 231 aa. Note: Also similar to the downstream CDS BPSL2906 (233 aa) fasta scores: E(): 1.9e-24, 39.224% identity in 232 aa overla
YP_109502.1	Similar to Xylella fastidiosa transcriptional regulator xf1254 SWALL:Q9PDX5 (EMBL:AE003959) (280 aa) fasta scores: E(): 1.7e-34, 42.22% id in 270 aa, and to Streptomyces antibioticus  AraC-like transcription regulator SWALL:ARAL_STRAT (SWALL:Q03320) (303 aa) fasta scores: E(): 1.7e-15, 37.44% id in 219 aa
YP_109503.1	essential respiratory protein A; may be involved in the transfer of iron-sulfur clusters; essential for growth using oxygen or alternate electron acceptors
YP_109504.1	forms a direct contact with the tRNA during translation
YP_109505.1	in Escherichia coli this protein is one of the earliest assembly proteins in the large subunit
YP_109506.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 hypothetical protein YhfA or b3356 or c4131 or z4717 or ecs4207 SWALL:YHFA_ECOLI (SWALL:P24246) (134 aa) fasta scores: E(): 3.5e-24, 48.57% id in 140 aa, and to Ralstonia solanacearum hypothetical protein rsc0489 or rs05752 SWALL:Q8Y247 (EMBL:AL646059) (148 aa) fasta scores: E(): 2.5e-42, 78.98% id in 138 aa
YP_109507.1	Similar to Ralstonia solanacearum  transmembrane protein rsc0488 or rs05751 SWALL:Q8Y248 (EMBL:AL646059) (270 aa) fasta scores: E(): 6.2e-45, 52.65% id in 264 aa
YP_109508.1	catalyzes the formation of N-carbamoyl-L-aspartate from (S)-dihydroorotate in pyrimidine biosynthesis
YP_109509.1	Similar to Ralstonia solanacearum hypothetical protein rsc0485 or rs04388 SWALL:Q8Y251 (EMBL:AL646059) (276 aa) fasta scores: E(): 6.8e-84, 74.81% id in 266 aa, and to Neisseria meningitidis hypothetical protein nma0646 SWALL:Q9JVW6 (EMBL:AL162753) (280 aa) fasta scores: E(): 1.3e-57, 55.88% id in 272 aa. Note: This CDS is longer in its C-terminal region than most of its database matches
YP_109511.1	Similar to Pseudomonas putida heat shock protein, pp3313 SWALL:AAN68920 (EMBL:AE016786) (123 aa) fasta scores: E(): 2.3e-12, 43.26% id in 104 aa, and to Rhizobium loti small heat shock protein mlr4721 SWALL:Q98DG0 (EMBL:AP003004) (159 aa) fasta scores: E(): 4e-09, 41.17% id in 102 aa. Note: Also similar to BPSL1322 (134 aa) fasta scores: E(): 3.1e-25, 57.576% identity in 132 aa overlap
YP_109512.1	Similar to Pseudomonas putida heat shock protein, Hsp20 family pp3314 SWALL:AAN68921 (EMBL:AE016786) (151 aa) fasta scores: E(): 1.8e-18, 39.18% id in 148 aa, and to Thermotoga maritima small heat shock protein ShsP SWALL:Q9ZFD1 (EMBL:AF106330) (142 aa) fasta scores: E(): 8.1e-10, 36.23% id in 138 aa. Note: Also similar to BPSL1323 (199 aa) fasta scores: E(): 1.6e-33, 59.333% identity in 150 aa overlap
YP_109513.1	Similar to Chromatium vinosum 10 kDa chaperonin GroS or GroES SWALL:CH10_CHRVI (SWALL:P31295) (96 aa) fasta scores: E(): 2.7e-20, 57.89% id in 95 aa, and to Methylovorus sp. 10 kDa chaperonin GroS or GroES SWALL:Q9WWL3 (EMBL:AF152236) (105 aa) fasta scores: E(): 1.3e-24, 66.66% id in 105 aa. Note: Also similar to BPSL2698 (98 aa) fasta scores: E(): 4.5e-21, 59.375% identity in 96 aa overlap
YP_109515.1	Similar to Escherichia coli, and Escherichia coli O157:H7 glutamate/aspartate transport ATP-binding protein GltL or b0652 or z0802 or ecs0691 SWALL:GLTL_ECOLI (SWALL:P41076) (241 aa) fasta scores: E(): 3.5e-64, 83.81% id in 241 aa, and to Yersinia pestis  glutamate/aspartate transport ATP-binding protein ypo2612 SWALL:Q8ZDF6 (EMBL:AJ414153) (242 aa) fasta scores: E(): 1.5e-64, 84.64% id in 241 aa
YP_109516.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 glutamate/aspartate transport system permease GltK or b0653 or c0737 or z0803 or ecs0692 SWALL:GLTK_ECOLI (SWALL:P41075) (224 aa) fasta scores: E(): 6.2e-58, 72.07% id in 222 aa, and to Salmonella typhi glutamate/aspartate transport system permease sty0708 SWALL:Q8Z8G9 (EMBL:AL627267) (224 aa) fasta scores: E(): 5.4e-59, 72.97% id in 222 aa
YP_109517.1	Similar to Escherichia coli, and Escherichia coli O6 glutamate/aspartate transport system permease GltJ or b0654 or c0738 SWALL:GLTJ_ECOLI (SWALL:P41074) (246 aa) fasta scores: E(): 8.3e-62, 63.56% id in 247 aa, and to Yersinia pestis  glutamate/aspartate transport system permease ypo2614 SWALL:Q8ZDF4 (EMBL:AJ414153) (246 aa) fasta scores: E(): 2.5e-64, 66.39% id in 247 aa
YP_109518.1	Similar to Escherichia coli glutamate/aspartate periplasmic binding protein precursor GltI or b0655 SWALL:GLTI_ECOLI (SWALL:P37902) (302 aa) fasta scores: E(): 8.4e-74, 67.88% id in 302 aa, and to Salmonella typhimurium glutamate/aspartate periplasmic binding protein precursor stm0665 SWALL:GLTI_SALTY (SWALL:Q9ZF60) (302 aa) fasta scores: E(): 2.4e-74, 68.64% id in 303 aa
YP_109519.1	Similar to Bacillus subtilis NAD-specific glutamate dehydrogenase GudB SWALL:GUDB_BACSU (SWALL:P50735) (426 aa) fasta scores: E(): 2.1e-70, 47.51% id in 402 aa, and to Salmonella typhimurium  homolog of glutamic dehyrogenase stm1795 SWALL:Q8ZP21 (EMBL:AE008780) (441 aa) fasta scores: E(): 2.4e-109, 64.67% id in 419 aa
YP_109520.1	Similar to Ralstonia solanacearum  transcription regulator protein rsc0479 or rs04416 SWALL:Q8Y257 (EMBL:AL646059) (314 aa) fasta scores: E(): 2.6e-70, 64.55% id in 316 aa, and to Rhizobium meliloti transcriptional regulator ra0049 or sma0097 SWALL:Q930Z5 (EMBL:AE007199) (313 aa) fasta scores: E(): 3.9e-27, 37.8% id in 328 aa
YP_109521.1	Similar to Bacillus subtilis nitrate transporter NasA SWALL:NASA_BACSU (SWALL:P42432) (421 aa) fasta scores: E(): 3.2e-19, 34.09% id in 352 aa, and to Aquifex aeolicus nitrate transporter NasA or aq_215 SWALL:O66589 (EMBL:AE000678) (475 aa) fasta scores: E(): 2.3e-82, 53.53% id in 439 aa. Note: This CDS is longer in its N-terminal region than most of its database matches. It has an alternative start codon at residue 18
YP_109522.1	Catalyzes two discrete reactions in the de novo synthesis of purines: the cleavage of adenylosuccinate and succinylaminoimidazole carboxamide ribotide
YP_109523.1	Similar to Escherichia coli thermoresistant gluconokinase GntK or b3437 SWALL:GNTK_ECOLI (SWALL:P46859) (174 aa) fasta scores: E(): 1.9e-21, 43.31% id in 157 aa, and to Ralstonia solanacearum probable thermoresistant gluconokinase rsc0441 or rs04466 SWALL:Q8Y295 (EMBL:AL646059) (169 aa) fasta scores: E(): 2.1e-27, 49.68% id in 161 aa
YP_109524.1	Similar to Escherichia coli high-affinity gluconate transporter GntT or UsgA or GntM or b3415 SWALL:GNTT_ECOLI (SWALL:P39835) (437 aa) fasta scores: E(): 1.3e-68, 45.33% id in 450 aa, and to Pseudomonas aeruginosa gluconate permease pa2322 SWALL:GNUT_PSEAE (SWALL:Q9ZIJ1) (450 aa) fasta scores: E(): 4.7e-83, 52.53% id in 453 aa
YP_109525.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 KHG/KDPG aldolase [includes: 4-hydroxy-2-oxoglutarate aldolase (EC 4.1.3.16) (2-keto-4-hydroxyglutarate aldolase) (khg-aldolase); 2- dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14) (phospho-2- dehydro-3-deoxygluconate aldolase) (phospho-2-keto-3-deoxygluconate aldolase) (2-keto-3-deoxy-6-phosphogluconate aldolase) (kdpg- aldolase)] Eda or Hga or KdgA or b1850 or c2263 or z2902 or ecs2560 SWALL:ALKH_ECOLI (SWALL:P10177) (213 aa) fasta scores: E(): 6.8e-31, 44.82% id in 203 aa, and to Neisseria meningitidis 2-keto-4-hydroxyglutarate aldolase Eda or nma1611 or nmb1394 SWALL:Q9JR44 (EMBL:AL162756) (212 aa) fasta scores: E(): 1.3e-35, 50.74% id in 201 aa
YP_109526.1	catalyzes the formation of 2-dehydro-3-deoxy-6-phospho-D-gluconate from 6-phospho-D-gluconate
YP_109527.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa5438 SWALL:Q9HTC8 (EMBL:AE004956) (293 aa) fasta scores: E(): 2.9e-39, 44.29% id in 289 aa, and to Escherichia coli hex regulon repressor HexR or b1853 SWALL:HEXR_ECOLI (SWALL:P46118) (289 aa) fasta scores: E(): 1.4e-32, 40.58% id in 276 aa
YP_109528.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc2740 or rs00114 SWALL:Q8XVT7 (EMBL:AL646071) (140 aa) fasta scores: E(): 3.1e-32, 62.85% id in 140 aa, and to Neisseria meningitidis conserved hypothetical inner membrane protein nma2177 SWALL:Q9JSR1 (EMBL:AL162758) (145 aa) fasta scores: E(): 2.9e-22, 48.25% id in 143 aa
YP_109529.2	Catalyzes the phosphorylation of L-glutamate during the proline biosynthesis pathway
YP_109530.1	required for the assembly and function of the DNAX complex which is required for the assembly of the beta subunit onto primed DNA
YP_109531.1	Similar to Escherichia coli, and Escherichia coli O6 rare lipoprotein B precursor RlpB or b0641 or c0732 SWALL:RLPB_ECOLI (SWALL:P10101) (193 aa) fasta scores: E(): 0.06, 26.45% id in 189 aa, and to Ralstonia solanacearum  lipoprotein B transmembrane RlpB or rsc2743 or rs00111 SWALL:Q8XVT4 (EMBL:AL646071) (169 aa) fasta scores: E(): 8e-17, 43.29% id in 164 aa
YP_109532.1	leucine--tRNA ligase; LeuRS; class-I aminoacyl-tRNA synthetase; charges leucine by linking carboxyl group to alpha-phosphate of ATP and then transfers aminoacyl-adenylate to its tRNA; due to the large number of codons that tRNA(Leu) recognizes, the leucyl-tRNA synthetase does not recognize the anticodon loop of the tRNA, but instead recognition is dependent on a conserved discriminator base A37 and a long arm; an editing domain hydrolyzes misformed products; in Methanothermobacter thermautotrophicus this enzyme associates with prolyl-tRNA synthetase
YP_109533.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 biopolymer transport ExbD protein or b3005 or c3740 or z4358 or ecs3889 SWALL:EXBD_ECOLI (SWALL:P18784) (141 aa) fasta scores: E(): 2.6e-06, 33.87% id in 124 aa, and to Xanthomonas campestris biopolymer transport ExbD1 protein or xcc0010 SWALL:EXB1_XANCP (SWALL:O34259) (140 aa) fasta scores: E(): 4.3e-11, 44.11% id in 136 aa. Note: This CDS is longer in its -terminal region than most of its database matches
YP_109534.1	Similar to Neisseria meningitidis biopolymer transport protein ExbB or nma1984 or nmb1729 SWALL:EXBB_NEIMA (SWALL:P57027) (220 aa) fasta scores: E(): 3.1e-26, 46.19% id in 210 aa, and to Escherichia coli, and Escherichia coli O157:H7 TolQ protein or Fii or b0737 or z0905 or ecs0772 SWALL:TOLQ_ECOLI (SWALL:P05828) (230 aa) fasta scores: E(): 1.8e-13, 32.42% id in 219 aa
YP_109535.1	catalyzes the reduction of 2,3-dihydrodipicolinate to 2,3,4,5-tetrahydrodipicolinate in lysine and diaminopimelate biosynthesis
YP_109536.1	Identical in its N-terminal region to Burkholderia pseudomallei outer membrane lipoprotein OmlA (Fragment) SWALL:Q9F9X1 (EMBL:AF153356) (133 aa) fasta scores: E(): 5.2e-31, 100% id in 133 aa, and simiar in its full length to Pseudomonas fluorescens outer membrane lipoprotein precursor OmlA or OprX SWALL:OMLA_PSEFL (SWALL:O68564) (175 aa) fasta scores: E(): 0.00012, 32.38% id in 176 aa
YP_109537.1	Previously sequenced as Burkholderia pseudomallei ferric uptake regulator Fur SWALL:Q9Z5Z9 (EMBL:AF117238) (142 aa) fasta scores: E(): 8.2e-57, 100% id in 142 aa. Highly similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 ferric uptake regulation protein Fur or b0683 or c0770 or z0831 or ecs0714 SWALL:FUR_ECOLI (SWALL:P06975) (148 aa) fasta scores: E(): 8.1e-29, 55% id in 140 aa
YP_109538.1	catalyzes the formation of glyoxylate from (S)-ureidoglycolate
YP_109539.1	catalyzes the formation of S-ureidoglycolate and urea from allantoate
YP_109540.1	involved in the transport of C4-dicarboxylates across the membrane
YP_109541.1	Similar to Erwinia chrysanthemi exu regulon transcriptional regulator ExuR SWALL:EXUR_ERWCH (SWALL:Q9X9E0) (259 aa) fasta scores: E(): 1.8e-13, 31.79% id in 217 aa, and to Ralstonia solanacearum probable transcription regulator protein rsc2102 or rs01502 SWALL:Q8XXL1 (EMBL:AL646068) (254 aa) fasta scores: E(): 1.4e-17, 35.16% id in 236 aa
YP_109542.1	controls the expression of the cynTSX operon involved in degrading and using cyanate as a sole nitrogen source
YP_109543.1	Similar to Escherichia coli, and Escherichia coli O157:H7 carbonic anhydrase CynT or b0339 or z0435 or ecs0392 SWALL:CYNT_ECOLI (SWALL:P17582) (219 aa) fasta scores: E(): 4e-62, 72.6% id in 219 aa, and to Pseudomonas aeruginosa carbonate dehydratase pa2053 SWALL:Q9I262 (EMBL:AE004631) (220 aa) fasta scores: E(): 1e-60, 73.81% id in 210 aa
YP_109544.1	catalyzes the reaction of cyanate and bicarbonate to produce ammonia and carbon dioxide
YP_109545.1	Similar to Xanthomonas axonopodis MFS transporter xac0509 SWALL:AAM35398 (EMBL:AE011677) (396 aa) fasta scores: E(): 2e-57, 46.78% id in 389 aa, and to Escherichia coli hypothetical protein YgaY or b2680/b2681 SWALL:YGAY_ECOLI (SWALL:P76628) (394 aa) fasta scores: E(): 4.8e-54, 42.15% id in 389 aa
YP_109546.1	Similar to Bacillus subtilis glyceraldehyde 3-phosphate dehydrogenase 1 AapA or Gap SWALL:G3P1_BACSU (SWALL:P09124) (334 aa) fasta scores: E(): 2.7e-71, 60.06% id in 333 aa, and to Alcaligenes eutrophus glyceraldehyde 3-phosphate dehydrogenase, plasmid CbbGP SWALL:G3PP_ALCEU (SWALL:P50322) (336 aa) fasta scores: E(): 5.1e-112, 84.52% id in 336 aa
YP_109547.1	catalyzes the formation of ribose 5-phosphate and xylulose 5-phosphate from sedoheptulose 7-phosphate and glyceraldehyde 3-phosphate; can transfer ketol groups between several groups; in Escherichia coli there are two tkt genes, tktA expressed during exponential growth and the tktB during stationary phase
YP_109548.1	catalyzes the formation of spermidine from putrescine and S-adenosylmethioninamine
YP_109549.1	Similar to Mycobacterium tuberculosis hypothetical protein rv0887c or mt0910 or mtcy31.15C SWALL:Y887_MYCTU (SWALL:Q10548) (170 aa) fasta scores: E(): 7.2e-10, 33.84% id in 130 aa, and to Ralstonia solanacearum hypothetical protein rsc2762 or rs00092 SWALL:Q8XVR7 (EMBL:AL646071) (141 aa) fasta scores: E(): 1.3e-30, 59.39% id in 133 aa
YP_109550.2	in Escherichia coli RsmE methylates the N3 position of the U1498 base in 16S rRNA; cells lacking this function can grow, but are outcompeted by wild-type; SAM-dependent m(3)U1498 methyltransferase
YP_109551.1	Similar to Ralstonia solanacearum hypothetical protein RSC2765 or RS00089 SWALL:Q8XVR4 (EMBL:AL646071) (198 aa) fasta scores: E(): 9e-39, 60.41% id in 192 aa. C-terminal region is similar to Xylella fastidiosa conserved hypothetical protein SWALL:Q87A41 (EMBL:AE012560) (138 aa) fasta scores: E(): 0.00017, 31.2% id in 125 aa. Possible alternative translational start site after codon 55
YP_109552.1	Similar to Streptomyces aureofaciens guanyl-specific ribonuclease SA3 precursor RnaSA3 SWALL:RNS3_STRAU (SWALL:P30289) (141 aa) fasta scores: E(): 1.1e-14, 44.36% id in 133 aa, and to Ralstonia solanacearum probable guanyl-specific ribonuclease precursor signal peptide protein rsc2766 or rs00088 SWALL:Q8XVR3 (EMBL:AL646071) (143 aa) fasta scores: E(): 3.5e-21, 54.88% id in 133 aa
YP_109553.1	NAD-dependent; catalyzes the oxidative decarboxylation of malate to form pyruvate; does not decarboxylate oxaloacetate
YP_109554.1	catalyzes the formation of thiamine diphosphate from thiamine phosphate ant ATP
YP_109555.1	Similar to Escherichia coli phosphatidylglycerophosphatase A PgpA or b0418 SWALL:PGPA_ECOLI (SWALL:P18200) (172 aa) fasta scores: E(): 7.2e-20, 40.97% id in 144 aa, and to Ralstonia solanacearum probable phosphatidyl-glycerophosphatase hydrolase transmembrane protein rsc2769 or rs00078 SWALL:Q8XVR0 (EMBL:AL646071) (174 aa) fasta scores: E(): 4.8e-35, 56.32% id in 158 aa. Note: This CDS is shorter in its N-terminal region than most of its database matches
YP_109556.1	Similar to Escherichia coli, and Escherichia coli O6 protein YgaD or b2700 or c3254 SWALL:YGAD_ECOLI (SWALL:P41053) (165 aa) fasta scores: E(): 1.1e-26, 54.48% id in 156 aa, and to Ralstonia solanacearum hypothetical protein rsc2770 or rs00077 SWALL:Q8XVQ9 (EMBL:AL646071) (166 aa) fasta scores: E(): 1.7e-37, 65.45% id in 165 aa
YP_109557.1	OMP decarboxylase; OMPDCase; OMPdecase; type 2 subfamily; involved in last step of pyrimidine biosynthesis; converts orotidine 5'-phosphate to UMP and carbon dioxide; OMP decarboxylase; OMPDCase; OMPdecase
YP_109558.1	Similar to Ralstonia solanacearum hypothetical protein rsc2754 or rs00100 SWALL:Q8XVS5 (EMBL:AL646071) (296 aa) fasta scores: E(): 9.1e-52, 49.31% id in 292 aa, and to Rhizobium loti hypothetical protein mlr7196 SWALL:Q986V3 (EMBL:AP003011) (308 aa) fasta scores: E(): 4.7e-33, 35.83% id in 293 aa. Note: This CDS is longer in its N-terminal region than most of its database matches
YP_109559.1	Similar to Pseudomonas paucimobilis 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase LinX SWALL:LINX_PSEPA (SWALL:P50198) (250 aa) fasta scores: E(): 3.4e-20, 34.41% id in 247 aa, and to Rhizobium meliloti probable oxidoreductase r00826 or smc00880 SWALL:Q92RN6 (EMBL:AL591785) (256 aa) fasta scores: E(): 5.6e-39, 48.19% id in 249 aa. Note: This CDS is longer in its N-terminal region than most of its database matches
YP_109560.1	Part of the ABC transporter complex AraFGH involved in the high affinity transport of arabinose
YP_109561.2	Part of the ABC transporter complex AraFGH involved in the high affinity transport of arabinose
YP_109562.1	Similar to Ralstonia solanacearum probable L-arabinose-binding periplasmic rsc2758 or rs00096 SWALL:Q8XVS1 (EMBL:AL646071) (331 aa) fasta scores: E(): 1.5e-86, 71.56% id in 327 aa, and to Escherichia coli L-arabinose-binding periplasmic protein precursor AraF or b1901 SWALL:ARAF_ECOLI (SWALL:P02924) (329 aa) fasta scores: E(): 5.3e-57, 48.93% id in 327 aa
YP_109563.1	Similar to Rhizobium loti probable oxidoreductase mll7083 SWALL:Q987E5 (EMBL:AP003010) (258 aa) fasta scores: E(): 1.8e-54, 61.86% id in 257 aa, and to Escherichia coli oxidoreductase UcpA or b2426 SWALL:UCPA_ECOLI (SWALL:P37440) (263 aa) fasta scores: E(): 1.6e-27, 40% id in 260 aa
YP_109564.1	catalyzes the formation of D-glyceraldehyde 3-phosphate and pyruvate from 2-dehydro-3-deoxy-D-galactonate 6-phosphate; functions in galactonate metabolism
YP_109565.1	Similar to Rhizobium meliloti 2-dehydro-3-deoxygalactonokinase ra0372 or sma0705 SWALL:Q92ZS7 (EMBL:AE007229) (324 aa) fasta scores: E(): 8.4e-24, 38.22% id in 327 aa, and to Escherichia coli 2-dehydro-3-deoxygalactonokinase DgoK or b3693 SWALL:DGOK_ECOLI (SWALL:P31459) (292 aa) fasta scores: E(): 1.3e-09, 34.16% id in 319 aa
YP_109566.1	Similar to Escherichia coli transcriptional regulator KdgR or b1827 SWALL:KDGR_ECOLI (SWALL:P76268) (263 aa) fasta scores: E(): 6.3e-18, 33.46% id in 263 aa, and CFT073  transcriptional regulator c4779 SWALL:AAN83212 (EMBL:AE016770) (284 aa) fasta scores: E(): 1.2e-27, 56.64% id in 256 aa
YP_109568.1	Similar to Ralstonia solanacearum probable carboxypeptidase rsc1003 or rs04289 SWALL:Q8Y0P0 (EMBL:AL646062) (543 aa) fasta scores: E(): 1.1e-50, 40.29% id in 546 aa, and to Caulobacter crescentus hypothetical protein cc3418 SWALL:Q9A2Y8 (EMBL:AE006002) (504 aa) fasta scores: E(): 1.8e-19, 30.4% id in 546 aa
YP_109569.1	glycosyltransferase; polymerizes glycan strands in the peptidoglycan
YP_109570.1	AroE; catalyzes the conversion of shikimate to 3-dehydroshikimate
YP_109571.1	Similar to Escherichia coli exoribonuclease II Rnb or b1286 SWALL:RNB_ECOLI (SWALL:P30850) (644 aa) fasta scores: E(): 2e-08, 28.45% id in 355 aa, and to Neisseria meningitidis ribonuclease II-related protein nmb0282 SWALL:Q9K185 (EMBL:AE002385) (626 aa) fasta scores: E(): 2.2e-64, 39.9% id in 644 aa
YP_109572.1	Similar to Ralstonia solanacearum hypothetical protein rsc2781 or rs00066 SWALL:Q8XVP9 (EMBL:AL646071) (210 aa) fasta scores: E(): 2.7e-47, 66.48% id in 188 aa, and to Vibrio cholerae hypothetical protein vc2432 SWALL:Q9KPD8 (EMBL:AE004313) (195 aa) fasta scores: E(): 2.9e-19, 38.5% id in 187 aa
YP_109573.1	Similar to Escherichia coli UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso- diamino pimelate ligase Mpl or b4233 SWALL:MPL_ECOLI (SWALL:P37773) (457 aa) fasta scores: E(): 5.9e-102, 59.05% id in 464 aa, and to Ralstonia solanacearum probable UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso- diaminopimelate ligase transmembrane protein mpl or rsc2782 or rs00065 SWALL:Q8XVP8 (EMBL:AL646071) (461 aa) fasta scores: E(): 2.2e-136, 76.18% id in 466 aa. Note: This CDS has an alternative start codon at residue 25
YP_109574.1	Similar to Ralstonia solanacearum hypothetical protein rsc2783 or rs00064 SWALL:Q8XVP7 (EMBL:AL646071) (224 aa) fasta scores: E(): 1e-40, 60.18% id in 221 aa, and to Xanthomonas axonopodis hypothetical protein xac3387 SWALL:AAM38230 (EMBL:AE011985) (216 aa) fasta scores: E(): 2.8e-10, 35.09% id in 208 aa
YP_109575.1	Similar to Chlorobium limicola thioredoxin SoxW SWALL:Q8RLW7 (EMBL:AY074395) (185 aa) fasta scores: E(): 9.4e-10, 34.41% id in 154 aa, and to Ralstonia solanacearum  thioredoxin-related transmembrane protein rsc2784 or rs00063 SWALL:Q8XVP6 (EMBL:AL646071) (174 aa) fasta scores: E(): 4.3e-25, 49.66% id in 151 aa
YP_109576.1	catalyzes the formation of 3-dehydroshikimate from 3-dehydroquinate in chorismate biosynthesis
YP_109577.1	composes the biotin carboxyl carrier protein subunit of the acetyl-CoA carboxylase complex, the enzyme that catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, which in turn controls the rate of fatty acid metabolism
YP_109578.1	an AccC homodimer forms the biotin carboxylase subunit of the acetyl CoA carboxylase, an enzyme that catalyzes the formation of malonyl-CoA, which in turn controls the rate of fatty acid metabolism
YP_109579.1	methylates ribosomal protein L11 at multiple amino acid positions; mutations of these genes in Escherichia coli or Thermus thermophilus has no apparent phenotype
YP_109580.1	Low similarity to Ralstonia solanacearum probable transmembrane protein rsc2789 or rs00058 SWALL:Q8XVP1 (EMBL:AL646071) (473 aa) fasta scores: E(): 8.3e-20, 31.02% id in 490 aa
YP_109581.1	Similar to Escherichia coli, Escherichia coli O6, Escherichia coli O157:H7, and Shigella dysenteriae thiol peroxidase Tpx or b1324 or c1796 or z2452 or ecs1903 SWALL:TPX_ECOLI (SWALL:P37901) (167 aa) fasta scores: E(): 5.7e-36, 62.19% id in 164 aa, and to Ralstonia solanacearum probable thiol peroxidase rsc2790 or rs00057 SWALL:TPX_RALSO (SWALL:Q8XVP0) (166 aa) fasta scores: E(): 1.1e-42, 71.25% id in 167 aa
YP_109582.1	Similar to Bacillus subtilis ribokinase RbsK SWALL:RBSK_BACSU (SWALL:P36945) (293 aa) fasta scores: E(): 7.6e-08, 26.33% id in 262 aa, and to Ralstonia solanacearum  sugar kinase transferase rsc2791 or rs00056 SWALL:Q8XVN9 (EMBL:AL646071) (311 aa) fasta scores: E(): 3.9e-78, 64.19% id in 310 aa
YP_109583.1	Similar to Yersinia enterocolitica outer membrane lipoprotein precursor Pcp or PcpY SWALL:PCP_YEREN (SWALL:P31484) (155 aa) fasta scores: E(): 2.4e-12, 40.94% id in 149 aa, and to Escherichia coli, and Escherichia coli O157:H7 outer membrane lipoprotein slyb precursor SlyB or b1641 or z2655 or ecs2350 SWALL:SLYB_ECOLI (SWALL:P55741) (155 aa) fasta scores: E(): 1.3e-10, 36.87% id in 141 aa
YP_109584.1	Similar to Chlamydia trachomatis histone H1-like protein HC2 HctB SWALL:HC2X_CHLTR (SWALL:Q46397) (221 aa) fasta scores: E(): 2.8e-13, 50.5% id in 200 aa, and to Bordetella pertussis histone H1 SWALL:Q45370 (EMBL:L37438) (182 aa) fasta scores: E(): 7.5e-21, 64.61% id in 195 aa
YP_109585.1	Catalyzes the rate-limiting step in dNTP synthesis
YP_109586.1	Catalyzes the rate-limiting step in dNTP synthesis
YP_109587.1	Similar to Escherichia coli N-acetylmuramyl-L-alanine amidase AmpD or b0110 SWALL:AMPD_ECOLI (SWALL:P13016) (183 aa) fasta scores: E(): 1.2e-39, 59.88% id in 172 aa, and to Ralstonia solanacearum  N-acetylmuramyl-L-alanine amidase rsc2806 or rs00299 SWALL:Q8XVM4 (EMBL:AL646072) (200 aa) fasta scores: E(): 7.8e-50, 61.25% id in 191 aa
YP_109588.1	Weakly similar to Ralstonia solanacearum hypothetical transmembrane protein rsc2809 rsc2809 or rs00296 SWALL:Q8XVM1 (EMBL:AL646072) (86 aa) fasta scores: E(): 2, 32.07% id in 106 aa. C-terminal region is similar to the C-terminus of Pseudomonas putida conserved hypothetical protein pp0621 SWALL:Q88Q74 (EMBL:AE016776) (103 aa) fasta scores: E(): 0.043, 42.59% id in 54 aa
YP_109589.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc2810 or rs00295 SWALL:Q8XVM0 (EMBL:AL646072) (303 aa) fasta scores: E(): 4.5e-64, 61.41% id in 311 aa, and to Neisseria meningitidis hypothetical inner membrane protein nma2189 SWALL:Q9JSQ1 (EMBL:AL162758) (268 aa) fasta scores: E(): 3e-17, 38.04% id in 297 aa
YP_109590.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 signal recognition particle protein Ffh or b2610 or c3131 or z3904 or ecs3473 SWALL:SR54_ECOLI (SWALL:P07019) (453 aa) fasta scores: E(): 1.6e-95, 65.26% id in 452 aa, and to Ralstonia solanacearum  signal recognition particle protein rsc2811 or rs00294 SWALL:Q8XVL9 (EMBL:AL646072) (476 aa) fasta scores: E(): 2.2e-101, 80.88% id in 476 aa
YP_109591.1	Catalyzes the salvage synthesis of inosine-5'-monophosphate (IMP) and guanosine-5'-monophosphate (GMP) from the purine bases hypoxanthine and guanine, respectively
YP_109592.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc2813 or rs00292 SWALL:Q8XVL7 (EMBL:AL646072) (197 aa) fasta scores: E(): 3.3e-48, 71.5% id in 200 aa, and to Xylella fastidiosa hypothetical protein xf2666 SWALL:Q9PA54 (EMBL:AE004072) (198 aa) fasta scores: E(): 4.4e-29, 48.43% id in 192 aa
YP_109593.1	catalyzes the formation of prolyl-tRNA(Pro) from proline and tRNA(Pro)
YP_109594.1	hydrolyzes diadenosine polyphosphate
YP_109595.1	Similar to Ralstonia solanacearum  lipoprotein rsc2818 or rs00287 SWALL:Q8XVL2 (EMBL:AL646072) (213 aa) fasta scores: E(): 7.4e-16, 42.38% id in 151 aaWeakly similar to Neisseria meningitidis  periplasmic protein nma0881 SWALL:Q9JVD8 (EMBL:AL162754) (203 aa) fasta scores: E(): 0.0044, 27.66% id in 188 aa
YP_109596.1	Similar to Thermoanaerobacter tengcongensis transposase TTE0846 SWALL:Q8RBH2 (EMBL:AE013051) (492 aa) fasta scores: E(): 3.4e-74, 43.76% id in 457 aa, and to Pseudomonas sp.  transposase TnpA SWALL:Q936Y1 (EMBL:U66917) (456 aa) fasta scores: E(): 1.4e-32, 30.96% id in 478 aa
YP_109597.1	catalyzes the formation of glutamate 5-phosphate from glutamate in proline biosynthesis
YP_109598.1	essential GTPase; exhibits high exchange rate for GTP/GDP; associates with 50S ribosomal subunit; involved in regulation of chromosomal replication
YP_109599.1	involved in the peptidyltransferase reaction during translation
YP_109600.1	Similar to Escherichia coli 50S ribosomal protein L21 RplU or b3186 or z4549 or ecs4065 SWALL:RL21_ECOLI (SWALL:P02422) (103 aa) fasta scores: E(): 1.7e-14, 43.68% id in 103 aa
YP_109601.1	Similar to Escherichia coli octaprenyl-diphosphate synthase IspB or Cel or b3187 SWALL:ISPB_ECOLI (SWALL:P19641) (323 aa) fasta scores: E(): 9.1e-60, 51.12% id in 311 aa
YP_109602.1	Similar to Ralstonia solanacearum probable transmembrane protein Rsc2824 or Rs00236 SWALL:Q8XVK6 (EMBL:AL646072) (425 aa) fasta scores: E(): 3.4e-98, 59.71% id in 422 aa, and to Escherichia coli hypothetical protein YfjD or b2612/b2613 SWALL:YFJD_ECOLI (SWALL:P37908) (428 aa) fasta scores: E(): 1.4e-58, 37.73% id in 424 aa
YP_109603.1	Similar to Aeromonas hydrophila type IV pilus assembly protein TapB SWALL:TAPB_AERHY (SWALL:P45792) (568 aa) fasta scores: E(): 1.3e-64, 51.04% id in 382 aa
YP_109604.1	Similar to Burkholderia pseudomallei pilus assembly protein PilC SWALL:Q9ZF71 (EMBL:AF110186) (186 aa) fasta scores: E(): 6e-62, 98.92% id in 186 aa, and to Aeromonas hydrophila type IV pilus assembly protein TapC SWALL:TAPC_AERHY (SWALL:P45793) (413 aa) fasta scores: E(): 1e-44, 35.85% id in 396 aa
YP_109605.1	Previously characterised as Burkholderia pseudomallei type IV prepilin-like proteins leader peptide processing enzyme [includes: leader peptidase (EC 3.4.23.43) (prepilin peptidase); N- methyltransferase (EC 2.1.1.-)] GspO SWALL:LEP4_BURPS (SWALL:Q9ZF70) (275 aa) fasta scores: E(): 5.9e-105, 99.27% id in 275 aa
YP_109606.1	catalyzes the phosphorylation of the 3'-hydroxyl group of dephosphocoenzyme A to form coenzyme A; involved in coenzyme A biosynthesis
YP_109607.1	Similar to Ralstonia solanacearum hypothetical protein Rsc2829 or Rs00276 SWALL:Q8XVK1 (EMBL:AL646072) (252 aa) fasta scores: E(): 5.7e-71, 71.42% id in 252 aa, and to Escherichia coli hypothetical protein YacF or b0102 SWALL:YACF_ECOLI (SWALL:P36680) (247 aa) fasta scores: E(): 3.9e-21, 32.28% id in 254 aa
YP_109608.1	Similar to Ralstonia solanacearum hypothetical zinc-binding upf0243 protein rsc2830 or rs00275 SWALL:YS30_RALSO (SWALL:Q8XVK0) (71 aa) fasta scores: E(): 4.5e-13, 58.73% id in 63 aa, and to Neisseria gonorrhoeae hypothetical zinc-binding upf0243 protein SWALL:YPIL_NEIGO (SWALL:Q50961) (69 aa) fasta scores: E(): 2.5e-10, 55.93% id in 59 aa
YP_109609.1	Similar to Escherichia coli mutator MutT protein or b0099 SWALL:MUTT_ECOLI (SWALL:P08337) (129 aa) fasta scores: E(): 5.8e-11, 34.64% id in 127 aa, and to Escherichia coli CTP pyrophosphohydrolase NudG or b1759 SWALL:NUDG_ECOLI (SWALL:P77788) (135 aa) fasta scores: E(): 4.7e-09, 38.71% id in 124 aa
YP_109610.1	Similar to Ralstonia solanacearum hypothetical protein Rsc2832 or Rs00273 SWALL:Q8XVJ8 (EMBL:AL646072) (294 aa) fasta scores: E(): 1.3e-80, 77.14% id in 280 aa
YP_109611.1	bifunctional arginine biosynthesis protein ArgJ; functions at the 1st and 5th steps in arginine biosynthesis; involved in synthesis of acetylglutamate from glutamate and acetyl-CoA and ornithine by transacetylation between acetylornithine and glutmate
YP_109612.1	functions in protein export; can interact with acidic membrane phospholipids and the SecYEG protein complex; binds to preproteins; binds to ATP and undergoes a conformational change to promote membrane insertion of SecA/bound preprotein; ATP hydrolysis appears to drive release of the preprotein from SecA and deinsertion of SecA from the membrane; additional proteins SecD/F/YajC aid SecA recycling; exists in an equilibrium between monomers and dimers; may possibly form higher order oligomers; proteins in this cluster correspond SecA1; SecA2 is not essential and seems to play a role in secretion of a subset of proteins
YP_109613.1	Similar to Ralstonia solanacearum hypothetical protein Rsc2836 or Rs00269 SWALL:Q8XVJ4 (EMBL:AL646072) (195 aa) fasta scores: E(): 1.2e-10, 38.6% id in 158 aa
YP_109614.1	zinc-dependent; catalyzes the deacetylation of UDP-(3-O-acyl)-N-acetylglucosamine to UDP-3-O-(3-hydroxytetradecanoyl)-glucosamine in the second step of lipid A biosynthesis
YP_109615.1	Similar to Populus tremula x Populus tremuloides peroxiredoxin SWALL:Q8S3L0 (EMBL:AF483268) (162 aa) fasta scores: E(): 7.5e-26, 47.87% id in 165 aa, and to Brassica rapa subsp. pekinensis type 2 peroxiredoxin PrxII SWALL:Q9XF72 (EMBL:AF133302) (162 aa) fasta scores: E(): 2.2e-24, 45.45% id in 165 aa
YP_109616.1	GTPase; similar structure to tubulin; forms ring-shaped polymers at the site of cell division; other proteins such as FtsA, ZipA, and ZapA, interact with and regulate FtsZ function
YP_109617.1	Similar to Escherichia coli cell division protein FtsA or DivA or b0094 or z0104 or ecs0098 SWALL:FTSA_ECOLI (SWALL:P06137) (420 aa) fasta scores: E(): 2.2e-62, 46.86% id in 414 aa
YP_109618.1	Similar to Escherichia coli cell division protein FtsQ or b0093 SWALL:FTSQ_ECOLI (SWALL:P06136) (276 aa) fasta scores: E(): 1.6e-18, 30.33% id in 211 aa, and to Ralstonia solanacearum  cell division transmembrane protein FtsQ or Rsc2841 or Rs00264 SWALL:Q8XVJ0 (EMBL:AL646072) (299 aa) fasta scores: E(): 1.9e-56, 55.85% id in 256 aa
YP_109619.1	D-alanine--D-alanine ligase; DdlA; DdlB; cytoplasmic; catalyzes the formation of D-alanyl-D-alanine from two D-alanines in peptidoglycan synthesis; there are two forms of this enzyme in Escherichia coli
YP_109620.1	Catalyzes the formation of UDP-N-acetylmuramoyl-L-alanine from UDP-N-acetylmuramate and L-alanine in peptidoglycan synthesis
YP_109621.1	UDP-N-acetylglucosamine--N-acetylmuramyl- (pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase; involved in cell wall formation; inner membrane-associated; last step of peptidoglycan synthesis
YP_109622.1	Similar to Escherichia coli cell division protein FtsW or b0089 or z0099 or ecs0093 SWALL:FTSW_ECOLI (SWALL:P16457) (414 aa) fasta scores: E(): 1.5e-60, 43% id in 386 aa
YP_109623.2	UDP-N-acetylmuramoylalanine--D-glutamate ligase; involved in peptidoglycan biosynthesis; cytoplasmic; catalyzes the addition of glutamate to the nucleotide precursor UDP-N-acetylmuramoyl-L-alanine during cell wall formation
YP_109624.1	First step of the lipid cycle reactions in the biosynthesis of the cell wall peptidoglycan
YP_109625.1	Similar to Escherichia coli UDP-N-acetylmuramoylalanyl-D-glutamyl-2, 6-diaminopimelate-- D-alanyl-D-alanyl ligase MurF or Mra or b0086 SWALL:MURF_ECOLI (SWALL:P11880) (452 aa) fasta scores: E(): 5.6e-47, 40.7% id in 457 aa
YP_109626.1	involved in cell wall formation; peptidoglycan synthesis; cytoplasmic enzyme; catalyzes the addition of meso-diaminopimelic acid to the nucleotide precursor UDP-N-aceylmuramoyl-l-alanyl-d-glutamate
YP_109627.1	Similar to Escherichia coli peptidoglycan synthetase FtsI or PbpB or b0084 or z0094 or ecs0088 SWALL:FTSI_ECOLI (SWALL:P04286) (588 aa) fasta scores: E(): 2.5e-72, 42.08% id in 556 aa
YP_109628.1	Similar to Escherichia coli cell division protein FtsL or MraR or b0083 or z0093 or ecs0087 SWALL:FTSL_ECOLI (SWALL:P22187) (121 aa) fasta scores: E(): 2.3, 27.02% id in 74 aa, and to Ralstonia solanacearum probable cell division ftsl transmembrane protein FtsI or Rsc2851 or Rs00254 SWALL:Q8XVI0 (EMBL:AL646072) (108 aa) fasta scores: E(): 3e-13, 50% id in 108 aa
YP_109629.1	Similar to Escherichia coli S-adenosyl-methyltransferase MraW or b0082 or z0092 or ecs0086 SWALL:MRAW_ECOLI (SWALL:P18595) (313 aa) fasta scores: E(): 2.4e-60, 54.14% id in 314 aa
YP_109630.1	MraZ; UPF0040; crystal structure shows similarity to AbrB
YP_109631.1	Similar to Ralstonia solanacearum hypothetical protein Rsc2854 or Rs00251 SWALL:Q8XVH7 (EMBL:AL646072) (211 aa) fasta scores: E(): 7.9e-49, 63.5% id in 211 aa, and to Pseudomonas aeruginosa hypothetical protein Pa0655 SWALL:Q9I5R6 (EMBL:AE004500) (215 aa) fasta scores: E(): 1.2e-32, 47.34% id in 207 aa
YP_109632.1	Similar to Burkholderia cepacia Opcp1 porin SWALL:Q45106 (EMBL:D63823) (361 aa) fasta scores: E(): 1.2e-35, 45.89% id in 390 aa, and to Comamonas acidovorans outer membrane porin protein 32 precursor Omp32 SWALL:OM32_COMAC (SWALL:P24305) (351 aa) fasta scores: E(): 1.4e-16, 32.26% id in 406 aa
YP_109633.1	activates fatty acids by binding to coenzyme A
YP_109634.1	Similar to Ralstonia solanacearum hypothetical oxidoreductase Rsc2859 or Rs00246 SWALL:Q8XVH2 (EMBL:AL646072) (698 aa) fasta scores: E(): 5e-202, 69.66% id in 689 aa, and to Escherichia coli formate dehydrogenase H FdhF or b4079 SWALL:FDHF_ECOLI (SWALL:P07658) (715 aa) fasta scores: E(): 4.8e-32, 27.15% id in 718 aa
YP_109635.1	Catalyzes the reversible hydration of unsaturated fatty acyl-CoA to beta-hydroxyacyl-CoA
YP_109636.1	Similar to Azoarcus evansii PaaZ SWALL:Q9F9V2 (EMBL:AF176259) (562 aa) fasta scores: E(): 2.4e-118, 58.43% id in 551 aa, and to Streptomyces coelicolor dehydrogenase SCO3835 or SCH69.05 SWALL:Q9XA29 (EMBL:AL079308) (563 aa) fasta scores: E(): 1.3e-114, 56.11% id in 556 aa, and to Azoarcus evansii  ring opening enzyme PacL SWALL:Q9FA63 (EMBL:AJ278756) (483 aa) fasta scores: E(): 7.1e-80, 52.86% id in 524 aa
YP_109637.1	catalyzes the thiolytic cleavage of beta-ketoadipyl-CoA to succinate and acetyl-CoA
YP_109638.1	Catalyzes the reversible hydration of unsaturated fatty acyl-CoA to beta-hydroxyacyl-CoA
YP_109639.1	Similar to Escherichia coli phenylacetic acid degradation protein PaaI or b1396 SWALL:PAAI_ECOLI (SWALL:P76084) (140 aa) fasta scores: E(): 1.2e-22, 48.8% id in 125 aa
YP_109640.1	Similar to Escherichia coli phenylacetate-coenzyme A ligase PaaK or b1398 SWALL:PAAK_ECOLI (SWALL:P76085) (437 aa) fasta scores: E(): 5.2e-108, 65.12% id in 433 aa
YP_109641.1	Similar to Escherichia coli membrane-bound lytic murein transglycosylase A MltA or Mlt or b2813 or z4130 or ecs3673 SWALL:MLTA_ECOLI (SWALL:P46885) (365 aa) fasta scores: E(): 3e-23, 34.52% id in 307 aa, and to Ralstonia solanacearum  membrane-bound lytic murein transglycosylase A transmembrane protein Rsc2876 or Rs00226 SWALL:Q8XVF5 (EMBL:AL646072) (380 aa) fasta scores: E(): 3e-78, 59.28% id in 334 aa
YP_109642.1	protein associated with Co2+ and Mg2+ efflux
YP_109643.1	catalyzes the interconversion of D-ribulose 5-phosphate to xylulose 5-phosphate
YP_109644.1	Similar to Alcaligenes eutrophus phosphoglycolate phosphatase, chromosomal SWALL:GPHC_ALCEU (SWALL:P40852) (231 aa) fasta scores: E(): 2.4e-24, 40.61% id in 229 aa
YP_109645.1	with component II, the glutamine amidotransferase, catalyzes the formation of anthranilate from chorismate and glutamine
YP_109646.1	TrpG; with TrpE catalyzes the formation of anthranilate and glutamate from chorismate and glutamine; TrpG provides the glutamine amidotransferase activity
YP_109647.1	Catalyzes the conversion of N-(5-phospho-D-ribosyl)-anthranilate and diphosphate to anthranilate and 5-phospho-alpha-D-ribose 1-diphosphate
YP_109648.1	involved in tryptophan biosynthesis; amino acid biosynthesis; converts 1-(2-carboxyphenylamino)-1-deoxy-D-ribulose 5-phosphate to C(1)-(3-indolyl)-glycerol 3-phosphate and carbon dioxide and water
YP_109649.1	Similar to Ralstonia solanacearum hypothetical protein Rsc2886 or Rs00215 SWALL:Q8XVE5 (EMBL:AL646072) (223 aa) fasta scores: E(): 2.3e-23, 46.33% id in 218 aa
YP_109650.1	Excises uracil residues from the DNA which can arise as a result of misincorporation of dUMP residues by DNA polymerase or due to deamination of cytosine
YP_109651.1	Similar to Escherichia coli acyl carrier protein phosphodiesterase AcpD or b1412 SWALL:ACPD_ECOLI (SWALL:P41407) (200 aa) fasta scores: E(): 1.4e-31, 48.48% id in 198 aa
YP_109652.1	Similar to Ralstonia solanacearum hypothetical protein Rsc2890 or Rs00209 SWALL:Q8XVE1 (EMBL:AL646072) (621 aa) fasta scores: E(): 9.6e-90, 60.69% id in 631 aa, and to Neisseria meningitidis hypothetical protein Nmb1726 SWALL:Q9JY58 (EMBL:AE002523) (582 aa) fasta scores: E(): 4e-59, 42.93% id in 587 aa
YP_109653.1	Similar to Escherichia coli thiol:disulfide interchange protein DsbC or XprA or b2893 or z4231 or ecs3765 SWALL:DSBC_ECOLI (SWALL:P21892) (236 aa) fasta scores: E(): 8.4e-11, 30.3% id in 231 aa, and to Ralstonia solanacearum probable thiol:disulfide interchange protein DsbC or Rsc2892 or Rs00206 SWALL:Q8XVD9 (EMBL:AL646072) (248 aa) fasta scores: E(): 5.7e-51, 55.06% id in 247 aa
YP_109654.1	Similar to Escherichia coli protein VisC or b2906 SWALL:VISC_ECOLI (SWALL:P25535) (400 aa) fasta scores: E(): 2.6e-33, 34.01% id in 391 aa, and to Escherichia coli 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase UbiF or b0662 SWALL:UBIF_ECOLI (SWALL:P75728) (391 aa) fasta scores: E(): 1.2e-30, 35.78% id in 394 aa
YP_109657.1	translation-associated GTPase; the crystal structure of the Haemophilus influenzae YchF protein showed similarity to the yeast structure (PDB: 1NI3); fluorescence spectroscopy revealed nucleic acid binding; the yeast protein YBR025c interacts with the translation elongation factor eEF1
YP_109658.1	The point of entry for the majority of electrons that traverse the respiratory chain eventually resulting in the reduction of oxygen
YP_109659.1	Weakly similar to Xanthomonas campestris transcriptional regulator AraC family xcc0235 SWALL:AAM39554 (EMBL:AE012119) (245 aa) fasta scores: E(): 0.013, 26.19% id in 252 aa. Similar to the C-terminal region of Caulobacter crescentus transcriptional regulator, arac family cc3506 SWALL:Q9A2Q0 (EMBL:AE006009) (321 aa) fasta scores: E(): 3.4e-07, 30.26% id in 228 aa
YP_109660.1	Similar to Escherichia coli GabA permease GabP or b2663 SWALL:GABP_ECOLI (SWALL:P25527) (466 aa) fasta scores: E(): 6e-107, 66.51% id in 433 aa, and to Pseudomonas aeruginosa gamma-aminobutyrate permease GabP or Pa0129 SWALL:Q9I703 (EMBL:AE004450) (475 aa) fasta scores: E(): 3.4e-117, 68.77% id in 458 aa
YP_109661.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa4792 SWALL:Q9HV16 (EMBL:AE004892) (311 aa) fasta scores: E(): 2.8e-46, 49.02% id in 308 aa, and to Bacillus subtilis glycerophosphoryl diester phosphodiesterase GlpQ SWALL:GLPQ_BACSU (SWALL:P37965) (293 aa) fasta scores: E(): 0.00032, 30.82% id in 133 aa
YP_109662.1	ChvD; in Agrobacterium tumefaciens, mutations in both Walker boxes were found to affect virulence
YP_109663.1	Similar to many including predicted hydrolases eg. Agrobacterium tumefaciens hydrolase Atu0797 or agr_c_1458 SWALL:Q8UH86 (EMBL:AE009046) (203 aa) fasta scores: E(): 1.2e-25, 41.58% id in 202 aa
YP_109664.1	Similar to many predicted hydrolases and hypotheticals eg. Clostridium acetobutylicum amidase from nicotinamidase Cac3465 SWALL:Q97DL0 (EMBL:AE007844) (178 aa) fasta scores: E(): 4.6e-13, 30.06% id in 153 aa
YP_109665.1	Similar to Neisseria meningitidis  aminopeptidase NMA1640 SWALL:Q9JTT6 (EMBL:AL162756) (659 aa) fasta scores: E(): 3.7e-119, 54.51% id in 598 aa, and to Sus scrofa Xaa-Pro aminopeptidase 2 precursor XpnPep2 SWALL:Q95333 (EMBL:U55039) (673 aa) fasta scores: E(): 1.5e-54, 34.59% id in 607 aa
YP_109666.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein Rsc2899 or Rs00198 SWALL:Q8XVD2 (EMBL:AL646072) (80 aa) fasta scores: E(): 0.0045, 37.5% id in 80 aa, and to Streptomyces coelicolor  integral membrane protein SCO1819 or SCI8.04c SWALL:Q9RJ49 (EMBL:AL132644) (93 aa) fasta scores: E(): 0.43, 27.5% id in 80 aa
YP_109667.2	catalyzes the formation of glutamate-1-semialdehyde from glutamyl-tRNA(Glu) and NADPH; the second step of the pathway is catalyzed by glutamate-1-semialdehyde aminomutase which results in the formation of 5-aminolevulinic acid; functions in porphyrin (tetrapyrroles) biosynthesis; the crystal structure showed a C-terminal dimerization domain that appears to be absent in Chlamydial proteins
YP_109668.1	recognizes the termination signals UAG and UAA during protein translation a specificity which is dependent on amino acid residues residing in loops of the L-shaped tRNA-like molecule of RF1; this protein is similar to release factor 2
YP_109669.1	Similar to Escherichia coli protein methyltransferase HemK or b1212 SWALL:HEMK_ECOLI (SWALL:P37186) (277 aa) fasta scores: E(): 1.2e-35, 44.68% id in 273 aa, and to Xylella fastidiosa hemk protein homolog HemK or Xf1512 SWALL:HEMK_XYLFA (SWALL:Q9PD67) (275 aa) fasta scores: E(): 1.2e-41, 50.17% id in 281 aa
YP_109670.1	Similar to Ralstonia solanacearum hypothetical protein Rsc2904 or Rs00191 SWALL:Q8XVC7 (EMBL:AL646072) (103 aa) fasta scores: E(): 8.6e-32, 83% id in 100 aa, and to Neisseria meningitidis hypothetical protein Nma0984 or Nmb0773 SWALL:Q9JR73 (EMBL:AL162754) (103 aa) fasta scores: E(): 8.2e-25, 67.67% id in 99 aa
YP_109671.1	catalyzes the formation of 2-octaprenylphenol from 3-octaprenyl-4-hydroxybenzoate
YP_109672.1	Similar to Xanthomonas campestris hypothetical protein Xcc3666 SWALL:AAM42936 (EMBL:AE012487) (272 aa) fasta scores: E(): 1.9e-47, 52.27% id in 264 aa, and to Streptomyces coelicolor hypothetical protein SCO3204 or SCE22.21c SWALL:Q9KYU2 (EMBL:AL355832) (253 aa) fasta scores: E(): 8.9e-36, 46.35% id in 233 aa
YP_109673.1	Similar to Ralstonia solanacearum probable amino-acid permease transmembrane protein Rsp0282 or Rs03682 SWALL:Q8XT33 (EMBL:AL646077) (543 aa) fasta scores: E(): 1.8e-156, 73.37% id in 522 aa
YP_109674.1	May play a regulatory role in chromosomal replication in nutrient-depleted cells. Similar to Escherichia coli cold shock-like protein CspD or CspH or b0880 or z1117 or ecs0966 SWALL:CSPD_ECOLI (SWALL:P24245) (74 aa) fasta scores: E(): 4.2e-16, 62.68% id in 67 aa
YP_109675.1	Similar to Rhizobium loti DnaK-type molecular chaperone, DnaK Mll5617 SWALL:Q98BE0 (EMBL:AP003007) (418 aa) fasta scores: E(): 1e-61, 44.89% id in 421 aa, and to Chlamydia muridarum chaperone protein DnaK or Tc0675 SWALL:DNAK_CHLMU (SWALL:P56836) (654 aa) fasta scores: E(): 1.7e-05, 26.8% id in 250 aa, and to Vibrio cholerae chaperone protein DnaK or Vc0855 SWALL:DNAK_VIBCH (SWALL:O34241) (635 aa) fasta scores: E(): 2e-05, 26.12% id in 421 aa
YP_109676.1	Similar to Paenibacillus sp. A11-2 thermophilic NAD(P)H-flavin oxidoreductase TdsD SWALL:Q9FAE6 (EMBL:AB040150) (200 aa) fasta scores: E(): 1.4e-22, 39.22% id in 181 aa
YP_109677.1	Similar to Ralstonia solanacearum  transport transmembrane protein Rsp0107 or Rs03015 SWALL:Q8XTK1 (EMBL:AL646076) (432 aa) fasta scores: E(): 3.8e-121, 75.06% id in 417 aa
YP_109678.1	Similar to Ralstonia solanacearum  transcription regulator protein Rsp0108 or Rs03014 SWALL:Q8XTK0 (EMBL:AL646076) (216 aa) fasta scores: E(): 1e-35, 56.45% id in 209 aa, and to Streptomyces coelicolor  TetR-family transcriptional regulator SCO7602 or SC7H9.14 SWALL:Q9EWI2 (EMBL:AL450223) (195 aa) fasta scores: E(): 1.4e-19, 40.23% id in 169 aa
YP_109679.1	Similar to Xylella fastidiosa hypothetical protein Xf1204 SWALL:Q9PE24 (EMBL:AE003954) (185 aa) fasta scores: E(): 7.3e-34, 52.57% id in 175 aa
YP_109680.1	Similar to Ralstonia solanacearum hypothetical protein Rsc3157 or Rs00441 SWALL:Q8XUN0 (EMBL:AL646074) (278 aa) fasta scores: E(): 5e-95, 83.75% id in 277 aa
YP_109681.1	Similar to Ralstonia solanacearum hypothetical protein Rsc3159 or Rs00439 SWALL:Q8XUM8 (EMBL:AL646074) (376 aa) fasta scores: E(): 3.1e-114, 75.92% id in 378 aa, and to Neisseria meningitidis hypothetical protein Nma1400 SWALL:Q9JUB9 (EMBL:AL162755) (331 aa) fasta scores: E(): 5.3e-57, 49.54% id in 329 aa
YP_109682.1	Similar to Micromonospora megalomicea subsp. nigra mycarose O-acyltransferase MegY SWALL:Q9F838 (EMBL:AF263245) (390 aa) fasta scores: E(): 5.7e-12, 25.38% id in 394 aa, and to Streptomyces mycarofaciens acyltransferase MdmB SWALL:MDMB_STRMY (SWALL:Q00718) (387 aa) fasta scores: E(): 0.00011, 25.93% id in 401 aa
YP_109683.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa0127 SWALL:Q9I705 (EMBL:AE004450) (166 aa) fasta scores: E(): 6.1e-31, 62.14% id in 140 aa
YP_109684.1	Similar to Ralstonia solanacearum  aminopeptidase transmembrane protein Rsp0532 or Rs00411 SWALL:Q8XSE4 (EMBL:AL646079) (748 aa) fasta scores: E(): 2.4e-99, 46.99% id in 749 aa, and to Mus musculus puromycin-sensitive aminopeptidase Psa SWALL:PSA_MOUSE (SWALL:Q11011) (920 aa) fasta scores: E(): 8e-34, 27.5% id in 629 aa, and to Lactobacillus helveticus aminopeptidase N PepN SWALL:AMPN_LACHE (SWALL:Q10730) (844 aa) fasta scores: E(): 1.1e-25, 30.13% id in 511 aa
YP_109687.1	Similar to Pseudomonas aeruginosa probable secretion protein Pa4142 SWALL:Q9HWN9 (EMBL:AE004831) (418 aa) fasta scores: E(): 2.3e-68, 53.82% id in 418 aa, and to Escherichia coli microcin H47 secretion protein MchE SWALL:MCHE_ECOLI (SWALL:Q9EXN6) (424 aa) fasta scores: E(): 7.3e-22, 25% id in 420 aa, and to Escherichia coli colicin V secretion protein CvaA SWALL:CVAA_ECOLI (SWALL:P22519) (413 aa) fasta scores: E(): 5.7e-20, 24.44% id in 405 aa
YP_109688.1	Similar to Pseudomonas aeruginosa probable toxin transporter Pa4143 SWALL:Q9HWN8 (EMBL:AE004831) (719 aa) fasta scores: E(): 1e-153, 67.77% id in 720 aa, and to Escherichia coli probable microcin H47 secretion ATP-binding protein MchF SWALL:MCHF_ECOLI (SWALL:Q9EXN5) (698 aa) fasta scores: E(): 2.1e-90, 41.15% id in 690 aa, and to Escherichia coli colicin V secretion ATP-binding protein CvaB SWALL:CVAB_ECOLI (SWALL:P22520) (698 aa) fasta scores: E(): 1.5e-87, 40.79% id in 679 aa
YP_109689.1	Similar to Pseudomonas aeruginosa probable secretion protein Pa4144 SWALL:Q9HWN7 (EMBL:AE004831) (471 aa) fasta scores: E(): 8.1e-62, 43.81% id in 477 aa, and to Bordetella pertussis protein CyaE SWALL:CYAE_BORPE (SWALL:P11092) (474 aa) fasta scores: E(): 1.1e-23, 31.89% id in 486 aa
YP_109690.1	Alanine-rich, low complexity protein. No significant database matches
YP_109691.1	Similar to Bacteriophage A500 L-alanyl-D-glutamate peptidase Ply or Ply500 SWALL:AEPE_BPA50 (SWALL:Q37979) (289 aa) fasta scores: E(): 0.001, 35.78% id in 109 aa, and to Listeria innocua phagelysin Cply2438 SWALL:Q48583 (EMBL:X89234) (287 aa) fasta scores: E(): 0.0019, 34.86% id in 109 aa
YP_109692.1	Similar to Ralstonia solanacearum probable transmembrane protein Rsp0763 or Rs01945 SWALL:Q8XRR8 (EMBL:AL646080) (1313 aa) fasta scores: E(): 2.1e-151, 70.59% id in 1306 aa, and to Rhizobium leguminosarum ImpL SWALL:Q93EC2 (EMBL:AF361470) (1158 aa) fasta scores: E(): 2.6e-34, 25.43% id in 1270 aa, and to Salmonella enterica subsp. enterica serovar Typhimurium SciS protein SWALL:Q93IR7 (EMBL:AJ320483) (1289 aa) fasta scores: E(): 4.5e-13, 25.89% id in 1259 aa
YP_109693.1	Similar to Ralstonia solanacearum hypothetical protein Rsp0762 or Rs01946 SWALL:Q8XRR9 (EMBL:AL646080) (328 aa) fasta scores: E(): 3.3e-81, 61.28% id in 328 aa
YP_109694.1	Similar to Ralstonia solanacearum probable lipoprotein Rsp0761 or Rs01947 SWALL:Q8XRS0 (EMBL:AL646080) (277 aa) fasta scores: E(): 9.8e-51, 62.9% id in 275 aa, and to Bordetella avium outer membrane protein A precursor OmpA SWALL:OMPA_BORAV (SWALL:Q05146) (194 aa) fasta scores: E(): 1.8e-07, 44.89% id in 98 aa
YP_109695.1	Similar to Ralstonia solanacearum hypothetical protein Rsp0759 or Rs01949 SWALL:Q8XRS2 (EMBL:AL646080) (337 aa) fasta scores: E(): 1.5e-44, 52.82% id in 354 aa, and to Rhizobium leguminosarum ImpA SWALL:Q93ED3 (EMBL:AF361470) (358 aa) fasta scores: E(): 7.1e-06, 27.1% id in 380 aa
YP_109696.1	Similar to Escherichia coli ClpB protein or HtpM or b2592 or z3886 or ecs3455 SWALL:CLPB_ECOLI (SWALL:P03815) (857 aa) fasta scores: E(): 2.5e-88, 38.75% id in 867 aa, and to Yersinia enterocolitica Clp protease-associated protein ClpB SWALL:Q9F746 (EMBL:AF285784) (890 aa) fasta scores: E(): 5.8e-134, 49.31% id in 876 aa
YP_109697.1	Similar to Ralstonia solanacearum hypothetical protein Rsp0748 or Rs01960 SWALL:Q8XRT3 (EMBL:AL646080) (363 aa) fasta scores: E(): 4.5e-83, 57.33% id in 368 aa, and to Salmonella enterica subsp. enterica serovar Typhimurium SciB protein SWALL:Q93IT4 (EMBL:AJ320483) (291 aa) fasta scores: E(): 1.6e-17, 30.07% id in 256 aa
YP_109698.1	Similar to Ralstonia solanacearum hypothetical protein Rsp0747 or Rs01961 SWALL:Q8XRT4 (EMBL:AL646080) (616 aa) fasta scores: E(): 1.2e-156, 60.72% id in 611 aa, and to Salmonella enterica subsp. enterica serovar Typhimurium SciC protein SWALL:Q93IT3 (EMBL:AJ320483) (627 aa) fasta scores: E(): 6e-31, 30.15% id in 630 aa
YP_109699.1	Similar to Ralstonia solanacearum hypothetical protein Rsp0746 or Rs01962 SWALL:Q8XRT5 (EMBL:AL646080) (157 aa) fasta scores: E(): 1.4e-42, 71.79% id in 156 aa
YP_109700.1	Similar to Ralstonia solanacearum hypothetical protein Rsp0745 or Rs01963 SWALL:Q8XRT6 (EMBL:AL646080) (167 aa) fasta scores: E(): 3.7e-49, 72.45% id in 167 aa, and to Pseudomonas aeruginosa hypothetical protein Pa2367 SWALL:Q9I1B2 (EMBL:AE004663) (165 aa) fasta scores: E(): 1.1e-11, 32.91% id in 158 aa
YP_109701.1	Similar to Ralstonia solanacearum hypothetical protein Rsp0744 or Rs01964 SWALL:Q8XRT7 (EMBL:AL646080) (496 aa) fasta scores: E(): 9.4e-175, 86.26% id in 495 aa, and to Rhizobium leguminosarum ImpC SWALL:Q93ED1 (EMBL:AF361470) (493 aa) fasta scores: E(): 3.2e-102, 51.41% id in 496 aa
YP_109702.1	Similar to Ralstonia solanacearum hypothetical protein Rsp0743 or Rs01965 SWALL:Q8XRT8 (EMBL:AL646080) (170 aa) fasta scores: E(): 4.6e-47, 79.16% id in 168 aa
YP_109703.1	Similar to Ralstonia solanacearum  lipoprotein Rsp0742 or Rs01966 SWALL:Q8XRT9 (EMBL:AL646080) (215 aa) fasta scores: E(): 4.6e-27, 53.36% id in 223 aa
YP_109704.1	Similar to Ralstonia solanacearum  transmembrane protein Rsp0741 or Rs01967 SWALL:Q8XRU0 (EMBL:AL646080) (193 aa) fasta scores: E(): 3.9e-40, 59.16% id in 191 aa
YP_109705.1	Similar to Ralstonia solanacearum hypothetical protein Rsp0740 or Rs01968 SWALL:Q8XRU1 (EMBL:AL646080) (448 aa) fasta scores: E(): 3.8e-135, 73.66% id in 448 aa, and to Rhizobium leguminosarum ImpJ SWALL:Q93EC4 (EMBL:AF361470) (446 aa) fasta scores: E(): 8.8e-32, 29.13% id in 460 aa
YP_109706.1	Similar to Ralstonia solanacearum probable transmembrane protein Rsp0739 or Rs01969 SWALL:Q8XRU2 (EMBL:AL646080) (263 aa) fasta scores: E(): 2.7e-70, 64.98% id in 257 aa
YP_109708.1	Similar to Neisseria meningitidis transcriptional regulator, HTH_3 family NMB2012 SWALL:Q9JXJ6 (EMBL:AE002551) (363 aa) fasta scores: E(): 8.6e-26, 38.1% id in 370 aa, and to Comamonas testosteroni regulation of transfer protein TrbA SWALL:Q9AHH8 (EMBL:AF311437) (102 aa) fasta scores: E(): 0.068, 31.52% id in 92 aa
YP_109709.1	Identical to Burkholderia cepacia insertion element IS407 hypothetical protein SWALL:YI74_BURCE (SWALL:P24580) (87 aa) fasta scores: E(): 3.7e-32, 100% id in 87 aa. Similar to Ralstonia solanacearum ISRso14-transposase orfA protein SWALL:Q8XGL4 (EMBL:AL646083) (87 aa) fasta scores: E(): 2.1e-29, 93.1% id in 87 aa
YP_109710.1	Similar to Ralstonia solanacearum ISRso14-transposase orfB protein SWALL:Q8XF72 (EMBL:AL646083) (275 aa) fasta scores: E(): 1.2e-97, 86.86% id in 274 aa. C-terminus is identical to Burkholderia cepacia insertion element IS407 hypothetical protein SWALL:YI71_BURCE (SWALL:P24577) (183 aa) fasta scores: E(): 8.9e-73, 100% id in 183 aa
YP_109711.1	Contains a region with similarity to type I restriction modification system methylases eg. Xanthomonas campestris XmnI methyltransferase Xcc4142 SWALL:AAM43363 (EMBL:AE012539) (487 aa) fasta scores: E(): 5.6e-08, 27.5% id in 440 aa, and Campylobacter jejuni restriction and modification enzyme CjeI SWALL:Q9JN06 (EMBL:AF264911) (1250 aa) fasta scores: E(): 0.00027, 20.59% id in 369 aa. CDS contain C-terminal imperfect repeat region with similarity to intergenic region between BSPL3111 and BPSL3113
YP_109712.1	Similar to Ralstonia solanacearum  stringent starvation protein B SspB or Rsc2925 or Rs00327 SWALL:Q8XVA6 (EMBL:AL646072) (165 aa) fasta scores: E(): 2.2e-26, 55.42% id in 175 aa, and to Escherichia coli stringent starvation protein B SspB or b3228 or z4586 or ecs4101 SWALL:SSPB_ECOLI (SWALL:P25663) (165 aa) fasta scores: E(): 1.9e-13, 38.5% id in 174 aa
YP_109713.1	Similar to Ralstonia solanacearum  transcription modulator protein SspA or Rsc2926 or Rs00165 SWALL:Q8XVA5 (EMBL:AL646072) (203 aa) fasta scores: E(): 6.1e-79, 98.03% id in 203 aa, and to Escherichia coli stringent starvation protein A SspA or Ssp or Pog or b3229 or z4587 or ecs4102 SWALL:SSPA_ECOLI (SWALL:P05838) (211 aa) fasta scores: E(): 3.3e-30, 44.82% id in 203 aa
YP_109714.1	Similar to Rhodospirillum rubrum cytochrome c1 precursor PetC SWALL:CY1_RHORU (SWALL:P23135) (272 aa) fasta scores: E(): 2.5e-07, 32.45% id in 228 aa, and to Ralstonia solanacearum  cytochrome c1 precursor transmembrane protein PetC or Rsc2927 or Rs00164 SWALL:Q8XVA4 (EMBL:AL646072) (248 aa) fasta scores: E(): 4.8e-67, 65.07% id in 252 aa
YP_109715.1	Similar to Rhodobacter capsulatus cytochrome b PetB or CytB SWALL:CYB_RHOCA (SWALL:P08502) (436 aa) fasta scores: E(): 4.6e-57, 39.69% id in 456 aa, and to Rhodocyclus gelatinosus cytochrome b CytB or PetB SWALL:Q93SY6 (EMBL:AF380164) (423 aa) fasta scores: E(): 7.1e-102, 66.96% id in 448 aa
YP_109716.1	Similar to Rhodobacter capsulatus ubiquinol-cytochrome C reductase iron-sulfur subunit PetA or FbcF SWALL:UCRI_RHOCA (SWALL:P08500) (191 aa) fasta scores: E(): 1.3e-14, 37.5% id in 192 aa, and to Rhodocyclus gelatinosus rieske protein PetA SWALL:Q93SY7 (EMBL:AF380164) (198 aa) fasta scores: E(): 6.7e-41, 54.87% id in 195 aa
YP_109717.1	Similar to Ralstonia solanacearum hypothetical protein Rsc2931 or Rs00159 SWALL:YT31_RALSO (SWALL:Q8XVA0) (248 aa) fasta scores: E(): 2.7e-60, 59.67% id in 248 aa
YP_109718.1	Similar to Pseudomonas aeruginosa AlgW SWALL:Q51374 (EMBL:U29172) (389 aa) fasta scores: E(): 2e-57, 49.09% id in 385 aa, and to Brucella melitensis protease DO Bmei0783 SWALL:Q8YHL4 (EMBL:AE009519) (474 aa) fasta scores: E(): 3.3e-48, 45.78% id in 356 aa, and to Escherichia coli protease DegQ or HhoA or b3234 SWALL:DEGQ_ECOLI (SWALL:P39099) (455 aa) fasta scores: E(): 2.3e-46, 43.37% id in 362 aa
YP_109719.1	Similar to Escherichia coli Sec-independent protein translocase TatC or MttB or b3839 or z5360 or ecs4768 SWALL:TATC_ECOLI (SWALL:P27857) (258 aa) fasta scores: E(): 1.8e-48, 52.03% id in 246 aa, and to Alcaligenes eutrophus TatC SWALL:Q8VQ52 (EMBL:AF461118) (265 aa) fasta scores: E(): 5.3e-69, 71.14% id in 253 aa
YP_109720.1	Similar to Escherichia coli Sec-independent protein translocase TatB or MttA2 or b3838 or z5359 or ecs4767 SWALL:TATB_ECOLI (SWALL:O69415) (171 aa) fasta scores: E(): 0.022, 31.46% id in 143 aa, and to Alcaligenes eutrophus TatB SWALL:Q8VQ53 (EMBL:AF461118) (170 aa) fasta scores: E(): 2.4e-30, 57.22% id in 173 aa
YP_109721.1	TatA; similar to TatE that is found in some proteobacteria; part of system that translocates proteins with a conserved twin arginine motif across the inner membrane; capable of translocating folded substrates typically those with bound cofactors; similar to a protein import system in thylakoid membranes
YP_109722.1	Similar to Neisseria meningitidis nucleotide-binding protein NMA0806 SWALL:Q9JVK0 (EMBL:AL162754) (107 aa) fasta scores: E(): 1.7e-19, 51.37% id in 109 aa
YP_109723.1	Similar to Ralstonia solanacearum probable transmembrane protein Rsc2943 or Rs00144 SWALL:Q8XV88 (EMBL:AL646072) (124 aa) fasta scores: E(): 4e-22, 54.62% id in 119 aa
YP_109724.1	catalyzes the formation of 1-(5-phosphoribosyl)-AMP from 1-(5-phosphoribolsyl)-ATP in histidine biosynthesis
YP_109725.1	PR-AMP cyclohydrolase; functions in histidine biosynthesis from PRPP; converts 1-(5-phosphoribosyl)-AMP to 1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxyamide during the histidine biosynthesis pathway; binds zinc and magnesium; forms homodimers
YP_109726.2	catalyzes the conversion of 5-[(5-phospho-1-deoxyribulos-1-ylamino)methylideneamino]- 1-(5-phosphoribosyl)imidazole-4-carboxamideand glutamine to imidazole-glycerol phosphate, 5-aminoimidazol-4-carboxamideribonucleotide and glutamate; the HisF subunit acts as a cyclase
YP_109727.1	catalyzes the formation of 5-(5-phospho-1-deoxyribulos-1-ylamino)methylideneamino-l- (5-phosphoribosyl)imidazole-4-carboxamide from 1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino] imidazole-4-carboxamide
YP_109728.1	with HisF IGPS catalyzes the conversion of phosphoribulosyl-formimino-5-aminoimidazole-4-carboxamide ribonucleotide phosphate and glutamine to imidazole-glycerol phosphate, 5-aminoimidazol-4-carboxamide ribonucleotide, and glutamate in histidine biosynthesis; the HisH subunit provides the glutamine amidotransferase activity that produces the ammonia necessary to HisF for the synthesis of imidazole-glycerol phosphate and 5-aminoimidazol-4-carboxamide ribonucleotide
YP_109729.1	Similar to Ralstonia solanacearum probable transmembrane protein Rsc2949 or Rs00137 SWALL:Q8XV82 (EMBL:AL646072) (207 aa) fasta scores: E(): 1.6e-51, 67.31% id in 205 aa, and to Shigella flexneri MarC SWALL:AAL06491 (EMBL:AF411963) (221 aa) fasta scores: E(): 6.5e-12, 34.74% id in 213 aa
YP_109730.1	catalyzes the dehydration of D-erythro-1-(imidazol-4-yl)glycerol 3-phosphate to 3-(imidazol-4-yl)-2-oxopropyl phosphate in histidine biosynthesis
YP_109731.1	catalyzes the formation of L-histidinol phosphate from imidazole-acetol phosphate and glutamate in histidine biosynthesis
YP_109732.1	catalyzes the oxidation of L-histidinol to L-histidinaldehyde and then to L-histidine in histidine biosynthesis; functions as a dimer
YP_109733.1	short form of enzyme; requires HisZ for function; catalyzes the formation of N'-5'-phosphoribosyl-ATP from phosphoribosyl pyrophosphate; crucial role in histidine biosynthesis; forms heteromultimer of HisG and HisZ
YP_109734.1	adds enolpyruvyl to UDP-N-acetylglucosamine as a component of cell wall formation; gram-positive bacteria have 2 copies of MurA which are active
YP_109735.1	Similar to Ralstonia solanacearum hypothetical protein Rsc2954 or Rs01346 SWALL:Q8XV77 (EMBL:AL646072) (78 aa) fasta scores: E(): 3.7e-27, 87.01% id in 77 aa, and to Vibrio cholerae BolA protein or Vc2296 SWALL:BOLA_VIBCH (SWALL:Q9KPS0) (106 aa) fasta scores: E(): 1e-06, 41.09% id in 73 aa
YP_109736.1	Similar to Caulobacter crescentus ABC-2 type transporter Cc2244 SWALL:Q9A651 (EMBL:AE005895) (273 aa) fasta scores: E(): 3.3e-39, 50.59% id in 253 aa, and to Yersinia pestis  ABC transporter integral membrane protein Ypo3405 SWALL:Q8ZBK4 (EMBL:AJ414157) (256 aa) fasta scores: E(): 5.9e-30, 37.5% id in 248 aa
YP_109737.1	Similar to Ralstonia solanacearum probable ATP-binding ABC transporter protein Rsc2956 or Rs01344 SWALL:Q8XV75 (EMBL:AL646072) (321 aa) fasta scores: E(): 1.3e-76, 78.85% id in 298 aa, and to Rhizobium loti nodulation ATP-binding protein I NodI or Mlr6164 SWALL:NODI_RHILO (SWALL:P23703) (340 aa) fasta scores: E(): 6e-27, 38.39% id in 323 aa
YP_109738.1	Similar to Ralstonia solanacearum  signal peptide protein Rsc2957 or Rs01343 SWALL:Q8XV74 (EMBL:AL646072) (115 aa) fasta scores: E(): 3.2e-09, 50.6% id in 83 aa, and to Pseudomonas putida toluene tolerance protein Ttg2E SWALL:Q9Z3Z8 (EMBL:AF106002) (100 aa) fasta scores: E(): 0.13, 31.25% id in 80 aa
YP_109739.1	Similar to Ralstonia solanacearum probable signal peptide protein Rsc2958 or Rs01342 SWALL:Q8XV73 (EMBL:AL646072) (211 aa) fasta scores: E(): 4.6e-34, 47.84% id in 209 aa, and to Pseudomonas putida toluene tolerance protein Ttg2D SWALL:Q9Z3Z9 (EMBL:AF106002) (215 aa) fasta scores: E(): 1.9e-06, 25% id in 208 aa
YP_109740.1	Similar to Ralstonia solanacearum probable lipoprotein precursor VacJ or Rsc2959 or Rs01340 SWALL:Q8XV72 (EMBL:AL646072) (269 aa) fasta scores: E(): 1.5e-30, 52.61% id in 249 aa, and to Shigella flexneri VacJ lipoprotein or Sf2424 SWALL:VACJ_SHIFL (SWALL:P43262) (251 aa) fasta scores: E(): 1.7e-15, 39.16% id in 240 aa
YP_109741.1	Similar to Ralstonia solanacearum probable signal peptide protein Rsc2960 or Rs01338 SWALL:Q8XV71 (EMBL:AL646072) (173 aa) fasta scores: E(): 3.5e-36, 67.42% id in 175 aa, and to Neisseria meningitidis  outer membrane transport protein NMA0487 or NMB1964 SWALL:Q9JR43 (EMBL:AL162753) (164 aa) fasta scores: E(): 3.4e-25, 58.89% id in 163 aa
YP_109742.1	Similar to many membrane proteins, e.g. Ralstonia solanacearum probable transmembrane protein Rsc2961 or Rs01337 SWALL:Q8XV70 (EMBL:AL646072) (255 aa) fasta scores: E(): 3.7e-67, 77.64% id in 255 aa
YP_109743.1	Similar to Ralstonia solanacearum probable ATP-binding ABC transporter protein Rsc2962 or Rs01335 SWALL:Q8XV69 (EMBL:AL646072) (279 aa) fasta scores: E(): 1.3e-66, 72.79% id in 272 aa, and to Pseudomonas putida toluene tolerance protein Ttg2A SWALL:Q9Z402 (EMBL:AF106002) (269 aa) fasta scores: E(): 1.6e-49, 54.85% id in 268 aa
YP_109744.1	Contains extra N-terminal domain not seen in most homologues. C-terminal portion similar to Escherichia coli thiamine-phosphate pyrophosphorylase ThiE or b3993 SWALL:THIE_ECOLI (SWALL:P30137) (211 aa) fasta scores: E(): 2.3e-33, 55.28% id in 208 aa Full length similarity to to Ralstonia solanacearum probable thiamine-phosphate pyrophosphorylase ThiE1 or Rsc0108 or Rs00978 SWALL:Q8Y373 (EMBL:AL646057) (383 aa) fasta scores: E(): 1.3e-33, 46.6% id in 339 aa
YP_109745.1	functions in thiamine (vitamin B1) biosynthesis; in Bacillus subtilis this enzyme catalyzes the formation of thiazole from dehydroxyglycine and 1-deoxy-D-xylulose-5-phosphate and ThiS-thiocarboxylate
YP_109746.1	with ThiF, ThiG, and ThiO catalyzes the formation of the thiazole moiety of thiamine pyrophosphate
YP_109747.1	Similar to Rhizobium etli  thiamine biosynthesis oxidoreductase ThiO SWALL:THIO_RHIET (SWALL:O34292) (327 aa) fasta scores: E(): 1.5e-29, 43.9% id in 328 aa
YP_109748.2	Similar to Ralstonia solanacearum probable ATP-binding transport ABC transporter protein rsc0456 or rs04444 SWALL:Q8Y280 (EMBL:AL646059) (614 aa) fasta scores: E(): 1.9e-86, 49.01% id in 557 aa
YP_109749.1	Similar to Ralstonia solanacearum hypothetical protein Rsc2364 or Rs01182 SWALL:Q8XWV6 (EMBL:AL646069) (207 aa) fasta scores: E(): 1.6e-08, 31.74% id in 189 aa, and to Pyrococcus abyssi hypothetical protein Pab0062 SWALL:Q9V2H2 (EMBL:AJ248283) (184 aa) fasta scores: E(): 0.00024, 26.08% id in 184 aa
YP_109750.1	Similar to Vibrio cholerae sodium/alanine symporter Vc2356 SWALL:Q9KPL1 (EMBL:AE004306) (476 aa) fasta scores: E(): 4.5e-94, 56.5% id in 469 aa, and to Bacillus subtilis amino acid carrier protein AlsT SWALL:ALST_BACSU (SWALL:Q45068) (465 aa) fasta scores: E(): 3.8e-80, 49.46% id in 463 aa
YP_109751.2	glutamate synthase is composed of subunits alpha and beta; beta subunit is a flavin adenine dinucleotide-NADPH dependent oxidoreductase; provides electrons to the alpha subunit, which binds L-glutamine and 2-oxoglutarate and forms L-glutamate
YP_109752.1	Similar to Synechocystis sp. ferredoxin-dependent glutamate synthase 2 GltS or Sll1499 SWALL:GLTS_SYNY3 (SWALL:P55038) (1556 aa) fasta scores: E(): 0, 43.8% id in 1573 aa, and to Ralstonia solanacearum probable glutamate synthase GltB or Rsc2965 or Rs01332 SWALL:Q8XV66 (EMBL:AL646072) (1582 aa) fasta scores: E(): 0, 83.76% id in 1564 aa
YP_109753.1	Similar to Ralstonia solanacearum hypothetical protein Rsc2966 or rs01331 SWALL:Q8XV65 (EMBL:AL646072) (241 aa) fasta scores: E(): 2.5e-39, 46.66% id in 225 aa
YP_109754.1	Similar to Ralstonia solanacearum  outer membrane W OmpW or Rsc3350 or Rs02625 SWALL:Q8XU43 (EMBL:AL646074) (241 aa) fasta scores: E(): 2e-43, 51.01% id in 247 aa, and to Vibrio cholerae outer membrane protein W OmpW or Vca0867 SWALL:OMPW_VIBCH (SWALL:P17266) (217 aa) fasta scores: E(): 9.6e-11, 30.16% id in 242 aa
YP_109755.1	hydrolyzes diesters during transport at the inner face of the cytoplasmic membrane to glycerol-3-phosphate and alcohol; induced when cells are starved for inorganic phosphate
YP_109756.1	part of the UgpABCE glycerol-3-phosphate uptake system
YP_109757.1	with UgpABC is involved in uptake of glycerol-3-phosphate
YP_109758.1	Possibly involved in transport of sn-glycerol-3-phosphate. Similar to many eg. Escherichia coli Sn-glycerol-3-phosphate transport system permease UgpA or b3452 SWALL:UGPA_ECOLI (SWALL:P10905) (295 aa) fasta scores: E(): 4.5e-78, 70.73% id in 287 aa
YP_109759.1	with UgpACE is involved in the uptake of glycerol-3-phosphate
YP_109760.1	dGTPase type 2 subfamily; presumably hydrolyzes dGTP to deoxyguanosine and triphosphate
YP_109761.1	catalyzes the formation of 3-dehydroquinate from 3-deoxy-arabino-heptulonate 7-phosphate; functions in aromatic amino acid biosynthesis
YP_109762.1	catalyzes the formation of shikimate 3-phosphate from shikimate in aromatic amino acid biosynthesis
YP_109763.1	Similar to regions from larger proteins eg. Ralstonia solanacearum probable fimbrial type-4 assembly signal peptide protein PilQ or Rsc2971 or Rs01326 SWALL:Q8XV60 (EMBL:AL646073) (714 aa) fasta scores: E(): 5.7e-36, 49.16% id in 421 aa, and to Haemophilus influenzae competence protein E precursor or hi0435 SWALL:COME_HAEIN (SWALL:P31772) (445 aa) fasta scores: E(): 4.7e-31, 31.64% id in 414 aa
YP_109765.1	Similar to Ralstonia solanacearum probable fimbrial type-4 assembly membrane transmembrane protein PilN or Rsc2974 or Rs01323 SWALL:Q8XV57 (EMBL:AL646073) (210 aa) fasta scores: E(): 0.0057, 26.69% id in 206 aa
YP_109766.1	Similar to Ralstonia solanacearum probable fimbrial type-4 assembly protein PilM or Rsc2975 or Rs01321 SWALL:Q8XV56 (EMBL:AL646073) (356 aa) fasta scores: E(): 0.008, 26.94% id in 193 aa
YP_109767.1	Similar to Escherichia coli penicillin-binding protein 1A MrcA or PonA or b3396 SWALL:PBPA_ECOLI (SWALL:P02918) (850 aa) fasta scores: E(): 1.9e-88, 38.63% id in 818 aa
YP_109768.1	defects in the mitochondrial frataxin protein cause Friedreich ataxis which is an autosomal recessive neurodegenerative disease; based on phylogenomic distribution this protein may have a role in iron-sulfur cluster protein assembly
YP_109770.1	Similar to Pseudomonas aeruginosa diaminopimelate decarboxylase LysA or Pa5277 SWALL:DCDA_PSEAE (SWALL:P19572) (415 aa) fasta scores: E(): 1.3e-95, 63.46% id in 416 aa
YP_109771.1	in Escherichia coli this inner membrane protein was found to anchor the periplasmic catalytic oxidoreductase YedY; sulfite oxidase activity not demonstrated; contains heme
YP_109772.1	in Escherichia coli this periplasmic enzyme was found to encode the periplasmic catalytic subunit of an oxidoreductase; sulfite oxidase activity not demonstrated; requires inner membrane anchor protein YedZ
YP_109773.1	Similar to Chlamydomonas reinhardtii cytochrome c biogenesis protein CcsA SWALL:CCSA_CHLRE (SWALL:P48269) (353 aa) fasta scores: E(): 6.1e-29, 38.73% id in 253 aa, and to Ralstonia solanacearum  transmembrane cytochrome c-type biogenesis transmembrane protein rsc2985 or rs01238 SWALL:Q8XV46 (EMBL:AL646073) (395 aa) fasta scores: E(): 4.1e-112, 72.2% id in 385 aa
YP_109774.1	Similar to Ralstonia solanacearum  cytochrome c-type biogenesis transmembrane protein Rsc2986 or Rs01235 SWALL:Q8XV45 (EMBL:AL646073) (700 aa) fasta scores: E(): 2.4e-161, 60.98% id in 692 aa, and to Chlamydomonas reinhardtii Ccs1 SWALL:O50041 (EMBL:U71000) (613 aa) fasta scores: E(): 0.0016, 23.92% id in 418 aa
YP_109775.1	Similar to Azotobacter vinelandii cytochrome c4 precursor CycA SWALL:CYC4_AZOVI (SWALL:P43302) (210 aa) fasta scores: E(): 2.4e-25, 45.9% id in 220 aa
YP_109776.1	binds guanine nucleotides; in Escherichia coli depletion results in defective cell division and filamentation; in Bacillus subtilis this gene is essential
YP_109777.1	catalyzes the formation of porphobilinogen from 5-aminolevulinate
YP_109778.1	Similar to Escherichia coli thiol:disulfide interchange protein DsbD or DipZ or CycZ or CutA2 or b4136 SWALL:DSBD_ECOLI (SWALL:P36655) (565 aa) fasta scores: E(): 2e-23, 33.17% id in 612 aa, and to Ralstonia solanacearum thiol:disulfide interchange protein DsbD or Rsc2990 or Rs01128 SWALL:DSBD_RALSO (SWALL:Q8XV41) (608 aa) fasta scores: E(): 8.3e-68, 51.56% id in 607 aa
YP_109779.1	Similar to Escherichia coli periplasmic divalent cation tolerance protein cuta cuta or cycy or cuta1 or b4137 or z5742 or ecs5118 SWALL:CUTA_ECOLI (SWALL:P36654) (112 aa) fasta scores: E(): 1.4e-09, 35.51% id in 107 aa
YP_109780.1	is a component of the macrolide binding site in the peptidyl transferase center
YP_109781.1	catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Dimerization of the alpha subunit is the first step in the sequential assembly of subunits to form the holoenzyme
YP_109782.1	primary rRNA binding protein; nucleates 30S assembly; involved in translational accuracy with proteins S5 and S12; interacts with protein S5; involved in autogeneously regulating ribosomal proteins by binding to pseudoknot structures in the polycistronic mRNA; interacts with transcription complex and functions similar to protein NusA in antitermination
YP_109783.1	located on the platform of the 30S subunit, it bridges several disparate RNA helices of the 16S rRNA; forms part of the Shine-Dalgarno cleft in the 70S ribosome; interacts with S7 and S18 and IF-3
YP_109784.1	located at the top of the head of the 30S subunit, it contacts several helices of the 16S rRNA; makes contact with the large subunit via RNA-protein interactions and via protein-protein interactions with L5; contacts P-site tRNA
YP_109785.1	smallest protein in the large subunit; similar to what is found with protein L31 and L33 several bacterial genomes contain paralogs which may be regulated by zinc; the protein from Thermus thermophilus has a zinc-binding motif and contains a bound zinc ion; the proteins in this group have the motif
YP_109786.1	stimulates the activities of the other two initiation factors, IF-2 and IF-3
YP_109787.2	forms heterotrimeric complex in the membrane; in bacteria the complex consists of SecY which forms the channel pore and SecE and SecG; the SecG subunit is not essential; in bacteria translocation is driven via the SecA ATPase
YP_109788.1	late assembly protein
YP_109789.1	L30 binds domain II of the 23S rRNA and the 5S rRNA; similar to eukaryotic protein L7
YP_109790.1	located at the back of the 30S subunit body where it stabilizes the conformation of the head with respect to the body; contacts S4 and S8; with S4 and S12 plays a role in translational accuracy; mutations in this gene result in spectinomycin resistance
YP_109791.1	binds 5S rRNA along with protein L5 and L25
YP_109792.1	ribosomal protein L6 appears to have arisen as a result of an ancient gene duplication as based on structural comparison of the Bacillus stearothermophilus protein; RNA-binding appears to be in the C-terminal domain; mutations in the L6 gene confer resistance to aminoglycoside antibiotics such as gentamicin and these occur in truncations of the C-terminal domain; it has been localized to a region between the base of the L7/L12 stalk and the central protuberance
YP_109793.1	binds directly to 16S rRNA central domain where it helps coordinate assembly of the platform of the 30S subunit
YP_109794.1	located in the peptidyl transferase center and involved in assembly of 30S ribosome subunit; similar to what is observed with proteins L31 and L33, some proteins in this family contain CXXC motifs that are involved in zinc binding; if two copies are present in a genome, then the duplicated copy appears to have lost the zinc-binding motif and is instead regulated by zinc; the proteins in this group do not appear to have the zinc-binding motif
YP_109795.1	part of 50S and 5S/L5/L18/L25 subcomplex; contacts 5S rRNA and P site tRNA; forms a bridge to the 30S subunit in the ribosome by binding to S13
YP_109796.1	assembly initiator protein; binds to 5' end of 23S rRNA and nucleates assembly of the 50S; surrounds polypeptide exit tunnel
YP_109797.1	binds to the 23S rRNA between the centers for peptidyl transferase and GTPase
YP_109798.1	primary binding protein; helps mediate assembly; involved in translation fidelity
YP_109799.1	one of the stabilizing components for the large ribosomal subunit
YP_109800.1	located in the peptidyl transferase center and may be involved in peptidyl transferase activity; similar to archaeal L10e
YP_109801.1	forms a complex with S10 and S14; binds the lower part of the 30S subunit head and the mRNA in the complete ribosome to position it for translation
YP_109802.1	binds specifically to 23S rRNA during the early stages of 50S assembly; makes contact with all 6 domains of the 23S rRNA in the assembled 50S subunit and ribosome; mutations in this gene result in erythromycin resistance; located near peptidyl-transferase center
YP_109803.1	protein S19 forms a complex with S13 that binds strongly to the 16S ribosomal RNA
YP_109804.1	one of the primary rRNA-binding proteins; required for association of the 30S and 50S subunits to form the 70S ribosome, for tRNA binding and peptide bond formation
YP_109805.1	binds third domain of 23S rRNA and protein L29; part of exit tunnel
YP_109806.1	L4 is important during the early stages of 50S assembly; it initially binds near the 5' end of the 23S rRNA
YP_109807.1	binds directly near the 3' end of the 23S rRNA, where it nucleates assembly of the 50S subunit; essential for peptidyltransferase activity; mutations in this gene confer resistance to tiamulin
YP_109808.1	NusE; involved in assembly of the 30S subunit; in the ribosome, this protein is involved in the binding of tRNA; in Escherichia coli this protein was also found to be involved in transcription antitermination; NusB/S10 heterodimers bind boxA sequences in the leader RNA of rrn operons which is required for antitermination; binding of NusB/S10 to boxA nucleates assembly of the antitermination complex
YP_109809.1	EF-Tu; promotes GTP-dependent binding of aminoacyl-tRNA to the A-site of ribosomes during protein biosynthesis; when the tRNA anticodon matches the mRNA codon, GTP hydrolysis results; the inactive EF-Tu-GDP leaves the ribosome and release of GDP is promoted by elongation factor Ts; many prokaryotes have two copies of the gene encoding EF-Tu
YP_109810.1	EF-G; promotes GTP-dependent translocation of the ribosome during translation; many organisms have multiple copies of this gene
YP_109811.1	binds directly to 16S rRNA where it nucleates assembly of the head domain of the 30S subunit
YP_109812.1	interacts with and stabilizes bases of the 16S rRNA that are involved in tRNA selection in the A site and with the mRNA backbone; located at the interface of the 30S and 50S subunits, it traverses the body of the 30S subunit contacting proteins on the other side; mutations in the S12 gene confer streptomycin resistance
YP_109813.1	Similar to Escherichia coli ATP-dependent DNA helicase RecQ or b3822 SWALL:RECQ_ECOLI (SWALL:P15043) (607 aa) fasta scores: E(): 2.8e-77, 44.62% id in 614 aa, and to Ralstonia solanacearum probable ATP-dependent DNA helicase RecQ or Rsc3025 or Rs04732 SWALL:Q8XV07 (EMBL:AL646073) (637 aa) fasta scores: E(): 7.7e-178, 72.38% id in 630 aa
YP_109814.1	DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Subunit beta' binds to sigma factor allowing it to bind to the -10 region of the promoter
YP_109815.1	DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates; beta subunit is part of the catalytic core which binds with a sigma factor to produce the holoenzyme
YP_109816.1	Similar to Neisseria meningitidis 50S ribosomal protein L7/L12 RplL or NMA0143 or nmb0131 SWALL:RL7_NEIMA (SWALL:P80716) (122 aa) fasta scores: E(): 4.2e-23, 76.36% id in 110 aa
YP_109817.1	binds the two ribosomal protein L7/L12 dimers and anchors them to the large ribosomal subunit
YP_109818.1	in Escherichia coli and Methanococcus, this protein autoregulates expression; the binding site in the mRNA mimics the binding site in the 23S rRNA
YP_109819.1	binds directly to 23S ribosomal RNA
YP_109820.1	Modulates Rho-dependent transcription termination
YP_109821.1	forms a complex with SecY and SecG; SecYEG forms a protein-conducting channel to which secA binds and translocates targeted polypeptides across the cytoplasmic membrane, a process driven by ATP and a proton-motive force
YP_109822.1	EF-Tu; promotes GTP-dependent binding of aminoacyl-tRNA to the A-site of ribosomes during protein biosynthesis; when the tRNA anticodon matches the mRNA codon, GTP hydrolysis results; the inactive EF-Tu-GDP leaves the ribosome and release of GDP is promoted by elongation factor Ts; many prokaryotes have two copies of the gene encoding EF-Tu
YP_109823.1	Similar to Rhizobium loti  secreted protein Mlr4086 SWALL:Q98EU1 (EMBL:AP003003) (426 aa) fasta scores: E(): 1.9e-42, 39.85% id in 419 aa
YP_109824.1	with PaaBCDE catalyzes the hydroxylation of phenylacetyl-CoA
YP_109825.1	with PaaBCDE catalyzes the hydroxylation of phenylacetyl-CoA; involved in phenylacetate degradation
YP_109826.1	Similar to Escherichia coli phenylacetic acid degradation protein PaaC or b1390 SWALL:PAAC_ECOLI (SWALL:P76079) (248 aa) fasta scores: E(): 5e-21, 43.51% id in 262 aa
YP_109827.1	Similar to Escherichia coli phenylacetic acid degradation protein PaaD or b1391 SWALL:PAAD_ECOLI (SWALL:P76080) (167 aa) fasta scores: E(): 1.1e-15, 49.12% id in 171 aa
YP_109828.1	Similar to Escherichia coli probable phenylacetic acid degradation NADH oxidoreductase PaaE or b1392 SWALL:PAAE_ECOLI (SWALL:P76081) (356 aa) fasta scores: E(): 1.9e-58, 47.05% id in 357 aa
YP_109829.1	Similar to Ralstonia solanacearum hypothetical protein Rsc3094 or Rs00547 SWALL:Q8XUU1 (EMBL:AL646073) (264 aa) fasta scores: E(): 2.3e-38, 41.97% id in 274 aa
YP_109830.1	Similar to many eg. Ralstonia solanacearum probable transcription regulator protein Rsp0613 or Rs03754 SWALL:Q8XS68 (EMBL:AL646079) (215 aa) fasta scores: E(): 5.1e-42, 59% id in 200 aa, and to Streptomyces coelicolor TetR-family transcriptional regulator SCO3129 or SCE66.08 SWALL:Q9K3T5 (EMBL:AL359989) (225 aa) fasta scores: E(): 3.6e-06, 27.77% id in 198 aa
YP_109831.1	Similar to Ralstonia solanacearum hypothetical protein Rsc3098 or Rs00551 SWALL:Q8XUT7 (EMBL:AL646073) (231 aa) fasta scores: E(): 1.2e-44, 59.34% id in 214 aa
YP_109832.1	Similar to Ralstonia solanacearum probable transcription regulator protein Rsc3102 or Rs00555 SWALL:Q8XUT3 (EMBL:AL646073) (162 aa) fasta scores: E(): 6.2e-19, 65.88% id in 170 aa, and to Escherichia coli leucine-responsive regulatory protein Lrp or b0889 or z1234 or ecs0974 SWALL:LRP_ECOLI (SWALL:P19494) (163 aa) fasta scores: E(): 2.5e-10, 43.11% id in 167 aa
YP_109833.1	Similar to Pseudomonas sp. 4-hydroxyphenylpyruvate dioxygenase SWALL:HPPD_PSESP (SWALL:P80064) (357 aa) fasta scores: E(): 5.7e-37, 57.89% id in 361 aa
YP_109835.1	Catalyzes the ferredoxin-dependent oxidative decarboxylation of arylpyruvates
YP_109836.1	NADP-dependent; catalyzes the oxidative decarboxylation of malate to form pyruvate; decarboxylates oxaloacetate
YP_109837.1	involved in fifth step of pyrimidine biosynthesis; converts orotidine 5'-phosphate and diphosphate to orotate and 5-phospho-alpha-D-ribose 1-diphosphate
YP_109838.1	Similar to many eg. Salmonella typhimurium  outer membrane protein Stm1081 SWALL:Q8ZQ63 (EMBL:AE008747) (182 aa) fasta scores: E(): 1.9e-24, 43.95% id in 182 aa
YP_109839.1	Similar to Ralstonia solanacearum  Trp repressor binding protein homolog Rsc2207 or Rs01392 SWALL:Q8XXA9 (EMBL:AL646068) (190 aa) fasta scores: E(): 8.1e-48, 65.42% id in 188 aa, and to Escherichia coli flavoprotein WrbA or b1004 SWALL:WRBA_ECOLI (SWALL:P30849) (197 aa) fasta scores: E(): 0.0024, 26.15% id in 195 aa
YP_109840.1	catalyzes the reduction of N-acetyl-5-glutamyl phosphate to N-acetyl-L-glutamate 5-semialdehyde in arginine biosynthesis
YP_109843.1	Similar to Ralstonia solanacearum  outer membrane W signal peptide protein OmpW or Rsc3350 or Rs02625 SWALL:Q8XU43 (EMBL:AL646074) (241 aa) fasta scores: E(): 5.7e-11, 40.94% id in 276 aa, and to Escherichia coli outer membrane protein W precursor OmpW or b1256 SWALL:OMPW_ECOLI (SWALL:P21364) (212 aa) fasta scores: E(): 0.36, 24.54% id in 277 aa
YP_109844.1	Similar to Rhizobium loti probable transcriptional regulator Mll2263 SWALL:Q98IT2 (EMBL:AP002999) (304 aa) fasta scores: E(): 7.9e-50, 50.51% id in 291 aa, and to Erwinia carotovora hydrogen peroxide-inducible genes activator OxyR SWALL:OXYR_ERWCA (SWALL:P71318) (302 aa) fasta scores: E(): 4.5e-12, 27.81% id in 302 aa
YP_109845.1	Similar to Rhizobium loti probable antibiotic resistance protein Mlr2264 SWALL:Q98IT1 (EMBL:AP002999) (407 aa) fasta scores: E(): 1.3e-66, 54.1% id in 390 aa, and to Escherichia coli sugar efflux transporter SotB or b1528 SWALL:SOTB_ECOLI (SWALL:P31122) (396 aa) fasta scores: E(): 2.8e-05, 22.59% id in 385 aa
YP_109846.1	Similar to Agrobacterium tumefaciens homoserine/homoserine lactone efflux protein RhtB or Atu1864 or agr_c_3421 SWALL:Q8UE96 (EMBL:AE009140) (273 aa) fasta scores: E(): 5.7e-11, 36.19% id in 221 aa, and to Escherichia coli homoserine/homoserine lactone efflux protein RhtB or b3824 or z5345 or ecs4754 SWALL:RHTB_ECOLI (SWALL:P27847) (206 aa) fasta scores: E(): 2.8e-08, 33.92% id in 224 aa
YP_109847.1	Similar to Xanthomonas campestris dehydrogenase Xcc0308 SWALL:AAM39627 (EMBL:AE012127) (291 aa) fasta scores: E(): 5e-49, 53.1% id in 290 aa, and to Pseudomonas cruciviae D-threonine dehydrogenase DtdS SWALL:Q9ZNH7 (EMBL:AB015439) (292 aa) fasta scores: E(): 5.4e-14, 29.06% id in 289 aa
YP_109848.1	Similar to many eg. Mycobacterium tuberculosis hypothetical protein Rv0579 or Mt0608.1 or mtv039.17 SWALL:O53776 (EMBL:AL021942) (252 aa) fasta scores: E(): 2.8e-35, 45.3% id in 245 aa
YP_109852.1	Similar to Pseudomonas aeruginosa probable amino acid permease Pa0789 SWALL:Q9I5E9 (EMBL:AE004514) (471 aa) fasta scores: E(): 1.2e-131, 74.5% id in 451 aa, and to Salmonella typhimurium proline-specific permease ProY or Stm0400 SWALL:PROY_SALTY (SWALL:P37460) (456 aa) fasta scores: E(): 5.6e-98, 56.72% id in 439 aa
YP_109853.1	Similar to plasmid and pathogenicity island recombinases eg. Xanthomonas axonopodis shufflon-specific recombinase Rci or Xac2418 SWALL:AAM37269 (EMBL:AE011879) (315 aa) fasta scores: E(): 2.6e-24, 63.96% id in 333 aa, and to Salmonella typhi, and Salmonella dublin Rci or Sty4552 SWALL:O51802 (EMBL:AF000001) (383 aa) fasta scores: E(): 6.2e-07, 34.25% id in 327 aa, and to Escherichia coli shufflon-specific DNA recombinase Rci SWALL:RCI2_ECOLI (SWALL:P16470) (384 aa) fasta scores: E(): 1.3e-06, 35.78% id in 327 aa
YP_109854.1	Similar to Campylobacter jejuni hypothetical protein RloE SWALL:Q8RN16 (EMBL:AF486555) (800 aa) fasta scores: E(): 3.7e-58, 34.92% id in 839 aa, and to Chlorobium tepidum hypothetical protein Ct0683 SWALL:AAM71921 (EMBL:AE012840) (767 aa) fasta scores: E(): 9e-12, 26.8% id in 802 aa. Contains PF02370 M protein repeats which are associated with virulence in group A Streptococci
YP_109855.1	Similar to Escherichia coli TraD protein traD SWALL:TRD5_ECOLI (SWALL:P27192) (129 aa) fasta scores: E(): 5.7e-05, 56.25% id in 48 aa
YP_109856.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa4674 SWALL:Q9HVC1 (EMBL:AE004881) (101 aa) fasta scores: E(): 0.00078, 35.86% id in 92 aa, and to Bacteroides nodosus virulence-associated protein A' VapA' SWALL:VAPZ_BACNO (SWALL:Q46561) (115 aa) fasta scores: E(): 0.0012, 35.29% id in 85 aa
YP_109858.1	Similar to Enterobacter aerogenes IncP plasmid conjugal transfer protein TrbL SWALL:P71187 (EMBL:U67194) (572 aa) fasta scores: E(): 8.9e-53, 44.11% id in 544 aa, and to Escherichia coli IncP plasmid conjugal transfer protein TrbL SWALL:Q03536 (EMBL:M93696) (528 aa) fasta scores: E(): 1.8e-50, 44.82% id in 522 aa
YP_109859.1	Similar to Escherichia coli plasmid congugal transfer entry exclusion protein A EexA or TrbJ SWALL:Q03534 (EMBL:M93696) (258 aa) fasta scores: E(): 1.9e-45, 56.03% id in 257 aa, and to Agrobacterium rhizogenes rooting plasmid Riorf126 SWALL:Q9F5C6 (EMBL:AP002086) (265 aa) fasta scores: E(): 1.1e-06, 27.31% id in 205 aa
YP_109860.1	Similar to Escherichia coli RP4 conjugal transfer protein TraI SWALL:TRI5_ECOLI (SWALL:Q00192) (747 aa) fasta scores: E(): 2.6e-124, 52.79% id in 752 aa
YP_109861.1	Similar to Escherichia coli plasmid RP4 conjugal transfer protein TraJ SWALL:TRJ6_ECOLI (SWALL:P17909) (122 aa) fasta scores: E(): 6.9e-26, 66.37% id in 116 aa
YP_109862.1	Doubtful CDS. No significant database matches
YP_109866.1	Similar to plasmid replication proteins eg. Escherichia coli broad-host-range plasmid pIPO2T RepA protein SWALL:Q91UU9 (EMBL:AJ297913) (462 aa) fasta scores: E(): 5.3e-50, 43.13% id in 306 aa, and to Shigella flexneri pSa plasmid replication protein RepA SWALL:Q04559 (EMBL:U30471) (323 aa) fasta scores: E(): 8.5e-40, 38.72% id in 297 aa
YP_109867.1	Similar to Pseudomonas aeruginosa cytochrome c-551 precursor NirM or PA0518 SWALL:C551_PSEAE (SWALL:P00099) (104 aa) fasta scores: E(): 3.9e-09, 37.93% id in 87 aa. Possible alternative translational start sites
YP_109868.1	Similar to Ralstonia solanacearum hypothetical signal peptide protein Rsc3264 or Rs02493 SWALL:Q8XUC7 (EMBL:AL646074) (271 aa) fasta scores: E(): 7.4e-23, 41.79% id in 256 aa
YP_109869.1	Similar to Pseudomonas aeruginosa probable phosphoheptose isomerase Pa4425 SWALL:Q9HVZ0 (EMBL:AE004857) (197 aa) fasta scores: E(): 3.4e-25, 45.55% id in 191 aa, and to Burkholderia pseudomallei GmhA SWALL:Q93UJ2 (EMBL:AF228583) (197 aa) fasta scores: E(): 6.5e-15, 35.97% id in 189 aa, and to Aneurinibacillus thermoaerophilus sedoheptulose 7-phosphate isomerase GmhA SWALL:Q9AGY7 (EMBL:AF324836) (198 aa) fasta scores: E(): 2.2e-13, 35.75% id in 193 aa
YP_109870.1	Similar to many eg. Yersinia pestis hypothetical protein Ypo3549 SWALL:Q8ZB75 (EMBL:AJ414157) (117 aa) fasta scores: E(): 8.5e-18, 55.55% id in 117 aa
YP_109871.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein rsc3266 rsc3266 or rs02495 SWALL:Q8XUC5 (EMBL:AL646074) (300 aa) fasta scores: E(): 2.7e-59, 63.79% id in 290 aa, and to Salmonella typhimurium  methyltransferase yral or stm3263 SWALL:Q8ZLU5 (EMBL:AE008850) (287 aa) fasta scores: E(): 1.7e-41, 49.82% id in 281 aa
YP_109872.1	Similar to Pseudomonas aeruginosa RlpA-like lipoprotein precursor or Pa4000 SWALL:RLPA_PSEAE (SWALL:Q9X6V6) (342 aa) fasta scores: E(): 1.5e-20, 43.01% id in 186 aa, and to Escherichia coli rare lipoprotein a precursor RlpA or b0633 SWALL:RLPA_ECOLI (SWALL:P10100) (362 aa) fasta scores: E(): 2.5e-09, 39.51% id in 124 aa
YP_109873.1	Similar to Yersinia pestis metallo-beta-lactamase superfamily protein Ypo1409 SWALL:Q8ZG96 (EMBL:AJ414148) (215 aa) fasta scores: E(): 6.4e-53, 59.15% id in 213 aa
YP_109874.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein Rsc3269 or Rs02498 SWALL:Q8XUC2 (EMBL:AL646074) (226 aa) fasta scores: E(): 1.5e-62, 73.73% id in 198 aa
YP_109875.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator Pa3965 SWALL:Q9HX51 (EMBL:AE004814) (169 aa) fasta scores: E(): 4.7e-22, 45.16% id in 155 aa, and to Pseudomonas putida bkd operon transcriptional regulator BkdR SWALL:BKDR_PSEPU (SWALL:P42179) (161 aa) fasta scores: E(): 2.3e-19, 40.66% id in 150 aa
YP_109876.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein Rsc3077 or Rs00528 SWALL:Q8XUV6 (EMBL:AL646073) (392 aa) fasta scores: E(): 4e-59, 49.1% id in 389 aa, and to Methanosarcina mazei cobalt-zinc-cadmium resistance protein CzcD or Mm1778 SWALL:AAM31474 (EMBL:AE013414) (323 aa) fasta scores: E(): 7.6e-31, 38.9% id in 293 aa
YP_109877.1	Similar to Ralstonia solanacearum  HNS-like transcription regulator protein Rsp0335 or Rs00711 SWALL:Q8XSY2 (EMBL:AL646078) (96 aa) fasta scores: E(): 5.6e-14, 52.57% id in 97 aa, and to Rhodobacter sphaeroides SpB=leucine-zipper transcription factor/trans-acting light-dependent negative puf operon regulator Spb SWALL:P95680 (EMBL:S82916) (104 aa) fasta scores: E(): 0.00027, 35.64% id in 101 aa
YP_109878.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa4388 SWALL:Q9HW16 (EMBL:AE004854) (244 aa) fasta scores: E(): 1.4e-14, 34.45% id in 209 aa
YP_109879.1	Similar to many membrane proteins, e.g. Ralstonia solanacearum  transport transmembrane protein Rsc0585 or Rs04878 SWALL:Q8Y1V4 (EMBL:AL646060) (408 aa) fasta scores: E(): 4.8e-58, 48.85% id in 393 aa
YP_109880.1	Similar to Ralstonia solanacearum  amino acid-binding periplasmic ABC transporter protein Rsc2441 or Rs01353 SWALL:Q8XWN2 (EMBL:AL646070) (336 aa) fasta scores: E(): 7.2e-88, 74.1% id in 336 aa, and to Escherichia coli leucine-specific binding protein precursor LivK or b3458 SWALL:LIVK_ECOLI (SWALL:P04816) (369 aa) fasta scores: E(): 5.4e-31, 34.77% id in 348 aa
YP_109881.1	Similar to many members of a faimily including Xanthomonas campestris 2-nitropropane dioxygenase Xcc1197 SWALL:AAM40495 (EMBL:AE012219) (364 aa) fasta scores: E(): 1.7e-37, 42.73% id in 358 aa, and to Neurospora crassa 2-nitropropane dioxygenase precursor Ncd-2 SWALL:2NPD_NEUCR (SWALL:Q01284) (378 aa) fasta scores: E(): 8.5e-08, 26.87% id in 346 aa
YP_109882.1	Similar to Pseudomonas sp. CA10 dienelactone hydrolase SWALL:Q9AQN6 (EMBL:AB047548) (273 aa) fasta scores: E(): 5.3e-32, 45.16% id in 217 aa, and to Pseudomonas putida, and Pseudomonas sp. carboxymethylenebutenolidase ClcD SWALL:CLCD_PSEPU (SWALL:P11453) (236 aa) fasta scores: E(): 9.8e-23, 35.37% id in 229 aa
YP_109883.1	Similar to Flavobacterium sp. 6-aminohexanoate-cyclic-dimer hydrolase NylA SWALL:NYLA_FLASK (SWALL:P13397) (492 aa) fasta scores: E(): 1.8e-41, 36.27% id in 499 aa
YP_109884.1	Similar to Escherichia coli 5,10-methylenetetrahydrofolate reductase MetF or b3941 SWALL:METF_ECOLI (SWALL:P00394) (296 aa) fasta scores: E(): 1.3e-44, 45.98% id in 274 aa
YP_109885.1	Similar to Ralstonia solanacearum probable transmembrane protein Rsc0092 or Rs02279 SWALL:Q8Y388 (EMBL:AL646057) (113 aa) fasta scores: E(): 4.8e-21, 55.85% id in 111 aa
YP_109886.1	catalyzes the formation of L-homocysteine from S-adenosyl-L-homocysteine
YP_109887.1	sigma factors are initiation factors that promote the attachment of RNA polymerase to specific initiation sites and are then released; this sigma factor directs late flagellar biosynthesis genes
YP_109888.1	Similar to Vibrio parahaemolyticus flagellar biosynthesis protein FlhG SWALL:Q9LB16 (EMBL:AF069392) (295 aa) fasta scores: E(): 4.4e-09, 33.33% id in 267 aa
YP_109889.1	positive regulator of class III flagellar genes
YP_109890.1	membrane protein involved in the flagellar export apparatus
YP_109891.1	membrane protein responsible for substrate specificity switching from rod/hook-type export to filament-type export
YP_109892.1	Similar to Streptomyces coelicolor hypothetical protein SCO7282 or SC5H1.10c SWALL:Q9X7R8 (EMBL:AL049863) (160 aa) fasta scores: E(): 1e-31, 54.14% id in 157 aa
YP_109895.1	cytosolic phosphatase which functions in the chemotaxis signal transduction complex by controlling the level of phosphorylated CheY through dephosphorylation
YP_109896.1	Previously described as Burkholderia pseudomallei CheY SWALL:P94342 (EMBL:U78087) (131 aa) fasta scores: E(): 3.6e-47, 100% id in 131 aa. Similar to Escherichia coli chemotaxis protein CheY or b1882 or z2936 or ecs2592 SWALL:CHEY_ECOLI (SWALL:P06143) (128 aa) fasta scores: E(): 1e-34, 77.59% id in 125 aa
YP_109897.1	regulates chemotaxis by demethylation of methyl-accepting chemotaxis proteins
YP_109898.1	catalyzes the conversion of glutamine residues to glutamate on methyl-accepting chemotaxis receptors
YP_109899.1	Similar to Escherichia coli chemotaxis protein methyltransferase CheR or CheX or b1884 SWALL:CHER_ECOLI (SWALL:P07364) (286 aa) fasta scores: E(): 4.9e-60, 57.51% id in 266 aa
YP_109900.1	Similar to Escherichia coli methyl-accepting chemotaxis protein I Tsr or CheD or b4355 SWALL:MCP1_ECOLI (SWALL:P02942) (551 aa) fasta scores: E(): 9e-44, 42.88% id in 541 aa
YP_109901.1	Previously characterised as Burkholderia pseudomallei chemotaxis protein CheW SWALL:O05183 (EMBL:U92493) (175 aa) fasta scores: E(): 2.1e-66, 100% id in 175 aa, and to Escherichia coli chemotaxis protein CheW or b1887 or z2941 or ecs2597 SWALL:CHEW_ECOLI (SWALL:P07365) (167 aa) fasta scores: E(): 9.8e-39, 71.81% id in 149 aa
YP_109902.1	Similar to Escherichia coli chemotaxis protein CheA or b1888 SWALL:CHEA_ECOLI (SWALL:P07363) (654 aa) fasta scores: E(): 9.5e-76, 56.14% id in 741 aa
YP_109903.1	Similar to Rhizobium meliloti chemotaxis regulator CheY or R00638 or Smc03006 SWALL:Q52879 (EMBL:U13166) (121 aa) fasta scores: E(): 7.1e-15, 43.8% id in 121 aa
YP_109904.1	with MotA forms the ion channels that couple flagellar rotation to proton/sodium motive force across the membrane and forms the stator elements of the rotary flagellar machine
YP_109905.1	With MotB forms the ion channels that couple flagellar rotation to proton/sodium motive force across the membrane and forms the stator elements of the rotary flagellar machine
YP_109906.1	With FlhD is involved in the activation of class 2 flagellar genes and as well as a number of other genetic systems
YP_109907.1	with FlhC is involved in the activation of class 2 flagellar genes and is involved in the regulation of a number of other genetic systems
YP_109908.1	Similar to Synechococcus sp. UDP-glucose:tetrahydrobiopterin glucosyltransferase SWALL:Q93EY3 (EMBL:AF331846) (359 aa) fasta scores: E(): 1.6e-18, 31.61% id in 329 aa
YP_109909.1	Similar to Ralstonia solanacearum  HNS-like transcription regulator protein Rsp0335 or Rs00711 SWALL:Q8XSY2 (EMBL:AL646078) (96 aa) fasta scores: E(): 6.6e-15, 53.6% id in 97 aa, and to Escherichia coli Ler Lee-encoded regulator SWALL:Q9AJ33 (EMBL:AF200363) (129 aa) fasta scores: E(): 1.5e-05, 33.66% id in 101 aa, and to Bordetella pertussis Bph3 HNS protein SWALL:O07507 (EMBL:U82566) (123 aa) fasta scores: E(): 0.0053, 36.03% id in 111 aa
YP_109910.1	porin involved in osmoregulation allowing water to move into and out of the cell in response to osmotic pressure
YP_109911.1	Similar to Escherichia coli Cof protein or b0446 SWALL:COF_ECOLI (SWALL:P46891) (272 aa) fasta scores: E(): 8.2e-29, 37.16% id in 261 aa
YP_109912.1	Similar to Rhizobium loti hypothetical protein Mll7250 SWALL:Q986Q7 (EMBL:AP003011) (294 aa) fasta scores: E(): 9.8e-26, 40.13% id in 289 aa
YP_109913.1	Similar to Escherichia coli DNA-3-methyladenine glycosylase I Tag or b3549 SWALL:3MG1_ECOLI (SWALL:P05100) (187 aa) fasta scores: E(): 1.3e-32, 49.44% id in 180 aa, and to Ralstonia solanacearum probable DNA-3-methyladenine glycosylase I protein Tag or Rsp0666 or Rs01783 SWALL:Q8XS15 (EMBL:AL646080) (190 aa) fasta scores: E(): 8.3e-43, 64.97% id in 177 aa
YP_109914.1	a small basic protein that is one of the last in the subunit assembly; omission does not prevent assembly but the subunit is inactive; binds central domain of 16S rRNA
YP_109915.1	structural flagella protein; Vibrio contains multiple flagellin genes usually localized into two region on the chromosome, flaAC and flaCEDB in V. cholerae, flaFBA and flaCDE in V. parahemolyticus; FlaA is sigma 54 dependent and essential for motility in V.cholerae but not in V. parahaemolyticus
YP_109916.1	Similar to Escherichia coli flagellar hook-associated protein 2 FliD or FlbC or FlaV or b1924 SWALL:FLID_ECOLI (SWALL:P24216) (467 aa) fasta scores: E(): 1.1e-21, 34.67% id in 496 aa
YP_109918.1	Similar to Caulobacter crescentus TPR domain protein cc0119 SWALL:Q9ABV1 (EMBL:AE005686) (747 aa) fasta scores: E(): 2.3e-74, 35.09% id in 738 aa, and to Petunia hybrida spindly protein Spy involved in signal transduction SWALL:O82039 (EMBL:Y17720) (932 aa) fasta scores: E(): 4e-50, 28.86% id in 776 aa
YP_109919.1	Similar to Xanthomonas axonopodis nucleotide sugar transaminase VioA or Xac1966 SWALL:AAM36828 (EMBL:AE011831) (369 aa) fasta scores: E(): 7.3e-103, 71.03% id in 366 aa, and to Streptomyces antibioticus dehydratase OleNI SWALL:Q9RR26 (EMBL:AF055579) (393 aa) fasta scores: E(): 6.2e-41, 38.48% id in 369 aa
YP_109920.1	Similar to Streptomyces coelicolor 3-oxoacyl-[acyl-carrier-protein] synthase sco5888 or sc3f7.08 SWALL:O54151 (EMBL:AL021409) (335 aa) fasta scores: E(): 4.2e-29, 34.44% id in 331 aa, and to Cuphea wrightii 3-oxoacyl-[acyl-carrier-protein] synthase III A, chloroplast precursor Kas3A SWALL:FBH1_CUPWR (SWALL:P49244) (400 aa) fasta scores: E(): 3.2e-27, 31.59% id in 326 aa
YP_109921.1	Similar to Myxococcus xanthus acyl carrier protein AcpP SWALL:ACP_MYXXA (SWALL:P80921) (78 aa) fasta scores: E(): 0.27, 32.85% id in 70 aa
YP_109922.1	Similar to Streptomyces coelicolor 3-oxoacyl-[acyl-carrier-protein] synthase SCO5888 or SC3F7.08 SWALL:O54151 (EMBL:AL021409) (335 aa) fasta scores: E(): 2.5e-28, 36.2% id in 337 aa, and to Allium porrum 3-ketoacyl carrier protein synthase III SWALL:O04439 (EMBL:U30600) (402 aa) fasta scores: E(): 3.1e-23, 32.33% id in 334 aa
YP_109923.1	Similar to Xanthomonas axonopodis 3-oxoacyl-[ACP] reductase FabG or Xac1963 SWALL:AAM36825 (EMBL:AE011831) (254 aa) fasta scores: E(): 1.2e-26, 44.89% id in 245 aa, and to Azoarcus evansii  beta-hydroxyacyl-CoA dehydrogenase SWALL:Q93FC5 (EMBL:AF320253) (269 aa) fasta scores: E(): 1.3e-15, 36.65% id in 251 aa
YP_109924.1	Similar to Caulobacter crescentus acetyltransferase LpsB or cc1011 SWALL:O85353 (EMBL:AF062345) (215 aa) fasta scores: E(): 2.4e-15, 34.28% id in 210 aa, and to Escherichia coli WbdR or WbhH or z3192 or ecs2831 SWALL:O85344 (EMBL:AF061251) (221 aa) fasta scores: E(): 1.4e-09, 27.35% id in 212 aa
YP_109925.1	Similar to Caulobacter crescentus rieske 2Fe-2S family protein cc3122 SWALL:Q9A3T0 (EMBL:AE005975) (404 aa) fasta scores: E(): 1.9e-11, 25.7% id in 354 aa
YP_109928.1	Similar to Ralstonia solanacearum  Rsc0231 or Rs00662 SWALL:Q8Y2V1 (EMBL:AL646058) (211 aa) fasta scores: E(): 8e-54, 74.51% id in 208 aa, and to Escherichia coli homoserine/homoserine lactone efflux protein RhtB or b3824 or z5345 or ecs4754 SWALL:RHTB_ECOLI (SWALL:P27847) (206 aa) fasta scores: E(): 2.7e-13, 31.68% id in 202 aa
YP_109929.1	Previously described as Burkholderia pseudomallei acid phosphatase AcpA SWALL:Q9L5C5 (EMBL:AF252862) (577 aa) fasta scores: E(): 0, 99.48% id in 577 aa
YP_109930.1	Similar to Ralstonia solanacearum probable lipoprotein Rsp0675 or Rs01774 SWALL:Q8XS06 (EMBL:AL646080) (223 aa) fasta scores: E(): 6.9e-51, 63.72% id in 215 aa
YP_109931.1	Similar to Ralstonia solanacearum probable lipoprotein Rsp0674 or Rs01775 SWALL:Q8XS07 (EMBL:AL646080) (125 aa) fasta scores: E(): 4.4e-17, 52.94% id in 119 aa
YP_109932.1	Similar to Ralstonia solanacearum probable lipoprotein Rsp0673 or Rs01776 SWALL:Q8XS08 (EMBL:AL646080) (227 aa) fasta scores: E(): 4.3e-52, 68.32% id in 221 aa
YP_109933.1	Similar to Xanthomonas campestris beta-ketoadipate enol-lactone hydrolase PcaD or Xcc1864 SWALL:AAM41153 (EMBL:AE012288) (271 aa) fasta scores: E(): 4.5e-60, 57.09% id in 268 aa, and to Pseudomonas sp. 3-oxoadipate enol-lactone hydrolase CatD SWALL:Q8VPF0 (EMBL:AY044272) (262 aa) fasta scores: E(): 2.7e-13, 31.5% id in 273 aa
YP_109934.1	Similar to Yersinia pestis  methyl-accepting chemotaxis protein Tsr2 or ypo1229 SWALL:Q8ZGQ7 (EMBL:AJ414147) (595 aa) fasta scores: E(): 2e-125, 64.33% id in 600 aa, and to Escherichia coli methyl-accepting chemotaxis protein I Tsr or CheD or b4355 SWALL:MCP1_ECOLI (SWALL:P02942) (551 aa) fasta scores: E(): 6.1e-49, 49.18% id in 368 aa
YP_109935.1	Similar to Yersinia pestis  oxidoreductase Ypo0308 SWALL:Q8ZJ22 (EMBL:AJ414142) (685 aa) fasta scores: E(): 8e-110, 54.69% id in 554 aa, and to Chondrus crispus hexose oxidase SWALL:P93762 (EMBL:U89770) (546 aa) fasta scores: E(): 7e-32, 34.74% id in 567 aa
YP_109936.1	Similar to Serratia marcescens Cbp21 chitin-binding protein SWALL:O83009 (EMBL:AB015998) (197 aa) fasta scores: E(): 0.00011, 35.17% id in 199 aa
YP_109938.1	Similar to Salmonella typhimurium IbfA protein SWALL:BAB91598 (EMBL:AP005147) (518 aa) fasta scores: E(): 1.1e-14, 25.86% id in 491 aa, and to Bacteriophage lambda EA59 protein SWALL:VE59_LAMBD (SWALL:P03754) (525 aa) fasta scores: E(): 0.67, 24.57% id in 293 aa
YP_109939.1	Similar to Yersinia pestis  phage protein Ypo2321 SWALL:Q8ZE62 (EMBL:AJ414152) (104 aa) fasta scores: E(): 1.3e-11, 41.48% id in 94 aa, and to Bacteriophage N15 Gp49 protein SWALL:O64357 (EMBL:AF064539) (103 aa) fasta scores: E(): 6.5e-11, 44.82% id in 87 aa
YP_109940.1	Similar to Bacteriophage D3 integrase orf35 SWALL:Q9T1P3 (EMBL:AF165214) (369 aa) fasta scores: E(): 2.9e-44, 44.8% id in 279 aa, and to Escherichia coli prophage Dlp12 integrase IntD or Int or b0537 SWALL:INTD_ECOLI (SWALL:P24218) (387 aa) fasta scores: E(): 3.3e-18, 36.64% id in 191 aa
YP_109941.1	Weakly similar to Brevibacillus borstelensis cryptic plasmid pHT926 Rep protein SWALL:Q52178 (EMBL:D43692) (281 aa) fasta scores: E(): 0.032, 26.04% id in 192 aa
YP_109942.1	No significant database matches. Possible coiled-coil region at residues 41-58.
YP_109943.1	Similar to Yersinia pestis  phage-related secreted protein Ypo2280 SWALL:Q8ZEA2 (EMBL:AJ414151) (414 aa) fasta scores: E(): 4.5e-26, 32.17% id in 401 aa, and to Bacteriophage M13 IV protein SWALL:VG4_BPM13 (SWALL:P03665) (426 aa) fasta scores: E(): 1.1e-08, 23.81% id in 252 aa
YP_109944.1	Similar to Bacteriophage Pf3 32.7 kDa protein SWALL:VG30_BPPF3 (SWALL:P03626) (301 aa) fasta scores: E(): 9.6e-18, 34.63% id in 257 aa
YP_109945.1	No significant database matches. Contains 14 x NPTG repeat at residues 413-468.
YP_109947.1	Similar to Xylella fastidiosa hypothetical protein Xf1878 SWALL:Q9PCA3 (EMBL:AE004008) (73 aa) fasta scores: E(): 0.25, 32.25% id in 62 aa, and to Bacteriophage Pf3 major coat protein SWALL:COAT_BPPF3 (SWALL:P03623) (44 aa) fasta scores: E(): 5.9, 32.43% id in 37 aa
YP_109949.1	Similar to Ralstonia solanacearum probable transmembrane protein Rsc3084 or Rs00536 SWALL:Q8XUU9 (EMBL:AL646073) (294 aa) fasta scores: E(): 7.1e-50, 57.75% id in 303 aa, and to Neisseria meningitidis cytochrome NMA1936 SWALL:Q9JT84 (EMBL:AL162757) (279 aa) fasta scores: E(): 5.8e-09, 36.67% id in 289 aa, and to Chlorobium limicola f.sp. thiosulfatophilum cytochrome c-555 SWALL:C555_CHLLT (SWALL:P00123) (86 aa) fasta scores: E(): 6.3e-06, 45.23% id in 84 aa
YP_109950.1	Similar to Escherichia coli ATP-dependent DNA helicase Rep or b3778 SWALL:REP_ECOLI (SWALL:P09980) (673 aa) fasta scores: E(): 1.6e-75, 47.07% id in 701 aa
YP_109951.1	Similar to Streptomyces coelicolor  membrane protein SCO0619 or SCF56.03 SWALL:Q9RD63 (EMBL:AL133424) (247 aa) fasta scores: E(): 0.092, 32.53% id in 249 aa
YP_109952.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa3750 SWALL:Q9HXP4 (EMBL:AE004794) (249 aa) fasta scores: E(): 3.9e-18, 40.08% id in 227 aa
YP_109953.1	Similar to many predicted oxidoreductases eg. Yersinia pestis  oxidoreductase Ypo2259 SWALL:Q8ZEC1 (EMBL:AJ414151) (349 aa) fasta scores: E(): 5.5e-54, 43.93% id in 346 aa
YP_109954.1	Similar to Ralstonia solanacearum probable lipoprotein Rsc1586 or Rs03948 SWALL:Q8XZ20 (EMBL:AL646065) (118 aa) fasta scores: E(): 5e-14, 52.54% id in 118 aa
YP_109955.1	catalyzes the transfer of a methylene carbon from the methylamine-loaded GcvH protein to tetrahydrofolate, causing the release of ammonia and the generation of reduced GcvH protein
YP_109956.1	Similar to Escherichia coli glycine cleavage system H protein GcvH or b2904 or z4241 or ecs3775 or sty3210 SWALL:GCSH_ECOLI (SWALL:P23884) (128 aa) fasta scores: E(): 7.9e-26, 60.8% id in 125 aa
YP_109957.1	decarboxylating; acts in conjunction with GvcH to form H-protein-S-aminomethyldihydrolipoyllysine from glycine
YP_109958.1	No significant database similarities
YP_109959.1	Similar to Escherichia coli L-serine dehydratase 1 SdaA or b1814 SWALL:SDHL_ECOLI (SWALL:P16095) (454 aa) fasta scores: E(): 1.7e-86, 52.7% id in 463 aa
YP_109960.1	Weakly similar to Neisseria gonorrhoeae hypothetical 33.4 kDa protein SWALL:Q93NE6 (EMBL:AF374415) (289 aa) fasta scores: E(): 3.4e-07, 31% id in 229 aa
YP_109961.1	catalyzes the formation of 2-acetolactate from pyruvate, leucine sensitive; also known as acetolactate synthase large subunit
YP_109962.1	No significant database similarities
YP_109963.1	Similar to Salmonella typhimurium ethanolamine operon regulatory protein EutR or Stm2454 SWALL:EUTR_SALTY (SWALL:Q9ZFU7) (350 aa) fasta scores: E(): 4.5e-37, 41.08% id in 314 aa
YP_109964.1	Similar to Alcaligenes eutrophus acetaldehyde dehydrogenase II AcoD SWALL:DHA2_ALCEU (SWALL:P46368) (506 aa) fasta scores: E(): 5.2e-172, 81.02% id in 506 aa
YP_109965.1	No significant database similarities
YP_109966.1	catalyzes the formation of acetaldehyde from ethanolamine
YP_109967.1	Similar to Salmonella typhimurium ethanolamine ammonia-lyase heavy chain EutB or Stm2458 SWALL:EUTB_SALTY (SWALL:P19264) (453 aa) fasta scores: E(): 3.2e-85, 52.24% id in 446 aa
YP_109968.1	Lies upstream of a CDS for ethanolamine utilisation. Similar to Xanthomonas campestris ethanolamin permease EutP or Xcc2259 SWALL:AAM41538 (EMBL:AE012333) (454 aa) fasta scores: E(): 3.4e-119, 72.66% id in 428 aa, and to Rhodococcus erythropolis ethanolamine permease EutP SWALL:Q53148 (EMBL:L24492) (488 aa) fasta scores: E(): 1.6e-38, 35.46% id in 454 aa
YP_109969.1	Similar to Rhizobium loti hypothetical protein Mll4680 SWALL:Q98DJ2 (EMBL:AP003004) (576 aa) fasta scores: E(): 1.4e-06, 28.52% id in 305 aa
YP_109970.1	Doubtful CDS. No significant database similarities
YP_109971.1	Similar to Ralstonia solanacearum probable transmembrane protein Rsp1274 or Rs05319 SWALL:Q8XQF3 (EMBL:AL646083) (487 aa) fasta scores: E(): 1e-150, 84.88% id in 483 aa
YP_109972.1	Similar to Pseudomonas putida CadA SWALL:Q93TP6 (EMBL:AF333961) (737 aa) fasta scores: E(): 4e-100, 65.9% id in 745 aa, and to Ralstonia metallidurans Pb-efflux ATPase PbrA SWALL:Q9AKR5 (EMBL:AJ278984) (798 aa) fasta scores: E(): 1.1e-93, 66.94% id in 714 aa, and to Staphylococcus aureus probable cadmium-transporting ATPase CadA SWALL:CADD_STAAU (SWALL:P37386) (804 aa) fasta scores: E(): 2.8e-88, 40.3% id in 722 aa. CDS is extended at the N-terminus in comparison to orthologues
YP_109973.1	Similar to Escherichia coli, and Escherichia coli O157:H7 Zn(ii)-responsive regulator of zntA ZntR SWALL:ZNTR_ECOLI (SWALL:P36676) (141 aa) fasta scores: E(): 3.8e-13, 39.06% id in 128 aa, and to Pseudomonas putida MerR family response regulator of cadmium resistance CadR SWALL:Q93TP7 (EMBL:AF333961) (147 aa) fasta scores: E(): 3e-28, 58.33% id in 144 aa
YP_109974.1	Similar to Rhizobium leguminosarum hypothetical 12.6 kDa protein SWALL:Q9XAT0 (EMBL:AJ243305) (106 aa) fasta scores: E(): 3.1e-18, 58.82% id in 102 aa, and to Streptomyces argillaceus mithramycin resistance determinant, ATP-binding protein SWALL:Q53625 (EMBL:U43537) (219 aa) fasta scores: E(): 8.8e-18, 36.81% id in 201 aa
YP_109975.1	Similar to Salmonella typhimurium lysine-arginine-ornithine-binding periplasmic protein precursor ArgT or stm2355 SWALL:ARGT_SALTY (SWALL:P02911) (260 aa) fasta scores: E(): 2.2e-40, 46.36% id in 261 aa
YP_109976.1	catalyzes the transfer of an amino moiety
YP_109977.1	Similar to many eg. Rhizobium meliloti regulatory protein BetI or R00950 or Smc00095 SWALL:BETI_RHIME (SWALL:O69786) (203 aa) fasta scores: E(): 0.012, 29.32% id in 208 aa
YP_109978.1	Similar to Burkholderia pseudomallei  acyl-CoA dehydrogenase AidB SWALL:Q9ANZ8 (EMBL:AF317886) (554 aa) fasta scores: E(): 5.7e-123, 60.94% id in 553 aa, and to Escherichia coli AidB or b4187 SWALL:AIDB_ECOLI (SWALL:P33224) (541 aa) fasta scores: E(): 2.7e-82, 46.48% id in 512 aa
YP_109979.1	Similar to Rhizobium leguminosarum malonyl CoA synthetase MatB SWALL:Q9ZIP5 (EMBL:AF117694) (504 aa) fasta scores: E(): 2e-34, 33.46% id in 505 aa
YP_109980.1	Similar to Ralstonia solanacearum  amino-acid transport signal peptide protein Rsc3300 or Rs02529 SWALL:Q8XU93 (EMBL:AL646074) (377 aa) fasta scores: E(): 2.9e-92, 71.11% id in 367 aa, and to Pseudomonas aeruginosa leucine-, isoleucine-, valine-, threonine-, and alanine-binding protein precursor BraC or Pa1074 SWALL:BRAC_PSEAE (SWALL:P21175) (373 aa) fasta scores: E(): 3.2e-32, 34.85% id in 373 aa
YP_109981.1	proline utilization protein A; multifunctional protein that functions in proline catabolism in the first two enzymatic steps resulting in the conversion of proline to glutamate; in Escherichai coli this protein also self-regulates transcription via a DNA-binding domain at the N-terminus; forms dimers and is a peripherally membrane-associated protein
YP_109982.1	Possible gene remnant. Similar to an internal region of Rhizobium meliloti  ABC transporter permease SMA0081 SWALL:Q931A4 (EMBL:AE007198) (218 aa) fasta scores: E(): 8.4, 34.69% id in 49 aa
YP_109983.1	binding of PriA to forked DNA starts the assembly of the primosome, also possesses 3'-5' helicase activity
YP_109984.1	catalyzes the formation of coproporphyrinogen from uroporphyrinogen III
YP_109985.1	Similar to Pseudomonas aeruginosa cyclohexadienyl dehydratase precursor [includes: prephenate dehydratase (EC 4.2.1.51); arogenate dehydratase (EC 4.-.-.-)] PheC or Pa3475 SWALL:PHEC_PSEAE (SWALL:Q01269) (268 aa) fasta scores: E(): 3.4e-53, 54.33% id in 254 aa
YP_109986.1	Similar to many hypotheticals though shorter in the N-terminus. Similar to Ralstonia solanacearum hypothetical protein Rsc3313 or Rs02543 SWALL:Q8XU80 (EMBL:AL646074) (153 aa) fasta scores: E(): 3.7e-14, 52.47% id in 101 aa, and to Escherichia coli protein YccU or b0965 SWALL:YCCU_ECOLI (SWALL:P75874) (137 aa) fasta scores: E(): 1.8e-11, 46.8% id in 94 aa. Possible gene remnant
YP_109987.1	activates fatty acids by binding to coenzyme A
YP_109988.1	part of catalytic core of ATP synthase; alpha(3)beta(3)gamma(1)delta(1)epsilon(1); involved in producing ATP from ADP in the presence of the proton motive force across the membrane
YP_109989.1	Produces ATP from ADP in the presence of a proton gradient across the membrane. The beta chain is a regulatory subunit
YP_109990.1	Produces ATP from ADP in the presence of a proton gradient across the membrane. The gamma chain is a regulatory subunit
YP_109991.1	produces ATP from ADP in the presence of a proton gradient across the membrane; the alpha chain is a catalytic subunit
YP_109992.1	Produces ATP from ADP in the presence of a proton gradient across the membrane; the delta subunit is part of the catalytic core of the ATP synthase complex
YP_109993.1	Produces ATP from ADP in the presence of a proton gradient across the membrane. Subunit B is part of the membrane proton channel.
YP_109994.1	Produces ATP from ADP in the presence of a proton gradient across the membrane. Subunit C is part of the membrane proton channel F0
YP_109995.1	Produces ATP from ADP in the presence of a proton gradient across the membrane. Subunit A is part of the membrane proton channel F0
YP_109996.1	Note possible downstream alternative start codons. Full length similarity to Ralstonia solanacearum hypothetical transmembrane protein Rsc3324 or Rs02554 SWALL:Q8XU69 (EMBL:AL646074) (190 aa) fasta scores: E(): 5.1e-17, 39.34% id in 183 aa. N-terminally truncated version similar to Pseudomonas aeruginosa ATP synthase I AtpI or Pa5561 SWALL:Q9HT13 (EMBL:AE004967) (126 aa) fasta scores: E(): 3.9e-06, 36.2% id in 116 aa.
YP_109997.1	Similar to Ralstonia solanacearum probable transmembrane protein Rsp0802 or Rs01905 SWALL:Q8XRM9 (EMBL:AL646080) (408 aa) fasta scores: E(): 5.6e-56, 45.69% id in 372 aa
YP_109998.1	Similar to Ralstonia solanacearum  chromosome partitioning protein ParB or Rsc3325 or Rs02555 SWALL:Q8XU68 (EMBL:AL646074) (303 aa) fasta scores: E(): 2.3e-72, 73.12% id in 294 aa, and to Caulobacter crescentus chromosome partitioning protein ParB or Cc3752 SWALL:PARB_CAUCR (SWALL:O05190) (294 aa) fasta scores: E(): 3.8e-32, 42.42% id in 297 aa
YP_109999.1	Similar to Ralstonia solanacearum  chromosome partitioning protein ParA or rsc3326 or Rs02560 SWALL:Q8XU67 (EMBL:AL646074) (261 aa) fasta scores: E(): 3.2e-75, 79.29% id in 256 aa, and to Caulobacter crescentus chromosome partitioning protein ParA or Cc3753 SWALL:PARA_CAUCR (SWALL:O05189) (267 aa) fasta scores: E(): 1.8e-43, 49.21% id in 254 aa
YP_110000.1	glucose-inhibited division protein B; SAM-dependent methyltransferase; methylates the N7 position of guanosine in position 527 of 16S rRNA
YP_110001.1	GidA; glucose-inhibited cell division protein A; involved in the 5-carboxymethylaminomethyl modification (mnm(5)s(2)U) of the wobble uridine base in some tRNAs
YP_110002.1	Similar to Ralstonia solanacearum probable amino-acid composite ATP-binding transmembrane ABC transporter protein Rsp0707 or Rs01742 SWALL:Q8XRX4 (EMBL:AL646080) (247 aa) fasta scores: E(): 3.2e-59, 78.6% id in 243 aa, and to Pseudomonas aeruginosa high-affinity branched-chain amino acid transport ATP-binding protein BraG or Pa1070 SWALL:BRAG_PSEAE (SWALL:P21630) (233 aa) fasta scores: E(): 4.4e-31, 47.05% id in 238 aa
YP_110003.1	Similar to Ralstonia solanacearum probable amino-acid composite ATP-binding transmembrane ABC transporter protein Rsp0706 or Rs01743 SWALL:Q8XRX5 (EMBL:AL646080) (608 aa) fasta scores: E(): 2.1e-134, 73.89% id in 586 aa
YP_110004.1	Similar to Ralstonia solanacearum probable amino-acid transmembrane ABC transporter protein rsp0705 or rs01744 SWALL:Q8XRX6 (EMBL:AL646080) (350 aa) fasta scores: E(): 9.9e-85, 68.57% id in 350 aa
YP_110005.1	Similar to predicted amino-acid-binding periplasmic proteins eg. Ralstonia solanacearum probable amino-acid-binding periplasmic Rsc3329 or Rs02563 SWALL:Q8XU64 (EMBL:AL646074) (382 aa) fasta scores: E(): 3.5e-93, 67.62% id in 383 aa
YP_110006.1	Weakly similar to Ralstonia solanacearum probable amino-acid-binding periplasmic Rsc3329 or Rs02563 SWALL:Q8XU64 (EMBL:AL646074) (382 aa) fasta scores: E(): 1.4e-06, 27.41% id in 372 aa. Lies within a  amino acid transport operon but does not show any other evidence of association with transport
YP_110007.1	Similar to Ralstonia solanacearum probable transmembrane ABC transporter protein Rsc3340 or Rs02575 SWALL:Q8XU53 (EMBL:AL646074) (328 aa) fasta scores: E(): 1.5e-83, 71.6% id in 317 aa
YP_110008.1	Similar to many eg. Ralstonia solanacearum probable transmembrane ABC transporter protein Rsc3341 or Rs02576 SWALL:Q8XU52 (EMBL:AL646074) (313 aa) fasta scores: E(): 5e-89, 82.99% id in 294 aa
YP_110009.1	Similar to Ralstonia solanacearum substrate-binding periplasmic rsc3342 or rs02578 SWALL:Q8XU51 (EMBL:AL646074) (402 aa) fasta scores: E(): 8.7e-112, 72.56% id in 401 aa, and to Azoarcus evansii substrate binding protein SWALL:Q93FB9 (EMBL:AF320253) (391 aa) fasta scores: E(): 1.8e-19, 28.69% id in 359 aa
YP_110010.1	Similar to Rhizobium meliloti  ATP-binding ABC transporter protein R02974 or Smc03119 SWALL:Q92LQ6 (EMBL:AL591792) (233 aa) fasta scores: E(): 1.4e-49, 60.94% id in 233 aa, and to Pseudomonas aeruginosa high-affinity branched-chain amino acid transport ATP-binding protein BraG or Pa1070 SWALL:BRAG_PSEAE (SWALL:P21630) (233 aa) fasta scores: E(): 9.6e-26, 42.35% id in 229 aa
YP_110011.1	Similar to Ralstonia solanacearum probable amino acid ATP-binding ABC transporter protein Rsc2438 or Rs02664 SWALL:Q8XWN5 (EMBL:AL646070) (257 aa) fasta scores: E(): 1e-25, 37.3% id in 252 aa, and to Salmonella typhimurium high-affinity branched-chain amino acid transport ATP-binding protein LivG or stm3561 or Sty4251 SWALL:LIVG_SALTY (SWALL:P30293) (255 aa) fasta scores: E(): 1.9e-24, 39.23% id in 260 aa
YP_110012.1	Similar to Ralstonia solanacearum  choline dehydrogenase lipoprotein oxidoreductase beta or Rsc3345 or Rs02583 SWALL:Q8XU48 (EMBL:AL646074) (544 aa) fasta scores: E(): 1e-158, 72.81% id in 548 aa, and to Escherichia coli choline dehydrogenase beta or b0311 SWALL:BETA_ECOLI (SWALL:P17444) (556 aa) fasta scores: E(): 1.9e-69, 39.59% id in 538 aa
YP_110013.1	Similar to Streptomyces coelicolor methylmalonic acid semialdehyde dehydrogenase MsdA SWALL:Q53935 (EMBL:L48550) (500 aa) fasta scores: E(): 5.7e-112, 60.28% id in 491 aa
YP_110014.1	Similar to Ralstonia solanacearum probable transcription regulator protein Rsp1450 or Rs03093 SWALL:Q8XQ36 (EMBL:AL646084) (297 aa) fasta scores: E(): 1.6e-35, 41.75% id in 297 aa, and to Escherichia coli xanthosine operon regulatory protein XapR or PndR or b2405 SWALL:XAPR_ECOLI (SWALL:P23841) (294 aa) fasta scores: E(): 1e-16, 29.69% id in 293 aa
YP_110015.1	Similar to Ralstonia solanacearum hypothetical protein Rsc1389 or Rs04672 SWALL:Q8XZK6 (EMBL:AL646064) (172 aa) fasta scores: E(): 3.3e-24, 48.23% id in 170 aa
YP_110016.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator Pa3965 SWALL:Q9HX51 (EMBL:AE004814) (169 aa) fasta scores: E(): 5.8e-18, 41.5% id in 159 aa, and to Klebsiella pneumoniae leucine-responsive regulatory protein Lrp SWALL:LRP_KLEPN (SWALL:P37424) (163 aa) fasta scores: E(): 1.8e-15, 35.57% id in 149 aa
YP_110017.1	phenylalanine 4-hydroxylase; phenylalanine 4-hydroxylase; catalyzes the formation of 4a-hydroxytetrahydrobiopterin and tyrosine from phenylalanine and tetrahydrobiopterin
YP_110018.1	4-alpha-hydroxytetrahydrobiopterin dehydratase activity; catalyzes the formation of (6R)-6-(L-erythro-1,2-dihydroxypropyl)-7, 8-dihydro-6H-pterin from (6R)-6-(L-erythro-1,2-dihydroxypropyl)-5,6,7, 8-tetrahydro-4a-hydroxypterin; functions in recycling tetrahydrobiopterin (BH4) in phenylalanine hydroxylase reaction
YP_110019.1	Similar to Rhizobium loti two-component response regulator Mll7953 SWALL:Q984L3 (EMBL:AP003013) (223 aa) fasta scores: E(): 3.7e-35, 50.66% id in 227 aa, and to Salmonella typhimurium transcriptional regulatory protein TctD or Stm2785 SWALL:TCTD_SALTY (SWALL:P22104) (224 aa) fasta scores: E(): 1.1e-29, 42.34% id in 222 aa
YP_110020.1	Similar to Xanthomonas axonopodis two-component system sensor protein TctC or xac3482 SWALL:AAM38325 (EMBL:AE011996) (461 aa) fasta scores: E(): 3.6e-26, 32.27% id in 474 aa, and to Escherichia coli O157:H7 sensor protein QseC or z4378 or ecs3908/ecs3909 SWALL:QSEC_ECO57 (SWALL:Q8X524) (449 aa) fasta scores: E(): 4e-18, 29.95% id in 464 aa
YP_110021.1	Similar to Ralstonia solanacearum hypothetical protein Rsc3358 or Rs02633 SWALL:Q8XU36 (EMBL:AL646074) (179 aa) fasta scores: E(): 1.9e-43, 70.19% id in 151 aa
YP_110022.1	Similar to ful length Ralstonia solanacearum NADH-dependent flavin oxidoreductase Rsc0702 or Rs01607 SWALL:Q8Y1I8 (EMBL:AL646060) (370 aa) fasta scores: E(): 1e-93, 63.78% id in 370 aa, and to C-terminal portion of Azoarcus evansii 2-amninobenzoyl-CoA monooxygenase/reductase SWALL:Q93FB8 (EMBL:AF320254) (773 aa) fasta scores: E(): 6.5e-55, 44.38% id in 356 aa
YP_110023.1	Catalyzes the transfer of the ammonia group from glutamine to a new carbon-nitrogen group
YP_110024.1	Similar to many predicted regulators eg. Pseudomonas aeruginosa probable transcriptional regulator pa0942 SWALL:Q9I516 (EMBL:AE004528) (186 aa) fasta scores: E(): 9.7e-08, 31.86% id in 182 aa
YP_110026.1	Similar to Ralstonia solanacearum probable integrase/recombinase rsp1102 or rs02608 SWALL:Q8XQW6 (EMBL:AL646082) (323 aa) fasta scores: E(): 4.8e-34, 37.89% id in 314 aa, and to parts of Rhizobium loti integrase/recombinase mll6042 and mll5956 SWALL:Q981F2 (EMBL:AP003008) (332 aa) fasta scores: E(): 3e-06, 29.65% id in 172 aa
YP_110028.1	Similar to Ralstonia solanacearum  transcription regulator protein rsp0962 or rs02293 SWALL:Q8XR97 (EMBL:AL646082) (182 aa) fasta scores: E(): 3.2e-31, 53.33% id in 180 aa, and to Streptomyces coelicolor transcriptional regulatory protein sco1312 or scbac36f5.23C SWALL:Q93IV8 (EMBL:AL592292) (201 aa) fasta scores: E(): 2.2e-11, 30.11% id in 176 aa. Note: This CDS is longer in its N-terminal region than most of its database matches
YP_110029.1	catalyzes the formation of 2-amino-3-oxobutanoate from acetyl-CoA and glycine
YP_110030.1	converts threonine and NAD to 1,2-amino-3-oxobutanoate and NADH; functions in threonine catabolism
YP_110031.1	Similar to Caulobacter crescentus hypothetical protein cc3392 SWALL:Q9A314 (EMBL:AE005999) (213 aa) fasta scores: E(): 9.6e-20, 36.76% id in 204 aa, and to Xylella fastidiosa hypothetical protein xf1840 SWALL:Q9PCE1 (EMBL:AE004005) (237 aa) fasta scores: E(): 3e-19, 33.99% id in 203 aa
YP_110032.1	Similar to Anabaena sp. transcriptional regulator all7523 SWALL:Q8ZSI7 (EMBL:AP003602) (190 aa) fasta scores: E(): 1.8e-19, 35.26% id in 190 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa3034 SWALL:Q9HZH4 (EMBL:AE004728) (185 aa) fasta scores: E(): 5.7e-19, 41.53% id in 183 aa
YP_110033.1	Similar to Agrobacterium tumefaciens hypothetical protein atu5387 or agr_pat_559 SWALL:Q8UJT8 (EMBL:AE008960) (154 aa) fasta scores: E(): 9.4e-52, 76.31% id in 152 aa, and to Pseudomonas aeruginosa hypothetical protein pa5395 SWALL:Q9HTG9 (EMBL:AE004952) (156 aa) fasta scores: E(): 6.3e-51, 74.19% id in 155 aa
YP_110035.1	Similar to Escherichia coli probable tartrate dehydrogenase YeaU or b1800 SWALL:TTUC_ECOLI (SWALL:P76251) (361 aa) fasta scores: E(): 2.2e-106, 70.95% id in 358 aa, and to Ralstonia solanacearum probable tartrate dehydrogenase oxidoreductase TtuC or rsp1612 or rs02169 SWALL:Q8XPM6 (EMBL:AL646086) (361 aa) fasta scores: E(): 5.3e-113, 75% id in 360 aa
YP_110036.1	Similar to Escherichia coli hypothetical transcriptional regulator YeaT or b1799 SWALL:YEAT_ECOLI (SWALL:P76250) (307 aa) fasta scores: E(): 3.4e-70, 60.13% id in 296 aa, and to Yersinia pestis llysr-family transcriptional regulatory protein ypo2497 SWALL:Q8ZDQ9 (EMBL:AJ414152) (313 aa) fasta scores: E(): 3.7e-67, 56.31% id in 309 aa
YP_110037.1	Similar to Methanosarcina acetivorans hypothetical protein ma2467 SWALL:Q8TN26 (EMBL:AE010940) (237 aa) fasta scores: E(): 2.4e-28, 35.37% id in 229 aa, and to Rhizobium loti hypothetical protein mll0909 SWALL:Q98LR8 (EMBL:AP002996) (244 aa) fasta scores: E(): 9.6e-21, 31.6% id in 212 aa
YP_110038.1	Similar to Escherichia coli, and Escherichia coli O6 hypothetical GST-like protein YliJ or b0838 or c0923 SWALL:YLIJ_ECOLI (SWALL:P75805) (208 aa) fasta scores: E(): 8.4e-22, 38.38% id in 198 aa, and to Xanthomonas axonopodis glutathione S-transferase xac4352 SWALL:AAM39182 (EMBL:AE012089) (206 aa) fasta scores: E(): 4.8e-42, 57.07% id in 198 aa
YP_110040.1	Similar to Ralstonia solanacearum  transmembrane protein rsp1060 or rs02397 SWALL:Q8XR08 (EMBL:AL646082) (377 aa) fasta scores: E(): 2.7e-87, 62.29% id in 366 aa, and to Rhizobium loti hypothetical protein mlr2398 SWALL:Q98IH7 (EMBL:AP002999) (390 aa) fasta scores: E(): 3.1e-65, 49.2% id in 378 aa
YP_110041.1	catalyzes the formation of acetoacetate from 3-hydroxybutyrate
YP_110042.1	converts acetoacetate to acetone and carbon dioxide
YP_110043.1	Similar to Escherichia coli hypothetical protein YbjG or b0841 SWALL:YBJG_ECOLI (SWALL:P75806) (198 aa) fasta scores: E(): 2.2e-18, 35.71% id in 196 aa, and to Ralstonia solanacearum  transport transmembrane protein rsc3142 or rs00461 SWALL:Q8XUP4 (EMBL:AL646073) (199 aa) fasta scores: E(): 2.3e-20, 38.29% id in 188 aa
YP_110045.1	Similar to Stigmatella aurantiaca iron utilization protein MxcB SWALL:Q9F641 (EMBL:AF299336) (270 aa) fasta scores: E(): 1.4e-50, 50.18% id in 271 aa, and to Vibrio cholerae vibriobactin utilization protein ViuB or vc2210 SWALL:VIUB_VIBCH (SWALL:Q56646) (271 aa) fasta scores: E(): 5.4e-20, 33.85% id in 257 aa
YP_110046.1	Similar to Ralstonia solanacearum hypothetical protein rsp0258 or rs03708 SWALL:Q8XT57 (EMBL:AL646077) (218 aa) fasta scores: E(): 1.8e-24, 46.39% id in 222 aa
YP_110047.1	Similar to Polyangium cellulosum cytochrome-P450-monooxygenase SpiL SWALL:CAD43453 (EMBL:AJ505006) (456 aa) fasta scores: E(): 1.1e-16, 25.6% id in 457 aa, and to Mycobacterium tuberculosis cytochrome P450 137 Cyp137 or rv3685c or mt3787 or mtv025.033C SWALL:C137_MYCTU (SWALL:O69653) (476 aa) fasta scores: E(): 1.8e-16, 25.27% id in 451 aa
YP_110049.1	Weakly similar to Pseudomonas aeruginosa hypothetical protein pa3283 SWALL:Q9HYW0 (EMBL:AE004750) (284 aa) fasta scores: E(): 4.9e-12, 33.33% id in 258 aa, and to Rhizobium meliloti hypothetical protein rb0508 or smb20529 SWALL:Q92W37 (EMBL:AL603643) (309 aa) fasta scores: E(): 5.6e-08, 24.68% id in 239 aa
YP_110051.1	N-terminus is similar to the N-terminal region of Pyrococcus horikoshii hypothetical methyltransferase ph0819 SWALL:Y819_PYRHO (SWALL:O58549) (459 aa) fasta scores: E(): 3.2e-28, 30.07% id in 399 aa, and to the full length Methanopyrus kandleri predicted Fe-S oxidoreductase mk0992 SWALL:Q8TWP0 (EMBL:AE010388) (483 aa) fasta scores: E(): 2.5e-25, 26.53% id in 505 aa
YP_110052.1	Low similarity to Streptomyces lincolnensis LmbW protein SWALL:Q54376 (EMBL:X79146) (318 aa) fasta scores: E(): 7.2e-08, 25.91% id in 328 aa
YP_110053.1	Similar to Brucella melitensis transporter LysE family bmei1274 SWALL:Q8YG87 (EMBL:AE009566) (204 aa) fasta scores: E(): 1.5e-30, 49.74% id in 197 aa, and to Ralstonia solanacearum probable transmembrane protein rsc0385 or rs03353 SWALL:Q8Y2F1 (EMBL:AL646059) (212 aa) fasta scores: E(): 7.8e-28, 47.71% id in 197 aa
YP_110054.1	specific inhibitor of chromosomal initiation of replication in vitro; binds the three 13-mers in the origin (oriC) to block initiation of replication; also controls genes involved in arginine transport
YP_110055.1	Similar to Neisseria meningitidis  anaerobic transcriptional regulatory protein nma2107 or nmb0380 SWALL:Q9JQQ8 (EMBL:AL162758) (244 aa) fasta scores: E(): 3.8e-40, 45.1% id in 235 aa, and to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 fumarate and nitrate reduction regulatory protein Fnr or NirR or b1334 or c1807 or z2433 or ecs1915 SWALL:FNR_ECOLI (SWALL:P03019) (250 aa) fasta scores: E(): 1.9e-35, 42.47% id in 226 aa
YP_110056.1	Similar to Ralstonia solanacearum hypothetical protein rsc0179 or rs00610 SWALL:Q8Y302 (EMBL:AL646057) (151 aa) fasta scores: E(): 6.2e-16, 40.69% id in 145 aa, and to Methanosarcina acetivorans universal stress protein ma3284 SWALL:Q8TKW0 (EMBL:AE011032) (152 aa) fasta scores: E(): 7.3e-11, 37.16% id in 148 aa
YP_110058.1	Similar to Xanthomonas campestris ketoglutarate semialdehyde dehydrogenase xcc3244 SWALL:AAM42514 (EMBL:AE012441) (526 aa) fasta scores: E(): 4e-114, 62.14% id in 523 aa, and to Vibrio harveyi fatty aldehyde dehydrogenase AldH SWALL:DHAF_VIBHA (SWALL:Q56694) (510 aa) fasta scores: E(): 6.1e-82, 48.58% id in 494 aa. Note: Also similar to BPSS0329 (531 aa) fasta scores: E(): 7.2e-91, 60.803% identity in 523 aa overlap
YP_110059.1	Similar to Zymomonas mobilis gluconolactonase precursor Gnl SWALL:GNL_ZYMMO (SWALL:Q01578) (320 aa) fasta scores: E(): 1.4e-14, 33.45% id in 278 aa, and to Ralstonia solanacearum  gluconolactonase precursor rsp0824 or rs05371 SWALL:Q8XRK7 (EMBL:AL646081) (353 aa) fasta scores: E(): 2.8e-69, 59.2% id in 326 aa
YP_110062.1	Similar to the plasmid borne Synechococcus sp. serine acetyltransferase, plasmid SrpH SWALL:SRPH_SYNP7 (SWALL:Q59967) (319 aa) fasta scores: E(): 1.3e-62, 59.19% id in 299 aa, and to Pseudomonas putida serine O-acetyltransferase,  pp0228 SWALL:AAN65860 (EMBL:AE016774) (174 aa) fasta scores: E(): 9.3e-46, 74.26% id in 171 aa
YP_110063.1	Similar to Synechocystis sp. 3-oxoacyl-[acyl-carrier protein] reductase 1 slr0886 SWALL:FAG1_SYNY3 (SWALL:P73574) (247 aa) fasta scores: E(): 2.5e-17, 37.55% id in 245 aa, and to Ralstonia solanacearum  oxidoreductase rsc0156 or rs01026 SWALL:Q8Y325 (EMBL:AL646057) (267 aa) fasta scores: E(): 5.9e-28, 41.66% id in 264 aa
YP_110064.1	involved in the first step of tetrahydrofolate biosynthesis; catalyzes the formation of formate and 2-amino-4-hydroxy-6-(erythro-1,2, 3-trihydroxypropyl)dihydropteridine triphosphate from GTP and water; forms a homopolymer
YP_110065.1	Similar to the plasmid borne Pseudomonas putida transcriptional activator protein NahR SWALL:NAHR_PSEPU (SWALL:P10183) (300 aa) fasta scores: E(): 4.8e-43, 42.28% id in 298 aa, and to Rhizobium tropici nodulation protein D1 NodD1 SWALL:NOD1_RHITR (SWALL:Q02876) (308 aa) fasta scores: E(): 1.3e-26, 35.01% id in 297 aa
YP_110066.1	catalyzes the formation of protocatechuate from 4-hydroxybenzoate
YP_110067.1	Similar to Pseudomonas putida 3-oxoadipate CoA-transferase subunit A PcaI SWALL:PCAI_PSEPU (SWALL:Q01103) (231 aa) fasta scores: E(): 3.5e-63, 75.33% id in 223 aa, and to Ralstonia solanacearum probable 3-oxoadipate coa-transferase subunit A protein rsc2254 or rs01305 SWALL:Q8XX62 (EMBL:AL646069) (229 aa) fasta scores: E(): 2.6e-67, 80.34% id in 229 aa
YP_110068.1	Similar to Pseudomonas putida 3-oxoadipate CoA-transferase subunit B PcaJ SWALL:PCAJ_PSEPU (SWALL:Q01104) (212 aa) fasta scores: E(): 9.6e-62, 76.55% id in 209 aa, and to Ralstonia solanacearum probable 3-oxoadipate coa-transferase subunit B protein rsc2253 or rs01306 SWALL:Q8XX63 (EMBL:AL646069) (220 aa) fasta scores: E(): 2.7e-62, 77.98% id in 209 aa
YP_110069.1	Catalyzes the cycloisomerization of cis,cis-muconate
YP_110070.1	Similar to Alcaligenes eutrophus 3-oxoadipate enol-lactone hydrolase CatD1 SWALL:Q9EV40 (EMBL:AF042281) (260 aa) fasta scores: E(): 3.8e-44, 47.69% id in 260 aa, and to Ralstonia solanacearum probable b-ketoadipate enol-lactone hydrolase transmembrane protein rsc2250 or rs01309 SWALL:Q8XX66 (EMBL:AL646069) (270 aa) fasta scores: E(): 5.3e-44, 45% id in 260 aa
YP_110071.1	Similar to Acinetobacter calcoaceticus 4-carboxymuconolactone decarboxylase PcaC SWALL:DC4C_ACICA (SWALL:P20370) (134 aa) fasta scores: E(): 8.8e-29, 57.02% id in 121 aa, and to Ralstonia solanacearum 4-carboxymuconolactone decarboxylase rsc2249 or rs01310 SWALL:Q8XX67 (EMBL:AL646069) (131 aa) fasta scores: E(): 9e-38, 76.98% id in 126 aa
YP_110072.1	Similar to Pseudomonas putida 4-hydroxybenzoate transporter PcaK SWALL:PCAK_PSEPU (SWALL:Q51955) (448 aa) fasta scores: E(): 1.3e-87, 52.08% id in 432 aa, and to Acinetobacter calcoaceticus 4-hydroxybenzoate transporter PcaK SWALL:PCAK_ACICA (SWALL:Q43975) (457 aa) fasta scores: E(): 8.2e-79, 49.32% id in 442 aa
YP_110074.1	Similar to Pseudomonas aeruginosa hypothetical protein pa2306 SWALL:Q9I1G9 (EMBL:AE004657) (205 aa) fasta scores: E(): 1.3e-40, 53.26% id in 199 aa, and to Rhizobium meliloti hypothetical transmembrane protein r02108 or smc01425 SWALL:Q92NS0 (EMBL:AL591789) (197 aa) fasta scores: E(): 5.7e-38, 52.76% id in 199 aa
YP_110075.1	Similar to Rhizobium meliloti  transport transmembrane protein r00752 or smc00807 SWALL:Q92RU2 (EMBL:AL591784) (400 aa) fasta scores: E(): 5.7e-69, 56.18% id in 388 aa, and to Thermoplasma acidophilum sugar transporter related protein ta1377 SWALL:Q9HIG2 (EMBL:AL445067) (381 aa) fasta scores: E(): 3.9e-20, 29.24% id in 383 aa. Note: This CDS is longer in its N-terminal region than most of its database matches
YP_110076.1	Similar to the Ralstonia solanacearum hypothetical protein rsp0556 or rs03923 SWALL:Q8XSC2 (EMBL:AL646079) (182 aa) fasta scores: E(): 2.2e-39, 72.66% id in 139 aa, and to the C-terminal region of Bradyrhizobium japonicum superoxide dismutase SodM-like protein SWALL:Q9RH60 (EMBL:AF065159) (276 aa) fasta scores: E(): 3.9e-31, 54.9% id in 153 aa. CDS is truncated at the C-terminus in comparison to both proteins
YP_110077.1	Highly similar to the plasmid borne Alcaligenes eutrophus chromate transport protein ChrA SWALL:CHRA_ALCEU (SWALL:P17551) (401 aa) fasta scores: E(): 5.6e-109, 75.19% id in 387 aa, and to Ralstonia solanacearum probable chromate transport transmembrane protein rsp0555 or rs03924 SWALL:Q8XSC3 (EMBL:AL646079) (401 aa) fasta scores: E(): 4.1e-110, 74.74% id in 396 aa
YP_110078.1	Similar to Alcaligenes eutrophus protein ChrB SWALL:CHRB_ALCEU (SWALL:P17552) (324 aa) fasta scores: E(): 1.2e-64, 54.66% id in 311 aa, and to Ralstonia solanacearum probable chromate resistance signal peptide protein rsp0554 or rs03925 SWALL:Q8XSC4 (EMBL:AL646079) (323 aa) fasta scores: E(): 9.1e-67, 56.01% id in 316 aa
YP_110079.1	Similar to Rhizobium loti hypothetical protein mll8139 SWALL:Q983W7 (EMBL:AP003013) (174 aa) fasta scores: E(): 1.9e-19, 46.28% id in 175 aa, and to Pseudomonas aeruginosa hypothetical protein pa2134 SWALL:Q9I1Y1 (EMBL:AE004641) (190 aa) fasta scores: E(): 8.6e-09, 34.52% id in 168 aa
YP_110080.1	Similar to Rhizobium loti hypothetical protein mlr4661 SWALL:Q98DK6 (EMBL:AP003004) (100 aa) fasta scores: E(): 5.8e-07, 37.89% id in 95 aa, and to Methanosarcina mazei copper-binding protein mm2343 SWALL:AAM32039 (EMBL:AE013477) (103 aa) fasta scores: E(): 7e-07, 35.41% id in 96 aa
YP_110081.1	member of the extracytoplasmic function sigma factors which are active under specific conditions; binds with the catalytic core of RNA polymerase to produce the holoenzyme and directs bacterial core RNA polymerase to specific promoter elements to initiate transcription
YP_110082.1	N-terminal region similar to Micrococcus luteus excinuclease ABC subunit A uvrA SWALL:UVRA_MICLU (SWALL:P13567) (992 aa) fasta scores: E(): 2.4e-33, 41.63% id in 1052 aa, and C-terminal region similar to Mycobacterium tuberculosis excinuclease ABC subunit A rv1638 or mt1675 or mtcy06h11.02 SWALL:UVRA_MYCTU (SWALL:P94972) (972 aa) fasta scores: E(): 2.8e-31, 41.73% id in 1016 aa. Note: This CDS seems to have duplicated itself forming a whole CDS which N-terminal region is highly similar to its C-terminal region
YP_110083.1	Similar to Enterobacter aerogenes KluA SWALL:Q93KC6 (EMBL:U67194) (89 aa) fasta scores: E(): 6.5e-12, 53.84% id in 78 aa, and to Pseudomonas sp. hypothetical 10.2 kDa protein orf2 SWALL:Q937D1 (EMBL:U66917) (93 aa) fasta scores: E(): 6.7e-12, 53.84% id in 78 aa, and to Rhizobium meliloti hypothetical protein rb0121 or smb20121 SWALL:Q92X41 (EMBL:AL603642) (91 aa) fasta scores: E(): 6.5e-10, 43.67% id in 87 aa
YP_110085.1	Similar to Salmonella typhimurium, and Salmonella typhi DNA-binding protein H-NS Hns SWALL:HNS_SALTY (SWALL:P17428) (136 aa) fasta scores: E(): 3, 29.31% id in 116 aa, and to Ralstonia solanacearum  HNS-like transcription regulator protein rs00711 SWALL:Q8XSY2 (EMBL:AL646078) (96 aa) fasta scores: E(): 1.5e-14, 58.16% id in 98 aa
YP_110086.1	Similar to Escherichia coli alpha-ketoglutarate permease KgtP or WitA or b2587 SWALL:KGTP_ECOLI (SWALL:P17448) (432 aa) fasta scores: E(): 4.5e-84, 51.63% id in 428 aa, and to Ralstonia solanacearum alpha-ketoglutarate permease transmembrane protein rsp0007 or rs01979 SWALL:Q8XTU7 (EMBL:AL646076) (447 aa) fasta scores: E(): 5.9e-131, 77.87% id in 443 aa. CDS is extended at the N-terminus in comparison to orthologues
YP_110087.1	Similar to Ralstonia solanacearum probable C4-dicarboxylate transport sensor kinase transcription regulator protein dctb1 or rsp0008 or rs01980 SWALL:Q8XTU6 (EMBL:AL646076) (634 aa) fasta scores: E(): 4.7e-73, 54.57% id in 634 aa, and to Rhizobium leguminosarum C4-dicarboxylate transport sensor protein DctB SWALL:DCTB_RHILE (SWALL:P10047) (622 aa) fasta scores: E(): 2.3e-24, 31.02% id in 635 aa
YP_110088.1	Similar to Rhizobium meliloti C4-dicarboxylate transport transcriptional regulatory protein DctD or rb1525 or smb20613 SWALL:DCTD_RHIME (SWALL:P13632) (460 aa) fasta scores: E(): 7.2e-75, 51.82% id in 438 aa, and to Escherichia coli, and Escherichia coli O157:H7 nitrogen regulation protein Nr GlnG or NtrC or GlnT or b3868 or z5404 or ecs4790 SWALL:NTRC_ECOLI (SWALL:P06713) (469 aa) fasta scores: E(): 9.6e-53, 41.1% id in 472 aa
YP_110089.1	No significant database matches. Possible alternative translational start sites
YP_110090.1	Weak similarity to the C-terminal region of Anabaena sp. hypothetical protein all2038 SWALL:Q8YVE0 (EMBL:AP003588) (743 aa) fasta scores: E(): 3.5e-14, 30.93% id in 682 aa
YP_110091.1	Similar to the C-terminal region of Pseudomonas aeruginosa ornithine utilization regulator OruR or pa0831 SWALL:ORUR_PSEAE (SWALL:P72171) (339 aa) fasta scores: E(): 2.1e-10, 35.13% id in 148 aa, and to Mycobacterium tuberculosis hypothetical transcriptional regulator rv1395 or mt1440 or mtcy21b4.12 SWALL:YD95_MYCTU (SWALL:P71663) (344 aa) fasta scores: E(): 4.4e-10, 36.55% id in 145 aa. Possible gene remnant
YP_110092.1	Similar to Pseudomonas aeruginosa non-hemolytic phospholipase C precursor PlcN or pa3319 SWALL:PHLN_PSEAE (SWALL:P15713) (692 aa) fasta scores: E(): 6e-54, 53.29% id in 728 aa, and to Burkholderia pseudomallei non-hemolytic phospholipase C precursor PlcN SWALL:PHLN_BURPS (SWALL:Q9RGS8) (700 aa) fasta scores: E(): 4e-39, 45.43% id in 744 aa
YP_110094.1	Similar to Escherichia coli transposase InsI for insertion sequence element IB30B/C/D (InsI1 or b0256) and (InsI2 or b1404) and (InsI3 or b4284) SWALL:INSI_ECOLI (SWALL:P37246) (383 aa) fasta scores: E(): 8.3e-21, 39.17% id in 388 aa, and to Alcaligenes eutrophus transposase for insertion sequence element IS1086 SWALL:TRA8_ALCEU (SWALL:P37248) (339 aa) fasta scores: E(): 3.8e-19, 42.2% id in 372 aa
YP_110095.1	Similar to Pseudomonas aeruginosa ornithine utilization regulator OruR or pa0831 SWALL:ORUR_PSEAE (SWALL:P72171) (339 aa) fasta scores: E(): 4.4e-20, 27.92% id in 333 aa and to Pseudomonas aeruginosa probable transcriptional regulator pa2704 SWALL:Q9I0D8 (EMBL:AE004698) (339 aa) fasta scores: E(): 3.1e-28, 32.39% id in 321 aa
YP_110097.1	Similar to Escherichia coli spermidine/putrescine transport system permease PotB or b1125 SWALL:POTB_ECOLI (SWALL:P23860) (275 aa) fasta scores: E(): 7.8e-29, 34.69% id in 245 aa, and to Pseudomonas aeruginosa probable permease of ABC transporter pa0325 SWALL:Q9I6G6 (EMBL:AE004470) (309 aa) fasta scores: E(): 3.4e-49, 49.08% id in 273 aa
YP_110098.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 spermidine/putrescine transport system permease PotC or b1124 or c1399 or z1763 or ecs1500 SWALL:POTC_ECOLI (SWALL:P23859) (264 aa) fasta scores: E(): 8.6e-29, 33.84% id in 260 aa, and to Pseudomonas aeruginosa probable permease of ABC transporter pa0324 SWALL:Q9I6G7 (EMBL:AE004470) (262 aa) fasta scores: E(): 2.9e-42, 47.52% id in 263 aa
YP_110099.1	Similar to Escherichia coli spermidine/putrescine-binding periplasmic protein precursor PotD or b1123 SWALL:POTD_ECOLI (SWALL:P23861) (348 aa) fasta scores: E(): 2.3e-25, 26.23% id in 343 aa, and to Pseudomonas aeruginosa probable binding protein component of ABC transporter pa0323 SWALL:Q9I6G8 (EMBL:AE004470) (347 aa) fasta scores: E(): 9.7e-69, 48.19% id in 332 aa
YP_110100.1	Similar to Ralstonia solanacearum  HNS-like transcription regulator protein rsp0335 or rs00711 SWALL:Q8XSY2 (EMBL:AL646078) (96 aa) fasta scores: E(): 1.5e-10, 43.29% id in 97 aa, and to Bordetella pertussis Bph3 SWALL:O07507 (EMBL:U82566) (123 aa) fasta scores: E(): 0.00073, 32.72% id in 110 aa
YP_110101.1	Similar to Ralstonia solanacearum  VGR-related protein rsp0518 or rs06151 SWALL:Q8XSF8 (EMBL:AL646079) (908 aa) fasta scores: E(): 1.1e-90, 41.55% id in 900 aa, and to Escherichia coli VgrE protein SWALL:O52660 (EMBL:AF044499) (702 aa) fasta scores: E(): 0.00017, 25% id in 532 aa
YP_110102.1	Similar to Pseudomonas aeruginosa hypothetical protein pa0260 SWALL:Q9I6M9 (EMBL:AE004464) (716 aa) fasta scores: E(): 1.5e-24, 31.81% id in 770 aa
YP_110103.1	Similar to parts of Pseudomonas aeruginosa hypothetical protein pa0259 SWALL:Q9I6N0 (EMBL:AE004464) (480 aa) fasta scores: E(): 2.3e-15, 27.19% id in 478 aa
YP_110104.1	Similar to Ralstonia solanacearum hypothetical protein RSC3217 or RS02434 SWALL:Q8XUH1 (EMBL:AL646074) (90 aa) fasta scores: E(): 3e-20, 62.79% id in 86 aa, and to the N-terminal region of Burkholderia thailandensis bacteriophage protein GP29 SWALL:Q8VP97 (EMBL:AY063741) (186 aa) fasta scores: E(): 5e-07, 42.35% id in 85 aa
YP_110105.1	Similar to Escherichia coli, and Escherichia coli O157:H7 hypothetical protein YjbQ or b4056 or z5655 or ecs5038 SWALL:YJBQ_ECOLI (SWALL:P32698) (138 aa) fasta scores: E(): 1.2e-18, 42.85% id in 133 aa, and to Rhizobium meliloti hypothetical protein r02310 or smc01559 SWALL:Q92NA3 (EMBL:AL591790) (140 aa) fasta scores: E(): 6.2e-28, 56.42% id in 140 aa
YP_110106.1	Similar to Xanthomonas axonopodis thioredoxin TrxA or xac0109 SWALL:AAM35001 (EMBL:AE011634) (109 aa) fasta scores: E(): 2.1e-17, 50% id in 96 aa, and to Pseudomonas aeruginosa probable thioredoxin pa2694 SWALL:Q9I0E8 (EMBL:AE004697) (108 aa) fasta scores: E(): 1.1e-22, 60.78% id in 102 aa
YP_110108.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0361 or rs03329 SWALL:Q8Y2H5 (EMBL:AL646058) (171 aa) fasta scores: E(): 2e-11, 33.96% id in 159 aa. Weakly similar to Bordetella parapertussis membrane protein bpp4203 SWALL:Q7W345 (EMBL:BX640436) (181 aa) fasta scores: E(): 0.00057, 27.16% id in 162 aa. CDS is extended at the C- and N-termini in comparison to the R. solanacearum protein. The presence of a gene remnant overlapping the C-terminus of the CDS (BPSS0084) suggest that this may be a partial gene
YP_110109.1	Similar to Bradyrhizobium japonicum cytochrome C oxidase polypeptide I CtaD or CoxA SWALL:COX1_BRAJA (SWALL:P31833) (541 aa) fasta scores: E(): 3.4e-116, 54.49% id in 534 aa, and to Rhizobium leguminosarum cytochrome C oxidase polypeptide I CtaD or CoxA SWALL:COX1_RHILE (SWALL:Q08855) (538 aa) fasta scores: E(): 5.8e-116, 56.18% id in 534 aa
YP_110111.1	No significant database matches to the full length CDS. Similar to parts of Xanthomonas axonopodis outer membrane protein XadA or xac3546 SWALL:AAM38389 (EMBL:AE012003) (2190 aa) fasta scores: E(): 1.5e-48, 41.17% id in 629 aa
YP_110112.1	Similar to Ralstonia solanacearum  transmembrane protein rsp0161 or rs05517 SWALL:Q8XTF1 (EMBL:AL646076) (517 aa) fasta scores: E(): 3.2e-115, 57.32% id in 485 aa, and to Xanthomonas axonopodis hypothetical protein xac3119 SWALL:AAM37964 (EMBL:AE011956) (504 aa) fasta scores: E(): 2.5e-104, 53.07% id in 471 aa
YP_110113.1	Low similarity to Yersinia pestis  exported protein ypo1208 SWALL:Q8ZGS3 (EMBL:AJ414147) (175 aa) fasta scores: E(): 3.4e-08, 27.71% id in 166 aa, and to Salmonella typhimurium  inner membrane protein YfaZ or stm2294 SWALL:Q8ZNF6 (EMBL:AE008803) (215 aa) fasta scores: E(): 8.4e-07, 29.56% id in 159 aa
YP_110114.1	Similar to Escherichia coli f17 fimbrial protein precursor f17a-A SWALL:FMF3_ECOLI (SWALL:P11312) (180 aa) fasta scores: E(): 1.1e-12, 35% id in 180 aa, and to Yersinia pestis frimbrial protein ypo2945 SWALL:Q8ZCN6 (EMBL:AJ414154) (181 aa) fasta scores: E(): 4.5e-15, 37.83% id in 185 aa
YP_110115.1	Similar to Escherichia coli chaperone protein precursor EcpD or b0140 SWALL:ECPD_ECOLI (SWALL:P33128) (246 aa) fasta scores: E(): 3.4e-36, 45.04% id in 242 aa, and to Bordetella pertussis chaperone protein precursor FimB or FhaD SWALL:FIMB_BORPE (SWALL:P33409) (244 aa) fasta scores: E(): 4.8e-31, 44.08% id in 245 aa
YP_110116.1	Similar to Escherichia coli outer membrane usher protein precursor AfaC SWALL:AFAC_ECOLI (SWALL:P53517) (859 aa) fasta scores: E(): 8.4e-77, 33.4% id in 877 aa
YP_110117.1	Similar to Xylella fastidiosa fimbrial subunit precursor xf0083 SWALL:Q9PH63 (EMBL:AE003862) (184 aa) fasta scores: E(): 9.2e-12, 37.5% id in 176 aa, and to Escherichia coli F17 fimbrial protein precursor F17a-A SWALL:FMF3_ECOLI (SWALL:P11312) (180 aa) fasta scores: E(): 4.4e-10, 38.46% id in 169 aa
YP_110118.1	Similar to Yersinia pestis  membrane protein ypo1468 or ypo0975 or y2703 or y3366 SWALL:Q8XF18 (EMBL:AJ414148) (228 aa) fasta scores: E(): 8.8e-07, 27.67% id in 206 aa
YP_110119.1	Similar to Yersinia pestis  membrane protein ypo2953 or y1530 SWALL:Q8ZCM8 (EMBL:AJ414154) (560 aa) fasta scores: E(): 8.4e-25, 23.54% id in 565 aa, and to Yersinia pestis  OmpA-family membrane protein ypo0974 or y2702 or y3365 SWALL:Q8ZHC6 (EMBL:AJ414145) (578 aa) fasta scores: E(): 7.2e-19, 28.17% id in 575 aa
YP_110120.1	Similar to Yersinia pestis hypothetical protein ypo2939 SWALL:Q8ZCN9 (EMBL:AJ414154) (174 aa) fasta scores: E(): 2.4e-48, 84.75% id in 164 aa, and to Salmonella typhi hypothetical protein sty0297 SWALL:Q8Z970 (EMBL:AL627266) (180 aa) fasta scores: E(): 6.7e-48, 76.66% id in 180 aa. Note: Also similar to BPSS0173 (194 aa) fasta scores: E(): 2e-48, 81.818% identity in 165 aa overlap
YP_110121.1	Similar to Yersinia pestis hypothetical protein ypo2938 SWALL:Q8ZCP0 (EMBL:AJ414154) (500 aa) fasta scores: E(): 1.3e-175, 84.6% id in 500 aa, and to Salmonella enterica subsp. enterica serovar Typhimurium SciI protein SWALL:Q93IS7 (EMBL:AJ320483) (497 aa) fasta scores: E(): 9.3e-171, 83.36% id in 499 aa. Note: Also similar to BPSS0172 (500 aa) fasta scores: E(): 1.5e-182, 84.168% identity in 499 aa overlap
YP_110122.1	Similar to Salmonella typhimurium, and Salmonella enterica subsp. enterica serovar Typhimurium  cytoplasmic protein stm0279 or SciM SWALL:Q93IS3 (EMBL:AE008707) (161 aa) fasta scores: E(): 8e-39, 63.29% id in 158 aa, and to Yersinia pestis hypothetical protein ypo2937 SWALL:Q8ZCP1 (EMBL:AJ414154) (161 aa) fasta scores: E(): 7.9e-38, 55.69% id in 158 aa. Note: Also similar to BPSS0171 (162 aa) fasta scores: E(): 1.8e-43, 66.456% identity in 158 aa overlap
YP_110123.1	Similar to Salmonella enterica subsp. enterica serovar Typhimurium SciN protein precursor SciN SWALL:Q93IS2 (EMBL:AJ320483) (163 aa) fasta scores: E(): 5.3e-21, 39.21% id in 153 aa, and to Pseudomonas aeruginosa hypothetical protein pa0080 SWALL:Q9I752 (EMBL:AE004447) (154 aa) fasta scores: E(): 1.4e-12, 35.24% id in 122 aa. Note: Also similar to BPSS0170 (171 aa) fasta scores: E(): 5.8e-24, 45.860% identity in 157 aa overlap
YP_110124.1	Similar to Yersinia pestis hypothetical protein ypo2934 or y1549 SWALL:Q8ZCP3 (EMBL:AJ414154) (449 aa) fasta scores: E(): 3.1e-111, 62.61% id in 444 aa, and to Salmonella typhi hypothetical protein sty0304 SWALL:Q8Z966 (EMBL:AL627266) (447 aa) fasta scores: E(): 2.7e-97, 57.9% id in 449 aa. Note: Also similar to BPSS0169 (449 aa) fasta scores: E(): 1.1e-108, 62.054% identity in 448 aa overlap
YP_110125.1	Similar to Salmonella typhi  membrane protein sty0305 SWALL:Q8Z965 (EMBL:AL627266) (433 aa) fasta scores: E(): 1.8e-76, 55.78% id in 380 aa, and to Yersinia pestis  OmpA-family membrane protein ypo0514 SWALL:Q8ZII3 (EMBL:AJ414143) (536 aa) fasta scores: E(): 3.2e-24, 30.93% id in 375 aa. Note: The N-terminal region of this CDS does not present similarities to any of the database matches. Also similar to BPSS0168 (422 aa) fasta scores: E(): 1.9e-61, 46.283% identity in 417 aa overlap
YP_110126.1	Similar to Salmonella enterica subsp. enterica serovar Typhimurium SciS protein precursor SWALL:Q93IR7 (EMBL:AJ320483) (1289 aa) fasta scores: E(): 8.3e-165, 45.82% id in 1305 aa, and to Yersinia pestis  membrane protein ypo2724 SWALL:Q8ZD68 (EMBL:AJ414153) (1275 aa) fasta scores: E(): 2.4e-94, 34.01% id in 1317 aa. Note: Also similar to BPSS0167 (1359 aa) fasta scores: E(): 3.2e-101, 47.210% identity in 1362 aa overlap
YP_110128.1	Similar in almost its full length to Yersinia pestis hypothetical protein ypo2725 SWALL:Q8ZD67 (EMBL:AJ414153) (921 aa) fasta scores: E(): 8e-76, 45.87% id in 896 aa, C-terminal region to Shigella flexneri Rhs-family protein sf0265 SWALL:AAN41925 (EMBL:AE015061) (737 aa) fasta scores: E(): 7.7e-48, 41.75% id in 697 aa, and C-terminal region where the highly repetitive fragment is to Thermoproteus tenax virus 1 viral protein Tpx SWALL:VTP3_TTV1V (SWALL:P19275) (474 aa) fasta scores: E(): 1.6e-32, 59.53% id in 304 aa. Note: Contains a highly repetitive region at the C-terminal domain
YP_110129.1	Similar to Yersinia pestis hypothetical protein ypo2951 or y1532 SWALL:Q8ZCN0 (EMBL:AJ414154) (445 aa) fasta scores: E(): 4e-50, 36.11% id in 407 aa
YP_110130.1	Similar to Yersinia pestis  fimbrial protein ypo2950 or y1533 SWALL:Q8ZCN1 (EMBL:AJ414154) (343 aa) fasta scores: E(): 0.00019, 23.52% id in 357 aa, and C-terminal region to Salmonella typhimurium fimbrial-like protein precursor FimF or stm0548 SWALL:FIMF_SALTY (SWALL:P37926) (172 aa) fasta scores: E(): 0.41, 27.38% id in 168 aa
YP_110131.1	Similar to Salmonella typhimurium, and Salmonella enterica subsp. enterica serovar Typhimurium  cytoplasmic protein stm0266 or SciA SWALL:Q93IT5 (EMBL:AE008707) (351 aa) fasta scores: E(): 9.6e-42, 43.42% id in 350 aa, and to Yersinia pestis hypothetical protein ypo2949 SWALL:Q8ZCN2 (EMBL:AJ414154) (393 aa) fasta scores: E(): 1.1e-31, 38.03% id in 376 aa. Note: Also similar to BPSS0180 (382 aa) fasta scores: E(): 3.7e-28, 44.101% identity in 356 aa overlap
YP_110132.1	Similar to Yersinia pestis hypothetical protein ypo2948 SWALL:Q8ZCN3 (EMBL:AJ414154) (341 aa) fasta scores: E(): 5.7e-72, 52.1% id in 332 aa, and to Salmonella enterica subsp. enterica serovar Typhimurium SciB protein SWALL:Q93IT4 (EMBL:AJ320483) (291 aa) fasta scores: E(): 9.5e-68, 57.54% id in 285 aa. Note: Also similar to BPSS0179 (363 aa) fasta scores: E(): 2.8e-68, 55.224% identity in 335 aa overlap
YP_110133.1	Similar to Yersinia pestis hypothetical protein ypo2947 or y1537 SWALL:Q8ZCN4 (EMBL:AJ414154) (626 aa) fasta scores: E(): 3.3e-177, 64.05% id in 626 aa, and to Salmonella enterica subsp. enterica serovar Typhimurium SciC protein SWALL:Q93IT3 (EMBL:AJ320483) (627 aa) fasta scores: E(): 8.1e-163, 60.92% id in 627 aa. Note: Also similar to BPSS0178 (630 aa) fasta scores: E(): 1.5e-156, 63.796% identity in 627 aa overlap
YP_110134.1	Similar to Salmonella typhimurium, and Salmonella enterica subsp. enterica serovar Typhimurium  cytoplasmic protein stm0269 or SciD SWALL:Q93IT2 (EMBL:AE008707) (164 aa) fasta scores: E(): 1.2e-21, 43.79% id in 153 aa, and to Yersinia pestis hypothetical protein ypo2728 or y1561 SWALL:Q8ZD64 (EMBL:AJ414153) (159 aa) fasta scores: E(): 3.1e-20, 40.12% id in 157 aa. Note: Also similar to BPSS0177 (194 aa) fasta scores: E(): 1.6e-24, 45.912% identity in 159 aa overlap
YP_110135.1	Similar to Salmonella enterica subsp. enterica serovar Typhimurium SciE protein SWALL:Q93IT1 (EMBL:AJ320483) (279 aa) fasta scores: E(): 5.9e-38, 39.85% id in 276 aa, and to Yersinia pestis hypothetical protein ypo2727 or y1560 SWALL:Q8ZD65 (EMBL:AJ414153) (268 aa) fasta scores: E(): 8.6e-36, 39.36% id in 254 aa. Note: Also similar to BPSS0176 (322 aa) fasta scores: E(): 4.8e-29, 39.590% identity in 293 aa overlap
YP_110137.1	Similar to Salmonella typhimurium, and Salmonella enterica subsp. enterica serovar Typhimurium  ATPase with chaperone activity, homolog of Yersinia ClpB stm0272 or SciG SWALL:Q93IS9 (EMBL:AE008707) (879 aa) fasta scores: E(): 4.1e-196, 63.58% id in 865 aa, and to Yersinia pestis Clp ATPase ClpB or ypo0506 or y3669 SWALL:Q8ZIJ2 (EMBL:AJ414143) (867 aa) fasta scores: E(): 1.9e-121, 44.6% id in 843 aa
YP_110138.1	Similar to Ralstonia solanacearum probable capsular synthesis regulatory RcsC or rsp1622 or rs02179 SWALL:Q8XPL6 (EMBL:AL646086) (1098 aa) fasta scores: E(): 1.2e-48, 27.88% id in 1126 aa, and C-terminal region to Escherichia coli sensor protein EvgS precursor or b2370 SWALL:EVGS_ECOLI (SWALL:P30855) (1197 aa) fasta scores: E(): 2.1e-40, 32.07% id in 555 aa
YP_110140.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 capsular synthesis regulator component B RcsB or b2217 or c2760 or z3476 or ecs3106 SWALL:RCSB_ECOLI (SWALL:P14374) (216 aa) fasta scores: E(): 9.3e-24, 41.34% id in 208 aa, and to Pseudomonas aeruginosa probable response regulator pa4080 SWALL:Q9HWU8 (EMBL:AE004824) (214 aa) fasta scores: E(): 6.8e-35, 47.84% id in 209 aa. Note: Also similar to BPSS0124 (243 aa) fasta scores: E(): 3.7e-33, 45.283% identity in 212 aa overlap
YP_110141.1	Similar to Yersinia pestis  outer membrane fimbrial usher protein ypo0302 or y0562 SWALL:Q8ZJ27 (EMBL:AJ414142) (792 aa) fasta scores: E(): 1.4e-120, 42.67% id in 764 aa, and to Escherichia coli outer membrane usher protein precursor FanD SWALL:FAND_ECOLI (SWALL:P12050) (783 aa) fasta scores: E(): 5.4e-22, 22.91% id in 768 aa
YP_110142.1	member of the periplasmic pilus chaperone family of proteins
YP_110143.1	Similar to Yersinia pestis  exported protein ypo0301 or y0561 SWALL:Q8ZJ28 (EMBL:AJ414142) (212 aa) fasta scores: E(): 3.1e-26, 41.09% id in 219 aa
YP_110144.1	Similar to Yersinia pestis  exported protein ypo0301 or y0561 SWALL:Q8ZJ28 (EMBL:AJ414142) (212 aa) fasta scores: E(): 6.2e-34, 48.13% id in 214 aa
YP_110145.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 capsular synthesis regulator component B RcsB or b2217 or c2760 or z3476 or ecs3106 SWALL:RCSB_ECOLI (SWALL:P14374) (216 aa) fasta scores: E(): 1.5e-21, 35.61% id in 205 aa, and to Pseudomonas aeruginosa probable response regulator pa4080 SWALL:Q9HWU8 (EMBL:AE004824) (214 aa) fasta scores: E(): 9.9e-31, 47.61% id in 210 aa. Note: Also similar to BPSS0119 (221 aa) fasta scores: E(): 6.9e-29, 45.283% identity in 212 aa overlap
YP_110146.1	Similar to Ralstonia solanacearum  HNS-like transcription regulator protein rsp0029 or rs02004 SWALL:Q8XTS5 (EMBL:AL646076) (95 aa) fasta scores: E(): 4e-06, 34.4% id in 93 aa, and low similarity to Rhodobacter capsulatus trans-acting regulatory protein HvrA SWALL:HVRA_RHOCA (SWALL:P42505) (102 aa) fasta scores: E(): 0.84, 31.64% id in 79 aa
YP_110147.1	Similar to Agrobacterium vitis  tartrate transporter TtuB SWALL:TUB3_AGRVI (SWALL:P70786) (449 aa) fasta scores: E(): 1.5e-62, 42.23% id in 412 aa, and to Xanthomonas campestris MFS transporter xcc4227 SWALL:AAM43443 (EMBL:AE012550) (461 aa) fasta scores: E(): 1.2e-100, 61.88% id in 446 aa. Note: This CDS is shorter in its N-terminal region than most of its database matches
YP_110148.1	Similar to Escherichia coli glycerate kinase 1 GlxK or GlxB5 or b0514 SWALL:GRK1_ECOLI (SWALL:P77364) (381 aa) fasta scores: E(): 2.6e-63, 55.05% id in 376 aa, and to Xanthomonas axonopodis glycerate kinase xac4360 SWALL:AAM39190 (EMBL:AE012090) (389 aa) fasta scores: E(): 1.6e-77, 64.3% id in 381 aa
YP_110149.1	Similar to Bacillus stearothermophilus pyruvate kinase Pyk SWALL:KPYK_BACST (SWALL:Q02499) (587 aa) fasta scores: E(): 1.7e-60, 41.27% id in 470 aa, and to Pseudomonas aeruginosa pyruvate kinase I PykF or pa1498 SWALL:Q9I3L4 (EMBL:AE004578) (477 aa) fasta scores: E(): 1.5e-83, 55.57% id in 466 aa
YP_110150.1	Similar to Escherichia coli carbohydrate diacid regulator CdaR or SdaR SWALL:CDAR_ECOLI (SWALL:P37047) (385 aa) fasta scores: E(): 8.2e-49, 40.63% id in 379 aa, and to Xanthomonas campestris sugar diacide regulator xcc4225 SWALL:Q8P353 (EMBL:AE012550) (392 aa) fasta scores: E(): 2.2e-47, 40.56% id in 392 aa
YP_110151.1	Similar in its full length to Ralstonia solanacearum  peptide synthase rsp1419 or rs03122 SWALL:Q8XQ67 (EMBL:AL646084) (937 aa) fasta scores: E(): 0, 61.11% id in 936 aa, and in its N-terminal region to Bacillus subtilis  polyketide synthase PksJ SWALL:PKSJ_BACSU (SWALL:P40806) (557 aa) fasta scores: E(): 8.8e-64, 35.95% id in 534 aa
YP_110152.1	Similar to Rhizobium meliloti  epimerase dehydratase, red superfamily, possibly UDP-glucose 4-epimerase rb0631 or smb21052 SWALL:Q92VR8 (EMBL:AL603644) (321 aa) fasta scores: E(): 1.5e-08, 26.68% id in 311 aa, and to Streptomyces avermitilis dtdp-glucose 4,6-dehydratase AveBII SWALL:Q9S0P5 (EMBL:AB032523) (355 aa) fasta scores: E(): 1.1e-07, 25.76% id in 260 aa
YP_110153.1	Similar to Rhizobium loti hypothetical protein mlr5282 SWALL:Q98C61 (EMBL:AP003006) (148 aa) fasta scores: E(): 6.3e-06, 29.45% id in 129 aa
YP_110154.1	Similar to Actinomadura hibisca ORF6 SWALL:O32456 (EMBL:D87924) (341 aa) fasta scores: E(): 3e-36, 36.73% id in 343 aa, and to Streptomyces lipmanii O-demethylpuromycin-O-methyltransferase DmpM SWALL:DMPM_STRLP (SWALL:P42712) (376 aa) fasta scores: E(): 7.8e-32, 35.65% id in 331 aa
YP_110155.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 glycine cleavage system transcriptional activator GcvA or b2808 or c3378 or z4125 or ecs3668 SWALL:GCVA_ECOLI (SWALL:P32064) (305 aa) fasta scores: E(): 1e-25, 34.23% id in 295 aa, and to Pseudomonas putida transcriptional regulator,  pp1393 SWALL:AAN67016 (EMBL:AE016779) (291 aa) fasta scores: E(): 7.9e-30, 38.88% id in 288 aa. Note: This CDS is longer in its N-terminal region than most of its database matches, lacks an appropriate translational start codon. Possible pseudogene
YP_110156.1	Similar to Ralstonia solanacearum hypothetical protein rsp1479 or rs03064 SWALL:Q8XQ07 (EMBL:AL646085) (150 aa) fasta scores: E(): 2e-17, 45.86% id in 133 aa
YP_110157.1	Similar in its full length to Ralstonia solanacearum probable transmembrane protein rsc3143 or rs00460 SWALL:Q8XUP3 (EMBL:AL646073) (459 aa) fasta scores: E(): 1e-97, 58.48% id in 448 aa, and to Bradyrhizobium japonicum two-component hybrid sensor and regulator blr5677 SWALL:BAC50942 (EMBL:AP005955) (941 aa) fasta scores: E(): 1.7e-17, 32.38% id in 315 aa
YP_110159.1	No significant database matches. Possible alternative translational start site
YP_110160.1	Enables the enzymatic reduction of mercuric ions to elemental mercury
YP_110161.1	Similar to Escherichia coli O157:H7  periplasmic ribose-binding protein of ABC transport system z5689 or ecs5071 SWALL:Q8X5Q6 (EMBL:AE005642) (313 aa) fasta scores: E(): 3.9e-54, 54.27% id in 304 aa, and to Bacillus subtilis D-ribose-binding protein precursor RbsB SWALL:RBSB_BACSU (SWALL:P36949) (305 aa) fasta scores: E(): 1.6e-17, 31.31% id in 281 aa
YP_110162.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 ribose transport system permease RbsC or b3750 or c4678 or z5251 or ecs4692 SWALL:RBSC_ECOLI (SWALL:P04984) (321 aa) fasta scores: E(): 6e-36, 45.48% id in 310 aa, and to Yersinia pestis sugar transport system permease ypo3963 or y3866 SWALL:Q8ZA55 (EMBL:AJ414160) (330 aa) fasta scores: E(): 2.3e-62, 60.67% id in 328 aa
YP_110163.1	Similar to Escherichia coli ribose transport ATP-binding protein RbsA or b3749 SWALL:RBSA_ECOLI (SWALL:P04983) (501 aa) fasta scores: E(): 1.2e-71, 45.4% id in 500 aa, and to Yersinia pestis sugar transport ATP-binding protein ypo3964 or y3865 SWALL:Q8ZA54 (EMBL:AJ414160) (507 aa) fasta scores: E(): 1.2e-90, 59.28% id in 501 aa
YP_110164.1	Similar to Rhizobium meliloti  transcription regulator protein r00475 or smc02172 SWALL:Q92SC9 (EMBL:AL591783) (409 aa) fasta scores: E(): 1.3e-34, 33.42% id in 386 aa, and to Agrobacterium tumefaciens transcriptional regulator, ROK family atu4655 or agr_l_455 SWALL:Q8U701 (EMBL:AE009394) (429 aa) fasta scores: E(): 2.9e-28, 31.93% id in 404 aa
YP_110165.1	N-terminal region similar to Clostridium sp. glucoamylase precursor Cga SWALL:AMYG_CLOSP (SWALL:P29761) (702 aa) fasta scores: E(): 8.9e-20, 37.14% id in 743 aa, and C-terminal end to Streptomyces violaceus alpha-amylase precursor Aml SWALL:AMY_STRVL (SWALL:P22998) (569 aa) fasta scores: E(): 7.5e-13, 37.8% id in 164 aa
YP_110166.1	exhibits an RNA-dependent ATPase activity, specifically stimulated by bacterial 23S rRNA
YP_110167.1	Similar to the C-terminal region of Ralstonia solanacearum probable porin signal peptide protein rsp0051 or rs02026 SWALL:Q8XTQ5 (EMBL:AL646076) (382 aa) fasta scores: E(): 2.3e-23, 38.64% id in 207 aa, and of Acinetobacter lwoffii hypothetical 36.5 kDa protein SWALL:Q934S0 (EMBL:U77658) (344 aa) fasta scores: E(): 1e-06, 26.22% id in 225 aa
YP_110168.1	Similar to Klebsiella pneumoniae citrate-proton symporter CitH or Cit SWALL:CIT1_KLEPN (SWALL:P16482) (444 aa) fasta scores: E(): 4.8e-44, 37.05% id in 421 aa, and to the plasmid borne Escherichia coli citrate-proton symporter CitA or Cit SWALL:CIT1_ECOLI (SWALL:P07661) (431 aa) fasta scores: E(): 3.7e-41, 35.84% id in 399 aa
YP_110169.1	Similar to Campylobacter jejuni hippurate hydrolase HipO or cj0985C SWALL:HIPO_CAMJE (SWALL:P45493) (383 aa) fasta scores: E(): 2.3e-64, 47.53% id in 385 aa, and to Pseudomonas aeruginosa probable hydrolase pa4344 SWALL:Q9HW57 (EMBL:AE004850) (406 aa) fasta scores: E(): 1.3e-86, 59.17% id in 387 aa
YP_110170.1	Similar to Comamonas testosteroni TsaR SWALL:P94678 (EMBL:U32622) (298 aa) fasta scores: E(): 2.3e-35, 37.79% id in 299 aa, and to Escherichia coli  transcriptional regulator AbgR or b1339 SWALL:ABGR_ECOLI (SWALL:P77744) (302 aa) fasta scores: E(): 7e-28, 32.64% id in 291 aa
YP_110171.1	Low similarity to Pseudomonas aeruginosa hypothetical protein pa5101 SWALL:Q9HU82 (EMBL:AE004923) (265 aa) fasta scores: E(): 5.2e-20, 36.07% id in 219 aa, and to Rhizobium loti hypothetical protein mll1215 SWALL:Q98L21 (EMBL:AP002996) (275 aa) fasta scores: E(): 2.2e-08, 34.57% id in 214 aa
YP_110172.1	Similar to Pseudomonas aeruginosa hypothetical protein pa5102 SWALL:Q9HU81 (EMBL:AE004923) (312 aa) fasta scores: E(): 1.8e-58, 49.21% id in 317 aa, and to Burkholderia cepacia  omega-3 fatty acid desaturase SWALL:Q9ZGQ3 (EMBL:AF076477) (334 aa) fasta scores: E(): 8.2e-05, 28.78% id in 264 aa. Note: CDS is longer in its N-terminal region than most of its database matches, possible alternative start codon at residue 51
YP_110173.1	Similar to Ralstonia solanacearum  transmembrane protein rsc3150 or rs00450 SWALL:Q8XUN7 (EMBL:AL646073) (143 aa) fasta scores: E(): 3e-25, 72.26% id in 137 aa, and to Pseudomonas aeruginosa hypothetical protein pa5183 SWALL:Q9HU06 (EMBL:AE004931) (135 aa) fasta scores: E(): 2.7e-13, 47.94% id in 146 aa
YP_110174.1	Similar to Escherichia coli glutamate/aspartate periplasmic binding protein precursor GltI or b0655 SWALL:GLTI_ECOLI (SWALL:P37902) (302 aa) fasta scores: E(): 1.8e-60, 55% id in 300 aa, and to Ralstonia solanacearum probable amino-acid-binding periplasmic rsc0481 or rs04394 SWALL:Q8Y255 (EMBL:AL646059) (313 aa) fasta scores: E(): 1.8e-64, 59.37% id in 288 aa
YP_110175.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 D-amino acid dehydrogenase small subunit DadA or DadR or b1189 or c1638 or z1952 or ecs1684 SWALL:DADA_ECOLI (SWALL:P29011) (432 aa) fasta scores: E(): 5.6e-51, 37.85% id in 420 aa, and to Pseudomonas aeruginosa D-amino acid dehydrogenase 2 small subunit pa5084 SWALL:DAD2_PSEAE (SWALL:Q9HU99) (416 aa) fasta scores: E(): 1e-68, 51.44% id in 414 aa
YP_110176.1	Similar to Escherichia coli transcriptional activator protein LysR or b2839 SWALL:LYSR_ECOLI (SWALL:P03030) (311 aa) fasta scores: E(): 1.7e-16, 34.95% id in 246 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa5085 SWALL:Q9HU98 (EMBL:AE004921) (318 aa) fasta scores: E(): 1.7e-30, 41.58% id in 291 aa
YP_110177.1	Similar to Ralstonia solanacearum probable dehydrogenase/reductase oxidoreductase rsc1029 or rs04221 SWALL:Q8Y0L4 (EMBL:AL646062) (246 aa) fasta scores: E(): 6.8e-24, 39.5% id in 243 aa, and to Bacillus cereus benzil reductase YueD SWALL:Q8RJ14 (EMBL:AB052927) (249 aa) fasta scores: E(): 1.8e-19, 34.04% id in 235 aa
YP_110179.1	Very low similarity to Anabaena sp. hypothetical protein all2038 SWALL:Q8YVE0 (EMBL:AP003588) (743 aa) fasta scores: E(): 1.3e-16, 30.72% id in 677 aa, and in its C-terminal region to Anabaena sp. hypothetical protein all3696 SWALL:Q8YQW5 (EMBL:AP003594) (379 aa) fasta scores: E(): 2.1e-06, 27.71% id in 368 aa
YP_110180.1	Similar to Xanthomonas campestris hypothetical protein xcc2894 SWALL:Q8P6S1 (EMBL:AE012403) (781 aa) fasta scores: E(): 2.6e-40, 34.17% id in 793 aa, and to Mycobacterium tuberculosis hypothetical protein rv0584 or mt0612 or mtv039.22 SWALL:O86365 (EMBL:AL021942) (877 aa) fasta scores: E(): 4.7e-37, 38.47% id in 850 aa
YP_110181.1	Similar to Pseudomonas aeruginosa pyoverdine biosynthesis protein PvcA or pa2254 SWALL:Q9I1L5 (EMBL:AE004651) (328 aa) fasta scores: E(): 1.5e-74, 61.16% id in 309 aa, and to the N-terminal region of Vibrio cholerae PvcA protein vc1949 SWALL:Q9KQP9 (EMBL:AE004270) (608 aa) fasta scores: E(): 1.3e-13, 30.45% id in 243 aa
YP_110182.1	Similar to Pseudomonas aeruginosa pyoverdine biosynthesis protein PvcB or pa2255 SWALL:Q9I1L4 (EMBL:AE004651) (291 aa) fasta scores: E(): 4.4e-76, 61.03% id in 290 aa, and to Vibrio cholerae PvcB protein vc1944 SWALL:Q9KQQ4 (EMBL:AE004270) (287 aa) fasta scores: E(): 1.1e-54, 48.86% id in 264 aa
YP_110183.1	Similar to Pseudomonas aeruginosa pyoverdin chromophore biosynthetic protein PvcC or pa2256 SWALL:PVCC_PSEAE (SWALL:O30372) (500 aa) fasta scores: E(): 2.2e-156, 76.17% id in 491 aa, and to Escherichia coli 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component HpaB SWALL:HPAB_ECOLI (SWALL:Q57160) (520 aa) fasta scores: E(): 2.5e-81, 43.84% id in 504 aa
YP_110184.1	Similar to Bacillus subtilis asparagine synthetase [glutamine-hydrolyzing] 3 AsnO SWALL:ASNO_BACSU (SWALL:O05272) (614 aa) fasta scores: E(): 1.6e-68, 42.01% id in 626 aa, and to Streptomyces aureofaciens asparagine synthase homolog TcsG SWALL:Q9FAR2 (EMBL:AB039379) (609 aa) fasta scores: E(): 2.6e-128, 54.76% id in 619 aa
YP_110185.1	Similar to Mycobacterium tuberculosis quinone oxidoreductase rv1454c or mt1501 or mtv007.01C SWALL:O53146 (EMBL:AL021184) (335 aa) fasta scores: E(): 2.6e-54, 54.1% id in 329 aa, and to Pseudomonas aeruginosa quinone oxidoreductase Qor or pa0023 SWALL:QOR_PSEAE (SWALL:P43903) (325 aa) fasta scores: E(): 3.4e-42, 46.27% id in 322 aa
YP_110186.1	Similar to Salmonella typhi 3,4-dihydroxyphenylacetate 2,3-dioxygenase sty1137 SWALL:Q8Z7Q1 (EMBL:AL627269) (283 aa) fasta scores: E(): 6.7e-18, 29.21% id in 291 aa, and to Escherichia coli 3,4-dihydroxyphenylacetate 2,3-dioxygenase HpcB SWALL:HPCB_ECOLI (SWALL:Q05353) (275 aa) fasta scores: E(): 4.2e-16, 28.95% id in 259 aa
YP_110187.1	Similar to Pseudomonas aeruginosa transcriptional regulator for exotoxin A production PtxR or pa2258 SWALL:PTXR_PSEAE (SWALL:P72131) (312 aa) fasta scores: E(): 1.3e-42, 42.06% id in 290 aa, and to Salmonella typhi possible LysR-family transcriptional regulator sty3037 SWALL:Q8Z482 (EMBL:AL627276) (310 aa) fasta scores: E(): 4.1e-25, 30.84% id in 308 aa
YP_110188.1	Similar to Salmonella enterica subsp. enterica serovar Typhimurium SciS protein precursor SWALL:Q93IR7 (EMBL:AJ320483) (1289 aa) fasta scores: E(): 2.4e-141, 45.3% id in 1351 aa, and to Yersinia pestis  membrane protein ypo2724 SWALL:Q8ZD68 (EMBL:AJ414153) (1275 aa) fasta scores: E(): 3.4e-48, 29.77% id in 1360 aa. Note: The amino acid residues between approx. position 255 and position 320 present no similarities to the database matches. Also similar to BPSS0103 (1303 aa) fasta scores: E(): 5.1e-92, 47.210% identity in 1362 aa overlap
YP_110189.1	Similar to Salmonella typhimurium, and Salmonella enterica subsp. enterica serovar Typhimurium  outer membrane protein, OmpA family stm0282 or SciP SWALL:Q93IS0 (EMBL:AE008707) (434 aa) fasta scores: E(): 6.7e-63, 48.33% id in 391 aa, and to Pseudomonas aeruginosa hypothetical protein pa0078 SWALL:Q9I754 (EMBL:AE004447) (449 aa) fasta scores: E(): 1.3e-22, 37.44% id in 414 aa. Note: Also similar to BPSS0102 (434 aa) fasta scores: E(): 2.1e-55, 46.283% identity in 417 aa overlap
YP_110190.1	Similar to Salmonella typhimurium, and Salmonella enterica subsp. enterica serovar Typhimurium  cytoplasmic protein stm0281 or SciO SWALL:Q93IS1 (EMBL:AE008707) (447 aa) fasta scores: E(): 4.3e-107, 59.73% id in 447 aa, and to Yersinia pestis hypothetical protein ypo2934 or y1549 SWALL:Q8ZCP3 (EMBL:AJ414154) (449 aa) fasta scores: E(): 3.6e-97, 55.05% id in 445 aa. Note: Also similar to BPSS0101 (453 aa) fasta scores: E(): 4.5e-106, 62.054% identity in 448 aa overlap
YP_110191.1	Similar to Salmonella enterica subsp. enterica serovar Typhimurium SciN protein precursor SWALL:Q93IS2 (EMBL:AJ320483) (163 aa) fasta scores: E(): 2.9e-21, 46.25% id in 160 aa, and to Pseudomonas aeruginosa hypothetical protein pa1666 SWALL:Q9I359 (EMBL:AE004594) (168 aa) fasta scores: E(): 6.4e-13, 39.85% id in 138 aa. Note: Also similar to BPSS0100 (161 aa) fasta scores: E(): 2.9e-21, 45.860% identity in 157 aa overlap
YP_110192.1	Similar to Salmonella typhimurium, and Salmonella enterica subsp. enterica serovar Typhimurium  cytoplasmic protein stm0279 or SciM SWALL:Q93IS3 (EMBL:AE008707) (161 aa) fasta scores: E(): 2.9e-42, 68.12% id in 160 aa, and to Yersinia pestis hypothetical protein ypo2937 SWALL:Q8ZCP1 (EMBL:AJ414154) (161 aa) fasta scores: E(): 8.8e-37, 57.59% id in 158 aa. Note: Also similar to BPSS0099 (161 aa) fasta scores: E(): 4.1e-42, 66.456% identity in 158 aa overlap
YP_110193.1	Similar to Yersinia pestis hypothetical protein ypo2938 SWALL:Q8ZCP0 (EMBL:AJ414154) (500 aa) fasta scores: E(): 9.3e-166, 80.2% id in 500 aa, and to Salmonella enterica subsp. enterica serovar Typhimurium SciI protein SWALL:Q93IS7 (EMBL:AJ320483) (497 aa) fasta scores: E(): 4.6e-161, 78.49% id in 493 aa. Note: Also similar to BPSS0098 (500 aa) fasta scores: E(): 5.9e-182, 84.168% identity in 499 aa overlap
YP_110194.1	Similar to Yersinia pestis hypothetical protein ypo2939 SWALL:Q8ZCN9 (EMBL:AJ414154) (174 aa) fasta scores: E(): 1.8e-45, 78.31% id in 166 aa, and to Salmonella typhimurium, and Salmonella enterica subsp. enterica serovar Typhimurium  cytoplasmic protein stm0273 or SciH SWALL:Q93IS8 (EMBL:AE008707) (180 aa) fasta scores: E(): 1.2e-44, 77.43% id in 164 aa. Note: This CDS is longer in its C-terminal region than most of its database matches and also similar to BPSS0097 (180 aa) fasta scores: E(): 4.5e-46, 81.818% identity in 165 aa overlap
YP_110195.1	Similar to Salmonella typhimurium, and Salmonella enterica subsp. enterica serovar Typhimurium  ATPase with chaperone activity stm0272 or sciG SWALL:Q93IS9 (EMBL:AE008707) (879 aa) fasta scores: E(): 1.4e-75, 58.54% id in 948 aa, and to Yersinia enterocolitica Clp protease-associated protein ClpB SWALL:Q9F746 (EMBL:AF285784) (890 aa) fasta scores: E(): 1.7e-69, 55.59% id in 939 aa. Note: Also similar to BPSS1502 (1013 aa) fasta scores: E(): 1.8e-94, 44.865% identity in 1003 aa overlap
YP_110197.1	Similar to Salmonella enterica subsp. enterica serovar Typhimurium SciE protein SWALL:Q93IT1 (EMBL:AJ320483) (279 aa) fasta scores: E(): 6.8e-24, 38.69% id in 292 aa, and to Pseudomonas aeruginosa hypothetical protein pa0086 SWALL:Q9I746 (EMBL:AE004447) (281 aa) fasta scores: E(): 8.4e-23, 37.5% id in 272 aa. Note: Also similar to BPSS0114 (285 aa) fasta scores: E(): 7.9e-24, 39.590% identity in 293 aa overlap
YP_110198.1	Similar to Salmonella typhimurium, and Salmonella enterica subsp. enterica serovar Typhimurium  cytoplasmic protein stm0269 or SciD SWALL:Q93IT2 (EMBL:AE008707) (164 aa) fasta scores: E(): 6.7e-24, 48.12% id in 160 aa, and to Yersinia pestis hypothetical protein ypo2728 or y1561 SWALL:Q8ZD64 (EMBL:AJ414153) (159 aa) fasta scores: E(): 3e-21, 38.71% id in 155 aa. Note: Also similar to BPSS0113 (173 aa) fasta scores: E(): 3.8e-25, 45.912% identity in 159 aa overlap
YP_110199.1	Similar to Salmonella enterica subsp. enterica serovar Typhimurium SciC protein SWALL:Q93IT3 (EMBL:AJ320483) (627 aa) fasta scores: E(): 3.9e-156, 61.14% id in 628 aa, and to Yersinia pestis hypothetical protein ypo2947 or y1537 SWALL:Q8ZCN4 (EMBL:AJ414154) (626 aa) fasta scores: E(): 2.1e-143, 55.09% id in 628 aa. Note: Also similar to BPSS0112 (627 aa) fasta scores: E(): 1.2e-144, 63.796% identity in 627 aa overlap
YP_110200.1	Similar to Salmonella enterica subsp. enterica serovar Typhimurium SciB protein SWALL:Q93IT4 (EMBL:AJ320483) (291 aa) fasta scores: E(): 1.2e-65, 56.29% id in 286 aa, and to Yersinia pestis hypothetical protein ypo2948 SWALL:Q8ZCN3 (EMBL:AJ414154) (341 aa) fasta scores: E(): 1.2e-57, 47.02% id in 319 aa. Note: This CDS is longer in its N-terminal region than most of its database matches and it is also similar to BPSS0111 (350 aa) fasta scores: E(): 4.6e-66, 55.224% identity in 335 aa overlap
YP_110201.1	Similar to Salmonella typhimurium, and Salmonella enterica subsp. enterica serovar Typhimurium  cytoplasmic protein stm0266 or SciA SWALL:Q93IT5 (EMBL:AE008707) (351 aa) fasta scores: E(): 1.7e-34, 45.33% id in 364 aa, and to Yersinia pestis hypothetical protein ypo2949 SWALL:Q8ZCN2 (EMBL:AJ414154) (393 aa) fasta scores: E(): 5.7e-20, 30.53% id in 393 aa. Note: Also similar to BPSS0110 (357 aa) fasta scores: E(): 1.3e-23, 44.101% identity in 356 aa overlap
YP_110202.1	Similar to Yersinia pestis hypothetical protein ypo2725 SWALL:Q8ZD67 (EMBL:AJ414153) (921 aa) fasta scores: E(): 4.7e-87, 45.51% id in 580 aa, and to Shigella flexneri Rhs-family protein sf0265 SWALL:AAN41925 (EMBL:AE015061) (737 aa) fasta scores: E(): 2.4e-74, 46.15% id in 546 aa
YP_110203.1	Similar in its full length to Yersinia pestis hypothetical y3665 SWALL:AAM87213 (EMBL:AE013969) (739 aa) fasta scores: E(): 6.7e-20, 24.39% id in 779 aa, C-terminal region to Yersinia pestis hypothetical protein ypo0509 SWALL:Q8ZII9 (EMBL:AJ414143) (540 aa) fasta scores: E(): 3.1e-09, 23.14% id in 566 aa, and N-terminal region to Rhizobium loti hypothetical protein mlr2351 SWALL:Q98IL3 (EMBL:AP002999) (367 aa) fasta scores: E(): 0.00016, 29.11% id in 261 aa
YP_110204.1	Similar to the C-terminal region of Anabaena sp. hypothetical protein all3114 SWALL:Q8YSH1 (EMBL:AP003591) (576 aa) fasta scores: E(): 3.3e-14, 26.19% id in 313 aa, and to the full length of Synechocystis sp. hypothetical protein sll1446 SWALL:P74206 (EMBL:D90913) (320 aa) fasta scores: E(): 6.2e-10, 24.76% id in 323 aa
YP_110206.1	Similar to Yersinia pestis hypothetical protein ypo0511a or y3662 SWALL:Q8ZII6 (EMBL:AJ414143) (121 aa) fasta scores: E(): 2e-08, 40.17% id in 117 aa
YP_110207.1	Similar to Anabaena sp. hypothetical protein all2038 SWALL:Q8YVE0 (EMBL:AP003588) (743 aa) fasta scores: E(): 2.9e-14, 28.5% id in 684 aa, and in its C-terminal region to Anabaena sp. hypothetical protein all3696 SWALL:Q8YQW5 (EMBL:AP003594) (379 aa) fasta scores: E(): 3.3e-05, 28.8% id in 368 aa
YP_110208.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa1223 SWALL:Q9I4B5 (EMBL:AE004552) (297 aa) fasta scores: E(): 1.2e-82, 71.38% id in 297 aa, and to Rhizobium sp. SyrM protein homolog 1 SyrS1 or Y4pN SWALL:SYR1_RHISN (SWALL:P55619) (338 aa) fasta scores: E(): 3e-30, 39.46% id in 299 aa
YP_110209.1	Similar to Pseudomonas aeruginosa probable NAD(P)H deydrogenase pa1224 SWALL:Q9I4B4 (EMBL:AE004552) (259 aa) fasta scores: E(): 3.3e-82, 72.48% id in 258 aa, and to Rhizobium meliloti  NADPH dehydrogenase quinone reductase transmembrane protein r02916 or smc03185 SWALL:Q92LV5 (EMBL:AL591792) (270 aa) fasta scores: E(): 4.7e-65, 58.52% id in 258 aa
YP_110210.1	Similar to Bacillus halodurans O-acetylhomoserine sulfhydrylase bh2603 SWALL:Q9K9P2 (EMBL:AP001516) (430 aa) fasta scores: E(): 7.2e-95, 60.71% id in 420 aa, and to the full length of the eukaryotic Emericella nidulans O-acetylhomoserine CysD SWALL:CYSD_EMENI (SWALL:P50125) (437 aa) fasta scores: E(): 1.6e-83, 51.16% id in 430 aa
YP_110211.1	Similar to Ralstonia solanacearum hypothetical protein rsc2017 or rs03585 SWALL:Q8XXU6 (EMBL:AL646067) (134 aa) fasta scores: E(): 3.9e-05, 33.61% id in 119 aa, and to Caulobacter crescentus hypothetical protein cc2962 SWALL:Q9A481 (EMBL:AE005960) (121 aa) fasta scores: E(): 4.2e-05, 30.64% id in 124 aa
YP_110214.1	Similar to Pseudomonas aeruginosa hypothetical protein pa0496 SWALL:Q9I622 (EMBL:AE004486) (325 aa) fasta scores: E(): 4.1e-81, 65.2% id in 319 aa, and similar to parts of Pseudomonas fluorescens urea amidolyase homologue UahA SWALL:Q9XAV3 (EMBL:AJ243652) (1213 aa) fasta scores: E(): 2.4e-34, 42.76% id in 311 aa
YP_110215.1	Similar to Pseudomonas aeruginosa hypothetical protein pa0495 SWALL:Q9I623 (EMBL:AE004486) (292 aa) fasta scores: E(): 5.2e-84, 69.55% id in 289 aa, and to parts of Pseudomonas fluorescens urea amidolyase homologue UahA SWALL:Q9XAV3 (EMBL:AJ243652) (1213 aa) fasta scores: E(): 4.9e-13, 26.18% id in 275 aa
YP_110216.1	an AccC homodimer forms the biotin carboxylase subunit of the acetyl CoA carboxylase, an enzyme that catalyzes the formation of malonyl-CoA, which in turn controls the rate of fatty acid metabolism
YP_110217.1	Catalyzes the formation of malnoyl-CoA, which in turn controls the rate of fatty acid metabolism
YP_110218.1	Similar to Pseudomonas aeruginosa hypothetical protein pa0492 SWALL:Q9I626 (EMBL:AE004486) (252 aa) fasta scores: E(): 7.9e-69, 72.58% id in 248 aa, and to Escherichia coli protein YbgL or b0713 SWALL:YBGL_ECOLI (SWALL:P75746) (244 aa) fasta scores: E(): 8.5e-28, 38.55% id in 249 aa
YP_110219.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 hydrogen peroxide-inducible genes activator OxyR or MomR or Mor or b3961 or c4922 or z5519 or ecs4890 SWALL:OXYR_ECOLI (SWALL:P11721) (305 aa) fasta scores: E(): 1.2e-18, 30.5% id in 295 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa0491 SWALL:Q9I627 (EMBL:AE004486) (308 aa) fasta scores: E(): 1.8e-73, 64.21% id in 299 aa
YP_110220.1	Similar to Brucella abortus  penicillin acylase II batn1953.orf25 SWALL:Q8VQK2 (EMBL:AF454951) (761 aa) fasta scores: E(): 6e-37, 29.86% id in 817 aa, and to Arthrobacter viscosus penicillin G acylase precursor Pac or Pa SWALL:PAC_ARTVI (SWALL:P31956) (802 aa) fasta scores: E(): 1.3e-33, 27.75% id in 544 aa
YP_110221.1	Similar to Serratia marcescens proline iminopeptidase Pip SWALL:PIP_SERMA (SWALL:O32449) (317 aa) fasta scores: E(): 4.7e-86, 66.77% id in 310 aa, and to Ralstonia solanacearum probable prolyl aminopeptidase rsp0196 or rs04709 SWALL:Q8XTB7 (EMBL:AL646077) (320 aa) fasta scores: E(): 4.9e-88, 68.6% id in 309 aa
YP_110222.1	Very low similarities to parts of Mycobacterium tuberculosis hypothetical 37.9 kDa protein rv1523 or mt1574 or mtcy19g5.05C SWALL:Q50584 (EMBL:Z77826) (347 aa) fasta scores: E(): 9.2e-06, 35.03% id in 137 aa, and to Pseudomonas aeruginosa hypothetical protein pa2650 SWALL:Q9I0I8 (EMBL:AE004694) (269 aa) fasta scores: E(): 5.8e-05, 34.07% id in 135 aa
YP_110224.1	Similar to Escherichia coli methyl-accepting chemotaxis protein I Tsr or CheD or b4355 SWALL:MCP1_ECOLI (SWALL:P02942) (551 aa) fasta scores: E(): 7.7e-55, 47.52% id in 484 aa, and to Ralstonia solanacearum probable methyl-accepting chemotaxis transmembrane protein rsc1234 or rs02741 SWALL:Q8Y011 (EMBL:AL646063) (514 aa) fasta scores: E(): 1.4e-100, 65.1% id in 513 aa
YP_110225.1	Similar to Burkholderia sacchari PrpR SWALL:Q8VPT1 (EMBL:AY033092) (646 aa) fasta scores: E(): 3.9e-121, 60.78% id in 663 aa, and to Escherichia coli propionate catabolism operon regulatory protein PrpR or b0330 SWALL:PRPR_ECOLI (SWALL:P77743) (528 aa) fasta scores: E(): 3e-41, 36.99% id in 673 aa. CDS is extended at the C-terminus in comparison to orthologues
YP_110226.1	catalyzes the formation of pyruvate and succinate from 2-methylisocitrate
YP_110227.1	catalyzes the synthesis of 2-methylcitrate from propionyl-CoA and oxaloacetate; also catalyzes the condensation of oxaloacetate with acetyl-CoA but with a lower specificity
YP_110228.1	Catalyzes the conversion of citrate to isocitrate
YP_110229.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein rsp0119 or rs03003 SWALL:Q8XTI9 (EMBL:AL646076) (396 aa) fasta scores: E(): 2.8e-129, 88.07% id in 394 aa, and to Burkholderia sacchari hypothetical 41.4 kDa protein SWALL:Q8VPS6 (EMBL:AY033092) (396 aa) fasta scores: E(): 4.9e-128, 86.36% id in 396 aa
YP_110230.1	Similar to Deinococcus radiodurans hypothetical protein dra0198 SWALL:Q9RYV8 (EMBL:AE001862) (164 aa) fasta scores: E(): 7.4e-21, 45.73% id in 129 aa, and to Rhizobium loti hypothetical protein mlr6946 SWALL:Q987R7 (EMBL:AP003010) (171 aa) fasta scores: E(): 1.4e-06, 32.39% id in 142 aa
YP_110231.1	Similar to Ralstonia solanacearum hypothetical protein rsc1725 or rs02913 SWALL:Q8XYN3 (EMBL:AL646066) (63 aa) fasta scores: E(): 2.2e-08, 62.26% id in 53 aa, and to the C-terminal region of Ralstonia solanacearum hypothetical protein rsc1727 or rs02915 SWALL:Q8XYN1 (EMBL:AL646066) (193 aa) fasta scores: E(): 0.00076, 45.9% id in 61 aa
YP_110232.1	Similar to Ralstonia solanacearum hypothetical protein rsc1726 or rs02914 SWALL:Q8XYN2 (EMBL:AL646066) (208 aa) fasta scores: E(): 6.3e-40, 54.71% id in 212 aa, and to Ralstonia solanacearum hypothetical protein rsc1727 or rs02915 SWALL:Q8XYN1 (EMBL:AL646066) (193 aa) fasta scores: E(): 3.2e-13, 39.61% id in 207 aa
YP_110233.1	Similar to Ralstonia solanacearum hypothetical protein rsc1727 or rs02915 SWALL:Q8XYN1 (EMBL:AL646066) (193 aa) fasta scores: E(): 2.1e-33, 51.79% id in 195 aa, and to Ralstonia solanacearum hypothetical protein rsc1726 or rs02914 SWALL:Q8XYN2 (EMBL:AL646066) (208 aa) fasta scores: E(): 1.3e-12, 36.94% id in 203 aa
YP_110234.1	Similar to Ralstonia solanacearum hypothetical protein rsc1728 or rs02916 SWALL:Q8XYN0 (EMBL:AL646066) (491 aa) fasta scores: E(): 3.8e-168, 84.45% id in 489 aa, and to Pyrobaculum aerophilum metallo cofactor biosynthesis protein pae0579 SWALL:Q8ZYW8 (EMBL:AE009774) (384 aa) fasta scores: E(): 1.7e-19, 28.45% id in 369 aa
YP_110235.1	Similar to Salmonella typhimurium methyl-accepting chemotaxis protein II Tar or CheM or stm1919 SWALL:MCP2_SALTY (SWALL:P02941) (553 aa) fasta scores: E(): 9.9e-67, 47.81% id in 525 aa, and to Escherichia coli methyl-accepting chemotaxis protein I Tsr or CheD or b4355 SWALL:MCP1_ECOLI (SWALL:P02942) (551 aa) fasta scores: E(): 4e-63, 44.93% id in 523 aa
YP_110236.1	Similar to Rhizobium loti transmembrane efflux protein mll5686 SWALL:Q98B85 (EMBL:AP003007) (502 aa) fasta scores: E(): 3.1e-40, 32.99% id in 491 aa, and to Streptomyces glaucescens tetracenomycin C resistance and export protein TcmA SWALL:TCMA_STRGA (SWALL:P39886) (538 aa) fasta scores: E(): 1.7e-37, 31.08% id in 518 aa. Note: This CDS is longer in its N-terminal region than most of its database matches
YP_110237.1	Similar to Agrobacterium tumefaciens transcriptional regulator, LysR family atu4021 or agr_l_1663 SWALL:Q8U8R9 (EMBL:AE009333) (309 aa) fasta scores: E(): 2.6e-32, 37.2% id in 293 aa, and to Yersinia pestis probable LysR-family transcriptional regulator ypo1929 SWALL:Q8ZF22 (EMBL:AJ414150) (292 aa) fasta scores: E(): 1.6e-23, 31.59% id in 288 aa
YP_110238.1	Similar to Ralstonia solanacearum probable mannose-6-phosphate isomerase ManA or rsc3058 or rs00502 SWALL:Q8XUX5 (EMBL:AL646073) (410 aa) fasta scores: E(): 1.6e-39, 43.22% id in 391 aa, and to Rhizobium meliloti mannose-6-phosphate isomerase Pmi or r02982 or smc03111 SWALL:MANA_RHIME (SWALL:P29954) (387 aa) fasta scores: E(): 9.4e-06, 28.75% id in 386 aa
YP_110239.1	Similar to Escherichia coli, and Escherichia coli O157:H7 hypothetical protein YhiD or b3508 or z4920 or ecs4388 SWALL:YHID_ECOLI (SWALL:P26606) (215 aa) fasta scores: E(): 1.1e-24, 40.55% id in 217 aa, and to Aquifex aeolicus Mg(2+) transport ATPase MgtC or aq_447 SWALL:O66755 (EMBL:AE000690) (225 aa) fasta scores: E(): 6.8e-20, 39.3% id in 201 aa
YP_110240.1	No significant database matches. Possible alternative translational start site
YP_110241.1	Doubtful CDS. Poor database matches. Weakly similar to the N-terminal region of Mycobacterium paratuberculosis FtsQ ftsQ SWALL:Q73YR0 (EMBL:AE017233) (375 aa) fasta scores: E(): 0.00018, 31.51% id in 330 aa
YP_110242.1	Similar to Listeria monocytogenes hypothetical protein lmo0624 SWALL:Q8Y9A8 (EMBL:AL591976) (147 aa) fasta scores: E(): 2.4e-12, 32.43% id in 148 aa, and to Bacillus subtilis YycN protein SWALL:O32293 (EMBL:Z99124) (156 aa) fasta scores: E(): 1.9e-11, 30.71% id in 153 aa
YP_110244.1	No significant database matches to the full length CDS. N-terminal region is similar to Similar to Homo sapiens copper-transporting ATPase 2 ATP7B or WND or PWD or WC1 SWALL:AT7B_HUMAN (SWALL:P35670) (1465 aa) fasta scores: E(): 3e-07, 27% id in 300 aa. C-terminal region is similar to Ralstonia solanacearum probable cation-transporting ATPase transmembrane protein rsc3348 or rs02623 SWALL:Q8XU45 (EMBL:AL646074) (748 aa) fasta scores: E(): 1.1e-121, 59.89% id in 768 aa, and to Synechocystis sp. cation-transporting ATPase PacS or sll1920 SWALL:ATCS_SYNY3 (SWALL:P73241) (745 aa) fasta scores: E(): 2.8e-81, 44.01% id in 777 aa
YP_110246.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein rsc0254 or rs00689 SWALL:Q8Y2T1 (EMBL:AL646058) (542 aa) fasta scores: E(): 1.1e-24, 34.67% id in 522 aa, and to Listeria monocytogenes hypothetical protein lmo0525 SWALL:Q8Y9K2 (EMBL:AL591975) (443 aa) fasta scores: E(): 8.1e-18, 28.17% id in 465 aa
YP_110247.1	Similar to Ralstonia solanacearum  transmembrane protein rsc0896 or rs06183 SWALL:Q8Y0Z7 (EMBL:AL646061) (1261 aa) fasta scores: E(): 8e-67, 44.29% id in 1314 aa, and to Pseudomonas aeruginosa hypothetical protein pa4735 SWALL:Q9HV64 (EMBL:AE004887) (1088 aa) fasta scores: E(): 1.9e-29, 24.82% id in 1305 aa
YP_110249.1	Similar to Rhizobium loti hypothetical protein mlr2187 SWALL:Q98IY7 (EMBL:AP002999) (508 aa) fasta scores: E(): 1.1e-53, 43.19% id in 551 aa
YP_110250.1	Similar to Photorhabdus luminescens ORF38 SWALL:AAO18063 (EMBL:AY144116) (131 aa) fasta scores: E(): 1.7e-23, 47.61% id in 126 aa, and to Bacillus subtilis hypothetical protein YycE SWALL:YYCE_BACSU (SWALL:P37479) (139 aa) fasta scores: E(): 1.1e-16, 38.52% id in 122 aa
YP_110251.1	Similar to the N-terminal region of Ralstonia solanacearum hypothetical protein RSP1103 or RS02609 SWALL:Q8XQW5 (EMBL:AL646082) (56 aa) fasta scores: E(): 2, 45.65% id in 46 aa
YP_110252.1	Similar to Methylococcus capsulatus squalene synthase Sqs SWALL:O69445 (EMBL:Y09978) (362 aa) fasta scores: E(): 8.3e-20, 29.1% id in 323 aa
YP_110253.1	Similar to Pseudomonas aeruginosa cyanide insensitive terminal oxidase CioB or pa3929 SWALL:O07441 (EMBL:Y10528) (335 aa) fasta scores: E(): 3.3e-78, 60.59% id in 335 aa, and to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 cytochrome D ubiquinol oxidase subunit II CydB or Cyd-2 or b0734 or c0812 or z0901 or ecs0769 SWALL:CYDB_ECOLI (SWALL:P11027) (379 aa) fasta scores: E(): 1.3e-21, 28.22% id in 372 aa
YP_110254.1	Similar to Salmonella typhimurium cytochrome BD2 subunit I stm0360 SWALL:Q8ZRG3 (EMBL:AE008712) (467 aa) fasta scores: E(): 1e-118, 65.73% id in 467 aa, and to Escherichia coli, and Escherichia coli O6 cytochrome D ubiquinol oxidase subunit I CydA or Cyd-1 or b0733 or c0811 SWALL:CYDA_ECOLI (SWALL:P11026) (522 aa) fasta scores: E(): 2.4e-39, 31.67% id in 502 aa
YP_110255.1	Similar to Escherichia coli low-specificity L-threonine aldolase LtaE or b0870 SWALL:LTAE_ECOLI (SWALL:P75823) (333 aa) fasta scores: E(): 1.4e-68, 58.98% id in 334 aa, and to Salmonella typhimurium LT2 L-allo-threonine aldolase LtaA SWALL:Q8ZQF1 (EMBL:AE008737) (333 aa) fasta scores: E(): 1.3e-70, 61.07% id in 334 aa
YP_110256.1	specific inhibitor of chromosomal initiation of replication in vitro; inds the three 13-mers in the origin (oriC) to block initiation of replication; also controls genes involved in arginine transport
YP_110257.1	Similar to Bacillus subtilis penicillin-binding protein 1A/1B PonA SWALL:PBPA_BACSU (SWALL:P39793) (914 aa) fasta scores: E(): 8.7e-44, 30.94% id in 685 aa, and to Escherichia coli penicillin-binding protein 1B MrcB or PonB or PbpF or b0149 SWALL:PBPB_ECOLI (SWALL:P02919) (844 aa) fasta scores: E(): 9.3e-43, 31.98% id in 591 aa
YP_110258.1	Similar to Escherichia coli, and Escherichia coli O6 hypothetical protein YicG or b3646 or c4470 SWALL:YICG_ECOLI (SWALL:P31432) (205 aa) fasta scores: E(): 5.6e-29, 42.57% id in 202 aa, and to Vibrio cholerae hypothetical protein Vc2115 vc2115 SWALL:Q9KQ86 (EMBL:AE004285) (207 aa) fasta scores: E(): 1.2e-32, 51.77% id in 197 aa
YP_110259.1	with HmuTU is involved in the import of hemin
YP_110260.1	Similar to Yersinia pestis hemin transport system permease HmuU or ypo0280 or y0540 SWALL:HMUU_YERPE (SWALL:Q56992) (334 aa) fasta scores: E(): 2.6e-43, 45.48% id in 343 aa, and to Bordetella avium BhuU SWALL:Q8L1U4 (EMBL:AY095952) (334 aa) fasta scores: E(): 9.1e-45, 49.41% id in 344 aa
YP_110261.1	Similar to Yersinia pestis hemin-binding periplasmic protein precursor HmuT or ypo0281 or y0541 SWALL:HMUT_YERPE (SWALL:Q56991) (279 aa) fasta scores: E(): 2.7e-17, 41.72% id in 266 aa, and to Escherichia coli O157:H7  periplasmic binding protein ChuT or z4913 or ecs4382 SWALL:Q8X5N7 (EMBL:AE005576) (304 aa) fasta scores: E(): 8.4e-22, 32.97% id in 276 aa
YP_110262.1	Similar to Yersinia pestis hemin transport protein HmuS or ypo0282 or y0542 SWALL:HMUS_YERPE (SWALL:Q56990) (345 aa) fasta scores: E(): 1.8e-45, 42.2% id in 327 aa, and to Ralstonia solanacearum probable hemin transport protein rsp0243 or rs03723 SWALL:Q8XT72 (EMBL:AL646077) (380 aa) fasta scores: E(): 3.5e-70, 56.7% id in 358 aa
YP_110263.1	Similar to Caulobacter crescentus TonB-dependent receptor cc2194 SWALL:Q9A6A0 (EMBL:AE005891) (733 aa) fasta scores: E(): 4.5e-100, 41.94% id in 739 aa, and to Vibrio mimicus heme receptor precursor MhuA SWALL:Q9AQK5 (EMBL:AB048382) (710 aa) fasta scores: E(): 1.9e-33, 29.43% id in 727 aa
YP_110265.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 glycine cleavage system transcriptional activator GcvA or b2808 or c3378 or z4125 or ecs3668 SWALL:GCVA_ECOLI (SWALL:P32064) (305 aa) fasta scores: E(): 7.3e-26, 32.88% id in 298 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa0448 SWALL:Q9I670 (EMBL:AE004482) (302 aa) fasta scores: E(): 2.3e-33, 37.07% id in 294 aa
YP_110266.1	Similar to Pseudomonas aeruginosa probable permease of ABC transporter pa3253 SWALL:Q9HYY7 (EMBL:AE004747) (265 aa) fasta scores: E(): 2.2e-19, 29.32% id in 266 aa, and to Ralstonia solanacearum probable permease transmembrane ABC transporter protein rsc1793 or rs04192 SWALL:Q8XYG5 (EMBL:AL646066) (265 aa) fasta scores: E(): 1e-14, 28.15% id in 238 aa
YP_110267.1	Similar to Rhizobium loti ABC transporter ATP-binding protein mll2948 SWALL:Q98HB1 (EMBL:AP003000) (371 aa) fasta scores: E(): 8.1e-41, 43.31% id in 314 aa, and to Alicyclobacillus acidocaldarius  ABC-transporter ATP-binding protein CysA SWALL:Q9RHZ7 (EMBL:AJ252160) (393 aa) fasta scores: E(): 1.4e-37, 46.1% id in 295 aa
YP_110268.1	Similar to Ralstonia solanacearum probable solute-binding periplasmic rsc1791 or rs04190 SWALL:Q8XYG7 (EMBL:AL646066) (343 aa) fasta scores: E(): 1.5e-37, 37.27% id in 330 aa, and to Campylobacter jejuni periplasmic solute-binding protein cj0727 SWALL:Q9PPI0 (EMBL:AL139076) (348 aa) fasta scores: E(): 8.9e-28, 31.05% id in 351 aa
YP_110269.1	Similar to Ralstonia solanacearum probable transport system permease transmembrane ABC transporter protein rsc1792 or rs04191 SWALL:Q8XYG6 (EMBL:AL646066) (282 aa) fasta scores: E(): 4.9e-17, 35.03% id in 254 aa, and to Agrobacterium tumefaciens ABC transporter membrane spanning protein atu2148 or agr_c_3892 SWALL:Q8UDH7 (EMBL:AE009165) (331 aa) fasta scores: E(): 3.4e-15, 31.53% id in 260 aa
YP_110270.1	C-terminal region is similar to Methanosarcina mazei hypothetical protein mm3075 SWALL:Q8PSK4 (EMBL:AE013563) (156 aa) fasta scores: E(): 3.9e-14, 43.38% id in 136 aa, and Aquifex pyrophilus hypothetical protein SWALL:AAN12294 (EMBL:AY135660) (150 aa) fasta scores: E(): 1.4e-12, 38.62% id in 145 aa. Possible alternative start codon at codon 20
YP_110271.1	Similar to Ralstonia solanacearum probable porin transmembrane protein rsc1082 or rs04105 SWALL:Q8Y0G2 (EMBL:AL646062) (394 aa) fasta scores: E(): 3.1e-44, 43.06% id in 404 aa, and to Bordetella pertussis outer membrane porin protein precursor SWALL:OMP_BORPE (SWALL:Q04064) (385 aa) fasta scores: E(): 3.1e-20, 34.18% id in 392 aa
YP_110272.1	Similar to Pasteurella multocida hypothetical protein pm1646 SWALL:Q9CKH2 (EMBL:AE006201) (317 aa) fasta scores: E(): 1.2e-59, 52.68% id in 317 aa, and to Bacillus halodurans transcriptional regulator bh0780 SWALL:Q9KER9 (EMBL:AP001509) (316 aa) fasta scores: E(): 1.7e-24, 29.83% id in 305 aa
YP_110273.1	Similar to Escherichia coli ribose 5-phosphate isomerase B RpiB or b4090 SWALL:RPIB_ECOLI (SWALL:P37351) (149 aa) fasta scores: E(): 5.9e-21, 46.62% id in 148 aa, and to Yersinia pestis ribose 5-phosphate isomerase B RpiB or ypo3353 or y0837 SWALL:AAM84422 (EMBL:AJ414156) (151 aa) fasta scores: E(): 1.7e-28, 55.4% id in 148 aa
YP_110274.1	Similar to Escherichia coli ribose transport ATP-binding protein RbsA or b3749 SWALL:RBSA_ECOLI (SWALL:P04983) (501 aa) fasta scores: E(): 2.6e-60, 40.89% id in 494 aa, and to Yersinia pestis sugar transport ATP-binding protein ypo0858 SWALL:Q8ZHN2 (EMBL:AJ414145) (502 aa) fasta scores: E(): 1.6e-74, 48.77% id in 490 aa
YP_110275.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 ribose transport system permease RbsC or b3750 or c4678 or z5251 or ecs4692 SWALL:RBSC_ECOLI (SWALL:P04984) (321 aa) fasta scores: E(): 1.3e-45, 53.31% id in 302 aa, and to Salmonella typhimurium, and Salmonella typhi ABC superfamily stm3883 or sty3895 SWALL:Q8XFM3 (EMBL:AE008881) (321 aa) fasta scores: E(): 5.1e-46, 53.97% id in 302 aa
YP_110276.1	Similar to Escherichia coli D-ribose-binding periplasmic protein precursor RbsB or RbsP or PrlB or b3751 SWALL:RBSB_ECOLI (SWALL:P02925) (296 aa) fasta scores: E(): 4.1e-13, 28.18% id in 298 aa, and to Brucella melitensis D-ribose-binding periplasmic protein precursor bmei0393 SWALL:Q8YIQ0 (EMBL:AE009482) (325 aa) fasta scores: E(): 6.3e-54, 51.09% id in 321 aa
YP_110277.1	Similar to Escherichia coli 2-deoxy-D-gluconate 3-dehydrogenase KduD or b2842 SWALL:KDUD_ECOLI (SWALL:P37769) (253 aa) fasta scores: E(): 9.3e-24, 37.45% id in 251 aa, and to Yersinia pestis  dehydrogenase ypo3351 or y0839 SWALL:Q8ZBQ6 (EMBL:AJ414156) (256 aa) fasta scores: E(): 1.7e-39, 52.17% id in 253 aa
YP_110278.1	Similar to Pseudomonas putida 2,3-butanediol dehydrogenase Adh SWALL:Q59696 (EMBL:L35343) (362 aa) fasta scores: E(): 2.8e-32, 32.12% id in 358 aa, and to Yersinia pestis  zinc-binding dehydrogenase ypo3352 SWALL:Q8ZBQ5 (EMBL:AJ414156) (371 aa) fasta scores: E(): 7.9e-88, 61.51% id in 356 aa
YP_110279.1	Similar to Yersinia pestis  dihydroxyacetone kinase DhaK or ypo3350 SWALL:Q8ZBQ7 (EMBL:AJ414156) (333 aa) fasta scores: E(): 2.1e-72, 62.72% id in 330 aa, and to Selenomonas ruminantium subsp. ruminantium dihydroxyacetone kinase DhaK1 SWALL:Q93PV9 (EMBL:AF297121) (329 aa) fasta scores: E(): 2.6e-45, 43.3% id in 321 aa
YP_110280.1	Similar to the plasmid-borne Rhizobium meliloti dihydroxyacetone kinase rb0299 or smb20313 SWALL:Q92WN3 (EMBL:AL603643) (213 aa) fasta scores: E(): 5.6e-36, 54.93% id in 213 aa, and to Selenomonas ruminantium subsp. ruminantium dihydroxyacetone kinase DhaK2 SWALL:Q9F677 (EMBL:AF297121) (207 aa) fasta scores: E(): 1.2e-19, 37.18% id in 199 aa
YP_110281.1	Similar to Salmonella typhi aminoglycoside 6'-N-acetyltransferase Aac or sty1445 SWALL:Q8Z762 (EMBL:AL627270) (172 aa) fasta scores: E(): 4.6e-23, 49.65% id in 145 aa, and to Enterobacter aerogenes aminoglycoside N AacA7 SWALL:AAC6_ENTAE (SWALL:P50858) (152 aa) fasta scores: E(): 9.3e-17, 43.91% id in 148 aa
YP_110284.1	Similar to Bordetella pertussis outer membrane porin protein precursor SWALL:OMP_BORPE (SWALL:Q04064) (385 aa) fasta scores: E(): 1.1e-21, 33.58% id in 405 aa, and to Ralstonia solanacearum probable porin signal peptide protein rsp0051 or rs02026 SWALL:Q8XTQ5 (EMBL:AL646076) (382 aa) fasta scores: E(): 1.6e-34, 39.75% id in 405 aa
YP_110285.1	Similar to Ralstonia solanacearum probable signal peptide protein rsc0922 or rs04493 SWALL:Q8Y0X1 (EMBL:AL646061) (266 aa) fasta scores: E(): 4.7e-57, 62.54% id in 259 aa, and to Brucella melitensis ABC transporter substrate binding protein bmei1954 SWALL:Q8YEC4 (EMBL:AE009628) (268 aa) fasta scores: E(): 7.2e-42, 46% id in 263 aa
YP_110286.1	Similar to Pseudomonas aeruginosa arginine/ornithine transport operon protein Aot AotO or pa0891 SWALL:O50184 (EMBL:AF012537) (370 aa) fasta scores: E(): 1.3e-51, 43.39% id in 371 aa, and to Rhizobium loti hypothetical protein mlr2771 SWALL:Q98HP7 (EMBL:AP003000) (351 aa) fasta scores: E(): 1.3e-09, 30.34% id in 379 aa
YP_110287.1	Similar to Rhizobium loti O-antigen acetylase mlr0695 SWALL:Q98M77 (EMBL:AP002995) (688 aa) fasta scores: E(): 1.3e-66, 42.93% id in 694 aa, and to Pseudomonas aeruginosa probable O-antigen acetylase pa5238 SWALL:Q9HTV2 (EMBL:AE004936) (662 aa) fasta scores: E(): 6e-32, 31.62% id in 702 aa. CDS is extended at the N-terminus in comparison to orthologues. Possible alternative translational start site
YP_110289.1	Similar to Escherichia coli lysine-arginine-ornithine-binding periplasmic protein precursor ArgT or b2310 SWALL:ARGT_ECOLI (SWALL:P09551) (260 aa) fasta scores: E(): 2.6e-52, 53.66% id in 259 aa, and histidine-binding periplasmic protein precursor HisJ or b2309 or c2851 or z3571 or ecs3193 SWALL:HISJ_ECOLI (SWALL:P39182) (260 aa) fasta scores: E(): 3.5e-52, 52.51% id in 259 aa
YP_110290.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa2921 SWALL:Q9HZS6 (EMBL:AE004718) (329 aa) fasta scores: E(): 2.7e-26, 37% id in 300 aa, and to Escherichia coli  transcriptional regulator AbgR or b1339 SWALL:ABGR_ECOLI (SWALL:P77744) (302 aa) fasta scores: E(): 2e-21, 29.96% id in 297 aa
YP_110291.1	Similar to Campylobacter jejuni hippurate hydrolase HipO or cj0985C SWALL:HIPO_CAMJE (SWALL:P45493) (383 aa) fasta scores: E(): 5.6e-56, 44.44% id in 387 aa, and to Agrobacterium tumefaciens amidohydrolase atu3635 or agr_l_2386 SWALL:Q8U9U0 (EMBL:AE009292) (430 aa) fasta scores: E(): 6.1e-67, 47.84% id in 395 aa
YP_110292.1	Similar to Pseudomonas aeruginosa probable MFS transporter pa4343 SWALL:Q9HW58 (EMBL:AE004850) (439 aa) fasta scores: E(): 2.3e-64, 46.82% id in 425 aa, and to Escherichia coli citrate-proton symporter CitA or Cit SWALL:CIT1_ECOLI (SWALL:P07661) (431 aa) fasta scores: E(): 1.3e-45, 36.77% id in 416 aa
YP_110293.1	Similar to Escherichia coli and Escherichia coli O6 hypothetical transcriptional regulator YcdC or b1013 or c1150 SWALL:YCDC_ECOLI (SWALL:P75899) (212 aa) fasta scores: E(): 8.2e-22, 38.42% id in 190 aa, and to Pseudomonas putida transcriptional regulator, TetR family pp0594 SWALL:AAN66221 (EMBL:AE016776) (247 aa) fasta scores: E(): 8e-30, 37.39% id in 238 aa
YP_110294.1	Similar to Pseudomonas putida pca regulon regulatory protein PcaR SWALL:PCAR_PSEPU (SWALL:Q52154) (291 aa) fasta scores: E(): 1.8e-38, 42.85% id in 273 aa, and to Ralstonia solanacearum probable transcription regulator protein rsc2255 or rs01304 SWALL:Q8XX61 (EMBL:AL646069) (275 aa) fasta scores: E(): 1.2e-68, 67.75% id in 276 aa. Possible alternative translational start site
YP_110295.1	catalyzes the thiolytic cleavage of beta-ketoadipyl-CoA to succinate and acetyl-CoA
YP_110296.1	Similar to Escherichia coli aerotaxis receptor Aer or Air or b3072 SWALL:AER_ECOLI (SWALL:P50466) (506 aa) fasta scores: E(): 7.6e-83, 51.65% id in 515 aa, and to Ralstonia solanacearum probable aerotaxis sensor receptor rsp1224 or rs03168 SWALL:Q8XQK0 (EMBL:AL646083) (514 aa) fasta scores: E(): 8.2e-120, 69.84% id in 514 aa
YP_110297.1	Similar to Streptomyces sp. JP95  methyltransferase GrhL SWALL:Q8KSX2 (EMBL:AF509565) (343 aa) fasta scores: E(): 2e-16, 27.32% id in 333 aa, and to Mycobacterium tuberculosis  methyltransferase rv0567 or mt0593 or mtv039.05 SWALL:O53764 (EMBL:AL021942) (340 aa) fasta scores: E(): 1.1e-16, 28.03% id in 321 aa
YP_110298.1	Low similarity to Pseudomonas sp. vanillate O-demethylase oxygenase subunit VanA SWALL:VANA_PSESP (SWALL:O05616) (354 aa) fasta scores: E(): 1.9e-06, 24.49% id in 298 aa, and to Xanthomonas campestris vanillate O-demethylase oxygenase subunit xcc0363 SWALL:AAM39682 (EMBL:AE012132) (358 aa) fasta scores: E(): 1.7e-08, 25.98% id in 304 aa
YP_110299.1	Very low similarity to parts of Arabidopsis thaliana  rieske iron-sulfur protein at2g24820 SWALL:Q9SK50 (EMBL:AC006585) (539 aa) fasta scores: E(): 8e-13, 29.8% id in 255 aa, and to Anabaena sp. hypothetical protein all3866 SWALL:Q8YQG5 (EMBL:AP003594) (351 aa) fasta scores: E(): 8.4e-10, 32.89% id in 152 aa
YP_110300.1	Similar to Escherichia coli succinate-semialdehyde dehydrogenase [NADP+] GabD or b2661 SWALL:GABD_ECOLI (SWALL:P25526) (482 aa) fasta scores: E(): 1.4e-130, 69.7% id in 482 aa, and to Salmonella typhi succinate-semialdehyde dehydrogenase sty2911 SWALL:Q8Z4F8 (EMBL:AL627276) (482 aa) fasta scores: E(): 7.2e-131, 70.12% id in 482 aa
YP_110301.1	Similar to Escherichia coli 4-aminobutyrate aminotransferase GabT or b2662 SWALL:GABT_ECOLI (SWALL:P22256) (426 aa) fasta scores: E(): 4.8e-79, 54.24% id in 424 aa, and to Ralstonia solanacearum probable 4-aminobutyrate aminotransferase rsc0029 or rs01852 SWALL:Q8Y3F1 (EMBL:AL646057) (426 aa) fasta scores: E(): 1.5e-108, 71.29% id in 418 aa
YP_110302.1	Similar to Ralstonia solanacearum  transcription regulator protein rsc0030 or rs01853 SWALL:Q8Y3F0 (EMBL:AL646057) (509 aa) fasta scores: E(): 3e-74, 57.69% id in 520 aa, and to Yersinia pestis  GntR-family regulatory protein ypo2845 or y1389 SWALL:Q8ZCW3 (EMBL:AJ414154) (501 aa) fasta scores: E(): 3e-61, 46.1% id in 514 aa
YP_110303.1	Similar to Bacillus halodurans hypothetical protein bh2308 SWALL:Q9KAH9 (EMBL:AP001515) (470 aa) fasta scores: E(): 1.9e-35, 25.87% id in 460 aa, and to Salmonella typhi membrane protein sty4802 SWALL:Q8Z128 (EMBL:AL627283) (467 aa) fasta scores: E(): 6.2e-19, 28.75% id in 480 aa
YP_110304.1	Similar to Escherichia coli transcriptional regulator KdgR or b1827 SWALL:KDGR_ECOLI (SWALL:P76268) (263 aa) fasta scores: E(): 1.8e-15, 30.92% id in 249 aa, and to Bacillus halodurans transcriptional regulator bh2137 SWALL:Q9KAZ9 (EMBL:AP001514) (251 aa) fasta scores: E(): 1e-18, 31.85% id in 248 aa
YP_110305.1	Similar to Rhizobium loti N-formylglutamate amidohydrolase mll3040 SWALL:Q98H42 (EMBL:AP003001) (313 aa) fasta scores: E(): 1.5e-28, 37.72% id in 273 aa, and to Agrobacterium tumefaciens hypothetical protein atu3884 or agr_l_1927 SWALL:Q8U946 (EMBL:AE009319) (294 aa) fasta scores: E(): 8.5e-28, 36.49% id in 274 aa
YP_110306.1	Similar to Rhizobium loti hypothetical protein mlr7896 SWALL:Q984Q1 (EMBL:AP003012) (278 aa) fasta scores: E(): 7.6e-27, 40.14% id in 269 aa, and to Streptomyces coelicolor  integral membrane protein sco3164 or sce87.15C SWALL:Q9RKC3 (EMBL:AL939115) (281 aa) fasta scores: E(): 1.8e-26, 39.63% id in 275 aa
YP_110307.1	catalyzes the formation of selenophosphate from selenide and ATP
YP_110308.1	Similar to Ralstonia solanacearum  purine nucleoside permease rsc0798 or rs05039 SWALL:Q8Y192 (EMBL:AL646061) (381 aa) fasta scores: E(): 2e-74, 56.32% id in 348 aa, and to Brucella melitensis purine nucleoside permease bmei0469 SWALL:Q8YIH5 (EMBL:AE009489) (345 aa) fasta scores: E(): 3.8e-56, 48.11% id in 318 aa
YP_110310.1	Similar to Burkholderia cepacia  transcriptional regulator CeoR SWALL:Q8VL17 (EMBL:AY008288) (334 aa) fasta scores: E(): 8.5e-123, 91.01% id in 334 aa, and to Salmonella typhi  transcriptional regulator sty1386 SWALL:Q8Z7A3 (EMBL:AL627270) (301 aa) fasta scores: E(): 8.7e-49, 43.79% id in 290 aa
YP_110311.1	C-terminal region is similar to Burkholderia cepacia lipase-like protein LlpE SWALL:Q8VL16 (EMBL:AY008288) (286 aa) fasta scores: E(): 7.8e-78, 74.55% id in 283 aa. C-terminus is similar to the C-terminal region of Ralstonia solanacearum probable lipase rsp1111 or rs02619 SWALL:Q8XQV7 (EMBL:AL646082) (357 aa) fasta scores: E(): 5.4e-46, 50.9% id in 277 aa
YP_110312.1	Similar to Escherichia coli, and Escherichia coli O157:H7 acriflavine resistance protein A precursor AcrA or MtcA or Lir or b0463 or z0578 or ecs0516 SWALL:ACRA_ECOLI (SWALL:P31223) (397 aa) fasta scores: E(): 5.3e-33, 32.98% id in 385 aa, and to Ralstonia solanacearum probable transmembrane multidrug efflux system transmembrane protein ys02620 or rsp1112 or rs02620 SWALL:Q8XQV6 (EMBL:AL646082) (438 aa) fasta scores: E(): 6.1e-78, 57.77% id in 405 aa
YP_110313.1	Similar to Pseudomonas aeruginosa multidrug resistance protein MexB or pa0426 SWALL:MEXB_PSEAE (SWALL:P52002) (1046 aa) fasta scores: E(): 3e-158, 42.63% id in 1046 aa, and to Escherichia coli probable aminoglycoside efflux pump AcrD or b2470 SWALL:ACRD_ECOLI (SWALL:P24177) (1037 aa) fasta scores: E(): 5.4e-157, 41.32% id in 1038 aa
YP_110314.1	Similar to Ralstonia solanacearum  outer-membrane drug efflux protein rsp1114 or rs05506 SWALL:Q8XQV4 (EMBL:AL646082) (508 aa) fasta scores: E(): 8.9e-99, 59.63% id in 493 aa, and to Pseudomonas aeruginosa outer membrane protein precursor OprM or OprK or pa0427 SWALL:OPRM_PSEAE (SWALL:Q51487) (485 aa) fasta scores: E(): 2.2e-39, 35.33% id in 484 aa
YP_110315.1	Similar to Escherichia coli O157:H7  symport protein z0888 or ecs0758 SWALL:Q8X4W0 (EMBL:AE005251) (426 aa) fasta scores: E(): 2.6e-37, 33% id in 406 aa, and to Bacillus subtilis C4-dicarboxylate transport protein DctA or DctP SWALL:DCTA_BACSU (SWALL:P96603) (421 aa) fasta scores: E(): 2.4e-35, 30.53% id in 393 aa
YP_110316.1	Similar to Bradyrhizobium japonicum transcriptional regulatory protein bll4018 SWALL:BAC49283 (EMBL:AP005949) (230 aa) fasta scores: E(): 1.8e-26, 40.8% id in 223 aa, and to Thermoanaerobacter tengcongensis transcriptional regulator tte2558 SWALL:Q8R766 (EMBL:AE013196) (225 aa) fasta scores: E(): 1e-12, 31.52% id in 203 aa
YP_110317.1	Similar to Listeria innocua hypothetical protein lin2871 SWALL:Q927B8 (EMBL:AL596173) (153 aa) fasta scores: E(): 5.2e-07, 33.61% id in 119 aa, and to Bacillus subtilis YitI protein SWALL:O06744 (EMBL:Z99109) (154 aa) fasta scores: E(): 4.6e-05, 27.48% id in 131 aa
YP_110318.1	Similar to Xanthomonas axonopodis hypothetical protein xac0191 SWALL:AAM35083 (EMBL:AE011644) (305 aa) fasta scores: E(): 3.3e-21, 31.86% id in 295 aa, and to Aquifex aeolicus hypothetical protein aq_1392 SWALL:O67397 (EMBL:AE000738) (292 aa) fasta scores: E(): 3e-14, 28.85% id in 298 aa
YP_110319.1	Similar to the N-terminal region of Streptomyces coelicolor polyketide synthase sco5892 or sc3f7.12 SWALL:O54155 (EMBL:AL939125) (2297 aa) fasta scores: E(): 2.6e-69, 41.73% id in 587 aa, and to the full length of Mycobacterium tuberculosis  fatty-acid--CoA ligase rv1521 or mt1572 or mtcy19g5.07 SWALL:FD25_MYCTU (SWALL:Q50586) (583 aa) fasta scores: E(): 5.3e-56, 36.65% id in 592 aa
YP_110320.1	Similar to Escherichia coli, and Escherichia coli O6 malonyl CoA-acyl carrier protein transacylase FabD or TfpA or b1092 or c1361 SWALL:FABD_ECOLI (SWALL:P25715) (308 aa) fasta scores: E(): 2.6e-24, 34.75% id in 305 aa, and to Bacillus subtilis PksC protein SWALL:O34825 (EMBL:Z99112) (288 aa) fasta scores: E(): 1.3e-39, 43.35% id in 286 aa
YP_110322.1	Similar to Escherichia coli probable crotonobetaine/carnitine-CoA ligase CaiC or b0037 SWALL:CAIC_ECOLI (SWALL:P31552) (522 aa) fasta scores: E(): 2.8e-37, 29.91% id in 488 aa, and to Mycobacterium tuberculosis  chain fatty-acid-CoA ligase FadD13 or rv3089 or mtv013.10 or mt3174 SWALL:O53306 (EMBL:AL021309) (503 aa) fasta scores: E(): 5.9e-43, 32.62% id in 518 aa
YP_110323.1	Similar to Pseudomonas aeruginosa diaminopimelate decarboxylase pa5277 SWALL:DCDA_PSEAE (SWALL:P19572) (415 aa) fasta scores: E(): 1.6e-21, 31.68% id in 404 aa, and to Escherichia coli diaminopimelate decarboxylase LysA or b2838 SWALL:DCDA_ECOLI (SWALL:P00861) (420 aa) fasta scores: E(): 4.8e-19, 31.76% id in 403 aa
YP_110325.1	Similar to Bacillus subtilis ketol-acid reductoisomerase IlvC SWALL:ILVC_BACSU (SWALL:P37253) (342 aa) fasta scores: E(): 7e-27, 36.91% id in 298 aa, and to Neisseria meningitidis ketol-acid reductoisomerase nma1763 SWALL:ILVC_NEIMA (SWALL:Q9JTI3) (337 aa) fasta scores: E(): 9.9e-31, 35.71% id in 322 aa
YP_110326.1	Similar to Xanthomonas albilineans albicidin multifunctional polyketide-peptide synthase XabB SWALL:Q9AIT3 (EMBL:AF239749) (4801 aa) fasta scores: E(): 1.4e-123, 36.11% id in 3458 aa, and to Bacillus subtilis polyketide synthase PksM or PksY SWALL:PKSM_BACSU (SWALL:P40872) (4273 aa) fasta scores: E(): 2.3e-93, 36% id in 2861 aa
YP_110327.1	catalyzes the formation of 4-aminobutanoate from 4-aminobutanal; involved in putrescine degradation
YP_110328.1	Similar to Rhizobium loti aminotransferase mll3663 SWALL:Q98FQ6 (EMBL:AP003002) (472 aa) fasta scores: E(): 4.5e-88, 48.42% id in 444 aa, and to Pseudomonas aeruginosa probable class III aminotransferase pa4805 SWALL:Q9HV04 (EMBL:AE004893) (468 aa) fasta scores: E(): 4.9e-82, 47.21% id in 449 aa
YP_110329.1	Similar to Pseudomonas syringae syringomycin biosynthesis enzyme SyrP SWALL:P97053 (EMBL:U88574) (353 aa) fasta scores: E(): 2.4e-22, 31.43% id in 334 aa, and to Streptomyces verticillus SyrP-like protein SWALL:Q9FB16 (EMBL:AF210249) (339 aa) fasta scores: E(): 1.8e-21, 29.51% id in 332 aa
YP_110331.1	Similar to Microcystis aeruginosa peptide synthetase and polyketide synthase McyG SWALL:Q9FDT8 (EMBL:AB032549) (2632 aa) fasta scores: E(): 1.9e-45, 25.62% id in 2420 aa, and to Ralstonia solanacearum probable polyketide synthase rsc1810 or rs04235 SWALL:Q8XYE8 (EMBL:AL646066) (2380 aa) fasta scores: E(): 1.5e-46, 29.7% id in 2013 aa
YP_110332.1	Similar to Vibrio anguillarum transcriptional activator protein VanR SWALL:VANR_VIBAN (SWALL:P74946) (240 aa) fasta scores: E(): 2e-21, 34.32% id in 201 aa, and to Ralstonia solanacearum transcriptional activator protein SolR or rsc3287 or rs02516 SWALL:SLR1_RALSO (SWALL:P58590) (236 aa) fasta scores: E(): 2.2e-22, 37.76% id in 233 aa
YP_110333.1	Similar to Pasteurella haemolytica outer membrane lipoprotein 2 precursor PlpB SWALL:PLPB_PASHA (SWALL:Q08869) (276 aa) fasta scores: E(): 4.2e-28, 40.69% id in 231 aa, and to Escherichia coli O157:H7 D-methionine-binding lipoprotein precursor MetQ or z0209 or ecs0199 SWALL:Q8X8V9 (EMBL:AE005195) (271 aa) fasta scores: E(): 4.8e-28, 40.24% id in 246 aa
YP_110334.1	Similar to Rhodococcus sp. dibenzothiophene desulfurization enzyme A SoxA or DdszA SWALL:SOXA_RHOSG (SWALL:P54995) (453 aa) fasta scores: E(): 5.2e-52, 38.32% id in 454 aa
YP_110335.1	Similar to Escherichia coli D-methionine transport ATP-binding protein MetN or Abc or b0199 SWALL:METN_ECOLI (SWALL:P30750) (343 aa) fasta scores: E(): 6.1e-42, 46.32% id in 354 aa, and to Pseudomonas putida ABC transporter ATP-binding protein pp0220 SWALL:AAN65852 (EMBL:AE016774) (369 aa) fasta scores: E(): 5.1e-52, 53.03% id in 379 aa
YP_110336.1	Similar to Pseudomonas aeruginosa probable permease of ABC transporter pa2351 SWALL:Q9I1C7 (EMBL:AE004661) (217 aa) fasta scores: E(): 5.6e-52, 68.66% id in 217 aa, and to Brucella melitensis ABC transporter permease bmeii0336 SWALL:Q8YD41 (EMBL:AE009671) (230 aa) fasta scores: E(): 3.7e-47, 62.21% id in 217 aa
YP_110337.1	Similar to Pseudomonas aeruginosa probable FMNH2-dependent monooxygenase pa2355 SWALL:Q9I1C3 (EMBL:AE004661) (394 aa) fasta scores: E(): 3.6e-63, 46.03% id in 391 aa, and to Rhodococcus sp. dibenzothiophene desulfurization enzyme C SoxC or DszC SWALL:SOXC_RHOSO (SWALL:P54998) (417 aa) fasta scores: E(): 5.9e-34, 41.04% id in 402 aa
YP_110340.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 pyruvate dehydrogenase complex repressor PdhR or GenA or AceC or b0113 or c0140 or z0123 or ecs0117 SWALL:PDHR_ECOLI (SWALL:P06957) (254 aa) fasta scores: E(): 3.5e-24, 39.48% id in 233 aa, and to Yersinia pestis transcriptional regulator for pyruvate dehydrogenase complex y0766 SWALL:AAM84353 (EMBL:AE013678) (278 aa) fasta scores: E(): 9.3e-25, 38.75% id in 240 aa
YP_110341.1	Similar to Escherichia coli hypothetical protein YkgE or b0306 SWALL:YKGE_ECOLI (SWALL:P77252) (239 aa) fasta scores: E(): 5.7e-35, 43.03% id in 237 aa, and to Ralstonia solanacearum hypothetical protein rsc1611 or rs03974 SWALL:Q8XYZ5 (EMBL:AL646065) (241 aa) fasta scores: E(): 5.5e-50, 56.25% id in 240 aa. Note: This CDS is longer in its N-terminal region than most of its database matches
YP_110342.1	Similar to Ralstonia solanacearum  iron-sulfur binding protein rsc1612 or rs03975 SWALL:Q8XYZ4 (EMBL:AL646065) (469 aa) fasta scores: E(): 3.2e-76, 46.45% id in 465 aa, and to Pasteurella multocida hypothetical protein pm1854 SWALL:Q9CJY4 (EMBL:AE006223) (467 aa) fasta scores: E(): 9.4e-67, 41.59% id in 464 aa
YP_110343.1	C-terminus is similar to the C-terminal regions of Ralstonia solanacearum  transmembrane protein rsc1032 or rs04218 SWALL:Q8Y0L1 (EMBL:AL646062) (243 aa) fasta scores: E(): 7.3e-15, 41.11% id in 180 aa, and Bacillus subtilis YvbY protein SWALL:O32259 (EMBL:Z99121) (240 aa) fasta scores: E(): 3.6e-07, 30.86% id in 162 aa
YP_110344.1	Similar to Escherichia coli glycolate permease GlcA or b2975 SWALL:GLCA_ECOLI (SWALL:Q46839) (560 aa) fasta scores: E(): 3.4e-77, 68.47% id in 571 aa, and to Escherichia coli L-lactate permease LldP or LctP or b3603 SWALL:LLDP_ECOLI (SWALL:P33231) (551 aa) fasta scores: E(): 3.5e-65, 59.47% id in 570 aa
YP_110345.1	Similar to Escherichia coli hypothetical protein YphA or b2543 SWALL:YPHA_ECOLI (SWALL:P77751) (140 aa) fasta scores: E(): 8.9e-16, 40.32% id in 124 aa, and to Ralstonia solanacearum probable transmembrane protein rsc2500 or rs01095 SWALL:Q8XWH4 (EMBL:AL646070) (136 aa) fasta scores: E(): 2.5e-14, 42.85% id in 119 aa
YP_110346.1	Similar (appart from the internal repeat region) the plasmid-borne Streptomyces coelicolor methylenomycin A resistance protein Mmr or scp1.237C SWALL:MMR_STRCO (SWALL:P11545) (475 aa) fasta scores: E(): 7.2e-20, 32.75% id in 464 aa, and to Rhizobium loti probable transporter mll2542 SWALL:Q98I66 (EMBL:AP002999) (505 aa) fasta scores: E(): 8.6e-22, 32.99% id in 494 aa. The effect of the extra internal amino acids on the function of protein is not known
YP_110347.1	Similar to Pseudomonas aeruginosa probable MFS transporter pa5370 SWALL:Q9HTJ4 (EMBL:AE004949) (438 aa) fasta scores: E(): 1.6e-109, 66.82% id in 425 aa, and to Agrobacterium tumefaciens MFS permease[proline/betaine] TphA or atu2154 or agr_c_3904 SWALL:Q8UDH1 (EMBL:AE009165) (443 aa) fasta scores: E(): 1.5e-88, 55.76% id in 416 aa
YP_110348.1	Similar to Methanothermus fervidus malate/L-sulfolactate dehydrogenase Mdh SWALL:MDH_METFE (SWALL:P16142) (339 aa) fasta scores: E(): 6.7e-22, 31.76% id in 277 aa, and to Pseudomonas aeruginosa hypothetical oxidoreductase pa1252 SWALL:YC52_PSEAE (SWALL:Q9I492) (334 aa) fasta scores: E(): 5.2e-77, 61.56% id in 333 aa
YP_110349.1	Similar to Caulobacter crescentus fatty aldehyde dehydrogenase cc2791 SWALL:Q9A4N9 (EMBL:AE005944) (528 aa) fasta scores: E(): 6.8e-120, 65.7% id in 522 aa, and to Vibrio harveyi fatty aldehyde dehydrogenase AldH SWALL:DHAF_VIBHA (SWALL:Q56694) (510 aa) fasta scores: E(): 1.5e-76, 47.22% id in 504 aa. Note: Also similar to BPSS0034 (527 aa) fasta scores: E(): 7.3e-87, 60.803% identity in 523 aa overlap
YP_110350.1	Similar to Xanthomonas campestris amino acid permease YveA or xcc2406 SWALL:AAM41684 (EMBL:AE012351) (528 aa) fasta scores: E(): 4.7e-138, 70.19% id in 520 aa, and to Ralstonia solanacearum probable amino-acid permease transmembrane protein rsp0282 or rs03682 SWALL:Q8XT33 (EMBL:AL646077) (543 aa) fasta scores: E(): 4.4e-69, 38.47% id in 512 aa. Note: This CDS is longer in its N-terminal region than most of its database matches
YP_110351.1	Similar to Prochlorococcus marinus dihydrodipicolinate synthase DapA SWALL:DAPA_PROMA (SWALL:P49423) (302 aa) fasta scores: E(): 1.1e-19, 30.24% id in 291 aa, and to Pseudomonas aeruginosa probable dihydrodipicolinate synthetase pa1254 SWALL:Q9I490 (EMBL:AE004555) (305 aa) fasta scores: E(): 3.3e-92, 73.52% id in 306 aa
YP_110352.1	Similar to Pseudomonas aeruginosa hypothetical protein pa1268 SWALL:Q9I476 (EMBL:AE004556) (314 aa) fasta scores: E(): 1.1e-84, 71.79% id in 312 aa, and to Xanthomonas axonopodis hypothetical protein xac2550 SWALL:AAM37401 (EMBL:AE011895) (312 aa) fasta scores: E(): 5e-64, 57.82% id in 313 aa
YP_110353.1	Similar to Xanthomonas campestris D-amino acid oxidase xcc2414 SWALL:AAM41692 (EMBL:AE012352) (389 aa) fasta scores: E(): 7.1e-63, 53.84% id in 364 aa, and to Rhizobium meliloti opine oxidase subunit B OoxB SWALL:OOB2_RHIME (SWALL:P72299) (371 aa) fasta scores: E(): 1.2e-08, 26.24% id in 381 aa
YP_110354.1	Similar to Xanthomonas campestris sarcosine oxidase alpha subunit SoxA or xcc2413 SWALL:AAM41691 (EMBL:AE012352) (81 aa) fasta scores: E(): 3.1e-08, 48.61% id in 72 aa, and to Pseudomonas aeruginosa hydrogen cyanide synthase HcnA or pa2193 SWALL:Q9REV9 (EMBL:AF208523) (104 aa) fasta scores: E(): 1.3e-07, 45.33% id in 75 aa
YP_110355.1	Similar to Rhizobium meliloti opine oxidase subunit A OoxA or ra1200 or sma2225 SWALL:OOA1_RHIME (SWALL:Q92XP4) (458 aa) fasta scores: E(): 3.2e-06, 32.88% id in 450 aa, and to Xanthomonas campestris oxidoreductase xcc2412 SWALL:AAM41690 (EMBL:AE012352) (444 aa) fasta scores: E(): 4.9e-58, 48.15% id in 434 aa
YP_110356.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa1261 SWALL:Q9I483 (EMBL:AE004555) (224 aa) fasta scores: E(): 6.8e-51, 58.48% id in 224 aa, and to Xanthomonas axonopodis transcriptional regulator xac2551 SWALL:Q8PJI0 (EMBL:AE011895) (226 aa) fasta scores: E(): 1.5e-38, 45.53% id in 224 aa
YP_110358.2	Similar to Shigella flexneri  transposase for IS110 s0128 SWALL:Q9AFS5 (EMBL:AF348706) (398 aa) fasta scores: E(): 3e-111, 76.73% id in 404 aa, and to Streptomyces coelicolor insertion element IS110 hypothetical 43.6 kDa protein SWALL:YIS1_STRCO (SWALL:P19780) (405 aa) fasta scores: E(): 3.9e-75, 58.71% id in 390 aa. Note: Also similar to BPSS1472 (428 aa) fasta scores: E(): 9.1e-117, 88.732% identity in 426 aa overlap
YP_110359.1	Similar to Pseudomonas putida 4-hydroxyphenylpyruvate dioxygenase,  pp2554 SWALL:AAN68163 (EMBL:AE016783) (635 aa) fasta scores: E(): 2.8e-61, 53.44% id in 683 aa. CDS contains region with additional internal amino acids (residues 272 to 338) in comparison to orthologues
YP_110360.1	catalyzes the formation of 3-dehydroshikimate from 3-dehydroquinate in chorismate biosynthesis
YP_110361.1	AroE; catalyzes the conversion of shikimate to 3-dehydroshikimate
YP_110362.1	Similar to Ralstonia solanacearum  glucarate transporter GudP or rsp0828 or rs05367 SWALL:Q8XRK3 (EMBL:AL646081) (450 aa) fasta scores: E(): 9.1e-73, 44.14% id in 444 aa, and to Escherichia coli, and Escherichia coli O6 D-galactonate transporter DgoT or b3691 or c4612 SWALL:DGOT_ECOLI (SWALL:P31457) (430 aa) fasta scores: E(): 9.8e-71, 46.26% id in 428 aa
YP_110363.1	catalyzes the formation of phosphonoacetaldehyde from 2-aminoethylphosphonate and pyruvate
YP_110364.1	Similar to Salmonella typhi probable periplasmic binding component of 2-aminoethylphosphonate transporter PhnS or sty0468 SWALL:Q8Z8W7 (EMBL:AL627266) (337 aa) fasta scores: E(): 1.8e-31, 37.03% id in 324 aa, and to Pyrococcus furiosus  solute binding lipoprotein pf1751 SWALL:Q9HH27 (EMBL:AF307052) (357 aa) fasta scores: E(): 2.2e-19, 29.26% id in 352 aa
YP_110365.1	Similar to Agrobacterium tumefaciens ABC transporter nucleotide binding/ATPase AfuC or atu4786 or agr_l_193 SWALL:Q8U6M1 (EMBL:AE009407) (353 aa) fasta scores: E(): 7e-41, 40.4% id in 349 aa, and to Brucella melitensis iron(III)-transport ATP-binding protein bmeii0567 SWALL:Q8YCG3 (EMBL:AE009693) (353 aa) fasta scores: E(): 2.6e-40, 44.59% id in 305 aa
YP_110366.1	Similar to Salmonella typhimurium PhnU or stm0427 SWALL:P96064 (EMBL:U69493) (286 aa) fasta scores: E(): 5.1e-28, 36.78% id in 261 aa, and to Brucella melitensis iron(III)-transport system permease bmeii0585 SWALL:Q8YCE6 (EMBL:AE009695) (448 aa) fasta scores: E(): 2.7e-14, 32.28% id in 285 aa. CDS is extended at the N-terminus in comparison to orthologues
YP_110367.1	Similar to Salmonella typhimurium PhnV or stm0426 SWALL:P96065 (EMBL:U69493) (265 aa) fasta scores: E(): 2.7e-22, 34.97% id in 243 aa, and to Rhizobium meliloti spermidine putrescine ABC transporter permease PotC or rb0779 or smb21275 SWALL:Q92VC9 (EMBL:AL603644) (259 aa) fasta scores: E(): 5.8e-13, 30.54% id in 239 aa
YP_110368.1	Similar to Pseudomonas fluorescens phosphonoacetate hydrolase PhnA SWALL:Q51782 (EMBL:L49465) (407 aa) fasta scores: E(): 1.5e-94, 60.48% id in 410 aa, and to Rhizobium meliloti  phosphonoacetate hydrolase rb0978 or smb21538 SWALL:Q92UV8 (EMBL:AL603645) (424 aa) fasta scores: E(): 3.1e-85, 56.06% id in 412 aa
YP_110369.1	Similar to Streptococcus mutans NADP-dependent glyceraldehyde-3-phosphate dehydrogenase GapN or smu.676 SWALL:GAPN_STRMU (SWALL:Q59931) (475 aa) fasta scores: E(): 3.5e-48, 35.32% id in 453 aa, and to Methanobacterium thermoautotrophicum NADP-dependent glyceraldehyde-3-phosphate dehydrogenase mth978 SWALL:O27059 (EMBL:AE000871) (455 aa) fasta scores: E(): 8.9e-58, 42.3% id in 442 aa. Note: Also similar to BPSS0607 (491 aa) fasta scores: E(): 2.8e-91, 59.244% identity in 476 aa overlap
YP_110370.1	Similar to Anabaena sp. hypothetical protein all2220 SWALL:Q8YUW1 (EMBL:AP003588) (186 aa) fasta scores: E(): 2.9e-29, 47.54% id in 183 aa, and to Pseudomonas aeruginosa hypothetical protein pa2804 SWALL:Q9I039 (EMBL:AE004707) (193 aa) fasta scores: E(): 1.4e-25, 49.71% id in 175 aa
YP_110371.1	Similar to Escherichia coli transcriptional regulator CueR or b0487 SWALL:CUER_ECOLI (SWALL:P77565) (135 aa) fasta scores: E(): 4.6e-18, 44.27% id in 131 aa, and to Rhizobium meliloti transcriptional regulator HmrR SWALL:HMRR_RHIME (SWALL:Q9X5X4) (147 aa) fasta scores: E(): 1.9e-30, 65.35% id in 127 aa
YP_110372.1	Similar to Escherichia coli hypothetical protein YhiR or b3499 SWALL:YHIR_ECOLI (SWALL:P37634) (280 aa) fasta scores: E(): 7.5e-46, 48.28% id in 263 aa, and to Ralstonia solanacearum hypothetical protein rsc3368 or rs02643 SWALL:Q8XU26 (EMBL:AL646075) (285 aa) fasta scores: E(): 1.4e-73, 62.1% id in 285 aa
YP_110373.1	Similar to the C-terminal region of Homo sapiens voltage-gated potassium channel beta-2 subunit KCNAB2 or KCNA2b or KCNK2 SWALL:KVB2_HUMAN (SWALL:Q13303) (367 aa) fasta scores: E(): 4.2e-56, 45.79% id in 321 aa, and to Xanthomonas campestris voltage-gated potassium channel beta subunit XCC0766 SWALL:AAM40081 (EMBL:AE012176) (322 aa) fasta scores: E(): 5.7e-62, 52.97% id in 319 aa
YP_110374.1	catalyzes the formation of acetoacetate from 3-hydroxybutyrate
YP_110375.1	catalyzes the formation of L-glutamate and an aromatic oxo acid from an aromatic amino acid and 2-oxoglutarate
YP_110376.1	The UvrABC repair system catalyzes the recognition and processing of DNA lesions. The beta-hairpin of the Uvr-B subunit is inserted between the strands, where it probes for the presence of a lesion
YP_110377.1	Similar to Brucella melitensis 19 kDa periplasmic protein bmeii0885 SWALL:Q8YBL4 (EMBL:AE009722) (185 aa) fasta scores: E(): 2.8e-42, 61.62% id in 185 aa, and to Brucella suis membrane antigen,  bra0381 SWALL:AAN33579 (EMBL:AE014537) (182 aa) fasta scores: E(): 4.4e-42, 67.27% id in 165 aa
YP_110378.1	Similar to Brucella melitensis hypothetical protein bmeii0884 SWALL:Q8YBL5 (EMBL:AE009722) (124 aa) fasta scores: E(): 2.2e-13, 46.29% id in 108 aa, and to Rickettsia conorii hypothetical protein rc0541 SWALL:Q92I79 (EMBL:AE008615) (126 aa) fasta scores: E(): 2.7e-07, 38.27% id in 81 aa
YP_110379.1	Similar to Escherichia coli hypothetical protein YcdN or b1016/b1017 SWALL:YCDN_ECOLI (SWALL:P75901) (276 aa) fasta scores: E(): 5e-17, 30.28% id in 284 aa, and to Brucella melitensis high-affinity iron permease bmeii0883 SWALL:Q8YBL6 (EMBL:AE009722) (278 aa) fasta scores: E(): 6.8e-49, 53.58% id in 265 aa
YP_110380.1	Similar to Brucella melitensis nitrogen fixation protein VnfA bmeii0882 SWALL:Q8YBL7 (EMBL:AE009722) (457 aa) fasta scores: E(): 3.1e-104, 54.08% id in 453 aa, and to the C-terminal region of Anabaena sp. nitrogen assimilation regulatory protein all3558 SWALL:Q8YR90 (EMBL:AP003593) (841 aa) fasta scores: E(): 7.5e-11, 27.25% id in 466 aa
YP_110381.1	Similar to Escherichia coli, and Escherichia coli O6 protein GlcG or b2977 or c3706 SWALL:GLCG_ECOLI (SWALL:P45504) (134 aa) fasta scores: E(): 1.9e-20, 49.24% id in 132 aa, and to Pseudomonas aeruginosa hypothetical protein pa5352 SWALL:Q9HTK6 (EMBL:AE004947) (133 aa) fasta scores: E(): 6.9e-22, 53.38% id in 133 aa
YP_110382.1	Low similarity to Ralstonia solanacearum  hemin uptake protein HemP or rsc1966 or rs03540 SWALL:Q8XXZ7 (EMBL:AL646067) (92 aa) fasta scores: E(): 0.0018, 39.02% id in 82 aa
YP_110383.1	Similar to Ralstonia solanacearum hypothetical protein rsc1364 or rs04646 SWALL:Q8XZN1 (EMBL:AL646064) (156 aa) fasta scores: E(): 3.5e-24, 49.67% id in 155 aa, and to Pseudomonas aeruginosa hypothetical protein pa1206 SWALL:Q9I4D2 (EMBL:AE004550) (157 aa) fasta scores: E(): 6e-14, 38.81% id in 152 aa
YP_110384.1	Similar to Streptomyces coelicolor possible chromosome condensation protein sco3798 or scac2.06C SWALL:Q9F320 (EMBL:AL939117) (325 aa) fasta scores: E(): 1.5e-47, 45.39% id in 293 aa, and to Lycopersicon esculentum pirin-like protein SWALL:PIRL_LYCES (SWALL:Q9SEE4) (291 aa) fasta scores: E(): 4.2e-45, 45.93% id in 283 aa
YP_110385.1	Similar to Xanthomonas axonopodis transcriptional regulator xac1655 SWALL:AAM36523 (EMBL:AE011797) (333 aa) fasta scores: E(): 1.4e-49, 45.39% id in 315 aa, and to Yersinia pestis lysr-family transcriptional regulatory protein ypo2150 SWALL:Q8ZEL4 (EMBL:AJ414151) (301 aa) fasta scores: E(): 4.5e-45, 43.33% id in 300 aa. Note: This CDS contains two possible alternative start codons at residues 8 or 18
YP_110386.1	Similar to Xanthomonas campestris biopolymer transport protein ExbD1 or xcc0010 SWALL:EXB1_XANCP (SWALL:O34259) (140 aa) fasta scores: E(): 4.8e-18, 43.18% id in 132 aa, and to Ralstonia solanacearum probable biopolymer transport transmembrane protein rsc1965 or rs03539 SWALL:Q8XXZ8 (EMBL:AL646067) (137 aa) fasta scores: E(): 4.7e-30, 61.76% id in 136 aa
YP_110387.1	Similar to Xanthomonas campestris biopolymer transport protein ExbB or xcc0009 SWALL:EXBB_XANCP (SWALL:O34260) (253 aa) fasta scores: E(): 1.3e-30, 42.46% id in 219 aa, and to Pseudomonas aeruginosa TolQ protein or pa0969 SWALL:TOLQ_PSEAE (SWALL:P50598) (231 aa) fasta scores: E(): 1.7e-15, 30.95% id in 210 aa
YP_110388.1	Similar to Ralstonia solanacearum probable TonB transmembrane protein or rsc1963 or rs03537 SWALL:Q8XY00 (EMBL:AL646067) (221 aa) fasta scores: E(): 5.8e-10, 35.71% id in 238 aa, and to Bordetella bronchiseptica TonB SWALL:Q9ZG18 (EMBL:AF087669) (268 aa) fasta scores: E(): 2.4e-06, 33.86% id in 251 aa
YP_110389.1	Similar to Escherichia coli, and Escherichia coli O6 bacterioferritin-associated ferredoxin Bfd or b3337 or c4108 SWALL:BFD_ECOLI (SWALL:P13655) (64 aa) fasta scores: E(): 0.002, 35.84% id in 53 aa, and to Ralstonia solanacearum  bacterioferritin-associated ferredoxin protein rsc0349 or rs03316 SWALL:Q8Y2I7 (EMBL:AL646058) (91 aa) fasta scores: E(): 6.3e-07, 45.45% id in 55 aa. CDS is extended at the C-terminus in comparison to orthologues
YP_110390.1	converts L-glutamate to D-glutamate, a component of peptidoglycan
YP_110391.1	Similar to Azotobacter vinelandii bacterioferritin Bfr SWALL:BFR_AZOVI (SWALL:P22759) (156 aa) fasta scores: E(): 3.7e-38, 68.83% id in 154 aa, and to Serratia marcescens bacterioferritin Bfr SWALL:BFR_SERMA (SWALL:O68935) (159 aa) fasta scores: E(): 1.2e-32, 59.74% id in 154 aa
YP_110392.1	Similar to Escherichia coli, and Escherichia coli O6 fumarate hydratase class I, aerobic FumA or b1612 or c2004 SWALL:FUMA_ECOLI (SWALL:P00923) (547 aa) fasta scores: E(): 1.1e-29, 33.89% id in 472 aa, and to Ralstonia solanacearum probable fumarate hydratase rsc1955 or rs03529 SWALL:Q8XY08 (EMBL:AL646067) (507 aa) fasta scores: E(): 1.3e-168, 85.51% id in 511 aa
YP_110393.1	Similar to Escherichia coli, and Escherichia coli O157:H7 hypothetical protein YqhA or b3002 or z4355 or ecs3886 SWALL:YQHA_ECOLI (SWALL:P52082) (164 aa) fasta scores: E(): 8.3e-22, 37.65% id in 162 aa, and to Ralstonia solanacearum probable transmembrane protein rsc1954 or rs03528 SWALL:Q8XY09 (EMBL:AL646067) (179 aa) fasta scores: E(): 6.6e-50, 78.78% id in 165 aa
YP_110394.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc1953 or rs03527 SWALL:Q8XY10 (EMBL:AL646067) (336 aa) fasta scores: E(): 2.9e-71, 66.1% id in 298 aa, and to Bacillus subtilis hypothetical transport protein YetK SWALL:YETK_BACSU (SWALL:O31540) (330 aa) fasta scores: E(): 2.6e-32, 33.55% id in 295 aa
YP_110395.1	Acs; catalyzes the conversion of acetate and CoA to acetyl-CoA
YP_110397.1	Similar to Ralstonia solanacearum probable solute:Na+ symporter permease transmembrane protein rsc1951 or rs03525 SWALL:Q8XY12 (EMBL:AL646067) (688 aa) fasta scores: E(): 2.8e-156, 62.25% id in 673 aa, and to Alcaligenes eutrophus hypothetical protein in acoE 3'region SWALL:YACO_ALCEU (SWALL:P31640) (332 aa) fasta scores: E(): 1e-66, 59.31% id in 322 aa
YP_110398.1	Similar to Escherichia coli prophage CP4-57 integrase IntA or SlpA or IntX or b2622 SWALL:INTA_ECOLI (SWALL:P32053) (413 aa) fasta scores: E(): 2.6e-30, 31.07% id in 399 aa, and to Ralstonia solanacearum  integrase prophage protein rsc1896 or rs03460 SWALL:Q8XY67 (EMBL:AL646067) (411 aa) fasta scores: E(): 2.3e-67, 49.59% id in 373 aa
YP_110400.1	Similar to Bacillus subtilis BglII control element BglIIC SWALL:Q45487 (EMBL:U49842) (77 aa) fasta scores: E(): 3e-06, 40.98% id in 61 aa, and to Salmonella enterica, and Salmonella paratyphi-A regulatory protein SbaIC SWALL:Q9EZ27 (EMBL:AF508974) (78 aa) fasta scores: E(): 4.9e-06, 44.44% id in 72 aa. Note: Also similar to BPSS0381 (82 aa) fasta scores: E(): 2.7e-27, 88.889% identity in 81 aa overlap
YP_110401.1	Doubtful CDS. No significant database matches
YP_110402.1	Doubtful CDS. No significant database matches
YP_110403.1	Similar to Bacillus subtilis BglII control element BglIIC SWALL:Q45487 (EMBL:U49842) (77 aa) fasta scores: E(): 1.2e-05, 37.7% id in 61 aa, and to Salmonella enterica, and Salmonella paratyphi-a regulatory protein SbaIC SWALL:Q9EZ27 (EMBL:AF508974) (78 aa) fasta scores: E(): 1.2e-05, 38.88% id in 72 aa. Note: Also similar to BPSS0380 (82 aa) fasta scores: E(): 6.3e-28, 88.889% identity in 81 aa overlap
YP_110404.1	Similar in its N-terminal region to Escherichia coli DNA primase TraC SWALL:TRC4_ECOLI (SWALL:P27189) (1061 aa) fasta scores: E(): 5.5e-22, 32.87% id in 362 aa, and in its C-terminal region to Salmonella typhimurium inner membrane protein stm2745 SWALL:Q8ZMQ9 (EMBL:AE008824) (689 aa) fasta scores: E(): 2.7e-61, 33.57% id in 691 aa. Note: Also similar to BPSL0082 (956 aa) fasta scores: E(): 0, 91.832% identity in 955 aa overlap
YP_110405.1	Similar to Yersinia pestis  regulatory protein ypo0878 or y3260 SWALL:Q8ZHL3 (EMBL:AJ414145) (66 aa) fasta scores: E(): 8.5e-05, 42% id in 50 aa, and to Vibrio cholerae transcriptional regulator vc1785 SWALL:Q9KR58 (EMBL:AE004255) (68 aa) fasta scores: E(): 8.8e-05, 37.03% id in 54 aa
YP_110409.1	Similar to Escherichia coli transposon tn2501 resolvase TnpR SWALL:TNR0_ECOLI (SWALL:P05823) (194 aa) fasta scores: E(): 6.7e-43, 67.02% id in 188 aa, and to Salmonella typhimurium DNA-invertase Hin or stm2772 SWALL:HIN_SALTY (SWALL:P03013) (190 aa) fasta scores: E(): 4.3e-17, 37.7% id in 183 aa
YP_110410.1	Similar to Burkholderia thailandensis bacteriophage phiE125 protein Gp31 SWALL:Q8VP95 (EMBL:AY063741) (363 aa) fasta scores: E(): 2.3e-32, 36.74% id in 362 aa
YP_110411.1	Similar to Burkholderia thailandensis bacteriophage phiE125 protein Gp30 SWALL:Q8VP96 (EMBL:AY063741) (244 aa) fasta scores: E(): 7.1e-27, 42.04% id in 245 aa
YP_110412.1	Similar to Burkholderia thailandensis bacteriophage phiE125 protein Gp29 SWALL:Q8VP97 (EMBL:AY063741) (186 aa) fasta scores: E(): 4.1e-35, 60.77% id in 181 aa
YP_110413.1	Similar to Rhizobium meliloti hypothetical protein r02039 or smc04441 SWALL:Q92K60 (EMBL:AL591789) (62 aa) fasta scores: E(): 1.9e-11, 61.01% id in 59 aa, and to Clostridium perfringens hypothetical protein pcp27 SWALL:Q93MC0 (EMBL:AP003515) (65 aa) fasta scores: E(): 6.2e-11, 53.44% id in 58 aa
YP_110414.1	Similar to Bacteriophage HP1 hypothetical 14.9 kDa protein in rep-hol intergenic region SWALL:YO14_BPHP1 (SWALL:P51716) (133 aa) fasta scores: E(): 8.8e-14, 38.34% id in 133 aa, and to Rhizobium loti hypothetical protein mlr2150 SWALL:Q98J17 (EMBL:AP002999) (133 aa) fasta scores: E(): 2.2e-11, 40.32% id in 124 aa
YP_110416.1	C-terminus is similar to the C-terminal region of Rhizobium meliloti hypothetical protein r00618 or smc04432 SWALL:Q92KN5 (EMBL:AL591784) (105 aa) fasta scores: E(): 6.9e-07, 52.63% id in 57 aa. Similar to Yersinia pestis hypothetical protein ypo1882 or y2427 SWALL:Q8ZF36 (EMBL:AJ414150) (96 aa) fasta scores: E(): 1e-06, 41.57% id in 89 aa
YP_110417.1	Low similarity in its C-termianl region to Xylella fastidiosa hypothetical protein xf1562 SWALL:Q9PD18 (EMBL:AE003986) (88 aa) fasta scores: E(): 7.9e-07, 52.94% id in 51 aa
YP_110418.1	Similar to Bacteriophage phiE125 Gp49 SWALL:Q8W6Q1 (EMBL:AF447491) (91 aa) fasta scores: E(): 3.7e-34, 95.6% id in 91 aa
YP_110419.1	Similar to Bacteriophage phiE125 Gp48 SWALL:Q8W6Q2 (EMBL:AF447491) (43 aa) fasta scores: E(): 1.5e-15, 97.67% id in 43 aa
YP_110422.1	Similar to Bacteriophage phiE125 Gp46 SWALL:Q8W6Q4 (EMBL:AF447491) (84 aa) fasta scores: E(): 2.9e-34, 95.23% id in 84 aa
YP_110423.1	Low similarity in parts to Bacteriophage phiE125 Gp45 SWALL:Q8W6Q5 (EMBL:AF447491) (217 aa) fasta scores: E(): 0.12, 34.78% id in 115 aa
YP_110424.1	Identical to Bacteriophage phiE125 Gp44 SWALL:Q8W6Q6 (EMBL:AF447491) (49 aa) fasta scores: E(): 8.1e-19, 100% id in 49 aa
YP_110425.1	Probable fusion protein. N-terminal region highly similar to Bacteriophage phiE125 Gp43 SWALL:Q8W6Q7 (EMBL:AF447491) (270 aa) fasta scores: E(): 5e-90, 99.61% id in 258 aa, and C-terminal region to Pseudomonas putida transposase, ORFB pp4420 SWALL:AAN69997 (EMBL:AE016790) (269 aa) fasta scores: E(): 1.3e-18, 48.07% id in 156 aa; N-terminal region highly similar to Bacteriophage phiE125 Gp43 SWALL:Q8W6Q7 (EMBL:AF447491) (270 aa) fasta scores: E(): 5e-90, 99.61% id in 258 aa, and C-terminal region to Pseudomonas putida transposase, ORFB pp4420 SWALL:AAN69997 (EMBL:AE016790) (269 aa) fasta scores: E(): 1.3e-18, 48.07% id in 156 aa
YP_110426.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein rsc2492 or rs01104 SWALL:Q8XWI2 (EMBL:AL646070) (502 aa) fasta scores: E(): 1.1e-131, 66.73% id in 490 aa, and N-terminal region to Wolbachia sp. Wri phosphoprotein phosphatase SWALL:Q9RBM2 (EMBL:AJ012073) (428 aa) fasta scores: E(): 7.3e-21, 29.89% id in 368 aa. Note: Also similar to BPSS1331 (516 aa) fasta scores: E(): 1.2e-154, 87.866% identity in 478 aa overlap
YP_110427.1	Similar to Paracoccus denitrificans methylamine utilization protein precursor MauG SWALL:MAUG_PARDE (SWALL:Q51658) (387 aa) fasta scores: E(): 4.3e-18, 34.41% id in 369 aa, and to Rhizobium loti methylamine utilization protein mlr1826 SWALL:Q98JQ7 (EMBL:AP002998) (437 aa) fasta scores: E(): 1.8e-46, 40.57% id in 419 aa. Possible alternative translational start site
YP_110428.1	Similar to Mycobacterium tuberculosis hypothetical protein precursor rv2277c or mt2337 or mtcy339.33 SWALL:YM77_MYCTU (SWALL:Q50687) (301 aa) fasta scores: E(): 2.3e-38, 40.53% id in 301 aa, and to Yersinia pestis exported protein ypo3232 or y0958 SWALL:Q8ZBZ8 (EMBL:AJ414156) (315 aa) fasta scores: E(): 5.7e-29, 49.16% id in 299 aa
YP_110429.1	No significant database matches. Doubtful CDS
YP_110430.1	Similar to Rhodobacter capsulatus  insertion element SWALL:O68064 (EMBL:AF010496) (191 aa) fasta scores: E(): 4e-49, 68.68% id in 182 aa, and to Ralstonia solanacearum ISrso14-transposase ORFB protein SWALL:Q8XF72 (EMBL:AL646083) (275 aa) fasta scores: E(): 1.7e-11, 34.18% id in 234 aa. Note: Also similar in its N-terminal region to BPSS0661 (276 aa) fasta scores: E(): 5.1e-52, 97.143% identity in 140 aa overlap and in its C-terminal region to BPSS0662 (59 aa) fasta scores: E(): 3.6e-18, 96.429% identity in 56 aa overlap
YP_110437.1	Similar to Caulobacter crescentus acetolactate synthase, large subunit cc2100 SWALL:Q9A6J3 (EMBL:AE005883) (582 aa) fasta scores: E(): 3.3e-53, 36.34% id in 575 aa, and to Bacillus subtilis acetolactate synthase large subunit IlvB SWALL:ILVB_BACSU (SWALL:P37251) (573 aa) fasta scores: E(): 7.6e-53, 33.74% id in 572 aa
YP_110438.1	Similar to Salmonella typhimurium  outer membrane lipoprotein YjbH or stm4225 SWALL:Q8ZKI1 (EMBL:AE008897) (698 aa) fasta scores: E(): 2.6e-34, 40.08% id in 726 aa, and to Escherichia coli hypothetical lipoprotein precursor YmcA or b0984 SWALL:YMCA_ECOLI (SWALL:P75882) (698 aa) fasta scores: E(): 4.8e-33, 39.68% id in 693 aa. Note: N-terminal region presents no similarities to any database entries
YP_110441.1	C-terminus is weakly similar to the C-terinal region of Escherichia coli polysialic acid transport protein precursor KpsD SWALL:KSD1_ECOLI (SWALL:Q03961) (558 aa) fasta scores: E(): 1.4e-09, 25.1% id in 458 aa, and to Shewanella oneidensis polysaccharide biosynthesis protein so3193 SWALL:AAN56193 (EMBL:AE015757) (921 aa) fasta scores: E(): 5.3e-26, 26.41% id in 863 aa
YP_110442.1	Similar to Escherichia coli, and Escherichia coli O6 capsule polysaccharide export inner-membrane protein KpsE or c3687 SWALL:KSE5_ECOLI (SWALL:P42214) (382 aa) fasta scores: E(): 0.00055, 22.35% id in 340 aa, and to Ralstonia solanacearum  tyrosine-protein kinase EpsB SWALL:EPB2_RALSO (SWALL:Q45409) (750 aa) fasta scores: E(): 7.4e-06, 25.16% id in 302 aa. Note: The N-terminal region does not seem to present any similarities with database entries. Possible alternative translational start site
YP_110443.1	Similar to Salmonella typhimurium glucose-1-phosphate cytidylyltransferase RfbF or stm2092 SWALL:RFBF_SALTY (SWALL:P26396) (257 aa) fasta scores: E(): 4e-73, 68.09% id in 257 aa, and to Yersinia enterocolitica DdhA SWALL:Q56860 (EMBL:U46859) (261 aa) fasta scores: E(): 9e-74, 66.14% id in 257 aa
YP_110444.1	Similar to Salmonella typhimurium CDP-glucose 4,6-dehydratase RfbG or stm2091 SWALL:RFBG_SALTY (SWALL:P26397) (359 aa) fasta scores: E(): 2.3e-85, 55.55% id in 351 aa, and to Yersinia pseudotuberculosis CDP-D-glucose-4,6-dehydratase AscB or DdhB SWALL:Q57329 (EMBL:L33181) (357 aa) fasta scores: E(): 8.7e-88, 58.33% id in 348 aa
YP_110445.1	Similar to Salmonella typhimurium lipopolysaccharide biosynthesis protein RfbH or stm2090 SWALL:RFBH_SALTY (SWALL:P26398) (437 aa) fasta scores: E(): 4.6e-120, 64.45% id in 436 aa, and to Yersinia pseudotuberculosis, and Yersinia pseudotuberculosis CDP-4-keto-6-deoxy-D-glucose-3-dehydrase DdhC SWALL:Q05341 (EMBL:AF461770) (437 aa) fasta scores: E(): 1.3e-119, 65.13% id in 436 aa
YP_110446.1	C-terminal region similar to Escherichia coli, and Escherichia coli O157:H7 perosamine synthetase Per or RfbE or z3200 or ecs2841 SWALL:O07849 (EMBL:AF061251) (366 aa) fasta scores: E(): 3.5e-50, 38.76% id in 356 aa and N-terminal region similar to Agrobacterium tumefaciens acetyltransferase atu2080 or agr_c_3768 SWALL:Q8UDP1 (EMBL:Q8UDP1) (177 aa) blastp scores: Score = 39.9 bits (91), Expect = 0.14 Identities = 46/165 (27%), Positives = 70/165 (41%), Gaps = 18/165 (10%)
YP_110447.1	Similar to Salmonella enterica hypothetical protein with 12 predicted transmembrane segments which possibly functions in export of O-antigen SWALL:Q00339 (EMBL:X61917) (446 aa) fasta scores: E(): 2e-39, 30.15% id in 441 aa, and to Sphingomonas sp. S88 hypothetical 47.3 kDa protein SpsS SWALL:P74815 (EMBL:U51197) (452 aa) fasta scores: E(): 1.5e-05, 26.01% id in 469 aa
YP_110448.1	Similar to Salmonella enterica WbaR protein SWALL:Q00337 (EMBL:X61917) (320 aa) fasta scores: E(): 1.1e-15, 32.25% id in 248 aa, and low similarity to Salmonella typhimurium O antigen biosynthesis abequosyltransferase RfbV or stm2087 SWALL:RFBV_SALTY (SWALL:P26401) (333 aa) fasta scores: E(): 0.00069, 26.54% id in 275 aa
YP_110449.1	Similar to Escherichia coli lipopolysaccharide heptosyltransferase-1 RfaC or WaaC or Rfa-2 or b3621 SWALL:RFAC_ECOLI (SWALL:P24173) (319 aa) fasta scores: E(): 7.8e-07, 26.45% id in 310 aa, and to Rhizobium loti ADP-heptose-LPS heptosyltransferase mlr2566 SWALL:Q98I51 (EMBL:AP003000) (335 aa) fasta scores: E(): 1.8e-15, 26.87% id in 346 aa
YP_110450.1	Similar to Escherichia coli WaaQ SWALL:Q9R9D5 (EMBL:AF019746) (340 aa) fasta scores: E(): 4.7e-06, 22.68% id in 335 aa, and to Neisseria gonorrhoeae ADP-heptose:LPS heptosyltransferase II RfaF SWALL:Q51063 (EMBL:Z37141) (336 aa) fasta scores: E(): 5.8e-09, 24.92% id in 349 aa
YP_110451.1	Similar to Escherichia coli  lipopolysaccharide biosynthesis O-acetyl transferase WbbJ or b2033 SWALL:WBBJ_ECOLI (SWALL:P37750) (196 aa) fasta scores: E(): 4.5e-09, 36.06% id in 122 aa, and to Aeromonas hydrophila O-acetyl transferase SWALL:AAM74482 (EMBL:AF148126) (199 aa) fasta scores: E(): 2.2e-11, 31.6% id in 174 aa
YP_110452.1	Similar to Salmonella enterica rhamnosyl transferase SWALL:Q00482 (EMBL:X61917) (347 aa) fasta scores: E(): 4.6e-25, 30.03% id in 323 aa, and to Salmonella typhimurium O antigen biosynthesis abequosyltransferase RfbV or stm2087 SWALL:RFBV_SALTY (SWALL:P26401) (333 aa) fasta scores: E(): 0.00046, 23.58% id in 229 aa
YP_110454.1	Similar to Pseudomonas putida transcriptional regulator, LysR family pp3811 SWALL:AAN69405 (EMBL:AE016788) (294 aa) fasta scores: E(): 9.2e-52, 50% id in 288 aa, and to Bradyrhizobium japonicum transcriptional regulatory protein blr6553 SWALL:BAC51818 (EMBL:AP005959) (323 aa) fasta scores: E(): 8.9e-39, 41.69% id in 295 aa
YP_110455.1	Similar to Escherichia coli protein YhhW or b3439 SWALL:YHHW_ECOLI (SWALL:P46852) (231 aa) fasta scores: E(): 2.7e-42, 49.57% id in 234 aa, and to Xanthomonas axonopodis hypothetical protein xac1747 SWALL:AAM36613 (EMBL:AE011806) (233 aa) fasta scores: E(): 2.7e-52, 58.44% id in 231 aa
YP_110456.1	Highly similar in its N-terminal region to Rhizobium loti hypothetical protein mlr1837 SWALL:Q98JQ1 (EMBL:AP002998) (143 aa) fasta scores: E(): 2.3e-30, 68.08% id in 141 aa, and similar in its full length to Ralstonia solanacearum  permease transmembrane protein rsc0238 or rs00670 SWALL:Q8Y2U4 (EMBL:AL646058) (236 aa) fasta scores: E(): 6.9e-20, 39.42% id in 208 aa
YP_110457.1	Low similarity to Xanthomonas axonopodis thioredoxin reductase TrxB or xac1182 SWALL:AAM36054 (EMBL:AE011747) (365 aa) fasta scores: E(): 9.5e-05, 28.67% id in 286 aa
YP_110458.1	C-terminus is similar to the C-terminal regions of Rhizobium loti probable transcriptional regulator mll0489 SWALL:Q98MP6 (EMBL:AP002995) (313 aa) fasta scores: E(): 5.7e-24, 36.29% id in 259 aa, and Pseudomonas aeruginosa probable transcriptional regulator pa2696 SWALL:Q9I0E6 (EMBL:AE004697) (297 aa) fasta scores: E(): 5.5e-20, 34.07% id in 226 aa
YP_110459.1	Similar to Rhizobium leguminosarum  arac-like transcriptional regulator SWALL:Q93EA6 (EMBL:AF361470) (303 aa) fasta scores: E(): 1.6e-38, 38.92% id in 298 aa, and to Rhizobium leguminosarum  arac-like transcriptional regulator SWALL:Q93EA7 (EMBL:AF361470) (306 aa) fasta scores: E(): 3.7e-14, 26.88% id in 305 aa
YP_110460.1	Similar to Rhizobium loti hypothetical protein mll3464 SWALL:Q98G70 (EMBL:AP003002) (405 aa) fasta scores: E(): 1.3e-54, 44.63% id in 401 aa, and to Xanthomonas campestris MFS transporter xcc0495 SWALL:AAM39811 (EMBL:AE012146) (396 aa) fasta scores: E(): 3.3e-42, 39.23% id in 390 aa
YP_110461.1	Similar to Ralstonia solanacearum probable transcription regulator protein rsp0910 or rs01682 SWALL:Q8XRE4 (EMBL:AL646081) (309 aa) fasta scores: E(): 5.5e-53, 49.5% id in 303 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa0056 SWALL:Q9I776 (EMBL:AE004445) (306 aa) fasta scores: E(): 3.5e-30, 35.43% id in 302 aa
YP_110462.1	Similar to Ralstonia solanacearum  hydrolase rsc0242 or rs00674 SWALL:Q8Y2U0 (EMBL:AL646058) (228 aa) fasta scores: E(): 2.4e-77, 85.9% id in 227 aa, and to Rhizobium meliloti  hydrolase ra0202 or sma0376 SWALL:Q930J3 (EMBL:AE007213) (229 aa) fasta scores: E(): 5.6e-68, 78.94% id in 228 aa
YP_110463.1	Similar to Xanthomonas campestris hypothetical protein xcc2052 SWALL:Q8P914 (EMBL:AE012311) (102 aa) fasta scores: E(): 9.2e-19, 62.13% id in 103 aa, and to Rhizobium leguminosarum hypothetical 10.3 kDa protein SWALL:Q93EB2 (EMBL:AF361470) (96 aa) fasta scores: E(): 7.9e-15, 56.38% id in 94 aa
YP_110464.1	Similar to Agrobacterium tumefaciens hypothetical protein atu3982 or agr_l_1745 SWALL:Q8U8V6 (EMBL:AE009329) (625 aa) fasta scores: E(): 1.1e-204, 79.32% id in 624 aa, and to Ralstonia solanacearum hypothetical protein rsc0239 or rs00671 SWALL:Q8Y2U3 (EMBL:AL646058) (612 aa) fasta scores: E(): 7e-154, 65.59% id in 625 aa
YP_110465.1	C-terminal region similar to C-terminal region of Xanthomonas campestris hypothetical protein xcc2051 SWALL:Q8P915 (EMBL:AE012311) (403 aa) fasta scores: E(): 4e-61, 63.57% id in 280 aa, and similar in its C-terminal region to the full length of Bradyrhizobium japonicum protein blr4261 SWALL:BAC49526 (EMBL:AP005950) (310 aa) fasta scores: E(): 1.4e-60, 59.04% id in 293 aa, N-terminal region similar to Streptomyces coelicolor hypothetical protein sco0467 or scf76.07 SWALL:Q9RJG7 (EMBL:Q9RJG7) blastp scores: Score = 49.2 bits (115), Expect = 1e-04 Identities = 24/55 (43%), Positives = 34/55 (61%), Gaps = 1/55 (1%)
YP_110466.1	Similar to Xanthomonas campestris hypothetical protein xcc2050 SWALL:AAM41339 (EMBL:AE012311) (463 aa) fasta scores: E(): 4.3e-106, 57.7% id in 435 aa, and to Zymomonas mobilis hypothetical 54.0 kDa protein SWALL:Q9RQC9 (EMBL:AF117351) (483 aa) fasta scores: E(): 1.2e-07, 24.41% id in 340 aa
YP_110467.1	Similar to Pseudomonas fluorescens non-heme chloroperoxidase Cpo or CpoF SWALL:PRXC_PSEFL (SWALL:O31158) (273 aa) fasta scores: E(): 2.3e-73, 67.77% id in 270 aa, and to Burkholderia cepacia chloride peroxidase SWALL:Q8VT61 (EMBL:AF335493) (273 aa) fasta scores: E(): 1.2e-86, 78.59% id in 271 aa
YP_110468.1	Similar to Xanthomonas axonopodis hypothetical protein xac0432 SWALL:Q8PQ96 (EMBL:AE011670) (226 aa) fasta scores: E(): 1.2e-40, 57.61% id in 210 aa, and to Pseudomonas aeruginosa hypothetical protein pa4017 SWALL:Q9HX10 (EMBL:AE004818) (213 aa) fasta scores: E(): 4.1e-21, 42.1% id in 209 aa
YP_110469.1	Similar to Escherichia coli hypothetical protein YddH or b1462 SWALL:YDDH_ECOLI (SWALL:P76121) (189 aa) fasta scores: E(): 2.5e-22, 38.42% id in 190 aa, and to Xanthomonas campestris hypothetical protein xcc3203 SWALL:AAM42473 (EMBL:AE012437) (193 aa) fasta scores: E(): 6.4e-08, 28.49% id in 179 aa
YP_110471.1	Similar to Rhodobacter sphaeroides hypothetical transcriptional regulator in rdxA 3'region SWALL:YRDX_RHOSH (SWALL:Q01856) (456 aa) fasta scores: E(): 1.1e-45, 37.81% id in 439 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa2100 SWALL:Q9I215 (EMBL:AE004637) (477 aa) fasta scores: E(): 6.5e-43, 35.46% id in 423 aa
YP_110472.1	Similar to Methanosarcina mazei transcriptional regulator, AraC family mm3310 SWALL:AAM33006 (EMBL:AE013592) (209 aa) fasta scores: E(): 6.8e-05, 26.92% id in 208 aa, and to parts of Xanthomonas campestris thiJ/pfpI family protein xcc3565 SWALL:AAM42835 (EMBL:AE012477) (257 aa) fasta scores: E(): 5.9e-07, 29.37% id in 177 aa
YP_110473.1	C-terminal region is similar to Escherichia coli, and Shigella flexneri penicillin-binding protein 7 precursor PbpG or b2134 or sf2219 or s2348 SWALL:PBP7_ECOLI (SWALL:P33364) (313 aa) fasta scores: E(): 2.9e-36, 46.69% id in 272 aa. Full length CDS is similar to Ralstonia solanacearum D-alanyl-D-alanine-endopeptidase rsc1609 or rs03972 SWALL:Q8XYZ7 (EMBL:AL646065) (375 aa) fasta scores: E(): 1.2e-51, 47.82% id in 345 aa
YP_110474.1	Similar in its N-terminal region to Thermoanaerobacter tengcongensis DNA polymerase IV Pol4 or tte2516 SWALL:Q8R7A2 (EMBL:AE013193) (570 aa) fasta scores: E(): 3.1e-74, 43.36% id in 565 aa, and to Bacillus halodurans DNA-dependent DNA polymerase beta chain bh3107 SWALL:Q9K899 (EMBL:AP001517) (571 aa) fasta scores: E(): 5.3e-63, 38.21% id in 581 aa. Note: This CDS presents no similarity to any of the database matches in its C-terminal region (from approx. residue 577 onwards)
YP_110477.1	Similar to Agrobacterium tumefaciens copper tolerance protein CopB or atu3992 or agr_l_1720 WALL:Q8U8U6 (EMBL:AE009330) (492 aa) fasta scores: E(): 1.1e-42, 40.04% id in 482 aa, and to Rhizobium meliloti hypothetical protein ra0562 or sma1037 SWALL:Q92ZC8 (EMBL:AE007246) (488 aa) fasta scores: E(): 3.4e-42, 39.17% id in 485 aa
YP_110478.1	Similar to Bradyrhizobium japonicum multicopper oxidase CopA or bll2210 SWALL:BAC47475 (EMBL:AP005942) (445 aa) fasta scores: E(): 5.9e-124, 70.99% id in 424 aa, and low to the plasmid-borne Escherichia coli copper resistance protein A precursor PcoA SWALL:PCOA_ECOLI (SWALL:Q47452) (605 aa) fasta scores: E(): 2e-12, 26.94% id in 386 aa
YP_110479.1	Similar to Ralstonia solanacearum hypothetical signal peptide protein rsp0929 or rs05404 SWALL:Q8XRC9 (EMBL:AL646081) (114 aa) fasta scores: E(): 2.3e-10, 45.76% id in 118 aa, and to Rhizobium meliloti hypothetical signal peptide protein r00588 or smc02284 SWALL:Q92S41 (EMBL:AL591784) (94 aa) fasta scores: E(): 8.3e-08, 52% id in 75 aa
YP_110480.1	Similar to Yersinia pestis  copper resistance protein ypo1784 SWALL:Q8ZFD0 (EMBL:AJ414150) (128 aa) fasta scores: E(): 5e-10, 40.51% id in 116 aa, and to Escherichia coli copper resistance protein C precursor PcoC SWALL:PCOC_ECOLI (SWALL:Q47454) (126 aa) fasta scores: E(): 6.1e-05, 34.86% id in 109 aa
YP_110481.1	Similar to Ralstonia solanacearum probable copper resistance D transmembrane protein CopD or rsp0659 or rs01790 SWALL:Q8XS22 (EMBL:AL646080) (309 aa) fasta scores: E(): 2.3e-08, 30.88% id in 327 aa, and to Pseudomonas syringae copper resistance protein D copD SWALL:COPD_PSESF (SWALL:Q9KWM8) (311 aa) fasta scores: E(): 2.6e-08, 31.29% id in 262 aa
YP_110482.1	Similar to Salmonella typhimurium methyl-accepting chemotaxis citrate transducer Tcp or stm3577 SWALL:MCPC_SALTY (SWALL:Q02755) (547 aa) fasta scores: E(): 1e-49, 43.19% id in 558 aa, and to Ralstonia solanacearum probable methyl-accepting chemotaxis I CheD3 or rsp1406 or rs02052 SWALL:Q8XQ80 (EMBL:AL646084) (608 aa) fasta scores: E(): 1e-57, 44.6% id in 621 aa
YP_110483.1	Similar to Escherichia coli probable oxidoreductase OrdL or b1301 SWALL:ORDL_ECOLI (SWALL:P37906) (426 aa) fasta scores: E(): 4.4e-61, 43.97% id in 423 aa, and to Pseudomonas aeruginosa probable oxidoreductase pa5309 SWALL:Q9HTP5 (EMBL:AE004943) (439 aa) fasta scores: E(): 2e-73, 50% id in 436 aa
YP_110484.1	Similar to Pseudomonas putida oxidoreductase, pp5273 SWALL:AAN70838 (EMBL:AE016793) (430 aa) fasta scores: E(): 5e-58, 42.51% id in 421 aa, and to Escherichia coli probable oxidoreductase OrdL or b1301 SWALL:ORDL_ECOLI (SWALL:P37906) (426 aa) fasta scores: E(): 1.7e-53, 38.42% id in 419 aa. Note: This CDS contains two possible alternative start codons at residues 5 and/or 14
YP_110486.1	Similar to Escherichia coli, and Escherichia coli O6 putrescine transport system permease PotI or b0857 or c0990 SWALL:POTI_ECOLI (SWALL:P31136) (281 aa) fasta scores: E(): 2.4e-56, 58.86% id in 265 aa, and to Salmonella typhi putrescine transport system permease sty0913 SWALL:Q8Z843 (EMBL:AL627268) (281 aa) fasta scores: E(): 4.5e-55, 57.35% id in 265 aa. Note: This CDS is longer in its C-terminal region than most of its database matches
YP_110487.1	Similar to Escherichia coli putrescine transport system permease PotH or b0856 SWALL:POTH_ECOLI (SWALL:P31135) (317 aa) fasta scores: E(): 8.1e-65, 55.98% id in 284 aa, and to Yersinia pestis putrescine transport system permease ypo1333 or y2848 SWALL:AAM86399 (EMBL:AJ414147) (321 aa) fasta scores: E(): 4.5e-67, 53.72% id in 322 aa. Note: This CDS has a possible aternative star codon at residue 44
YP_110488.1	Similar to Escherichia coli putrescine transport ATP-binding protein PotG or b0855 SWALL:POTG_ECOLI (SWALL:P31134) (377 aa) fasta scores: E(): 1.4e-71, 54.83% id in 372 aa, and to Neisseria meningitidis spermidine/putrescine ABC transporter ATP-binding protein nmb0610 SWALL:Q9K0I9 (EMBL:AE002416) (419 aa) fasta scores: E(): 1.4e-76, 56.38% id in 360 aa
YP_110489.1	Similar to Escherichia coli putrescine-binding periplasmic protein precursor PotF or b0854 SWALL:POTF_ECOLI (SWALL:P31133) (370 aa) fasta scores: E(): 3.3e-67, 49.3% id in 357 aa, and to Pseudomonas aeruginosa polyamine transport protein pa0301 SWALL:Q9I6J0 (EMBL:AE004468) (365 aa) fasta scores: E(): 6.3e-69, 49.59% id in 367 aa. Possible alternative translational start site
YP_110490.1	Similar to Pseudomonas fluorescens BioA SWALL:Q9AH00 (EMBL:AF323694) (453 aa) fasta scores: E(): 1.1e-109, 58.29% id in 446 aa, and to Agrobacterium tumefaciens adenosylmethionine-8-amino-7-oxononanoate aminotransferase BioA or atu1002 or agr_c_1843 SWALL:Q8UGN4 (EMBL:AE009065) (484 aa) fasta scores: E(): 3.3e-101, 54.56% id in 438 aa
YP_110491.1	Similar to Xanthomonas campestris glutamine synthetase GlnA or xcc2346 SWALL:AAM41624 (EMBL:AE012342) (461 aa) fasta scores: E(): 6e-107, 58.63% id in 440 aa, and to Thermotoga maritima glutamine synthetase GlnA or tm0943 SWALL:GLNA_THEMA (SWALL:P36205) (439 aa) fasta scores: E(): 1.9e-29, 28.09% id in 420 aa
YP_110492.1	Similar to Pseudomonas aeruginosa probable glutamine amidotransferase pa0297 SWALL:Q9I6J4 (EMBL:AE004467) (250 aa) fasta scores: E(): 1.6e-48, 55.46% id in 247 aa, and to Escherichia coli O157:H7 probable amidotransferase subunit YcjL or z2490 or ecs1875 SWALL:Q8X7G2 (EMBL:AE005376) (258 aa) fasta scores: E(): 2e-31, 40.87% id in 252 aa
YP_110494.1	Similar to Brucella melitensis transcriptional regulator, MerR family bmeii0372 SWALL:Q8YD05 (EMBL:AE009674) (182 aa) fasta scores: E(): 4.6e-32, 49.73% id in 185 aa, and to Shewanella oneidensis transcriptional regulator,  so1265 SWALL:AAN54333 (EMBL:AE015570) (182 aa) fasta scores: E(): 2.1e-31, 53.29% id in 182 aa
YP_110495.1	Similar to Escherichia coli  aldehyde dehydrogenase AldH or b1300 SWALL:DHAL_ECOLI (SWALL:P23883) (495 aa) fasta scores: E(): 8.7e-104, 54.52% id in 497 aa, and to Pseudomonas aeruginosa probable aldehyde dehydrogenase pa5312 SWALL:Q9HTP2 (EMBL:AE004944) (497 aa) fasta scores: E(): 5.9e-121, 62.65% id in 498 aa
YP_110496.1	catalyzes the formation of putrescine from agmatine
YP_110498.1	10 kDa chaperonin; Cpn10; GroES; forms homoheptameric ring; binds to one or both ends of the GroEL double barrel in the presence of adenine nucleotides capping it; folding of unfolded substrates initiates in a GroEL-substrate bound and capped by GroES; release of the folded substrate is dependent on ATP binding and hydrolysis in the trans ring
YP_110499.1	60 kDa chaperone family; promotes refolding of misfolded polypeptides especially under stressful conditions; forms two stacked rings of heptamers to form a barrel-shaped 14mer; ends can be capped by GroES; misfolded proteins enter the barrel where they are refolded when GroES binds; many bacteria have multiple copies of the groEL gene which are active under different environmental conditions; the B.japonicum protein in this cluster is expressed constitutively; in Rhodobacter, Corynebacterium and Rhizobium this protein is not essential for growth
YP_110500.1	Similar to Pseudomonas aeruginosa hypothetical protein pa2757 SWALL:Q9I086 (EMBL:AE004703) (147 aa) fasta scores: E(): 3.2e-30, 55.47% id in 146 aa, and to Vitreoscilla sp. hypothetical 17.2 kDa protein SWALL:Q9XD48 (EMBL:AF114793) (152 aa) fasta scores: E(): 6.4e-21, 45.32% id in 139 aa
YP_110501.1	Similar to Vaccinia virus ribonucleoside-diphosphate reductase large chain I4L SWALL:RIR1_VACCV (SWALL:P12848) (771 aa) fasta scores: E(): 2.8e-22, 25.22% id in 654 aa, and to Thermoanaerobacter tengcongensis ribonucleotide reductase alpha subunit tte2336 SWALL:Q8R7R2 (EMBL:AE013176) (691 aa) fasta scores: E(): 9.2e-56, 36.48% id in 677 aa
YP_110503.1	Similar to Azoarcus evansii 2-aminobenzoate-CoA ligase SWALL:Q93FC0 (EMBL:AF320253) (542 aa) fasta scores: E(): 2.6e-119, 57.35% id in 537 aa, and to Bacillus subtilis long-chain-fatty-acid--CoA ligase LcfA SWALL:LCFA_BACSU (SWALL:P94547) (560 aa) fasta scores: E(): 1.9e-31, 29.07% id in 564 aa
YP_110504.1	Similar in its N-terminal region to Pseudomonas aeruginosa hypothetical protein pa0997 SWALL:Q9I4X2 (EMBL:AE004532) (283 aa) fasta scores: E(): 2.6e-08, 33.15% id in 190 aa and very low similarity also in its N-terminal region to Bacillus subtilis 3-oxoacyl-[acyl-carrier-protein] synthase III FabH SWALL:FABH_BACSU (SWALL:O34746) (312 aa) fasta scores: E(): 0.25, 27.27% id in 154 aa
YP_110505.1	Most of the significant database matches in this CDS are to eukaryotic entries. Similar to Perilla frutescens beta-ketoacyl-ACP synthase IIIA Kas IIIA SWALL:O48944 (EMBL:AF026150) (401 aa) fasta scores: E(): 1.2e-18, 28.29% id in 357 aa, and to Cuphea wrightii 3-oxoacyl-[acyl-carrier-protein] synthase III A, chloroplast precursor Kas3A SWALL:FBH1_CUPWR (SWALL:P49244) (400 aa) fasta scores: E(): 1.6e-17, 28.88% id in 367 aa
YP_110506.1	FabH; beta-ketoacyl-acyl carrier protein synthase III; catalyzes the condensation of acetyl-CoA with malonyl-ACP to initiate cycles of fatty acid elongation; differs from 3-oxoacyl-(acyl carrier protein) synthase I and II in that it utilizes CoA thioesters as primers rather than acyl-ACPs; in Pseudomonas this protein is involved in quinolone signal biosynthesis
YP_110507.1	Similar to Pseudomonas aeruginosa hypothetical protein pa1000 SWALL:YA00_PSEAE (SWALL:P20581) (301 aa) fasta scores: E(): 3.7e-25, 32.67% id in 303 aa, and to Aeropyrum pernix hypothetical protein ape2156 SWALL:Q9Y9Y3 (EMBL:AP000063) (298 aa) fasta scores: E(): 7.7e-07, 24.9% id in 249 aa
YP_110508.1	N-terminal region similar to Streptomyces atroolivaceus non-ribosomal peptide synthetase SWALL:AAN85512 (EMBL:AF484556) (1745 aa) fasta scores: E(): 2.8e-67, 36.51% id in 838 aa, and C-terminal region similar to Pseudomonas aeruginosa probable acyl-CoA dehydrogenase pa1631 SWALL:Q9I391 (EMBL:AE004590) (384 aa) fasta scores: E(): 2e-23, 32.13% id in 361 aa
YP_110510.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0788 or rs05049 SWALL:Q8Y1A2 (EMBL:AL646061) (127 aa) fasta scores: E(): 2.7e-17, 47.1% id in 121 aa, and to Neisseria meningitidis  membrane protein nma1176 SWALL:Q9JUR4 (EMBL:AL162755) (127 aa) fasta scores: E(): 8.6e-14, 42.06% id in 126 aa
YP_110511.1	Similar to Rhizobium loti hypothetical protein mlr2292 SWALL:Q98IR1 (EMBL:AP002999) (183 aa) fasta scores: E(): 4.2e-09, 32.62% id in 141 aa, and to Xanthomonas axonopodis hypothetical protein xac0102 SWALL:AAM34994 (EMBL:AE011633) (219 aa) fasta scores: E(): 2e-08, 33.11% id in 151 aa
YP_110512.1	Similar to Pseudomonas putida alkyl hydroperoxide reductase subunit F AhpF SWALL:AHPF_PSEPU (SWALL:O82864) (520 aa) fasta scores: E(): 2.5e-134, 71.26% id in 522 aa, and to Escherichia coli alkyl hydroperoxide reductase subunit F Ahpf or b0606 SWALL:AHPF_ECOLI (SWALL:P35340) (521 aa) fasta scores: E(): 1.6e-117, 60.5% id in 519 aa
YP_110513.1	Similar to Escherichia coli, Escherichia coli O6, Escherichia coli O157:H7, and Shigella flexneri alkyl hydroperoxide reductase C22 protein AhpC or b0605 or c0694 or z0749 or ecs0644 or sf0524 SWALL:AHPC_ECOLI (SWALL:P26427) (186 aa) fasta scores: E(): 8.4e-52, 67.02% id in 185 aa, and to Pseudomonas putida AhpC SWALL:O82863 (EMBL:AB010689) (187 aa) fasta scores: E(): 6.4e-62, 81.28% id in 187 aa
YP_110514.1	Similar to the N-terminal region of Yersinia pestis carbohydrate-binding protein ypo3227 SWALL:Q8ZC03 (EMBL:AJ414156) (534 aa) fasta scores: E(): 9.8e-68, 52.97% id in 353 aa, and of Alteromonas sp. chitin-binding protein 1 precursor Cbp1 SWALL:Q8VLQ2 (EMBL:AB063629) (475 aa) fasta scores: E(): 1.2e-28, 38.04% id in 347 aa
YP_110516.1	Similar to Pseudomonas aeruginosa hypothetical protein pa3208 SWALL:Q9HZ32 (EMBL:AE004744) (186 aa) fasta scores: E(): 9.9e-25, 43.71% id in 183 aa, and to Escherichia coli, and Escherichia coli O157:H7 protein YdjA or b1765 or z2798 or ecs2471 SWALL:YDJA_ECOLI (SWALL:P24250) (183 aa) fasta scores: E(): 7.8e-18, 39.08% id in 174 aa. Note: This CDS is longer in its N-terminal region than most of its database matches
YP_110517.1	Similar to Rhizobium loti hypothetical protein mll0717 SWALL:Q98M60 (EMBL:AP002995) (478 aa) fasta scores: E(): 4.6e-148, 78.52% id in 475 aa, and to Synechocystis sp. hypothetical protein sll0335 SWALL:Y335_SYNY3 (SWALL:Q55587) (481 aa) fasta scores: E(): 1e-94, 52.13% id in 468 aa
YP_110518.1	Similar to Rhizobium loti hypothetical protein mll0716 SWALL:Q98M61 (EMBL:AP002995) (313 aa) fasta scores: E(): 1.3e-84, 66.98% id in 312 aa, and to Agrobacterium tumefaciens hypothetical protein atu2339 or agr_c_4249 SWALL:Q8UCY9 (EMBL:AE009183) (313 aa) fasta scores: E(): 1.7e-74, 56.91% id in 311 aa
YP_110519.1	Similar to Agrobacterium tumefaciens hypothetical protein atu2340 or agr_c_4251 SWALL:Q8UCY8 (EMBL:AE009183) (273 aa) fasta scores: E(): 1.6e-26, 39.81% id in 319 aa, and to Rhizobium meliloti hypothetical protein rb1182 or smb20888 SWALL:Q92UE9 (EMBL:AL603646) (272 aa) fasta scores: E(): 1.9e-25, 38.8% id in 317 aa
YP_110520.1	Similar to Rhizobium loti hypothetical protein mll2877 SWALL:Q98HG6 (EMBL:AP003000) (1119 aa) fasta scores: E(): 1.2e-129, 56.41% id in 1138 aa, and to Mycobacterium leprae hypothetical protein ml2678 or mlcb1913.12 SWALL:O53120 (EMBL:AL022118) (1000 aa) fasta scores: E(): 1.7e-23, 32.69% id in 1049 aa
YP_110521.1	Similar to Pseudomonas aeruginosa hypothetical protein pa4927 SWALL:Q9HUN7 (EMBL:AE004905) (830 aa) fasta scores: E(): 8.9e-69, 42.25% id in 833 aa, and to Mycobacterium leprae hypothetical protein ml2679 or mlcb1913.13 SWALL:O53121 (EMBL:AL022118) (893 aa) fasta scores: E(): 2.3e-47, 32.03% id in 899 aa
YP_110522.1	CDS is extended at the N-terminus in comparison to some orthologues. Similar to Pseudomonas aeruginosa hypothetical protein pa4926 SWALL:Q9HUN8 (EMBL:AE004905) (311 aa) fasta scores: E(): 6.3e-32, 45.51% id in 323 aa, and to Mycobacterium tuberculosis hypothetical protein Rv2569c or MT2645 or MTCY227.32 SWALL:YP69_MYCTU (SWALL:Q50652) (314 aa) fasta scores: E(): 2.7e-28, 41.61% id in 310 aa
YP_110523.1	Similar to Rhizobium meliloti probable rhizopine catabolism regulatory protein MocR SWALL:MOCR_RHIME (SWALL:P49309) (493 aa) fasta scores: E(): 8.3e-36, 31.95% id in 460 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa4165 SWALL:Q9HWL6 (EMBL:AE004833) (496 aa) fasta scores: E(): 4.8e-49, 38.21% id in 471 aa
YP_110524.1	Similar to Pseudomonas aeruginosa chloramphenicol resistance protein CmlA SWALL:CMLA_PSEAE (SWALL:P32482) (419 aa) fasta scores: E(): 9.1e-26, 29.92% id in 381 aa, and to Pseudomonas aeruginosa probable MFS transporter pa3573 SWALL:Q9HY47 (EMBL:AE004778) (392 aa) fasta scores: E(): 3.7e-34, 34.39% id in 378 aa
YP_110525.1	Similar to Ralstonia solanacearum probable transmembrane protein rsp0134 or rs02986 SWALL:Q8XTH6 (EMBL:AL646076) (361 aa) fasta scores: E(): 9.4e-72, 58.68% id in 351 aa, and to Neisseria meningitidis integral membrane protein nma0079 SWALL:Q9JX36 (EMBL:AL162752) (375 aa) fasta scores: E(): 8.9e-27, 34.57% id in 350 aa
YP_110526.1	Similar to Streptomyces coelicolor  transcriptional regulator SCO6746 or SC5f2A.29 SWALL:Q9X7Q2 (EMBL:AL939129) (325 aa) fasta scores: E(): 5.5e-47, 45.62% id in 320 aa, and to Caulobacter crescentus AraC family transcriptional regulator cc2960 SWALL:Q9A483 (EMBL:AE005960) (312 aa) fasta scores: E(): 8.8e-44, 43.5% id in 308 aa. Similar to BPSS1864, 56.782% identity (56.782% ungapped) in 317 aa overlap
YP_110527.1	Similar to Anabaena sp. ThiJ family protein all7521 SWALL:Q8ZSI9 (EMBL:AP003602) (226 aa) fasta scores: E(): 2.7e-23, 39.6% id in 202 aa, and to Streptomyces coelicolor hypothetical protein sco6747 sco6747 or sc5f2a.30 SWALL:Q9X7Q3 (EMBL:AL939129) (211 aa) fasta scores: E(): 2.2e-14, 31.03% id in 203 aa
YP_110528.1	Similar to Pseudomonas aeruginosa 2-aminoethylphosphonate:pyruvate aminotransferase PhnW or pa1310 SWALL:Q9I434 (EMBL:AE004560) (371 aa) fasta scores: E(): 5.8e-31, 35.42% id in 350 aa, and to Vibrio cholerae 2-aminoethylphosphonate:pyruvate aminotransferase vca0604 SWALL:Q9KLY7 (EMBL:AE004391) (367 aa) fasta scores: E(): 8.4e-37, 37% id in 354 aa
YP_110529.1	Similar to Streptomyces viridochromogenes 3-phosphonopyruvate decarboxylase Ppd SWALL:O86938 (EMBL:Y14337) (397 aa) fasta scores: E(): 3.7e-49, 45.29% id in 393 aa, and to Streptomyces hygroscopicus 3-phosphonopyruvate decarboxylase BcpC SWALL:BAA07055 (EMBL:D37809) (401 aa) fasta scores: E(): 5.5e-46, 43.9% id in 394 aa
YP_110530.1	Possible fusion protein. N-terminal region is similar to Mytilus edulis phosphoenolpyruvate phosphomutase SWALL:PEPM_MYTED (SWALL:P56839) (295 aa) fasta scores: E(): 1.1e-72, 68.18% id in 286 aa, and to Tetrahymena pyriformis phosphoenolpyruvate phosphomutase precursor pepM SWALL:PEPM_TETPY (SWALL:P33182) (300 aa) fasta scores: E(): 2.7e-68, 61.95% id in 297 aa. C-terminal region is weakly similar to Pseudomonas putida transferase,  pp0726 SWALL:AAN66351 (EMBL:AE016776) (241 aa) fasta scores: E(): 4.1e-13, 28.76% id in 226 aa
YP_110531.1	Similar to Caulobacter crescentus nucleotidyltransferase cc1152 SWALL:Q9A942 (EMBL:AE005793) (253 aa) fasta scores: E(): 3.8e-14, 32.93% id in 249 aa, and to Archaeoglobus fulgidus glucose-1-phosphate cytidylyltransferase af1142 SWALL:O29123 (EMBL:AE001025) (241 aa) fasta scores: E(): 3.2e-13, 28.62% id in 248 aa
YP_110532.1	Similar to Pseudomonas aeruginosa hypothetical protein pa4313 SWALL:Q9HW88 (EMBL:AE004847) (333 aa) fasta scores: E(): 4.3e-05, 25.98% id in 304 aa, and to Mycobacterium leprae probable integral membrane protein ml2618 SWALL:Q9CD01 (EMBL:AL583926) (352 aa) fasta scores: E(): 0.12, 24.31% id in 329 aa
YP_110533.1	Weakly similar to Streptomyces griseus ArpA protein SWALL:Q54223 (EMBL:X79605) (250 aa) fasta scores: E(): 8.3e-05, 26.02% id in 196 aa
YP_110534.1	Weakly similar to Aeropyrum pernix hypothetical protein ape1516 SWALL:Q9YBT3 (EMBL:AP000061) (223 aa) fasta scores: E(): 2.3e-05, 27.91% id in 197 aa, and to Streptomyces coelicolor  transmembrane protein SCO3457 or SCE46.14 SWALL:Q9RKH5 (EMBL:AL939116) (205 aa) fasta scores: E(): 0.00014, 32.63% id in 190 aa
YP_110535.1	Similar to Clostridium kluyveri succinyl-CoA:coenzyme A transferase Cat1 SWALL:CAT1_CLOKL (SWALL:P38946) (538 aa) fasta scores: E(): 2e-97, 51.73% id in 520 aa, and to Xanthomonas campestris coa tranferase xcc3588 SWALL:Q8P4W8 (EMBL:AE012479) (504 aa) fasta scores: E(): 1.2e-133, 68.52% id in 502 aa. Possible alternative translational start sites
YP_110536.1	Weakly similar to Yersinia pestis hypothetical protein ypo0499 or y3676 SWALL:Q8ZIJ9 (EMBL:AJ414143) (337 aa) fasta scores: E(): 2.6e-05, 28.43% id in 313 aa, and to Xanthomonas axonopodis hypothetical protein xac4112 SWALL:Q8PF73 (EMBL:AE012060) (347 aa) fasta scores: E(): 0.084, 26.3% id in 346 aa
YP_110537.1	Similar to Yersinia pestis hypothetical protein ypo0500 SWALL:Q8ZIJ8 (EMBL:AJ414143) (186 aa) fasta scores: E(): 5.8e-30, 55.76% id in 156 aa, and to Salmonella typhi hypothetical protein sty0297 SWALL:Q8Z970 (EMBL:AL627266) (180 aa) fasta scores: E(): 4.7e-28, 47.51% id in 181 aa
YP_110538.1	Similar to Yersinia pestis hypothetical protein ypo0501 SWALL:Q8ZIJ7 (EMBL:AJ414143) (503 aa) fasta scores: E(): 5.4e-142, 65.66% id in 498 aa, and to Pseudomonas aeruginosa hypothetical protein pa0084 SWALL:Q9I748 (EMBL:AE004447) (498 aa) fasta scores: E(): 8e-133, 61.94% id in 494 aa
YP_110539.1	Similar to Yersinia pestis hypothetical protein ypo0502 SWALL:Q8ZIJ6 (EMBL:AJ414143) (172 aa) fasta scores: E(): 1e-49, 72.09% id in 172 aa, and to Pseudomonas aeruginosa hypothetical protein pa0085 SWALL:Q9I747 (EMBL:AE004447) (162 aa) fasta scores: E(): 4.1e-13, 37.27% id in 169 aa
YP_110540.1	Similar to Yersinia pestis hypothetical protein ypo0503 SWALL:Q8ZIJ5 (EMBL:AJ414143) (147 aa) fasta scores: E(): 9.3e-06, 30.37% id in 135 aa. Weakly similar to Salmonella typhi hypothetical protein sty0290 SWALL:Q8Z977 (EMBL:AL627266) (164 aa) fasta scores: E(): 0.1, 31.57% id in 114 aa
YP_110541.1	Similar to Yersinia pestis hypothetical protein ypo0504 SWALL:Q8ZIJ4 (EMBL:AJ414143) (614 aa) fasta scores: E(): 5.2e-60, 33.98% id in 612 aa, and to Pseudomonas aeruginosa hypothetical protein pa0088 SWALL:Q9I744 (EMBL:AE004447) (619 aa) fasta scores: E(): 1.3e-39, 31.38% id in 615 aa
YP_110542.1	Similar to Yersinia pestis hypothetical protein ypo0505 SWALL:Q8ZIJ3 (EMBL:AJ414143) (327 aa) fasta scores: E(): 4.8e-37, 36.41% id in 335 aa. Weakly similar to Pseudomonas aeruginosa hypothetical protein pa0089 SWALL:Q9I743 (EMBL:AE004447) (348 aa) fasta scores: E(): 5.4e-15, 28.34% id in 321 aa
YP_110543.1	N-terminal region is similar to Escherichia coli heat shock protein ClpB or HtpM SWALL:CLPB_ECOLI (SWALL:P03815) (857 aa) fasta scores: E(): 7.4e-43, 36.28% id in 871 aa, and to Yersinia pestis  Clp ATPase ypo0506 SWALL:Q8ZIJ2 (EMBL:AJ414143) (867 aa) fasta scores: E(): 1.6e-136, 48.66% id in 861 aa
YP_110544.1	Similar to Yersinia pestis hypothetical protein ypo0507 SWALL:Q8ZIJ1 (EMBL:AJ414143) (782 aa) fasta scores: E(): 1.4e-145, 58.14% id in 786 aa, and to Pseudomonas aeruginosa hypothetical protein pa0095 SWALL:Q9I737 (EMBL:AE004448) (741 aa) fasta scores: E(): 4.8e-63, 33.56% id in 733 aa. CDS is extended at the C-terminus in comparison to orthologues. Highly simlar to BPSS0524, 91.874% identity (91.995% ungapped) in 763 aa overlap
YP_110545.1	Similar to Yersinia pestis hypothetical protein ypo0507 SWALL:Q8ZIJ1 (EMBL:AJ414143) (782 aa) fasta scores: E(): 1.1e-143, 57.7% id in 785 aa, and to Pseudomonas aeruginosa hypothetical protein pa0095 SWALL:Q9I737 (EMBL:AE004448) (741 aa) fasta scores: E(): 1.3e-60, 33.6% id in 735 aa. Highly similar to BPSS0523, 91.874% identity (91.995% ungapped) in 763 aa overlap
YP_110546.1	No significant database matches to the full length CDS. N-terminal region is similar to Yersinia pestis hypothetical protein ypo0508 SWALL:Q8ZIJ0 (EMBL:AJ414143) (190 aa) fasta scores: E(): 4.9e-08, 30.6% id in 183 aa. Internal region is similar to Yersinia pestis hypothetical protein ypo0509 SWALL:Q8ZII9 (EMBL:AJ414143) (540 aa) fasta scores: E(): 4.2e-21, 24.13% id in 547 aa. C-terminal region is similar to to Yersinia pestis hypothetical protein ypo0510 SWALL:Q8ZII8 (EMBL:AJ414143) (367 aa) fasta scores: E(): 0.00034, 18.62% id in 247 aa
YP_110547.1	Weakly similar to Chlorobium tepidum pentapeptide repeat family protein CT0918 SWALL:AAM72153 (EMBL:AE012857) (382 aa) fasta scores: E(): 0.06, 19.69% id in 325 aa
YP_110548.1	Possible alternative translational start site. C-terminal region is weakly similar to Yersinia pestis hypothetical protein ypo0511 SWALL:Q8ZII7 (EMBL:AJ414143) (205 aa) fasta scores: E(): 0.0008, 25.74% id in 202 aa
YP_110549.1	Similar to Yersinia pestis hypothetical protein ypo0511a SWALL:Q8ZII6 (EMBL:AJ414143) (121 aa) fasta scores: E(): 1.1e-09, 44.14% id in 111 aa. Similar to BPSS0185, 55.556% identity (56.075% ungapped) in 108 aa overlap
YP_110550.1	Weakly similar to Yersinia pestis  lipoprotein ypo0512 SWALL:Q8ZII5 (EMBL:AJ414143) (163 aa) fasta scores: E(): 1.1e-05, 23.7% id in 135 aa
YP_110551.1	Similar to Yersinia pestis hypothetical protein ypo0513 SWALL:Q8ZII4 (EMBL:AJ414143) (451 aa) fasta scores: E(): 5.3e-66, 41.2% id in 449 aa, and to Pseudomonas aeruginosa hypothetical protein pa0079 SWALL:Q9I753 (EMBL:AE004447) (444 aa) fasta scores: E(): 1.5e-46, 35.21% id in 443 aa
YP_110552.1	Similar to Yersinia pestis  OmpA-family membrane protein ypo0514 SWALL:Q8ZII3 (EMBL:AJ414143) (536 aa) fasta scores: E(): 5.4e-45, 36.23% id in 505 aa. Internal region is weakly similar to Salmonella typhi  membrane protein sty0305 SWALL:Q8Z965 (EMBL:AL627266) (433 aa) fasta scores: E(): 3.5e-13, 28.31% id in 445 aa. CDS is extended at the C-terminus in comparison to similar proteins
YP_110553.1	Similar to Yersinia pestis  membrane protein ypo0515 SWALL:Q8ZII2 (EMBL:AJ414143) (1150 aa) fasta scores: E(): 2.6e-128, 34.31% id in 1157 aa. C-terminal region is similar to Pseudomonas aeruginosa hypothetical protein pa0077 SWALL:Q9I755 (EMBL:AE004446) (1101 aa) fasta scores: E(): 6e-62, 26.85% id in 1132 aa
YP_110554.1	Similar to Yersinia pestis hypothetical protein ypo0516 SWALL:Q8ZII1 (EMBL:AJ414143) (117 aa) fasta scores: E(): 1.1e-07, 31.53% id in 111 aa
YP_110555.1	Doubtful CDS. No significant database matches
YP_110557.1	Similar to Pseudomonas aeruginosa rhamnosyltransferase 1 subunit A RhlA SWALL:RHLA_PSEAE (SWALL:Q51559) (295 aa) fasta scores: E(): 4e-45, 48.49% id in 266 aa, and to Pseudomonas putida (R)-3-hydroxydecanoyl-ACP:CoA transacylase PhaG SWALL:PHAG_PSEPU (SWALL:O85207) (295 aa) fasta scores: E(): 8.2e-42, 42.64% id in 272 aa. Almost identical to BPSS1352, 99.666% identity (99.666% ungapped) in 299 aa overlap
YP_110558.1	Similar to Pseudomonas aeruginosa rhamnosyltransferase 1 catalytic subunit B RhlB SWALL:Q51560 (EMBL:L28170) (426 aa) fasta scores: E(): 1.2e-47, 47.54% id in 427 aa, and to Nocardia aerocolonigenes  glycosyltransferase RbmA or Ngt SWALL:CAC93713 (EMBL:AF534707) (421 aa) fasta scores: E(): 3.7e-08, 27.35% id in 446 aa. Almost identical to BPSS1351, 99.569% identity (99.569% ungapped) in 464 aa overlap
YP_110559.1	Similar to Escherichia coli multidrug resistance protein B EmrB SWALL:EMRB_ECOLI (SWALL:P27304) (512 aa) fasta scores: E(): 6.9e-88, 45.34% id in 505 aa, and to Burkholderia pseudomallei hypothetical protein SWALL:Q9ZF72 (EMBL:AF110185) (520 aa) fasta scores: E(): 2.7e-114, 56.92% id in 527 aa. CDS is extended at the N-terminus in comparison to some orthologues. Almost identical to BPSS1350, 99.621% identity (99.621% ungapped) in 528 aa overlap
YP_110560.1	Similar to Shigella flexneri DTDP-rhamnosyl transferase RfbF or sf2099 SWALL:RFBF_SHIFL (SWALL:P37782) (296 aa) fasta scores: E(): 2.7e-15, 25% id in 304 aa, and to Pseudomonas aeruginosa hypothetical protein pa1130 SWALL:Q9I4K5 (EMBL:AE004543) (325 aa) fasta scores: E(): 3.7e-41, 45.51% id in 312 aa. Almost identical to BPSS1349, 99.085% identity (99.085% ungapped) in 328 aa overlap
YP_110561.1	Similar to Xanthomonas axonopodis outer membrane efflux protein xac1444 SWALL:AAM36315 (EMBL:AE011776) (496 aa) fasta scores: E(): 7.2e-38, 38.41% id in 505 aa, and to Burkholderia cepacia fusaric acid resistance protein fusa precursor FusA SWALL:FUSA_BURCE (SWALL:P24126) (530 aa) fasta scores: E(): 9.3e-28, 31.74% id in 526 aa. Identical to BPSS1348, 100.000% identity (100.000% ungapped) in 527 aa overlap
YP_110562.1	Similar to Escherichia coli multidrug resistance protein A EmrA SWALL:EMRA_ECOLI (SWALL:P27303) (390 aa) fasta scores: E(): 9e-46, 40.51% id in 390 aa, and to Xanthomonas campestris multidrug resistance efflux pump xcc1399 SWALL:AAM40697 (EMBL:AE012239) (397 aa) fasta scores: E(): 5.4e-50, 44.44% id in 387 aa. Almost identical to BPSS1347, 99.742% identity (99.742% ungapped) in 388 aa overlap
YP_110563.1	Similar to Hansenula anomala invertase precursor INV1 SWALL:INV1_HANAN (SWALL:P40912) (550 aa) fasta scores: E(): 4.3e-41, 31.59% id in 519 aa, and to Acetobacter diazotrophicus levanase precursor LsdB SWALL:Q9RBJ1 (EMBL:L41732) (534 aa) fasta scores: E(): 1.4e-105, 53.09% id in 501 aa
YP_110564.1	Similar to Acetobacter diazotrophicus levansucrase precursor LsdA SWALL:SACB_ACEDI (SWALL:Q43998) (584 aa) fasta scores: E(): 4.8e-129, 66.8% id in 476 aa, and to Arthrobacter sp. K-1 beta-fructofuranosidase Bff SWALL:Q8VW87 (EMBL:AB062134) (578 aa) fasta scores: E(): 7.6e-109, 56.27% id in 526 aa
YP_110565.1	Similar to Escherichia coli raffinose operon repressor RafR SWALL:RAFR_ECOLI (SWALL:P21867) (335 aa) fasta scores: E(): 3.5e-39, 38.85% id in 332 aa, and to Rhizobium meliloti transcription regulator AglR or r00694 or smc03060 SWALL:AGLR_RHIME (SWALL:Q9Z3R4) (356 aa) fasta scores: E(): 4.5e-37, 40.18% id in 321 aa
YP_110566.1	Similar to Pseudomonas putida glutathione-independent formaldehyde dehydrogenase FdhA SWALL:FADH_PSEPU (SWALL:P46154) (398 aa) fasta scores: E(): 1.2e-121, 80.9% id in 398 aa, and to Ralstonia solanacearum probable glutathione-independent formaldehyde dehydrogenase oxidoreductase rsp0053 or rs02028 SWALL:Q8XTQ3 (EMBL:AL646076) (398 aa) fasta scores: E(): 2e-142, 92.98% id in 399 aa
YP_110567.1	Similar to Ralstonia solanacearum probable transcriptional regulator transcription regulator protein rsp0054 or rs02029 SWALL:Q8XTQ2 (EMBL:AL646076) (343 aa) fasta scores: E(): 5.7e-114, 85.71% id in 336 aa, and to Ralstonia solanacearum probable transcriptional regulator transcription regulator protein rsp0068 or rs02043 SWALL:Q8XTN8 (EMBL:AL646076) (334 aa) fasta scores: E(): 1.5e-65, 55.12% id in 312 aa. Similar to BPSS1424, 56.913% identity (57.097% ungapped) in 311 aa overlap
YP_110568.1	catalyzes the reaction of glycine with 5,10-methylenetetrahydrofolate to form L-serine and tetrahydrofolate
YP_110569.1	Similar to Ralstonia solanacearum  dipeptidase rsp0056 or rs02031 SWALL:Q8XTQ0 (EMBL:AL646076) (323 aa) fasta scores: E(): 1.7e-119, 90.4% id in 323 aa, and to Pseudomonas aeruginosa hypothetical protein pa5396 SWALL:Q9HTG8 (EMBL:AE004952) (325 aa) fasta scores: E(): 1.1e-94, 71.47% id in 319 aa
YP_110570.1	Similar to Ralstonia solanacearum hypothetical protein rsp0057 or rs02032 SWALL:Q8XTP9 (EMBL:AL646076) (177 aa) fasta scores: E(): 8.8e-72, 90.85% id in 175 aa, and to Pseudomonas aeruginosa hypothetical protein pa5397 SWALL:Q9HTG7 (EMBL:AE004952) (176 aa) fasta scores: E(): 1e-39, 57.71% id in 175 aa
YP_110571.1	Similar to Rhizobium meliloti probable N-methylproline demethylase StcD or StcD2 or rb1010 or smb21570 SWALL:STCD_RHIME (SWALL:O87278) (678 aa) fasta scores: E(): 2.6e-101, 43.61% id in 681 aa, and to Ralstonia solanacearum probable stachydrine utilization oxidoreductase rsp0058 or rs02033 SWALL:Q8XTP8 (EMBL:AL646076) (687 aa) fasta scores: E(): 0, 94.46% id in 687 aa
YP_110572.1	Similar to Ralstonia solanacearum probable transmembrane protein rsp0059 or rs02034 SWALL:Q8XTP7 (EMBL:AL646076) (641 aa) fasta scores: E(): 1.6e-211, 86.73% id in 641 aa. C-terminal region os weakly similar to Escherichia coli anaerobic glycerol-3-phosphate dehydrogenase subunit C GlpC SWALL:GLPC_ECOLI (SWALL:P13034) (396 aa) fasta scores: E(): 0.0036, 22.41% id in 415 aa
YP_110573.1	CDS is extended at the N-terminus in comparison to most orthologues. C-terminal region is similar to Bradyrhizobium japonicum electron transfer flavoprotein alpha-subunit EtfA or EtfL SWALL:ETFA_BRAJA (SWALL:P53573) (314 aa) fasta scores: E(): 3.2e-14, 30.35% id in 313 aa. Full length CDS is similar to Ralstonia solanacearum electron transfer flavoprotein alpha-subunit rsp0060 or rs02035 SWALL:Q8XTP6 (EMBL:AL646076) (392 aa) fasta scores: E(): 2.1e-98, 71.89% id in 395 aa. Possible alternative translational start site
YP_110574.1	C-terminus is similar to the C-terminal region of Methylophilus methylotrophus electron transfer flavoprotein beta-subunit EtfB SWALL:ETFB_METME (SWALL:P53570) (264 aa) fasta scores: E(): 0.11, 27.92% id in 222 aa. Full length CDS is similar to Ralstonia solanacearum  electron transfer flavoprotein beta-subunit rsp0061 or rs02036 SWALL:Q8XTP5 (EMBL:AL646076) (261 aa) fasta scores: E(): 6.7e-70, 77.39% id in 261 aa
YP_110575.1	Similar to Ralstonia solanacearum  dioxygenase rsp0062 or rs02037 SWALL:Q8XTP4 (EMBL:AL646076) (414 aa) fasta scores: E(): 9.8e-153, 84.42% id in 411 aa, and to Pseudomonas aeruginosa probable ring hydroxylating dioxygenase, alpha-subunit pa5410 SWALL:Q9HTF4 (EMBL:AE004953) (429 aa) fasta scores: E(): 4e-73, 43.81% id in 420 aa. Possible alternative translational start site
YP_110576.1	Similar to Ralstonia solanacearum probable ferredoxin oxidoreductase rsp0063 or rs02038 SWALL:Q8XTP3 (EMBL:AL646076) (382 aa) fasta scores: E(): 2.7e-133, 84.81% id in 382 aa, and to the C-terminal region of Escherichia coli probable phenylacetic acid degradation NADH oxidoreductase PaaE paae or b1392 SWALL:PAAE_ECOLI (SWALL:P76081) (356 aa) fasta scores: E(): 1.3e-21, 31.56% id in 358 aa
YP_110577.1	Similar to Ralstonia solanacearum  glycine betaine transmembrane and periplasmic ABC transporter protein rsp0064 or rs02039 SWALL:Q8XTP2 (EMBL:AL646076) (289 aa) fasta scores: E(): 1.3e-89, 80.56% id in 283 aa. C-terminal region is similar to the N-terminal region of Bacillus subtilis glycine betaine-binding protein precursor opuaC SWALL:OPAC_BACSU (SWALL:P46922) (293 aa) fasta scores: E(): 2.9e-21, 38.63% id in 176 aa
YP_110578.1	Similar to Rhizobium meliloti  permease r00105 or smc04147 SWALL:Q92T75 (EMBL:AL591782) (594 aa) fasta scores: E(): 8e-72, 46.73% id in 597 aa, and weakly similar to Mus musculus cystine/glutamate transporter SLC7A11 SWALL:XCT_MOUSE (SWALL:Q9WTR6) (502 aa) fasta scores: E(): 5.7e-05, 24.4% id in 549 aa
YP_110579.1	produces formate from formyl-tetrahydrofolate which is the major source of formate for PurT in de novo purine nucleotide biosynthesis; has a role in one-carbon metabolism; forms a homohexamer; activated by methionine and inhibited by glycine
YP_110580.1	Similar to Escherichia coli glycine cleavage system transcriptional activator GcvA SWALL:GCVA_ECOLI (SWALL:P32064) (305 aa) fasta scores: E(): 1.9e-32, 37.5% id in 296 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa0032 SWALL:Q9I798 (EMBL:AE004442) (304 aa) fasta scores: E(): 9.4e-40, 43.53% id in 294 aa
YP_110581.1	Similar to Rhizobium meliloti choline-sulfatase BetC SWALL:BETC_RHIME (SWALL:O69787) (512 aa) fasta scores: E(): 8.2e-93, 46.96% id in 511 aa, and to Pseudomonas aeruginosa choline sulfatase pa0031 SWALL:Q9I799 (EMBL:AE004442) (503 aa) fasta scores: E(): 2.2e-126, 61.06% id in 506 aa
YP_110582.1	Similar to Brucella melitensis glycine betaine/L-proline-binding protein bmei0441 SWALL:Q8YIK3 (EMBL:AE009487) (326 aa) fasta scores: E(): 5.5e-48, 43.36% id in 309 aa. C-terminal region is similar to the N-terminal region of Bacillus subtilis glycine betaine-binding protein precursor opuaC SWALL:OPAC_BACSU (SWALL:P46922) (293 aa) fasta scores: E(): 6.3e-07, 24.58% id in 179 aa
YP_110583.1	Similar to Burkholderia cepacia major porin protein OpcP1 SWALL:Q45106 (EMBL:D63823) (361 aa) fasta scores: E(): 1e-29, 38.07% id in 394 aa, and to Alcaligenes eutrophus hypothetical protein SWALL:Q44021 (EMBL:L36817) (390 aa) fasta scores: E(): 1.1e-32, 39.34% id in 399 aa
YP_110584.1	Similar to the N-terminal region of Vibrio proteolyticus bacterial leucyl aminopeptidase precursor SWALL:AMPX_VIBPR (SWALL:Q01693) (504 aa) fasta scores: E(): 1.8e-62, 45.27% id in 402 aa, and to the full length Aeromonas punctata aminopeptidase ApaC SWALL:O82996 (EMBL:AB015725) (393 aa) fasta scores: E(): 2.6e-61, 46.63% id in 401 aa
YP_110585.1	Similar to Bacillus stearothermophilus thermolysin precursor NprT SWALL:THER_BACST (SWALL:P06874) (548 aa) fasta scores: E(): 0.00076, 23.78% id in 597 aa, and to Alicyclobacillus acidocaldarius thermolysin precursor SWALL:Q43880 (EMBL:U07824) (546 aa) fasta scores: E(): 2.5e-05, 24.32% id in 592 aa
YP_110586.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa5389 SWALL:Q9HTH5 (EMBL:AE004951) (336 aa) fasta scores: E(): 5.2e-77, 62.58% id in 310 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa5380 SWALL:Q9HTI4 (EMBL:AE004950) (367 aa) fasta scores: E(): 1.5e-48, 43.73% id in 311 aa
YP_110587.1	Similar to Pseudomonas aeruginosa hypothetical protein pa5388 SWALL:Q9HTH6 (EMBL:AE004951) (312 aa) fasta scores: E(): 1.2e-60, 50% id in 302 aa. C-terminal region is similar to the N-terminal region of Bacillus subtilis glycine betaine-binding protein precursor OpaC SWALL:OPAC_BACSU (SWALL:P46922) (293 aa) fasta scores: E(): 7.4e-10, 28.24% id in 177 aa. Similar to BPSS1423, 64.664% identity (64.664% ungapped) in 283 aa overlap
YP_110588.1	Similar to Pseudomonas aeruginosa hypothetical protein pa5387 SWALL:Q9HTH7 (EMBL:AE004951) (294 aa) fasta scores: E(): 8.5e-96, 83.05% id in 295 aa, and to Streptomyces coelicolor hypothetical protein sco6298 or scbac8d1.11c SWALL:Q93RX4 (EMBL:AL939127) (308 aa) fasta scores: E(): 1.3e-77, 66.88% id in 305 aa
YP_110589.1	converts (S)-3-hydroxybutanoyl-CoA to 3-acetoacetyl-CoA
YP_110590.1	Similar to Pseudomonas aeruginosa hypothetical protein pa5385 SWALL:Q9HTH9 (EMBL:AE004951) (159 aa) fasta scores: E(): 1.6e-29, 54.19% id in 155 aa, and to Rhizobium loti hypothetical protein mlr1489 SWALL:Q98KG3 (EMBL:AP002997) (159 aa) fasta scores: E(): 9.8e-17, 39.31% id in 145 aa
YP_110591.1	Similar to Escherichia coli acetyl esterase Aes SWALL:AES_ECOLI (SWALL:P23872) (319 aa) fasta scores: E(): 3.8e-11, 29.96% id in 297 aa, and to Rhizobium loti lipase mll4497 SWALL:Q98DY0 (EMBL:AP003004) (319 aa) fasta scores: E(): 2.1e-23, 43.46% id in 306 aa
YP_110592.1	No significant database matches. Similar to BPSS1748, 52.525% identity (57.143% ungapped) in 99 aa overlap, and to BPSS0881, 50.000% identity (55.446% ungapped) in 112 aa overlap
YP_110593.1	Similar to Homo sapiens androgen-regulated short-chain dehydrogenase/reductase 1 ARSDR1 SWALL:Q9NRW0 (EMBL:AF167438) (318 aa) fasta scores: E(): 1.8e-28, 38.56% id in 293 aa, and to Pseudomonas aeruginosa probable short chain dehydrogenase pa5031 SWALL:Q9HUD8 (EMBL:AE004916) (309 aa) fasta scores: E(): 1.7e-70, 61.11% id in 306 aa
YP_110594.1	Doubtful CDS. No significant database matches
YP_110595.1	Similar to Escherichia coli D-amino acid dehydrogenase small subunit DadA or DadR SWALL:DADA_ECOLI (SWALL:P29011) (432 aa) fasta scores: E(): 3.7e-17, 28.78% id in 410 aa, and to Rhizobium meliloti  oxidoreductase r00742 or smc00797 SWALL:Q92RU9 (EMBL:AL591784) (417 aa) fasta scores: E(): 3.2e-77, 52.64% id in 416 aa
YP_110596.1	Similar to Pseudomonas aeruginosa leucine-, isoleucine-, valine-, threonine-, and alanine-binding protein precursor BraC SWALL:BRAC_PSEAE (SWALL:P21175) (373 aa) fasta scores: E(): 5.9e-79, 59.23% id in 368 aa, and to Escherichia coli Leu/Ile/Val-binding protein precursor LivJ b3460 SWALL:LIVJ_ECOLI (SWALL:P02917) (367 aa) fasta scores: E(): 2.3e-65, 50.41% id in 361 aa
YP_110597.1	Similar to Pseudomonas aeruginosa high-affinity branched-chain amino acid transport system permease BraD SWALL:BRAD_PSEAE (SWALL:P21627) (307 aa) fasta scores: E(): 1.9e-64, 59.6% id in 302 aa, and to Escherichia coli high-affinity branched-chain amino acid transport system permease LivH SWALL:LIVH_ECOLI (SWALL:P08340) (308 aa) fasta scores: E(): 5.3e-62, 56.91% id in 311 aa
YP_110598.2	Part of the ABC transporter complex LivFGHMJ and LivFGHMK involved in the high-affinity transport of branched-chain amino acids; LivFGHMK is specific for the transport of leucine, while LivFGHMJ is a transporter for leucine, isoleucine, and valine
YP_110599.1	Part of the ABC transporter complexes LivFGHMJ and LivFGHMK involved in the high-affinity transport of branched-chain amino acids; LivFGHMK is specific for the transport of leucine, while LivFGHMJ is a transporter for leucine, isoleucine, and valine
YP_110600.1	Similar to Pseudomonas aeruginosa high-affinity branched-chain amino acid transport ATP-binding protein BraG SWALL:BRAG_PSEAE (SWALL:P21630) (233 aa) fasta scores: E(): 1e-52, 65.23% id in 233 aa, and to Escherichia coli high-affinity branched-chain amino acid transport ATP-binding protein LivF SWALL:LIVF_ECOLI (SWALL:P22731) (237 aa) fasta scores: E(): 5.1e-52, 65.66% id in 233 aa. Similar to BPSL0923, 50.215% identity (50.431% ungapped) in 233 aa overlap
YP_110601.1	N-terinal region is similar to the C-terminal region of Pseudomonas aeruginosa protease LasA SWALL:LASA_PSEAE (SWALL:P14789) (418 aa) fasta scores: E(): 6.2e-10, 29.22% id in 308 aa, and to Achromobacter lyticus beta-lytic metalloendopeptidase precursor SWALL:PRLB_ACHLY (SWALL:P27458) (374 aa) fasta scores: E(): 1.2e-08, 28.85% id in 305 aa
YP_110602.1	involved in the conversion of chorismate to salicylate
YP_110603.1	catalyzes the second reaction in the pyochelin biosynthetic pathway, the conversion of isochorismate to salicylate and pyruvate.
YP_110604.1	Similar to Pseudomonas aeruginosa pyochelin biosynthetic protein PchC SWALL:Q9HWG2 (EMBL:AE004840) (251 aa) fasta scores: E(): 5.5e-46, 56.17% id in 235 aa, and to Streptomyces avermitilis thioesterase SWALL:Q93H55 (EMBL:AB070951) (249 aa) fasta scores: E(): 1.7e-33, 42.38% id in 243 aa
YP_110605.1	Similar to Pseudomonas aeruginosa salicyl-AMP ligase PchD SWALL:Q9RFM9 (EMBL:AF184620) (547 aa) fasta scores: E(): 1.6e-152, 69.33% id in 538 aa, and to Bacillus subtilis 2,3-dihydroxybenzoate-AMP ligase DhbE or EntE SWALL:DHBE_BACSU (SWALL:P40871) (539 aa) fasta scores: E(): 2.8e-112, 54.63% id in 529 aa
YP_110606.1	Similar to Pseudomonas aeruginosa AraC family activator of pyochelin and ferripyochelin receptor synthesis PchR SWALL:PCHR_PSEAE (SWALL:P40883) (296 aa) fasta scores: E(): 1.4e-78, 67.34% id in 297 aa
YP_110607.1	Similar to Pseudomonas aeruginosa pyochelin synthetase PchE SWALL:Q9RFM8 (EMBL:AF184621) (1438 aa) fasta scores: E(): 0, 57.14% id in 1484 aa, and to Yersinia pestis yersiniabactin biosynthetic protein Irp2 or ypo1911 SWALL:Q8ZF24 (EMBL:AJ414150) (2035 aa) fasta scores: E(): 4.3e-111, 35.92% id in 1495 aa
YP_110608.1	Similar to Pseudomonas aeruginosa pyochelin synthetase PchF SWALL:Q9RFM7 (EMBL:AF184622) (1809 aa) fasta scores: E(): 1.1e-173, 56.86% id in 2019 aa. Weakly similar to Yersinia pestis yersiniabactin biosynthetic protein Irp2 or ypo1911 SWALL:Q8ZF24 (EMBL:AJ414150) (2035 aa) fasta scores: E(): 3.8e-91, 29% id in 1958 aa
YP_110609.1	Similar to Pseudomonas aeruginosa reductase required pyochelin biosynthesis PchG SWALL:Q9HWG5 (EMBL:AE004839) (349 aa) fasta scores: E(): 5e-68, 56.81% id in 345 aa, and to Yersinia enterocolitica Irp3 protein SWALL:O54512 (EMBL:Y12527) (365 aa) fasta scores: E(): 4.5e-15, 27.95% id in 347 aa
YP_110610.1	Similar to Pseudomonas aeruginosa probable ATP-binding component of ABC transporter pa4223 or PchH SWALL:Q9HWG6 (EMBL:AE004839) (570 aa) fasta scores: E(): 3.1e-92, 56.09% id in 574 aa, and to Streptomyces coelicolor  ABC transporter ATP-binding protein SCO7689 or SC4C2.24 SWALL:Q9EWN8 (EMBL:AL939132) (608 aa) fasta scores: E(): 5.1e-53, 39.93% id in 571 aa
YP_110611.1	Similar to Pseudomonas aeruginosa probable ATP-binding component of ABC transporter pa4222 SWALL:Q9HWG7 (EMBL:AE004839) (574 aa) fasta scores: E(): 2.8e-97, 59.71% id in 556 aa, and to Mycobacterium tuberculosis hypothetical ABC transporter ATP-binding protein rv1349 or mt1392 or mtcy02b10.13 SWALL:YD49_MYCTU (SWALL:Q11019) (579 aa) fasta scores: E(): 1.2e-33, 32.35% id in 578 aa
YP_110612.1	Similar to Pseudomonas aeruginosa Fe(III)-pyochelin receptor precursor FptA SWALL:FPTA_PSEAE (SWALL:P42512) (720 aa) fasta scores: E(): 1.5e-172, 63.05% id in 674 aa, and to the C-terminal region of Pseudomonas aeruginosa ferripyoverdine receptor precursor FpvA SWALL:FPVA_PSEAE (SWALL:P48632) (815 aa) fasta scores: E(): 1.9e-62, 31.42% id in 732 aa. Poor similarity to the P. aeruginosa FptA protein in the N-terminal region. CDS lacks a N-terminal signal sequence, effect on the function of the CDS is not known
YP_110613.1	Similar to Pseudomonas aeruginosa FptB protein precursor pa4220 SWALL:FPTB_PSEAE (SWALL:P42513) (93 aa) fasta scores: E(): 0.00021, 38.82% id in 85 aa
YP_110614.1	Similar to Pseudomonas aeruginosa hypothetical protein pa0801 SWALL:Q9I5D7 (EMBL:AE004515) (506 aa) fasta scores: E(): 1.2e-18, 26.73% id in 520 aa. C-terminal region is similar to Pseudomonas aeruginosa hypothetical protein pa4219 SWALL:Y6B9_PSEAE (SWALL:P42514) (394 aa) fasta scores: E(): 9e-68, 53.62% id in 386 aa
YP_110615.1	Similar to Pseudomonas aeruginosa probable transporter pa4218 SWALL:Q9HWG8 (EMBL:AE004838) (414 aa) fasta scores: E(): 2.8e-105, 71.56% id in 408 aa. N-terminal region is similar to the N-terminal region of Escherichia coli AmpG protein SWALL:AMPG_ECOLI (SWALL:P36670) (491 aa) fasta scores: E(): 7e-12, 24.41% id in 344 aa
YP_110616.1	Similar to Synechococcus sp. ferredoxin I PetF SWALL:FER1_SYNP2 (SWALL:P31965) (96 aa) fasta scores: E(): 1.3e-07, 37.93% id in 87 aa, and to Equisetum telmateia ferredoxin I SWALL:FER1_EQUTE (SWALL:P00234) (95 aa) fasta scores: E(): 6.8e-08, 44.3% id in 79 aa
YP_110617.1	Similar to Alcaligenes eutrophus acetoin catabolism regulatory protein AcoR SWALL:ACOR_ALCEU (SWALL:P28614) (668 aa) fasta scores: E(): 1.1e-63, 38.95% id in 652 aa, and to Xanthomonas axonopodis transcriptional regulator xac0654 SWALL:AAM35543 (EMBL:AE011694) (661 aa) fasta scores: E(): 2.8e-62, 40.25% id in 641 aa
YP_110618.1	Similar to an internal region of Chlorobium tepidum hypothetical protein CT1731 SWALL:Q8KBQ3 (EMBL:AE012927) (263 aa) fasta scores: E(): 0.99, 35.48% id in 62 aa. Possible gene remnant
YP_110619.1	Similar to Ralstonia solanacearum hypothetical protein rsc1512 or rs03792 SWALL:Q8XZ92 (EMBL:AL646065) (92 aa) fasta scores: E(): 3.5e-11, 50.57% id in 87 aa, and to Ralstonia solanacearum hypothetical protein rsc1590 or rs03952 SWALL:Q8XZ16 (EMBL:AL646065) (95 aa) fasta scores: E(): 0.042, 36.47% id in 85 aa. Similar to BPSS0833, 59.140% identity (60.440% ungapped) in 93 aa overlap
YP_110620.1	Similar to Oryza sativa protein P0432C03.16 SWALL:Q8S9Q3 (EMBL:AP004031) (56 aa) fasta scores: E(): 2, 39.62% id in 53 aa
YP_110621.1	Similar to Rhizobium loti hypothetical protein mll4983 SWALL:Q98CV6 (EMBL:AP003005) (281 aa) fasta scores: E(): 7.3, 34.88% id in 86 aa. Possible gene remnant
YP_110622.1	Similar to Ralstonia solanacearum probable transmembrane protein rsp1678 or rs02237 SWALL:Q8XPG3 (EMBL:AL646086) (434 aa) fasta scores: E(): 1.3e-123, 74.76% id in 432 aa, and to Comamonas acidovorans xanthine/uracil permease XprA SWALL:Q8RLB9 (EMBL:AY082333) (433 aa) fasta scores: E(): 3.1e-115, 69.14% id in 431 aa
YP_110623.1	Poor database matches. Weakly similar to the C-terminal region of Caulobacter crescentus hypothetical protein cc3240 SWALL:Q9A3G4 (EMBL:AE005988) (318 aa) fasta scores: E(): 1.5e-16, 29.63% id in 189 aa
YP_110625.1	C-terminal region is similar to Ralstonia solanacearum hypothetical protein rsc0324 or rs03291 SWALL:Q8Y2L1 (EMBL:AL646058) (119 aa) fasta scores: E(): 0.0023, 31.31% id in 99 aa. Possible alternative translational start site
YP_110626.1	Similar to Rhizobium meliloti hypothetical membrane protein rb0104 or smb20104 SWALL:Q92X58 (EMBL:AL603642) (252 aa) fasta scores: E(): 9.9e-15, 27.61% id in 239 aa, and to Methanosarcina acetivorans hypothetical protein ma1331 SWALL:Q8TR53 (EMBL:AE010803) (243 aa) fasta scores: E(): 6.6e-09, 24.18% id in 244 aa
YP_110627.1	Similar to Escherichia coli glycine cleavage system transcriptional activator GcvA SWALL:GCVA_ECOLI (SWALL:P32064) (305 aa) fasta scores: E(): 1.3e-25, 30.16% id in 295 aa, and to Pseudomonas fluorescens positive transcriptional regulator PhnR SWALL:O69758 (EMBL:L49465) (299 aa) fasta scores: E(): 1.2e-48, 47.6% id in 292 aa
YP_110628.1	Similar to Streptococcus mutans NADP-dependent glyceraldehyde-3-phosphate dehydrogenase GapN SWALL:GAPN_STRMU (SWALL:Q59931) (475 aa) fasta scores: E(): 3.7e-47, 35.91% id in 426 aa, and to Rhizobium meliloti  aldehyde dehydrogenase rb0979 or smb21539 SWALL:Q92UV7 (EMBL:AL603645) (485 aa) fasta scores: E(): 2.4e-85, 50.43% id in 456 aa. Also similar to BPSS0349 (482 aa) fasta scores: E(): 3.1e-100, 59.244% identity in 476 aa overlap
YP_110629.1	Similar to Alcaligenes eutrophus alpha-ketoglutarate-dependent 2,4-dichlorophenoxyacetate dioxygenase TfdA SWALL:TFDA_ALCEU (SWALL:P10088) (287 aa) fasta scores: E(): 1.4e-20, 30.76% id in 260 aa, and to Pseudomonas aeruginosa hypothetical protein pa2310 SWALL:Q9I1G5 (EMBL:AE004657) (295 aa) fasta scores: E(): 5.4e-31, 35.94% id in 281 aa
YP_110630.1	Similar to Streptomyces wedmorensis phosphonopyruvate decarboxylase Fom2 SWALL:Q56190 (EMBL:AB016934) (384 aa) fasta scores: E(): 3.2e-56, 47.48% id in 377 aa, and to Streptomyces viridochromogenes 3-phosphonopyruvate decarboxylase Ppd SWALL:O86938 (EMBL:Y14337) (397 aa) fasta scores: E(): 8.5e-37, 38.51% id in 405 aa
YP_110631.1	Similar to Tetrahymena pyriformis phosphoenolpyruvate phosphomutase precursor PepM SWALL:PEPM_TETPY (SWALL:P33182) (300 aa) fasta scores: E(): 5e-19, 32.05% id in 287 aa, and to he c-terminal region of Bacteroides fragilis  phosphoenolpyruvate phosphomutase AepX SWALL:Q9F765 (EMBL:AF285774) (433 aa) fasta scores: E(): 1.7e-55, 52% id in 300 aa
YP_110632.1	Similar to Pseudomonas aeruginosa hypothetical protein pa3325 SWALL:Q9HYS0 (EMBL:AE004754) (295 aa) fasta scores: E(): 1.1e-59, 48.46% id in 293 aa, and to Streptomyces coelicolor hypothetical protein SCO2221 or SC10B7.16 SWALL:Q9KZ16 (EMBL:AL939111) (296 aa) fasta scores: E(): 6.6e-46, 43.86% id in 285 aa. Similar to BPSS1223, 74.150% identity (74.150% ungapped) in 294 aa overlap
YP_110633.1	Similar to Pseudomonas aeruginosa probable short-chain dehydrogenase pa3324 SWALL:Q9HYS1 (EMBL:AE004754) (592 aa) fasta scores: E(): 9.2e-113, 50.42% id in 593 aa, and to Streptomyces coelicolor oxidoreductase SCO3954 or SCD78.21c SWALL:Q9ZBX8 (EMBL:AL939118) (585 aa) fasta scores: E(): 4.4e-107, 50.69% id in 578 aa
YP_110634.1	Similar to Pseudomonas aeruginosa hypothetical protein pa3323 SWALL:Q9HYS2 (EMBL:AE004754) (291 aa) fasta scores: E(): 2.2e-70, 62.72% id in 279 aa, and to the C-terminal region of Streptomyces coelicolor hypothetical protein SCO3955 or SCD78.22c SWALL:Q9ZBX7 (EMBL:AL939118) (339 aa) fasta scores: E(): 5e-56, 53.65% id in 274 aa
YP_110635.1	Similar to thye C-terminal region of Homo sapiens erythrocyte band 7 integral membrane protein EPB72 or BND7 SWALL:BAN7_HUMAN (SWALL:P27105) (287 aa) fasta scores: E(): 4.9e-39, 48.99% id in 249 aa, and to the full length Ralstonia solanacearum  stomatin-like transmembrane protein rsc0802 or rs05031 SWALL:Q8Y188 (EMBL:AL646061) (249 aa) fasta scores: E(): 2.3e-66, 76.73% id in 245 aa
YP_110636.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0803 or rs05027 SWALL:Q8Y187 (EMBL:AL646061) (470 aa) fasta scores: E(): 1.6e-74, 58.71% id in 465 aa, and to Rhizobium meliloti probable membrane protein necessary for nodulation competitiveness NfeD or rb1115 or smb20990 SWALL:Q92UL2 (EMBL:AL603646) (478 aa) fasta scores: E(): 2.6e-56, 47.78% id in 475 aa
YP_110637.1	Similar to Pseudomonas aeruginosa ornithine utilization regulator OruR SWALL:ORUR_PSEAE (SWALL:P72171) (339 aa) fasta scores: E(): 5.3e-14, 25% id in 332 aa, and to Ralstonia solanacearum probable transcription regulator protein rsp0653 or rs05569 SWALL:Q8XS28 (EMBL:AL646080) (387 aa) fasta scores: E(): 5.1e-89, 64.85% id in 350 aa. Possible alternative translational start site
YP_110638.1	Similar to the C-terminal region of Homo sapiens acyl-CoA dehydrogenase, short-chain specific, mitochondrial precursor ACSDS SWALL:ACDS_HUMAN (SWALL:P16219) (412 aa) fasta scores: E(): 5.4e-64, 48.51% id in 371 aa, and to the full length Ralstonia solanacearum probable acyl-CoA dehydrogenase oxidoreductase rsp0652 or rs05570 SWALL:Q8XS29 (EMBL:AL646080) (377 aa) fasta scores: E(): 2.2e-119, 79.57% id in 377 aa
YP_110639.1	Similar to Ralstonia solanacearum probable acetyl-coenzyme A synthetase rsp0651 or rs05571 SWALL:Q8XS30 (EMBL:AL646080) (567 aa) fasta scores: E(): 2.8e-165, 75.22% id in 561 aa, and to Streptomyces coelicolor  acetyl-coenzyme A synthetase SCO6195 or SC2G5.16 SWALL:Q9Z5A7 (EMBL:AL939126) (558 aa) fasta scores: E(): 1.1e-118, 58.46% id in 561 aa
YP_110640.1	Similar to Pseudomonas aeruginosa methylmalonate-semialdehyde dehydrogenase [acylating] MmsA SWALL:MMSA_PSEAE (SWALL:P28810) (496 aa) fasta scores: E(): 6.6e-114, 58.46% id in 496 aa, and to Ralstonia solanacearum probable methylmalonate-semialdehyde dehydrogenase oxidoreductase rsp0650 or rs05572 SWALL:Q8XS31 (EMBL:AL646080) (515 aa) fasta scores: E(): 3.2e-161, 80.86% id in 507 aa
YP_110641.1	Similar to Pseudomonas aeruginosa 3-hydroxyisobutyrate dehydrogenase MmsB SWALL:MMSB_PSEAE (SWALL:P28811) (298 aa) fasta scores: E(): 1.5e-44, 50.33% id in 300 aa, and to Ralstonia solanacearum probable 3-hydroxyisobutyrate dehydrogenase oxidoreductase rsp0649 or rs05573 SWALL:Q8XS32 (EMBL:AL646080) (298 aa) fasta scores: E(): 1e-72, 73.89% id in 295 aa
YP_110642.1	Catalyzes the reversible hydration of unsaturated fatty acyl-CoA to beta-hydroxyacyl-CoA
YP_110643.1	Similar to Homo sapiens 3-hydroxyisobutyryl-coenzyme A hydrolase SWALL:Q92931 (EMBL:U66669) (381 aa) fasta scores: E(): 3.2e-33, 36.24% id in 367 aa, and to Ralstonia solanacearum enoyl-coenzyme A hydratase rsp0647 or rs05575 SWALL:Q8XS34 (EMBL:AL646080) (390 aa) fasta scores: E(): 9e-102, 71.77% id in 372 aa
YP_110644.1	Similar to Pseudomonas aeruginosa outer membrane protein OprJ SWALL:OPRJ_PSEAE (SWALL:Q51397) (479 aa) fasta scores: E(): 5.6e-27, 30.22% id in 450 aa, and to Ralstonia solanacearum  outer membrane multidrug resistance lipoprotein rsc1854 or rs05605 SWALL:Q8XYA8 (EMBL:AL646067) (475 aa) fasta scores: E(): 1.8e-29, 29.55% id in 467 aa
YP_110645.1	Similar to Escherichia coli macrolide-specific ABC-type efflux carrier MacB SWALL:MACB_ECOLI (SWALL:P75831) (648 aa) fasta scores: E(): 7.7e-128, 59.35% id in 652 aa, and to Yersinia pestis  ABC transporter ATP-binding protein ypo1365 SWALL:Q8ZGD7 (EMBL:AJ414148) (649 aa) fasta scores: E(): 9.7e-131, 59.01% id in 649 aa
YP_110646.1	Similar to Escherichia coli macrolide-specific efflux protein MacA SWALL:MACA_ECOLI (SWALL:P75830) (371 aa) fasta scores: E(): 3e-34, 43.33% id in 390 aa, and to Pseudomonas syringae  periplasmic protein SWALL:Q93NK1 (EMBL:AF372703) (389 aa) fasta scores: E(): 9.4e-54, 52.04% id in 367 aa
YP_110647.1	Similar to Pseudomonas putida alkanesulfonate monooxygenase SsuD or DsuD SWALL:SSUD_PSEPU (SWALL:O85764) (382 aa) fasta scores: E(): 2.8e-19, 28.99% id in 369 aa, and to Pseudomonas aeruginosa hypothetical protein pa3954 SWALL:Q9HX62 (EMBL:AE004813) (364 aa) fasta scores: E(): 1.9e-115, 79.94% id in 364 aa
YP_110648.1	Similar to Escherichia coli ribonuclease I precursor Rna or RnsA SWALL:RNI_ECOLI (SWALL:P21338) (268 aa) fasta scores: E(): 4.5e-08, 30.29% id in 241 aa, and to Rhizobium meliloti  ribonuclease r02202 or smc02819 SWALL:Q92NJ8 (EMBL:AL591789) (255 aa) fasta scores: E(): 4.3e-16, 30.17% id in 232 aa
YP_110649.1	catalyzes the formation of glutamate from glutamine
YP_110651.1	Similar to Escherichia coli, Salmonella typhimurium, Salmonella typhi and Shigella flexneri transcriptional regulatory protein OmpR SWALL:OMPR_ECOLI (SWALL:P03025) (239 aa) fasta scores: E(): 7.1e-29, 43.53% id in 232 aa, and to Pseudomonas aeruginosa probable two-component response regulator pa1157 SWALL:Q9I4I0 (EMBL:AE004546) (236 aa) fasta scores: E(): 5.4e-43, 54.14% id in 229 aa
YP_110652.1	No significant database matches to the full length CDS. C-terminus is similar to the C-terminal regions of Escherichia coli sensor protein CpxA or EcfB or Ssd or Eup SWALL:CPXA_ECOLI (SWALL:P08336) (457 aa) fasta scores: E(): 9.9e-15, 31.93% id in 238 aa, and to Pseudomonas aeruginosa probable two-component sensor pa1798 SWALL:Q9I2U4 (EMBL:AE004606) (428 aa) fasta scores: E(): 1.7e-33, 39.17% id in 291 aa. Possible alternative translational start site
YP_110653.2	Similar to Pseudomonas aeruginosa hypothetical protein pa3339 SWALL:Q9HYQ6 (EMBL:AE004756) (728 aa) fasta scores: E(): 6.6e-53, 34.01% id in 729 aa, and to Vibrio cholerae hypothetical protein vc0603 SWALL:Q9KUB9 (EMBL:AE004145) (764 aa) fasta scores: E(): 7.6e-43, 32.18% id in 755 aa. Possible alternative translational start site
YP_110654.1	Similar to Escherichia coli, Salmonella typhimurium, Salmonella typhi, and Shigella flexneri rod shape-determining protein MreB SWALL:MREB_ECOLI (SWALL:P13519) (347 aa) fasta scores: E(): 3.8e-57, 51.43% id in 348 aa, and to Ralstonia solanacearum probable rod shape-determining protein rsc0059 or rs01882 SWALL:Q8Y3C1 (EMBL:AL646057) (347 aa) fasta scores: E(): 3.5e-63, 54.95% id in 333 aa. Similar to BPSL0186, 54.955% identity (54.955% ungapped) in 333 aa overlap
YP_110655.1	Similar to Pseudomonas aeruginosa hypothetical protein pa1878 SWALL:Q9I2L9 (EMBL:AE004614) (192 aa) fasta scores: E(): 2e-51, 69.84% id in 189 aa, and to Agrobacterium tumefaciens hypothetical protein SWALL:Q9R6H4 (EMBL:AB016260) (222 aa) fasta scores: E(): 8.6e-14, 36.41% id in 184 aa
YP_110656.1	C-terminal region is similar to Rhizobium loti hypothetical protein mll0692 SWALL:Q98M80 (EMBL:AP002995) (660 aa) fasta scores: E(): 1.1e-110, 53.38% id in 665 aa. Full length CDS is similar to Bacillus halodurans hypothetical protein bh3691 SWALL:Q9K6N7 (EMBL:AP001519) (702 aa) fasta scores: E(): 5.2e-74, 35.78% id in 693 aa
YP_110657.1	Poor database matches. Similar to the C-terminal region of Myxococcus xanthus RNA polymerase sigma factor CarQ SWALL:CARQ_MYXXA (SWALL:Q06909) (174 aa) fasta scores: E(): 6.7, 32.91% id in 79 aa
YP_110658.1	Similar to Pseudomonas putida glyoxalase pp3444 SWALL:AAN69046 (EMBL:AE016786) (159 aa) fasta scores: E(): 3.9e-25, 51.92% id in 156 aa, and to Ralstonia solanacearum hypothetical protein rsc0107 or rs00977 SWALL:Q8Y374 (EMBL:AL646057) (159 aa) fasta scores: E(): 2e-24, 47.61% id in 147 aa
YP_110659.1	Similar to Zea mays glutathione S-transferase III Gst3 SWALL:GTH3_MAIZE (SWALL:P04907) (221 aa) fasta scores: E(): 2e-05, 30.18% id in 212 aa, and to Rhizobium meliloti  glutathione S-transferase r02060 or smc04321 SWALL:Q92NV7 (EMBL:AL591789) (224 aa) fasta scores: E(): 1.3e-36, 48.59% id in 214 aa
YP_110660.1	Similar to Rhizobium meliloti hypothetical protein r02087 or smc01408 SWALL:Q92NT5 (EMBL:AL591789) (236 aa) fasta scores: E(): 4.6e-66, 67.09% id in 234 aa, and to Rhizobium loti hypothetical protein mll2522 SWALL:Q98I82 (EMBL:AP002999) (273 aa) fasta scores: E(): 1.9e-20, 41.42% id in 239 aa
YP_110661.1	Similar to Escherichia coli sensor protein QseC SWALL:QSEC_ECOLI (SWALL:P40719) (449 aa) fasta scores: E(): 4.6e-27, 32.08% id in 452 aa, and to Ralstonia solanacearum probable transmembrane two-component sensor kinase transcription regulator protein rsp1553 or rs02109 SWALL:Q8XPT4 (EMBL:AL646085) (438 aa) fasta scores: E(): 9.4e-50, 41.34% id in 445 aa
YP_110662.1	Similar to Salmonella typhimurium transcriptional regulatory protein BasR or PmrA or ParA SWALL:BASR_SALTY (SWALL:P36556) (222 aa) fasta scores: E(): 1.2e-38, 50.46% id in 214 aa, and to Ralstonia solanacearum probable response regulator transcription regulator protein rsc3404 or rs01713 SWALL:Q8XTZ1 (EMBL:AL646075) (221 aa) fasta scores: E(): 1.1e-43, 55% id in 220 aa. Simlar to BPSL0806, self_match.tab 935589:936422 forward MW:3 (278 aa) initn: 837 init1: 837 opt: 839 Z-score: 811.0 bits: 157.5 E(): 1.3e-39 Smith-Waterman score: 839; 59.259% identity (59.259% ungapped) in 216 aa overlap
YP_110663.1	Similar to Rhizobium loti hypothetical protein mlr5989 SWALL:Q98AI2 (EMBL:AP003008) (293 aa) fasta scores: E(): 1.2e-27, 35.12% id in 279 aa, and to Ralstonia solanacearum hypothetical protein rsc0081 or rs02255 SWALL:Q8Y399 (EMBL:AL646057) (300 aa) fasta scores: E(): 3.8e-24, 34.04% id in 282 aa
YP_110664.1	Weakly similar to Salmonella typhi hypothetical protein sty2195 SWALL:Q8Z5Q9 (EMBL:AL627272) (81 aa) fasta scores: E(): 0.066, 38.33% id in 60 aa, and to Escherichia coli hypothetical protein YodC SWALL:YODC_ECOLI (SWALL:P76331) (60 aa) fasta scores: E(): 0.098, 40.74% id in 54 aa
YP_110665.1	C-terminal region is similar to Bacteriophage T4 immunity protein Imm SWALL:IMM_BPT4 (SWALL:P08986) (83 aa) fasta scores: E(): 0.004, 40.35% id in 57 aa, and to Bacteriophage T2 ORF42.1 SWALL:Q38392 (EMBL:Z35073) (83 aa) fasta scores: E(): 0.0055, 36.36% id in 55 aa
YP_110666.1	Similar to Escherichia coli O157:H7 hypothetical protein Z2165 SWALL:Q8X475 (EMBL:AE005351) (131 aa) fasta scores: E(): 9.3e-29, 60.46% id in 129 aa, and to the C-terminal region of Vibrio cholerae hypothetical protein vca1053 SWALL:Q9KKP9 (EMBL:AE004431) (166 aa) fasta scores: E(): 1.8e-29, 62.69% id in 126 aa
YP_110667.1	upregulated by FixLJ/FixK under oxygen limitation; involved in regulation of genes involved in carbon and amino acid metabolism
YP_110668.1	Poor database matches. Weakly similar to Rhizobium etli hypothetical protein SWALL:AAM54839 (EMBL:U80928) (157 aa) fasta scores: E(): 6.4, 28.14% id in 135 aa
YP_110669.1	Similar to Xanthomonas axonopodis succinyl-diaminopimelate desuccinylase xac2952 SWALL:AAM37797 (EMBL:AE011937) (497 aa) fasta scores: E(): 6e-105, 56.72% id in 476 aa, and to Xanthomonas campestris succinyl-diaminopimelate desuccinylase xcc2782 SWALL:AAM42054 (EMBL:AE012391) (497 aa) fasta scores: E(): 7.9e-104, 56.51% id in 476 aa
YP_110670.1	Similar to Ralstonia solanacearum hypothetical protein rsc0090 or rs02263 SWALL:Q8Y390 (EMBL:AL646057) (152 aa) fasta scores: E(): 3.1e-12, 45.94% id in 111 aa, and to Rhizobium loti hypothetical protein mlr0026 SWALL:Q98NQ9 (EMBL:AP002994) (107 aa) fasta scores: E(): 5e-08, 32.03% id in 103 aa
YP_110671.1	Similar to Rhizobium meliloti  membrane protein, similar to periplasmic nitrate reductase NnuR rb1123 or smb20997 SWALL:Q92UK4 (EMBL:AL603646) (194 aa) fasta scores: E(): 1e-25, 40.31% id in 191 aa, and to Caulobacter crescentus hypothetical protein CC0706 SWALL:Q9AAA0 (EMBL:AE005745) (188 aa) fasta scores: E(): 3.6e-25, 42.48% id in 193 aa
YP_110673.2	catalyzes the removal of N-terminal dipeptides when proline is the penultimate residue
YP_110674.1	Similar to Bradyrhizobium japonicum hypothetical protein bll5514 SWALL:BAC50779 (EMBL:AP005955) (520 aa) fasta scores: E(): 2e-18, 30.07% id in 562 aa, and to Caulobacter crescentus hypothetical protein CC3418 SWALL:Q9A2Y8 (EMBL:AE006002) (504 aa) fasta scores: E(): 4.7e-17, 29.55% id in 538 aa
YP_110677.1	Similar to Agrobacterium tumefaciens VirA/G regulated gene VirK SWALL:O50246 (EMBL:AF034769) (144 aa) fasta scores: E(): 1.4e-09, 29.92% id in 137 aa, and to Xanthomonas campestris VirK protein xcc0418 SWALL:Q8PDC2 (EMBL:AE012139) (143 aa) fasta scores: E(): 2.2e-10, 36.05% id in 147 aa
YP_110678.1	Similar to the C-terminal regions of Escherichia coli adhesin AIDA-I SWALL:AIDA_ECOLI (SWALL:Q03155) (1286 aa) fasta scores: E(): 0.62, 29.31% id in 116 aa, and to Pseudomonas aeruginosa probable adhesin pa4082 SWALL:Q9HWU6 (EMBL:AE004824) (1018 aa) fasta scores: E(): 0.16, 27.13% id in 129 aa. Possible gene remnant
YP_110679.1	Similar to Escherichia coli and Shigella flexneri transcriptional regulatory protein CpxR SWALL:CPXR_ECOLI (SWALL:P16244) (232 aa) fasta scores: E(): 1.3e-13, 29.53% id in 237 aa, and to Salmonella typhi two-component response regulatory protein sty3812 SWALL:Q8Z2W2 (EMBL:AL627279) (232 aa) fasta scores: E(): 9.6e-14, 29.53% id in 237 aa
YP_110680.1	Similar to Escherichia coli alpha-ketoglutarate-dependent taurine dioxygenase TauD or SsiD SWALL:TAUD_ECOLI (SWALL:P37610) (282 aa) fasta scores: E(): 4.9e-32, 37.23% id in 282 aa, and to Pseudomonas aeruginosa hypothetical protein pa0193 SWALL:Q9I6U1 (EMBL:AE004457) (300 aa) fasta scores: E(): 2e-61, 54.54% id in 286 aa
YP_110681.1	Subfamily M9A unassigned peptidase. C-terminal region is similar to an internal region of Vibrio alginolyticus microbial collagenase precursor SWALL:COLA_VIBAL (SWALL:P43154) (814 aa) fasta scores: E(): 1.8e-54, 32.52% id in 578 aa, and to the C-terminal region of Vibrio parahaemolyticus microbial collagenase precursor PrtVp SWALL:COLA_VIBPA (SWALL:Q56696) (587 aa) fasta scores: E(): 9.3e-48, 33.21% id in 545 aa. Similar to BPSS0827, 81.329% identity (81.458% ungapped) in 632 aa overlap
YP_110682.1	Similar to Xanthomonas campestris hypothetical protein xcc1648 SWALL:AAM40942 (EMBL:AE012266) (78 aa) fasta scores: E(): 4e-05, 43.54% id in 62 aa, and to an internal region of Pseudomonas aeruginosa hypothetical protein pa3012 SWALL:Q9HZJ4 (EMBL:AE004726) (124 aa) fasta scores: E(): 6.1e-09, 61.01% id in 59 aa
YP_110683.1	Similar to Salmonella typhimurium  cytoplasmic protein stm0986 SWALL:Q8ZQC1 (EMBL:AE008742) (410 aa) fasta scores: E(): 4.1e-83, 52.03% id in 394 aa, and to Escherichia coli hypothetical protein YcaQ SWALL:YCAQ_ECOLI (SWALL:P75843) (410 aa) fasta scores: E(): 1.1e-82, 51.64% id in 395 aa
YP_110684.1	Similar to Rhizobium loti multidrug efflux protein mll8348 SWALL:Q983F7 (EMBL:AP003013) (473 aa) fasta scores: E(): 1.6e-74, 46.01% id in 452 aa, and to Xanthomonas axonopodis drug resistance translocase xac2494 SWALL:AAM37345 (EMBL:AE011887) (471 aa) fasta scores: E(): 2.5e-64, 43.13% id in 459 aa
YP_110685.3	Similar to Escherichia coli periplasmic trehalase precursor TreA or OsmA SWALL:TREA_ECOLI (SWALL:P13482) (565 aa) fasta scores: E(): 7.9e-103, 55.96% id in 495 aa, and to Ralstonia solanacearum probable periplasmic alpha,alpha-trehalase signal peptide protein rsp0277 or rs03687 SWALL:Q8XT38 (EMBL:AL646077) (551 aa) fasta scores: E(): 1.1e-134, 68.56% id in 528 aa. CDS is extended at the N-terminus in comparison to orthologues and lacks an N-terminal signal sequence; the effect on the function of CDS is not known
YP_110686.1	Weakly similar to Pseudomonas putida formate/nitrite transporter family transporter protein PP1156 SWALL:AAN66781 (EMBL:AE016778) (298 aa) fasta scores: E(): 0.11, 22.69% id in 260 aa. Possible alternative translational start site. C-terminal region is similar to the C-terminal region of Similar to Pseudomonas putida  membrane protein PP1696 SWALL:AAN67317 (EMBL:AE016780) (392 aa) fasta scores: E(): 0.91, 28.19% id in 227 aa. Possible gene remnant
YP_110687.1	Similar to the C-terminal region of Synechocystis sp. cytochrome c oxidase polypeptide III CtaE SWALL:COX3_SYNY3 (SWALL:Q06475) (233 aa) fasta scores: E(): 2.1e-12, 31.79% id in 173 aa, and to the full length Bradyrhizobium japonicum nitric oxide reductase subunit E blr3212 SWALL:BAC48477 (EMBL:AP005946) (191 aa) fasta scores: E(): 2e-21, 39.44% id in 180 aa
YP_110688.1	Similar to Pseudomonas fluorescens NirP protein SWALL:Q9F0X2 (EMBL:AF197466) (81 aa) fasta scores: E(): 3.9, 29.87% id in 77 aa
YP_110689.1	Similar to Burkholderia cepacia genomovar III regulatory protein SWALL:Q8VP25 (EMBL:AY028431) (302 aa) fasta scores: E(): 7.8e-78, 66% id in 303 aa. C-terminal region is similar to Pseudomonas aeruginosa transcriptional activator protein LasR SWALL:LASR_PSEAE (SWALL:P25084) (239 aa) fasta scores: E(): 4.6e-05, 25.1% id in 243 aa
YP_110690.1	Similar to Burkholderia cepacia genomovar III regulatory protein SWALL:Q8VP24 (EMBL:AY028431) (277 aa) fasta scores: E(): 1.3e-55, 56.27% id in 279 aa. C-terminal region is weakly similar to the C-terminal region of Pseudomonas aeruginosa transcriptional activator protein LasR SWALL:LASR_PSEAE (SWALL:P25084) (239 aa) fasta scores: E(): 6.5, 21.59% id in 213 aa
YP_110691.1	Similar to Burkholderia cepacia genomovar III asparagine synthetase SWALL:Q8VP10 (EMBL:AY028431) (656 aa) fasta scores: E(): 6e-206, 74.54% id in 656 aa. N-terminal region is similar to the N-terminal region of Bacillus subtilis asparagine synthetase [glutamine-hydrolyzing] 2 AsnH SWALL:ASNH_BACSU (SWALL:P42113) (747 aa) fasta scores: E(): 4.6e-23, 27.93% id in 605 aa
YP_110692.1	Similar to Brevundimonas diminuta isoquinoline 1-oxidoreductase beta subunit IorB SWALL:IORB_BREDI (SWALL:Q51698) (781 aa) fasta scores: E(): 4e-14, 34.82% id in 784 aa, and to Pseudomonas aeruginosa probable oxidoreductase pa1880 SWALL:Q9I2L7 (EMBL:AE004614) (731 aa) fasta scores: E(): 0, 79.26% id in 738 aa
YP_110693.1	Similar to Brevundimonas diminuta isoquinoline 1-oxidoreductase alpha subunit IorA SWALL:IORA_BREDI (SWALL:Q51697) (152 aa) fasta scores: E(): 5e-32, 58.62% id in 145 aa, and to Pseudomonas aeruginosa probable oxidoreductase pa1881 SWALL:Q9I2L6 (EMBL:AE004614) (153 aa) fasta scores: E(): 1e-50, 84.96% id in 153 aa
YP_110694.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa2047 SWALL:Q9I268 (EMBL:AE004631) (329 aa) fasta scores: E(): 1.8e-49, 47.72% id in 329 aa, and weakly similar to Pseudomonas aeruginosa regulatory protein AraC family activator of pyochelin and ferripyochelin receptor synthesis PchR SWALL:PCHR_PSEAE (SWALL:P40883) (296 aa) fasta scores: E(): 7.7e-06, 24.25% id in 301 aa
YP_110695.1	Similar to Vibrio vulnificus conserved hypothetical protein vv12197 SWALL:AAO10581 (EMBL:AE016804) (129 aa) fasta scores: E(): 5.3e-16, 46.15% id in 117 aa, and to Streptomyces coelicolor hypothetical protein SCO4364 or SCD19.19 SWALL:Q9F2Y3 (EMBL:AL939119) (125 aa) fasta scores: E(): 1.5e-09, 38.33% id in 120 aa. Possible alternative translational start sites
YP_110697.1	Similar to Rhodococcus sp. dibenzothiophene desulfurization enzyme C SoxC or DszC SWALL:SOXC_RHOSO (SWALL:P54998) (417 aa) fasta scores: E(): 1.3e-15, 36.09% id in 399 aa, and to Pseudomonas aeruginosa hypothetical protein pa2325 SWALL:Q9I1F3 (EMBL:AE004658) (411 aa) fasta scores: E(): 7.3e-93, 59.46% id in 412 aa. Similar to BPSS0685, 55.721% identity (56.566% ungapped) in 402 aa overlap
YP_110698.1	Similar to Rhodococcus sp. dibenzothiophene desulfurization enzyme C SoxcC or DszC SWALL:SOXC_RHOSO (SWALL:P54998) (417 aa) fasta scores: E(): 7.9e-13, 30.65% id in 411 aa, and to Pseudomonas aeruginosa hypothetical protein pa2347 SWALL:Q9I1D1 (EMBL:AE004661) (405 aa) fasta scores: E(): 6e-88, 60.3% id in 393 aa. Similar to BPSS0684, 55.721% identity (56.566% ungapped) in 402 aa overlap
YP_110699.1	Similar to Rhodococcus sp. dibenzothiophene desulfurization enzyme A SoxA or DszA SWALL:SOXA_RHOSO (SWALL:P54995) (453 aa) fasta scores: E(): 2e-52, 38.03% id in 447 aa, and to Pseudomonas aeruginosa hypothetical protein pa2326 SWALL:Q9I1F2 (EMBL:AE004658) (469 aa) fasta scores: E(): 2.3e-134, 71.23% id in 452 aa. Similar to BPSS0314, 57.802% identity (58.444% ungapped) in 455 aa overlap
YP_110701.1	Similar to Escherichia coli sensor protein RstB or UspT SWALL:RSTB_ECOLI (SWALL:P18392) (433 aa) fasta scores: E(): 3.3e-37, 33.63% id in 437 aa, and to Ralstonia solanacearum probable transmembrane sensor histidine kinase transcription regulator protein rsc3063 or rs00507 SWALL:Q8XUX0 (EMBL:AL646073) (433 aa) fasta scores: E(): 1.9e-84, 55.88% id in 433 aa
YP_110702.1	Similar to Escherichia coli transcriptional regulatory protein RstA or UrpT SWALL:RSTA_ECOLI (SWALL:P52108) (242 aa) fasta scores: E(): 1.3e-32, 42.61% id in 237 aa, and to Ralstonia solanacearum probable response regulator transcription regulator protein rsc3064 or rs00508 SWALL:Q8XUW9 (EMBL:AL646073) (243 aa) fasta scores: E(): 5.1e-78, 83.12% id in 243 aa
YP_110703.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein rsc3065 or rs06074 SWALL:Q8XUW8 (EMBL:AL646073) (261 aa) fasta scores: E(): 3.4e-40, 43.77% id in 249 aa. Weakly similar to Escherichia coli, and Shigella flexneri MltA-interacting protein precursor MipA SWALL:MIPA_ECOLI (SWALL:P77486) (248 aa) fasta scores: E(): 0.073, 23.67% id in 245 aa
YP_110704.1	Similar to Ralstonia solanacearum  signal peptide protein rsc1462 or rs03845 SWALL:Q8XZD9 (EMBL:AL646064) (367 aa) fasta scores: E(): 3.8e-41, 37.97% id in 366 aa, and to Yersinia pestis hypothetical protein ypo1559 or y2608 SWALL:Q8ZFW6 (EMBL:AJ414149) (379 aa) fasta scores: E(): 1.3e-32, 34.97% id in 366 aa. Possible alternative translational start site
YP_110705.1	Similar to Escherichia coli, and Shigella flexneri homoprotocatechuate degradative operon repressor HpcR or HpaR SWALL:HPCR_ECOLI (SWALL:Q07095) (148 aa) fasta scores: E(): 6.2e-20, 46.04% id in 139 aa, and to Ralstonia solanacearum probable transcription regulator protein rsc1592 or rs03954 SWALL:Q8XZ14 (EMBL:AL646065) (154 aa) fasta scores: E(): 5.6e-21, 47.18% id in 142 aa
YP_110706.1	Similar to Pseudomonas aeruginosa hypothetical protein pa4121 SWALL:Q9HWR0 (EMBL:AE004828) (219 aa) fasta scores: E(): 6.1e-30, 42.92% id in 212 aa, and to the N-terminal region of Escherichia coli 4-hydroxyphenylacetate degradation bifunctional isomerase/decarboxylase [includes: 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase; 5-carboxymethyl-2-oxo-hex-3- ene-1,7-dioate decarboxylase] HpaG SWALL:HPAG_ECOLI (SWALL:Q46978) (429 aa) fasta scores: E(): 1.6e-21, 33.97% id in 209 aa
YP_110707.1	Similar to Pseudomonas aeruginosa hypothetical protein pa4122 SWALL:Q9HWQ9 (EMBL:AE004828) (259 aa) fasta scores: E(): 4.6e-59, 59.68% id in 253 aa, and to the C-terminal region of Escherichia coli 4-hydroxyphenylacetate degradation bifunctional isomerase/decarboxylase [includes: 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase; 5-carboxymethyl-2-oxo-hex-3- ene-1,7-dioate decarboxylase] HpaG SWALL:HPAG_ECOLI (SWALL:Q46978) (429 aa) fasta scores: E(): 4.9e-47, 58.29% id in 223 aa
YP_110708.1	Similar to Escherichia coli 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase HpcC SWALL:HPCC_ECOLI (SWALL:P42269) (468 aa) fasta scores: E(): 2.7e-138, 75.05% id in 461 aa, and to Pseudomonas aeruginosa 5-carboxy-2-hydroxymuconate semialdehyde dehydrogenase pa4123 SWALL:Q9HWQ8 (EMBL:AE004828) (486 aa) fasta scores: E(): 3.2e-161, 81.85% id in 485 aa
YP_110709.1	Similar to Escherichia coli 3,4-dihydroxyphenylacetate 2,3-dioxygenase HpcB SWALL:HPCB_ECOLI (SWALL:Q05353) (275 aa) fasta scores: E(): 7e-71, 64.09% id in 259 aa, and to Salmonella typhi 3,4-dihydroxyphenylacetate 2,3-dioxygenase sty1137 SWALL:Q8Z7Q1 (EMBL:AL627269) (283 aa) fasta scores: E(): 6.1e-81, 66.31% id in 282 aa
YP_110710.1	Similar to Escherichia coli 5-carboxymethyl-2-hydroxymuconate delta-isomerase HpcD SWALL:HPCD_ECOLI (SWALL:Q05354) (125 aa) fasta scores: E(): 2e-18, 48.41% id in 126 aa, and to Ralstonia solanacearum  5-carboxymethyl-2-hydroxymuconate delta-isomerase rsc2419 or rs02694 SWALL:Q8XWQ4 (EMBL:AL646070) (134 aa) fasta scores: E(): 2.6e-24, 50.79% id in 126 aa
YP_110711.1	Similar to Escherichia coli 2-oxo-hepta-3-ene-1,7-dioic acid hydratase HpcG SWALL:HPCG_ECOLI (SWALL:P42270) (264 aa) fasta scores: E(): 3.3e-74, 70.3% id in 266 aa, and to Salmonella typhimurium, and Salmonella typhi 4-hydroxyphenylacetate catabolism stm1105 or sty1139 SWALL:Q8XGD0 (EMBL:AE008748) (267 aa) fasta scores: E(): 1.4e-80, 74.06% id in 266 aa
YP_110712.1	Similar to Escherichia coli 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase HpcH or HpaI SWALL:HPAI_ECOLI (SWALL:Q47098) (262 aa) fasta scores: E(): 9.1e-58, 67.3% id in 260 aa, and to Ralstonia solanacearum  2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase oxidoreductase rsc1591 or rs03953 SWALL:Q8XZ15 (EMBL:AL646065) (272 aa) fasta scores: E(): 4.4e-61, 69.61% id in 260 aa
YP_110713.1	Similar to Xanthomonas axonopodis transcriptional regulator xac1442 SWALL:AAM36313 (EMBL:AE011776) (271 aa) fasta scores: E(): 2e-34, 42.08% id in 259 aa, and to Xanthomonas campestris transcriptional regulator xcc1396 SWALL:AAM40694 (EMBL:AE012239) (287 aa) fasta scores: E(): 9.1e-34, 40.97% id in 266 aa
YP_110714.1	Similar to Dictyostelium discoideum hypothetical protein SWALL:Q8T1W9 (EMBL:AC116032) (321 aa) fasta scores: E(): 5.4e-30, 35.82% id in 321 aa, and to Streptomyces coelicolor  oxidoreductase SCO1199 or SCG11A.30c SWALL:Q9RJX1 (EMBL:AL939108) (326 aa) fasta scores: E(): 6.6e-15, 33.86% id in 313 aa
YP_110715.1	Similar to Comamonas acidovorans outer membrane porin protein 32 precursor Omp32 SWALL:OM32_COMAC (SWALL:P24305) (351 aa) fasta scores: E(): 1.7e-21, 32.97% id in 373 aa, and to Ralstonia solanacearum  transmembrane outer membrane porin signal peptide protein rsc1737 or rs02925 SWALL:Q8XYM1 (EMBL:AL646066) (353 aa) fasta scores: E(): 8e-92, 67.42% id in 350 aa
YP_110716.1	Similar to Ralstonia solanacearum probable ATP-binding ABC transporter protein rsc2939 or rs00150 SWALL:Q8XV92 (EMBL:AL646072) (358 aa) fasta scores: E(): 9.6e-77, 63.86% id in 357 aa, and to Yersinia pestis probable ABC-transporter ATP-binding protein ypo3048 SWALL:Q8ZCE3 (EMBL:AJ414155) (356 aa) fasta scores: E(): 1.7e-75, 62.64% id in 356 aa
YP_110717.1	Similar to Ralstonia solanacearum  transmembrane ABC transporter protein rsc2938 or rs00151 SWALL:Q8XV93 (EMBL:AL646072) (603 aa) fasta scores: E(): 7.4e-105, 63.13% id in 594 aa. Weakly similar to the C-terminal region of Actinobacillus pleuropneumoniae ferric transport system permease AfuB SWALL:AFUB_ACTPL (SWALL:Q44123) (687 aa) fasta scores: E(): 1.6e-22, 24.28% id in 556 aa
YP_110718.1	Similar to Ralstonia solanacearum  periplasmic iron-binding signal peptide protein rsc2937 or rs00344 SWALL:Q8XV94 (EMBL:AL646072) (365 aa) fasta scores: E(): 1.3e-76, 57.1% id in 366 aa, and to Yersinia pestis exported protein ypo3050 SWALL:Q8ZCE1 (EMBL:AJ414155) (362 aa) fasta scores: E(): 2.3e-69, 54.41% id in 340 aa
YP_110719.1	Similar to Escherichia coli transcriptional regulatory protein QseB SWALL:QSEB_ECOLI (SWALL:P52076) (219 aa) fasta scores: E(): 4.3e-28, 42.2% id in 218 aa, and to Ralstonia solanacearum probable two-component response regulator transcription regulator protein rsc1736 or rs02924 SWALL:Q8XYM2 (EMBL:AL646066) (230 aa) fasta scores: E(): 4.2e-59, 72.97% id in 222 aa. Similar to BPSL0775, 55.263% identity (55.507% ungapped) in 228 aa overlap
YP_110720.1	Similar to Escherichia coli sensor protein QseC SWALL:QSEC_ECOLI (SWALL:P40719) (449 aa) fasta scores: E(): 1.5e-29, 33.11% id in 468 aa, and to Ralstonia solanacearum probable two-component transmembrane sensor kinase transcription regulator protein rsc1735 or rs02923 SWALL:Q8XYM3 (EMBL:AL646066) (471 aa) fasta scores: E(): 2.4e-87, 59.64% id in 456 aa. CDS is extended at the C-terminus in comparison to orthologues
YP_110721.1	Similar to Agrobacterium tumefaciens hypothetical protein atu1042 or AGR_C_1923 SWALL:Q8UGJ5 (EMBL:AE009068) (285 aa) fasta scores: E(): 1e-22, 35.61% id in 278 aa, and to Pseudomonas aeruginosa hypothetical protein pa3022 SWALL:Q9HZI4 (EMBL:AE004727) (268 aa) fasta scores: E(): 1.7e-20, 40.07% id in 282 aa
YP_110722.1	Similar to Bordetella pertussis outer membrane porin protein precursor SWALL:OMP_BORPE (SWALL:Q04064) (385 aa) fasta scores: E(): 9.1e-19, 30% id in 380 aa, and to Alcaligenes eutrophus hypothetical protein SWALL:Q44021 (EMBL:L36817) (390 aa) fasta scores: E(): 2.9e-36, 37.28% id in 413 aa
YP_110723.1	Similar to Thermoanaerobacter tengcongensis transposase tte0846 SWALL:Q8RBH2 (EMBL:AE013051) (492 aa) fasta scores: E(): 4.4e-74, 43.54% id in 457 aa, and to Pseudomonas sp.  transposase tnpA SWALL:Q936Y1 (EMBL:U66917) (456 aa) fasta scores: E(): 1.7e-32, 30.94% id in 475 aa
YP_110724.1	Catalyzes the reversible hydration of unsaturated fatty acyl-CoA to beta-hydroxyacyl-CoA
YP_110725.1	converts L-alanine to D-alanine which is used in cell wall biosynthesis; binds one pyridoxal phosphate per monomer; forms a homodimer
YP_110726.1	Similar to Rhizobium meliloti hypothetical protein rb0957 or smb21379 SWALL:Q92UX8 (EMBL:AL603645) (124 aa) fasta scores: E(): 6.7e-31, 68.33% id in 120 aa, and to Mycobacterium tuberculosis hypothetical protein rv0140 or mt0148 SWALL:P96817 (EMBL:Z92770) (126 aa) fasta scores: E(): 4.7e-18, 50.4% id in 125 aa
YP_110727.1	Similar to Ralstonia solanacearum hypothetical protein rsc1789 or rs04188 SWALL:Q8XYG9 (EMBL:AL646066) (434 aa) fasta scores: E(): 1.2e-65, 56.35% id in 417 aa, and to Xanthomonas campestris hypothetical protein xcc0167 SWALL:AAM39486 (EMBL:AE012112) (427 aa) fasta scores: E(): 9e-57, 52.26% id in 419 aa
YP_110728.1	Similar to Synechocystis sp. hypothetical protein slr0865 SWALL:P73759 (EMBL:D90909) (337 aa) fasta scores: E(): 2.7e-41, 43.83% id in 308 aa, and to Mycobacterium tuberculosis hypothetical protein rv3701c or mt3804 SWALL:O69669 (EMBL:AL022121) (321 aa) fasta scores: E(): 8.3e-40, 42.4% id in 316 aa
YP_110730.1	Weakly similar to Bacillus stearothermophilus carboxylesterase precursor Est SWALL:EST_BACST (SWALL:Q06174) (247 aa) fasta scores: E(): 0.00011, 23.9% id in 251 aa, and to Thermotoga maritima esterase tm1022 SWALL:O50547 (EMBL:AJ001694) (253 aa) fasta scores: E(): 5.5e-07, 26% id in 250 aa
YP_110731.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0982 or rs04310 SWALL:Q8Y0R1 (EMBL:AL646062) (429 aa) fasta scores: E(): 1.4e-83, 53.42% id in 423 aa, and to Rhizobium meliloti two-component sensor histidine kinase rb1162 or smb20868 SWALL:Q92UG9 (EMBL:AL603646) (1229 aa) fasta scores: E(): 1e-09, 26.43% id in 435 aa
YP_110732.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa2196 SWALL:Q9I1S1 (EMBL:AE004646) (194 aa) fasta scores: E(): 1.6e-32, 51.59% id in 188 aa, and to Yersinia pestis TetR-family transcriptional regulatory protein ypo2378 SWALL:Q8ZE12 (EMBL:AJ414152) (199 aa) fasta scores: E(): 8.7e-28, 45.26% id in 190 aa
YP_110733.1	Similar to Streptomyces griseus subsp. griseus NonF protein SWALL:Q9XDF2 (EMBL:AF074603) (234 aa) fasta scores: E(): 4.9e-28, 42.98% id in 228 aa, and to Xanthomonas campestris NonF-related protein xcc3360 SWALL:AAM42630 (EMBL:AE012455) (226 aa) fasta scores: E(): 4.1e-56, 65.47% id in 223 aa
YP_110734.1	Similar to Pseudomonas putida xenobiotic reductase A XenA SWALL:Q9R9V9 (EMBL:AF154061) (363 aa) fasta scores: E(): 1.9e-111, 76.3% id in 363 aa, and to Xanthomonas campestris xenobiotic flavin oxidoreductase a xcc1170 SWALL:AAM40468 (EMBL:AE012216) (366 aa) fasta scores: E(): 3.5e-106, 73.75% id in 362 aa
YP_110735.1	Catalyzes a key regulatory step in fatty acid biosynthesis
YP_110736.1	Similar to Rhizobium meliloti hypothetical protein ra0234 or sma0447 SWALL:Q930G3 (EMBL:AE007216) (373 aa) fasta scores: E(): 1.4e-28, 34.64% id in 355 aa. Weakly similar to Rhizobium loti hypothetical protein mlr8361 SWALL:Q983E6 (EMBL:AP003013) (411 aa) fasta scores: E(): 5.8e-29, 29.72% id in 360 aa
YP_110737.1	Weakly similar to Pseudomonas aeruginosa osmotically inducible lipoprotein OsmE SWALL:Q9HUT7 (EMBL:AE004901) (114 aa) fasta scores: E(): 0.0005, 28.57% id in 105 aa
YP_110738.1	Similar to Pseudomonas aeruginosa probable short-chain dehydrogenase pa1344 SWALL:Q9I400 (EMBL:AE004564) (264 aa) fasta scores: E(): 1.4e-60, 66.28% id in 264 aa, and to Ralstonia solanacearum probable oxidoreductase rsc3138 or rs00465 SWALL:Q8XUP8 (EMBL:AL646073) (262 aa) fasta scores: E(): 9.4e-50, 58.17% id in 263 aa
YP_110739.1	Similar to Rhizobium meliloti probable rhizopine catabolism regulatory protein MocR SWALL:MOCR_RHIME (SWALL:P49309) (493 aa) fasta scores: E(): 8.8e-57, 39.91% id in 491 aa, and to Ralstonia solanacearum probable transcription regulator protein rsc3119 or rs00574 SWALL:Q8XUR6 (EMBL:AL646073) (488 aa) fasta scores: E(): 1.6e-129, 71.83% id in 490 aa
YP_110740.1	Similar to Ralstonia solanacearum hypothetical protein rsc3120 or rs00575 SWALL:Q8XUR5 (EMBL:AL646073) (227 aa) fasta scores: E(): 2.8e-66, 77.23% id in 224 aa, and to Streptomyces coelicolor hypothetical protein SCO1361 or SC10A9.03 SWALL:Q9AKA1 (EMBL:AL939108) (228 aa) fasta scores: E(): 2.7e-37, 48.67% id in 226 aa
YP_110741.1	C-terminal region is similar to Pseudomonas aeruginosa cyclic AMP receptor-like protein Vfr SWALL:VFR_PSEAE (SWALL:P55222) (214 aa) fasta scores: E(): 3.6e-05, 26.53% id in 196 aa. Full length CDS is similar to Ralstonia solanacearum  transcription regulator protein rsp0805 or rs01902 SWALL:Q8XRM6 (EMBL:AL646081) (239 aa) fasta scores: E(): 3.4e-15, 31.19% id in 234 aa
YP_110742.1	activates fatty acids by binding to coenzyme A
YP_110743.1	Poor database matches. C-terminal region is weakly similar to Pseudomonas aeruginosa hypothetical protein pa0981 SWALL:Q9I4Y8 (EMBL:AE004531) (207 aa) fasta scores: E(): 7.3e-12, 32.63% id in 190 aa
YP_110744.1	C-terminus is similar to the C-terminal region of Salmonella typhimurium methyl-accepting chemotaxis protein II Tar or CheM SWALL:MCP2_SALTY (SWALL:P02941) (553 aa) fasta scores: E(): 3.5e-40, 55.23% id in 277 aa. Full length CDS is similar to Ralstonia solanacearum methyl-accepting chemotaxis transmembrane protein rsc3136 or rs00467 SWALL:Q8XUQ0 (EMBL:AL646073) (661 aa) fasta scores: E(): 7.2e-44, 46.76% id in 680 aa
YP_110745.1	Similar to Pseudomonas aeruginosa outer membrane protein OprM or OprK SWALL:OPRM_PSEAE (SWALL:Q51487) (485 aa) fasta scores: E(): 5.5e-60, 50.92% id in 487 aa, and to Xanthomonas campestris outer membrane protein xcc2681 SWALL:AAM41953 (EMBL:AE012380) (497 aa) fasta scores: E(): 7e-62, 51.91% id in 495 aa. CDS is extended at the C-terminus in comparison to orthologues. Probable gene fusion resulting from the loss of a stop codon. The effect on the function of CDS is not known
YP_110746.1	Similar to an internal region of Acetobacter xylinus cellulose synthase 1 [includes: cellulose synthase catalytic domain [UDP-forming]; cyclic di-GMP binding domain (cellulose synthase 1 regulatory domain)] AcsA or AcsB SWALL:ACS1_ACEXY (SWALL:P21877) (1550 aa) fasta scores: E(): 2.4e-44, 31.8% id in 632 aa. Full length CDS is similar to Agrobacterium tumefaciens beta 1,3 glucan synthase catalytic subunit ATU3056 or AGR_L_3500 SWALL:Q8UBG0 (EMBL:AE009236) (654 aa) fasta scores: E(): 3.7e-107, 44.34% id in 654 aa
YP_110747.1	Similar to Agrobacterium tumefaciens hypothetical protein ATU3055 or AGR_L_3502 SWALL:Q8UBG1 (EMBL:AE009236) (437 aa) fasta scores: E(): 2.3e-66, 45.56% id in 406 aa
YP_110748.1	C-terminus is weakly similar to the C-terminal region of Agrobacterium tumefaciens hypothetical protein ATU3057 or AGR_L_3498 SWALL:Q8UBF9 (EMBL:AE009236) (526 aa) fasta scores: E(): 1.2e-13, 25.35% id in 489 aa. Internal region is similar to Rhizobium meliloti hypothetical protein rb0376 or smb20390 SWALL:Q92WG3 (EMBL:AL603643) (410 aa) fasta scores: E(): 6.6e-10, 24.81% id in 403 aa
YP_110750.1	Weakly similar to Chromobacterium violaceum hypothetical protein SWALL:Q7NTA3 (EMBL:AE016921) (135 aa) fasta scores: E(): 0.08, 36.44% id in 118 aa
YP_110751.1	Similar to the C-terminal region of Alcaligenes sp 2,4'-dihydroxyacetophenone dioxygenase (fragment) Dad SWALL:Q9REI7 (EMBL:AJ133820) (176 aa) fasta scores: E(): 5.3e-08, 32.23% id in 152 aa
YP_110753.1	Similar to Pseudomonas sp. SDS degradation transcriptional activation protein SdsB SWALL:SDSB_PSES9 (SWALL:P52686) (306 aa) fasta scores: E(): 7e-09, 27.11% id in 295 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa0133 SWALL:Q9I6Z9 (EMBL:AE004451) (305 aa) fasta scores: E(): 4.4e-44, 39.6% id in 303 aa
YP_110754.1	catalyzes the formation of pyruvate and beta-alanine from L-alanine and 3-oxopropanoate
YP_110755.1	Similar to Pseudomonas aeruginosa methylmalonate-semialdehyde dehydrogenase [acylating] MmsA SWALL:MMSA_PSEAE (SWALL:P28810) (496 aa) fasta scores: E(): 2.9e-89, 47.56% id in 492 aa, and to Pseudomonas aeruginosa probable aldehyde dehydrogenase pa0130 SWALL:Q9I702 (EMBL:AE004451) (497 aa) fasta scores: E(): 3.6e-129, 66.53% id in 493 aa. Similar to BPSL3420, 57.730% identity (58.300% ungapped) in 511 aa overlap
YP_110757.1	Weakly similar to Streptomyces coelicolor  secreted protein SCO7396 or SC10G8.24c SWALL:Q9L181 (EMBL:AL939131) (445 aa) fasta scores: E(): 9.8e-08, 27.56% id in 439 aa
YP_110758.1	Similar to Bordetella pertussis outer membrane porin protein precursor SWALL:OMP_BORPE (SWALL:Q04064) (385 aa) fasta scores: E(): 1.6e-13, 32.18% id in 407 aa, and to Ralstonia solanacearum probable porin signal peptide protein rsp0051 or rs02026 SWALL:Q8XTQ5 (EMBL:AL646076) (382 aa) fasta scores: E(): 5.5e-40, 42.22% id in 386 aa
YP_110759.1	Similar to Pseudomonas syringae pv. maculicola hypothetical protein SWALL:Q93TD7 (EMBL:AF359557) (126 aa) fasta scores: E(): 5e-20, 51.69% id in 118 aa, and to Agrobacterium tumefaciens hypothetical protein ATU1486 or AGR_C_2741 SWALL:Q8UFB2 (EMBL:AE009107) (129 aa) fasta scores: E(): 1.8e-15, 44.27% id in 131 aa
YP_110760.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa1484 SWALL:Q9I3M8 (EMBL:AE004577) (268 aa) fasta scores: E(): 2.9e-54, 56.01% id in 266 aa. C-terminal region is similar to Aeromonas salmonicida hypothetical transcriptional regulator SWALL:YEXN_AERSA (SWALL:P45785) (193 aa) fasta scores: E(): 2e-11, 35.86% id in 184 aa
YP_110761.1	Similar to Pseudomonas aeruginosa probable amino acid permease pa1485 SWALL:Q9I3M7 (EMBL:AE004577) (455 aa) fasta scores: E(): 2.7e-90, 56.76% id in 451 aa. N-terminus is similar to the N-terminal region of Homo sapiens large neutral amino acids transporter small subunit 1 SLC7A5 or LAT1 or MPE16 SWALL:LAT1_HUMAN (SWALL:Q01650) (507 aa) fasta scores: E(): 4.5e-13, 25.57% id in 391 aa
YP_110762.1	Similar to Pseudomonas aeruginosa hypothetical protein pa1486 SWALL:Q9I3M6 (EMBL:AE004577) (366 aa) fasta scores: E(): 1.3e-85, 67.47% id in 372 aa, and to Agrobacterium tumefaciens aminopeptidase ATU5242 or AGR_PAT_343 SWALL:Q8UK81 (EMBL:AE008947) (384 aa) fasta scores: E(): 1.2e-42, 44.79% id in 384 aa
YP_110763.1	Poor database matches. N-terminal region is weakly similar to Streptomyces coelicolor  lipoprotein SCO6050 or SC1b5.10c SWALL:O69838 (EMBL:AL939126) (289 aa) fasta scores: E(): 3.9, 26.03% id in 315 aa
YP_110764.1	No significant database matches. Doubtful CDS
YP_110765.1	Similar to Pseudomonas aeruginosa hypothetical protein pa3893 SWALL:Q9HXC0 (EMBL:AE004806) (731 aa) fasta scores: E(): 1.2e-94, 41.24% id in 708 aa. C-terminal region is similar to Burkholderia cepacia fusaric acid resistance protein FusD SWALL:FUSD_BURCE (SWALL:P24129) (208 aa) fasta scores: E(): 2e-22, 43.5% id in 200 aa
YP_110766.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa3895 SWALL:Q9HXB8 (EMBL:AE004807) (317 aa) fasta scores: E(): 1.2e-68, 57.84% id in 306 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa0876 SWALL:Q9I569 (EMBL:AE004522) (314 aa) fasta scores: E(): 1.8e-59, 51.79% id in 307 aa. Similar to BPSL1971, 57.843% identity (58.033% ungapped) in 306 aa overlap
YP_110768.1	Similar to Bordetella pertussis outer membrane porin protein precursor SWALL:OMP_BORPE (SWALL:Q04064) (385 aa) fasta scores: E(): 3.2e-17, 32.2% id in 413 aa, and to Ralstonia solanacearum probable porin signal peptide protein rsp0051 or rs02026 SWALL:Q8XTQ5 (EMBL:AL646076) (382 aa) fasta scores: E(): 3.1e-51, 47.38% id in 401 aa. Similar to BPSL2559, 54.271% identity (59.178% ungapped) in 398 aa overlap, and to BPSS0943, 50.382% identity (55.000% ungapped) in 393 aa overlap
YP_110769.1	Similar to Rhizobium loti hypothetical protein mlr5539 SWALL:Q98BJ9 (EMBL:AP003006) (156 aa) fasta scores: E(): 6.2e-35, 61.22% id in 147 aa, and to Caulobacter crescentus hypothetical protein cc1279 SWALL:Q9A8S2 (EMBL:AE005803) (151 aa) fasta scores: E(): 4.6e-25, 52.48% id in 141 aa
YP_110770.1	Similar to Escherichia coli cytosine permease CodB SWALL:CODB_ECOLI (SWALL:P25525) (419 aa) fasta scores: E(): 5.7e-44, 32.85% id in 414 aa, and to Pseudomonas aeruginosa cytosine permease pa0438 SWALL:Q9I679 (EMBL:AE004481) (416 aa) fasta scores: E(): 2.8e-44, 33.01% id in 415 aa
YP_110771.1	Similar to Clostridium perfringens hypothetical protein cpe0759 SWALL:Q8XMD0 (EMBL:AP003188) (399 aa) fasta scores: E(): 4.4e-10, 23.85% id in 415 aa, and to Clostridium acetobutylicum possible transcriptional regulator from leucine-rich protein cac1426 SWALL:Q97J60 (EMBL:AE007654) (397 aa) fasta scores: E(): 2.4e-08, 26.31% id in 399 aa
YP_110772.1	Similar to Escherichia coli cytosine deaminase CodA SWALL:CODA_ECOLI (SWALL:P25524) (426 aa) fasta scores: E(): 8.3e-86, 56.02% id in 407 aa, and to Salmonella typhimurium  cytosine deaminase stm3334 SWALL:Q8ZLR0 (EMBL:AE008853) (426 aa) fasta scores: E(): 3.6e-88, 56.71% id in 402 aa
YP_110773.1	Similar to Agrobacterium vitis  tartrate transporter TtuB SWALL:TUB3_AGRVI (SWALL:P70786) (449 aa) fasta scores: E(): 1.3e-55, 40.56% id in 424 aa, and to Ralstonia solanacearum probable permease transmembrane protein rsc2352 or rs01194 SWALL:Q8XWW8 (EMBL:AL646069) (442 aa) fasta scores: E(): 1.9e-59, 41.28% id in 419 aa
YP_110774.1	Similar to Rhizobium loti hypothetical protein mll0106 SWALL:Q98NK0 (EMBL:AP002994) (309 aa) fasta scores: E(): 4.3e-76, 65.48% id in 310 aa, and to Archaeoglobus fulgidus hypothetical protein af1210 SWALL:O29058 (EMBL:AE001021) (313 aa) fasta scores: E(): 2.9e-58, 51.14% id in 307 aa
YP_110775.1	Similar to Streptomyces galilaeus ketoacyl reductase AknIII SWALL:Q54190 (EMBL:D14040) (261 aa) fasta scores: E(): 6.2e-23, 37.98% id in 258 aa, and to Rhizobium loti probable short chain dehydrogenase mll1036 SWALL:Q98LG1 (EMBL:AP002996) (268 aa) fasta scores: E(): 1.8e-46, 54.51% id in 266 aa
YP_110776.1	Similar to Rhizobium loti transcriptional regulator mlr7171 SWALL:Q986X5 (EMBL:AP003011) (218 aa) fasta scores: E(): 2.7e-26, 43.6% id in 211 aa, and to Rhizobium loti transcriptional regulator mll7255 SWALL:Q986Q3 (EMBL:AP003011) (218 aa) fasta scores: E(): 5.2e-20, 39.13% id in 207 aa
YP_110777.1	C-terminal region is similar to Yersinia pseudotuberculosis  chloride channel protein EriC-like SWALL:ERIL_YERPS (SWALL:Q9AGD5) (429 aa) fasta scores: E(): 1e-20, 29.67% id in 401 aa, and to Zymomonas mobilis chloride channel protein Clc-B SWALL:Q9RNN4 (EMBL:AF179611) (425 aa) fasta scores: E(): 9.7e-66, 49.02% id in 410 aa. Possible alternative translational start site
YP_110779.1	Possible gene remnant. Similar to the C-terminal regions of Bradyrhizobium japonicum USDA 110 BLL6723 protein SWALL:Q89FH7 (EMBL:AP005959) (568 aa) fasta scores: E(): 2.1e-10, 52.27% id in 88 aa, and Francisella novicida acid phosphatase precursor acpA SWALL:Q47936 (EMBL:L39831) (514 aa) fasta scores: E(): 0.093, 38.59% id in 57 aa
YP_110780.1	Similar to Agrobacterium tumefaciens hypothetical protein ATU1617 or AGR_C_2981 SWALL:Q8UEY6 (EMBL:AE009119) (310 aa) fasta scores: E(): 1.5e-42, 46.78% id in 327 aa, and to Caulobacter crescentus hypothetical protein CC2313 SWALL:Q9A5Y4 (EMBL:AE005901) (328 aa) fasta scores: E(): 7.1e-33, 41.01% id in 334 aa
YP_110781.1	Doubtful CDS. Similar to the C-terminal region of Azoarcus evansii PaaB SWALL:Q9F9U8 (EMBL:AF176259) (103 aa) fasta scores: E(): 1.4, 50% id in 52 aa
YP_110782.1	Similar to Escherichia coli, and Shigella flexneri response regulator UvrY SWALL:UVRY_ECOLI (SWALL:P07027) (218 aa) fasta scores: E(): 9.6e-15, 28.98% id in 207 aa, and to Ralstonia solanacearum probable response regulator transcription regulator protein rsc0192 or rs00624 SWALL:Q8Y2Y9 (EMBL:AL646057) (215 aa) fasta scores: E(): 1.1e-32, 47.11% id in 208 aa. Similar to BPSS1161, 51.905% identity (51.905% ungapped) in 210 aa overlap, and to BPSS0835, 50.000% identity (50.237% ungapped) in 212 aa overlap
YP_110784.1	Similar to Ralstonia solanacearum probable transcription regulator protein rsp0224 or rs05199 SWALL:Q8XT91 (EMBL:AL646077) (154 aa) fasta scores: E(): 3.9e-21, 45.75% id in 153 aa. Weakly similar to Salmonella typhimurium multiple antibiotic resistance protein MarR SWALL:MARR_SALTY (SWALL:Q56069) (144 aa) fasta scores: E(): 0.0013, 30.18% id in 106 aa
YP_110785.1	Similar to Gallus gallus regucalcin SWALL:Q9I923 (EMBL:AB037935) (299 aa) fasta scores: E(): 4.9e-18, 29.96% id in 287 aa, and to Ralstonia solanacearum hypothetical protein rsc2755 or rs00099 SWALL:Q8XVS4 (EMBL:AL646071) (303 aa) fasta scores: E(): 1.1e-44, 51.23% id in 283 aa
YP_110786.1	Similar to Rhizobium meliloti hypothetical protein r01249 or smc01810 SWALL:Q92QQ8 (EMBL:AL591786) (113 aa) fasta scores: E(): 1.3e-05, 27.92% id in 111 aa, and to the C-terminal region of Agrobacterium tumefaciens hypothetical protein ATU0309 or AGR_C_536 SWALL:Q8UII6 (EMBL:AE009002) (170 aa) fasta scores: E(): 2e-17, 49.03% id in 104 aa
YP_110787.1	Similar to Rhizobium loti hypothetical protein mll2249 SWALL:Q98IU1 (EMBL:AP002999) (130 aa) fasta scores: E(): 1.1e-31, 73.68% id in 114 aa, and to Ralstonia solanacearum hypothetical protein rsp1476 or rs03067 SWALL:Q8XQ10 (EMBL:AL646085) (141 aa) fasta scores: E(): 1.2e-31, 66.93% id in 124 aa
YP_110788.1	catalyzes the conversion of feruloyl-CoA to vanillin and acetyl-CoA
YP_110789.1	Similar to Pseudomonas sp. salicylaldehyde dehydrogenase NahF or DoxF SWALL:NAHF_PSESP (SWALL:Q52460) (483 aa) fasta scores: E(): 5.7e-79, 47.59% id in 479 aa, and to Pseudomonas fluorescens vanillin: NAD+ oxidoreductase Vdh SWALL:O69763 (EMBL:Y13067) (482 aa) fasta scores: E(): 2.8e-113, 67.14% id in 484 aa. Similar to BPSL0843, 64.694% identity (64.959% ungapped) in 490 aa overlap
YP_110790.1	catalyzes the conversion of ferulic acid to feruloyl-CoA
YP_110791.1	Similar to Pseudomonas putida 4-hydroxybenzoate transporter PcaK SWALL:PCAK_PSEPU (SWALL:Q51955) (448 aa) fasta scores: E(): 3.4e-17, 35.75% id in 400 aa, and to Pseudomonas fluorescens hypothetical metabolite transport protein SWALL:O69757 (EMBL:L49465) (405 aa) fasta scores: E(): 1.7e-60, 48.72% id in 392 aa
YP_110792.1	Similar to Bordetella pertussis outer membrane porin protein precursor SWALL:OMP_BORPE (SWALL:Q04064) (385 aa) fasta scores: E(): 7.5e-13, 32.93% id in 413 aa, and to Ralstonia solanacearum probable porin signal peptide protein rsp1594 or rs02151 SWALL:Q8XPP4 (EMBL:AL646085) (374 aa) fasta scores: E(): 8.3e-78, 57.75% id in 374 aa
YP_110793.1	Similar to Acinetobacter sp. ADP1 chlorogenate esterase HcaG SWALL:Q8RLZ8 (EMBL:L05770) (580 aa) fasta scores: E(): 1.1e-104, 51.63% id in 552 aa, and to Agrobacterium tumefaciens tannase ATU5261 or AGR_PAT_374 SWALL:Q8UK62 (EMBL:AE008948) (553 aa) fasta scores: E(): 1.3e-11, 26.96% id in 560 aa. Lower levels of similarity in the N-terminal regions
YP_110794.1	Weakly similar to Erwinia chrysanthemi pectin degradation repressor protein KdgR SWALL:KDGR_ERWCH (SWALL:P37728) (305 aa) fasta scores: E(): 9.6e-08, 26.56% id in 256 aa. Similar to Rhizobium meliloti transcriptional regulator protein rb0681 or smb21102 SWALL:Q92VL9 (EMBL:AL603644) (260 aa) fasta scores: E(): 7.5e-40, 48.83% id in 258 aa. Similar to BPSS2127, 76.557% identity (76.557% ungapped) in 273 aa overlap
YP_110795.1	Similar to Salmonella typhimurium, and Salmonella typhi D-ribose-binding periplasmic protein precursor RbsB SWALL:RBSB_SALTY (SWALL:P02926) (296 aa) fasta scores: E(): 3e-14, 27.09% id in 299 aa, and to Rhizobium loti ABC transporter binding protein mll8567 SWALL:Q982N3 (EMBL:AP003014) (346 aa) fasta scores: E(): 2e-14, 28.82% id in 340 aa. CDS is extended at the C-terminus in comparison to orthologues
YP_110796.1	Similar to Escherichia coli ribose transport ATP-binding protein rbsA SWALL:RBSA_ECOLI (SWALL:P04983) (501 aa) fasta scores: E(): 1.3e-41, 34.86% id in 499 aa, and to Streptomyces coelicolor ABC transporter protein, ATP binding component SCO2746 or SCC57A.17 SWALL:Q9RDI1 (EMBL:AL939113) (517 aa) fasta scores: E(): 5.3e-49, 40.51% id in 501 aa
YP_110797.1	Similar to Escherichia coli ribose transport system permease rbsC SWALL:RBSC_ECOLI (SWALL:P04984) (321 aa) fasta scores: E(): 6.4e-29, 36.67% id in 319 aa, and to Rhizobium loti ABC transporter permease mll8565 SWALL:Q982N4 (EMBL:AP003014) (338 aa) fasta scores: E(): 2.6e-29, 34.04% id in 329 aa
YP_110798.1	Similar to Thermoplasma acidophilum hypothetical protein TA1392 SWALL:Q9HIE8 (EMBL:AL445067) (95 aa) fasta scores: E(): 0.00028, 27.77% id in 90 aa, and to Salmonella typhimurium, and Salmonella typhi  hydrolase N-terminus stm0649 or sty0700 SWALL:Q8XFB1 (EMBL:AE008726) (113 aa) fasta scores: E(): 7.9e-05, 38.09% id in 84 aa. Possible pseudogene, similar to the N-terminal region of Escherichia coli altronate hydrolase UxaA SWALL:UXAA_ECOLI (SWALL:P42604) (495 aa) fasta scores: E(): 2.2e-05, 40% id in 70 aa
YP_110799.1	Similar to Salmonella typhi  hydrolase C-terminus sty0701 SWALL:Q8Z8H4 (EMBL:AL627267) (390 aa) fasta scores: E(): 3.4e-39, 36.9% id in 401 aa, and to Brucella melitensis D-galactarate dehydratase bmeii0485 SWALL:Q8YCP3 (EMBL:AE009684) (433 aa) fasta scores: E(): 3.7e-34, 34.38% id in 413 aa. Possible pseudogene, similar to the C-terminal region of Escherichia coli altronate hydrolase UxaA SWALL:UXAA_ECOLI (SWALL:P42604) (495 aa) fasta scores: E(): 1.2e-20, 29.15% id in 415 aa
YP_110800.1	Similar to Xanthomonas axonopodis hypothetical protein xac4185 SWALL:AAM39020 (EMBL:AE012069) (290 aa) fasta scores: E(): 1.5e-51, 53.73% id in 281 aa, and to Xanthomonas campestris hypothetical protein xcc4066 SWALL:AAM43287 (EMBL:AE012528) (290 aa) fasta scores: E(): 1e-49, 53.02% id in 281 aa
YP_110801.1	Similar to Escherichia coli oxidoreductase UcpA SWALL:UCPA_ECOLI (SWALL:P37440) (263 aa) fasta scores: E(): 4.2e-22, 41.5% id in 253 aa, and to Yersinia pestis oxidoreductase ypo1565 SWALL:Q8ZFW2 (EMBL:AJ414149) (246 aa) fasta scores: E(): 1.2e-52, 63.52% id in 244 aa
YP_110802.1	Similar to Yersinia pestis  hydrolase ypo1566 SWALL:Q8ZFW1 (EMBL:AJ414149) (280 aa) fasta scores: E(): 1.3e-85, 72.76% id in 279 aa, and to Xanthomonas axonopodis 2-hydroxyhepta-2,4-diene-1, 7-dioateisomerase/5-carboxymethyl-2-oxo-hex-3-ene-1, 7-dioatedecarboxylase xac4187 SWALL:AAM39022 (EMBL:AE012069) (285 aa) fasta scores: E(): 3.4e-75, 65.1% id in 278 aa. Similar to BPSS2126, 73.285% identity (73.551% ungapped) in 277 aa overlap
YP_110803.1	Similar to Campylobacter jejuni  oxidoreductase cj0485 SWALL:Q9PI24 (EMBL:AL139075) (262 aa) fasta scores: E(): 2e-41, 48.06% id in 258 aa, and to Bos taurus short-chain dehydrogenase/reductase SDR3 SWALL:Q9MYP6 (EMBL:AF202997) (270 aa) fasta scores: E(): 8.7e-22, 38.52% id in 244 aa
YP_110804.1	Similar to Xanthomonas campestris hypothetical protein xcc4070 SWALL:AAM43291 (EMBL:AE012529) (125 aa) fasta scores: E(): 4.9e-13, 42.85% id in 112 aa, and to Xanthomonas axonopodis hypothetical protein xac4189 SWALL:AAM39024 (EMBL:AE012069) (119 aa) fasta scores: E(): 8.9e-13, 41.07% id in 112 aa
YP_110805.1	Similar to many low complexity proteins, including Rhizobium loti hypothetical glycine-rich protein mlr0587 SWALL:Q98MG7 (EMBL:AP002995) (3145 aa) fasta scores: E(): 1.3e-32, 24.78% id in 1743 aa. Possible alternative translational start site. Similar to BPSL1705, 65.523% identity (70.872% ungapped) in 1749 aa overlap
YP_110806.1	Similar to Rhodobacter capsulatus trans-acting regulatory protein HvrA SWALL:HVRA_RHOCA (SWALL:P42505) (102 aa) fasta scores: E(): 0.45, 29.41% id in 85 aa, and to Alcaligenes eutrophus H-NS-like protein SWALL:Q7WXF4 (EMBL:AY305378) (103 aa) fasta scores: E(): 2.4e-10, 44% id in 100 aa
YP_110807.1	Similar to the C-terminal region of Erwinia chrysanthemi pectin degradation repressor protein KdgR SWALL:KDGR_ERWCH (SWALL:P37728) (305 aa) fasta scores: E(): 2.2e-12, 29.71% id in 249 aa. Similar to Bacillus halodurans transcriptional regulator bh2137 SWALL:Q9KAZ9 (EMBL:AP001514) (251 aa) fasta scores: E(): 1e-13, 29.6% id in 250 aa. Similar to BPSS0284, 67.886% identity (67.886% ungapped) in 246 aa overlap
YP_110808.1	Poor database matches. C-terminus is similar to the C-terminal region of Caulobacter crescentus hypothetical protein CC0121 SWALL:Q9ABU9 (EMBL:AE005686) (151 aa) fasta scores: E(): 9.4, 30.08% id in 123 aa
YP_110809.1	C-terminal region is similar to Pseudomonas aeruginosa hypothetical protein pa2133 SWALL:Q9I1Y2 (EMBL:AE004640) (285 aa) fasta scores: E(): 4.7e-20, 34.22% id in 263 aa. Similar to the C-terminal region of Rhizobium loti hypothetical protein mlr5176 SWALL:Q98CF0 (EMBL:AP003005) (779 aa) fasta scores: E(): 2.8e-05, 23.17% id in 397 aa
YP_110810.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa1836 SWALL:Q9I2Q9 (EMBL:AE004609) (193 aa) fasta scores: E(): 6.8e-25, 40.95% id in 188 aa, and to Streptomyces coelicolor tetr-family transcriptional regulatory protein sco4480 or scd65.23C SWALL:Q9F2Q9 (EMBL:AL939120) (205 aa) fasta scores: E(): 8e-13, 31.25% id in 192 aa
YP_110811.1	Similar to Pseudomonas aeruginosa hypothetical protein pa1835 SWALL:Q9I2R0 (EMBL:AE004609) (145 aa) fasta scores: E(): 1.5e-30, 60.28% id in 141 aa, and to Xanthomonas campestris hypothetical protein xcc3727 SWALL:AAM42985 (EMBL:AE012493) (158 aa) fasta scores: E(): 1.3e-18, 49.25% id in 134 aa
YP_110812.1	Similar to Pseudomonas aeruginosa leucine-, isoleucine-, valine-, threonine-, and alanine-binding protein precursor BraC SWALL:BRAC_PSEAE (SWALL:P21175) (373 aa) fasta scores: E(): 8.7e-34, 33.6% id in 369 aa, and to Ralstonia solanacearum  amino-acid transport signal peptide protein rsc3300 or rs02529 SWALL:Q8XU93 (EMBL:AL646074) (377 aa) fasta scores: E(): 1.6e-60, 49.31% id in 367 aa. Similar to BPSL3284, 88.421% identity (88.421% ungapped) in 380 aa overlap
YP_110813.1	Similar to Bacillus cereus hemolysin III SWALL:HLY3_BACCE (SWALL:P54176) (219 aa) fasta scores: E(): 1.2e-31, 46.46% id in 198 aa, and to Neisseria meningitidis  haemolysin nma1900 SWALL:Q9JTB2 (EMBL:AL162757) (208 aa) fasta scores: E(): 1.5e-45, 58.17% id in 208 aa
YP_110815.1	Similar to Pseudomonas aeruginosa hypothetical protein pa1727 SWALL:Q9I310 (EMBL:AE004599) (685 aa) fasta scores: E(): 1.4e-108, 47.58% id in 683 aa, and to Xanthomonas campestris GGDEF family protein xcc1911 SWALL:AAM41200 (EMBL:AE012295) (696 aa) fasta scores: E(): 3.3e-108, 46.72% id in 687 aa
YP_110816.1	Similar to Escherichia coli, Shigella flexneri, and Enterobacter aerogenes leucine-responsive regulatory protein Lrp SWALL:LRP_ECOLI (SWALL:P19494) (163 aa) fasta scores: E(): 2.2e-18, 42.56% id in 148 aa, and to Ralstonia solanacearum probable transcription regulator protein rsp1377 or rs02081 SWALL:Q8XQA9 (EMBL:AL646084) (152 aa) fasta scores: E(): 6.2e-19, 42% id in 150 aa
YP_110817.1	Similar to Escherichia coli aromatic amino acid transport protein AroP SWALL:AROP_ECOLI (SWALL:P15993) (457 aa) fasta scores: E(): 5e-119, 68% id in 450 aa, and to Yersinia pestis aromatic amino acid transport protein ypo3421 SWALL:Q8ZBI9 (EMBL:AJ414157) (465 aa) fasta scores: E(): 1.1e-127, 72.99% id in 448 aa
YP_110818.1	catalyzes the formation of L-glutamate and an aromatic oxo acid from an aromatic amino acid and 2-oxoglutarate
YP_110819.1	Similar to Ralstonia solanacearum hypothetical protein rsp1510 or rs03031 SWALL:Q8XPX6 (EMBL:AL646085) (132 aa) fasta scores: E(): 7e-36, 71.53% id in 130 aa, and to Streptomyces coelicolor hypothetical protein SCO7305 or SC5F8.15c SWALL:Q9K4K9 (EMBL:AL939131) (117 aa) fasta scores: E(): 2.5e-05, 31.96% id in 122 aa
YP_110820.1	Similar to Rhizobium loti hypothetical protein mll3172 SWALL:Q98GU4 (EMBL:AP003001) (179 aa) fasta scores: E(): 5.5e-30, 49.12% id in 171 aa, and to Caulobacter crescentus acetyltransferase, GNAT family cc1083 SWALL:Q9A9B1 (EMBL:AE005785) (173 aa) fasta scores: E(): 1.9e-25, 45.56% id in 169 aa
YP_110821.1	C-terminal region is similar to Bradyrhizobium japonicum ID748 SWALL:Q9AMY0 (EMBL:AF322013) (225 aa) fasta scores: E(): 1.6e-36, 48.5% id in 200 aa, and to the C-terminal region of Pseudomonas aeruginosa hypothetical protein pa1894 SWALL:Q9I2K3 (EMBL:AE004615) (230 aa) fasta scores: E(): 5.2e-24, 41.27% id in 189 aa
YP_110822.1	Poor database matches. C-terminus is weakly similar to the C-terminal region of Streptomyces hygroscopicus OrfE protein SWALL:Q54310 (EMBL:X86780) (465 aa) fasta scores: E(): 0.0069, 24.92% id in 353 aa
YP_110824.1	Similar to the C-terminal regions of Anabaena sp. two-component sensor histidine kinase alr0642 SWALL:Q8YZ45 (EMBL:AP003583) (735 aa) fasta scores: E(): 5.4e-38, 32.41% id in 472 aa, and Anabaena sp. two-component sensor histidine kinase alr3225 SWALL:Q8YS66 (EMBL:AP003592) (986 aa) fasta scores: E(): 1.7e-33, 32.37% id in 451 aa. Possible gene remnant, CDS membrane spanning domains. C-terminal rgion is similar to C-terminal regions of BPSS1646, 50.765% identity (54.426% ungapped) in 327 aa overlap, and BPSL0703, 52.273% identity (54.949% ungapped) in 308 aa overlap
YP_110825.1	Similar to Bacillus subtilis chemotaxis protein CheY homolog CheY or CheB SWALL:CHEY_BACSU (SWALL:P24072) (119 aa) fasta scores: E(): 6.4e-07, 32.43% id in 111 aa, and to Vibrio cholerae response regulator vc1082 SWALL:Q9KT23 (EMBL:AE004189) (121 aa) fasta scores: E(): 4.9e-17, 47.5% id in 120 aa. Similar to BPSS2344, 62.810% identity (62.810% ungapped) in 121 aa overlap
YP_110826.1	Similar to Vibrio cholerae hypothetical protein vc1083 SWALL:Q9KT22 (EMBL:AE004189) (194 aa) fasta scores: E(): 1.2e-12, 32.83% id in 201 aa. N-terminus is similar to the N-terminal rgion of Bacillus subtilis chemotaxis protein CheC SWALL:CHEC_BACSU (SWALL:P40403) (209 aa) fasta scores: E(): 0.0046, 28.22% id in 124 aa
YP_110827.1	Internal region is similar to an internal region of Escherichia coli penicillin-binding protein 1c pbpc or b2519 SWALL:PBPC_ECOLI (SWALL:P76577) (770 aa) fasta scores: E(): 2.3e-29, 32.8% id in 631 aa. C-terminus is similar to the C-terminal region of Leptospira interrogans penicillin-binding protein 1F LA2187 SWALL:AAN49386 (EMBL:AE011390) (709 aa) fasta scores: E(): 3.8e-43, 35.27% id in 771 aa. Possible alternative translational start site
YP_110828.1	Weakly similar to Anabaena sp. hypothetical protein ALL5100 SWALL:YFA0_ANASP (SWALL:Q8YM40) (1906 aa) fasta scores: E(): 4e-12, 21.2% id in 2056 aa
YP_110829.1	Poor database matches. Weakly similar to an internal region of Neisseria meningitidis hypothetical protein Nmb0593 nmb0593 SWALL:Q9K0K2 (EMBL:AE002415) (808 aa) fasta scores: E(): 8.9, 26.28% id in 156 aa
YP_110830.1	Similar to Streptomyces coelicolor hypothetical protein SCO4918 or SCK13.10c SWALL:Q9AD81 (EMBL:AL939121) (145 aa) fasta scores: E(): 0.62, 30.96% id in 155 aa
YP_110831.1	Similar to Escherichia coli leucyl-tRNA synthetase LeuS SWALL:SYL_ECOLI (SWALL:P07813) (860 aa) fasta scores: E(): 1.1e-34, 30.27% id in 806 aa, and to Thermotoga maritima leucyl-tRNA synthetase leus or tm0168 SWALL:SYL_THEMA (SWALL:Q9WY15) (824 aa) fasta scores: E(): 7.5e-38, 33.33% id in 765 aa. CDS is truncated at the C-terminus in comparison to some orthologues
YP_110832.1	Poor database matches. C-terminal region is weakly similar to Halobacterium sp. hypothetical protein VNG0713C SWALL:Q9HRG3 (EMBL:AE005016) (231 aa) fasta scores: E(): 0.032, 29.74% id in 232 aa
YP_110833.1	Poor database matches. Weakly similar to an internal region of Streptomyces coelicolor hypothetical protein SCO6522 or SC5C7.07 SWALL:O86704 (EMBL:AL939128) (480 aa) fasta scores: E(): 0.13, 29.41% id in 306 aa
YP_110834.1	Poor database matches. Weakly similar to an internal region of Streptomyces coelicolor hypothetical protein SCO6994 or SC8f11.20c SWALL:Q9KZF9 (EMBL:AL939130) (1086 aa) fasta scores: E(): 1.7, 26.23% id in 587 aa
YP_110835.1	Similar to Escherichia coli alpha-ketoglutarate-dependent taurine dioxygenase TauD or SsiD SWALL:TAUD_ECOLI (SWALL:P37610) (282 aa) fasta scores: E(): 1.8e-24, 34.02% id in 291 aa, and to Pseudomonas aeruginosa hypothetical protein pa2310 SWALL:Q9I1G5 (EMBL:AE004657) (295 aa) fasta scores: E(): 1.1e-33, 40.07% id in 287 aa
YP_110836.1	Poor database matches. C-terminus is similar to the C-terminal region of Rhizobium loti hypothetical protein mlr1181 SWALL:Q98L47 (EMBL:AP002996) (218 aa) fasta scores: E(): 1.8e-12, 34.54% id in 165 aa. Possible alternative translational start site
YP_110837.1	Similar to Streptomyces clavuligerus isopenicillin N epimerase CefD SWALL:CEFD_STRCL (SWALL:P18549) (397 aa) fasta scores: E(): 2.5e-28, 36.36% id in 385 aa, and to Ralstonia solanacearum  isopenicillin N epimerase rsp0696 or rs01753 SWALL:Q8XRY5 (EMBL:AL646080) (419 aa) fasta scores: E(): 5.3e-39, 37.17% id in 390 aa
YP_110838.1	C-terminus is similar to the C-terminal region of Vibrio parahaemolyticus microbial collagenase precursor PrtVp SWALL:COLA_VIBPA (SWALL:Q56696) (587 aa) fasta scores: E(): 3.4e-43, 31.36% id in 542 aa. Similar to the N-terminal region of Streptomyces coelicolor SC10A5.17 protein SCO5912 or SC10A5.17 SWALL:O54108 (EMBL:AL939125) (865 aa) fasta scores: E(): 2.8e-63, 35.88% id in 627 aa. Similar to BPSS0666, 81.329% identity (81.458% ungapped) in 632 aa overlap
YP_110839.1	Poor database matches. Similar to an internal region of Archaeoglobus fulgidus hypothetical protein AF0070 SWALL:Y070_ARCFU (SWALL:O30166) (353 aa) fasta scores: E(): 7.7, 27.45% id in 102 aa. Similar to BPSS1748, 51.042% identity (55.682% ungapped) in 96 aa overlap
YP_110840.1	associated with the biosynthesis repression of 4-hydroxy-2-alkylquinolines (HAQs) and HAQ-analogs, which act as extracellular signals that interact with quorum sensing
YP_110841.1	N-terminal region is similar to Pseudomonas aeruginosa probable transcriptional regulator pa4499 SWALL:Q9HVS2 (EMBL:AE004863) (187 aa) fasta scores: E(): 1.9e-31, 55.49% id in 182 aa, and to Clostridium acetobutylicum predicted transcriptional regulator cac0841 SWALL:Q97KS5 (EMBL:AE007599) (179 aa) fasta scores: E(): 1.1e-08, 29.05% id in 179 aa. CDS is extended at the C-terminus in comparison to orthologues
YP_110844.1	Similar to Ralstonia solanacearum hypothetical protein rsc1512 or rs03792 SWALL:Q8XZ92 (EMBL:AL646065) (92 aa) fasta scores: E(): 1.2e-08, 46.42% id in 84 aa, and to Escherichia coli hypothetical protein YrdB SWALL:YRDB_ECOLI (SWALL:P45795) (85 aa) fasta scores: E(): 0.34, 32.87% id in 73 aa. Similar to BPSS0598, 59.140% identity (60.440% ungapped) in 93 aa overlap
YP_110846.1	Similar to Escherichia coli, and Shigella flexneri response regulator UvrYSWALL:UVRY_ECOLI (SWALL:P07027) (218 aa) fasta scores: E(): 4.4e-24, 36.84% id in 209 aa, and to Ralstonia solanacearum probable response regulator transcription regulator protein rsc0192 or rs00624 SWALL:Q8Y2Y9 (EMBL:AL646057) (215 aa) fasta scores: E(): 7.9e-48, 60.09% id in 213 aa. Similar to BPSS1161, 81.308% identity (81.308% ungapped) in 214 aa overlap, and to BPSS0770, 50.000% identity (50.237% ungapped) in 212 aa overlap
YP_110847.1	Similar to Ralstonia solanacearum hypothetical protein rsp1561 or rs02117 SWALL:Q8XPS7 (EMBL:AL646085) (151 aa) fasta scores: E(): 1e-14, 41.89% id in 148 aa, and to Pseudomonas aeruginosa hypothetical protein pa3309 SWALL:Q9HYT5 (EMBL:AE004753) (151 aa) fasta scores: E(): 2.1e-13, 40.94% id in 149 aa
YP_110848.1	Similar to Ralstonia solanacearum hypothetical protein rsc0185 or rs00616 SWALL:Q8Y2Z6 (EMBL:AL646057) (279 aa) fasta scores: E(): 5e-29, 35.56% id in 284 aa, and to Bradyrhizobium japonicum hypothetical protein SWALL:Q03082 (EMBL:L07487) (277 aa) fasta scores: E(): 1.5e-24, 38.24% id in 285 aa
YP_110849.1	Similar to Ralstonia solanacearum hypothetical protein rsp1561 or rs02117 SWALL:Q8XPS7 (EMBL:AL646085) (151 aa) fasta scores: E(): 3.7e-18, 46.75% id in 154 aa, and to Ralstonia solanacearum hypothetical protein rsc0184 or rs00615 SWALL:Q8Y2Z7 (EMBL:AL646057) (166 aa) fasta scores: E(): 2.3e-16, 41.61% id in 161 aa
YP_110850.1	Similar to Ralstonia solanacearum hypothetical protein rsc0185 or rs00616 SWALL:Q8Y2Z6 (EMBL:AL646057) (279 aa) fasta scores: E(): 5.5e-39, 42.14% id in 280 aa, and to Rhizobium loti hypothetical protein mll0142 SWALL:Q98NH2 (EMBL:AP002994) (277 aa) fasta scores: E(): 1.6e-23, 33.33% id in 285 aa
YP_110851.1	Similar to Bacillus subtilis sorbitol dehydrogenase GutB SWALL:DHSO_BACSU (SWALL:Q06004) (352 aa) fasta scores: E(): 1.1e-25, 30.25% id in 347 aa, and to Ralstonia solanacearum probable zinc-dependent alcohol dehydrogenase oxidoreductase rsc0194 or rs00626 SWALL:Q8Y2Y7 (EMBL:AL646058) (345 aa) fasta scores: E(): 1.1e-97, 73.46% id in 343 aa
YP_110852.1	Similar to Ralstonia solanacearum probable transmembrane protein rsp0396 or rs00824 SWALL:Q8XSS1 (EMBL:AL646078) (326 aa) fasta scores: E(): 4.5e-39, 38.19% id in 322 aa, and to Xanthomonas campestris hypothetical protein xcc1731 SWALL:Q8P9W4 (EMBL:AE012274) (330 aa) fasta scores: E(): 1.3e-29, 35.46% id in 313 aa. Possible alternative upstream translational start sites. CDS is extended at the C-terminus in comparison to some orthologues
YP_110853.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc1445 or rs03862 SWALL:Q8XZF6 (EMBL:AL646064) (400 aa) fasta scores: E(): 7.6e-85, 60% id in 400 aa, and to Klebsiella pneumoniae hypothetical protein SWALL:O87757 (EMBL:AJ011907) (404 aa) fasta scores: E(): 2.9e-76, 54.78% id in 376 aa
YP_110854.1	Similar to Bacillus megaterium glucose 1-dehydrogenase II GdhII SWALL:DHG2_BACME (SWALL:P39483) (261 aa) fasta scores: E(): 4.2e-10, 30.54% id in 203 aa, and to Pseudomonas aeruginosa probable short chain dehydrogenase pa0117 SWALL:Q9I715 (EMBL:AE004450) (242 aa) fasta scores: E(): 6.2e-30, 41.9% id in 241 aa
YP_110855.1	Similar to Pseudomonas aeruginosa hypothetical protein pa2095 SWALL:Q9I220 (EMBL:AE004637) (281 aa) fasta scores: E(): 3.2e-55, 57.66% id in 274 aa, and to Streptomyces clavuligerus methyltransferase CmcJ SWALL:O85727 (EMBL:AF073896) (310 aa) fasta scores: E(): 9e-17, 34.24% id in 292 aa
YP_110856.1	Similar to Salmonella typhimurium proline-specific permease ProY SWALL:PROY_SALTY (SWALL:P37460) (456 aa) fasta scores: E(): 2.9e-93, 52.62% id in 439 aa, and to Bacillus subtilis amino acid transporter YtnA SWALL:O34618 (EMBL:AF008220) (463 aa) fasta scores: E(): 2.3e-119, 65.2% id in 457 aa. Similar to BPSL3256, 66.667% identity (66.667% ungapped) in 438 aa overlap
YP_110857.1	Similar to Rhizobium loti hypothetical protein msr0960 SWALL:Q98LM9 (EMBL:AP002996) (83 aa) fasta scores: E(): 7.7e-06, 41.79% id in 67 aa, and to Shewanella oneidensis transcriptional regulator, Cro/CI family SC1469 SWALL:AAN54530 (EMBL:AE015592) (84 aa) fasta scores: E(): 5.7e-05, 44.44% id in 63 aa
YP_110858.1	Similar to Ralstonia solanacearum  HNS-like transcription regulator protein rsp0029 or rs02004 SWALL:Q8XTS5 (EMBL:AL646076) (95 aa) fasta scores: E(): 6.3e-13, 52.04% id in 98 aa, and to Escherichia coli Lee encoded regulator Ler SWALL:Q8VTF2 (EMBL:AF328682) (129 aa) fasta scores: E(): 0.017, 28% id in 100 aa
YP_110859.1	C-terminal region is similar to Xanthomonas axonopodis hypothetical protein xac0854 SWALL:AAM35742 (EMBL:AE011717) (434 aa) fasta scores: E(): 3.7e-81, 56.28% id in 382 aa. Full length CDS is similar to Agrobacterium tumefaciens acyl-CoA dehydrogenase Acd SWALL:Q8UAD5 (EMBL:AE009274) (451 aa) fasta scores: E(): 3.9e-41, 34.7% id in 438 aa
YP_110860.1	Similar to Pseudomonas aeruginosa hypothetical protein pa2768 SWALL:Q9I075 (EMBL:AE004704) (160 aa) fasta scores: E(): 1.3e-34, 58.55% id in 152 aa
YP_110861.1	Similar to Pseudomonas aeruginosa hypothetical protein pa0830 SWALL:Q9I5A9 (EMBL:AE004517) (277 aa) fasta scores: E(): 3e-33, 42% id in 269 aa, and to Caulobacter crescentus FF domain protein cc1344 SWALL:Q9A8K9 (EMBL:AE005810) (285 aa) fasta scores: E(): 1.4e-28, 37.18% id in 277 aa. Similar to 58.503% identity (59.930% ungapped) in 294 aa overlap, and to BPSS1914, 58.503% identity (59.930% ungapped) in 294 aa overlap, and to BPSS1822, 50.523% identity (51.971% ungapped) in 287 aa overlap
YP_110862.1	Similar to Bradyrhizobium japonicum BLL1287 protein SWALL:BAC46552 (EMBL:AP005939) (115 aa) fasta scores: E(): 3e-14, 44.73% id in 114 aa, and to the C-terminal region of Xanthomonas axonopodis hypothetical protein xac4063 SWALL:AAM38898 (EMBL:AE012054) (154 aa) fasta scores: E(): 7.6e-05, 36.44% id in 107 aa
YP_110863.1	Similar to Chelatobacter heintzii nitrilotriacetate monooxygenase component A NtaA or NmoA SWALL:NTAA_CHEHE (SWALL:P54989) (453 aa) fasta scores: E(): 5e-62, 45.23% id in 451 aa, and to Rhizobium loti nitrilotriacetate monooxygenase component a mll9178 SWALL:Q981Y9 (EMBL:AP003015) (448 aa) fasta scores: E(): 1.8e-78, 50.57% id in 433 aa
YP_110864.1	Similar to Crithidia fasciculata inosine-uridine preferring nucleoside hydrolase IunH SWALL:IUNH_CRIFA (SWALL:Q27546) (314 aa) fasta scores: E(): 5.3e-27, 36.73% id in 294 aa, and to Rhizobium meliloti  nucleoside hydrolase r02906 or smc03175 SWALL:Q92LV9 (EMBL:AL591792) (317 aa) fasta scores: E(): 1.6e-60, 54.65% id in 322 aa
YP_110865.1	Similar to Escherichia coli ribokinase RbsK SWALL:RBSK_ECOLI (SWALL:P05054) (309 aa) fasta scores: E(): 2.4e-26, 34.65% id in 303 aa, and to Agrobacterium tumefaciens ribokinase ATU4847 or AGR_L_78 SWALL:Q8U6G0 (EMBL:AE009413) (312 aa) fasta scores: E(): 3.2e-63, 56.67% id in 307 aa
YP_110866.1	Poor database matches. Weakly similar to Oryza sativa hypothetical protein SWALL:Q94LB7 (EMBL:AC084404) (179 aa) fasta scores: E(): 2.5, 29.44% id in 163 aa
YP_110867.1	Similar to Pseudomonas aeruginosa hypothetical protein pa1865 SWALL:Q9I2N0 (EMBL:AE004612) (559 aa) fasta scores: E(): 4.5e-114, 53.97% id in 554 aa. Weakly similar to the C-terminal region of Homo sapiens hypothetical protein KIAA1018 SWALL:Q9Y2M0 (EMBL:AB023235) (1017 aa) fasta scores: E(): 3.3e-08, 23.76% id in 648 aa
YP_110868.1	Similar to Pseudomonas aeruginosa hypothetical protein pa1866 SWALL:Q9I2M9 (EMBL:AE004612) (758 aa) fasta scores: E(): 3.9e-181, 61.17% id in 752 aa, and to Listeria innocua hypothetical protein lin0195 SWALL:Q92FB1 (EMBL:AL596163) (779 aa) fasta scores: E(): 8.1e-86, 35.45% id in 770 aa
YP_110869.1	No significant database matches to the full length CDS. Internal region is similar to Pseudomonas sp. ON4a L-2-amino-thiazoline-4-carboxylic acid hydrolase SWALL:Q9FB06 (EMBL:AB029899) (183 aa) fasta scores: E(): 2.6e-35, 72.83% id in 173 aa, and to Zymomonas mobilis hypothetical protein SWALL:Q9FDK5 (EMBL:AF212041) (160 aa) fasta scores: E(): 4e-24, 56.95% id in 151 aa. Possible alternative translational start site. CDS is extended at the C-terminus in comparison to similar proteins, possible gene fusion
YP_110870.1	Similar to Pseudomonas aeruginosa A-type flagellar hook-associated protein 2 FliD SWALL:FLDA_PSEAE (SWALL:O33421) (478 aa) fasta scores: E(): 9e-23, 28.36% id in 483 aa, and to Pseudomonas aeruginosa B-type flagellar hook-associated protein 2 pa1094 SWALL:FLDB_PSEAE (SWALL:Q9K3C5) (474 aa) fasta scores: E(): 4.8e-22, 28.99% id in 469 aa. CDS is extended at the N-terminus in comparison to orthologues. Similar to BPSL3320, 58.300% identity (58.765% ungapped) in 506 aa overlap
YP_110871.1	Similar to Pseudomonas aeruginosa transcriptional regulator PtxR SWALL:PTXR_PSEAE (SWALL:P72131) (312 aa) fasta scores: E(): 3.5e-31, 36.98% id in 292 aa, and to Yersinia pestis LysR-family transcriptional regulatory protein ypo0799 SWALL:Q8ZHT5 (EMBL:AJ414144) (302 aa) fasta scores: E(): 1.4e-61, 54.2% id in 297 aa
YP_110872.1	Similar to Rhizobium loti hypothetical protein mll3417 SWALL:Q98GA6 (EMBL:AP003001) (216 aa) fasta scores: E(): 3.3e-19, 38.86% id in 211 aa, and to Yersinia pestis hypothetical protein ypo0801 SWALL:Q8ZHT3 (EMBL:AJ414144) (211 aa) fasta scores: E(): 4.8e-10, 31.75% id in 211 aa
YP_110873.1	Similar to Xanthomonas axonopodis oxidoreductase xac0288 SWALL:AAM35180 (EMBL:AE011653) (323 aa) fasta scores: E(): 2e-70, 63.37% id in 314 aa, and to Pseudomonas aeruginosa probable oxidoreductase pa3795 SWALL:Q9HXK2 (EMBL:AE004798) (316 aa) fasta scores: E(): 6.1e-70, 63.6% id in 316 aa
YP_110874.1	Similar to Klebsiella aerogenes MoaF protein precursor MoaF SWALL:MOAF_KLEAE (SWALL:P54796) (262 aa) fasta scores: E(): 6.4e-38, 46.83% id in 284 aa, and to Pseudomonas aeruginosa hypothetical protein pa4087 SWALL:Q9HWU1 (EMBL:AE004825) (274 aa) fasta scores: E(): 1.6e-39, 50% id in 282 aa
YP_110875.2	Catalyzes the first of the two reduction steps in the elongation cycle of fatty acid synthesis
YP_110876.1	Similar to Klebsiella aerogenes monoamine regulon transcriptional regulator MoaR SWALL:MOAR_KLEAE (SWALL:P54794) (227 aa) fasta scores: E(): 7.5e-08, 34.27% id in 213 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa4074 SWALL:Q9HWV4 (EMBL:AE004823) (222 aa) fasta scores: E(): 8.6e-26, 43.66% id in 213 aa
YP_110877.1	Similar to Escherichia coli phenylacetaldehyde dehydrogenase FeaB or PadA or MaoB SWALL:FEAB_ECOLI (SWALL:P80668) (499 aa) fasta scores: E(): 7.1e-100, 54.36% id in 493 aa, and to Pseudomonas aeruginosa probable aldehyde dehydrogenase pa4073 SWALL:Q9HWV5 (EMBL:AE004823) (495 aa) fasta scores: E(): 2.2e-114, 60.8% id in 495 aa. Similar to BPSL0051, 59.259% identity (59.504% ungapped) in 486 aa overlap
YP_110878.1	Similar to Brucella melitensis omega-amino acid-pyruvate aminotransferase bmeii0130 SWALL:Q8YDP5 (EMBL:AE009651) (452 aa) fasta scores: E(): 4.7e-88, 52.48% id in 442 aa, and to Rhizobium sp. probable aminotransferase Y4UB SWALL:Y4UB_RHISN (SWALL:Q53196) (467 aa) fasta scores: E(): 4e-59, 41.37% id in 435 aa
YP_110879.1	Similar to Pseudomonas aeruginosa probable amino acid permease pa4072 SWALL:Q9HWV6 (EMBL:AE004823) (496 aa) fasta scores: E(): 2.4e-117, 69.51% id in 469 aa, and to Salmonella typhimurium  amino acid transporter stm3126 SWALL:Q8ZM30 (EMBL:AE008843) (499 aa) fasta scores: E(): 2.2e-110, 63.51% id in 466 aa
YP_110880.1	Weakly similar to Pseudomonas aeruginosa hypothetical protein pa4071 SWALL:Q9HWV7 (EMBL:AE004823) (192 aa) fasta scores: E(): 2.4e-05, 29.94% id in 187 aa
YP_110881.1	Similar to Escherichia coli ethanolamine operon regulatory protein EutR SWALL:EUTR_ECOLI (SWALL:P36547) (350 aa) fasta scores: E(): 3.5e-29, 33.83% id in 334 aa, and to Salmonella typhimurium ethanolamine operon regulatory protein stm2454 SWALL:EUTR_SALTY (SWALL:Q9ZFU7) (350 aa) fasta scores: E(): 1.6e-27, 32.91% id in 322 aa
YP_110882.1	Similar to Bordetella pertussis outer membrane porin protein precursor SWALL:OMP_BORPE (SWALL:Q04064) (385 aa) fasta scores: E(): 6.8e-16, 30.84% id in 389 aa, and to Alcaligenes eutrophus hypothetical protein SWALL:Q44021 (EMBL:L36817) (390 aa) fasta scores: E(): 4.9e-35, 37.06% id in 402 aa
YP_110883.1	No significant database matches. Doubtful CDS
YP_110884.1	Similar to Escherichia coli, and Shigella flexneri homoserine/homoserine lactone efflux protein RhtB SWALL:RHTB_ECOLI (SWALL:P27847) (206 aa) fasta scores: E(): 4.9e-09, 29.47% id in 190 aa, and to Rhizobium loti hypothetical protein mll4109 SWALL:Q98ES2 (EMBL:AP003003) (204 aa) fasta scores: E(): 1.1e-48, 63.54% id in 203 aa
YP_110885.1	Similar to Caulobacter crescentus acetyltransferase, GNAT family cc3261 SWALL:Q9A3E3 (EMBL:AE005989) (173 aa) fasta scores: E(): 2.6e-22, 50.63% id in 158 aa, and to Pseudomonas aeruginosa probable acetyltransferase pa2271 SWALL:Q9I1K2 (EMBL:AE004653) (171 aa) fasta scores: E(): 1.2e-06, 33.54% id in 161 aa
YP_110886.1	Similar to Escherichia coli N-ethylmaleimide reductase NemA SWALL:NEMA_ECOLI (SWALL:P77258) (365 aa) fasta scores: E(): 8.5e-57, 49.03% id in 363 aa, and to Pseudomonas aeruginosa xenobiotic reductase pa4356 SWALL:Q9HW45 (EMBL:AE004851) (350 aa) fasta scores: E(): 8.3e-94, 70.77% id in 349 aa
YP_110887.1	Similar to Pseudomonas aeruginosa hypothetical protein pa4354 SWALL:Q9HW47 (EMBL:AE004851) (100 aa) fasta scores: E(): 1.7e-20, 65.97% id in 97 aa, and to Rhizobium meliloti  transcription regulator protein r01565 or smc01226 SWALL:Q92PZ8 (EMBL:AL591787) (96 aa) fasta scores: E(): 1e-17, 59.57% id in 94 aa
YP_110888.1	Similar to Bordetella pertussis outer membrane porin protein precursor SWALL:OMP_BORPE (SWALL:Q04064) (385 aa) fasta scores: E(): 1e-14, 31.85% id in 405 aa, and to Burkholderia cepacia major porin protein OpcP1 SWALL:Q45106 (EMBL:D63823) (361 aa) fasta scores: E(): 3.5e-69, 76.45% id in 378 aa
YP_110889.1	Similar to Escherichia coli, and Shigella flexneri regulator of nucleoside diphosphate kinase Rnk SWALL:RNK_ECOLI (SWALL:P40679) (136 aa) fasta scores: E(): 6.2e-12, 38.28% id in 128 aa, and to Ralstonia solanacearum  regulator of nucleoside diphosphate kinase transcription regulator protein rsc2636 or rs04586 SWALL:Q8XW39 (EMBL:AL646071) (134 aa) fasta scores: E(): 1.1e-15, 44.36% id in 133 aa
YP_110890.1	No significant database matches. Similar to the C-terminal regions of BPSS1748, 50.538% identity (51.087% ungapped) in 93 aa overlap, and to BPSS0571, 50.000% identity (55.446% ungapped) in 112 aa overlap
YP_110891.1	Similar to Xanthomonas axonopodis hypothetical protein xac3045 SWALL:AAM37890 (EMBL:AE011946) (142 aa) fasta scores: E(): 1.5e-22, 53.9% id in 141 aa, and to Xanthomonas campestris hypothetical protein xcc2862 SWALL:AAM42134 (EMBL:AE012399) (142 aa) fasta scores: E(): 1.8e-22, 54.61% id in 141 aa
YP_110892.1	Similar to Escherichia coli, and Shigella flexneri GTP cyclohydrolase II RibA SWALL:GCH2_ECOLI (SWALL:P25523) (196 aa) fasta scores: E(): 1.2e-33, 52.66% id in 188 aa, and to the C-terminal region of Actinobacillus pleuropneumoniae riboflavin biosynthesis protein [includes: GTP cyclohydrolase II; 3,4-dihydroxy-2-butanone 4-phosphate synthase (dhbp synthase)] RibA SWALL:GCH2_ACTPL (SWALL:P50855) (401 aa) fasta scores: E(): 1e-33, 47.15% id in 193 aa. C-terminus is similar to the C-terminal region of BPSS1121, 54.088% identity (55.844% ungapped) in 159 aa overlap
YP_110894.1	Similar to Ralstonia solanacearum autoinducer synthesis protein SolI SWALL:SLI2_RALSO (SWALL:O30920) (204 aa) fasta scores: E(): 5.5e-51, 65.82% id in 199 aa, and to Burkholderia cepacia acyl homoserine lactone synthase CepI SWALL:Q9ZIU1 (EMBL:AF019654) (202 aa) fasta scores: E(): 6.6e-64, 76.84% id in 203 aa
YP_110895.1	Poor database matches. Weakly similar to the N-terminal region of Rhizobium meliloti hypothetical protein rb0634 or smb21055 SWALL:Q92VR5 (EMBL:AL603644) (194 aa) fasta scores: E(): 1.3, 31.34% id in 134 aa
YP_110896.1	Similar to Ralstonia solanacearum transcriptional activator protein SolR SWALL:SLR2_RALSO (SWALL:O30919) (236 aa) fasta scores: E(): 2.2e-66, 67.79% id in 236 aa, and to Burkholderia cepacia transcriptional activator CepR SWALL:Q9ZIU0 (EMBL:AF019654) (239 aa) fasta scores: E(): 2.7e-81, 79.91% id in 239 aa
YP_110897.1	Similar to Salmonella typhimurium Mg(2+) transport ATPase C MgtC SWALL:ATMC_SALTY (SWALL:P22037) (231 aa) fasta scores: E(): 2e-26, 41.92% id in 229 aa, and to Pseudomonas aeruginosa hypothetical protein pa4635 SWALL:Q9HVF6 (EMBL:AE004878) (234 aa) fasta scores: E(): 1.7e-34, 47.23% id in 235 aa
YP_110898.1	Similar to Helicobacter pylori J99 hypothetical protein JHP0380 SWALL:YA44_HELPJ (SWALL:Q9ZM43) (370 aa) fasta scores: E(): 3.4e-24, 31.86% id in 386 aa, and to Campylobacter jejuni hypothetical protein CJ0846 SWALL:Y846_CAMJE (SWALL:Q9PP77) (374 aa) fasta scores: E(): 2.7e-23, 32.22% id in 391 aa
YP_110899.1	Similar to Xanthomonas axonopodis  NADH dehydrogenase/NAD(P)H nitroreductase xac0554 SWALL:AAM35443 (EMBL:AE011683) (198 aa) fasta scores: E(): 1.2e-53, 74.24% id in 198 aa, and to Xanthomonas campestris  NADH dehydrogenase/NAD(P)H nitroreductase xcc3605 SWALL:AAM42875 (EMBL:AE012481) (196 aa) fasta scores: E(): 1.8e-53, 74.34% id in 191 aa
YP_110900.1	Similar to Escherichia coli alkylated DNA repair protein AlkB or AidD SWALL:ALKB_ECOLI (SWALL:P05050) (216 aa) fasta scores: E(): 0.15, 30.18% id in 222 aa, and to Pseudomonas aeruginosa hypothetical protein pa3306 SWALL:Q9HYT8 (EMBL:AE004753) (200 aa) fasta scores: E(): 1.2e-33, 50.75% id in 199 aa
YP_110901.1	Similar to Pseudomonas putida Pca regulon regulatory protein PcaR SWALL:PCAR_PSEPU (SWALL:Q52154) (291 aa) fasta scores: E(): 4.9e-15, 26.25% id in 278 aa. C-terminal region is similar to Pseudomonas aeruginosa probable transcriptional regulator pa3508 SWALL:Q9HYA1 (EMBL:AE004771) (277 aa) fasta scores: E(): 1.2e-41, 49.09% id in 275 aa. Similar to BPSS0900, 64.184% identity (65.108% ungapped) in 282 aa overlap
YP_110902.1	Similar to Bordetella pertussis outer membrane porin protein precursor SWALL:OMP_BORPE (SWALL:Q04064) (385 aa) fasta scores: E(): 1.5e-13, 33.16% id in 401 aa, and to Ralstonia solanacearum probable porin transmembrane protein rsc1082 or rs04105 SWALL:Q8Y0G2 (EMBL:AL646062) (394 aa) fasta scores: E(): 1e-29, 36.95% id in 368 aa
YP_110903.1	Similar to Pseudomonas aeruginosa naphthalene 1,2-dioxygenase system ferredoxin component NdoA or paha2 SWALL:NDOA_PSEAE (SWALL:Q51493) (103 aa) fasta scores: E(): 2.3e-09, 33.98% id in 103 aa, and to Acinetobacter sp. ADP1 hypothetical protein SWALL:O24846 (EMBL:AF009672) (101 aa) fasta scores: E(): 1.6e-17, 49% id in 100 aa
YP_110904.1	No significant database matches to the full length CDS. C-terminal region is similar to Pseudomonas aeruginosa hypothetical protein pa3501 SWALL:Q9HYA8 (EMBL:AE004770) (72 aa) fasta scores: E(): 0.0026, 36.06% id in 61 aa. Possible alternative translational start site
YP_110905.1	Similar to Pseudomonas sp. vanillate O-demethylase oxygenase subunit VanA SWALL:VANA_PSESP (SWALL:O05616) (354 aa) fasta scores: E(): 4e-18, 30.44% id in 358 aa, and to Acinetobacter sp. ADP1 hypothetical protein SWALL:O24847 (EMBL:AF009672) (316 aa) fasta scores: E(): 2.1e-88, 62.97% id in 316 aa
YP_110906.1	member of a large family of NAD or NADP-dependent oxidoreductases; paralogs occur in many bacteria
YP_110907.1	Similar to Pseudomonas aeruginosa hypothetical protein pa3510 SWALL:Q9HY99 (EMBL:AE004771) (176 aa) fasta scores: E(): 5.9e-50, 71.25% id in 167 aa, and to Rhodococcus sp. hypothetical protein SWALL:BAC00796 (EMBL:AB070454) (171 aa) fasta scores: E(): 1.2e-24, 49.36% id in 158 aa
YP_110908.1	Similar to Pseudomonas aeruginosa probable hydrolase pa3509 SWALL:Q9HYA0 (EMBL:AE004771) (289 aa) fasta scores: E(): 6e-33, 44.76% id in 277 aa, and to Agrobacterium tumefaciens hydrolase ATU4238 or AGR_L_1247 SWALL:Q8U861 (EMBL:AE009353) (286 aa) fasta scores: E(): 1.9e-10, 29.89% id in 291 aa
YP_110909.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa3508 SWALL:Q9HYA1 (EMBL:AE004771) (277 aa) fasta scores: E(): 6.5e-43, 49.62% id in 268 aa, and weakly similar to Pseudomonas putida Pca regulon regulatory protein PcaR SWALL:PCAR_PSEPU (SWALL:Q52154) (291 aa) fasta scores: E(): 1.4e-12, 26.37% id in 254 aa. Similar to BPSS0892, 64.184% identity (65.108% ungapped) in 282 aa overlap
YP_110910.1	Similar to Streptomyces cinnamonensis monensin polyketide synthase  ketoacyl reductase SWALL:DHKR_STRCM (SWALL:P41177) (261 aa) fasta scores: E(): 8.2e-19, 34.88% id in 258 aa, and to Pseudomonas aeruginosa probable short-chain dehydrogenase pa3507 SWALL:Q9HYA2 (EMBL:AE004771) (265 aa) fasta scores: E(): 2.4e-60, 61.74% id in 264 aa
YP_110911.1	Similar to Pseudomonas aeruginosa probable decarboxylase pa3506 SWALL:Q9HYA3 (EMBL:AE004771) (560 aa) fasta scores: E(): 1.8e-134, 66.13% id in 561 aa. Weakly similar to Escherichia coli acetolactate synthase isozyme I large subunit IlvB SWALL:ILVB_ECOLI (SWALL:P08142) (562 aa) fasta scores: E(): 1.8e-32, 28.57% id in 532 aa
YP_110912.1	catalyzes the formation of L-aspartate to iminoaspartate in NAD(+) biosynthesis
YP_110913.1	Similar to Bacillus subtilis betaine aldehyde dehydrogenase GbsA SWALL:DHAB_BACSU (SWALL:P71016) (490 aa) fasta scores: E(): 6.7e-69, 39.13% id in 488 aa, and to Pseudomonas aeruginosa probable aldehyde dehydrogenase pa3504 SWALL:Q9HYA5 (EMBL:AE004771) (494 aa) fasta scores: E(): 1.3e-129, 67.21% id in 488 aa
YP_110914.1	C-terminal region is similar to Pseudomonas aeruginosa hypothetical protein pa3503 SWALL:Q9HYA6 (EMBL:AE004770) (211 aa) fasta scores: E(): 1.1e-60, 67.3% id in 208 aa. Full length CDS is weakly similar to Pseudomonas aeruginosa  dioxygenase SWALL:O87625 (EMBL:AF087482) (309 aa) fasta scores: E(): 8.8e-13, 28.28% id in 297 aa. N-terminus is weakly similar to the N-terminal region of Rhodococcus rhodochrous metapyrocatechase CatA SWALL:CATA_RHORH (SWALL:Q53034) (318 aa) fasta scores: E(): 9.8e-05, 27.79% id in 277 aa
YP_110915.1	Similar to Escherichia coli 3-phenylpropionate dioxygenase ferredoxin--NAD(+) reductase component HcaD or PhdA or HcaA4 SWALL:HCAD_ECOLI (SWALL:P77650) (400 aa) fasta scores: E(): 1.8e-43, 38.76% id in 405 aa, and to Rhizobium loti  ferredoxin reductase MLR5000 SWALL:Q98CU3 (EMBL:AP003005) (412 aa) fasta scores: E(): 8.1e-52, 44.87% id in 390 aa
YP_110916.1	Similar to Acinetobacter calcoaceticus benzoate transport protein BenK SWALL:BENK_ACICA (SWALL:O30513) (466 aa) fasta scores: E(): 1.5e-22, 25.64% id in 429 aa, and to Agrobacterium tumefaciens MFS permease ATU5395 or AGR_PAT_571 SWALL:Q8UJT0 (EMBL:AE008961) (461 aa) fasta scores: E(): 5.3e-58, 37.5% id in 456 aa. CDS is extended at the N-terminus in comparison to some orthologues
YP_110917.1	C-terminal region is similar to the C-terminal region of Bradyrhizobium japonicum Blr5538 protein blr5538 SWALL:BAC50803 (EMBL:AP005955) (762 aa) fasta scores: E(): 3e-36, 32.9% id in 708 aa. Similar to an internal region of Xanthomonas axonopodis outer membrane protein xac3546 SWALL:Q8PGS0 (EMBL:AE012003) (2190 aa) fasta scores: E(): 2.3e-31, 32.42% id in 885 aa
YP_110918.1	C-terminus is similar to the C-terminal region of Escherichia coli outer membrane protein A precursor OmpA or TolG or Tut or Con SWALL:OMPA_ECOLI (SWALL:P02934) (346 aa) fasta scores: E(): 9.7e-16, 41.5% id in 159 aa. Full length CDS is similar to Haemophilus somnus antigen SWALL:Q48292 (EMBL:L07795) (273 aa) fasta scores: E(): 2e-10, 32.49% id in 277 aa
YP_110919.1	Similar to Salmonella typhimurium, and Salmonella typhi protein nucleotide-binding protein stm0614 or sty0662 SWALL:Q8XGB9 (EMBL:AE008724) (142 aa) fasta scores: E(): 0.19, 28.16% id in 142 aa, and to Methanobacterium thermoautotrophicum conserved protein mth898 SWALL:O26984 (EMBL:AE000865) (149 aa) fasta scores: E(): 0.26, 29.16% id in 144 aa
YP_110920.1	catalyzes the hydrolysis of a monocarboxylic acid amid to form a monocarboxylate and ammonia
YP_110921.1	Similar to Salmonella typhimurium, and Klebsiella aerogenes leucine-responsive regulatory protein Lrp SWALL:LRP_SALTY (SWALL:P37403) (163 aa) fasta scores: E(): 4.8e-17, 37.83% id in 148 aa, and to Pseudomonas putida Lrp-family transcriptional regulators MdeR SWALL:O33467 (EMBL:D89015) (159 aa) fasta scores: E(): 5.2e-28, 46.45% id in 155 aa
YP_110922.1	catalyzes the formation of methanethiol and 2-ocobutanoate from L-methionine
YP_110925.1	Similar to Salmonella typhimurium N-hydroxyarylamine O-acetyltransferase NhoA SWALL:NHOA_SALTY (SWALL:Q00267) (281 aa) fasta scores: E(): 3e-28, 35.05% id in 271 aa, and to Rhizobium loti arylamine N-acetyltransferase mlr4870 SWALL:Q98D42 (EMBL:AP003005) (278 aa) fasta scores: E(): 4.7e-39, 43.11% id in 276 aa
YP_110926.1	Similar to Rhizobium meliloti hypothetical protein r02764 or smc03980 SWALL:Q92M80 (EMBL:AL591791) (196 aa) fasta scores: E(): 3e-26, 44.08% id in 186 aa, and to Agrobacterium tumefaciens hypothetical protein atu5439 SWALL:Q8UJN7 (EMBL:AE008964) (195 aa) fasta scores: E(): 7e-24, 44.08% id in 186 aa
YP_110927.1	Similar to Agrobacterium tumefaciens hypothetical protein ATU0237 or AGR_C_402 SWALL:Q8UIQ6 (EMBL:AE008996) (152 aa) fasta scores: E(): 2.8e-28, 55.55% id in 153 aa, and to Rhizobium meliloti hypothetical protein r00359 or smc01160 SWALL:Q92SL2 (EMBL:AL591783) (152 aa) fasta scores: E(): 5.4e-25, 54% id in 150 aa
YP_110928.1	Similar to Agrobacterium tumefaciens oxidoreductase ATU0238 or AGR_C_405 SWALL:Q8UIQ5 (EMBL:AE008996) (297 aa) fasta scores: E(): 3e-50, 50.16% id in 297 aa, and to the C-terminal region of Bacillus sp. NADH dehydrogenase AhpF or Ndh SWALL:DHNA_BACSP (SWALL:P26829) (519 aa) fasta scores: E(): 4.9e-07, 25.08% id in 311 aa
YP_110929.1	Similar to Escherichia coli cyn operon transcriptional activator CynR SWALL:CYNR_ECOLI (SWALL:P27111) (311 aa) fasta scores: E(): 5.6e-17, 31.29% id in 262 aa, and to Rhizobium leguminosarum similarity to members of the LysR family SWALL:Q52868 (EMBL:U39409) (300 aa) fasta scores: E(): 1.4e-24, 31.37% id in 290 aa
YP_110930.1	Similar to Bradyrhizobium japonicum BLL7601 protein SWALL:BAC52866 (EMBL:AP005962) (461 aa) fasta scores: E(): 5.8e-106, 56.36% id in 456 aa, and to Streptomyces coelicolor  peptidase SCO5185 or 2SC3B6.09 SWALL:Q9FCK3 (EMBL:AL939122) (470 aa) fasta scores: E(): 7.6e-26, 30.1% id in 475 aa
YP_110931.1	Similar to Salmonella typhimurium, and Salmonella typhi citrate-proton symporter CitA SWALL:CIT1_SALTY (SWALL:P24115) (434 aa) fasta scores: E(): 6.4e-49, 35.28% id in 411 aa, and to Pseudomonas aeruginosa probable MFS transporter pa4343 SWALL:Q9HW58 (EMBL:AE004850) (439 aa) fasta scores: E(): 1.2e-57, 40.52% id in 417 aa
YP_110932.1	Similar to Mycobacterium tuberculosis probable oxidoreductase EphD or rv2214c or mt2270 or mtcy190.25c SWALL:EPHD_MYCTU (SWALL:Q10402) (592 aa) fasta scores: E(): 4.8e-17, 34.36% id in 323 aa. N-terminus is similar to the N-terminal region of Pseudomonas aeruginosa probable short-chain dehydrogenase pa3324 SWALL:Q9HYS1 (EMBL:AE004754) (592 aa) fasta scores: E(): 9e-27, 48.79% id in 291 aa
YP_110933.1	Similar to Pseudomonas aeruginosa hypothetical protein pa1542 SWALL:Q9I3H1 (EMBL:AE004582) (278 aa) fasta scores: E(): 2.4e-34, 43.46% id in 260 aa, and to Pseudomonas aeruginosa hypothetical protein pa0830 SWALL:Q9I5A9 (EMBL:AE004517) (277 aa) fasta scores: E(): 2.3e-33, 41.72% id in 266 aa. Similar to BPSS1914, 68.942% identity (69.896% ungapped) in 293 aa overlap, and to BPSS1822, 61.938% identity (63.028% ungapped) in 289 aa overlap, and to BPSS0849, 58.503% identity (59.930% ungapped) in 294 aa overlap
YP_110934.1	Similar to Pseudomonas paucimobilis C alpha-dehydrogenase LigD SWALL:LIGD_PSEPA (SWALL:Q01198) (305 aa) fasta scores: E(): 4.2e-16, 30.13% id in 292 aa. Previously sequenced as Burkholderia pseudomallei hypothetical protein LPW137-138 SWALL:Q9APG2 (EMBL:AF298896) (308 aa) fasta scores: E(): 5.5e-117, 100% id in 308 aa. Similar to BPSS1968, 53.378% identity (54.110% ungapped) in 296 aa overlap
YP_110935.1	Similar to Pseudomonas fluorescens  flavin-binding monooxygenase SWALL:O87636 (EMBL:AF090329) (512 aa) fasta scores: E(): 3.7e-142, 63.7% id in 507 aa, and weakly similar to Acinetobacter sp cyclohexanone monooxygenase SWALL:CYMO_ACISP (SWALL:P12015) (542 aa) fasta scores: E(): 2.2e-23, 28.17% id in 504 aa
YP_110936.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein rsc3353 or rs02628 SWALL:Q8XU41 (EMBL:AL646074) (253 aa) fasta scores: E(): 2.4e-20, 41.96% id in 224 aa, and to Rhizobium loti hypothetical protein mll3549 SWALL:Q98G00 (EMBL:AP003002) (224 aa) fasta scores: E(): 1.1e-07, 35.18% id in 216 aa
YP_110937.1	Similar to Escherichia coli  aliphatic sulfonates binding protein precursor SsuA SWALL:SSUA_ECOLI (SWALL:P75853) (319 aa) fasta scores: E(): 3.5e-46, 43.97% id in 307 aa, and to Ralstonia solanacearum alkanesulfonates binding protein precursor rsp1383 or rs02075 SWALL:Q8XQA3 (EMBL:AL646084) (334 aa) fasta scores: E(): 2.2e-74, 61.46% id in 327 aa. Similar to BPSL1252, 50.485% identity (50.980% ungapped) in 309 aa overlap
YP_110938.1	Similar to Ralstonia solanacearum probable transcription regulator protein rsc3080 or rs00531 SWALL:Q8XUV3 (EMBL:AL646073) (256 aa) fasta scores: E(): 5.6e-48, 56.66% id in 240 aa, and to Streptomyces coelicolor  MerR-family transcriptional regulator SCO3173 or SCE87.24 SWALL:Q9RKB4 (EMBL:AL939115) (215 aa) fasta scores: E(): 3.2e-19, 39.46% id in 223 aa
YP_110939.1	Similar to Alcaligenes faecalis phosphinothricin N-acetyltransferase Pat SWALL:PAT_ALCFA (SWALL:P31668) (197 aa) fasta scores: E(): 8.3e-36, 59.76% id in 169 aa, and to Streptomyces hygroscopicus phosphinothricin N-acetyltransferase Bar SWALL:PAT_STRHY (SWALL:P16426) (183 aa) fasta scores: E(): 2.8e-16, 38.85% id in 175 aa
YP_110940.1	Poor database matches. Weakly similar to the C-terminal region of Heterodoxus macropus NADH dehydrogenase subunit 2 Nad2 SWALL:Q9B8G3 (EMBL:AF270939) (298 aa) fasta scores: E(): 2.1, 25.24% id in 202 aa
YP_110941.1	Similar to the C-terminal regions of Streptomyces coelicolor  integral membrane transport protein SCO2344 or SCC8A.02c SWALL:Q9KY46 (EMBL:AL939112) (689 aa) fasta scores: E(): 5.7e-93, 52.89% id in 501 aa, and to Streptomyces coelicolor  exporter SCO3366 or SCE94.17c SWALL:Q9X8M3 (EMBL:AL939116) (531 aa) fasta scores: E(): 1.6e-85, 46.42% id in 504 aa
YP_110942.1	Similar to Escherichia coli methyl-accepting chemotaxis protein I Tsr or CheD SWALL:MCP1_ECOLI (SWALL:P02942) (551 aa) fasta scores: E(): 4.2e-61, 44.29% id in 526 aa, and to Ralstonia solanacearum probable methyl-accepting chemotaxis transmembrane protein rsp0303 or rs05471 SWALL:Q8XT14 (EMBL:AL646077) (515 aa) fasta scores: E(): 1.3e-76, 50.78% id in 512 aa. CDS is truncated at the C-terminus in comparison to some orthologues. Similar to N-terminal region of BPSL1829, 51.908% identity (52.510% ungapped) in 524 aa overlap
YP_110944.1	Poor database matches. C-terminus is weakly similar to the N-terminal region of Bradyrhizobium japonicum transcriptional regulatory protein FixJ SWALL:FIXJ_BRAJA (SWALL:P23221) (205 aa) fasta scores: E(): 0.02, 29.26% id in 123 aa
YP_110945.1	Similar to Rhizobium meliloti  amino acid deaminase transmembrane protein r02931 or smc03200 SWALL:Q92LU0 (EMBL:AL591792) (445 aa) fasta scores: E(): 5.5e-50, 37.41% id in 441 aa, and to Corynebacterium sp. sarcosine oxidase beta subunit SoxB SWALL:SOXB_CORS1 (SWALL:P40875) (405 aa) fasta scores: E(): 1.8e-10, 25.33% id in 446 aa
YP_110946.1	Similar to Streptomyces coelicolor  membrane protein SCO3826 or SCGD3.27c SWALL:Q9XA52 (EMBL:AL939117) (365 aa) fasta scores: E(): 7.7e-32, 33.43% id in 344 aa, and to Mycobacterium tuberculosis hypothetical protein rv3200c or mtv014.44c or mt3294 SWALL:O53346 (EMBL:AL021646) (355 aa) fasta scores: E(): 1.7e-31, 33.12% id in 320 aa
YP_110947.1	Similar to Streptomyces coelicolor  epoxide hydrolase SCOo6277 or SC1G7.03 SWALL:Q93S12 (EMBL:AL939127) (286 aa) fasta scores: E(): 1.5e-35, 40.82% id in 267 aa. Weakly similar to Glycine max epoxide hydrolase SWALL:O49857 (EMBL:X78548) (341 aa) fasta scores: E(): 3.6e-12, 28% id in 275 aa
YP_110948.1	Similar to Acinetobacter calcoaceticus 4-carboxymuconolactone decarboxylase PcaC SWALL:DC4C_ACICA (SWALL:P20370) (134 aa) fasta scores: E(): 6.5e-15, 40.47% id in 126 aa, and to Pseudomonas aeruginosa hypothetical protein pa4486 SWALL:Q9HVT5 (EMBL:AE004862) (128 aa) fasta scores: E(): 1.5e-24, 59.2% id in 125 aa
YP_110949.1	catalyzes the formation of L-proline from L-ornithine
YP_110950.1	Similar to Agrobacterium tumefaciens esterase/lipase ATU2002 or AGR_C_3637 SWALL:Q8UDW6 (EMBL:AE009152) (322 aa) fasta scores: E(): 6.1e-17, 33.11% id in 305 aa. C-terminal region is weakly similar to Caldocellum saccharolyticum acetyl esterase XynC SWALL:XYNC_CALSA (SWALL:P23553) (266 aa) fasta scores: E(): 5.6e-11, 26.39% id in 269 aa. Possible alternative translational start site
YP_110951.1	Similar to Rhodobacter sphaeroides OpgC SWALL:Q9FA51 (EMBL:AF016298) (399 aa) fasta scores: E(): 1.1e-15, 30.33% id in 389 aa, and to Rhizobium meliloti hypothetical transmembrane protein smc04381 r03285 or smc04381 SWALL:Q92L11 (EMBL:AL591793) (385 aa) fasta scores: E(): 7.2e-18, 29.28% id in 362 aa. N-terminal region is similar to the C-termial region of BPSS2162, 50.992% identity (52.023% ungapped) in 353 aa overlap
YP_110952.1	Similar to Bordetella pertussis outer membrane porin protein precursor SWALL:OMP_BORPE (SWALL:Q04064) (385 aa) fasta scores: E(): 2.8e-19, 34.21% id in 377 aa, and to Ralstonia solanacearum probable porin signal peptide protein rsp0051 or rs02026 SWALL:Q8XTQ5 (EMBL:AL646076) (382 aa) fasta scores: E(): 2.1e-87, 60.1% id in 386 aa. Similar to BPSL2559, 53.197% identity (55.914% ungapped) in 391 aa overlap, and to BPSL3036, 50.370% identity (55.890% ungapped) in 405 aa overlap, and to BPSS0757, 50.382% identity (55.000% ungapped) in 393 aa overlap
YP_110953.1	Similar to Chromatium vinosum rubisco operon transcriptional regulator RbcR SWALL:RBCR_CHRVI (SWALL:P25544) (302 aa) fasta scores: E(): 2.5e-13, 24.54% id in 273 aa, and to Ralstonia solanacearum probable transcription regulator protein rsp1267 or rs05312 SWALL:Q8XQG0 (EMBL:AL646083) (294 aa) fasta scores: E(): 3.8e-64, 57.73% id in 291 aa
YP_110954.1	Similar to the C-terminal regions of Escherichia coli, and Shigella flexneri lipoprotein NlpD precursor SWALL:NLPD_ECOLI (SWALL:P33648) (379 aa) fasta scores: E(): 1.3e-12, 32.25% id in 310 aa, and to Rhodocyclus gelatinosus NlpD protein SWALL:Q9JP90 (EMBL:AB034704) (314 aa) fasta scores: E(): 1.4e-28, 42.95% id in 305 aa
YP_110955.1	Similar to Yersinia enterocolitica beta-lactamase precursor BlaA SWALL:BLAC_YEREN (SWALL:Q01166) (294 aa) fasta scores: E(): 1.5e-60, 57.43% id in 289 aa. Previously sequenced as Burkholderia pseudomallei class A beta-lactamase PenA or Bla-BPS-1d SWALL:Q932Y0 (EMBL:AY032872) (295 aa) fasta scores: E(): 4.9e-114, 100% id in 295 aa
YP_110956.1	Similar to Escherichia coli glycine cleavage system transcriptional activator GcvA SWALL:GCVA_ECOLI (SWALL:P32064) (305 aa) fasta scores: E(): 1.6e-32, 37.93% id in 290 aa, and to Pseudomonas putida  transcriptional regulator PP1393 SWALL:AAN67016 (EMBL:AE016779) (291 aa) fasta scores: E(): 4.4e-49, 51.86% id in 268 aa
YP_110957.1	Poor database matches. N-terminus is similar to the N-terminal region of Escherichia coli hypothetical protein YmdA SWALL:YMDA_ECOLI (SWALL:P75917) (103 aa) fasta scores: E(): 2.5, 32.85% id in 70 aa
YP_110958.1	Similar to Streptococcus pneumoniae oligopeptide transport ATP-binding protein AmiF SWALL:AMIF_STRPN (SWALL:P18766) (308 aa) fasta scores: E(): 5.8e-29, 43.13% id in 255 aa, and to Rhizobium meliloti  dipeptide transport ATP-binding ABC transporter protein r02409 or smc01529 SWALL:Q92N30 (EMBL:AL591790) (255 aa) fasta scores: E(): 2.5e-46, 59.44% id in 254 aa
YP_110959.1	Similar to the N-terminal region of Bacillus subtilis oligopeptide transport ATP-binding protein OppD SWALL:OPPD_BACSU (SWALL:P24136) (358 aa) fasta scores: E(): 8.4e-32, 42.5% id in 280 aa, and to the full length Rhizobium meliloti  dipeptide transport ATP-binding ABC transporter protein r02410 or smc01528 SWALL:Q92N29 (EMBL:AL591790) (277 aa) fasta scores: E(): 2.5e-48, 59.05% id in 276 aa
YP_110960.1	Similar to Escherichia coli dipeptide transport system permease DppC SWALL:DPPC_ECOLI (SWALL:P37315) (300 aa) fasta scores: E(): 1.1e-43, 44.36% id in 275 aa, and to Rhizobium meliloti  dipeptide transport system permease ABC transporter protein r02411 or smc01527 SWALL:Q92N28 (EMBL:AL591790) (310 aa) fasta scores: E(): 4.5e-74, 67.56% id in 296 aa. CDS is extended at the N-terminus in comparison to some orthologues
YP_110961.1	Similar to Escherichia coli dipeptide transport system permease DppB SWALL:DPPB_ECOLI (SWALL:P37316) (339 aa) fasta scores: E(): 1.4e-44, 43.21% id in 324 aa, and to Rhizobium meliloti  dipeptide transport system permease ABC transporter protein r02412 or smc01526 SWALL:Q92N27 (EMBL:AL591790) (347 aa) fasta scores: E(): 3.9e-78, 62.24% id in 339 aa. CDS is extended at the N-terminus in comparison to some orthologues
YP_110962.1	Similar to Rhizobium meliloti  dipeptide binding periplasmic protein r02413 or smc01525 SWALL:Q92N26 (EMBL:AL591790) (546 aa) fasta scores: E(): 1e-68, 51.3% id in 536 aa, and to Agrobacterium tumefaciens ABC transporter substrate binding protein ATU4431 or AGR_L_873 SWALL:Q8U7L8 (EMBL:AE009372) (545 aa) fasta scores: E(): 1.5e-66, 51.61% id in 527 aa. Similar to BPSS0964, 72.744% identity (73.019% ungapped) in 532 aa overlap
YP_110963.1	catalyzes the hydrolysis of D-alanyl-D-alanine dipeptide: Zn dependent; involved in peptidoglycan synthesis
YP_110964.1	Weakly similar to Salmonella typhimurium transcriptional regulator stm4417 SWALL:Q8ZK65 (EMBL:AE008907) (277 aa) fasta scores: E(): 3e-06, 20.75% id in 265 aa, and to Yersinia pestis hypothetical protein ypo2576 SWALL:Q8ZDJ0 (EMBL:AJ414152) (284 aa) fasta scores: E(): 1.1e-05, 22.84% id in 267 aa
YP_110965.1	No significant database matches to the full length CDS. C-terminus is weakly similar to the C-terminal region of Ralstonia solanacearum probable ATP-binding ABC transporter protein rsc1016 or rs04262 SWALL:Q8Y0M7 (EMBL:AL646062) (523 aa) fasta scores: E(): 4.1, 25.14% id in 354 aa
YP_110966.1	Similar to Pseudomonas aeruginosa hypothetical protein pa0091 SWALL:Q9I741 (EMBL:AE004447) (643 aa) fasta scores: E(): 1.4e-75, 37.03% id in 640 aa, and to the N-terminal region of Pseudomonas aeruginosa hypothetical protein pa0095 SWALL:Q9I737 (EMBL:AE004448) (741 aa) fasta scores: E(): 3e-79, 37.89% id in 636 aa
YP_110967.1	Similar to Yersinia pestis hypothetical protein ypo3614 SWALL:Q8ZB15 (EMBL:AJ414158) (140 aa) fasta scores: E(): 2.2e-10, 30.88% id in 136 aa, and to Ralstonia solanacearum hypothetical protein rsp1138 or rs05481 SWALL:Q8XQT1 (EMBL:AL646083) (143 aa) fasta scores: E(): 1.2e-09, 26.61% id in 139 aa
YP_110968.1	Similar to Ralstonia solanacearum  Rhs-related transmembrane protein rsp1137 or rs05482 SWALL:Q8XQT2 (EMBL:AL646083) (1517 aa) fasta scores: E(): 1.2e-94, 34.74% id in 1557 aa. Internal region is similar to an internal region of Escherichia coli RhsD protein precursor SWALL:RHSD_ECOLI (SWALL:P16919) (1426 aa) fasta scores: E(): 1e-13, 28.1% id in 1000 aa
YP_110970.1	Weakly similar to Serratia marcescens extracellular serine protease precursor SWALL:PRTT_SERMA (SWALL:P29805) (1045 aa) fasta scores: E(): 2.8e-32, 29.08% id in 1193 aa, and to Pseudomonas fluorescens serine protease homologue PspB SWALL:Q9ZNI5 (EMBL:AB015053) (1036 aa) fasta scores: E(): 8.4e-71, 36.9% id in 1176 aa. Autotransporter protein
YP_110972.1	Similar to Escherichia coli periplasmic dipeptide transport protein precursor DppA SWALL:DPPA_ECOLI (SWALL:P23847) (535 aa) fasta scores: E(): 3.4e-17, 26.19% id in 542 aa, and to Agrobacterium tumefaciens ABC transporter substrate binding protein ATU4431 or AGR_L_873 SWALL:Q8U7L8 (EMBL:AE009372) (545 aa) fasta scores: E(): 6.3e-65, 51.02% id in 535 aa. Similar to BPSS0954, 72.744% identity (73.019% ungapped) in 532 aa overlap
YP_110973.1	C-terminal region is similar to Bacillus subtilis oxalate decarboxylase OxdD SWALL:OXDD_BACSU (SWALL:O34767) (392 aa) fasta scores: E(): 3.5e-70, 51.09% id in 366 aa. Full legth CDS is similar to Agrobacterium tumefaciens oxalate decarboxylase ATU4771 or AGR_L_224 SWALL:Q8U6N6 (EMBL:AE009405) (415 aa) fasta scores: E(): 1e-106, 63.15% id in 418 aa
YP_110974.1	Similar to Escherichia coli manganese transport protein MntH SWALL:MNTH_ECOLI (SWALL:P77145) (412 aa) fasta scores: E(): 3.1e-65, 48.08% id in 391 aa, and to Deinococcus radiodurans probable manganese transport protein dr1709 SWALL:MNTH_DEIRA (SWALL:Q9RTP8) (436 aa) fasta scores: E(): 9.4e-74, 51.75% id in 398 aa
YP_110975.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein rsc0141 or rs01011 SWALL:Q8Y340 (EMBL:AL646057) (166 aa) fasta scores: E(): 9.8e-31, 70.31% id in 128 aa, and to Xanthomonas campestris membrane protein xcc3812 SWALL:AAM43486 (EMBL:AE012502) (144 aa) fasta scores: E(): 1.6e-30, 77.5% id in 120 aa
YP_110976.1	Similar to Ralstonia solanacearum hypothetical protein rsc3414 or rs01793 SWALL:YY14_RALSO (SWALL:Q8XTY1) (306 aa) fasta scores: E(): 1.1e-50, 48.66% id in 300 aa, and to Salmonella typhi hypothetical protein sty1534 SWALL:YNEE_SALTI (SWALL:Q8Z706) (315 aa) fasta scores: E(): 3e-39, 43.1% id in 290 aa
YP_110977.1	Similar to Ralstonia solanacearum  formate dehydrogenase oxidoreductase rsp1048 or rs06130 SWALL:Q8XR20 (EMBL:AL646082) (779 aa) fasta scores: E(): 9e-208, 65.21% id in 756 aa, and to Ralstonia solanacearum formate dehydrogenase oxidoreductase rsp0070 or rs06105 SWALL:Q8XTN6 (EMBL:AL646076) (764 aa) fasta scores: E(): 4e-206, 64.81% id in 756 aa
YP_110978.1	Similar to Pseudomonas aeruginosa hypothetical protein pa4132 SWALL:Q9HWP9 (EMBL:AE004829) (471 aa) fasta scores: E(): 2.7e-88, 51.82% id in 467 aa, and to Yersinia pestis similar to tyrosine aminotransferase ypo1960 SWALL:Q9ZC65 (EMBL:AL031866) (473 aa) fasta scores: E(): 7.2e-72, 42.45% id in 464 aa
YP_110980.1	Similar to Chlorobium tepidum hypothetical protein ct1745 SWALL:AAM72967 (EMBL:AE012928) (267 aa) fasta scores: E(): 1.1e-17, 33.85% id in 254 aa, and to Chlorobium tepidum hypothetical protein ct0395 SWALL:AAM71641 (EMBL:AE012816) (265 aa) fasta scores: E(): 1.3e-17, 38.72% id in 266 aa
YP_110981.1	Similar to Salmonella typhimurium Mg(2+) transport ATPase, P-type 2 MgtB SWALL:ATMB_SALTY (SWALL:P22036) (908 aa) fasta scores: E(): 1e-166, 60.02% id in 908 aa, and to Pseudomonas aeruginosa Mg(2+) transport ATPase, P-type 2 pa4825 SWALL:Q9HUY5 (EMBL:AE004895) (903 aa) fasta scores: E(): 5e-181, 64.78% id in 903 aa
YP_110982.1	No significant database matches to the full length CDS. C-teminal region is similar to an internal region of Bacteroides nodosus extracellular basic protease precursor BprV or Bpr SWALL:BPRV_BACNO (SWALL:P42779) (603 aa) fasta scores: E(): 8.9e-41, 39.94% id in 393 aa. C-terminal region is similar to Burkholderia pseudomallei serine metalloprotease precursor SWALL:Q9F881 (EMBL:AF254803) (500 aa) fasta scores: E(): 1.6e-71, 52.4% id in 500 aa. C-terminal region is similar to BPSS1993, 52.400% identity (54.132% ungapped) in 500 aa overlap
YP_110983.1	Similar to Pantoea citrea 2-keto-gluconate dehydrogenase subunit KdgA SWALL:Q9XCR1 (EMBL:AF131202) (189 aa) fasta scores: E(): 0.025, 31.28% id in 163 aa, and to Ralstonia solanacearum  transmembrane dehydrogenase rsc0770 or rs05084 SWALL:Q8Y1C0 (EMBL:AL646061) (163 aa) fasta scores: E(): 2.1e-31, 59.39% id in 165 aa
YP_110984.1	Similar to Pantoea citrea 2-keto-gluconate dehydrogenase subunit KdgB SWALL:Q9XCR0 (EMBL:AF131202) (553 aa) fasta scores: E(): 1.5e-89, 45.23% id in 535 aa, and to Ralstonia solanacearum  transmembrane dehydrogenase rsc0771 or rs05083 SWALL:Q8Y1B9 (EMBL:AL646061) (539 aa) fasta scores: E(): 4.7e-179, 83.48% id in 539 aa
YP_110985.1	Similar to Pantoea agglomerans cytochrome c subunit II SWALL:Q9RH53 (EMBL:AF068066) (470 aa) fasta scores: E(): 2.6e-64, 47.29% id in 425 aa, and to Ralstonia solanacearum  oxidoreductase dehydrogenase rsc0772 or rs05082 SWALL:Q8Y1B8 (EMBL:AL646061) (429 aa) fasta scores: E(): 1.9e-96, 62.91% id in 418 aa. Possible alternative translational start site
YP_110986.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc2500 or rs01095 SWALL:Q8XWH4 (EMBL:AL646070) (136 aa) fasta scores: E(): 3.6e-24, 53.54% id in 127 aa, and to Escherichia coli, and Shigella flexneri hypothetical protein YphA or sf2590 SWALL:YPHA_ECOLI (SWALL:P77751) (140 aa) fasta scores: E(): 3.1e-23, 51.96% id in 127 aa
YP_110987.1	Similar to Bordetella pertussis outer membrane porin protein precursor SWALL:OMP_BORPE (SWALL:Q04064) (385 aa) fasta scores: E(): 2.5e-11, 30.13% id in 365 aa, and to Ralstonia solanacearum probable porin signal peptide protein rsc2136 or rs01467 SWALL:Q8XXH8 (EMBL:AL646068) (352 aa) fasta scores: E(): 4.2e-38, 40.27% id in 370 aa
YP_110988.1	Similar to Clostridium acetobutylicum uncharacterized membrane protein cac0467 SWALL:Q97LT7 (EMBL:AE007561) (269 aa) fasta scores: E(): 9.4e-35, 38.49% id in 265 aa, and to Thermoanaerobacter tengcongensis hypothetical protein tte0750 SWALL:Q8RBR3 (EMBL:AE013042) (269 aa) fasta scores: E(): 1.2e-29, 35.84% id in 265 aa
YP_110989.1	Similar to Salmonella typhimurium, and Salmonella typhi histidine transport system permease HisQ SWALL:HISQ_SALTY (SWALL:P02913) (228 aa) fasta scores: E(): 1.5e-49, 62.44% id in 229 aa, and to Pseudomonas aeruginosa histidine transport system permease pa2924 SWALL:Q9HZS3 (EMBL:AE004718) (229 aa) fasta scores: E(): 2.1e-55, 67.69% id in 226 aa. Similar to BPSL1032, 76.856% identity (76.856% ungapped) in 229 aa overlap, and to BPSL2394, 77.293% identity (77.293% ungapped) in 229 aa overlap
YP_110990.1	Similar to Salmonella typhimurium, and Salmonella typhi histidine transport system permease HisM SWALL:HISM_SALTY (SWALL:P02912) (235 aa) fasta scores: E(): 1.3e-56, 61.63% id in 232 aa, and to Pseudomonas aeruginosa histidine transport system permease pa2925 SWALL:Q9HZS2 (EMBL:AE004718) (237 aa) fasta scores: E(): 1.1e-62, 64.97% id in 237 aa. Similar to BPSL1031, 74.153% identity (74.153% ungapped) in 236 aa overlap, and to BPSL2393, 67.511% identity (67.511% ungapped) in 237 aa overlap
YP_110991.1	Similar to Salmonella typhimurium histidine transport ATP-binding protein HisP SWALL:HISP_SALTY (SWALL:P02915) (258 aa) fasta scores: E(): 2.2e-61, 69.29% id in 254 aa, and to Pseudomonas aeruginosa histidine transport protein pa2926 SWALL:Q9HZS1 (EMBL:AE004718) (255 aa) fasta scores: E(): 6.5e-62, 71.37% id in 255 aa. Similar to BPSL2392, 78.656% identity (78.656% ungapped) in 253 aa overlap, and to BPSL1030, 78.125% identity (78.125% ungapped) in 256 aa overlap, and to BPSS1671, 51.460% identity (52.416% ungapped) in 274 aa overlap
YP_110992.1	Similar to Escherichia coli, and Shigella flexneri UDP-N-acetylglucosamine 1-carboxyvinyltransferase MurA or MurZ SWALL:MURA_ECOLI (SWALL:P28909) (419 aa) fasta scores: E(): 3.9e-30, 31.79% id in 434 aa, and to Borrelia burgdorferi UDP-N-acetylglucosamine 1-carboxyvinyltransferase bb0472 SWALL:MURA_BORBU (SWALL:O51428) (427 aa) fasta scores: E(): 9.1e-49, 33.95% id in 430 aa
YP_110993.1	Similar to Rhizobium loti hypothetical protein mlr0112 SWALL:Q98NJ4 (EMBL:AP002994) (132 aa) fasta scores: E(): 2.3e-13, 36.36% id in 132 aa, and to Rhizobium meliloti hypothetical protein r02006 or smc04177 SWALL:Q92K68 (EMBL:AL591789) (153 aa) fasta scores: E(): 1.4e-10, 32.72% id in 165 aa
YP_110994.1	Weakly similar to Anabaena sp. hypothetical protein all3462 SWALL:Q8YRI4 (EMBL:AP003593) (260 aa) fasta scores: E(): 2.3, 24.32% id in 259 aa
YP_110996.1	Possible alternative translational start site. Similar to Bradyrhizobium japonicum  inner membrane protein SpcT SWALL:Q9RH56 (EMBL:AF065159) (411 aa) fasta scores: E(): 1.2e-61, 51.97% id in 406 aa, and to Streptomyces spectabilis export protein SpcT SWALL:Q9L629 (EMBL:AF244574) (432 aa) fasta scores: E(): 3.2e-26, 31.02% id in 419 aa
YP_110997.1	Poor database matches. Similar to Ralstonia solanacearum probable transmembrane protein rsp1154 or rs05433 SWALL:Q8XQR7 (EMBL:AL646083) (164 aa) fasta scores: E(): 0.053, 30.3% id in 165 aa
YP_110998.1	Similar to Vibrio cholerae hypothetical protein vca0851 SWALL:Q9KL95 (EMBL:AE004413) (359 aa) fasta scores: E(): 5e-25, 34.92% id in 335 aa, and to an internal region of Ralstonia solanacearum  transmembrane sensor histidine kinase transcription regulator protein rsc1351 or rs02874 SWALL:Q8XZP4 (EMBL:AL646064) (414 aa) fasta scores: E(): 2.2e-29, 37% id in 354 aa
YP_110999.1	Similar to Pseudomonas aeruginosa catalase precursor KatB SWALL:CATB_PSEAE (SWALL:Q59635) (513 aa) fasta scores: E(): 7.5e-129, 65.6% id in 503 aa, and to Ralstonia solanacearum probable catalase hydroperoxidase HPII oxidoreductase rsp1581 or rs02137 SWALL:Q8XPQ7 (EMBL:AL646085) (509 aa) fasta scores: E(): 1.8e-155, 77.57% id in 504 aa
YP_111000.1	Similar to Synechocystis sp. hypothetical protein sll1526 SWALL:YF26_SYNY3 (SWALL:P74360) (506 aa) fasta scores: E(): 1.3e-39, 32.11% id in 439 aa, and to Caulobacter crescentus hypothetical protein cc3341 SWALL:Q9A365 (EMBL:AE005995) (528 aa) fasta scores: E(): 3.1e-27, 30.02% id in 473 aa. Possible alternative translational start site. CDS is truncated at the C-terminus in comparison to some similar proteins
YP_111001.1	Similar to Ralstonia solanacearum regulatory protein HrpB SWALL:HRPB_RALSO (SWALL:P31778) (477 aa) fasta scores: E(): 4.3e-42, 31.48% id in 486 aa, and to Burkholderia pseudomallei hypothetical protein SWALL:Q93L01 (EMBL:AF074878) (483 aa) fasta scores: E(): 5.7e-61, 39.47% id in 494 aa. CDS is extended at the C-terminus in comparison to orthologues
YP_111002.1	N-terminus is similar to the N-terinal region of Pseudomonas putida phthalate 4,5-dioxygenase oxygenase subunit Pht3 SWALL:PHT3_PSEPU (SWALL:Q05183) (439 aa) fasta scores: E(): 1.5e-10, 27.44% id in 317 aa. Similar to an internal region to Rhodococcus erythropolis terminal oxygenase KshA SWALL:AAL96829 (EMBL:AY083508) (398 aa) fasta scores: E(): 4.3e-27, 31.57% id in 342 aa
YP_111003.1	Similar to Streptomyces coelicolor hypothetical protein SCO0642 or SCF91.02c SWALL:Q9RJC2 (EMBL:AL939106) (581 aa) fasta scores: E(): 4.3e-111, 50.61% id in 569 aa, and to Rhizobium loti hypothetical protein mll8338 SWALL:Q983G4 (EMBL:AP003013) (559 aa) fasta scores: E(): 4.1e-93, 42.15% id in 548 aa
YP_111004.1	involved in polyketide production
YP_111005.1	Acyl carrier proteins are involved in the biosynthetic pathways of fatty acids, phospholipids, lipopolysaccharides, and oligosaccharides; this ACP may be involved in the biosynthesis of lipopeptide antibiotics
YP_111006.1	involved in polyketide production
YP_111007.1	involved in polyketide synthesis
YP_111008.1	Similar to Myxococcus xanthus ACP synthase (KAS III) homologue Tac SWALL:Q9XB06 (EMBL:AJ132503) (420 aa) fasta scores: E(): 8.3e-121, 67.78% id in 419 aa, and to Yersinia pestis  hydroxymethylglutaryl-coenzyme A synthase ypo1457 SWALL:Q8ZG58 (EMBL:AJ414148) (412 aa) fasta scores: E(): 2e-33, 32.78% id in 424 aa. Weakly similar to the N-terminal region of Gallus gallus cytoplasmic hydroxymethylglutaryl-CoA synthase HMGCS SWALL:HMCS_CHICK (SWALL:P23228) (522 aa) fasta scores: E(): 4.3e-05, 25.9% id in 471 aa
YP_111010.1	C-terminal region is similar to Escherichia coli malonyl CoA-acyl carrier protein transacylase FabD or TfpA SWALL:FABD_ECOLI (SWALL:P25715) (308 aa) fasta scores: E(): 1.2e-21, 35.4% id in 305 aa, and to Bacillus subtilis PksC protein SWALL:O34825 (EMBL:Z99112) (288 aa) fasta scores: E(): 3.7e-43, 51.38% id in 288 aa
YP_111011.1	Similar to Streptomyces lavendulae integral membrane ion antiporter SWALL:Q93N84 (EMBL:AF386507) (425 aa) fasta scores: E(): 2.2e-34, 34.35% id in 393 aa, and to Xanthomonas axonopodis Na+/H+-exchanging protein yjl094c or xac0254 SWALL:AAM35146 (EMBL:AE011650) (419 aa) fasta scores: E(): 5.8e-29, 32.62% id in 423 aa
YP_111012.1	C-terminal region is similar to the C-terminal regions of Bacillus subtilis  polyketide synthase PksL or PksX or PksA or OutG SWALL:PKSL_BACSU (SWALL:Q05470) (4427 aa) fasta scores: E(): 3.8e-88, 26.92% id in 4427 aa, and to Pseudomonas fluorescens MmpIV protein SWALL:Q8RL72 (EMBL:AF318063) (6521 aa) fasta scores: E(): 1.7e-78, 28.45% id in 4608 aa
YP_111013.1	Internal region is similar to the C-terminal region of Bacillus subtilis  polyketide synthase PksL or PksX or PksA or OutG SWALL:PKSL_BACSU (SWALL:Q05470) (4427 aa) fasta scores: E(): 5.7e-96, 33.1% id in 4951 aa, and to the N-terminal region of Streptomyces natalensis polyketide synthase PimS1 SWALL:Q9X993 (EMBL:AJ132222) (6797 aa) fasta scores: E(): 2.2e-79, 28.67% id in 5797 aa
YP_111014.1	N-terminal region is similar to the the N-terminal region of Bacillus subtilis  polyketide synthase PksK SWALL:PKSK_BACSU (SWALL:P40803) (4447 aa) fasta scores: E(): 1.1e-167, 38.79% id in 3439 aa. Internal region is similar to an internal region of Pseudomonas fluorescens MmpIV protein SWALL:Q8RL72 (EMBL:AF318063) (6521 aa) fasta scores: E(): 2.8e-41, 32.83% id in 4069 aa
YP_111015.1	C-terminal region is similar to an internal region of Bacillus subtilis  polyketide synthase Pksl or PksX or PksA or OutG SWALL:PKSL_BACSU (SWALL:Q05470) (4427 aa) fasta scores: E(): 3.4e-65, 39.49% id in 633 aa, and to Pseudomonas fluorescens MmpII protein SWALL:Q8RL74 (EMBL:AF318063) (2076 aa) fasta scores: E(): 6.5e-62, 38.92% id in 632 aa
YP_111016.1	Similar to Pseudomonas fluorescens halogenase PrnC SWALL:P95482 (EMBL:U74493) (567 aa) fasta scores: E(): 9.7e-91, 43.42% id in 555 aa, and to Burkholderia cepacia PrnC SWALL:Q9RPG5 (EMBL:AF161183) (566 aa) fasta scores: E(): 1.1e-89, 44.99% id in 549 aa
YP_111017.1	Similar to Streptomyces lipmanii puromycin resistance protein Pur8 SWALL:PUR8_STRLP (SWALL:P42670) (503 aa) fasta scores: E(): 8.1e-50, 39.73% id in 453 aa, and to Nocardia aerocolonigenes  antibiotic antiporter RbmK or RebI SWALL:CAC93723 (EMBL:AF534707) (473 aa) fasta scores: E(): 1.6e-57, 43.76% id in 473 aa, and to Streptomyces coelicolor  transmembrane transport protein sco2309 or scc30.17C SWALL:Q9L004 (EMBL:AL939112) (489 aa) fasta scores: E(): 5.5e-55, 41.22% id in 473 aa, and to Streptomyces roseofulvus  antibiotic antiporter FrnF SWALL:O68912 (EMBL:AF058302) (517 aa) fasta scores: E(): 7.4e-55, 42.15% id in 465 aa
YP_111018.1	Similar to Salmonella typhimurium voltage-gated clc-type chloride channel EriC or stm0203 SWALL:ERIC_SALTY (SWALL:Q8ZRP8) (473 aa) fasta scores: E(): 1.3e-18, 27.84% id in 431 aa, and to Ralstonia solanacearum probable transmembrane protein rsc2431 or rs02676 SWALL:Q8XWP2 (EMBL:AL646070) (599 aa) fasta scores: E(): 4.4e-131, 68.8% id in 625 aa, and to Rhizobium loti chloride channel protein mll1477 SWALL:Q98KH1 (EMBL:AP002997) (612 aa) fasta scores: E(): 7.8e-90, 54.41% id in 487 aa
YP_111019.1	Similar to Ralstonia solanacearum  transcription regulator protein rsc2430 or rs02662 SWALL:Q8XWP3 (EMBL:AL646070) (139 aa) fasta scores: E(): 4.6e-30, 63.7% id in 135 aa, and to Rhizobium loti probable transcriptional regulator mlr1478 SWALL:Q98KH0 (EMBL:AP002997) (148 aa) fasta scores: E(): 1.6e-13, 44.8% id in 125 aa
YP_111020.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0130 or rs01000 SWALL:Q8Y351 (EMBL:AL646057) (378 aa) fasta scores: E(): 7.7e-62, 58.61% id in 389 aa, and to Agrobacterium tumefaciens hypothetical protein atu1509 or agr_c_2783 SWALL:Q8UF90 (EMBL:AE009110) (382 aa) fasta scores: E(): 3.5e-50, 45.23% id in 378 aa, and to Pseudomonas stutzeri Orf378 protein SWALL:P95554 (EMBL:Z73914) (378 aa) fasta scores: E(): 1.5e-40, 40.21% id in 378 aa
YP_111021.1	Similar to Pseudomonas putida transcriptional regulator, lysR family pp1262 SWALL:AAN66886 (EMBL:AE016778) (315 aa) fasta scores: E(): 7e-57, 51.29% id in 308 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa3895 SWALL:Q9HXB8 (EMBL:AE004807) (317 aa) fasta scores: E(): 7.8e-56, 49.68% id in 316 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa0876 SWALL:Q9I569 (EMBL:AE004522) (314 aa) fasta scores: E(): 2.4e-52, 49.68% id in 314 aa
YP_111022.1	Similar to Escherichia coli calcium/proton antiporter ChaA or b1216 SWALL:CHAA_ECOLI (SWALL:P31801) (366 aa) fasta scores: E(): 3.3e-38, 37.89% id in 351 aa, and to Streptomyces coelicolor ionic transporter sco1962 or scc54.22C SWALL:Q9Z504 (EMBL:AL939110) (366 aa) fasta scores: E(): 1.7e-65, 57.26% id in 358 aa, and to Mycobacterium tuberculosis  ionic transporter ChaA or rv1607 or mtv046.05 or mt1642 SWALL:O53910 (EMBL:AL022001) (360 aa) fasta scores: E(): 2.8e-63, 56.33% id in 355 aa
YP_111023.1	Similar to Escherichia coli multiple antibiotic resistance protein MarC or b1529 SWALL:MARC_ECOLI (SWALL:P31123) (221 aa) fasta scores: E(): 2.5e-15, 29.03% id in 217 aa, and to Caulobacter crescentus hypothetical protein Cc1662 SWALL:Q9A7Q8 (EMBL:AE005841) (228 aa) fasta scores: E(): 4.7e-25, 39.33% id in 211 aa, and to Bordetella pertussis  multiple antibiotic resistance protein maR SWALL:Q9X6A6 (EMBL:AF135154) (132 aa) fasta scores: E(): 9.7e-18, 61.29% id in 93 aa; possible alternative start site at codon 42
YP_111024.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa5132 SWALL:Q9HU52 (EMBL:AE004926) (272 aa) fasta scores: E(): 3.3e-25, 43.01% id in 279 aa, and to Yersinia pestis  membrane protein ypo1140 SWALL:Q8ZGY1 (EMBL:AJ414146) (272 aa) fasta scores: E(): 1.1e-22, 38.48% id in 278 aa, and to Vibrio cholerae hypothetical protein Vc1074 SWALL:Q9KT31 (EMBL:AE004189) (276 aa) fasta scores: E(): 1.3e-22, 37.4% id in 278 aa. Possible alternative translational start.
YP_111025.1	Similar to Ralstonia sp. U2 fumarylpyruvate hydrolase nagK SWALL:O86042 (EMBL:AF036940) (192 aa) fasta scores: E(): 3.5e-23, 40.2% id in 194 aa, and to Rhizobium loti hypothetical protein Mlr1134 mlr1134 SWALL:Q98L86 (EMBL:AP002996) (232 aa) fasta scores: E(): 1.4e-57, 63.04% id in 230 aa, and to Ralstonia solanacearum hypothetical protein rsc0383 rsc0383 or rs03351 SWALL:Q8Y2F3 (EMBL:AL646059) (233 aa) fasta scores: E(): 1.2e-48, 55.6% id in 232 aa
YP_111026.1	Similar to Bacillus sp. GL1 protein Orf1 SWALL:Q9RC93 (EMBL:AB019619) (297 aa) fasta scores: E(): 8.1e-06, 27.88% id in 269 aa, to codon 279 and to Streptococcus pyogenes  two-component response regulator Spy1556 SWALL:Q99YT2 (EMBL:AE006588) (246 aa) fasta scores: E(): 4.3e-07, 40.2% id in 97 aa, from codon 209 to codon 301 and to Citrobacter freundii arabinose operon regulatory protein araC SWALL:ARAC_CITFR (SWALL:P11765) (281 aa) fasta scores: E(): 6.3e-07, 38.23% id in 102 aa from codon 194 to codon 296
YP_111027.1	Weakly similar to the N-terminal region Pseudomonas putida conserved hypothetical protein pp2172 SWALL:Q88KW7 (EMBL:AE016782) (147 aa) fasta scores: E(): 1.8, 53.48% id in 43 aa, and to Rhizobium meliloti hypothetical lipoprotein transmembrane r01981 or smc04335 SWALL:Q92K72 (EMBL:AL591789) (57 aa) fasta scores: E(): 7.1, 43.18% id in 44 aa
YP_111028.1	Similar to Rhizobium leguminosarum extracytoplasmic sigma factor EcfR SWALL:Q9X5V5 (EMBL:AF127795) (186 aa) fasta scores: E(): 2.1e-22, 48.64% id in 148 aa, and to Bradyrhizobium japonicum sigma factor EcfA SWALL:Q9EXR8 (EMBL:AJ304855) (172 aa) fasta scores: E(): 6.5e-22, 52.41% id in 166 aa, and to Rhizobium loti RNA polymerase sigma factor mlr0407 SWALL:Q98MW7 (EMBL:AP002994) (183 aa) fasta scores: E(): 3.6e-21, 45.86% id in 157 aa
YP_111029.1	Similar to Agrobacterium tumefaciens transcriptional regulator PrtR or atu1484 or agr_c_2736 SWALL:Q8UFB4 (EMBL:AE009107) (258 aa) fasta scores: E(): 7.5e-16, 34.83% id in 267 aa, and to Agrobacterium tumefaciens hypothetical protein atu2031 or agr_c_3680 SWALL:Q8UDT8 (EMBL:AE009154) (262 aa) fasta scores: E(): 2.3e-15, 32.53% id in 249 aa, and to Rhizobium loti hypothetical protein Mlr7774 SWALL:Q984Z9 (EMBL:AP003012) (263 aa) fasta scores: E(): 1e-14, 32.28% id in 254 aa
YP_111030.1	Similar to Caulobacter crescentus hypothetical protein Cc2609 SWALL:Q9A555 (EMBL:AE005928) (230 aa) fasta scores: E(): 9.1e-08, 34.61% id in 156 aa, and to Caulobacter crescentus hypothetical protein Cc3392 SWALL:Q9A314 (EMBL:AE005999) (213 aa) fasta scores: E(): 3.3e-06, 30.35% id in 168 aa, and to Streptomyces coelicolor hypothetical protein sco2566 or scc123.04C SWALL:Q9RDM0 (EMBL:AL939113) (293 aa) fasta scores: E(): 3.8e-06, 30.34% id in 145 aa
YP_111031.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc2984 or rs01242 SWALL:Q8XV47 (EMBL:AL646073) (148 aa) fasta scores: E(): 1.5e-18, 54.63% id in 97 aa, and to Pseudomonas aeruginosa hypothetical protein Pa5359 SWALL:Q9HTJ9 (EMBL:AE004947) (151 aa) fasta scores: E(): 5.5e-16, 45.76% id in 118 aa, and to Pseudomonas syringae pv. maculicola hypothetical 13.4 kDa protein SWALL:Q93TD7 (EMBL:AF359557) (126 aa) fasta scores: E(): 6.3e-16, 45.52% id in 123 aa
YP_111033.1	Similar to Escherichia coli probable RNA polymerase sigma factor FecI or b4293 SWALL:FECI_ECOLI (SWALL:P23484) (173 aa) fasta scores: E(): 1.2e-23, 47.33% id in 150 aa, and to Pseudomonas aeruginosa  RNA polymerase sigma factor pa3899 SWALL:Q9HXB4 (EMBL:AE004807) (169 aa) fasta scores: E(): 2.6e-33, 53.61% id in 166 aa, and to Pseudomonas aeruginosa  RNA polymerase sigma factor pa1912 SWALL:Q9I2J2 (EMBL:AE004617) (168 aa) fasta scores: E(): 1.3e-30, 53.98% id in 163 aa, and to Bordetella avium RhuI rhuI SWALL:AAM28266 (EMBL:AY095952) (168 aa) fasta scores: E(): 5.7e-27, 48.76% id in 162 aa
YP_111034.1	Similar to Escherichia coli protein iron uptake sensor regulator FecR or b4292 SWALL:FECR_ECOLI (SWALL:P23485) (317 aa) fasta scores: E(): 1.3e-25, 35.04% id in 311 aa, and to Pseudomonas aeruginosa probable transmembrane sensor pa2467 SWALL:Q9I115 (EMBL:AE004674) (328 aa) fasta scores: E(): 8.7e-42, 44.09% id in 322 aa
YP_111035.1	Similar to Pseudomonas putida ferric-pseudobactin bn7/bn8 receptor precursor PupB SWALL:PUPB_PSEPU (SWALL:P38047) (809 aa) fasta scores: E(): 1e-32, 26.81% id in 839 aa, and to Pseudomonas aeruginosa probable tonB-dependent receptor pa0151 SWALL:Q9I6Y1 (EMBL:AE004453) (795 aa) fasta scores: E(): 1e-155, 56.5% id in 807 aa, from codon 140 to 822 and to Yersinia pestis hydroxamate-type ferrisiderophore receptor ypo0956 SWALL:Q8ZHE4 (EMBL:AJ414145) (699 aa) fasta scores: E(): 7.2e-110, 45.76% id in 684 aa, and to Escherichia coli O157:H7  iron compound receptor z4386 or ecs3917 SWALL:Q8XBQ5 (EMBL:AE005533) (713 aa) fasta scores: E(): 6.6e-96, 42.67% id in 703 aa, from codon 124 to 822
YP_111036.1	Similar to Bacillus subtilis ribose transport system permease RbsC SWALL:RBSC_BACSU (SWALL:P36948) (322 aa) fasta scores: E(): 1.8e-18, 30.46% id in 302 aa, and to Bacillus halodurans ribose ABC transporter RbsC or bh3731 SWALL:Q9K6J8 (EMBL:AP001519) (314 aa) fasta scores: E(): 1e-20, 30.54% id in 311 aa, and to Thermotoga maritima ribose ABC transporter permease tm0955 SWALL:Q9X050 (EMBL:AE001758) (331 aa) fasta scores: E(): 1.6e-20, 33.02% id in 321 aa
YP_111037.1	Similar to Bacillus subtilis ribose transport system permease RbsC SWALL:RBSC_BACSU (SWALL:P36948) (322 aa) fasta scores: E(): 5.2e-23, 35.23% id in 315 aa, and to Rhizobium loti permease of ribose ABC transporter mll2145 SWALL:Q98J21 (EMBL:AP002999) (338 aa) fasta scores: E(): 1e-22, 33.83% id in 334 aa, and to Streptomyces coelicolor bifunctional carbohydrate binding and transport protein sco2747 or scc57a.18 SWALL:Q9RDI0 (EMBL:AL939113) (651 aa) fasta scores: E(): 1.1e-21, 35.54% id in 332 aa; possible alternative start site at codon 30
YP_111038.1	Similar to Bacillus subtilis ribose transport ATP-binding protein RbsA SWALL:RBSA_BACSU (SWALL:P36947) (493 aa) fasta scores: E(): 7.5e-23, 35.76% id in 548 aa, and to Thermotoga maritima sugar ABC transporter ATP-binding protein tm0115 SWALL:Q9WXX0 (EMBL:AE001697) (520 aa) fasta scores: E(): 2.2e-22, 35.59% id in 545 aa, and to Rhizobium meliloti  ATP-binding ABC transporter protein r02565 or smc02337 SWALL:Q92MP8 (EMBL:AL591791) (501 aa) fasta scores: E(): 2.4e-22, 38.63% id in 541 aa
YP_111039.1	Similar to Bacillus subtilis D-ribose-binding protein precursor RbsB SWALL:RBSB_BACSU (SWALL:P36949) (305 aa) fasta scores: E(): 2e-08, 24.02% id in 308 aa, and to Pseudomonas putida sugar-binding protein,  pp2757 SWALL:AAN68365 (EMBL:AE016784) (323 aa) fasta scores: E(): 3.6e-61, 57.14% id in 322 aa, and to Pseudomonas putida ribose ABC transporter periplasmic ribose-binding protein, pp2758 SWALL:AAN68366 (EMBL:AE016784) (342 aa) fasta scores: E(): 2.3e-60, 57.79% id in 308 aa, and to Yersinia pestis  ABC transporter binding protein y2651 SWALL:AAM86204 (EMBL:AE013867) (363 aa) fasta scores: E(): 7.6e-14, 29.03% id in 341 aa
YP_111040.1	Similar to Rhizobium loti hypothetical protein Mll1752 SWALL:Q98JW1 (EMBL:AP002998) (178 aa) fasta scores: E(): 2.7e-22, 42.44% id in 172 aa, and to Rhizobium loti nickel-cobalt-cadmium resistance protein mlr6490 SWALL:Q989C1 (EMBL:AP003009) (176 aa) fasta scores: E(): 3e-06, 30.95% id in 168 aa, and to Sulfolobus tokodaii hypothetical protein St1187 SWALL:Q972E1 (EMBL:AP000985) (199 aa) fasta scores: E(): 7.1e-06, 29.65% id in 145 aa
YP_111042.1	Similar to Paenibacillus sp. A11-2 thermophilic dibenzothiophene desulfurization enzyme C TdsC SWALL:Q9LBX2 (EMBL:AB033997) (414 aa) fasta scores: E(): 1.1e-11, 29.11% id in 419 aa, and to Pseudomonas aeruginosa hypothetical protein Pa2324 SWALL:Q9I1F4 (EMBL:AE004658) (419 aa) fasta scores: E(): 3.5e-105, 68.21% id in 409 aa, and to Xanthomonas axonopodis hypothetical protein Xac0854 SWALL:AAM35742 (EMBL:AE011717) (434 aa) fasta scores: E(): 3.7e-64, 48.41% id in 411 aa
YP_111043.1	Similar to Bacillus subtilis arabinose-proton symporter AraE SWALL:ARAE_BACSU (SWALL:P96710) (464 aa) fasta scores: E(): 7.5e-19, 26.56% id in 463 aa, and to Thermoplasma acidophilum sugar transport protein related protein ta0775 SWALL:Q9HK33 (EMBL:AL445065) (474 aa) fasta scores: E(): 5e-25, 28.31% id in 452 aa, and to Sulfolobus solfataricus metabolite transport protein,  sso3120 SWALL:Q97U99 (EMBL:AE006902) (483 aa) fasta scores: E(): 1e-24, 30.04% id in 406 aa
YP_111045.1	Almost identical to Burkholderia pseudomallei sensor protein IrlS SWALL:IRLS_BURPS (SWALL:O31396) (464 aa) fasta scores: E(): 6.7e-167, 99.56% id in 464 aa. Similar to and to Ralstonia solanacearum probable transmembrane sensory transduction histidine kinase for cobalt-zinc-cadmium resistance transcription regulator protein CzcS or rsp0488 or rs00366 SWALL:Q8XSI6 (EMBL:AL646079) (465 aa) fasta scores: E(): 6.8e-48, 38.17% id in 461 aa, and to Pseudomonas fluorescens CztS SWALL:Q9ALR1 (EMBL:AY007258) (478 aa) fasta scores: E(): 4.5e-42, 34.64% id in 456 aa. Probably activates partner IrlR by phosphorylation
YP_111046.1	Almost identical to the previously sequenced Burkholderia pseudomallei transcriptional activator protein IrlR SWALL:IRLR_BURPS (SWALL:O31395) (229 aa) fasta scores: E(): 1.2e-90, 99.56% id in 229 aa. Probably activated following phosphorylation by IrlS. Similar to Ralstonia solanacearum probable response regulator for cobalt zinc cadmium resistance transcription regulator protein CzcR or rsp0489 or rs00367 SWALL:Q8XSI5 (EMBL:AL646079) (224 aa) fasta scores: E(): 2.8e-58, 67.72% id in 220 aa, and to Pseudomonas aeruginosa two-component response regulator IrlR or pa4885 SWALL:Q9HUS8 (EMBL:AE004901) (229 aa) fasta scores: E(): 7.1e-58, 63.06% id in 222 aa
YP_111047.1	Similar to Alcaligenes sp. cation efflux system protein CzcA SWALL:CZCA_ALCSP (SWALL:P94177) (1063 aa) fasta scores: E(): 0, 73.37% id in 1044 aa, and to Alcaligenes eutrophus cobalt-zinc-cadmium resistance protein CzcA SWALL:CZCA_ALCEU (SWALL:P13511) (1063 aa) fasta scores: E(): 0, 73.08% id in 1044 aa, and to Ralstonia solanacearum probable cation efflux system transmembrane protein CzcA or rsp0493 or rs00371 SWALL:Q8XSI1 (EMBL:AL646079) (1064 aa) fasta scores: E(): 0, 72.42% id in 1059 aa, and to Pseudomonas fluorescens CztA SWALL:Q9ALR2 (EMBL:AY007258) (1051 aa) fasta scores: E(): 0, 70.97% id in 1044 aa
YP_111048.1	Similar to Alcaligenes eutrophus cobalt-zinc-cadmium resistance protein CzcB SWALL:CZCB_ALCEU (SWALL:P13510) (520 aa) fasta scores: E(): 3.3e-73, 53.04% id in 443 aa, and to Alcaligenes sp. cation efflux system protein CzcB SWALL:CZCB_ALCSP (SWALL:P94176) (520 aa) fasta scores: E(): 1e-72, 52.59% id in 443 aa, and to Pseudomonas aeruginosa RND divalent metal cation efflux membrane fusion protein czcb precursor czcb or pa2521 SWALL:Q9I0W1 (EMBL:AE004679) (484 aa) fasta scores: E(): 1.1e-62, 45.3% id in 490 aa, and to Ralstonia solanacearum probable cobalt-zinc-cadmium resistance CzcB or rsp0492 or rs00370 SWALL:Q8XSI2 (EMBL:AL646079) (404 aa) fasta scores: E(): 1.9e-56, 50.62% id in 403 aa
YP_111049.1	Similar to Alcaligenes eutrophus cobalt-zinc-cadmium resistance protein CzcC precursor SWALL:CZCC_ALCEU (SWALL:P13509) (417 aa) fasta scores: E(): 4.7e-34, 39.75% id in 415 aa, and to Alcaligenes sp CzcC SWALL:P94175 (EMBL:D67044) (417 aa) fasta scores: E(): 1.5e-37, 41.3% id in 414 aa, and to Ralstonia solanacearum probable cobalt-zinc-cadmium outer membrane resistance protein CzcC or rsp0491 or rs00369 SWALL:Q8XSI3 (EMBL:AL646079) (441 aa) fasta scores: E(): 4.3e-36, 42.92% id in 424 aa
YP_111050.1	Similar to Bacteriophage phiE125 gp48 SWALL:Q8W6Q2 (EMBL:AF447491) (43 aa) fasta scores: E(): 1.1e-05, 58.69% id in 46 aa
YP_111051.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0419 or rs03387 SWALL:Q8Y2B7 (EMBL:AL646059) (161 aa) fasta scores: E(): 2.1e-48, 75.62% id in 160 aa, and to Mycobacterium tuberculosis hypothetical protein rv3735 rv3735 or mt3840 or mtv025.083 SWALL:O69702 (EMBL:AL022121) (165 aa) fasta scores: E(): 2.2e-40, 64.51% id in 155 aa, and to Sulfolobus tokodaii hypothetical protein St1511 st1511 SWALL:Q970U0 (EMBL:AP000986) (162 aa) fasta scores: E(): 1.4e-33, 55.48% id in 155 aa
YP_111052.1	Similar to Ralstonia solanacearum hypothetical protein rsc2911 or rs00184 SWALL:Q8XVC0 (EMBL:AL646072) (162 aa) fasta scores: E(): 1.3e-38, 63.35% id in 161 aa, and to Rhizobium meliloti hypothetical protein r00461 or smc01705 SWALL:Q92SE2 (EMBL:AL591783) (156 aa) fasta scores: E(): 4.5e-22, 44.8% id in 154 aa, and to Rhizobium loti hypothetical protein Mlr1045 SWALL:Q98LF3 (EMBL:AP002996) (157 aa) fasta scores: E(): 6.8e-20, 38.71% id in 155 aa, and to Chlorobium tepidum hypothetical protein Ct1883 SWALL:AAM73102 (EMBL:AE012939) (155 aa) fasta scores: E(): 9.8e-11, 32.85% id in 140 aa
YP_111053.1	Limited similarity to Neisseria meningitidis hypothetical 13.0 kDa protein SWALL:Q9F403 (EMBL:AJ277475) (109 aa) fasta scores: E(): 0.0091, 32.46% id in 77 aa
YP_111063.1	Similar to Bacteriophage HP1 Replication protein Rep SWALL:REP_BPHP1 (SWALL:P51711) (775 aa) fasta scores: E(): 3.1e-41, 34.84% id in 442 aa, and to Haemophilus phage HP2 Rep SWALL:Q94N00 (EMBL:AY027935) (775 aa) fasta scores: E(): 3.1e-41, 34.68% id in 444 aa, and to Bacteriophage 186 replication gene A protein or cp87 SWALL:VPA_BP186 (SWALL:P41064) (694 aa) fasta scores: E(): 2e-39, 37.24% id in 443 aa
YP_111064.1	Limited similarity to Bacteriophage phi CTX orf34 SWALL:Q9ZXJ1 (EMBL:AB008550) (97 aa) fasta scores: E(): 0.0061, 30% id in 70 aa, and to Ralstonia solanacearum transcriptional activator transcription regulator protein rsc1904 or rs03470 SWALL:Q8XY59 (EMBL:AL646067) (82 aa) fasta scores: E(): 0.0072, 28.91% id in 83 aa
YP_111065.1	Limited similarity to Ralstonia solanacearum bacteriophage transcriptional activator-related transcription regulator protein rsc0964 or rs04403 SWALL:Q8Y0S9 (EMBL:AL646062) (73 aa) fasta scores: E(): 0.0084, 36.17% id in 47 aa, and to Ralstonia solanacearum transcriptional activator transcription regulator protein rsc1904 or rs03470 SWALL:Q8XY59 (EMBL:AL646067) (82 aa) fasta scores: E(): 0.096, 40% id in 50 aa
YP_111066.1	Similar to Mycobacterium celatum ParA-like protein SWALL:Q9XCD0 (EMBL:AF312688) (214 aa) fasta scores: E(): 1.1e-14, 35.6% id in 191 aa, and to Pseudomonas syringae Partition protein Par SWALL:Q9RBZ4 (EMBL:AF169828) (227 aa) fasta scores: E(): 2.1e-29, 47.34% id in 207 aa, and to Aquifex aeolicus hypothetical protein Aa35 aa35 SWALL:O66424 (EMBL:AE000667) (213 aa) fasta scores: E(): 3.3e-18, 37.85% id in 214 aa
YP_111068.1	Similar to the bacteriophage phiE125 gp29 SWALL:Q8W6S2 (EMBL:AF447491) (186 aa) fasta scores: E(): 1.2e-45, 72.83% id in 173 aa, and to Burkholderia thailandensis gp29 SWALL:Q8VP97 (EMBL:AY063741) (186 aa) fasta scores: E(): 1.2e-45, 72.83% id in 173 aa
YP_111069.1	Similar to Burkholderia thailandensis gp30 SWALL:Q8VP96 (EMBL:AY063741) (244 aa) fasta scores: E(): 3e-31, 43.72% id in 247 aa, and to Bacteriophage phiE125 gp30 SWALL:Q8W6S1 (EMBL:AF447491) (244 aa) fasta scores: E(): 3e-31, 43.72% id in 247 aa
YP_111070.1	Similar to Burkholderia thailandensis gp31 SWALL:Q8VP95 (EMBL:AY063741) (363 aa) fasta scores: E(): 9.6e-34, 37.96% id in 374 aa, and to Bacteriophage phiE125 gp31 SWALL:Q8W6S0 (EMBL:AF447491) (363 aa) fasta scores: E(): 9.6e-34, 37.96% id in 374 aa, and to Pseudomonas aeruginosa hypothetical protein pa0821 SWALL:Q9I5B8 (EMBL:AE004517) (362 aa) fasta scores: E(): 3.1e-20, 34.35% id in 326 aa
YP_111071.1	Similar to Xylella fastidiosa hypothetical protein Xf1703 SWALL:Q9PCS5 (EMBL:AE003994) (102 aa) fasta scores: E(): 2.6e-15, 44.89% id in 98 aa, and to Haemophilus influenzae hypothetical protein Hi1419 SWALL:YE19_HAEIN (SWALL:P44190) (99 aa) fasta scores: E(): 9.1e-15, 48.93% id in 94 aa, and to Anabaena sp. hypothetical protein All2402 SWALL:Q8YUE8 (EMBL:AP003589) (112 aa) fasta scores: E(): 3.4e-13, 52.43% id in 82 aa
YP_111072.1	Similar to Xylella fastidiosa hypothetical protein Xf2763 SWALL:Q9P9V8 (EMBL:AE004082) (102 aa) fasta scores: E(): 7.8e-11, 43.61% id in 94 aa, and to Ralstonia solanacearum hypothetical protein rsp0076 or rs05545 SWALL:Q8XTN0 (EMBL:AL646076) (99 aa) fasta scores: E(): 1.3e-10, 46.93% id in 98 aa, and to Haemophilus influenzae hypothetical protein Hi1420 SWALL:YE20_HAEIN (SWALL:P44191) (97 aa) fasta scores: E(): 3.3e-09, 45.45% id in 88 aa
YP_111073.1	Similar to Ralstonia solanacearum probable bacteriophage protein rsc1941 or rs03510 SWALL:Q8XY22 (EMBL:AL646067) (361 aa) fasta scores: E(): 3.6e-90, 62.07% id in 356 aa, and to Xanthomonas campestris phage-related capsid packaging protein Q or xcc2969 SWALL:AAM42241 (EMBL:AE012411) (343 aa) fasta scores: E(): 2.7e-84, 59.4% id in 335 aa, and to Salmonella typhi probable capsid portal protein sty4628 SWALL:Q8Z1E6 (EMBL:AL627283) (348 aa) fasta scores: E(): 2.6e-83, 62.06% id in 319 aa
YP_111074.1	Similar to Bacteriophage P2 terminase, ATPase subunit P SWALL:VPP_BPP2 (SWALL:P25479) (590 aa) fasta scores: E(): 5.2e-136, 56.32% id in 593 aa, and to Bacteriophage phi CTX Pseudomonas aeruginosa phage phi ctx SWALL:Q9ZXM5 (EMBL:AB008550) (594 aa) fasta scores: E(): 7.1e-160, 67.37% id in 564 aa, and to Xanthomonas campestris phage-related terminase P or xcc2970 SWALL:AAM42242 (EMBL:AE012411) (594 aa) fasta scores: E(): 1.3e-152, 62.52% id in 579 aa, and to Xanthomonas axonopodis phage-related terminase P or xac2642 SWALL:AAM37489 (EMBL:AE011904) (594 aa) fasta scores: E(): 5e-152, 62.69% id in 579 aa; alternative start site at codon 13
YP_111075.1	Similar to Bacteriophage phi CTX Pseudomonas aeruginosa phage phi ctx SWALL:Q9ZXM4 (EMBL:AB008550) (273 aa) fasta scores: E(): 7.2e-31, 45.07% id in 284 aa, and to Salmonella typhi  capsid scaffolding protein sty3676 SWALL:Q8Z357 (EMBL:AL627279) (277 aa) fasta scores: E(): 6.3e-30, 46.15% id in 286 aa, and to Ralstonia solanacearum probable bacteriophage protein rsc1938 or rs03507 SWALL:Q8XY25 (EMBL:AL646067) (279 aa) fasta scores: E(): 6.3e-30, 48.45% id in 291 aa
YP_111076.1	Similar to Bacteriophage P2 major capsid protein precursor N SWALL:VPN_BPP2 (SWALL:P25477) (357 aa) fasta scores: E(): 5.6e-72, 54.97% id in 342 aa, and to Bacteriophage phi CTX Pseudomonas aeruginosa phage phi ctx SWALL:Q9ZXM3 (EMBL:AB008550) (338 aa) fasta scores: E(): 1.7e-81, 64.2% id in 338 aa, and to Ralstonia solanacearum probable bacteriophage protein rsc1937 or rs03506 SWALL:Q8XY26 (EMBL:AL646067) (338 aa) fasta scores: E(): 2.6e-81, 62.9% id in 337 aa
YP_111077.1	Similar to Bacteriophage P2 terminase, endonuclease subunit M SWALL:VPM_BPP2 (SWALL:P25476) (247 aa) fasta scores: E(): 1.8e-27, 46.29% id in 216 aa, and to Ralstonia solanacearum probable bacteriophage protein rsc1936 or rs03505 SWALL:Q8XY27 (EMBL:AL646067) (240 aa) fasta scores: E(): 4.1e-30, 49.16% id in 238 aa, and to Bacteriophage phi CTX Pseudomonas aeruginosa phage phi ctx SWALL:Q9ZXM2 (EMBL:AB008550) (233 aa) fasta scores: E(): 3.8e-29, 48.9% id in 229 aa, and to Bacteriophage 186 protein R SWALL:O80305 (EMBL:U32222) (249 aa) fasta scores: E(): 1.2e-28, 48% id in 225 aa
YP_111078.1	Similar to Bacteriophage P2 head completion/stabilization protein L SWALL:VPL_BPP2 (SWALL:P25475) (169 aa) fasta scores: E(): 2.5e-15, 42.25% id in 142 aa, and to Ralstonia solanacearum probable bacteriophage protein rsc1935 or rs03504 SWALL:Q8XY28 (EMBL:AL646067) (159 aa) fasta scores: E(): 2.3e-26, 55.34% id in 159 aa, and to Xanthomonas campestris phage-related capsid completion protein l or xcc2974 SWALL:AAM42246 (EMBL:AE012412) (155 aa) fasta scores: E(): 1.4e-20, 47.79% id in 159 aa
YP_111080.1	Similar to Bacteriophage P2 tail protein X SWALL:VPX_BPP2 (SWALL:P51772) (67 aa) fasta scores: E(): 2.4e-11, 69.81% id in 53 aa, and to Xanthomonas axonopodis phage-related tail protein X or xac2647 or xcc2975 SWALL:AAM42247 (EMBL:AE011905) (69 aa) fasta scores: E(): 3.6e-13, 59.42% id in 69 aa, and to Xanthomonas axonopodis phage-related tail protein X or xac2647 or xcc2975 SWALL:AAM37494 (EMBL:AE011905) (69 aa) fasta scores: E(): 3.6e-13, 59.42% id in 69 aa
YP_111081.1	Similar to Xanthomonas campestris phage-related protein orf89 or xcc2976 SWALL:AAM42248(118 aa) (EMBL:AE012412)(118 aa) fasta scores: E(): 1.6e-15, 51.75% id in 114 aa,and to Xanthomonas axonopodis phage-related protein orf89 or xac2648 SWALL:AAM37495 (EMBL:AE011905) (118 aa) fasta scores: E(): 2.5e-15, 50.87% id in 114 aa, and to Pseudomonas aeruginosa hypothetical protein Pa0908 pa0908 SWALL:Q9I549 (EMBL:AE004525) (124 aa) fasta scores: E():/ 1.3e-09, 39.28% id in 112 aa
YP_111082.1	Similar to Xanthomonas axonopodis phage-related protein orf90 or xac2649 or xcc2977 SWALL:AAM37496 (EMBL:AE011905) (91 aa) fasta scores: E(): 4.7e-10, 41.75% id in 91 aa, and to Xanthomonas axonopodis phage-related protein orf90 or xac2649 or xcc2977 SWALL:AAM42249 (EMBL:AE011905) (91 aa) fasta scores: E(): 4.7e-10, 41.75% id in 91 aa, and to Bacteriophage phi CTX orf10 SWALL:Q9ZXL7 (EMBL:AB008550) (90 aa) fasta scores: E(): 2.9e-06, 37.5% id in 80 aa
YP_111083.1	Similar to Ralstonia solanacearum  phage-related protein rsc1931 or rs03500 SWALL:Q8XY32 (EMBL:AL646067) (268 aa) fasta scores: E(): 6.8e-50, 56.77% id in 273 aa, and to Bacteriophage phi CTX orf11 SWALL:Q9ZXL6 (EMBL:AB008550) (268 aa) fasta scores: E(): 1e-44, 50.92% id in 269 aa, and to Brucella melitensis hypothetical protein Bmeii0008 bmeii0008 SWALL:Q8YE10 (EMBL:AE009639) (174 aa) fasta scores: E(): 2.4e-09, 32.72% id in 165 aa
YP_111084.1	Limited similarity to Bacteriophage P2 protein LysB SWALL:LYSB_BPP2 (SWALL:P51770) (141 aa) fasta scores: E(): 0.00062, 29.92% id in 127 aa, and to Bacteriophage phi CTX orf12 SWALL:Q9ZXL5 (EMBL:AB008550) (153 aa) fasta scores: E(): 0.0018, 31.65% id in 139 aa, and to Bacteriophage 186 orf27 SWALL:O80310 (EMBL:U32222) (137 aa) fasta scores: E(): 0.0018, 32.14% id in 112 aa
YP_111085.1	Similar to Bacteriophage P2 LysC SWALL:Q8LTD0 (EMBL:AF063097) (96 aa) fasta scores: E(): 1.3e-09, 48.78% id in 82 aa, and to Bacteriophage WPhi LysC SWALL:Q7Y4E1 (EMBL:AY135739) (96 aa) fasta scores: E(): 3.2e-09, 48.78% id in 82 aa
YP_111086.1	Similar to Bacteriophage P2 tail completion protein R SWALL:VPR_BPP2 (SWALL:P36933) (155 aa) fasta scores: E(): 3.8e-13, 35.87% id in 131 aa, and to Ralstonia solanacearum probable tail completion-like protein rsc1929 or rs03499 SWALL:Q8XY34 (EMBL:AL646067) (144 aa) fasta scores: E(): 4.5e-19, 43.47% id in 138 aa, and to Bacteriophage phi CTX orf13 SWALL:Q9ZXL3 (EMBL:AB008550) (178 aa) fasta scores: E(): 1.2e-18, 41.22% id in 131 aa
YP_111087.1	Similar to Bacteriophage P2 tail completion proteinS SWALL:VPS_BPP2 (SWALL:P36934) (150 aa) fasta scores: E(): 2.8e-13, 37.66% id in 154 aa, and to Xanthomonas axonopodis phage-related tail protein s or xac2653 SWALL:AAM37500 (EMBL:AE011905) (148 aa) fasta scores: E(): 6.9e-25, 50.99% id in 151 aa, and to Bacteriophage phi CTX orf14 SWALL:Q9ZXL2 (EMBL:AB008550) (156 aa) fasta scores: E(): 9.4e-24, 51.65% id in 151 aa
YP_111089.1	Similar to Micrococcus lylae DNA methyltransferase MlyiM SWALL:Q93NZ3 (EMBL:AF355462) (266 aa) fasta scores: E(): 3.1e-08, 25.29% id in 253 aa, and to Xanthomonas campestris site-specific DNA-methyltransferase xcc2967 SWALL:AAM42239 (EMBL:AE012411) (234 aa) fasta scores: E(): 7e-38, 47.21% id in 233 aa, and to Xylella fastidiosa site-specific DNA-methyltransferase xf2313 SWALL:Q9PB32 (EMBL:AE004042) (243 aa) fasta scores: E(): 1.5e-37, 48.48% id in 231 aa; possible alternative start site at codon 50
YP_111090.1	Similar to Bacteriophage P2 baseplate assembly protein V SWALL:VPV_BPP2 (SWALL:P31340) (211 aa) fasta scores: E(): 2.5e-14, 35.8% id in 229 aa, and to Xanthomonas campestris phage-related baseplate protein V or xcc2986 to codon 187 SWALL:AAM42258 (EMBL:AE012413) (187 aa) fasta scores: E(): 3e-16, 36.46% id in 181 aa, and to Bacteriophage phi CTX orf16 to codon 190 SWALL:Q9ZXL0 (EMBL:AB008550) (190 aa) fasta scores: E(): 4e-15, 35.67% id in 199 aa, and to Bacteriophage 186 orf32 SWALL:O80314 (EMBL:U32222) (213 aa) fasta scores: E(): 1.1e-14, 35.23% id in 210 aa
YP_111091.1	Similar to Bacteriophage P2 baseplate assembly protein W SWALL:VPW_BPP2 (SWALL:P51768) (115 aa) fasta scores: E(): 9.7e-12, 36.28% id in 113 aa, and to Bacteriophage phi CTX orf17 SWALL:Q9ZXK9 (EMBL:AB008550) (114 aa) fasta scores: E(): 8.9e-16, 43.59% id in 117 aa, and to Xanthomonas campestris phage-related baseplate protein W or xcc2987 SWALL:AAM42259 (EMBL:AE012413) (119 aa) fasta scores: E(): 1.3e-15, 56.56% id in 99 aa, and to Ralstonia solanacearum probable phage-related protein rsc1924 or rs03493 SWALL:Q8XY39 (EMBL:AL646067) (115 aa) fasta scores: E(): 3.3e-14, 48.98% id in 98 aa
YP_111092.1	Similar to Bacteriophage P2 baseplate assembly protein J SWALL:VPJ_BPP2 (SWALL:P51767) (302 aa) fasta scores: E(): 3.2e-44, 45.6% id in 296 aa, and to Salmonella typhi phage baseplate assembly protein sty3689 SWALL:Q8Z344 (EMBL:AL627279) (302 aa) fasta scores: E(): 2e-48, 50.33% id in 296 aa, and to Salmonella typhi probable phage baseplate assembly protein sty4613 SWALL:Q8Z1G0 (EMBL:AL627283) (302 aa) fasta scores: E(): 3.6e-48, 50% id in 296 aa
YP_111093.1	Similar to Bacteriophage P2 tail protein I SWALL:VPI_BPP2 (SWALL:P26701) (176 aa) fasta scores: E(): 9.2e-13, 35.66% id in 143 aa, and to Xanthomonas axonopodis phage-related tail protein i or xac2656 SWALL:AAM37503 (EMBL:AE011905) (180 aa) fasta scores: E(): 2.2e-30, 50.29% id in 171 aa, and to Xanthomonas campestris phage-related tail protein I or xcc2983 SWALL:AAM42255 (EMBL:AE012412) (182 aa) fasta scores: E(): 5.4e-30, 46.89% id in 177 aa
YP_111094.1	Similar to Bacteriophage phiE125 gp17 from codon 346 to codon 518 SWALL:Q8W6T4 (EMBL:AF447491) (462 aa) fasta scores: E(): 1.6e-06, 41.44% id in 111 aa, and to Xanthomonas campestris phage-related tail fiber protein orf8 or xcc2984 to codon 401 SWALL:AAM42256 (EMBL:AE012412) (401 aa) fasta scores: E(): 1.7e-19, 30.71% id in 394 aa, and to Xylella fastidiosa phage-related tail fiber protein xf1706 from codon 503 to end SWALL:Q9PCS2 (EMBL:AE003994) (387 aa) fasta scores: E(): 1.4e-07, 28.28% id in 251 aa
YP_111095.1	Similar to Ralstonia solanacearum  tail fiber assembly-like protein rsc1920 or rs03489 to codon 179 SWALL:Q8XY43 (EMBL:AL646067) (250 aa) fasta scores: E(): 4.6e-09, 41.73% id in 115 aa
YP_111096.1	Similar to Bacteriophage P2 major tail sheath protein FI SWALL:VPF1_BPP2 (SWALL:P22501) (395 aa) fasta scores: E(): 1.9e-90, 61.63% id in 391 aa, and to Ralstonia solanacearum probable phage-related protein rsc1918 or rs03487 SWALL:Q8XY45 (EMBL:AL646067) (391 aa) fasta scores: E(): 2.7e-100, 67.26% id in 388 aa, and to Salmonella typhimurium fels-2 prophage: similar to tail sheath proteins in phage p2 stm2701 SWALL:Q8ZMV0 (EMBL:AE008823) (390 aa) fasta scores: E(): 1e-97, 66.83% id in 389 aa
YP_111097.1	Similar to Bacteriophage P2 major tail tube protein FII SWALL:VPF2_BPP2 (SWALL:P22502) (171 aa) fasta scores: E(): 2.2e-26, 44.7% id in 170 aa, and to Xanthomonas campestris phage-related tail protein FII or xcc2989 SWALL:AAM42261 (EMBL:AE012413) (169 aa) fasta scores: E(): 2e-36, 54.16% id in 168 aa, and to Bacteriophage phi CTX orf23 SWALL:Q9ZXK3 (EMBL:AB008550) (171 aa) fasta scores: E(): 4.7e-33, 52.63% id in 171 aa
YP_111098.1	Similar to Bacteriophage P2 protein gpe E SWALL:O64313 (EMBL:AF063097) (91 aa) fasta scores: E(): 1.7e-13, 56.81% id in 88 aa, and to Bacteriophage phi CTX orf24 SWALL:Q9ZXK2 (EMBL:AB008550) (108 aa) fasta scores: E(): 6.9e-14, 54.83% id in 93 aa
YP_111099.1	Similar to Xanthomonas campestris phage-related protein Orf52 SWALL:Q8P6H8 (EMBL:AE012413) (37 aa) fasta scores: E(): 1.2e-07, 62.16% id in 37 aa, and to Bacteriophage phi CTX Orf24.5 SWALL:Q9ZXK1 (EMBL:AB008550) (39 aa) fasta scores: E(): 6.3e-07, 56.75% id in 37 aa
YP_111100.1	Similar to Bacteriophage P2 protein gpt T SWALL:O64314 (EMBL:AF063097) (815 aa) fasta scores: E(): 1.7e-10, 23.27% id in 782 aa, and to Ralstonia solanacearum probable phage-related tail transmembrane protein rsc1914 or rs03483 SWALL:Q8XY49 (EMBL:AL646067) (887 aa) fasta scores: E(): 6.3e-91, 40.06% id in 991 aa, and to Salmonella typhimurium fels-2 prophage:similar to orfG protein in phage 186 stm2697 SWALL:Q8ZMV3 (EMBL:AE008823) (935 aa) fasta scores: E(): 3.7e-18, 23.92% id in 1024 aa
YP_111101.1	Similar to Bacteriophage phi CTX orf26 SWALL:Q9ZXJ9 (EMBL:AB008550) (146 aa) fasta scores: E(): 1.1e-21, 52% id in 125 aa, and to Xanthomonas campestris phage-related tail protein U or xcc2993 SWALL:AAM42265 (EMBL:AE012413) (133 aa) fasta scores: E(): 2.1e-21, 52.8% id in 125 aa, and to Ralstonia solanacearum probable phage-related tail protein rsc1913 or rs03482 SWALL:Q8XY50 (EMBL:AL646067) (140 aa) fasta scores: E(): 2.3e-20, 45.31% id in 128 aa
YP_111102.1	Similar to Bacteriophage 186 late control gene protein D SWALL:VPD_BP186 (SWALL:P21679) (389 aa) fasta scores: E(): 1.3e-34, 41.59% id in 363 aa, and to Xanthomonas campestris phage-related tail protein D or xcc2994 SWALL:AAM42266 (EMBL:AE012413) (328 aa) fasta scores: E(): 1.6e-62, 49.69% id in 328 aa, and to Bacteriophage phi CTX orf27 SWALL:Q9ZXJ8 (EMBL:AB008550) (424 aa) fasta scores: E(): 2.9e-49, 42.68% id in 328 aa
YP_111103.1	Similar to Vibrio proteolyticus alanine dehydrogenase ald SWALL:O85596 (EMBL:AF070716) (374 aa) fasta scores: E(): 5.5e-77, 63.76% id in 367 aa, and to Vibrio cholerae alanine dehydrogenase vc1905 SWALL:Q9KQU3 (EMBL:AE004266) (374 aa) fasta scores: E(): 3.2e-77, 64.01% id in 364 aa
YP_111104.1	Similar to Ralstonia solanacearum  HNS-like transcription regulator protein rsc0867 or rs04950 SWALL:Q8Y126 (EMBL:AL646061) (96 aa) fasta scores: E(): 3.2e-07, 43.01% id in 93 aa, and to Ralstonia solanacearum HNS-like transcription regulator protein rsp0029 or rs02004 SWALL:Q8XTS5 (EMBL:AL646076) (95 aa) fasta scores: E(): 2.6e-06, 39.17% id in 97 aa, and to Ralstonia solanacearum  hns-like transcription regulator protein rsp0335 or rs00711 SWALL:Q8XSY2 (EMBL:AL646078) (96 aa) fasta scores: E(): 2.6e-05, 35.71% id in 98 aa
YP_111105.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa2582 SWALL:Q9I0Q4 (EMBL:AE004686) (177 aa) fasta scores: E(): 1.2e-14, 41.66% id in 180 aa, and to Escherichia coli ProP effector ProQ or b1831 SWALL:PROQ_ECOLI (SWALL:P45577) (232 aa) fasta scores: E(): 4.3e-06, 37.06% id in 116 aa, and to Escherichia coli O157:H7 proq protein that influences osmotic activation of ProP ProQ or z2878 or ecs2541 SWALL:Q8XCM4 (EMBL:AE005405) (232 aa) fasta scores: E(): 4.3e-06, 37.06% id in 116 aa; possible alternative start site at codon 22
YP_111106.1	Similar to Escherichia coli 2-keto-4-pentenoate hydratase MhpD or b0350 from codon 25 SWALL:MHPD_ECOLI (SWALL:P77608) (269 aa) fasta scores: E(): 5.1e-06, 30.07% id in 266 aa, and to Agrobacterium tumefaciens hypothetical protein atu4592 atu4592 or agr_l_566 from codon 24 SWALL:Q8U762 (EMBL:AE009387) (270 aa) fasta scores: E(): 2.2e-13, 29.54% id in 264 aa, and to Ralstonia solanacearum  hydratase rsp0891 or rs01662 from codon 89 SWALL:Q8XRG3 (EMBL:AL646081) (265 aa) fasta scores: E(): 5e-07, 34.16% id in 161 aa. Possible alternative translational start site after codon 24
YP_111107.1	Similar to Rhodopirellula baltica hypothetical protein SWALL:Q7UN29 (EMBL:BX294146) (182 aa) fasta scores: E(): 1e-11, 36.11% id in 180 aa. C-terminal region is similar to the C-terminal region of Vibrio cholerae hypothetical protein VC1375 SWALL:Q9KS84 (EMBL:AE004217) (242 aa) fasta scores: E(): 1.1e-19, 52.38% id in 126 aa
YP_111108.1	Similar to Legionella pneumophila chaperone protein DnaK to codon 431 SWALL:DNAK_LEGPN (SWALL:O32482) (644 aa) fasta scores: E(): 1.5e-08, 26.22% id in 328 aa, and to Vibrio cholerae DnaK-related protein vc1374 to codon 611 SWALL:Q9KS85 (EMBL:AE004217) (631 aa) fasta scores: E(): 2.3e-137, 58.09% id in 618 aa, and to Vibrio cholerae DnaK-related protein vc1373 to codon 611 SWALL:Q9KS86 (EMBL:AE004217) (948 aa) fasta scores: E(): 2.9e-67, 39.74% id in 629 aa
YP_111109.1	Similar to Legionella pneumophila chaperone protein DnaK to codon 347 SWALL:DNAK_LEGPN (SWALL:O32482) (644 aa) fasta scores: E(): 3e-06, 25.72% id in 346 aa, and to the full-length Vibrio cholerae DnaK-related protein vc1373 SWALL:Q9KS86 (EMBL:AE004217) (948 aa) fasta scores: E(): 1.3e-84, 47.05% id in 952 aa, and to Vibrio cholerae DnaK-related protein vc1374 to codon 606 SWALL:Q9KS85 (EMBL:AE004217) (631 aa) fasta scores: E(): 1.6e-46, 40.6% id in 628 aa
YP_111110.1	Similar to Bacillus anthracis capsule biosynthesis protein CapA or pxo2-56 SWALL:CAPA_BACAN (SWALL:P19579) (411 aa) fasta scores: E(): 2.5e-08, 24.07% id in 324 aa, and to horizontally acquired Meloidogyne artiellia polyglutamate synthase ths SWALL:Q8T376 (EMBL:AJ310212) (361 aa) fasta scores: E(): 1.4e-79, 56.51% id in 361 aa, and to Mycobacterium tuberculosis hypothetical 41.5 kDa protein rv0574c or mtv039.12c or mt0602 SWALL:O53771 (EMBL:AL021942) (380 aa) fasta scores: E(): 1.4e-65, 50.98% id in 355 aa. Possible alternative translational start
YP_111111.1	Similar to Rhizobium meliloti hypothetical protein r01197 or smc01759 SWALL:Q92QV2 (EMBL:AL591786) (72 aa) fasta scores: E(): 0.00011, 37.87% id in 66 aa
YP_111112.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0198 or rs00630 SWALL:Q8Y2Y3 (EMBL:AL646058) (213 aa) fasta scores: E(): 6.9e-45, 56.28% id in 199 aa
YP_111113.1	Similar to Escherichia coli, and Escherichia coli O157:H7 cation transport ATPase MgtA or Mgt or CorB or b4242 or z5853 or ecs5219 SWALL:ATMA_ECOLI (SWALL:P39168) (898 aa) fasta scores: E(): 9.1e-46, 27.56% id in 849 aa, and to Methanobacterium thermoautotrophicum cation-transporting p-ATPase pacL mth1001 SWALL:O27082 (EMBL:AE000873) (844 aa) fasta scores: E(): 7.2e-64, 35.3% id in 830 aa, and to Streptomyces coelicolor  transport ATPase sco2499 or scc121.02C SWALL:Q9L2I4 (EMBL:AL939112) (1472 aa) fasta scores: E(): 4.6e-48, 32.07% id in 876 aa
YP_111114.1	Similar to Ralstonia solanacearum  signal peptide protein rsc1315 or rs02837 SWALL:Q8XZT0 (EMBL:AL646063) (141 aa) fasta scores: E(): 3.5e-08, 35.71% id in 140 aa
YP_111115.1	Similar to Streptococcus agalactiae hypothetical 25.7 kDa protein SWALL:O54084 (EMBL:Y12224) (228 aa) fasta scores: E(): 9.8e-09, 27.12% id in 188 aa, and to Streptomyces galilaeus AknG SWALL:Q9L546 (EMBL:AF257324) (286 aa) fasta scores: E(): 5e-08, 36% id in 150 aa, and to Streptomyces galilaeus AknG SWALL:Q8VWA8 (EMBL:AB008466) (286 aa) fasta scores: E(): 5e-08, 36% id in 150 aa
YP_111116.1	Similar to Paenibacillus thiaminolyticus thiaminase I precursor to codon 383 SWALL:THI1_PANTH (SWALL:P45741) (409 aa) fasta scores: E(): 1.3e-40, 35.84% id in 385 aa
YP_111117.1	Similar to Salmonella typhimurium phosphomethylpyrimidine kinase ThiD or stm2146 SWALL:THID_SALTY (SWALL:P55882) (266 aa) fasta scores: E(): 4.1e-47, 57.79% id in 263 aa, and to Salmonella typhi phosphomethylpyrimidine kinase ThiD or sty2375 SWALL:Q8Z5C9 (EMBL:AL627273) (266 aa) fasta scores: E(): 7.2e-47, 57.41% id in 263 aa, and to Escherichia coli O157:H7 phosphomethylpyrimidine kinase ThiD or z3267 or ecs2906 SWALL:Q8X7G5 (EMBL:AE005436) (266 aa) fasta scores: E(): 2.9e-46, 56.65% id in 263 aa
YP_111118.1	Similar to Streptomyces avermitilis C5-O-methyltransferase AveD SWALL:Q9S0N6 (EMBL:AB032524) (283 aa) fasta scores: E(): 9.3e-07, 38.28% id in 128 aa, and to Caulobacter crescentus methyltransferase,  Cc1846 SWALL:Q9A780 (EMBL:AE005858) (243 aa) fasta scores: E(): 3.9e-08, 31.08% id in 222 aa, and to Nocardia aerocolonigenes  methyltransferase RbmF SWALL:CAC93718 (EMBL:AF534707) (273 aa) fasta scores: E(): 3.3e-07, 39.49% id in 119 aa
YP_111119.1	Similar to Bacteriophage SP01 deoxyuridylate hydroxymethyltransferase 29 SWALL:DUHM_BPSP1 (SWALL:P31654) (383 aa) fasta scores: E(): 6.8e-12, 30.04% id in 223 aa, and to Rhizobium loti thymidylate synthase ThyA or mll1467 SWALL:Q98KH9 (EMBL:AP002997) (264 aa) fasta scores: E(): 8e-08, 24.05% id in 237 aa, and to Agrobacterium tumefaciens thymidylate synthase ThyA or atu2047 or agr_c_3709 SWALL:Q8UDS3 (EMBL:AE009155) (279 aa) fasta scores: E(): 6.8e-07, 23.72% id in 236 aa
YP_111121.1	Similar to Methanococcus jannaschii ADP-ribose pyrophosphatase NudF or mj1149 SWALL:ADPP_METJA (SWALL:Q58549) (169 aa) fasta scores: E(): 4.5e-07, 33.33% id in 123 aa, and to Aeropyrum pernix hypothetical protein Ape2080 ape2080 SWALL:Q9YA58 (EMBL:AP000063) (175 aa) fasta scores: E(): 2.9e-11, 42.4% id in 125 aa, and to Methanopyrus kandleri ADP-ribose pyrophosphatase mk1028 SWALL:Q8TWK5 (EMBL:AE010391) (154 aa) fasta scores: E(): 2.7e-10, 46.15% id in 117 aa; alternative start site at codon 30
YP_111122.1	Similar to the C-terminal regions of Arabidopsis thaliana (mouse ear cress)  phosphoethanolamine N-methyltransferase 3 NMT or at1g73600 or f6d5.1 or f25p22.1 PEM3_ARATH SWALL:PEM3_ARATH (SWALL:Q9C6B9) (490 aa) fasta scores: E(): 2.6e-24, 33.59% id in 259 aa, and Arabidopsis thaliana  phosphoethanolamine N-methyltransferase 2 NMT2 or at1g48600 or t1n15_20 or t1n15.22/t1n15.23
YP_111123.1	Similar to Pseudomonas sp. gamma-butyrobetaine,2-oxoglutarate dioxygenase SWALL:BODG_PSESK (SWALL:P80193) (383 aa) fasta scores: E(): 5.2e-20, 27.68% id in 372 aa, and to Rattus norvegicus gamma-butyrobetaine,2-oxoglutarate dioxygenase Bbox1 or BbH SWALL:BODG_RAT (SWALL:Q9QZU7) (387 aa) fasta scores: E(): 1.2e-21, 28.14% id in 366 aa, and to Drosophila melanogaster eg:bacr7a4.9 protein eg:bacr7a4.9 or cg14630 SWALL:Q9NF72 (EMBL:AL109630) (504 aa) fasta scores: E(): 3.5e-21, 29.03% id in 372 aa
YP_111124.1	Similar to Rhizobium loti hypothetical protein Mlr7896 SWALL:Q984Q1 (EMBL:AP003012) (278 aa) fasta scores: E(): 8.9e-49, 54.31% id in 278 aa, and to Salmonella typhimurium integral membrane protein stm3796A SWALL:Q8ZL13 (EMBL:AE008877) (286 aa) fasta scores: E(): 2.1e-29, 39.27% id in 275 aa, and to Streptomyces coelicolor  integral membrane protein sco3164 or sce87.15C SWALL:Q9RKC3 (EMBL:AL939115) (281 aa) fasta scores: E(): 1e-26, 37.9% id in 277 aa
YP_111125.1	Similar to Pseudomonas aeruginosa arginine/ornithine antiporter ArcD or pa5170 SWALL:ARCD_PSEAE (SWALL:P18275) (482 aa) fasta scores: E(): 5.8e-95, 55.88% id in 476 aa, and to Clostridium perfringens arginine/ornithine antiporter ArcD or cpe0170 SWALL:ARCD_CLOPE (SWALL:Q46170) (478 aa) fasta scores: E(): 8.7e-86, 50.1% id in 471 aa, and to Pseudomonas aeruginosa probable amino acid permease pa1194 SWALL:Q9I4E4 (EMBL:AE004549) (472 aa) fasta scores: E(): 2.6e-81, 51.69% id in 472 aa. N-terminus is extended in comparison to orthologues. Possible alternative start site at codon 23
YP_111126.1	Similar to Ralstonia solanacearum probable transmembrane protein rsp0998 or rs02331 SWALL:Q8XR63 (EMBL:AL646082) (197 aa) fasta scores: E(): 2.7e-37, 56.06% id in 198 aa, and to Xanthomonas axonopodis integral membrane protein xac2748 SWALL:AAM37593 (EMBL:AE011915) (253 aa) fasta scores: E(): 1.5e-26, 43.11% id in 218 aa, and to Xanthomonas campestris integral membrane protein xcc2577 SWALL:AAM41849 (EMBL:AE012370) (228 aa) fasta scores: E(): 2e-25, 43.54% id in 209 aa. Possible alternative translational start site
YP_111127.1	Similar to Bradyrhizobium japonicum metalloprotease FtsH SWALL:Q9XBG5 (EMBL:AJ243808) (640 aa) fasta scores: E(): 2e-93, 46.29% id in 635 aa, and to Anabaena sp. cell division protein FtsH or all4936 SWALL:Q8YMJ7 (EMBL:AP003598) (645 aa) fasta scores: E(): 1.3e-97, 48.94% id in 615 aa, and to Chlorobium tepidum cell division protein FtsH FtsH-1 or ct0127 SWALL:AAM71375 (EMBL:AE012791) (706 aa) fasta scores: E(): 5.9e-96, 47.29% id in 666 aa, and to Synechocystis sp. cell division protein FtsH homolog 3 sll1463 SWALL:FTH3_SYNY3 (SWALL:P73437) (628 aa) fasta scores: E(): 5.4e-94, 48.44% id in 611 aa
YP_111129.1	Similar to Mycobacterium tuberculosis hypothetical protein rv2913c or mt2981 or mtcy274.45c or mtcy338.01C SWALL:YT13_MYCTU (SWALL:Q10830) (611 aa) fasta scores: E(): 1.6e-136, 58.19% id in 586 aa, and to Caulobacter crescentus hypothetical protein Cc3460 SWALL:Q9A2U6 (EMBL:AE006004) (581 aa) fasta scores: E(): 1.6e-24, 28.21% id in 599 aa, and to Pyrococcus abyssi D-aminoacylase NdaD or pab0090 SWALL:Q9V2D3 (EMBL:AJ248283) (526 aa) fasta scores: E(): 3.8e-09, 26.06% id in 541 aa; possible alternative start at codon 15
YP_111130.1	Similar to Yersinia pestis hypothetical protein Ypo4077 SWALL:Q8Z9W2 (EMBL:AJ414160) (214 aa) fasta scores: E(): 2.3e-38, 52.58% id in 213 aa, and to Vibrio cholerae hypothetical protein Vc2666 SWALL:Q9KNR5 (EMBL:AE004332) (205 aa) fasta scores: E(): 1.6e-27, 42.5% id in 200 aa, and to Anabaena sp. hypothetical protein All2491 SWALL:Q8YU63 (EMBL:AP003589) (227 aa) fasta scores: E(): 1.6e-13, 29.68% id in 219 aa
YP_111131.1	Similar to Pseudomonas aeruginosa probable RND efflux membrane fusion protein precursor pa4206 SWALL:Q9HWH5 (EMBL:AE004837) (370 aa) fasta scores: E(): 9.3e-39, 39.07% id in 366 aa, and to Vibrio cholerae hypothetical protein Vc0165 SWALL:Q9KVI1 (EMBL:AE004106) (368 aa) fasta scores: E(): 3.1e-34, 35.21% id in 355 aa, and to Rhizobium loti RND efflux membrane fusion protein precursor mlr3647 SWALL:Q98FR7 (EMBL:AP003002) (465 aa) fasta scores: E(): 2.4e-29, 32.15% id in 367 aa
YP_111132.1	Similar to Pseudomonas aeruginosa probable RND efflux transporter pa4207 SWALL:Q9HWH4 (EMBL:AE004837) (1029 aa) fasta scores: E(): 1.2e-213, 58.8% id in 1017 aa, and to Pseudomonas aeruginosa probable RND efflux transporter pa4375 SWALL:Q9HW27 (EMBL:AE004853) (1018 aa) fasta scores: E(): 1.9e-184, 51.99% id in 1002 aa. CDS is shorter at the N-terminus in comparison to orthologues.
YP_111133.1	Similar to Pseudomonas putida efflux protein TtgC SWALL:Q9WWZ8 (EMBL:AF031417) (484 aa) fasta scores: E(): 9.1e-76, 49.68% id in 483 aa, and to Pseudomonas aeruginosa outer membrane protein OprM precursor or OprK or pa0427 SWALL:OPRM_PSEAE (SWALL:Q51487) (485 aa) fasta scores: E(): 3.8e-85, 56.19% id in 468 aa, and to Xanthomonas axonopodis outer membrane protein OprM or xac2842 SWALL:AAM37687 (EMBL:AE011925) (503 aa) fasta scores: E(): 5.4e-84, 53.18% id in 502 aa
YP_111134.1	catalyzes the conversion of GTP to formate and 2,5-diamino-6-hydroxy-4-(5-phosphoribosylamino)pyrimidine and diphosphate
YP_111135.1	Similar to Pseudomonas glumae WD-repeat protein ToxC SWALL:Q8RS37 (EMBL:AB040403) (563 aa) fasta scores: E(): 6.3e-132, 63.74% id in 571 aa, and to Streptomyces coelicolor  repetative protein sco2692 or scc61a.13 SWALL:Q9KYI0 (EMBL:AL939113) (626 aa) fasta scores: E(): 3.5e-15, 28.92% id in 560 aa, and to Anabaena sp. WD-repeat protein all4834 from codon 950 of Q8YMU3 SWALL:Q8YMU3 (EMBL:AP003597) (1551 aa) fasta scores: E(): 4.3e-13, 24.11% id in 593 aa
YP_111136.1	Similar to Bacillus halodurans hypothetical protein Bh2058 SWALL:Q9KB70 (EMBL:AP001514) (241 aa) fasta scores: E(): 8.5e-06, 29.63% id in 162 aa
YP_111137.1	Similar to Pseudomonas glumae trp-2 toxD SWALL:Q8RS36 (EMBL:AB040403) (325 aa) fasta scores: E(): 1.4e-88, 68.71% id in 326 aa, and to Streptomyces coelicolor hypothetical protein sco2695 or scc61a.16 SWALL:Q9KYH7 (EMBL:AL939113) (256 aa) fasta scores: E(): 5.4e-22, 42.85% id in 252 aa, and to Chlamydia trachomatis serine/threonine protein kinase ct145 SWALL:O84147 (EMBL:AE001288) (614 aa) fasta scores: E(): 1.2e-13, 34.49% id in 258 aa
YP_111138.1	Similar to Escherichia coli riboflavin biosynthesis protein RibD [includes: diaminohydroxyphosphoribosylaminopyrimidine deaminase RibD or RibG or b0414 SWALL:RIBD_ECOLI (SWALL:P25539) (367 aa) fasta scores: E(): 1.8e-33, 39.88% id in 336 aa, and to Xanthomonas campestris riboflavin-specific deaminase/5-amino-6-uracil reductase RibD or xcc0693 SWALL:AAM40009 (EMBL:AE012168) (364 aa) fasta scores: E(): 4.6e-40, 45.05% id in 384 aa, and to Pseudomonas aeruginosa riboflavin-specific deaminase/reductase RibD or pa4056 SWALL:Q9HWX2 (EMBL:AE004822) (373 aa) fasta scores: E(): 5.4e-40, 44.11% id in 365 aa
YP_111139.1	Similar to Streptomyces glaucescens tetracenomycin polyketide synthesis 8-O-methyl transferase TcmO SWALL:TCMO_STRGA (SWALL:P39896) (339 aa) fasta scores: E(): 2.8e-13, 26.74% id in 329 aa, and to Streptomyces sp. JP95  methyltransferase GrhL SWALL:AAM33664 (EMBL:AF509565) (343 aa) fasta scores: E(): 2.1e-17, 30.14% id in 355 aa, and to Streptomyces argillaceus O-methyltransferase MtmMI SWALL:Q9R6R8 (EMBL:AF077869) (345 aa) fasta scores: E(): 4.8e-15, 30.47% id in 292 aa
YP_111141.1	Similar to Burkholderia cepacia major facilitator superfamily transporter homolog SWALL:Q9RPH2 (EMBL:AF158699) (531 aa) fasta scores: E(): 5.1e-21, 27.65% id in 452 aa, and to Ralstonia solanacearum transport transmembrane protein rsc2324 or rs01224 SWALL:Q8XWZ4 (EMBL:AL646069) (475 aa) fasta scores: E(): 1.2e-69, 47.34% id in 471 aa, and to Mycobacterium tuberculosis hypothetical 47.7 kDa protein rv1634 or mtcy01b2.26 or mt1670 SWALL:O06151 (EMBL:Z95554) (471 aa) fasta scores: E(): 4.2e-47, 39.22% id in 464 aa
YP_111142.1	Limited similarity to Yersinia pestis  membrane protein ypo0899 SWALL:Q8ZHJ3 (EMBL:AJ414145) (165 aa) fasta scores: E(): 0.0034, 29.63% id in 135 aa
YP_111144.1	Similar to Vibrio cholerae transcriptional regulator, LuxR family, from codon 69 of vca1078 SWALL:Q9KKM5 (EMBL:AE004433) (319 aa) fasta scores: E(): 3.5e-33, 41.41% id in 227 aa
YP_111145.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa2120 SWALL:Q9I1Z5 (EMBL:AE004639) (142 aa) fasta scores: E(): 2.6e-28, 59.23% id in 130 aa, and to Ralstonia solanacearum hypothetical protein rsp0317 or rs05451 SWALL:Q8XT00 (EMBL:AL646078) (147 aa) fasta scores: E(): 4.5e-26, 59.09% id in 132 aa, and to Streptomyces coelicolor hypothetical protein sco7053 or sc4g1.19C SWALL:Q9FC31 (EMBL:AL939130) (139 aa) fasta scores: E(): 1e-11, 38.09% id in 126 aa
YP_111146.1	Similar to Escherichia coli 2,4-dienoyl-CoA reductase [NADPH] FadH or b3081 SWALL:FADH_ECOLI (SWALL:P42593) (671 aa) fasta scores: E(): 8.6e-165, 64.33% id in 673 aa, and to Streptomyces coelicolor 2,4-dienoyl-CoA reductase FadH or sco7066 or sc4g1.32 SWALL:Q9FC18 (EMBL:AL939130) (671 aa) fasta scores: E(): 1.8e-183, 71.32% id in 673 aa, and to Pseudomonas aeruginosa 2,4-dienoyl-Coareductase FadH1 or pa3092 SWALL:Q9HZB6 (EMBL:AE004733) (679 aa) fasta scores: E(): 6.1e-177, 68.64% id in 673 aa; possible alternative start site at codon 12
YP_111147.1	Similar to Streptomyces coelicolor hypothetical protein sco7067 or sc4g1.33 SWALL:Q9FC17 (EMBL:AL939130) (183 aa) fasta scores: E(): 3.5e-36, 60.23% id in 171 aa, and to Ralstonia solanacearum hypothetical protein rsp0309 or rs05461 SWALL:Q8XT08 (EMBL:AL646077) (178 aa) fasta scores: E(): 1.6e-31, 57.23% id in 159 aa, and to Anabaena sp. hypothetical protein All4972 SWALL:Q8YMG2 (EMBL:AP003598) (179 aa) fasta scores: E(): 7.1e-18, 35.75% id in 179 aa
YP_111148.1	Similar to Salmonella typhimurium hydroxyethylthiazole kinase ThiM or stm2147 SWALL:THIM_SALTY (SWALL:P55883) (265 aa) fasta scores: E(): 1.2e-23, 44.53% id in 238 aa, and to Leptospira interrogans hydroxyethylthiazole kinase ThiM or la3365 SWALL:AAN50563 (EMBL:AE011496) (265 aa) fasta scores: E(): 8.7e-30, 43.65% id in 252 aa, and to Shigella flexneri hydoxyethylthiazole kinase ThiM or sf2166 SWALL:AAN43697 (EMBL:AE015232) (262 aa) fasta scores: E(): 4.4e-24, 42.56% id in 242 aa
YP_111149.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa0187 SWALL:Q9I6U7 (EMBL:AE004456) (271 aa) fasta scores: E(): 1.9e-40, 46.41% id in 265 aa
YP_111150.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa0188 SWALL:Q9I6U6 (EMBL:AE004456) (293 aa) fasta scores: E(): 2.2e-48, 48.43% id in 287 aa, and to Pseudomonas aeruginosa hypothetical protein Pa1735 SWALL:Q9I302 (EMBL:AE004599) (295 aa) fasta scores: E(): 2e-29, 37.2% id in 293 aa, and to Vibrio cholerae hypothetical protein Vc1229 vc1229 SWALL:Q9KSM7 (EMBL:AE004202) (291 aa) fasta scores: E(): 5.3e-16, 30.31% id in 287 aa
YP_111151.1	Similar to Neisseria meningitidis hypothetical protein Nmb1992 nmb1992 SWALL:Q9JXK9 (EMBL:AE002548) (208 aa) fasta scores: E(): 5.7e-27, 44.82% id in 203 aa, and to Neisseria meningitidis hypothetical protein Nma0449 nma0449 SWALL:Q9JWC2 (EMBL:AL162753) (193 aa) fasta scores: E(): 5.5e-23, 51.8% id in 166 aa
YP_111152.1	Similar to Alcaligenes eutrophus hypothetical protein SWALL:Q7WXA3 (EMBL:AY305378) (99 aa) fasta scores: E(): 2.2e-15, 64.28% id in 70 aa
YP_111153.1	Similar to Ralstonia solanacearum hypothetical protein from codon 175 of rsp1561 or rs02117 SWALL:Q8XPS7 (EMBL:AL646085) (151 aa) fasta scores: E(): 1.8e-11, 39.18% id in 148 aa, and to Ralstonia solanacearum hypothetical protein from codon 175 of rsc0184 or rs00615 SWALL:Q8Y2Z7 (EMBL:AL646057) (166 aa) fasta scores: E(): 1.7e-09, 34.5% id in 142 aa, and to Pseudomonas aeruginosa hypothetical protein from codon 175 of Pa3309 SWALL:Q9HYT5 (EMBL:AE004753) (151 aa) fasta scores: E(): 3.7e-09, 35.61% id in 146 aa, and to Corynebacterium glutamicum universal stress protein UspA and related nucleotide-binding proteins cgl2943 SWALL:BAC00337 (EMBL:AP005283) (301 aa) fasta scores: E(): 2.2e-08, 28.3% id in 318 aa
YP_111155.1	Similar to Methanobacterium thermoautotrophicum hydrogenase small subunit EhaN SWALL:Q9UXP5 (EMBL:AJ243655) (148 aa) fasta scores: E(): 4.7e-17, 43.44% id in 122 aa, and to Methanosarcina mazei formate hydrogenlyase subunit 7 mm1064 SWALL:AAM30760 (EMBL:AE013333) (170 aa) fasta scores: E(): 2.7e-26, 54.96% id in 131 aa, and to Methanosarcina acetivorans hydrogenase-3, subunit G ma4373 SWALL:Q8THY5 (EMBL:AE011156) (170 aa) fasta scores: E(): 5.6e-26, 52.48% id in 141 aa
YP_111156.1	Similar to Escherichia coli formate hydrogenlyase subunit 5 precursor HycE or HevE or b2721 SWALL:HYCE_ECOLI (SWALL:P16431) (569 aa) fasta scores: E(): 2.5e-31, 31.25% id in 464 aa, and to Methanosarcina acetivorans hydrogenase-3, subunit E ma4372 SWALL:Q8THY6 (EMBL:AE011156) (545 aa) fasta scores: E(): 9.1e-42, 38.47% id in 473 aa, and to Mycobacterium tuberculosis probable formate hydrogenlyase cy251.05 rv0087 or mtcy251.05 SWALL:Q10884 (EMBL:Z74410) (492 aa) fasta scores: E(): 1.4e-39, 42.22% id in 450 aa
YP_111157.1	Catalyzes the transfer of electrons from NADH to ubiquinone
YP_111158.1	Similar to Mycobacterium tuberculosis hypothetical protein rv0085 or mt0092 or mtcy251.03 SWALL:Y085_MYCTU (SWALL:Q10882) (220 aa) fasta scores: E(): 4e-18, 32.07% id in 212 aa, and to Thermoanaerobacter tengcongensis hydrogenase 4 membrane subunit tte1704 SWALL:Q8R9B2 (EMBL:AE013124) (204 aa) fasta scores: E(): 5.4e-11, 25% id in 204 aa, and to Escherichia coli, and Escherichia coli O157:H7 hydrogenase-4 component E HyfE or b2485 or z3745 or ecs3347 SWALL:HYFE_ECOLI (SWALL:P77524) (216 aa) fasta scores: E(): 2.5e-09, 25.58% id in 215 aa
YP_111159.1	Similar to Escherichia coli formate hydrogenlyase subunit 4 HycD or HevD or b2722 SWALL:HYCD_ECOLI (SWALL:P16430) (307 aa) fasta scores: E(): 2.6e-27, 33.65% id in 306 aa. Almost identical to the previously sequenced Burkholderia pseudomallei formate hydrogenlyase subunit 4 SWALL:Q9ALX9 (EMBL:AF335723) (316 aa) fasta scores: E(): 2.9e-114, 98.73% id in 316 aa
YP_111160.1	Catalyzes the transfer of electrons from NADH to ubiquinone
YP_111161.1	Similar to Ralstonia solanacearum probable transmembrane protein rsp0353 or rs00757 SWALL:Q8XSW4 (EMBL:AL646078) (247 aa) fasta scores: E(): 5.1e-58, 63.74% id in 251 aa, and to Xanthomonas axonopodis hypothetical protein Xac1754 SWALL:AAM36618 (EMBL:AE011807) (233 aa) fasta scores: E(): 2.6e-06, 33.47% id in 230 aa, and to Ralstonia solanacearum permease transmembrane protein rsc0238 or rs00670 SWALL:Q8Y2U4 (EMBL:AL646058) (236 aa) fasta scores: E(): 3.5e-06, 31.53% id in 222 aa
YP_111163.1	Similar to Alcaligenes eutrophus phosphocarrier protein Hpr phbH SWALL:PTHP_ALCEU (SWALL:P23537) (89 aa) fasta scores: E(): 4.2e-05, 39.13% id in 69 aa, and to Ralstonia solanacearum probable phosphocarrier protein Hpr PstH or rsc0347 or rs03314 SWALL:Q8Y2I9 (EMBL:AL646058) (89 aa) fasta scores: E(): 9.4e-05, 38.37% id in 86 aa
YP_111164.1	Similar to Pseudomonas aeruginosa spermidine synthase SpeE or pa1687 SWALL:SPEE_PSEAE (SWALL:Q9X6R0) (286 aa) fasta scores: E(): 1.9e-06, 27.95% id in 254 aa, and to Xanthomonas campestris transferase xcc1548 SWALL:AAM40843 (EMBL:AE012255) (247 aa) fasta scores: E(): 1e-24, 43.19% id in 213 aa, and to Neisseria meningitidis transferase nma1087 or nmb0869 SWALL:Q9JQL8 (EMBL:AL162755) (263 aa) fasta scores: E(): 1.7e-20, 34.15% id in 243 aa
YP_111167.1	Similar to Paracoccus pantotrophus nitrate/nitrite transporter NarK SWALL:Q93PW1 (EMBL:AF295359) (905 aa) fasta scores: E(): 4.5e-63, 41.2% id in 415 aa, and to Pseudomonas fluorescens  nitrate/nitrite transporter narD SWALL:Q9F0X9 (EMBL:AF197465) (421 aa) fasta scores: E(): 1.6e-89, 56.46% id in 402 aa, and to Ralstonia solanacearum  nitrite/nitrate transporter transmembrane protein NarK1 or rsp0972 or rs02304 SWALL:Q8XR87 (EMBL:AL646082) (437 aa) fasta scores: E(): 4.3e-85, 53.44% id in 421 aa, and to Pseudomonas aeruginosa nitrate extrusion protein NarK1 or pa3877 SWALL:O54041 (EMBL:Y15252) (431 aa) fasta scores: E(): 6.4e-71, 44.36% id in 408 aa
YP_111168.1	Similar to Azotobacter vinelandii protein NifM SWALL:NIFM_AZOVI (SWALL:P14890) (292 aa) fasta scores: E(): 1.9e-09, 29.71% id in 212 aa, and to Pseudomonas aeruginosa probable peptidyl-prolyl cis-trans isomerase, Ppic-type pa3871 SWALL:Q9HXD5 (EMBL:AE004804) (272 aa) fasta scores: E(): 1.5e-23, 36.33% id in 267 aa, and to Brucella melitensis peptidyl-prolyl cis-trans isomerase C bmeii0954 SWALL:Q8YBE6 (EMBL:AE009728) (271 aa) fasta scores: E(): 4.7e-23, 43.07% id in 260 aa, and to Pseudomonas aeruginosa NifM protein SWALL:O54047 (EMBL:Y15252) (250 aa) fasta scores: E(): 7e-22, 36.94% id in 249 aa
YP_111169.1	Similar to Escherichia coli respiratory nitrate reductase 1 gamma chain NarI or ChlI or b1227 SWALL:NARI_ECOLI (SWALL:P11350) (225 aa) fasta scores: E(): 9.9e-38, 46.42% id in 224 aa, and to Brucella melitensis respiratory nitrate reductase 2 gamma chain bmeii0953 SWALL:Q8YBE7 (EMBL:AE009728) (241 aa) fasta scores: E(): 6e-43, 51.52% id in 229 aa, and to Brucella suis respiratory nitrate reductase, gamma subunit NarI or bra0296 SWALL:AAN33496 (EMBL:AE014530) (241 aa) fasta scores: E(): 6.9e-43, 51.52% id in 229 aa, and to Salmonella typhimurium nitrate reductase 1, cytochrome b NarI or stm1761 SWALL:Q8ZP40 (EMBL:AE008778) (225 aa) fasta scores: E(): 3.5e-38, 46.42% id in 224 aa
YP_111170.1	Similar to Paracoccus denitrificans respiratory nitrate reductase subunit protein NarJ SWALL:Q56356 (EMBL:Z26255) (228 aa) fasta scores: E(): 9.5e-25, 47.17% id in 212 aa, and to Ralstonia solanacearum  respiratory nitrate reductase oxidoreductase NarJ or rsp0976 or rs02308 SWALL:Q8XR83 (EMBL:AL646082) (226 aa) fasta scores: E(): 2.2e-23, 41.7% id in 223 aa, and to Pseudomonas aeruginosa  chaperone NarJ or pa3873 SWALL:O54045 (EMBL:Y15252) (246 aa) fasta scores: E(): 4.7e-23, 44.95% id in 218 aa
YP_111171.1	Similar to Paracoccus denitrificans nitrate reductase subunit NarH protein SWALL:Q56355 (EMBL:Z26255) (505 aa) fasta scores: E(): 8.3e-156, 73.82% id in 489 aa, and to Brucella melitensis nitrate reductase beta chain BmeII0951 SWALL:Q8YBE9 (EMBL:AE009728) (512 aa) fasta scores: E(): 1.6e-165, 76.11% id in 494 aa, and to Pseudomonas aeruginosa respiratory nitrate reductase beta subunit NarH or pa3874 SWALL:O54044 (EMBL:Y15252) (513 aa) fasta scores: E(): 3.3e-158, 75.54% id in 503 aa, and to Pseudomonas fluorescens respiratory nitrate reductase beta subunit NarH SWALL:Q9F0X6 (EMBL:AF197465) (512 aa) fasta scores: E(): 6.5e-157, 73.65% id in 501 aa
YP_111172.1	Similar to Escherichia coli respiratory nitrate reductase 2 alpha chain NarZ or b1468 SWALL:NARZ_ECOLI (SWALL:P19319) (1245 aa) fasta scores: E(): 0, 67.6% id in 1244 aa, and to Paracoccus halodenitrificans probable nitrate reductase alpha subunit NarG SWALL:Q8VUK0 (EMBL:AB076402) (1255 aa) fasta scores: E(): 0, 68.63% id in 1256 aa, and to Pseudomonas aeruginosa respiratory nitrate reductase alpha subunit NarG or pa3875 SWALL:O54043 (EMBL:Y15252) (1261 aa) fasta scores: E(): 0, 67.68% id in 1247 aa, and to Salmonella typhimurium nitrate reductase 2, alpha subunit NarZ or stm1577 SWALL:Q8ZPE1 (EMBL:AE008769) (1246 aa) fasta scores: E(): 0, 68.37% id in 1246 aa
YP_111173.1	Similar to Bacillus subtilis sensor protein DegS or SacU SWALL:DEGS_BACSU (SWALL:P13799) (385 aa) from codon 330 fasta scores: E(): 5.1e-18, 29.48% id in 329 aa, and to Ralstonia solanacearum probable transmembrane two component system sensor kinase transcription regulator protein rsc0191 or rs00623 from codon 202 SWALL:Q8Y2Z0 (EMBL:AL646057) (458 aa) fasta scores: E(): 4.3e-49, 49.12% id in 458 aa. No transmembrane regions are predicted.
YP_111174.1	Similar to Ralstonia solanacearum EPS/virulence gene regulator VsrD SWALL:Q45416 (EMBL:U18135) (210 aa) fasta scores: E(): 3.3e-31, 48.09% id in 210 aa, and to Ralstonia solanacearum probable response regulator transcription regulator protein rsc0192 or rs00624 SWALL:Q8Y2Y9 (EMBL:AL646057) (215 aa) fasta scores: E(): 2.2e-45, 59.07% id in 215 aa, and to Ralstonia solanacearum response regulator transcription regulator protein VsrD or rsc0292 or rs03259 SWALL:Q8Y2P3 (EMBL:AL646058) (210 aa) fasta scores: E(): 3.3e-31, 48.09% id in 210 aa
YP_111175.1	Similar to Ralstonia solanacearum (pseudomonas solanacearum) virulence regulator VsrD SWALL:Q45417 (EMBL:U18135) (146 aa) fasta scores: E(): 9.5e-07, 31.2% id in 125 aa, and to Ralstonia solanacearum  transcription regulator protein rsc0291 or rs03258 SWALL:Q8Y2P4 (EMBL:AL646058) (146 aa) fasta scores: E(): 1.1e-06, 31.2% id in 125 aa, and to Rhodococcus sp. NO1-1 CprR SWALL:O85372 (EMBL:AF064700) (212 aa) fasta scores: E(): 2.2e-05, 35.87% id in 131 aa
YP_111176.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 fumarate and nitrate reduction regulatory protein FNR or NirR or b1334 or c1807 or z2433 or ecs1915 SWALL:FNR_ECOLI (SWALL:P03019) (250 aa) fasta scores: E(): 5.1e-36, 39.41% id in 241 aa, and to Ralstonia solanacearum probable transcription regulator protein rsc0190 or rs00622 SWALL:Q8Y2Z1 (EMBL:AL646057) (266 aa) fasta scores: E(): 3.6e-47, 48.65% id in 261 aa, and to Neisseria meningitidis  anaerobic transcriptional regulatory protein nma2107 or nmb0380 SWALL:Q9JQQ8 (EMBL:AL162758) (244 aa) fasta scores: E(): 6.9e-43, 50.46% id in 216 aa
YP_111177.1	Similar to Xanthomonas axonopodis hypothetical protein Xac0753 SWALL:AAM35642 (EMBL:AE011705) (526 aa) fasta scores: E(): 1e-41, 37.03% id in 513 aa, and to Xanthomonas campestris hypothetical protein Xcc0700 SWALL:AAM40016 (EMBL:AE012168) (525 aa) fasta scores: E(): 1.2e-41, 36.07% id in 510 aa
YP_111178.1	Similar to Escherichia coli alpha-ketoglutarate-dependent taurine dioxygenase TauD or SsiD or b0368 SWALL:TAUD_ECOLI (SWALL:P37610) (282 aa) fasta scores: E(): 1.4e-22, 30.1% id in 279 aa, and to Pseudomonas aeruginosa hypothetical protein Pa2310 SWALL:Q9I1G5 (EMBL:AE004657) (295 aa) fasta scores: E(): 1.7e-31, 36.2% id in 279 aa, and to Ralstonia solanacearum alpha-ketoglutarate-dependent taurine dioxygenase oxidoreductase TauD or rsc0746 or rs05107 SWALL:Q8Y1E4 (EMBL:AL646060) (301 aa) fasta scores: E(): 4.8e-31, 39.43% id in 284 aa
YP_111179.1	Similar to Yersinia pestis  multidrug resistance protein ypo2148 or y2173 SWALL:Q8ZEL6 (EMBL:AJ414151) (400 aa) fasta scores: E(): 4e-21, 26.34% id in 372 aa, and to Escherichia coli florfenicol exporter FloR SWALL:Q9F8W2 (EMBL:AF231986) (404 aa) fasta scores: E(): 1.4e-20, 27.82% id in 399 aa, and to Vibrio cholerae Florfenicol exporter FloR SWALL:Q8VVN0 (EMBL:AY034138) (404 aa) fasta scores: E(): 1.4e-20, 27.82% id in 399 aa, and to Bacillus subtilis bicyclomycin resistance protein YdgK SWALL:P96709 (EMBL:AB001488) (402 aa) fasta scores: E(): 1.6e-20, 23.69% id in 384 aa
YP_111180.1	C-terminal region is similar to Streptomyces avermitilis thioesterase PteH SWALL:Q93H75 (EMBL:AB070949) (255 aa) fasta scores: E(): 2.8e-23, 36.28% id in 226 aa, and Clostridium acetobutylicum thioesterase II of alpha/beta hydrolase superfamily cac1022 SWALL:Q97K97 (EMBL:AE007618) (253 aa) fasta scores: E(): 2.9e-24, 35.34% id in 215 aa. Possible alternative translational start site
YP_111181.1	Similar to Corynebacterium glutamicum hypothetical protein Cgl0569 SWALL:BAB97962 (EMBL:AP005275) (152 aa) fasta scores: E(): 4.7e-11, 34.69% id in 147 aa, and to Anabaena sp. hypothetical protein All0878 SWALL:Q8YYH2 (EMBL:AP003583) (272 aa) fasta scores: E(): 9e-11, 27.67% id in 271 aa, and to Streptomyces coelicolor acetyltransferase sco7150 or sc9a4.12C SWALL:Q9FBU1 (EMBL:AL939130) (278 aa) fasta scores: E(): 2.1e-07, 31.33% id in 233 aa
YP_111182.1	Similar to Anabaena sp. polyketide synthase all2641 SWALL:Q8YTS2 (EMBL:AP003590) (1019 aa) fasta scores: E(): 1.8e-80, 42.77% id in 533 aa, and to Ralstonia solanacearum hypothetical protein rsp0639 or rs03728 SWALL:Q8XS42 (EMBL:AL646079) (537 aa) fasta scores: E(): 9.7e-77, 41.23% id in 519 aa, and to Streptomyces verticillus hypothetical 59.7 kDa protein SWALL:Q9AG77 (EMBL:AF340166) (544 aa) fasta scores: E(): 9.4e-50, 42.08% id in 537 aa
YP_111183.1	Similar to Polyangium cellulosum polyketide synthase EpoB SWALL:Q9L8C8 (EMBL:AF210843) (1832 aa) fasta scores: E(): 2.2e-74, 42.47% id in 664 aa, and to Polyangium cellulosum EpoC SWALL:Q9KIZ8 (EMBL:AF217189) (1832 aa) fasta scores: E(): 9.3e-74, 42.16% id in 664 aa, and to Nostoc sp. GSV224 NosB SWALL:Q9RAH3 (EMBL:AF204805) (1244 aa) fasta scores: E(): 9.1e-73, 45.99% id in 524 aa
YP_111184.1	Similar to Anabaena sp. 90 peptide synthetase AdpA SWALL:Q9K5M2 (EMBL:AJ269505) (2258 aa) fasta scores: E(): 2.2e-72, 29.05% id in 1084 aa, and to Ralstonia solanacearum probable peptide synthetase rsp0642 or rs05859 SWALL:Q8XS39 (EMBL:AL646079) (5953 aa) fasta scores: E(): 1e-66, 33.39% id in 1069 aa, and to Myxococcus xanthus saframycin mx1 synthetase B SafB SWALL:Q50857 (EMBL:U24657) (1770 aa) fasta scores: E(): 4.3e-61, 39.62% id in 593 aa
YP_111185.1	Similar to Polyangium cellulosum polyketide synthase EpoC SWALL:Q9KIZ8 (EMBL:AF217189) (1832 aa) fasta scores: E(): 1.7e-90, 46.7% id in 576 aa, and to Polyangium cellulosum polyketide synthase EpoB SWALL:Q9L8C8 (EMBL:AF210843) (1832 aa) fasta scores: E(): 2.2e-90, 46.52% id in 576 aa, and to Stigmatella aurantiaca MtaD SWALL:Q9RFK8 (EMBL:AF188287) (3291 aa) fasta scores: E(): 2.5e-89, 48.97% id in 537 aa
YP_111186.1	Similar to Streptomyces verticillus polyketide synthase BlmVIII SWALL:Q9FB25 (EMBL:AF210249) (1841 aa) fasta scores: E(): 9.9e-99, 37.09% id in 1143 aa, and to Streptomyces natalensis PimS4 protein Pims4 SWALL:Q9EWA3 (EMBL:AJ278573) (2024 aa) fasta scores: E(): 1.1e-79, 29.41% id in 1785 aa, and to Streptomyces avermitilis modular polyketide synthase PteA5 SWALL:Q93H83 (EMBL:AB070949) (3352 aa) fasta scores: E(): 1.2e-78, 30.65% id in 1579 aa
YP_111187.1	Similar to Agrobacterium tumefaciens non-ribosomal peptide synthetase MtaD or atu3682 or agr_l_2311 SWALL:Q8U9P4 (EMBL:AE009297) (2399 aa) fasta scores: E(): 7.7e-68, 31.58% id in 1086 aa, and to Xanthomonas campestris ATP-dependent serine activating enzyme EntF or xcc3867 SWALL:AAM43098 (EMBL:AE012507) (1326 aa) fasta scores: E(): 5.3e-67, 31.43% id in 1056 aa, and to Xanthomonas axonopodis ATP-dependent serine activating enzyme EntF or xac3922 SWALL:AAM38759 (EMBL:AE012041) (1332 aa) fasta scores: E(): 4e-66, 29.34% id in 1261 aa
YP_111188.1	Similar to Salmonella typhimurium oligopeptidase A PrlC or OpdA or OptA or stm3594 SWALL:OPDA_SALTY (SWALL:P27237) (680 aa) fasta scores: E(): 8e-99, 39.85% id in 685 aa, and to Ralstonia solanacearum probable oligopeptidase A PrlC or rsc1595 or rs03957 SWALL:Q8XZ11 (EMBL:AL646065) (706 aa) fasta scores: E(): 4.5e-124, 47.51% id in 684 aa, and to Xanthomonas campestris oligopeptidase A PrlC or xcc0580 SWALL:AAM39896 (EMBL:AE012156) (674 aa) fasta scores: E(): 3.5e-109, 44.47% id in 688 aa
YP_111189.1	Similar to Ralstonia solanacearum transcriptional activator protein SolR SWALL:SLR2_RALSO (SWALL:O30919) (236 aa) fasta scores: E(): 5.1e-31, 41.02% id in 234 aa, and to Ralstonia solanacearum probable transcriptional activator of quorum sensing autoinducer synthesis transcription regulator protein rsp0778 or rs01929 SWALL:Q8XRQ3 (EMBL:AL646080) (248 aa) fasta scores: E(): 4e-32, 40.08% id in 237 aa, and to Ralstonia solanacearum transcriptional activator protein SolR or rsc3287 or rs02516 SWALL:SLR1_RALSO (SWALL:P58590) (236 aa) fasta scores: E(): 3.2e-31, 40.88% id in 225 aa
YP_111190.1	Weakly similar to an internal reion of Pseudomonas syringae thioesterase SyrC SWALL:Q52401 (EMBL:U25130) (433 aa) fasta scores: E(): 7.1e-07, 23.93% id in 259 aa
YP_111191.1	Similar to Bacillus cereus antiporter GerN SWALL:Q9KI10 (EMBL:AF246294) (387 aa) fasta scores: E(): 3.9e-12, 28.85% id in 402 aa, and to Streptomyces viridochromogenes  transporter AviJ SWALL:Q93KW8 (EMBL:AF333038) (476 aa) fasta scores: E(): 2.5e-38, 33.4% id in 452 aa, and to Nocardia aerocolonigenes  membrane transporter protein rebG SWALL:CAC93721 (EMBL:AB090952) (426 aa) fasta scores: E(): 8.8e-36, 35.89% id in 404 aa
YP_111193.1	Similar to Burkholderia pseudomallei acyl homoserine lactone synthase BpsI SWALL:AAM21707 (EMBL:AF501236) (203 aa) fasta scores: E(): 1.4e-32, 48.7% id in 193 aa, and to Burkholderia cepacia AHL synthase CepI SWALL:Q9AM55 (EMBL:AF330014) (202 aa) fasta scores: E(): 8.6e-35, 47.8% id in 205 aa
YP_111194.1	Similar to Streptomyces pristinaespiralis pristinamycin I synthase I SnbC SWALL:Q54959 (EMBL:X98690) (2591 aa) fasta scores: E(): 6.9e-60, 41.81% id in 507 aa, and to Anabaena sp. hypothetical protein All1695 SWALL:Q8YWC0 (EMBL:AP003586) (1449 aa) fasta scores: E(): 4.5e-62, 41.42% id in 507 aa
YP_111195.1	Similar to the region of Escherichia coli enterobactin synthetase component F EntF or b0586 in which the acyl carrier protein (ACP) is encoded SWALL:ENTF_ECOLI (SWALL:P11454) (1293 aa) fasta scores: E(): 5.7, 40% id in 50 aa, and to Bacillus subtilis peptide synthetase 1 PpsA or Pps1 SWALL:PPS1_BACSU (SWALL:P39845) (2561 aa) fasta scores: E(): 5.4, 38.46% id in 52 aa, and to
YP_111196.1	Similar to Pseudomonas syringae syringomycin biosynthesis enzyme 2 Syrb2 SWALL:Q9RBY6 (EMBL:U25130) (310 aa) fasta scores: E(): 4.5e-72, 53.61% id in 304 aa, and to Pseudomonas syringae CmaB SWALL:O50472 (EMBL:U14657) (262 aa) fasta scores: E(): 1.9e-55, 53.93% id in 267 aa
YP_111197.1	Poor database matches. Similar to an internal region of Streptomyces sp. MA6548 FK506 peptide synthetase fkbP SWALL:Q9ZGA6 (EMBL:AF082100) (1504 aa) fasta scores: E(): 0.59, 31.18% id in 93 aa. Possible gene remnant
YP_111198.1	Poor database matches. Weakly similar to Acinetobacter calcoaceticus p-hydroxybenzoate hydroxylase transcriptional activator pobR SWALL:POBR_ACICA (SWALL:Q43992) (271 aa) fasta scores: E(): 1.1, 40% id in 40 aa
YP_111200.1	Similar to Bacillus halodurans hypothetical protein Bh0875 SWALL:Q9KEH7 (EMBL:AP001510) (335 aa) fasta scores: E(): 3.3e-20, 32.01% id in 328 aa, and to Bacillus subtilis hypothetical protein YwcH or ipa-44D SWALL:YWCH_BACSU (SWALL:P39606) (333 aa) fasta scores: E(): 7.4e-18, 36.17% id in 235 aa, and to Brucella melitensis alkanal monooxygenase alpha chain Bmei0894 SWALL:Q8YHA8 (EMBL:AE009530) (327 aa) fasta scores: E(): 2.2e-17, 32.42% id in 330 aa
YP_111201.1	Similar to Rhizobium leguminosarum 1-aminocyclopropane-1-carboxylate deaminase AcdS SWALL:Q93AG0 (EMBL:AF421376) (339 aa) fasta scores: E(): 2.4e-07, 25.77% id in 291 aa, and to Escherichia coli 1-aminocyclopropane-1-carboxylate deaminase YedO or b1919 SWALL:1A1D_ECOLI (SWALL:P76316) (328 aa) fasta scores: E(): 4.5e-15, 29.58% id in 311 aa, and to Salmonella typhimurium  1-cyclopropane-carboxylate deaminase YedO or stm1953 SWALL:Q8ZNT7 (EMBL:AE008786) (328 aa) fasta scores: E(): 4.5e-15, 29.8% id in 302 aa
YP_111203.1	N-terminus similar to Anabaena sp. 90 peptide synthetase AdpB SWALL:Q9K5M1 (EMBL:AJ269505) (5060 aa) fasta scores: E(): 1e-130, 33.65% id in 1539 aa, and N-terminus similar to Nostoc sp. GSV224 NosD SWALL:Q9RAH1 (EMBL:AF204805) (2450 aa) fasta scores: E(): 3.7e-117, 32.26% id in 1559 aa, and N-terminus similar to Bradyrhizobium japonicum Id930 SWALL:Q9AMR5 (EMBL:AF322013) (3310 aa) fasta scores: E(): 1.4e-110, 36.09% id in 1305 aa
YP_111204.1	C-terminus is similar to Stigmatella aurantiaca peptide synthase/polyketide synthase MtaG SWALL:Q9RFK5 (EMBL:AF188287) (1750 aa) fasta scores: E(): 5.9e-68, 39.81% id in 648 aa, and to Mycobacterium smegmatis peptide synthase/polyketide synthas FxbC SWALL:O87314 (EMBL:AF027770) (4976 aa) fasta scores: E(): 1e-67, 42.6% id in 629 aa
YP_111205.1	Similar to the N-terminus of Streptomyces verticillus peptide synthetase NRPS9-8 BlmX SWALL:Q9FB27 (EMBL:AF210249) (2162 aa) fasta scores: E(): 2.5e-11, 29.57% id in 470 aa, and to the N-terminus of Pseudomonas aeruginosa probable non-ribosomal peptide synthetase pa2302 SWALL:Q9I1H3 (EMBL:AE004656) (2124 aa) fasta scores: E(): 6.1e-10, 30.9% id in 466 aa
YP_111206.1	Similar to Pseudomonas syringae syringomycin biosynthesis enzyme SyrP SWALL:P97053 (EMBL:U88574) (353 aa) fasta scores: E(): 9.3e-40, 36.39% id in 349 aa
YP_111207.1	Similar to central portion of Ralstonia solanacearum probable peptide synthetase rsp0641 or rs05860 SWALL:Q8XS40 (EMBL:AL646079) (6889 aa) fasta scores: E(): 1.4e-124, 33.62% id in 3396 aa, and to N-terminus of Stigmatella aurantiaca StiC protein SWALL:Q8RJY4 (EMBL:AJ421825) (1885 aa) fasta scores: E(): 3.5e-95, 41.69% id in 933 aa, and to N-terminus of Stigmatella aurantiaca StiB protein SWALL:Q8RJY5 (EMBL:AJ421825) (1585 aa) fasta scores: E(): 1.3e-91, 36.35% id in 1268 aa
YP_111210.1	Similar to Rhizobium meliloti probable rhizopine catabolism regulatory protein MocR SWALL:MOCR_RHIME (SWALL:P49309) (493 aa) fasta scores: E(): 1.6e-40, 37.79% id in 471 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa0268 SWALL:Q9I6M2 (EMBL:AE004465) (473 aa) fasta scores: E(): 6.5e-75, 54.37% id in 491 aa, and to Anabaena sp. transcriptional regulator alr4738 SWALL:Q8YN32 (EMBL:AP003597) (490 aa) fasta scores: E(): 4e-53, 39.17% id in 485 aa
YP_111211.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa0269 SWALL:Q9I6M1 (EMBL:AE004465) (145 aa) fasta scores: E(): 6.7e-31, 54.86% id in 144 aa, and to Rhizobium meliloti hypothetical protein r00543 or smc02239 SWALL:Q92S80 (EMBL:AL591784) (153 aa) fasta scores: E(): 7e-31, 52.77% id in 144 aa, and to Agrobacterium tumefaciens hypothetical protein atu0492 or agr_c_871 SWALL:Q8UI08 (EMBL:AE009018) (167 aa) fasta scores: E(): 6.3e-29, 50.35% id in 141 aa
YP_111212.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa0270 pa0270 SWALL:Q9I6M0 (EMBL:AE004465) (135 aa) fasta scores: E(): 1.4e-11, 39.55% id in 134 aa, and to Rhizobium meliloti hypothetical exported protein smb20700 rb1407 or smb20700 SWALL:Q92TT8 (EMBL:AL603647) (137 aa) fasta scores: E(): 5.4e-11, 41.22% id in 131 aa. CDS is extended at the N-terminus in comparison to orthologues
YP_111213.1	catalyzes the conversion of carbamoyl phosphate and aspartate to form N-carbamoyl aspartate
YP_111214.1	Similar to Pseudomonas aeruginosa hydroxamate-type ferrisiderophore receptor PiuA or Fiu or pa4514 SWALL:O68590 (EMBL:AF051690) (753 aa) fasta scores: E(): 1.1e-134, 49.12% id in 741 aa, and to Escherichia coli O157:H7  outer membrane receptor for iron transport z1026 or ecs0883 SWALL:Q8X7W7 (EMBL:AE005261) (760 aa) fasta scores: E(): 7.3e-73, 36.9% id in 775 aa, and to Escherichia coli probable tonB-dependent receptor YbiL precursor or b0805 SWALL:YBIL_ECOLI (SWALL:P75780) (760 aa) fasta scores: E(): 7.3e-73, 36.77% id in 775 aa
YP_111215.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa4516 pa4516 SWALL:Q9HVQ6 (EMBL:AE004865) (271 aa) fasta scores: E(): 2.8e-35, 47.59% id in 229 aa, and to Xanthomonas axonopodis hypothetical protein Xac2943 xac2943 SWALL:AAM37788 (EMBL:AE011936) (252 aa) fasta scores: E(): 5.1e-32, 45.25% id in 232 aa, and to Xanthomonas campestris hypothetical protein Xcc2774 xcc2774 SWALL:AAM42046 (EMBL:AE012390) (252 aa) fasta scores: E(): 7.3e-31, 42.92% id in 226 aa
YP_111216.1	Similar to Pseudomonas aeruginosa iron-uptake factor PiuC SWALL:O68589 (EMBL:AF051690) (226 aa) fasta scores: E(): 1.8e-52, 58.4% id in 226 aa, and to Xanthomonas campestris hypothetical protein Xcc2773SWALL:AAM42045 (EMBL:AE012390) (228 aa) fasta scores: E(): 2.9e-54, 61.13% id in 229 aa, and to Bordetella bronchiseptica hypothetical 25.1 kDa protein SWALL:Q9S3N8 (EMBL:AJ132742) (226 aa) fasta scores: E(): 9.9e-54, 60.17% id in 226 aa
YP_111217.1	Similar to Escherichia coli transposase InsN for insertion sequence element Is911A InsN1 or b0255 SWALL:INN1_ECOLI (SWALL:P75679) (134 aa) fasta scores: E(): 0.45, 29.78% id in 94 aa, and to Bradyrhizobium japonicum Id47 id47 SWALL:Q9ANP5 (EMBL:AF322012) (119 aa) fasta scores: E(): 4.8e-23, 72.81% id in 103 aa, and to Bradyrhizobium japonicum Id62 SWALL:Q9ANN6 (EMBL:AF322012) (119 aa) fasta scores: E(): 2.5e-22, 71.84% id in 103 aa
YP_111218.1	Similar to Ralstonia solanacearum hypothetical protein rsc3217 or rs02434 SWALL:Q8XUH1 (EMBL:AL646074) (90 aa) fasta scores: E(): 1.1e-19, 60.71% id in 84 aa, and to Ralstonia solanacearum hypothetical protein rsc0961 or rs06040 SWALL:Q8Y0T2 (EMBL:AL646061) (88 aa) fasta scores: E(): 3.2e-15, 53.01% id in 83 aa, and to Ralstonia solanacearum hypothetical protein rsp0515 or rs00394 SWALL:Q8XSG1 (EMBL:AL646079) (88 aa) fasta scores: E(): 7e-15, 52.94% id in 85 aa
YP_111219.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa0259 SWALL:Q9I6N0 (EMBL:AE004464) (480 aa) fasta scores: E(): 4.5e-15, 28.39% id in 472 aa
YP_111220.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa0260 SWALL:Q9I6M9 (EMBL:AE004464) (716 aa) fasta scores: E(): 1.7e-24, 31.97% id in 763 aa
YP_111221.1	Similar to Ralstonia solanacearum  VGR-related protein rsc3222 or rs02439 SWALL:Q8XUG6 (EMBL:AL646074) (547 aa) fasta scores: E(): 7.4e-54, 45.28% id in 382 aa, and to Pseudomonas aeruginosa hypothetical protein Pa0262 SWALL:Q9I6M7 (EMBL:AE004464) (1019 aa) fasta scores: E(): 4.1e-43, 31.13% id in 893 aa, and to Pseudomonas aeruginosa hypothetical protein Pa1511 SWALL:Q9I3K1 (EMBL:AE004579) (842 aa) fasta scores: E(): 7.3e-39, 30.09% id in 864 aa
YP_111223.1	Similar to Klebsiella pneumoniae citrate-proton symporter CitH or Cit SWALL:CIT1_KLEPN (SWALL:P16482) (444 aa) fasta scores: E(): 2.2e-19, 25.71% id in 420 aa, and to Rickettsia conorii proline/betaine transporter Prop7 or rc1368 SWALL:Q92FV9 (EMBL:AE008682) (424 aa) fasta scores: E(): 1.1e-27, 26.19% id in 420 aa, and to Rickettsia prowazekii proline/betaine transporter rp881 SWALL:Q9ZC87 (EMBL:AJ235273) (423 aa) fasta scores: E(): 1.2e-27, 26.52% id in 411 aa
YP_111224.1	Similar to Bacillus subtilis thiamine-phosphate pyrophosphorylase ThiE or ThiC or Ipa-26D SWALL:THIE_BACSU (SWALL:P39594) (222 aa) fasta scores: E(): 8.4e-11, 27.32% id in 172 aa, and to Ralstonia solanacearum thiamine-phosphate pyrophosphorylase ThiE2 or rsp0984 or rs02315 SWALL:Q8XR75 (EMBL:AL646082) (198 aa) fasta scores: E(): 6.5e-31, 43.68% id in 190 aa, and to Xanthomonas axonopodis dGTP-pyrophosphohydrolase xac0789 SWALL:AAM35677 (EMBL:AE011709) (315 aa) fasta scores: E(): 1.3e-25, 43.78% id in 185 aa
YP_111225.1	Similar to Ralstonia solanacearum hypothetical protein rsp0327 or rs05439 SWALL:Q8XSZ0 (EMBL:AL646078) (199 aa) fasta scores: E(): 2.3e-33, 60.41% id in 192 aa, and to Caulobacter crescentus hypothetical protein Cc0019 SWALL:Q9AC47 (EMBL:AE005676) (210 aa) fasta scores: E(): 3.4e-14, 43.78% id in 201 aa, and to Rhizobium loti hypothetical protein Mlr0093 SWALL:Q98NL1 (EMBL:AP002994) (536 aa) fasta scores: E(): 3.5e-09, 36.84% id in 190 aa
YP_111226.1	C-terminus similar to Salmonella typhimurium methyl-accepting chemotaxis protein II Tar or Chem or stm1919 SWALL:MCP2_SALTY (SWALL:P02941) (553 aa) fasta scores: E(): 1.9e-53, 56.88% id in 327 aa, and entire protein similar to Ralstonia solanacearum methyl-accepting chemotaxis transducer transmembrane protein rsp1099 or rs02605 SWALL:Q8XQW9 (EMBL:AL646082) (513 aa) fasta scores: E(): 3.3e-87, 52.62% id in 515 aa, and entire protein similar to Ralstonia solanacearum probable methyl-accepting chemotaxis transducer transmembrane protein rsc1155 or rs04596 SWALL:Q8Y089 (EMBL:AL646063) (629 aa) fasta scores: E(): 9.5e-83, 50.87% id in 515 aa
YP_111227.1	Similar to Neisseria meningitidis penicillin-binding protein 2 PenA or nma2072 or nmb0413 SWALL:PBP2_NEIMA (SWALL:P11882) (581 aa) fasta scores: E(): 1.2e-81, 44.13% id in 580 aa, and to Ralstonia solanacearum probable penicillin-binding 3 precursor Pbp-3 transmembrane protein ftsi or rsc2850 or rs00255 SWALL:Q8XVI1 (EMBL:AL646072) (595 aa) fasta scores: E(): 1.9e-107, 51.9% id in 578 aa, and to Neisseria meningitidis penicillin-binding protein 2 PenA SWALL:Q51098 (EMBL:X59630) (582 aa) fasta scores: E(): 7.3e-82, 44.63% id in 578 aa
YP_111228.1	Similar to Escherichia coli L-arabinose-binding periplasmic protein precursor AraF or b1901 SWALL:ARAF_ECOLI (SWALL:P02924) (329 aa) fasta scores: E(): 2.9e-51, 46.08% id in 319 aa, and to Ralstonia solanacearum probable L-arabinose-binding periplasmic AraF or rsc2758 or rs00096 SWALL:Q8XVS1 (EMBL:AL646071) (331 aa) fasta scores: E(): 7.5e-77, 64.46% id in 318 aa, and to Rhizobium meliloti  ABC transporter periplasmic sugar-binding protein rb0490 or smb20508 SWALL:Q92W55 (EMBL:AL603643) (327 aa) fasta scores: E(): 1.7e-66, 55.55% id in 324 aa
YP_111229.1	Similar to Escherichia coli oxidoreductase UcpA or b2426 SWALL:UCPA_ECOLI (SWALL:P37440) (263 aa) fasta scores: E(): 9.6e-19, 35.03% id in 254 aa, and to Agrobacterium tumefaciens short-chain dehydrogenase atu2597 or agr_c_4705 SWALL:Q8UCA1 (EMBL:AE009206) (261 aa) fasta scores: E(): 7.8e-32, 46.03% id in 252 aa, and to Rhizobium meliloti  oxidoreductase, Sdr superfamily protein rb0825 or smb21159 SWALL:Q92V84 (EMBL:AL603645) (258 aa) fasta scores: E(): 2.7e-29, 43.47% id in 253 aa
YP_111230.1	Similar to Yersinia enterocolitica efflux pump/antiporter RosB SWALL:Q56876 (EMBL:U46859) (563 aa) fasta scores: E(): 5.1e-42, 46.44% id in 562 aa, and to Rhizobium meliloti  transport protein ra0872 or sma1600 SWALL:Q92YK4 (EMBL:AE007274) (584 aa) fasta scores: E(): 1.1e-95, 51.13% id in 573 aa, and to Brucella melitensis potassium/proton antiporter rosb bmei0679 SWALL:Q8YHW7 (EMBL:AE009509) (619 aa) fasta scores: E(): 1.1e-94, 50.52% id in 576 aa
YP_111231.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa3325 SWALL:Q9HYS0 (EMBL:AE004754) (295 aa) fasta scores: E(): 2.8e-58, 49.14% id in 291 aa, and to Streptomyces coelicolor hypothetical protein sco2221 or sc10b7.16 SWALL:Q9KZ16 (EMBL:AL939111) (296 aa) fasta scores: E(): 6.4e-46, 46.66% id in 285 aa, and to Mycobacterium tuberculosis hypothetical protein rv2777c or mt2847 or mtv002.42C SWALL:O33319 (EMBL:AL008967) (393 aa) fasta scores: E(): 1.1e-41, 39.22% id in 283 aa
YP_111232.1	Similar to Synechocystis sp. hypothetical protein Sll0173 SWALL:Q55557 (EMBL:D63999) (352 aa) fasta scores: E(): 2.4e-16, 31.06% id in 264 aa, and to Streptomyces coelicolor  hydrolase sco4449 or scd6.27C SWALL:Q9KZX7 (EMBL:AL939120) (299 aa) fasta scores: E(): 3.8e-05, 26.2% id in 290 aa, and to Ralstonia solanacearum  hydrolase transmembrane protein rsp0135 or rs02985 SWALL:Q8XTH5 (EMBL:AL646076) (349 aa) fasta scores: E(): 7.7e-05, 32.16% id in 286 aa
YP_111235.1	Similar to Streptomyces coelicolor hypothetical protein sco7282 or sc5h1.10C SWALL:Q9X7R8 (EMBL:AL939131) (160 aa) fasta scores: E(): 4.2e-28, 50.31% id in 159 aa, and to Bradyrhizobium japonicum Blr2409 protein SWALL:BAC47674 (EMBL:AP005943) (162 aa) fasta scores: E(): 7e-25, 42.4% id in 158 aa, and to Rhizobium loti hypothetical protein Mll5357 SWALL:Q98C01 (EMBL:AP003006) (156 aa) fasta scores: E(): 3.2e-24, 44.23% id in 156 aa
YP_111236.1	Similar to Pseudomonas fluorescens CmaX SWALL:Q9S4T9 (EMBL:AF115334) (331 aa) fasta scores: E(): 3.2e-19, 28.32% id in 293 aa, and to Pseudomonas aeruginosa hypothetical protein Pa1873 SWALL:Q9I2M4 (EMBL:AE004613) (340 aa) fasta scores: E(): 2.9e-77, 62.91% id in 329 aa, and to Pseudomonas aeruginosa cytoplasmic membrane-associated protein CmaX or pa1773 SWALL:Q9ZIH2 (EMBL:AF027290) (332 aa) fasta scores: E(): 1.1e-22, 28.48% id in 337 aa
YP_111237.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7  aga operon transcriptional repressor AgaR or b3131 or c3886 or z4483 or ecs4009 SWALL:AGAR_ECOLI (SWALL:P42902) (269 aa) fasta scores: E(): 1.1e-14, 28.62% id in 248 aa, and to Rhizobium loti transcriptional regulator mlr6641 SWALL:Q988Q4 (EMBL:AP003009) (238 aa) fasta scores: E(): 3.5e-46, 61.68% id in 214 aa, and to Rhizobium meliloti transcription regulator protein r03273 or smc03890 SWALL:Q92L17 (EMBL:AL591793) (260 aa) fasta scores: E(): 1.4e-31, 42.97% id in 249 aa
YP_111238.1	Similar to Yersinia pestis  membrane protein ypo1221 or y2967 SWALL:Q8ZGR2 (EMBL:AJ414147) (384 aa) fasta scores: E(): 1.7e-54, 46.32% id in 367 aa, and to Rhizobium meliloti  transport protein r03272 or smc03889 SWALL:Q92L18 (EMBL:AL591793) (379 aa) fasta scores: E(): 3.4e-36, 36.43% id in 365 aa, and to Agrobacterium tumefaciens MFS permease atu2724 or agr_c_4938 SWALL:Q8UBX5 (EMBL:AE009218) (398 aa) fasta scores: E(): 1.3e-34, 32.33% id in 368 aa
YP_111239.1	Similar to Yersinia pestis hypothetical protein Ypo4064 ypo4064 SWALL:Q8Z9X3 (EMBL:AJ414160) (150 aa) fasta scores: E(): 5.2e-26, 51.02% id in 147 aa
YP_111240.1	Similar to Rhodobacter sphaeroides periplasmic sorbitol-binding protein smoE SWALL:O30831 (EMBL:AF018073) (436 aa) fasta scores: E(): 2.4e-22, 28.47% id in 432 aa, and to the C-terminus of Yersinia pestis hypothetical protein similar to af039956_5 sinorhizobium fredii ypo1893 or y2417 SWALL:Q9ZC22 (EMBL:AL031866) (422 aa) fasta scores: E(): 6.2e-37, 33.87% id in 434 aa, and to Rhizobium meliloti probable sorbitol-binding periplasmic protein smoE or r02445 or smc01496 SWALL:Q92N02 (EMBL:AL591790) (436 aa) fasta scores: E(): 2e-23, 29.13% id in 429 aa
YP_111241.1	Similar to Streptococcus pneumoniae  binding protein dependent ORF-3 SWALL:Q54725 (EMBL:U43526) (294 aa) fasta scores: E(): 4.9e-26, 31.93% id in 285 aa, and to Rhizobium loti sugar ABC transporter permease mlr4912 SWALL:Q98D12 (EMBL:AP003005) (290 aa) fasta scores: E(): 1.9e-63, 60.77% id in 283 aa, and to Yersinia pestis similar to many ypo1894 or y2416 SWALL:Q9ZC23 (EMBL:AL031866) (286 aa) fasta scores: E(): 1.3e-31, 33.81% id in 278 aa
YP_111242.1	Similar to Rhizobium meliloti ThuG or rb0313 or smb20327 SWALL:Q9R9Q5 (EMBL:AF175299) (276 aa) fasta scores: E(): 9.7e-24, 35.33% id in 266 aa, and to Rhizobium loti sugar ABC transporter permease mlr4913 SWALL:Q98D11 (EMBL:AP003005) (276 aa) fasta scores: E(): 4.3e-58, 57.99% id in 269 aa, and to Pseudomonas fluorescens probable ABC transporter permease MtlG SWALL:O30493 (EMBL:AF007800) (276 aa) fasta scores: E(): 1.9e-26, 35.24% id in 261 aa
YP_111243.1	Similar to Candida sp. HA167 xylitol dehydrogenase Xdh SWALL:O74230 (EMBL:AF072541) (353 aa) fasta scores: E(): 2.5e-40, 40.95% id in 337 aa, and to Agrobacterium tumefaciens xylitol dehydrogenase atu4318 or agr_l_1091 SWALL:Q8U7Y1 (EMBL:AE009360) (350 aa) fasta scores: E(): 1.1e-78, 62.35% id in 348 aa, and to Rhizobium loti xylitol mlr4915 SWALL:Q98D10 (EMBL:AP003005) (348 aa) fasta scores: E(): 1.2e-76, 62.75% id in 341 aa
YP_111244.1	Similar to Bacillus pseudofirmus maltose transportor ATP-binding protein malK SWALL:O87551 (EMBL:AF084104) (366 aa) fasta scores: E(): 1.3e-51, 50.14% id in 355 aa, and to Rhizobium loti sugar ABC transporter ATP-binding protein mlr4917 SWALL:Q98D09 (EMBL:AP003005) (363 aa) fasta scores: E(): 1.2e-60, 58.21% id in 347 aa, and to Brucella melitensis maltose/maltodextrin transport ATP-binding protein malK bmeI1713 SWALL:Q8YF14 (EMBL:AE009605) (363 aa) fasta scores: E(): 2.3e-55, 53.46% id in 361 aa
YP_111245.1	Similar to Pseudomonas fluorescens activator protein mtlR SWALL:O52770 (EMBL:AF047527) (301 aa) fasta scores: E(): 1.2e-38, 39.33% id in 300 aa, and to Agrobacterium tumefaciens transcriptional regulator, AraC family atu4319 or agr_l_1086 SWALL:Q8U7Y0 (EMBL:AE009360) (305 aa) fasta scores: E(): 3.9e-51, 46.29% id in 283 aa
YP_111246.1	Similar to Klebsiella pneumoniae D-xylulose-kinase DalK SWALL:O52719 (EMBL:AF045245) (487 aa) fasta scores: E(): 4.7e-98, 52.92% id in 478 aa, and to Ralstonia solanacearum  D-arabinitol kinase DalK or rsc2128 or rs01476 SWALL:Q8XXI5 (EMBL:AL646068) (491 aa) fasta scores: E(): 9.3e-100, 55.8% id in 482 aa
YP_111247.1	Similar to Pseudomonas putida D-alanyl-D-alanine carboxypeptidase DacA or pp4803 SWALL:AAN70372 (EMBL:AE016792) (386 aa) fasta scores: E(): 3.1e-33, 42.75% id in 276 aa, and to Ralstonia solanacearum probable penicillin-binding Dac or rsc0327 or rs03294 SWALL:Q8Y2K8 (EMBL:AL646058) (397 aa) fasta scores: E(): 4.4e-45, 44.87% id in 312 aa, and to Xanthomonas axonopodis penicillin-binding protein 6 DacC or xac0664 SWALL:Q8PPM2 (EMBL:AE011695) (401 aa) fasta scores: E(): 1.2e-33, 38.8% id in 268 aa
YP_111248.1	Similar to Neisseria gonorrhoeae penicillin-binding protein 2 PenA SWALL:PBP2_NEIGO (SWALL:P08149) (581 aa) fasta scores: E(): 1.9e-65, 37.97% id in 574 aa, and to Ralstonia solanacearum probable penicillin-binding 3 precursor pbp-3 transmembrane protein FtsI or rsc2850 or rs00255 SWALL:Q8XVI1 (EMBL:AL646072) (595 aa) fasta scores: E(): 1e-84, 46.4% id in 556 aa, and to Xanthomonas axonopodis penicillin-binding protein 3 FtsI or xac0774 SWALL:AAM35662 (EMBL:AE011708) (622 aa) fasta scores: E(): 2.7e-68, 40.76% id in 547 aa
YP_111249.1	Possible fusion protein. N-terminal region is similar to Synechococcus sp. nitrate reductase NarB SWALL:NARB_SYNP7 (SWALL:P39458) (729 aa) fasta scores: E(): 9.4e-73, 43.09% id in 724 aa. C-terminal region is similar to Escherichia coli sulfite reductase [NADPH] flavoprotein alpha-component CysJ SWALL:CYSJ_ECOLI (SWALL:P38038) (598 aa) fasta scores: E(): 8.1e-70, 39.13% id in 598 aa
YP_111250.1	Similar to Escherichia coli, and Escherichia coli O157:H7 nitrite reductase [NAD(P)H] NirD or b3366 or z4727 or ecs4217 SWALL:NIRD_ECOLI (SWALL:P23675) (108 aa) fasta scores: E(): 5.4e-14, 46.29% id in 108 aa, and to Ralstonia solanacearum probable nitrite reductase NADPH NirD or rsp1221 or rs03165 SWALL:Q8XQK3 (EMBL:AL646083) (113 aa) fasta scores: E(): 2.3e-29, 70% id in 110 aa, and to Yersinia pestis nitrite reductase NirD or ypo0160 or y3944 SWALL:Q8ZJE9 (EMBL:AJ414141) (108 aa) fasta scores: E(): 9.3e-17, 48.64% id in 111 aa
YP_111251.1	Similar to Escherichia coli nitrite reductase [NAD(P)H] NirB or b3365 SWALL:NIRB_ECOLI (SWALL:P08201) (847 aa) fasta scores: E(): 3.8e-212, 61.02% id in 839 aa, and to Ralstonia solanacearum probable nitrite reductase NADPH NirB or rsp1222 or rs03166 SWALL:Q8XQK2 (EMBL:AL646083) (852 aa) fasta scores: E(): 0, 78.9% id in 839 aa
YP_111252.1	Similar to Cylindrotheca fusiformis nitrate transporter Nat1 SWALL:Q9SWR7 (EMBL:AF135038) (482 aa) fasta scores: E(): 1.4e-51, 38.79% id in 415 aa, and to Ralstonia solanacearum probable high affinity nitrate transporter transmembrane protein rsp1223 or rs03167 SWALL:Q8XQK1 (EMBL:AL646083) (441 aa) fasta scores: E(): 2e-120, 71.33% id in 436 aa, and to Skeletonema costatum nitrate transporter SWALL:Q8RY50 (EMBL:AY078280) (487 aa) fasta scores: E(): 8.7e-53, 38.39% id in 435 aa
YP_111253.1	Similar to Pseudomonas fluorescens uroporphyrin-III c-methyltransferase CobA SWALL:SUMT_PSEFL (SWALL:P37725) (247 aa) fasta scores: E(): 2.2e-32, 46.38% id in 235 aa, and to Xanthomonas campestris uroporphyrin-III c-methyltransferase CysG or xcc2010 SWALL:AAM41299 (EMBL:AE012305) (258 aa) fasta scores: E(): 1.5e-49, 63.55% id in 236 aa, and to Pseudomonas aeruginosa uroporphyrin-III c-methyltransferase CobA or pa1778 SWALL:Q9I2W4 (EMBL:AE004603) (245 aa) fasta scores: E(): 5e-37, 51.31% id in 228 aa; possible alternative start site at codon 41 and codon 44
YP_111254.1	Similar to Azotobacter vinelandii NasT SWALL:Q44531 (EMBL:X83602) (192 aa) fasta scores: E(): 9.3e-28, 45.69% id in 186 aa, and to Xanthomonas campestris histidine kinase/response regulator hybrid protein NasT or xcc2004 SWALL:AAM41293 (EMBL:AE012305) (190 aa) fasta scores: E(): 2e-36, 60.87% id in 184 aa. Possible alternative translational start site
YP_111255.1	Similar to Klebsiella oxytoca nitrate transporter component NasF SWALL:Q48466 (EMBL:L27431) (418 aa) fasta scores: E(): 3.3e-57, 45.55% id in 349 aa, and to Pseudomonas aeruginosa hypothetical protein Pa1786 SWALL:Q9I2V6 (EMBL:AE004604) (402 aa) fasta scores: E(): 6.3e-65, 53.17% id in 346 aa, and to Xanthomonas campestris nitrate transport ATP-binding protein NasF or xcc2005 SWALL:AAM41294 (EMBL:AE012305) (356 aa) fasta scores: E(): 2.4e-63, 51.03% id in 339 aa, and to Ralstonia solanacearum  nitrate transporter protein NasF or rsc0381 or rs03349 SWALL:Q8Y2F5 (EMBL:AL646058) (420 aa) fasta scores: E(): 5.6e-63, 48.98% id in 345 aa
YP_111256.1	involved in the first step of tetrahydrofolate biosynthesis; catalyzes the formation of formate and 2-amino-4-hydroxy-6-(erythro-1,2, 3-trihydroxypropyl)dihydropteridine triphosphate from GTP and water; forms a homopolymer
YP_111258.1	Similar to Mycoplana ramosa acetylpolyamine aminohydrolase AphA or Aph SWALL:APHA_MYCRA (SWALL:Q48935) (341 aa) fasta scores: E(): 1e-41, 37.46% id in 339 aa, and to Rhizobium loti acetylpolyamine aminohydrolase mll0103 SWALL:Q98NK3 (EMBL:AP002994) (342 aa) fasta scores: E(): 9.4e-59, 45.85% id in 338 aa, and to Pseudomonas aeruginosa acetylpolyamine aminohydrolase AphA or pa1409 SWALL:Q9I3T5 (EMBL:AE004570) (346 aa) fasta scores: E(): 1.5e-50, 43.64% id in 346 aa
YP_111259.1	allantoate amidohydrolase and N-carbamoyl-L-amino acid amidohydrolase are very similar; the allantoate amidohydrolase from Escherichia coli forms a dimer and binds zinc ions for catalytic activity and catalyzes the conversion of allantoate to (S)-ureidoglycolate and ammonia; carbamoyl amidohydrolase from Bacillus sp. converts N-carbamoyl amino acids to amino acids, ammonia, and carbon dioxide
YP_111260.1	Similar to Escherichia coli shikimate transporter ShiA or b1981 SWALL:SHIA_ECOLI (SWALL:P76350) (438 aa) fasta scores: E(): 5.4e-52, 36.34% id in 421 aa, and to Pseudomonas aeruginosa probable MFS transporter pa3595 SWALL:Q9HY31 (EMBL:AE004780) (469 aa) fasta scores: E(): 2.9e-66, 44.17% id in 446 aa, and to Rhodococcus sp  3- ohpA SWALL:Q9KH22 (EMBL:AF274045) (468 aa) fasta scores: E(): 8.3e-59, 40.54% id in 439 aa
YP_111261.1	Similar to Thiobacillus denitrificans CbbR SWALL:Q9APD4 (EMBL:AF307090) (316 aa) fasta scores: E(): 5.5e-15, 27.97% id in 286 aa, and to the Acinetobacter lwoffii fragment of hypothetical 14.1 kDa protein SWALL:O86998 (EMBL:U77659) (124 aa) fasta scores: E(): 8.5e-36, 78.51% id in 121 aa, and to Rhizobium meliloti transcriptional regulator, LysR family protein rb0846 or smb21180 SWALL:Q92V68 (EMBL:AL603645) (317 aa) fasta scores: E(): 1.2e-35, 37.93% id in 290 aa
YP_111262.1	Similar to Bradyrhizobium japonicum fragment of GstR SWALL:O67999 (EMBL:AF007569) (342 aa) fasta scores: E(): 2e-25, 35.25% id in 295 aa, and to Rhizobium meliloti transcriptional regulator protein rb0476 or smb20494 SWALL:Q92W69 (EMBL:AL603643) (298 aa) fasta scores: E(): 6.1e-54, 53.92% id in 293 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa2534 SWALL:Q9I0V0 (EMBL:AE004681) (303 aa) fasta scores: E(): 8.8e-53, 53% id in 300 aa. CDS is extended at the C-terminus in comparison to some orthologues
YP_111263.1	Similar to Picea abies short-chain type dehydrogenase/reductase SWALL:SDR1_PICAB (SWALL:Q08632) (271 aa) fasta scores: E(): 8.8e-29, 44.84% id in 252 aa, and to Rhizobium loti probable short chain dehydrogenase mll1981 SWALL:Q98JE4 (EMBL:AP002998) (258 aa) fasta scores: E(): 9.7e-50, 59.83% id in 239 aa, and to Rhizobium meliloti  short chain dehydrogenase/reductase rb0475 or smb20493 SWALL:Q92W70 (EMBL:AL603643) (244 aa) fasta scores: E(): 1.4e-48, 58.57% id in 239 aa, and to Xanthomonas axonopodis short chain dehydrogenase xac0083 SWALL:AAM34975 (EMBL:AE011631) (245 aa) fasta scores: E(): 1.3e-47, 58.02% id in 243 aa
YP_111264.1	Similar to Ralstonia solanacearum hypothetical protein rsc3367 or rs02642 SWALL:Q8XU27 (EMBL:AL646075) (482 aa) fasta scores: E(): 1.7e-58, 41.97% id in 467 aa, and to Ralstonia solanacearum hypothetical protein rsp1421 or rs03121 SWALL:Q8XQ65 (EMBL:AL646084) (383 aa) fasta scores: E(): 3.2e-12, 29.95% id in 227 aa, and to Mycobacterium tuberculosis hypothetical 38.7 kDa protein Mcr or rv1143 or mt1176 or mtci65.10 SWALL:O06543 (EMBL:Z95584) (395 aa) fasta scores: E(): 5.8e-12, 33.64% id in 211 aa
YP_111265.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa2197 SWALL:Q9I1S0 (EMBL:AE004646) (345 aa) fasta scores: E(): 4.7e-89, 67.44% id in 344 aa, and to Escherichia coli  NADP-dependent oxidoreductase YncB or b1449 SWALL:YNCB_ECOLI (SWALL:P76113) (353 aa) fasta scores: E(): 9.5e-85, 64.53% id in 344 aa, and to Escherichia coli O157:H7  oxidoreductase YncB or z2270 or ecs2053 SWALL:Q8X9W9 (EMBL:AE005361) (376 aa) fasta scores: E(): 1e-84, 64.53% id in 344 aa
YP_111266.1	Similar to Clostridium acetobutylicum NADH-dependent butanol dehydrogenase B BdhB or cac3298 SWALL:ADHB_CLOAB (SWALL:Q04945) (390 aa) fasta scores: E(): 1.1e-46, 39.72% id in 360 aa, and to Zymomonas mobilis NADH-dependent butanol dehydrogenase YugJ SWALL:Q9Z659 (EMBL:AF102543) (385 aa) fasta scores: E(): 2.8e-101, 67.79% id in 385 aa, and to Salmonella typhi probable alcohol dehydrogenase sty3337 SWALL:Q8Z3Q2 (EMBL:AL627277) (387 aa) fasta scores: E(): 3.2e-95, 63.99% id in 386 aa
YP_111267.1	Limited similarity to Escherichia coli O157:H7 plasmid pO157 DNA, complete sequence l7031 SWALL:O82882 (EMBL:AB011549) (898 aa) fasta scores: E(): 4.8e-13, 24.09% id in 332 aa
YP_111268.1	Similar to Ralstonia solanacearum hypothetical protein rsp0610 ror rs03757 SWALL:Q8XS71 (EMBL:AL646079) (110 aa) fasta scores: E(): 1.3e-33, 85.32% id in 109 aa, and to Neisseria meningitidis hypothetical protein Nma0986 SWALL:Q9JV57 (EMBL:AL162754) (106 aa) fasta scores: E(): 1.3e-11, 47.05% id in 102 aa, and to Neisseria meningitidis hypothetical protein Nmb0775 SWALL:Q9K047 (EMBL:AE002431) (106 aa) fasta scores: E(): 2.2e-10, 46.8% id in 94 aa
YP_111269.1	Similar to Ralstonia solanacearum hypothetical protein rsp1480 or rs03063 SWALL:Q8XQ06 (EMBL:AL646085) (246 aa) fasta scores: E(): 8.9e-39, 60.61% id in 259 aa, and to Xanthomonas axonopodis hypothetical protein Xac3752 SWALL:AAM38595 (EMBL:AE012024) (236 aa) fasta scores: E(): 7.8e-22, 46.61% id in 251 aa, and to Xanthomonas campestris hypothetical protein Xcc3710 SWALL:AAM42968 (EMBL:AE012492) (248 aa) fasta scores: E(): 1.2e-20, 45.07% id in 264 aa
YP_111270.1	Similar to Ralstonia solanacearum probable transmembrane protein rsp1481 or rs03062 SWALL:Q8XQ05 (EMBL:AL646085) (698 aa) fasta scores: E(): 1.6e-108, 53.09% id in 938 aa, and to Xanthomonas campestris hypothetical protein Xcc3711 xcc3711 SWALL:AAM42969 (EMBL:AE012492) (896 aa) fasta scores: E(): 2.9e-71, 48.25% id in 943 aa, and to Xanthomonas axonopodis hypothetical protein Xac3753 SWALL:AAM38596 (EMBL:AE012024) (452 aa) fasta scores: E(): 1.2e-68, 56.05% id in 421 aa
YP_111271.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein rs03061 SWALL:Q8XQ04 (EMBL:AL646085) (215 aa) fasta scores: E(): 1.8e-65, 81.86% id in 215 aa. C-terminus is similar to the C-terminal region of Bacillus subtilis chemotaxis MotB protein SWALL:MOTB_BACSU (SWALL:P28612) (261 aa) fasta scores: E(): 5.9e-05, 30% id in 130 aa
YP_111272.1	Similar to Ralstonia solanacearum hypothetical protein rsp1483 or rs03060 SWALL:Q8XQ03 (EMBL:AL646085) (219 aa) fasta scores: E(): 5.4e-14, 47.14% id in 280 aa, and to Xanthomonas campestris hypothetical protein Xcc3713 xcc3713 SWALL:Q8P4J4 (EMBL:AE012492) (237 aa) fasta scores: E(): 3.2e-07, 38.54% id in 262 aa, and to Xanthomonas axonopodis hypothetical protein Xac3755 SWALL:Q8PG62 (EMBL:AE012024) (440 aa) fasta scores: E(): 2e-06, 35.86% id in 276 aa. The coding sequence is contains a long repeat sequence (gcgcct x12) near the N-terminus
YP_111273.1	Similar to Bacillus subtilis siderophore synthase DhbF SWALL:Q9R9I2 (EMBL:AF184977) (2378 aa) fasta scores: E(): 1.1e-119, 41.63% id in 1052 aa, and to Streptomyces chrysomallus actinomycin synthetase II AcmB SWALL:O68487 (EMBL:AF047717) (2611 aa) fasta scores: E(): 3.6e-165, 49.07% id in 1076 aa, and to Pseudomonas syringae syringopeptin synthetase SypA SWALL:Q9FDB3 (EMBL:AF286216) (1261 aa) fasta scores: E(): 5.2e-123, 39.61% id in 1083 aa
YP_111274.1	Similar to Streptomyces avermitilis MbtH-like protein SWALL:Q93GZ2 (EMBL:AB070956) (72 aa) fasta scores: E(): 3.6e-14, 53.84% id in 65 aa, and to Amycolatopsis mediterranei hypothetical 7.8 kDa protein SWALL:Q939Y8 (EMBL:Y16952) (69 aa) fasta scores: E(): 7.7e-15, 61.9% id in 63 aa
YP_111275.1	Similar to Escherichia coli tetracycline resistance protein, class A TetA SWALL:TCR1_ECOLI (SWALL:P02982) (399 aa) fasta scores: E(): 4.6e-38, 35.75% id in 400 aa, and to Xanthomonas axonopodis tetracycline-efflux transporter TetA or xac4295 SWALL:AAM39125 (EMBL:AE012083) (421 aa) fasta scores: E(): 3.8e-46, 40.75% id in 400 aa, and to Xanthomonas campestris tetracycline-efflux transporter TetA or xcc4156 SWALL:AAM43372 (EMBL:AE012541) (420 aa) fasta scores: E(): 5.9e-43, 36.85% id in 407 aa
YP_111276.1	Similar to C-terminus of Aphanizomenon ovalisporum peptide synthetase AoaB SWALL:AAM33468 (EMBL:AF395828) (1869 aa) fasta scores: E(): 5.4e-125, 35.68% id in 1841 aa, and to C-terminus of Stigmatella aurantiaca MtaD SWALL:Q9RFK8 (EMBL:AF188287) (3291 aa) fasta scores: E(): 7.3e-124, 29.54% id in 3368 aa
YP_111277.1	Limited similarity to Caulobacter crescentus hypothetical protein Cc3057 SWALL:Q9A3Z3 (EMBL:AE005969) (261 aa) fasta scores: E(): 0.00043, 28.19% id in 227 aa
YP_111278.1	Similar to Streptomyces avermitilis hypothetical protein SWALL:Q93HB6 (EMBL:AB070946) (88 aa) fasta scores: E(): 4.5e-11, 53.33% id in 75 aa, and to Anabaena sp. hypothetical protein Alr4059 alr4059 SWALL:Q8YPY1 (EMBL:AP003595) (126 aa) fasta scores: E(): 1.2e-05, 34.61% id in 78 aa
YP_111279.1	Similar to Streptomyces avermitilis acyl-CoA dehydrogenase SWALL:Q93HB7 (EMBL:AB070946) (609 aa) fasta scores: E(): 1.3e-71, 47.28% id in 590 aa, and to Anabaena sp. hypothetical protein Alr4058 alr4058 SWALL:Q8YPY2 (EMBL:AP003595) (602 aa) fasta scores: E(): 1.7e-37, 31.36% id in 577 aa, and to Rhizobium meliloti isovaleryl-CoA dehydrogenase IvdH or rb0700 or smb21121 SWALL:Q92VK1 (EMBL:AL603644) (387 aa) fasta scores: E(): 3.1e-13, 28% id in 375 aa
YP_111280.1	Similar to Streptomyces avermitilis acyl-CoA dehydrogenase SWALL:Q93HB7 (EMBL:AB070946) (609 aa) fasta scores: E(): 1.2e-53, 36.45% id in 587 aa, and to Anabaena sp. hypothetical protein Alr4058 alr4058 SWALL:Q8YPY2 (EMBL:AP003595) (602 aa) fasta scores: E(): 1.1e-65, 38.39% id in 586 aa
YP_111281.1	Similar to N-terminus of Myxococcus xanthus saframycin Mx1 synthetase B SafB SWALL:Q50857 (EMBL:U24657) (1770 aa) fasta scores: E(): 1.5e-78, 43.85% id in 586 aa, and to entire protein Anabaena sp. hypothetical protein Alr4057 alr4057 SWALL:Q8YPY3 (EMBL:AP003595) (602 aa) fasta scores: E(): 1.5e-75, 41.27% id in 596 aa, and to N-terminus of Streptomyces coelicolor polyketide synthase sco5892 or sc3f7.12 SWALL:O54155 (EMBL:AL939125) (2297 aa) fasta scores: E(): 2.2e-75, 43.69% id in 579 aa
YP_111282.1	Similar to Pseudomonas syringae RNA polymerase sigma factor HrpL SWALL:HRPL_PSESY (SWALL:P37929) (184 aa) fasta scores: E(): 7e-10, 31.09% id in 164 aa, and to Ralstonia solanacearum probable RNA polymerase sigma factor transcription regulator protein rsp1651 or rs02210 SWALL:Q8XPI9 (EMBL:AL646086) (208 aa) fasta scores: E(): 4.6e-14, 38.23% id in 170 aa, and to Rhizobium meliloti rpoE6 RNA polymerase sigma factor rpoE6 or ra0075 or sma0143 SWALL:Q930W9 (EMBL:AE007202) (201 aa) fasta scores: E(): 8.2e-14, 37.03% id in 162 aa
YP_111283.1	Similar to Ralstonia solanacearum hypothetical protein rsc3277 or rs02506 SWALL:Q8XUB4 (EMBL:AL646074) (195 aa) fasta scores: E(): 5.3e-51, 73.95% id in 192 aa, and to Streptomyces coelicolor hypothetical protein sco1302 or scbac36f5.13C SWALL:Q93IW8 (EMBL:AL939108) (208 aa) fasta scores: E(): 4.2e-21, 40.41% id in 193 aa, and to Pseudomonas aeruginosa hypothetical protein Pa0168 SWALL:Q9I6W4 (EMBL:AE004454) (196 aa) fasta scores: E(): 3.3e-18, 39.47% id in 190 aa
YP_111284.1	Similar to Ralstonia metallidurans CnrT protein SWALL:Q9L3G0 (EMBL:AJ276513) (351 aa) fasta scores: E(): 3.5e-84, 65.16% id in 356 aa, and to Ralstonia solanacearum probable cobalt-nickel-resistance system transmembrane protein CnrT or rsp1044 or rs02381 SWALL:Q8XR24 (EMBL:AL646082) (352 aa) fasta scores: E(): 1.1e-86, 68.07% id in 354 aa
YP_111285.1	Similar to Deinococcus radiodurans hypothetical protein Dr1724 SWALL:Q9RTN3 (EMBL:AE002014) (441 aa) fasta scores: E(): 2.5e-08, 27% id in 437 aa, and to Deinococcus radiodurans orf509E (fragment) SWALL:O83031 (EMBL:AB016803) (324 aa) fasta scores: E(): 1.2e-07, 28.34% id in 321 aa
YP_111286.1	Weakly similar to Rhizobium loti MLL5233 protein SWALL:Q98CA4 (EMBL:AP003006) (219 aa) fasta scores: E(): 4.6e-05, 25.72% id in 206 aa. N-terminus similar to the N-terminal region of Anabaena sp. transcriptional regulator SWALL:Q8YQT9 (EMBL:AP003594) (192 aa) fasta scores: E(): 9.8e-10, 34% id in 150 aa
YP_111287.1	threonine deaminase; threonine dehydratase; in Escherichia coli, IlvA is part of the isoleucine biosynthetic pathway
YP_111289.1	Similar to Pseudomonas aeruginosa hypothetical protein pa2428 SWALL:Q9I154 (EMBL:AE004670) (304 aa) fasta scores: E(): 2.3e-90, 74.57% id in 295 aa, and to Rhizobium meliloti hypothetical protein ra0092 or sma0172 SWALL:Q930V2 (EMBL:AE007203) (306 aa) fasta scores: E(): 7.9e-73, 62.75% id in 298 aa
YP_111291.1	Similar to Klebsiella pneumoniae MceH SWALL:Q93GK4 (EMBL:AF063590) (413 aa) fasta scores: E(): 1.6e-14, 24.01% id in 404 aa, and to Xylella fastidiosa colicin V secretion protein xf1216 SWALL:Q9PE12 (EMBL:AE003955) (420 aa) fasta scores: E(): 7.5e-24, 28.96% id in 397 aa, and to Pseudomonas aeruginosa probable secretion protein pa4142 SWALL:Q9HWN9 (EMBL:AE004831) (418 aa) fasta scores: E(): 1.9e-20, 26.23% id in 404 aa. Possible alternative translational start site
YP_111293.1	Similar to Klebsiella pneumoniae microcin MceG SWALL:Q93GK5 (EMBL:AF063590) (698 aa) fasta scores: E(): 2.3e-56, 29.89% id in 679 aa, and to Pseudomonas aeruginosa probable toxin transporter pa4143 SWALL:Q9HWN8 (EMBL:AE004831) (719 aa) fasta scores: E(): 1.8e-70, 33.9% id in 696 aa, and to Xylella fastidiosa colicin V secretion ABC transporter ATP-binding protein xf1220 SWALL:Q9PE08 (EMBL:AE003955) (707 aa) fasta scores: E(): 2.2e-67, 34% id in 700 aa
YP_111296.1	Similar to Enterobacter aerogenes TolC protein precursor SWALL:Q8VLQ0 (EMBL:AJ421426) (486 aa) fasta scores: E(): 1e-19, 26.16% id in 451 aa, and to Ralstonia solanacearum probable porin rsc0695 or rs01600 SWALL:Q8Y1J5 (EMBL:AL646060) (484 aa) fasta scores: E(): 4.3e-25, 27.8% id in 446 aa
YP_111297.1	Similar to Helicobacter pylori gamma-glutamyltranspeptidase hp1118 SWALL:O25743 (EMBL:AE000618) (567 aa) fasta scores: E(): 1.3e-83, 42.43% id in 568 aa, and to Caulobacter crescentus gamma-glutamyltransferase cc0104 SWALL:Q9ABW6 (EMBL:AE005685) (583 aa) fasta scores: E(): 3.3e-132, 63.54% id in 565 aa, and to Pseudomonas aeruginosa gamma-glutamyltranspeptidase precursor Ggt or pa1338 SWALL:Q9I406 (EMBL:AE004563) (557 aa) fasta scores: E(): 3.2e-130, 63.04% id in 552 aa
YP_111300.1	Similar to Pseudomonas aeruginosa probable ATP-dependent DNA helicase pa3272 SWALL:Q9HYW9 (EMBL:AE004749) (1448 aa) fasta scores: E(): 4.7e-132, 63.01% id in 1598 aa, and to Xanthomonas axonopodis ATP-dependent DNA helicase Lhr1 or xac2450 SWALL:AAM37301 (EMBL:AE011882) (1480 aa) fasta scores: E(): 1.3e-123, 57.92% id in 1597 aa
YP_111301.1	Similar to Bacillus subtilis  amino acid permease YecA protein SWALL:O34560 (EMBL:Z99107) (463 aa) fasta scores: E(): 7e-40, 35.74% id in 414 aa, and to Escherichia coli O157:H7  transport YjeH or z5746 or ecs5122 SWALL:Q8XDR1 (EMBL:AE005648) (418 aa) fasta scores: E(): 3e-29, 34.21% id in 418 aa, and to Escherichia coli hypothetical protein YjeH or b4141 SWALL:YJEH_ECOLI (SWALL:P39277) (418 aa) fasta scores: E(): 3e-29, 34.21% id in 418 aa
YP_111302.1	Similar to Xanthomonas campestris hypothetical protein Xcc2424 SWALL:Q8P824 (EMBL:AE012353) (150 aa) fasta scores: E(): 2.8e-13, 55.17% id in 87 aa, and to Xanthomonas axonopodis hypothetical protein Xac2556 SWALL:Q8PJH5 (EMBL:AE011896) (124 aa) fasta scores: E(): 7.1e-12, 50.6% id in 83 aa
YP_111303.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa1354 SWALL:Q9I3Z0 (EMBL:AE004565) (141 aa) fasta scores: E(): 1e-36, 67.85% id in 140 aa, and to Agrobacterium tumefaciens hypothetical protein atu0851 or agr_c_1556 SWALL:Q8UH34 (EMBL:AE009052) (140 aa) fasta scores: E(): 8.5e-34, 62.85% id in 140 aa
YP_111304.1	catalyzes the formation of 3-deoxy-D-arabino-hept-2-ulosonate 7 phosphate from phosphoenolpyruvate and D-erythrose 4-phosphate, tyrosine sensitive
YP_111305.1	Similar to Acinetobacter sp. ADP1 O-methyltransferase-like protein SWALL:Q93D14 (EMBL:AF400582) (222 aa) fasta scores: E(): 7.2e-33, 47.27% id in 220 aa, and to Streptomyces coelicolor O-methyltransferase sco2338 or scc53.29 SWALL:Q9KXI2 (EMBL:AL939112) (223 aa) fasta scores: E(): 1.8e-41, 56.5% id in 223 aa, and to Rhizobium loti O-methyltransferase Mlr0279 SWALL:Q98N64 (EMBL:AP002994) (221 aa) fasta scores: E(): 1.2e-39, 53.18% id in 220 aa
YP_111306.1	Similar to Ralstonia solanacearum probable transmembrane protein rsp1524 or rs04801 SWALL:Q8XPW2 (EMBL:AL646085) (505 aa) fasta scores: E(): 2.2e-65, 39.58% id in 480 aa, and to Ralstonia solanacearum transmembrane protein rsp0398 or rs00826 SWALL:Q8XSR9 (EMBL:AL646078) (488 aa) fasta scores: E(): 2.9e-62, 39.62% id in 477 aa
YP_111308.1	Similar to Agrobacterium tumefaciens pca operon transcriptional activator PcaQ or atu4543 or agr_l_649 SWALL:PCAQ_AGRT5 (SWALL:P52668) (311 aa) fasta scores: E(): 1.7e-38, 41.74% id in 309 aa, and to Rhizobium meliloti  transcriptional activator of the Pca operon, LysR family protein pcaq or rb1492 or smb20580 SWALL:Q92TL9 (EMBL:AL603647) (313 aa) fasta scores: E(): 2.9e-40, 43.18% id in 308 aa, and to Ralstonia solanacearum probable transcriptional regulatory DNA-binding transcription regulator protein PcaQ or rsc1440 or rs03867 SWALL:Q8XZG1 (EMBL:AL646064) (319 aa) fasta scores: E(): 3.9e-40, 45.27% id in 307 aa
YP_111309.1	Similar to Burkholderia cepacia protocatechuate 3,4-dioxygenase beta chain PcaH SWALL:PCXB_BURCE (SWALL:P15110) (235 aa) fasta scores: E(): 9.7e-88, 91.06% id in 235 aa, and to Pseudomonas marginata protocatechuate 3,4-dioxygenase beta-subunit PcaH SWALL:Q9ZB85 (EMBL:U33634) (234 aa) fasta scores: E(): 5.5e-87, 88.46% id in 234 aa, and to Acinetobacter lwoffii protocatechuate 3,4-dioxygenase beta subunit PcaH SWALL:Q8KQ86 (EMBL:AY099487) (226 aa) fasta scores: E(): 1.1e-79, 84.51% id in 226 aa
YP_111310.1	Similar to Burkholderia cepacia protocatechuate 3,4-dioxygenase alpha chain PcaG SWALL:PCXA_BURCE (SWALL:P15109) (197 aa) fasta scores: E(): 4.3e-56, 74.11% id in 197 aa, and to Pseudomonas marginata protocatechuate 3,4-dioxygenase alpha-subunit PcaG SWALL:Q9ZB84 (EMBL:U33634) (196 aa) fasta scores: E(): 1.9e-57, 74.61% id in 197 aa
YP_111311.1	Similar to Ralstonia solanacearum hypothetical protein rsc1384 or rs04667 SWALL:Q8XZL1 (EMBL:AL646064) (271 aa) fasta scores: E(): 3.7e-59, 65.45% id in 275 aa, and to Deinococcus radiodurans peptide ABC transporter dr1843 SWALL:Q9RTC2 (EMBL:AE002024) (283 aa) fasta scores: E(): 2.2e-24, 40.28% id in 283 aa, and to Streptomyces coelicolor  transport associated protein sco6486 or sc9c7.22 SWALL:Q9ZBI8 (EMBL:AL939128) (277 aa) fasta scores: E(): 2.8e-19, 32.47% id in 271 aa
YP_111312.1	Similar to Ralstonia solanacearum probable D-aminopeptidase rsc1383 or rs04666 SWALL:Q8XZL2 (EMBL:AL646064) (341 aa) fasta scores: E(): 5.3e-39, 57.62% id in 413 aa, and to Brucella melitensis D-aminopeptidase bmeII0741 SWALL:Q8YBZ5 (EMBL:AE009708) (340 aa) fasta scores: E(): 5.9e-27, 41.14% id in 418 aa, and to Rhizobium loti probable D-aminopeptidase mlr2477 SWALL:Q98IB6 (EMBL:AP002999) (343 aa) fasta scores: E(): 8.3e-27, 41.53% id in 431 aa. CDS contains addition internal residue in comparison to orthologues. CDS is extended at the N-terminus in comparison to orthologues
YP_111313.1	Similar to Bacillus firmus dipeptide transport system permease DppC SWALL:DPPC_BACFI (SWALL:P94312) (304 aa) fasta scores: E(): 4.2e-46, 43.28% id in 298 aa, and to Ralstonia solanacearum probable transmembrane ABC transporter protein rsc1382 or rs04665 SWALL:Q8XZL3 (EMBL:AL646064) (299 aa) fasta scores: E(): 1.5e-93, 82.49% id in 297 aa, and to Escherichia coli O157:H7 transport system permease z1056 or ecs0911 SWALL:Q8X6V6 (EMBL:AE005264) (303 aa) fasta scores: E(): 2e-84, 77.03% id in 283 aa
YP_111314.1	Similar to Agrobacterium tumefaciens MoaB SWALL:O50268 (EMBL:AF242881) (313 aa) fasta scores: E(): 1e-42, 37.89% id in 314 aa, and to Ralstonia solanacearum probable transmembrane ABC transporter protein rsc1381 or rs04750 SWALL:Q8XZL4 (EMBL:AL646064) (307 aa) fasta scores: E(): 2.5e-96, 80.32% id in 305 aa, and to Salmonella typhi hypothetical ABC transporter permease ylic or sty0889 SWALL:Q8Z862 (EMBL:AL627268) (306 aa) fasta scores: E(): 3.9e-91, 76.14% id in 306 aa
YP_111315.1	Similar to Agrobacterium tumefaciens mannopinic acid permease AgaA SWALL:O50260 (EMBL:AF242881) (509 aa) fasta scores: E(): 7.9e-42, 30.29% id in 505 aa, and to Ralstonia solanacearum probable substate-binding periplasmic rsc1380 or rs04663 SWALL:Q8XZL5 (EMBL:AL646064) (517 aa) fasta scores: E(): 2.5e-150, 73.58% id in 511 aa, and to Escherichia coli O157:H7 transport protein z1054 or ecs0909 SWALL:Q8X6V9 (EMBL:AE005264) (512 aa) fasta scores: E(): 1.3e-128, 63.58% id in 508 aa
YP_111316.1	Similar to Agrobacterium tumefaciens mannopinic and agropinic acid catabolism protein MoaD SWALL:O50270 (EMBL:AF242881) (588 aa) fasta scores: E(): 1.8e-48, 48.4% id in 659 aa, and to Ralstonia solanacearum probable ATP-binding ABC transporter protein rsc1379 or rs04662 SWALL:Q8XZL6 (EMBL:AL646064) (627 aa) fasta scores: E(): 2.2e-76, 69.08% id in 676 aa, and to Mycobacterium tuberculosis hypothetical ABC transporter ATP-binding protein rv1281c rv1281c or mt1318 or mtcy50.01 SWALL:YC81_MYCTU (SWALL:Q11040) (612 aa) fasta scores: E(): 4.2e-66, 46.01% id in 628 aa
YP_111317.1	Similar to Hordeum vulgare asparaginase SWALL:Q9FUG8 (EMBL:AF308474) (333 aa) fasta scores: E(): 5.1e-26, 39.45% id in 327 aa, and to Ralstonia solanacearum probable L-asparaginase precursor protein rsc1378 or rs04661 SWALL:Q8XZL7 (EMBL:AL646064) (320 aa) fasta scores: E(): 8.2e-30, 62.89% id in 345 aa, and to Oryza sativa  L-asparaginase h0212b02.5 SWALL:Q9FSS5 (EMBL:AL442007) (333 aa) fasta scores: E(): 1.1e-27, 40.66% id in 332 aa
YP_111318.1	Similar to Yersinia pestis hex regulon repressor HexR or ypo2065 SWALL:Q8ZET8 (EMBL:AJ414151) (289 aa) fasta scores: E(): 2.5e-09, 27.82% id in 266 aa, and to Ralstonia solanacearum hypothetical protein rsc1377 or rs04660 SWALL:Q8XZL8 (EMBL:AL646064) (332 aa) fasta scores: E(): 1.7e-58, 57.14% id in 308 aa, and to Clostridium perfringens probable transcriptional regulator cpe1082 SWALL:Q8XLF9 (EMBL:AP003189) (291 aa) fasta scores: E(): 1.8e-16, 30.79% id in 276 aa
YP_111319.1	Similar to Rhizobium meliloti glycine/proline betaine transporter betP SWALL:Q8VTN3 (EMBL:AF323271) (706 aa) fasta scores: E(): 7.9e-120, 48.71% id in 663 aa, and to Pasteurella multocida hypothetical protein Pm1791 pm1791 SWALL:Q9CK43 (EMBL:AE006216) (668 aa) fasta scores: E(): 3.1e-131, 50% id in 658 aa, and to Haemophilus influenzae probable transport protein Hi1706 hi1706 SWALL:YH06_HAEIN (SWALL:P45335) (669 aa) fasta scores: E(): 1.9e-123, 47.59% id in 664 aa
YP_111320.1	Similar to Pseudomonas marginata esterase EstB SWALL:Q9KX40 (EMBL:U33634) (392 aa) fasta scores: E(): 1.9e-96, 68.38% id in 389 aa, and to Pseudomonas aeruginosa hypothetical protein Pa2315 SWALL:Q9I1G0 (EMBL:AE004657) (391 aa) fasta scores: E(): 2.3e-68, 52.46% id in 385 aa, and to Pseudomonas sp triacylglycerol lipase lip-1 SWALL:Q9KX30 (EMBL:X61673) (333 aa) fasta scores: E(): 1.4e-59, 53.65% id in 328 aa
YP_111321.1	Similar to Chromobacterium violaceum ATCC 12472 hypothetical protein SWALL:Q7P1Q6 (EMBL:AE016910) (96 aa) fasta scores: E(): 8.1e-09, 46.07% id in 102 aa
YP_111322.1	Similar to the N-terminal regions of Arabidopsis thaliana hypothetical 59.0 kDa protein at3g03520 SWALL:Q8VZ53 (EMBL:AY065242) (523 aa) fasta scores: E(): 4.6e-40, 35.03% id in 471 aa, and to Arabidopsis thaliana t21p5.6 protein t21p5.6 or at3g03520 SWALL:Q9SRQ6 (EMBL:AC009895) (523 aa) fasta scores: E(): 4.6e-40, 35.03% id in 471 aa
YP_111323.1	Similar to Streptomyces coelicolor  membrane protein sco3332 or sce68.30C SWALL:Q9WX02 (EMBL:AL939116) (238 aa) fasta scores: E(): 2e-06, 29.44% id in 180 aa
YP_111325.1	IleRS; catalyzes the formation of isoleucyl-tRNA(Ile) from isoleucine and tRNA(Ile); since isoleucine and other amino acids such as valine are similar, there are additional editing function in this enzyme; one is involved in hydrolysis of activated valine-AMP and the other is involved in deacylation of mischarged Val-tRNA(Ile); there are two active sites, one for aminoacylation and one for editing; class-I aminoacyl-tRNA synthetase type 1 subfamily; some organisms carry two different copies of this enzyme
YP_111326.1	Similar to Rhodobacter capsulatus hypothetical 32.2 kDa protein SWALL:O68125 (EMBL:AF010496) (296 aa) fasta scores: E(): 7e-35, 38.62% id in 290 aa, and to Sphingomonas aromaticivorans hypothetical 34.0 kDa protein orf114 SWALL:O85844 (EMBL:AF079317) (309 aa) fasta scores: E(): 8.5e-28, 33.44% id in 296 aa, and to Pseudomonas aeruginosa hypothetical protein Pa4287 pa4287 SWALL:Q9HWB3 (EMBL:AE004845) (296 aa) fasta scores: E(): 2.9e-22, 33.1% id in 287 aa
YP_111327.1	Similar to Ralstonia solanacearum probable alanyl-tRNA synthetase related protein rsc0988 or rs04304 SWALL:Q8Y0Q5 (EMBL:AL646062) (245 aa) fasta scores: E(): 7.9e-18, 39.03% id in 228 aa, and to Bacillus anthracis alanyl-tRNA synthetase domain protein ba1720 SWALL:Q81SE0 (EMBL:AE017029) (236 aa) fasta scores: E(): 2.7e-16, 31.65% id in 218 aa. Similar to an internal region of Escherichia coli alanyl-tRNA synthetase AlaS or LovB SWALL:SYA_ECOLI (SWALL:P00957) (876 aa) fasta scores: E(): 4.5e-09, 29.87% id in 231 aa
YP_111328.1	Similar to Saccharomyces cerevisiae D-lactate dehydrogenase [cytochrome], mitochondrial precursor DlD1 or Dld or ydl174C SWALL:DLD1_YEAST (SWALL:P32891) (587 aa) fasta scores: E(): 1.6e-53, 37.01% id in 489 aa, and to Ralstonia solanacearum  D-lactate dehydrogenase Dld or rsc2664 or rs04542 SWALL:Q8XW11 (EMBL:AL646071) (472 aa) fasta scores: E(): 1.1e-101, 58.98% id in 451 aa, and to Rhizobium loti probable D-lactate dehydrogenase mll1488 SWALL:Q98KG4 (EMBL:AP002997) (575 aa) fasta scores: E(): 2.4e-99, 56.4% id in 445 aa. Possible alternative translational start
YP_111329.1	Similar to Rhizobium loti hypothetical protein Msl7859 SWALL:Q984S8 (EMBL:AP003012) (97 aa) fasta scores: E(): 1.4e-08, 38.29% id in 94 aa, and to Ralstonia solanacearum hypothetical protein rsc1128 or rs04625 SWALL:Q8Y0B6 (EMBL:AL646062) (96 aa) fasta scores: E(): 2e-08, 35.48% id in 93 aa, and to Rhizobium meliloti hypothetical protein r00331 or smc00411 SWALL:Q92SN9 (EMBL:AL591783) (95 aa) fasta scores: E(): 1.5e-07, 40.21% id in 92 aa
YP_111331.1	C-terminus is similar to the N-terminus of Haemophilus influenzae hypothetical protein Hi0912 hi0912 SWALL:Y912_HAEIN (SWALL:P44074) (254 aa) fasta scores: E(): 4.1e-05, 30% id in 150 aa
YP_111332.1	Similar to Lactococcus lactis xylose regulatory protein XylR SWALL:Q9X421 (EMBL:AF092042) (319 aa) fasta scores: E(): 3.4e-05, 20.28% id in 281 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa3269 SWALL:Q9HYX2 (EMBL:AE004749) (284 aa) fasta scores: E(): 7e-24, 33.81% id in 275 aa, and to Agrobacterium tumefaciens transcriptional regulator, AraC family atu1081 or agr_c_1998 SWALL:Q8UGF7 (EMBL:AE009072) (285 aa) fasta scores: E(): 3e-23, 33.08% id in 272 aa
YP_111334.1	catalyzes conversion of 1-aminocyclopropane-1-carboxylate to ammonia and alpha-ketobutyrate
YP_111335.1	Similar to Klebsiella pneumoniae leucine-responsive regulatory protein Lrp SWALL:LRP_KLEPN (SWALL:P37424) (163 aa) fasta scores: E(): 3.1e-24, 45.09% id in 153 aa, and to Ralstonia solanacearum probable transcription regulator protein rsp0645 or rs05577 SWALL:Q8XS36 (EMBL:AL646080) (186 aa) fasta scores: E(): 1.7e-48, 75.88% id in 170 aa, and to Rhizobium leguminosarum leucine-responsive regulatory-like protein SWALL:AAO17689 (EMBL:AY172673) (158 aa) fasta scores: E(): 4.9e-27, 50% id in 150 aa
YP_111336.1	Similar to Xanthomonas campestris hypothetical protein Xcc3767 SWALL:AAM43024 (EMBL:AE012497) (277 aa) fasta scores: E(): 1.6e-07, 29.6% id in 304 aa, and to Xanthomonas axonopodis hypothetical protein Xac3820 SWALL:AAM38662 (EMBL:AE012031) (268 aa) fasta scores: E(): 3.3e-07, 29.53% id in 298 aa
YP_111337.1	Similar to Burkholderia cepacia phthalate transporter OphD SWALL:Q9RPP3 (EMBL:AF152094) (448 aa) fasta scores: E(): 8.5e-47, 36.21% id in 428 aa, and to Caulobacter crescentus major facilitator family transporter cc2354 SWALL:Q9A5U3 (EMBL:AE005905) (430 aa) fasta scores: E(): 6.9e-79, 52.55% id in 430 aa, and to Agrobacterium tumefaciens MFS permease atu2708 or agr_c_4908 SWALL:Q8UBZ0 (EMBL:AE009217) (487 aa) fasta scores: E(): 3.4e-75, 49.05% id in 424 aa. Possible alternative translational start sites.
YP_111338.1	Similar to Streptomyces griseus GntR-family transcriptional regulator DasR SWALL:Q8VV01 (EMBL:AB061860) (253 aa) fasta scores: E(): 1.1e-14, 31.33% id in 233 aa, and to Ralstonia solanacearum probable transcription regulator protein rsp1506 or rs03035 SWALL:Q8XPY0 (EMBL:AL646085) (240 aa) fasta scores: E(): 4.6e-66, 70.04% id in 237 aa, and to Ralstonia solanacearum probable transcription regulator protein rsc1997 or rs03565 SWALL:Q8XXW6 (EMBL:AL646067) (274 aa) fasta scores: E(): 3.3e-26, 35.34% id in 232 aa
YP_111339.1	Similar to Rhodococcus sp. 19070 benzoate transport protein BopK SWALL:Q93Q76 (EMBL:AF279141) (448 aa) fasta scores: E(): 3.4e-17, 27.94% id in 433 aa, and to Ralstonia solanacearum probable metabolite transport transmembrane protein rsp0234 or rs05189 SWALL:Q8XT81 (EMBL:AL646077) (416 aa) fasta scores: E(): 2.8e-51, 70.79% id in 428 aa, and to Pseudomonas aeruginosa probable MFS transporter pa2114 SWALL:Q9I201 (EMBL:AE004638) (423 aa) fasta scores: E(): 2.4e-35, 48.59% id in 428 aa. Possible alternative translational start sites.
YP_111340.1	Similar to Sphingomonas sp. LB126 fluorene degradation FldB protein SWALL:Q9L399 (EMBL:AJ277295) (295 aa) fasta scores: E(): 1.7e-19, 31.75% id in 274 aa, and to Ralstonia solanacearum probable hydrolase transmembrane protein rsp0233 or rs05190 SWALL:Q8XT82 (EMBL:AL646077) (302 aa) fasta scores: E(): 5.6e-61, 60.72% id in 275 aa, and to Yersinia pestis orf45 ypo1933 or y2378 SWALL:Q9ZC43 (EMBL:AL031866) (289 aa) fasta scores: E(): 1.4e-26, 35.35% id in 280 aa
YP_111341.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein rsc2492 or rs01104 SWALL:Q8XWI2 (EMBL:AL646070) (502 aa) fasta scores: E(): 6.5e-123, 66.4% id in 503 aa, and to Wolbachia sp. wri phosphoprotein phosphatase SWALL:Q9RBM2 (EMBL:AJ012073) (428 aa) fasta scores: E(): 9e-19, 28.91% id in 415 aa. Note: Also similar to BPSS0403 (479 aa) fasta scores: E(): 4.7e-135, 87.866% identity in 478 aa overlap
YP_111342.1	Similar to Paracoccus denitrificans methylamine utilization protein MauG precursor SWALL:MAUG_PARDE (SWALL:Q51658) (387 aa) fasta scores: E(): 9.1e-14, 36.74% id in 381 aa, and to Ralstonia solanacearum probable signal peptide protein rsc2493 or rs01103 SWALL:Q8XWI1 (EMBL:AL646070) (449 aa) fasta scores: E(): 6.4e-93, 67.86% id in 417 aa, and to Ralstonia solanacearum probable lipoprotein transmembrane rsp1173 or rs05063 SWALL:Q8XQP8 (EMBL:AL646083) (441 aa) fasta scores: E(): 4.5e-42, 39.9% id in 421 aa
YP_111343.1	Similar to Rhizobium loti hypothetical protein Mlr0915 SWALL:Q98LR1 (EMBL:AP002996) (299 aa) fasta scores: E(): 8.2e-25, 37.85% id in 280 aa, and to Bacillus subtilis hypothetical protein YktD SWALL:Q45500 (EMBL:AF012285) (304 aa) fasta scores: E(): 2.1e-15, 29.61% id in 287 aa, and to Methanosarcina acetivorans hypothetical protein Ma2904 SWALL:Q8TLW9 (EMBL:AE010992) (313 aa) fasta scores: E(): 1.2e-13, 32.85% id in 207 aa
YP_111344.1	Similar to Ralstonia solanacearum hypothetical protein rsp0427 or rs00886 SWALL:Q8XSP0 (EMBL:AL646078) (91 aa) fasta scores: E(): 7.9e-10, 44.94% id in 89 aa
YP_111345.1	Similar to Ralstonia solanacearum hypothetical protein rsc0762 or rs05091 SWALL:Q8Y1C8 (EMBL:AL646060) (68 aa) fasta scores: E(): 2.5e-19, 86.27% id in 51 aa, and to Pseudomonas aeruginosa hypothetical protein Pa0200 SWALL:Q9I6T8 (EMBL:AE004458) (70 aa) fasta scores: E(): 1.2e-17, 65.21% id in 69 aa
YP_111346.1	Similar to Ralstonia solanacearum probable acetyltransferase rsp0265 or rs03701 SWALL:Q8XT50 (EMBL:AL646077) (184 aa) fasta scores: E(): 4.3e-32, 58.68% id in 167 aa, and to C-terminus of Myxococcus xanthus acetyltransferase ActC SWALL:Q93P57 (EMBL:AF350253) (437 aa) fasta scores: E(): 4.8e-19, 42.77% id in 166 aa, and to entire protein of Deinococcus radiodurans hypothetical protein Dr2432 SWALL:Q9RRQ6 (EMBL:AE002073) (173 aa) fasta scores: E(): 1.6e-13, 39.21% id in 153 aa
YP_111347.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0437 or rs03406 SWALL:Q8Y299 (EMBL:AL646059) (137 aa) fasta scores: E(): 6e-32, 70.14% id in 134 aa, and to uncultured proteobacterium conserved hypothetical protein ebac000-60d04.57 SWALL:AAM48689 (EMBL:AE008921) (141 aa) fasta scores: E(): 1.2e-22, 57.93% id in 126 aa
YP_111348.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0438 or rs03407 SWALL:Q8Y298 (EMBL:AL646059) (144 aa) fasta scores: E(): 3.5e-32, 67.36% id in 144 aa, and to Vibrio cholerae hypothetical protein Vca0641 SWALL:Q9KLV0 (EMBL:AE004394) (139 aa) fasta scores: E(): 6.1e-17, 48.14% id in 135 aa, and to Rhizobium meliloti hypothetical protein ra0570 or sma1053 SWALL:Q92ZC0 (EMBL:AE007247) (136 aa) fasta scores: E(): 6.2e-16, 51.53% id in 130 aa
YP_111349.1	Similar to Rhizobium leguminosarum nodulation regulator NolR protein SWALL:O54057 (EMBL:AJ001934) (105 aa) fasta scores: E(): 4.5e-09, 40.86% id in 93 aa, and to Rhizobium loti transcriptional regulator mlr2159 SWALL:Q98J11 (EMBL:AP002999) (112 aa) fasta scores: E(): 6.8e-15, 52.63% id in 95 aa, and to Agrobacterium tumefaciens transcriptional regulator, ArsR family atu3466 or agr_l_2725 SWALL:Q8UAA8 (EMBL:AE009276) (117 aa) fasta scores: E(): 9.7e-15, 49.49% id in 99 aa
YP_111350.1	Similar to Escherichia coli, and Shigella flexneri cytochrome b561 CybB or b1418 or sf1794 SWALL:C561_ECOLI (SWALL:P08732) (176 aa) fasta scores: E(): 1.3e-07, 26.59% id in 173 aa, and to Xanthomonas axonopodis cytochrome like b561 xac1686 SWALL:AAM36553 (EMBL:AE011801) (173 aa) fasta scores: E(): 2.8e-12, 34.54% id in 165 aa, and to Rhizobium loti cytochrome b561 mlr4647 SWALL:Q98DL7 (EMBL:AP003004) (179 aa) fasta scores: E(): 1.1e-11, 32.35% id in 170 aa
YP_111351.1	Similar to Mycobacterium paratuberculosis probable cysteine desulfurase SWALL:CSD_MYCPA (SWALL:Q9KII6) (685 aa) fasta scores: E(): 1e-86, 53.23% id in 680 aa, and to Mycobacterium leprae probable cysteine desulfurase 1 Csd1 or ml0842 or mlcb22.44C SWALL:CSD1_MYCLE (SWALL:O32975) (611 aa) fasta scores: E(): 1.7e-81, 54.9% id in 632 aa. C-terminal region is similar to Erwinia chrysanthemi cysteine desulfurase SufS SWALL:Q9EXP2 (EMBL:AJ301654) (412 aa) fasta scores: E(): 4e-57, 52.64% id in 397 aa
YP_111352.1	Similar to Synechococcus sp. cysteine biosynthesis SrpI protein SWALL:SRPI_SYNP7 (SWALL:Q55032) (306 aa) fasta scores: E(): 1.3e-86, 73.59% id in 303 aa, and to Mycobacterium paratuberculosis 35 kDa protein SWALL:Q9RAJ4 (EMBL:AJ250887) (307 aa) fasta scores: E(): 9.6e-84, 69.38% id in 307 aa, and to Mycobacterium paratuberculosis major membrane protein-1 SWALL:Q9KII7 (EMBL:AF232751) (295 aa) fasta scores: E(): 3.6e-82, 70.84% id in 295 aa. Possible alternative start site at codon 29
YP_111353.1	Similar to Streptomyces griseus SgraiC control protein SWALL:Q9F6L1 (EMBL:AF290880) (79 aa) fasta scores: E(): 7.6e-05, 41.42% id in 70 aa, and to Rhizobium meliloti hypothetical transcription regulator protein smc02184 r00496 or smc02184 SWALL:Q92SB3 (EMBL:AL591783) (89 aa) fasta scores: E(): 2.8e-05, 44.04% id in 84 aa
YP_111354.1	Similar to Synechococcus sp. serine acetyltransferase, plasmid SrpH SWALL:SRPH_SYNP7 (SWALL:Q59967) (319 aa) fasta scores: E(): 3.4e-54, 58.05% id in 267 aa, and to Trypanosoma cruzi serine acetyltransferase Sat SWALL:Q9BKB1 (EMBL:AF296848) (348 aa) fasta scores: E(): 3.8e-28, 47.44% id in 196 aa, and to Entamoeba histolytica serine acetyltransferase EhsaT SWALL:Q9U8X2 (EMBL:AB023954) (305 aa) fasta scores: E(): 1.4e-25, 46.99% id in 183 aa
YP_111355.1	Similar to Ralstonia solanacearum hypothetical protein rsc1257 or rs02773 SWALL:Q8XZY8 (EMBL:AL646063) (158 aa) fasta scores: E(): 6.1e-21, 49.36% id in 158 aa, and to Ralstonia solanacearum hypothetical protein rsc0296 rsc0296 or rs03263 SWALL:Q8Y2N9 (EMBL:AL646058) (130 aa) fasta scores: E(): 8.9e-17, 46.82% id in 126 aa, and to Mycobacterium tuberculosis hypothetical protein rv0390 or mtcy04d9.02 SWALL:P95198 (EMBL:Z84725) (140 aa) fasta scores: E(): 3e-12, 49.29% id in 142 aa
YP_111356.1	Similar to Novosphingobium capsulatum prolyl oligopeptidase SWALL:Q9ZNM8 (EMBL:AB010298) (723 aa) fasta scores: E(): 1.7e-36, 29.04% id in 699 aa, and to Caulobacter crescentus prolyl oligopeptidase cc3687 SWALL:Q9A279 (EMBL:AE006026) (723 aa) fasta scores: E(): 1.9e-81, 37.78% id in 704 aa, and to Rhizobium sp. probable peptidase Y4nA SWALL:Y4NA_RHISN (SWALL:P55577) (726 aa) fasta scores: E(): 3.6e-80, 38.08% id in 709 aa
YP_111357.1	Similar to Neisseria gonorrhoeae efflux pump protein FarA SWALL:Q9RQ30 (EMBL:AF132909) (394 aa) fasta scores: E(): 6.5e-48, 48.46% id in 359 aa, and to Ralstonia solanacearum probable multidrug resistance A EmrA or rsc1293 or rs02806 SWALL:Q8XZV2 (EMBL:AL646063) (428 aa) fasta scores: E(): 6e-57, 47.76% id in 402 aa, and to Xanthomonas campestris multidrug resistance efflux pump PmrA or xcc1399 SWALL:AAM40697 (EMBL:AE012239) (397 aa) fasta scores: E(): 1.1e-49, 44.22% id in 398 aa
YP_111358.1	Similar to Burkholderia cepacia Fusaric acid resistance protein precursor FusA SWALL:FUSA_BURCE (SWALL:P24126) (530 aa) fasta scores: E(): 9.3e-28, 31.74% id in 526 aa, and to Xanthomonas axonopodis outer membrane efflux protein YjcP or xac1444 SWALL:AAM36315 (EMBL:AE011776) (496 aa) fasta scores: E(): 7.2e-38, 38.41% id in 505 aa, and to Ralstonia solanacearum  outer membrane chanel lipoprotein rsc1294 or rs02807 SWALL:Q8XZV1 (EMBL:AL646063) (489 aa) fasta scores: E(): 9.2e-38, 37.88% id in 483 aa
YP_111359.1	Similar to Shigella flexneri dTDP-rhamnosyl transferase RfbF or sf2099 SWALL:RFBF_SHIFL (SWALL:P37782) (296 aa) fasta scores: E(): 7.7e-16, 25% id in 312 aa, and to Pseudomonas aeruginosa hypothetical protein Pa1130 SWALL:Q9I4K5 (EMBL:AE004543) (325 aa) fasta scores: E(): 5.3e-42, 45.19% id in 312 aa, and to Ralstonia solanacearum probable dTDP-rhamnosyl transferase RfbF or rsc0687 or rs01592 SWALL:Q8Y1K3 (EMBL:AL646060) (309 aa) fasta scores: E(): 2.1e-30, 40.51% id in 311 aa
YP_111360.1	Similar to Escherichia coli, and Escherichia coli O157:H7 multidrug resistance protein B EmrB or b2686 or z3987 or ecs3548 SWALL:EMRB_ECOLI (SWALL:P27304) (512 aa) fasta scores: E(): 7.5e-88, 45.34% id in 505 aa, and to Burkholderia pseudomallei hypothetical 55.5 kDa protein SWALL:Q9ZF72 (EMBL:AF110185) (520 aa) fasta scores: E(): 3.8e-114, 56.73% id in 527 aa, and to Burkholderia cepacia multidrug efflux protein BcrA SWALL:Q937U9 (EMBL:AJ347753) (518 aa) fasta scores: E(): 9e-103, 53.83% id in 522 aa
YP_111361.1	Similar to Pseudomonas aeruginosa rhamnosyltransferase chain B RhlB or pa3478 SWALL:Q9HYD1 (EMBL:AE004768) (426 aa) fasta scores: E(): 6.3e-48, 48% id in 427 aa, and to Candida albicans UDP-glucose:sterol glucosyltransferase ugt51c1 SWALL:Q9Y752 (EMBL:AF091398) (1516 aa) fasta scores: E(): 9.5e-09, 25.31% id in 403 aa
YP_111362.1	Similar to Pseudomonas aeruginosa rhamnosyltransferase 1 subunit A RhlA or pa3479 SWALL:RHLA_PSEAE (SWALL:Q51559) (295 aa) fasta scores: E(): 2.7e-45, 48.49% id in 266 aa, and to Pseudomonas aeruginosa 3- hydroxyacyl-CoA-acyl carrier protein transferase PhaG or Qin or pa0730 SWALL:PHAG_PSEAE (SWALL:Q51553) (300 aa) fasta scores: E(): 2.4e-43, 43.11% id in 276 aa, and to Pseudomonas putida 3- hydroxyacyl-CoA-acyl carrier protein transferase PhaG SWALL:PHAG_PSEPU (SWALL:O85207) (295 aa) fasta scores: E(): 3.5e-42, 43.01% id in 272 aa
YP_111363.1	HTH-type; bet1; Repressor involved in choline regulation of the bet genes
YP_111364.1	catalyzes the formation of betaine from betaine aldehyde
YP_111365.1	catalyzes the oxidation of choline to betaine aldehyde and betain aldehyde to glycine betaine
YP_111367.1	Similar to Acinetobacter calcoaceticus 4-hydroxybenzoate transporter PcaK SWALL:PCAK_ACICA (SWALL:Q43975) (457 aa) fasta scores: E(): 2.2e-36, 30.24% id in 453 aa, and to Ralstonia solanacearum probable metabolite transport transmembrane protein rsp0052 or rs02027 SWALL:Q8XTQ4 (EMBL:AL646076) (476 aa) fasta scores: E(): 1e-145, 82.27% id in 474 aa, and to Pseudomonas aeruginosa probable MFS transporter pa3467 SWALL:Q9HYD9 (EMBL:AE004767) (455 aa) fasta scores: E(): 3.5e-124, 70.56% id in 462 aa
YP_111368.1	Similar to Erwinia chrysanthemi regulator HrpX SWALL:AAM46691 (EMBL:AF448202) (450 aa) fasta scores: E(): 8.4e-24, 28.46% id in 390 aa, and similar to the C-terminus of Pseudomonas aeruginosa probable two-component sensor pa0600 from codon 129 SWALL:Q9I5T8 (EMBL:AE004496) (797 aa) fasta scores: E(): 1.2e-36, 38.79% id in 366 aa, and to similar to the C-terminus of Ralstonia solanacearum probable transmembrane two component system sensor kinase transcription regulator protein rsc0191 or rs00623 from codon 254 SWALL:Q8Y2Z0 (EMBL:AL646057) (458 aa) fasta scores: E(): 7.7e-28, 44.87% id in 234 aa
YP_111369.1	Similar to Synechocystis sp. response regulator Rcp1 or slr0474 SWALL:RCP1_SYNY3 (SWALL:Q55169) (147 aa) fasta scores: E(): 9.3e-25, 48.98% id in 147 aa, and to Anabaena sp. two-component response regulator alr1967 SWALL:Q8YVK8 (EMBL:AP003587) (148 aa) fasta scores: E(): 3.6e-30, 57.24% id in 138 aa, and to Methanosarcina acetivorans response regulator receiver ma1268 SWALL:Q8TRB2 (EMBL:AE010795) (148 aa) fasta scores: E(): 2.8e-29, 58.39% id in 137 aa
YP_111370.1	C-terminus is similar to the C-terminal regions of Anabaena sp. cyanobacterial phytochrome A AphA or ALR3157 SWALL:PHYA_ANASP (SWALL:Q9LCC2) (765 aa) fasta scores: E(): 3.5e-45, 54.78% id in 261 aa, and to Methanosarcina acetivorans sensory transduction histidine kinase MA1270 SWALL:Q8TRB0 (EMBL:AE010795) (1456 aa) fasta scores: E(): 4.8e-62, 41.14% id in 508 aa
YP_111371.1	Similar to Vibrio cholerae hypothetical protein Vca0330 SWALL:Q9KMK9 (EMBL:AE004371) (162 aa) fasta scores: E(): 1.4e-32, 53.94% id in 152 aa, and to Xanthomonas campestris hypothetical protein Xcc2248 SWALL:AAM41527 (EMBL:AE012332) (156 aa) fasta scores: E(): 1.1e-13, 39.33% id in 150 aa, and to Agrobacterium tumefaciens hypothetical protein atu1003 or agr_c_1844 SWALL:Q8UGN3 (EMBL:AE009065) (176 aa) fasta scores: E(): 5.1e-13, 34.64% id in 153 aa
YP_111372.1	Involved in the metabolism of aromatic amino acids
YP_111373.1	Similar to Ralstonia solanacearum probable alanin-rich signal peptide protein rsp1518 or rs04795 SWALL:Q8XPW8 (EMBL:AL646085) (178 aa) fasta scores: E(): 2.5e-09, 47.61% id in 168 aa
YP_111374.1	Similar to Shewanella violacea cold shock-like protein CspG SWALL:Q9S170 (EMBL:AB022716) (70 aa) fasta scores: E(): 8.6e-17, 70.76% id in 65 aa, and to Ralstonia solanacearum probable cold shock-like transcription regulator protein CspD3 or rsp0002 or rs05790 SWALL:Q8XTV2 (EMBL:AL646076) (67 aa) fasta scores: E(): 4.6e-20, 78.78% id in 66 aa, and to Burkholderia multivorans cold-shock protein CspD SWALL:Q8RL32 (EMBL:AY089707) (68 aa) fasta scores: E(): 6e-19, 75.38% id in 65 aa
YP_111375.1	a small basic protein that is one of the last in the subunit assembly; omission does not prevent assembly but the subunit is inactive; binds central domain of 16S rRNA
YP_111376.1	Similar to Ralstonia solanacearum  dihydroneopterin aldolase FolB2 or rsc1105 or rs04050 SWALL:Q8Y0D9 (EMBL:AL646062) (148 aa) fasta scores: E(): 1.3e-37, 70.42% id in 142 aa, and to Ralstonia solanacearum probable dihydroneopterin aldolase FolB1 or rsp0050 or rs02025 SWALL:Q8XTQ6 (EMBL:AL646076) (148 aa) fasta scores: E(): 1e-36, 69.01% id in 142 aa
YP_111377.1	Similar to Corynebacterium sp. sarcosine oxidase gamma subunit SoxG SWALL:SOXG_CORS1 (SWALL:Q46338) (203 aa) fasta scores: E(): 1.6e-11, 32.98% id in 191 aa, and to Ralstonia solanacearum probable sarcosine oxidase SoxG2 or rsc1104 or rs04053 SWALL:Q8Y0E0 (EMBL:AL646062) (210 aa) fasta scores: E(): 2.8e-62, 75.71% id in 210 aa, and to Ralstonia solanacearum probable sarcosine oxidase SoxG1 or rsp0049 or rs02024 SWALL:Q8XTQ7 (EMBL:AL646076) (210 aa) fasta scores: E(): 2.8e-59, 73.81% id in 210 aa
YP_111378.1	Similar to Corynebacterium sp. sarcosine oxidase alpha subunit SoxA SWALL:SOXA_CORS1 (SWALL:Q46337) (967 aa) fasta scores: E(): 2.3e-145, 46.45% id in 1014 aa, and to Ralstonia solanacearum probable sarcosine oxidase SoxA2 or rsc1103 or rs04054 SWALL:Q8Y0E1 (EMBL:AL646062) (1003 aa) fasta scores: E(): 0, 86.14% id in 1003 aa, and to Pseudomonas aeruginosa sarcosine oxidase alpha subunit SoxA or pa5418 SWALL:Q9HTE6 (EMBL:AE004954) (1005 aa) fasta scores: E(): 1.3e-211, 57.46% id in 1011 aa
YP_111379.1	Similar to Corynebacterium sp. sarcosine oxidase delta subunit SoxD SWALL:SOXD_CORS1 (SWALL:Q46336) (98 aa) fasta scores: E(): 1.9e-19, 55.81% id in 86 aa, and to Ralstonia solanacearum probable sarcosine oxidase SoxD2 or rsc1102 or rs04055 SWALL:Q8Y0E2 (EMBL:AL646062) (98 aa) fasta scores: E(): 3.4e-31, 76.66% id in 90 aa, and to Ralstonia solanacearum probable sarcosine oxidase SoxD1 or rsp0047 or rs02022 SWALL:Q8XTQ9 (EMBL:AL646076) (107 aa) fasta scores: E(): 6.9e-30, 74.72% id in 91 aa
YP_111380.1	Similar to Corynebacterium sp. sarcosine oxidase beta subunit SoxB SWALL:SOXB_CORS1 (SWALL:P40875) (405 aa) fasta scores: E(): 1.1e-105, 65.91% id in 399 aa, and to Ralstonia solanacearum probable sarcosine oxidase SoxB1 or rsp0046 or rs06046 SWALL:Q8XTR0 (EMBL:AL646076) (414 aa) fasta scores: E(): 3.8e-157, 95.65% id in 414 aa, and to Ralstonia solanacearum probable sarcosine oxidase SoxB2 or rsc1101 or rs04056 SWALL:Q8Y0E3 (EMBL:AL646062) (414 aa) fasta scores: E(): 1.6e-156, 94.92% id in 414 aa
YP_111381.1	Similar to Escherichia coli L-serine dehydratase 2 SdaB or b2797 SWALL:SDHM_ECOLI (SWALL:P30744) (455 aa) fasta scores: E(): 1.3e-84, 50.86% id in 462 aa, and to Ralstonia solanacearum probable L-serine dehydratase SdaA1 or rsp0045 or rs02020 SWALL:Q8XTR1 (EMBL:AL646076) (461 aa) fasta scores: E(): 1.1e-162, 90.88% id in 461 aa, and to Ralstonia solanacearum probable L-serine dehydratase SdaA2 or rsc3296 or rs02527 SWALL:Q8XU97 (EMBL:AL646074) (458 aa) fasta scores: E(): 5.4e-121, 67.89% id in 461 aa
YP_111382.1	Similar to Streptomyces griseus transcriptional regulator AdpA SWALL:Q9S166 (EMBL:AB023785) (405 aa) fasta scores: E(): 3.6e-18, 30.97% id in 339 aa, and to Ralstonia solanacearum probable transcriptional regulatory DNA-binding transcription regulator protein rsc1098 or rs04066 SWALL:Q8Y0E6 (EMBL:AL646062) (360 aa) fasta scores: E(): 8.7e-115, 84.4% id in 359 aa, and to Ralstonia solanacearum probable transcription regulator protein rsp0044 or rs02019 SWALL:Q8XTR2 (EMBL:AL646076) (387 aa) fasta scores: E(): 1.2e-111, 82.81% id in 355 aa. CDS is extended in the C-terminus in comparison to some orthologues
YP_111383.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa2487 pa2487 SWALL:Q9I0Z5 (EMBL:AE004676) (90 aa) fasta scores: E(): 8.9e-12, 50% id in 80 aa
YP_111384.1	Similar to Vibrio cholerae hypothetical protein Vca0740 SWALL:Q9KLK3 (EMBL:AE004403) (216 aa) fasta scores: E(): 1.8e-28, 48.34% id in 211 aa, and to Vibrio vulnificus uncharacterized protein conserved in bacteria vv20756 SWALL:AAO07687 (EMBL:AE016810) (220 aa) fasta scores: E(): 8.2e-27, 48.38% id in 217 aa, and to Rhizobium loti hypothetical protein Mll4256 SWALL:Q98EG3 (EMBL:AP003003) (209 aa) fasta scores: E(): 4.5e-26, 44.11% id in 204 aa
YP_111385.1	Similar to Ralstonia solanacearum probable glutathione S-transferase rsc3070 or rs00514 SWALL:Q8XUW3 (EMBL:AL646073) (238 aa) fasta scores: E(): 4.1e-53, 59.75% id in 241 aa, and to Rhizobium meliloti probable glutathione S-transferase Gst12 or rb1278 or smb21449 SWALL:Q92U61 (EMBL:AL603646) (240 aa) fasta scores: E(): 1.1e-49, 56.19% id in 242 aa, and to Xanthomonas axonopodis glutathione transferase xac3203 SWALL:AAM38047 (EMBL:AE011966) (241 aa) fasta scores: E(): 1.2e-48, 56.96% id in 244 aa
YP_111386.1	C-terminal region is similar to Pseudomonas aeruginosa hypothetical protein Pa2187 SWALL:Q9I1S8 (EMBL:AE004645) (141 aa) fasta scores: E(): 2.5e-18, 51.35% id in 111 aa, and Agrobacterium tumefaciens hypothetical protein atu3812 or agr_l_2041 SWALL:Q8U9B6 (EMBL:AE009312) (135 aa) fasta scores: E(): 8.2e-17, 45.65% id in 138 aa
YP_111387.1	Similar to Rhodobacter sphaeroides quinol oxidase subunit II QxtB SWALL:O86081 (EMBL:AF084032) (335 aa) fasta scores: E(): 9e-62, 48.94% id in 331 aa, and to Ralstonia solanacearum  transmembrane cytochrome bd-II oxidase rsp1206 or rs03150 SWALL:Q8XQL6 (EMBL:AL646083) (336 aa) fasta scores: E(): 7.1e-94, 69.34% id in 336 aa, and to Pseudomonas aeruginosa cyanide insensitive terminal oxidase CioB or pa3929 SWALL:O07441 (EMBL:Y10528) (335 aa) fasta scores: E(): 1.7e-66, 51.04% id in 335 aa
YP_111388.1	Similar to Pseudomonas aeruginosa cyanide insensitive terminal oxidase CioA or pa3930 SWALL:O07440 (EMBL:Y10528) (488 aa) fasta scores: E(): 4.2e-82, 48.84% id in 475 aa, and to Ralstonia solanacearum  transmembrane cytochrome bd-II oxidase rsp1207 or rs03151 SWALL:Q8XQL5 (EMBL:AL646083) (482 aa) fasta scores: E(): 3.3e-117, 65.31% id in 470 aa, and to Xanthomonas campestris cyanide insensitive terminal oxidase CioA or xcc3691 SWALL:AAM43463 (EMBL:AE012490) (471 aa) fasta scores: E(): 1e-82, 50.31% id in 471 aa
YP_111389.1	Similar to Rhizobium meliloti hypothetical signal peptide protein smc00921 r00784 or smc00921 SWALL:Q92KL7 (EMBL:AL591784) (128 aa) fasta scores: E(): 1.1e-10, 45.52% id in 123 aa, and to Rhizobium loti hypothetical protein Mlr5326 SWALL:Q98C23 (EMBL:AP003006) (130 aa) fasta scores: E(): 1.1e-10, 44.44% id in 117 aa
YP_111390.1	Similar to Oceanobacillus iheyensis cation-transporting ATPase ob0089 SWALL:BAC12045 (EMBL:AP004593) (232 aa) fasta scores: E(): 1e-20, 46.02% id in 176 aa, and to Escherichia coli, and Escherichia coli O157:H7 hypothetical protein YhiD or b3508 or z4920 or ecs4388 SWALL:YHID_ECOLI (SWALL:P26606) (215 aa) fasta scores: E(): 1.8e-21, 40.84% id in 213 aa, and to Escherichia coli O6 hypothetical protein YhiD or c4319 SWALL:AAN82755 (EMBL:AE016768) (215 aa) fasta scores: E(): 2.8e-21, 40.37% id in 213 aa
YP_111392.1	Similar to Rhizobium meliloti  phospholipase rb0094 or smb20094 SWALL:Q92X68 (EMBL:AL603642) (590 aa) fasta scores: E(): 3.3e-51, 39.47% id in 461 aa, and to Caulobacter crescentus phospholipase D family protein cc0522 SWALL:Q9AAS4 (EMBL:AE005724) (505 aa) fasta scores: E(): 1.7e-42, 36.4% id in 478 aa, and to Caulobacter crescentus membrane protein,  cc1538 SWALL:Q9A826 (EMBL:AE005828) (239 aa) fasta scores: E(): 3.3e-14, 33.19% id in 235 aa
YP_111393.1	Similar to Brucella melitensis dioxygenase BmeII0240 SWALL:Q8YDD7 (EMBL:AE009663) (285 aa) fasta scores: E(): 4.9e-14, 36.36% id in 231 aa, and to Rhizobium loti hypothetical protein Mlr2853 mlr2853 SWALL:Q98HI7 (EMBL:AP003000) (246 aa) fasta scores: E(): 2.2e-13, 36.54% id in 249 aa. C-terminus is extended in comparison to similar proteins
YP_111395.1	Weakly similar to Ralstonia solanacearum  isomerase rotamase signal peptide protein rsc1744 or rs02932 SWALL:Q8XYL4 (EMBL:AL646066) (255 aa) fasta scores: E(): 1.3e-10, 28.44% id in 225 aa. C-terminus is similar to the C-terminal region of Nitrosomonas europaea PpiC-type peptidyl-prolyl cis-trans isomerase ne1418 SWALL:Q82UR3 (EMBL:BX321861) (264 aa) fasta scores: E(): 7.1e-10, 30.04% id in 213 aa
YP_111398.1	Poor database matches. Almost identical to the previously sequence Burkholderia pseudomallei hypothetical protein SWALL:Q93L05 (EMBL:AF074878) (1287 aa) fasta scores: E(): 0, 98.21% id in 1287 aa
YP_111399.1	Previously sequenced as Burkholderia pseudomallei hypothetical 17.9 kDa protein SWALL:Q93L04 (EMBL:AF074878) (161 aa) fasta scores: E(): 5e-66, 100% id in 161 aa. Similar to Sinorhizobium meliloti phage PBC5 hypothetical 17.1 kDa protein orf18 SWALL:Q8W6K9 (EMBL:AF448724) (150 aa) fasta scores: E(): 4.7e-13, 35.46% id in 141 aa
YP_111400.1	Similar to Burkholderia pseudomallei hypothetical 61.4 kDa protein SWALL:Q93L03 (EMBL:AF074878) (602 aa) fasta scores: E(): 7.5e-177, 99.5% id in 602 aa, and to C-terminus of Pseudomonas syringae HrpK SWALL:Q9L6W3 (EMBL:AF232004) (780 aa) fasta scores: E(): 2.8e-21, 30.3% id in 660 aa, and to C-terminus of Pseudomonas syringae HrpK SWALL:Q9L6V5 (EMBL:AF232005) (767 aa) fasta scores: E(): 6.6e-21, 29.83% id in 620 aa
YP_111402.1	Almost identical to the previously sequenced Burkholderia pseudomallei typeIII secretion-system associated protein SctC SWALL:Q93L02 (EMBL:AF074878) (588 aa) fasta scores: E(): 7.7e-207, 99.49% id in 588 aa. Similar to Ralstonia solanacearum hypersensitivity response secretion protein HrpA precursor HrpA or HrcC or rsp0874 or rs01645 SWALL:HRPA_RALSO (SWALL:Q52498) (568 aa) fasta scores: E(): 1.3e-84, 45.58% id in 577 aa, and to Burkholderia cepacia genomovar III BcsCC SWALL:Q8VP21 (EMBL:AY028431) (681 aa) fasta scores: E(): 2.9e-39, 37.1% id in 601 aa
YP_111403.1	Similar to Ralstonia solanacearum regulatory protein HrpB or rsp0873 or rs01644 SWALL:HRPB_RALSO (SWALL:P31778) (477 aa) fasta scores: E(): 5.6e-49, 34.35% id in 492 aa. Almost identical to the previously sequenced Burkholderia pseudomallei hypothetical 54.7 kDa protein SWALL:Q93L01 (EMBL:AF074878) (483 aa) fasta scores: E(): 4.9e-195, 99.58% id in 483 aa
YP_111404.1	Similar to Xanthomonas campestris type III secretion associated protein Hrpb8 SWALL:Q56786 (EMBL:U33548) (276 aa) fasta scores: E(): 7.1e-46, 44.64% id in 271 aa. Identical to Burkholderia pseudomallei type III secretion-associated protein SctT SWALL:Q93L00 (EMBL:AF074878) (240 aa) fasta scores: E(): 6.7e-93, 100% id in 240 aa. Similar to Xanthomonas campestris HrpB8 protein HrcT or xcc1238 SWALL:AAM40536 (EMBL:AE012222) (276 aa) fasta scores: E(): 1.6e-46, 44.98% id in 269 aa
YP_111405.1	Previously sequenced as Burkholderia pseudomallei ORF7 SWALL:Q93KZ9 (EMBL:AF074878) (168 aa) fasta scores: E(): 3.1e-52, 100% id in 168 aa
YP_111406.1	Almost identical to the previously sequenced Burkholderia pseudomallei type III secretion associated protein SctN SWALL:Q93KZ8 (EMBL:AF074878) (449 aa) fasta scores: E(): 8.6e-155, 99.77% id in 449 aa. Similar to Xanthomonas axonopodis HrcN protein or xac0412 SWALL:Q8PQB6 (EMBL:AE011666) (442 aa) fasta scores: E(): 1.2e-107, 70.48% id in 437 aa, and to Xanthomonas campestris probable ATP synthase HrpB6 SWALL:HRB6_XANCV (SWALL:P80153) (442 aa) fasta scores: E(): 3.6e-107, 70.48% id in 437 aa
YP_111407.1	Previously sequenced as Burkholderia pseudomallei type III secretion-associated protein SctL SWALL:Q93KZ7 (EMBL:AF074878) (289 aa) fasta scores: E(): 2.4e-103, 100% id in 289 aa. Similar to Ralstonia solanacearum protein HrpF or rsp0869 or rs01640 SWALL:Q8XRH8 (EMBL:AL646081) (301 aa) fasta scores: E(): 1.8e-15, 31.25% id in 288 aa, and to Xanthomonas axonopodis protein HrpB5 or xac0411 SWALL:AAM35302 (EMBL:AE011666) (233 aa) fasta scores: E(): 4.9e-15, 31.17% id in 247 aa
YP_111408.1	Almost identical to the previously sequenced Burkholderia pseudomallei hypothetical 27.8 kDa protein SWALL:Q93KZ6 (EMBL:AF074878) (255 aa) fasta scores: E(): 7.5e-105, 99.6% id in 255 aa
YP_111409.1	Almost identical to the previously sequenced Burkholderia pseudomallei type III secretion associated protein SctJ SWALL:Q93KZ5 (EMBL:AF074878) (274 aa) fasta scores: E(): 1e-101, 99.27% id in 274 aa. Similar to Xanthomonas campestris HrcJ protein or xcc1233 SWALL:AAM40531 (EMBL:AE012222) (254 aa) fasta scores: E(): 1.2e-44, 53.01% id in 249 aa, and to Ralstonia solanacearum Hrp conserved lipoprotein HrcJ transmembrane or rsp0867 or rs01638 SWALL:Q52492 (EMBL:AJ245811) (269 aa) fasta scores: E(): 3.1e-44, 52.29% id in 262 aa
YP_111410.1	Previously sequenced as Burkholderia pseudomallei hypothetical 13.9 kDa protein SWALL:Q93KZ4 (EMBL:AF074878) (128 aa) fasta scores: E(): 1.4e-41, 100% id in 128 aa
YP_111411.1	Highly similar to the previously sequenced Burkholderia pseudomallei hypothetical 19.6 kDa protein SWALL:Q93KZ3 (EMBL:AF074878) (178 aa) fasta scores: E(): 2.4e-70, 98.87% id in 178 aa. N-terminus is similar to the N-terminal region of Ralstonia solanacearum HRPK protein rsp0865 or rs01636 SWALL:Q52490 (EMBL:AJ245811) (158 aa) fasta scores: E(): 2.2e-06, 29.36% id in 126 aa
YP_111412.1	Almost identical to the previously sequenced Burkholderia pseudomallei type III secretion-associated protein SctU SWALL:Q93KZ2 (EMBL:AF074878) (351 aa) fasta scores: E(): 5.4e-132, 99.14% id in 352 aa. Similar to Ralstonia solanacearum hypersensitivity response secretion protein HrcU or HrpN or rsp0864 or rs01635 SWALL:HRCU_RALSO (SWALL:P35652) (357 aa) fasta scores: E(): 2.8e-60, 50% id in 346 aa, and to Xanthomonas campestris HrcU homolog SWALL:Q9RBK8 (EMBL:AF160974) (357 aa) fasta scores: E(): 3e-57, 45.79% id in 345 aa
YP_111413.1	Almost identical to the previously sequenced Burkholderia pseudomallei type III secretion-associated protein SctV SWALL:Q93KZ1 (EMBL:AF074878) (705 aa) fasta scores: E(): 0, 99.71% id in 705 aa. Similar to Pseudomonas glumae  HrpO SWALL:Q9F1J5 (EMBL:AB053455) (698 aa) fasta scores: E(): 7.7e-193, 77.69% id in 704 aa
YP_111414.1	Highly similar to the previously sequenced Burkholderia pseudomallei hypothetical 24.8 kDa protein SWALL:Q9ZGR2 (EMBL:AF074878) (227 aa) fasta scores: E(): 1.4e-73, 96.91% id in 227 aa
YP_111415.1	Similar to the previously sequenced Burkholderia pseudomallei type III secretion-associated protein SctQ SWALL:Q9ZGR1 (EMBL:AF074878) (310 aa) fasta scores: E(): 4.2e-117, 98.06% id in 310 aa. Similar to Zea mays fdr3 SWALL:Q94KV5 (EMBL:AF262623) (355 aa) fasta scores: E(): 1.1e-16, 33.33% id in 315 aa, and to Ralstonia solanacearum protein HrpQ or HrcQ or rsp0861 or rs01632 SWALL:Q52489 (EMBL:AJ245811) (354 aa) fasta scores: E(): 1.8e-12, 29.09% id in 299 aa
YP_111416.1	part of a set of proteins involved in the infection of eukaryotic cells; in plant pathogens involved in the hypersensitivity response
YP_111417.1	Highly similar to the previously sequenced Burkholderia pseudomallei type III secretion-associated protein SctS SWALL:Q9ZGR0 (EMBL:AF074878) (87 aa) fasta scores: E(): 3.7e-31, 98.85% id in 87 aa. Similar to Ralstonia solanacearum HrpU protein or HrcS or rsp0859 or rs01630 SWALL:Q52487 (EMBL:AJ245811) (86 aa) fasta scores: E(): 3.4e-14, 58.53% id in 82 aa, and to Xanthomonas oryzae pv. oryzicola HrcS SWALL:Q93MH8 (EMBL:AF404819) (86 aa) fasta scores: E(): 2e-13, 52.32% id in 86 aa
YP_111418.1	Similar to the previously sequenced Burkholderia pseudomallei hypothetical 34.4 kDa protein SWALL:Q9ZGQ9 (EMBL:AF074878) (317 aa) fasta scores: E(): 6.1e-118, 97.8% id in 319 aa
YP_111419.1	Highly similar to the previously sequenced Burkholderia pseudomallei type III secretion-associated protein SctD SWALL:Q93KZ0 (EMBL:AF074878) (349 aa) fasta scores: E(): 1.7e-119, 98.28% id in 349 aa. Similar to Xanthomonas campestris HrpD5 protein or xcc1223 SWALL:Q8PBA0 (EMBL:AE012221) (315 aa) fasta scores: E(): 1e-09, 30.09% id in 329 aa
YP_111420.1	Previously sequenced as Burkholderia pseudomallei hypothetical 8.8 kDa protein SWALL:Q93KY9 (EMBL:AF074878) (82 aa) fasta scores: E(): 7.3e-30, 100% id in 82 aa
YP_111422.1	Similar to Xanthomonas oryzae HpaB SWALL:Q9KW23 (EMBL:AB045311) (162 aa) fasta scores: E(): 7e-30, 52.86% id in 157 aa. Almost identical to the previously sequenced Burkholderia pseudomallei hypothetical 16.8 kDa protein SWALL:Q93KY8 (EMBL:AF074878) (151 aa) fasta scores: E(): 1.1e-61, 99.33% id in 151 aa
YP_111423.1	Previously sequenced as Burkholderia pseudomallei hypothetical 23.1 kDa protein SWALL:Q93KY7 (EMBL:AF074878) (218 aa) fasta scores: E(): 8e-79, 100% id in 218 aa. Weakly similar to Serratia entomophila SepC protein SWALL:Q9F9Z0 (EMBL:AF135182) (973 aa) fasta scores: E(): 5.3e-07, 29.94% id in 334 aa, and to Yersinia pestis insecticial toxin ypo2380 SWALL:Q8ZE10 (EMBL:AJ414152) (984 aa) fasta scores: E(): 7.7e-05, 31.45% id in 302 aa
YP_111424.1	Similar to Ralstonia solanacearum hypothetical protein rsc2672 or rs04533 SWALL:Q8XW03 (EMBL:AL646071) (159 aa) fasta scores: E(): 2.7e-13, 36.91% id in 149 aa, and to Rhizobium meliloti  auxin-binding protein r01214 or smc01776 SWALL:Q92QU1 (EMBL:AL591786) (167 aa) fasta scores: E(): 1.7e-06, 36.36% id in 99 aa
YP_111425.1	Similar to Bradyrhizobium japonicum Bll1358 protein SWALL:BAC46623 (EMBL:AP005939) (271 aa) fasta scores: E(): 5.4e-28, 44.33% id in 203 aa, and to Xanthomonas axonopodis hydrolase xac3428 SWALL:Q8PH32 (EMBL:AE011989) (205 aa) fasta scores: E(): 4.7e-16, 36.31% id in 201 aa
YP_111426.1	Similar to Rhodobacter capsulatus pyruvate dehydrogenase complex repressor PdhR SWALL:O33960 (EMBL:U78309) (257 aa) fasta scores: E(): 1.5e-12, 32.6% id in 230 aa, and to Rhizobium meliloti  GntR-family transcriptional regulator ra0130 or sma0246 SWALL:Q930R5 (EMBL:AE007207) (233 aa) fasta scores: E(): 8.2e-21, 37% id in 227 aa, and to Agrobacterium tumefaciens transcriptional regulator, GntR family atu2740 or agr_c_4967 SWALL:Q8UBW0 (EMBL:AE009221) (238 aa) fasta scores: E(): 1.7e-20, 36.74% id in 215 aa
YP_111427.1	Similar to Salmonella typhimurium 3-hydroxyisobutyrate dehydrogenase YgbJ or stm2918 SWALL:Q8ZMG4 (EMBL:AE008833) (307 aa) fasta scores: E(): 2.5e-52, 58.07% id in 291 aa, and to Pasteurella multocida hypothetical protein Pm1366 SWALL:Q9CL76 (EMBL:AE006174) (301 aa) fasta scores: E(): 9.3e-52, 55.66% id in 300 aa, and to Brucella melitensis D-beta-hydroxybutyrate dehydrogenase bmeII1090 SWALL:Q8YB11 (EMBL:AE009741) (302 aa) fasta scores: E(): 2.4e-49, 55.4% id in 296 aa
YP_111428.1	Similar to Pasteurella multocida hypothetical protein Pm1365 SWALL:Q9CL77 (EMBL:AE006174) (413 aa) fasta scores: E(): 4.4e-60, 48.96% id in 388 aa, and to Brucella melitensis hypothetical protein BmeII1091 SWALL:Q8YB10 (EMBL:AE009741) (436 aa) fasta scores: E(): 6.8e-60, 45.16% id in 465 aa, and to Rhizobium meliloti hypothetical protein rb1377 or smb20670 SWALL:Q92TW7 (EMBL:AL603646) (425 aa) fasta scores: E(): 8.9e-59, 48.34% id in 453 aa
YP_111429.1	Similar to Escherichia coli, and Shigella flexneri L-fuculose phosphate aldolase FucA or FucC or prd or b2800 or sf2814 SWALL:FUCA_ECOLI (SWALL:P11550) (215 aa) fasta scores: E(): 3.6e-07, 28.35% id in 201 aa, and to Rhizobium meliloti  aldolase, possibly L-fuculose-phosphate aldolase rb1373 or smb20666 SWALL:Q92TX1 (EMBL:AL603646) (225 aa) fasta scores: E(): 1.7e-34, 51.2% id in 207 aa, and to Brucella melitensis L-fuculose phosphate aldolase bmeII1095 SWALL:Q8YB06 (EMBL:AE009741) (224 aa) fasta scores: E(): 2.4e-29, 44.97% id in 209 aa
YP_111430.1	Similar to Burkholderia cepacia phthalate transporter OphD SWALL:Q9RPP3 (EMBL:AF152094) (448 aa) fasta scores: E(): 3.2e-70, 42.61% id in 420 aa, and to Brucella melitensis  tartrate transporter bmeii1096 SWALL:Q8YB05 (EMBL:AE009741) (451 aa) fasta scores: E(): 2e-112, 64.52% id in 420 aa, and to Ralstonia solanacearum probable permease transmembrane protein rsc2352 or rs01194 SWALL:Q8XWW8 (EMBL:AL646069) (442 aa) fasta scores: E(): 2.5e-106, 59.59% id in 443 aa
YP_111431.1	Similar to Escherichia coli hydroxypyruvate isomerase Hyi or Gip or b0508 SWALL:HYI_ECOLI (SWALL:P30147) (258 aa) fasta scores: E(): 3.6e-43, 43.96% id in 257 aa, and to Alcaligenes eutrophus hypothetical 28.3 kDa protein in Gbd 5'region SWALL:YGB4_ALCEU (SWALL:Q44015) (260 aa) fasta scores: E(): 4.8e-86, 79.45% id in 258 aa, and to Ralstonia solanacearum hypothetical protein rsc0020 or rs01842 SWALL:Q8Y3G0 (EMBL:AL646057) (262 aa) fasta scores: E(): 1.1e-77, 71.26% id in 254 aa
YP_111432.1	Similar to Alcaligenes eutrophus hypothetical 34.2 kDa protein in Gbd 5'region SWALL:Q44016 (EMBL:L36817) (324 aa) fasta scores: E(): 3.4e-76, 66.87% id in 320 aa, and to Yersinia pestis hypothetical protein ypo2238 or y2079 SWALL:Q8ZED6 (EMBL:AJ414151) (333 aa) fasta scores: E(): 9.1e-63, 55.03% id in 318 aa, and to Brucella melitensis 4-hydroxybutyrate dehydrogenase bmeII1094 SWALL:Q8YB07 (EMBL:AE009741) (321 aa) fasta scores: E(): 7.6e-59, 52.18% id in 320 aa
YP_111433.1	Similar to Rhizobium loti hypothetical protein Mll1937 from codon 35 SWALL:Q98JH6 (EMBL:AP002998) (228 aa) fasta scores: E(): 9.7e-45, 50.66% id in 225 aa. Possible alternative start site at codon 34
YP_111434.1	Similar to Ralstonia solanacearum aspartyl/asparaginyl beta-hydroxylase transmembrane protein rsc1877 or rs03437 SWALL:Q8XY86 (EMBL:AL646067) (300 aa) fasta scores: E(): 2.4e-77, 58.38% id in 298 aa, and to Pseudomonas aeruginosa hypothetical protein Pa4512 SWALL:Q9HVQ9 (EMBL:AE004865) (299 aa) fasta scores: E(): 4.9e-75, 60.06% id in 298 aa, and to Xanthomonas campestris aspartyl/asparaginyl beta-hydroxylase AspH or xcc0382 SWALL:AAM39701 (EMBL:AE012134) (301 aa) fasta scores: E(): 8.8e-74, 57.71% id in 298 aa
YP_111435.1	Similar to Rhizobium meliloti glycine betaine/L-proline ABC transporter ProX SWALL:Q8RPR1 (EMBL:AF360731) (309 aa) fasta scores: E(): 7.1e-57, 52.24% id in 312 aa, and to Brucella suis glycine betaine/L-proline ABC transporter periplasmic glycine betaine-binding protein,  br1579 SWALL:AAN30485 (EMBL:AE014452) (322 aa) fasta scores: E(): 6.3e-63, 55.84% id in 308 aa, and to Brucella melitensis glycine betaine/L-proline-binding protein ProX bmei0441 SWALL:Q8YIK3 (EMBL:AE009487) (326 aa) fasta scores: E(): 9.7e-63, 55.51% id in 308 aa
YP_111436.1	Similar to Pseudomonas syringae arginine pathway regulatory protein ArgR SWALL:Q8VVB2 (EMBL:AF443787) (354 aa) fasta scores: E(): 4.9e-35, 40% id in 315 aa, and to Ralstonia solanacearum probable transcriptional regulator protein rsp0068 or rs02043 SWALL:Q8XTN8 (EMBL:AL646076) (334 aa) fasta scores: E(): 2.1e-97, 76.2% id in 332 aa, and to Ralstonia solanacearum probable transcriptional regulator protein rsp0054 or rs02029 SWALL:Q8XTQ2 (EMBL:AL646076) (343 aa) fasta scores: E(): 2.4e-67, 56.82% id in 315 aa
YP_111437.1	Similar to Lactococcus lactis glycine-betaine binding permease BusAB or OpuabC SWALL:Q9RQ05 (EMBL:AF139575) (573 aa) fasta scores: E(): 7e-47, 50.73% id in 272 aa, and to Ralstonia solanacearum probable transmembrane ABC transporter protein rsp0067 or rs02042 SWALL:Q8XTN9 (EMBL:AL646076) (298 aa) fasta scores: E(): 1.7e-94, 84.84% id in 297 aa, and to Brucella melitensis glycine betaine/L-proline transport system permease ProW bmeii0549 SWALL:Q8YCH9 (EMBL:AE009690) (301 aa) fasta scores: E(): 6.5e-59, 58.82% id in 289 aa
YP_111438.1	Similar to Salmonella typhimurium glycine betaine/L-proline transport ATP-binding protein ProV or stm2809 SWALL:PROV_SALTY (SWALL:P17328) (400 aa) fasta scores: E(): 2.3e-57, 46.73% id in 398 aa, and to Ralstonia solanacearum  glycine betaine/L-proline ATP-binding ABC transporter protein OpuA or rsp0066 or rs02041 SWALL:Q8XTP0 (EMBL:AL646076) (385 aa) fasta scores: E(): 2.3e-106, 82.26% id in 389 aa, and to Brucella melitensis glycine betaine/L-proline transport ATP-binding protein ProV bmeii0548 SWALL:Q8YCI0 (EMBL:AE009690) (398 aa) fasta scores: E(): 4.7e-63, 50.51% id in 392 aa
YP_111439.1	Similar to Streptomyces avermitilis NADPH-dependent fmn reductase SWALL:Q82GT3 (EMBL:AP005036) (203 aa) fasta scores: E(): 1e-28, 50.79% id in 189 aa
YP_111442.1	Similar to Thiobacillus ferrooxidans ArsR-like protein SWALL:Q9L9D2 (EMBL:AF173880) (118 aa) fasta scores: E(): 1.7e-11, 50.52% id in 95 aa, and to Ralstonia solanacearum  arsenical resistance operon repressor transcription regulator protein ArsR or rsp1129 or rs05489 SWALL:Q8XQT9 (EMBL:AL646083) (107 aa) fasta scores: E(): 2.4e-17, 57.14% id in 105 aa, and to Caulobacter crescentus transcriptional regulator, ArsR family cc1505 SWALL:Q9A859 (EMBL:AE005825) (109 aa) fasta scores: E(): 5e-15, 51.57% id in 95 aa
YP_111443.1	Similar to Mycobacterium tuberculosis hypothetical protein rv2641 or mt2719 or mtcy441.11 SWALL:YQ41_MYCTU (SWALL:P71940) (152 aa) fasta scores: E(): 9.6e-12, 36.12% id in 155 aa, and to Anabaena sp. hypothetical protein Alr1104 SWALL:Q8YXV5 (EMBL:AP003584) (150 aa) fasta scores: E(): 2.6e-11, 34.21% id in 152 aa
YP_111444.1	Similar to Thiobacillus ferrooxidans arsenate reductase ArsC SWALL:Q9L9D3 (EMBL:AF173880) (163 aa) fasta scores: E(): 1.1e-13, 37.83% id in 148 aa, and to Ralstonia solanacearum  arsenate reductase ArsC or rsp1128 or rs05491 SWALL:Q8XQU0 (EMBL:AL646083) (164 aa) fasta scores: E(): 7.6e-52, 79.26% id in 164 aa, and to Rhodobacter capsulatus  arsenate reductase SWALL:O68076 (EMBL:AF010496) (281 aa) fasta scores: E(): 5.2e-22, 45.57% id in 158 aa
YP_111445.1	Similar to Sinorhizobium sp. As4 arsenic resistance ArsB SWALL:Q9RA92 (EMBL:AF178758) (351 aa) fasta scores: E(): 5.8e-24, 30.65% id in 349 aa, and to Agrobacterium tumefaciens sodium bile acid symporter family protein atu1491 or agr_c_2750 SWALL:Q8UFA7 (EMBL:AE009108) (352 aa) fasta scores: E(): 8.7e-87, 71.04% id in 335 aa, and to Pasteurella multocida hypothetical protein Pm1943 SWALL:Q9CJQ1 (EMBL:AE006231) (338 aa) fasta scores: E(): 3.6e-64, 51.66% id in 331 aa
YP_111446.1	Similar to C-terminus of Streptococcus pneumoniae cell wall surface anchor family protein sp1772 SWALL:Q97P71 (EMBL:AE007470) (4776 aa) fasta scores: E(): 1.2e-132, 37.46% id in 2565 aa, and to C-terminus of Streptococcus cristatus SrpA SWALL:Q9KX33 (EMBL:U96166) (3381 aa) fasta scores: E(): 8.9e-115, 32.07% id in 2703 aa, and to C-terminus of Streptococcus gordonii streptococcal hemagglutinin Hsa SWALL:Q9KWR3 (EMBL:AB029393) (2178 aa) fasta scores: E(): 1.5e-88, 35.24% id in 2105 aa
YP_111448.1	C-terminal region is similar to Ralstonia solanacearum hypothetical protein rsc3164 or rs00434 SWALL:Q8XUM3 (EMBL:AL646074) (387 aa) fasta scores: E(): 6e-30, 34.75% id in 374 aa, and Caulobacter crescentus protein FlbA or cc1457 SWALL:FLBA_CAUCR (SWALL:P21296) (596 aa) fasta scores: E(): 8.3e-11, 28.22% id in 613 aa
YP_111449.1	Similar to C-terminus of Staphylococcus epidermidis streptococcal hemagglutinin protein se2249 SWALL:AAO05891 (EMBL:AE016751) (2310 aa) fasta scores: E(): 1.8e-79, 40.67% id in 1480 aa, and to C-terminus of Streptococcus pneumoniae cell wall surface anchor family protein sp1772 SWALL:Q97P71 (EMBL:AE007470) (4776 aa) fasta scores: E(): 1.1e-73, 36.81% id in 1456 aa. Possible alternative translational start site
YP_111453.1	Similar to Mycobacterium tuberculosis acetyl-/propionyl-coenzyme A carboxylase alpha chain [includes: biotin carboxylase AccA1 or BccA or rv2501c or mt2576 or mtcy07a7.07C] SWALL:BCCA_MYCTU (SWALL:P46401) (654 aa) fasta scores: E(): 1.3e-95, 47.81% id in 663 aa, and to Xanthomonas campestris biotin carboxylase AccC or xcc0244 SWALL:AAM39563 (EMBL:AE012120) (675 aa) fasta scores: E(): 6e-133, 58.04% id in 665 aa, and to Xanthomonas axonopodis biotin carboxylase AccC or xac0263 SWALL:AAM35155 (EMBL:AE011651) (675 aa) fasta scores: E(): 2e-128, 57.31% id in 663 aa
YP_111454.1	Catalyzes the reversible hydration of unsaturated fatty acyl-CoA to beta-hydroxyacyl-CoA
YP_111455.1	Similar to Homo sapiens methylcrotonyl-coA carboxylase beta chain, mitochondrial precursor MccC2 or MccB SWALL:MCCB_HUMAN (SWALL:Q9HCC0) (563 aa) fasta scores: E(): 1e-140, 66.09% id in 522 aa, and to Ralstonia solanacearum  propionyl-coA carboxylase rsc0269 or rs03236 SWALL:Q8Y2R6 (EMBL:AL646058) (535 aa) fasta scores: E(): 4.7e-179, 81.86% id in 535 aa, and to Agrobacterium tumefaciens 3-methylcrotonoyl-coA carboxylase beta subunit MccB or atu3478 or agr_l_2706 SWALL:Q8UA96 (EMBL:AE009278) (537 aa) fasta scores: E(): 4.4e-164, 75.37% id in 532 aa
YP_111456.1	Similar to Solanum tuberosum isovaleryl-coA dehydrogenase 2, mitochondrial precursor Ivd2 SWALL:Q9FS87 (EMBL:AJ278988) (401 aa) fasta scores: E(): 2.1e-97, 65.54% id in 386 aa, and to Ralstonia solanacearum probable acyl-coA dehydrogenase oxidoreductase rsc0279 or rs03246 SWALL:Q8Y2Q6 (EMBL:AL646058) (393 aa) fasta scores: E(): 8e-131, 82.9% id in 392 aa, and to Xanthomonas campestris acyl-coA dehydrogenase AcdA or xcc0246 SWALL:AAM39565 (EMBL:AE012121) (387 aa) fasta scores: E(): 2.3e-112, 71.86% id in 391 aa
YP_111457.1	Similar to Bacillus subtilis hypothetical protein YsiA SWALL:P94548 (EMBL:Z75208) (194 aa) fasta scores: E(): 4.3e-10, 21.87% id in 192 aa, and to Bacillus cereus transcriptional regulator, TetR family SWALL:Q72ZL6 (EMBL:AE017278) (195 aa) fasta scores: E(): 3.4e-08, 24.06% id in 187 aa. CDS is extended at the N- and C-termini in comparison to similar proteins. Possible pseudogene
YP_111458.1	Similar to Neisseria gonorrhoeae major outer membrane protein Pan 1 precursor AniA SWALL:ANIA_NEIGO (SWALL:Q02219) (392 aa) fasta scores: E(): 7.9e-20, 31.92% id in 379 aa, and to Hyphomicrobium denitrificans nitrite reductase precursor NirK SWALL:Q8KKH4 (EMBL:AB076606) (486 aa) fasta scores: E(): 1.8e-20, 29.76% id in 467 aa. CDS is extended at the C-terminus in comparison to similar proteins
YP_111459.1	Possible gene fusion. N-terminus is similar to Rhodococcus sp. I24 nidA dioxygenase large subunit NidA SWALL:Q9X593 (EMBL:AF121905) (468 aa) fasta scores: E(): 7.4e-07, 32.74% id in 113 aa. C-terminus is similar to Vibrio alginolyticus carboxynorspermidine decarboxylase NspC SWALL:Q56575 (EMBL:D31783) (377 aa) fasta scores: E(): 6.9e-33, 30.37% id in 372 aa
YP_111460.1	C-terminal region is similar to Anabaena sp. hypothetical protein Alr0786 SWALL:Q8YYR0 (EMBL:AP003583) (344 aa) fasta scores: E(): 3.2e-29, 34.19% id in 348 aa, and Synechocystis sp. hypothetical protein Slr1287 SWALL:P74202 (EMBL:D90913) (336 aa) fasta scores: E(): 1.1e-24, 34.22% id in 336 aa. Possible alternative translational start site
YP_111461.1	Weakly similar to internal regions of Homo sapiens hypothetical protein Kiaa0585 SWALL:Q9Y4E2 (EMBL:AB011157) (416 aa) fasta scores: E(): 3.4e-14, 29.88% id in 261 aa, and Mus musculus apoptotic cell clearance receptor Ptdserr PtdsR SWALL:Q9ERI5 (EMBL:AF304118) (403 aa) fasta scores: E(): 4.5e-14, 29.5% id in 261 aa
YP_111463.1	Similar to Caulobacter crescentus hypothetical protein Cc1198 SWALL:Q9A8Z7 (EMBL:AE005797) (331 aa) fasta scores: E(): 4.5e-83, 62.23% id in 331 aa, and to Campylobacter jejuni hypothetical protein Cj0554 SWALL:Q9PHW0 (EMBL:AL139075) (334 aa) fasta scores: E(): 2.4e-64, 48.77% id in 326 aa, and to Streptomyces coelicolor hypothetical protein sco0437 or scf51a.15C SWALL:Q9RL49 (EMBL:AL939105) (341 aa) fasta scores: E(): 1e-54, 48.94% id in 331 aa
YP_111464.1	Similar to Comamonas testosteroni transporter PmdK SWALL:Q93PT0 (EMBL:AF305325) (465 aa) fasta scores: E(): 1e-16, 26.15% id in 455 aa, and to Xanthomonas campestris MFS transporter xcc1685 SWALL:AAM40979 (EMBL:AE012270) (468 aa) fasta scores: E(): 2.2e-83, 50.98% id in 459 aa, and to Xanthomonas axonopodis MFS transporter xac1705 SWALL:AAM36572 (EMBL:AE011802) (474 aa) fasta scores: E(): 4.2e-78, 49.56% id in 462 aa
YP_111465.1	Similar to Saccharomyces cerevisiae hypothetical 27.4 kDa protein in Hyr1 3'region yir042C SWALL:YIW2_YEAST (SWALL:P40586) (236 aa) fasta scores: E(): 8e-44, 51.94% id in 231 aa, and to Yersinia pestis hypothetical 27.4 kDa protein ypo1955 or y2355 SWALL:Q9ZC61 (EMBL:AL031866) (299 aa) fasta scores: E(): 1e-40, 46.48% id in 256 aa
YP_111466.1	Similar to Pseudomonas sp. JR1 two-component sensor ArmS SWALL:Q9KJZ1 (EMBL:AF155506) (440 aa) fasta scores: E(): 7.1e-18, 32.31% id in 359 aa, and to Brucella melitensis two-component system sensor bmeII1015 SWALL:Q8YB85 (EMBL:AE009734) (447 aa) fasta scores: E(): 7.6e-71, 51.03% id in 437 aa, and to Agrobacterium tumefaciens two component sensor kinase atu4018 or agr_l_1672 SWALL:Q8U8S2 (EMBL:AE009332) (445 aa) fasta scores: E(): 2.3e-46, 37.69% id in 443 aa
YP_111467.1	Similar to Pseudomonas sp. JR1 response regulator ArmR SWALL:Q9KJZ2 (EMBL:AF155506) (227 aa) fasta scores: E(): 6.5e-32, 45.37% id in 216 aa, and to Brucella melitensis two component response regulator bmIIi1014 SWALL:Q8YB86 (EMBL:AE009734) (225 aa) fasta scores: E(): 2.6e-52, 67.13% id in 216 aa, and to Agrobacterium tumefaciens two component response regulator atu4019 or agr_l_1670 SWALL:Q8U8S1 (EMBL:AE009332) (217 aa) fasta scores: E(): 4.5e-40, 52.99% id in 217 aa
YP_111468.1	Similar to Brucella melitensis hypothetical cytosolic protein BmeII1013 SWALL:Q8YB87 (EMBL:AE009734) (111 aa) fasta scores: E(): 4.9e-14, 43.22% id in 118 aa, and to Brucella melitensis hypothetical cytosolic protein Bmei0390 SWALL:Q8YIQ3 (EMBL:AE009481) (87 aa) fasta scores: E(): 0.00027, 37.34% id in 83 aa
YP_111469.1	Similar to Brucella melitensis hypothetical protein Bmeii1012 SWALL:Q8YB88 (EMBL:AE009733) (156 aa) fasta scores: E(): 3.9e-31, 57.41% id in 155 aa
YP_111470.1	Similar to Brucella melitensis sulfite reductase bmeii1011 SWALL:Q8YB89 (EMBL:AE009733) (733 aa) fasta scores: E(): 3.7e-34, 44.75% id in 782 aa, and to Caulobacter crescentus sulfite reductase cc3063 SWALL:Q9A3Y7 (EMBL:AE005969) (504 aa) fasta scores: E(): 9.1e-17, 31.37% id in 510 aa
YP_111471.1	Similar to Escherichia coli, and Escherichia coli O157:H7 thiamine biosynthesis lipoprotein ApbE precursor apbE SWALL:APBE_ECOLI (SWALL:P33944) (351 aa) fasta scores: E(): 8.5e-19, 28.42% id in 380 aa, and to Brucella melitensis thiamine biosynthesis lipoprotein ApbE precursor SWALL:Q8YB90 (EMBL:AE009733) (325 aa) fasta scores: E(): 2.2e-34, 42.64% id in 394 aa. CDS contains additional internal residues in comparison to orthologues
YP_111472.1	Similar to Streptomyces clavuligerus semialdehyde dehydrogenase Pcd SWALL:O85725 (EMBL:AF073895) (512 aa) fasta scores: E(): 2e-120, 66.05% id in 492 aa, and to Ralstonia solanacearum  transmembrane aldehyde dehydrogenase oxidoreductase rsp1591 or rs02148 SWALL:Q8XPP7 (EMBL:AL646085) (504 aa) fasta scores: E(): 9.4e-134, 69.84% id in 504 aa, and to Rhizobium loti aldehyde dehydrogenase mll2867 SWALL:Q98HH4 (EMBL:AP003000) (504 aa) fasta scores: E(): 4.1e-132, 68.93% id in 499 aa
YP_111473.1	Similar to Streptomyces coelicolor aminotransferase sco3306 or sce68.04C SWALL:Q9WX27 (EMBL:AL939116) (404 aa) fasta scores: E(): 1.2e-64, 50.5% id in 400 aa, and to Ralstonia solanacearum aminotransferase rsc0229 or rs00661 SWALL:Q8Y2V3 (EMBL:AL646058) (402 aa) fasta scores: E(): 1e-56, 47.08% id in 395 aa, and to Pyrococcus abyssi aminotransferase pab2227 SWALL:Q9V282 (EMBL:AJ248283) (410 aa) fasta scores: E(): 3.6e-53, 39.54% id in 397 aa
YP_111474.1	C-terminal region is similar to Anabaena sp. hypothetical protein Alr2404 alr2404 SWALL:Q8YUE6 (EMBL:AP003589) (313 aa) fasta scores: E(): 1.2e-08, 26.86% id in 309 aa. Possible alternative translation start sites
YP_111475.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 glycine cleavage system transcriptional activator GcvA or b2808 or c3378 or z4125 or ecs3668 SWALL:GCVA_ECOLI (SWALL:P32064) (305 aa) fasta scores: E(): 4.1e-31, 38.77% id in 294 aa, and to Ralstonia solanacearum probable transcription regulator protein rsp1593 or rs02150 SWALL:Q8XPP5 (EMBL:AL646085) (296 aa) fasta scores: E(): 5.1e-60, 55.89% id in 297 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa0448 SWALL:Q9I670 (EMBL:AE004482) (302 aa) fasta scores: E(): 1.4e-54, 53% id in 300 aa
YP_111476.1	N-terminal region is similar to Ralstonia solanacearum hypothetical protein RSC0264 SWALL:Q8Y2S1 (EMBL:AL646058) (99 aa) fasta scores: E(): 1.6e-06, 47.72% id in 88 aa. CDS contains an alanine rich region towards the C-terminus
YP_111477.1	Similar to Escherichia coli probable oxidoreductase OrdL or b1301 SWALL:ORDL_ECOLI (SWALL:P37906) (426 aa) fasta scores: E(): 9.2e-41, 37.43% id in 390 aa, and to Rhizobium meliloti  oxidoreductase ordl3 or r02961 or smc03132 SWALL:Q92LR9 (EMBL:AL591792) (426 aa) fasta scores: E(): 1.7e-56, 42.99% id in 414 aa, and to Pseudomonas aeruginosa hypothetical protein Pa2776 pa2776 SWALL:Q9I067 (EMBL:AE004705) (427 aa) fasta scores: E(): 1.6e-46, 39% id in 423 aa
YP_111478.1	Similar to Ralstonia solanacearum  transcription regulator protein rsp1395 or rs02063 SWALL:Q8XQ91 (EMBL:AL646084) (224 aa) fasta scores: E(): 2.7e-40, 53.15% id in 222 aa, and to Rhizobium meliloti hypothetical transcriptional regulator protein smb20033 rb0036 or smb20033 SWALL:Q92XC6 (EMBL:AL603642) (220 aa) fasta scores: E(): 1.1e-39, 55.02% id in 209 aa. Possible alternative translation start site after codon 8.
YP_111479.2	Similar to Shigella flexneri  transposase for IS110 s0128 SWALL:Q9AFS5 (EMBL:AF348706) (398 aa) fasta scores: E(): 8.1e-116, 79.64% id in 398 aa, and to Streptomyces coelicolor insertion element IS110 hypothetical 43.6 kDa protein SWALL:YIS1_STRCO (SWALL:P19780) (405 aa) fasta scores: E(): 1.1e-79, 59.74% id in 395 aa. Note: Also similar to BPSS0338 (427 aa) fasta scores: E(): 2.5e-113, 88.732% identity in 426 aa overlap
YP_111480.1	Limited similarity to Rhizobium meliloti hypothetical protein ra1102 or sma2012 SWALL:Q92XY6 (EMBL:AE007296) (638 aa) fasta scores: E(): 0.00033, 26.1% id in 544 aa
YP_111481.1	Similar to Escherichia coli glycerol-3-phosphate regulon repressor GlpR or b3423 SWALL:GLPR_ECOLI (SWALL:P09392) (252 aa) fasta scores: E(): 2e-21, 32.14% id in 252 aa, and to Rhizobium meliloti  transcriptional regulator, GntR family protein rb0973 or smb21533 SWALL:Q92UW3 (EMBL:AL603645) (261 aa) fasta scores: E(): 5.3e-33, 44.57% id in 249 aa, and to Rhizobium loti transcriptional regulator mlr5371 SWALL:Q98BY9 (EMBL:AP003006) (258 aa) fasta scores: E(): 9e-23, 35.96% id in 253 aa
YP_111482.1	Similar to Bacillus subtilis hexuronate transporter ExuT SWALL:EXUT_BACSU (SWALL:O34456) (422 aa) fasta scores: E(): 1.6e-32, 47.3% id in 408 aa, and to Salmonella typhimurium  transport protein stm1543 SWALL:Q8ZPG6 (EMBL:AE008767) (428 aa) fasta scores: E(): 4.4e-89, 54.73% id in 422 aa. Possible alternative translation start site after codon 5.
YP_111483.1	Similar to Pseudomonas fluorescens mannitol 2-dehydrogenase MtlD SWALL:O08355 (EMBL:AF007800) (493 aa) fasta scores: E(): 2.3e-53, 38.74% id in 431 aa, and to Brucella melitensis D-mannonate oxidoreductase bmeII0478 SWALL:Q8YCQ0 (EMBL:AE009684) (502 aa) fasta scores: E(): 3.1e-68, 44.9% id in 461 aa, and to Rhizobium meliloti D-mannonate oxidoreductase UxuB or rb1441 or smb20749 SWALL:Q92TQ9 (EMBL:AL603647) (487 aa) fasta scores: E(): 3.9e-67, 45.16% id in 476 aa
YP_111484.1	Similar to Bacillus stearothermophilus regulatory protein UxuR SWALL:Q9ZFL9 (EMBL:AF098273) (249 aa) fasta scores: E(): 7.3e-13, 30.55% id in 216 aa, and to Salmonella typhimurium, and Salmonella typhi  regulatory protein, GntR family ydfh or stm1510 or sty1551 SWALL:Q8XFZ6 (EMBL:AE008766) (228 aa) fasta scores: E(): 1.5e-17, 31.36% id in 220 aa, and to Rhizobium meliloti GntR-family transcriptional regulator ra0032 or sma0065 SWALL:Q931B2 (EMBL:AE007198) (230 aa) fasta scores: E(): 1.8e-17, 33.93% id in 221 aa
YP_111485.1	Similar to Escherichia coli starvation sensing protein RspA or b1581 SWALL:RSPA_ECOLI (SWALL:P38104) (404 aa) fasta scores: E(): 4.3e-108, 65.84% id in 404 aa, and to Caulobacter crescentus mandelate racemase / muconate lactonizing enzyme family cc2812 SWALL:Q9A4L8 (EMBL:AE005947) (403 aa) fasta scores: E(): 3.6e-113, 70.82% id in 401 aa, and to Xanthomonas campestris starvation sensing protein rspa or xcc4104 SWALL:AAM43325 (EMBL:AE012534) (419 aa) fasta scores: E(): 5.4e-109, 69.36% id in 395 aa
YP_111486.1	Similar to Escherichia coli starvation sensing protein RspB or b1580 SWALL:RSPB_ECOLI (SWALL:P38105) (339 aa) fasta scores: E(): 4.3e-69, 52.33% id in 342 aa, and to Salmonella typhimurium  dehydrogenase RspB or stm1506 SWALL:Q8ZPJ0 (EMBL:AE008765) (339 aa) fasta scores: E(): 7.5e-69, 52.92% id in 342 aa, and to Bacillus subtilis zinc-containing alcohol dehydrogenase YjmD SWALL:O35045 (EMBL:AF015825) (339 aa) fasta scores: E(): 3.2e-43, 38.01% id in 342 aa
YP_111488.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa3358 SWALL:Q9HYN8 (EMBL:AE004758) (292 aa) fasta scores: E(): 2.1e-30, 43.36% id in 279 aa, and to Rhizobium meliloti hypothetical membrane protein smb20885 rb1179 or smb20885 SWALL:Q92UF2 (EMBL:AL603646) (306 aa) fasta scores: E(): 4.8e-30, 38.94% id in 285 aa
YP_111489.1	catalyzes the formation of nicotinamide adenine dinucleotide (NAD) from nicotinic acid adenine dinucleotide (NAAD) using either ammonia or glutamine as the amide donor and ATP; ammonia-utilizing enzymes include the ones from Bacillus and Escherichia coli while glutamine-utilizing enzymes include the Mycobacterial one; forms homodimers
YP_111490.1	No significant database matches to the full length CDS. N-terminal region is similar to Rhizobium loti transcriptional regulator mll3386 SWALL:Q98GC7 (EMBL:AP003001) (219 aa) fasta scores: E(): 1.2e-20, 50.25% id in 193 aa, and Yersinia pestis  TetR-family regulatory protein ypo3840 or y0390 SWALL:Q8ZAG2 (EMBL:AJ414159) (228 aa) fasta scores: E(): 4e-15, 52.5% id in 200 aa
YP_111491.1	Similar to Yersinia pestis hypothetical protein ypo3839 or y0391 SWALL:Q8ZAG3 (EMBL:AJ414159) (405 aa) fasta scores: E(): 1.8e-95, 67.09% id in 392 aa, and to Rhizobium loti hypothetical protein Mll9388 SWALL:Q981G1 (EMBL:AP003016) (408 aa) fasta scores: E(): 5.3e-85, 59.43% id in 392 aa
YP_111492.1	Similar to Yersinia pestis hypothetical protein ypo3838 or y0392 SWALL:Q8ZAG4 (EMBL:AJ414159) (280 aa) fasta scores: E(): 2e-84, 80.43% id in 276 aa, and to Rhizobium sp. hypothetical 30.2 kDa protein Y4oV SWALL:Y4OV_RHISN (SWALL:P55607) (285 aa) fasta scores: E(): 1.3e-71, 69.53% id in 279 aa
YP_111493.1	Similar to Rhizobium loti hypothetical protein Mlr1698 SWALL:Q98K03 (EMBL:AP002998) (147 aa) fasta scores: E(): 1.4e-18, 45.11% id in 133 aa, and to Yersinia pestis hypothetical protein ypo0625 or y3553 SWALL:Q8ZI86 (EMBL:AJ414143) (148 aa) fasta scores: E(): 7.1e-13, 36.29% id in 135 aa
YP_111494.1	Similar to Ralstonia solanacearum probable major anaerobically induced outer membrane transmembrane protein rsp1503 or rs03038 SWALL:Q8XPY3 (EMBL:AL646085) (510 aa) fasta scores: E(): 3.3e-93, 71.45% id in 522 aa, and to Neisseria meningitidis nitrite reductase, major outer membrane copper-containing protein AniA or nma1887 SWALL:Q9JTB8 (EMBL:AL162757) (386 aa) fasta scores: E(): 1.9e-67, 58.26% id in 357 aa, and to Neisseria meningitidis major anaerobically induced outer membrane protein nmb1623 SWALL:Q9JYE1 (EMBL:AE002512) (390 aa) fasta scores: E(): 3.1e-67, 57.7% id in 357 aa
YP_111495.1	Similar to Ralstonia solanacearum probable signal peptide protein rsp1502 or rs03039 SWALL:Q8XPY4 (EMBL:AL646085) (263 aa) fasta scores: E(): 2.4e-78, 74.14% id in 263 aa, and to Neisseria meningitidis hypothetical protein Nma1888 SWALL:Q9JTB7 (EMBL:AL162757) (251 aa) fasta scores: E(): 8.8e-30, 38.71% id in 248 aa. CDs is extended at the N-terminus in comparison to orthologues. Possible alternative translational start site
YP_111496.1	Similar to Ralstonia solanacearum probable signal peptide protein rsp1501 or rs03040 SWALL:Q8XPY5 (EMBL:AL646085) (194 aa) fasta scores: E(): 1.4e-39, 63.1% id in 187 aa, and to Bacillus sp MnxC mnxC SWALL:Q45436 (EMBL:U31081) (195 aa) fasta scores: E(): 6.3e-09, 33.79% id in 145 aa, and to Aquifex aeolicus hypothetical protein Aq_2194 aq_2194 SWALL:O67938 (EMBL:AE000777) (232 aa) fasta scores: E(): 1.7e-08, 27.1% id in 166 aa
YP_111497.1	Similar to Ralstonia solanacearum N-acetylmuramoyl-L-alanine amidase rsc1796 or rs04196 SWALL:Q8XYG2 (EMBL:AL646066) (343 aa) fasta scores: E(): 1.2e-79, 65.31% id in 320 aa, and to Yersinia pestis probable N-acetylmuramoyl-L-alanine amidase ypo1715 or y1877 SWALL:Q8ZFI8 (EMBL:AJ414150) (283 aa) fasta scores: E(): 6.1e-40, 51.19% id in 252 aa, and to Salmonella typhi N-acetylmuramoyl-L-alanine amidase sty0927 SWALL:Q8Z834 (EMBL:AL627268) (276 aa) fasta scores: E(): 1.1e-34, 46.94% id in 262 aa
YP_111498.1	Similar to Escherichia coli hypothetical glycosyltransferase TibC SWALL:Q9S4K6 (EMBL:AF131891) (406 aa) fasta scores: E(): 2.5e-60, 45.45% id in 363 aa, and to Escherichia coli plasmid pib6 orfa DNA SWALL:Q93K96 (EMBL:AJ304444) (391 aa) fasta scores: E(): 8e-56, 42% id in 369 aa. CDS is extended at the N-terminus in comparison to orthologues. Possible alternative out of frame downstream translational start site, therefore CDS could be pseudogene
YP_111499.1	C-terminus is similar to Ralstonia solanacearum hemagglutinin-related protein rsp1620 or rs02177 SWALL:Q8XPL8 (EMBL:AL646086) (1309 aa) fasta scores: E(): 5.5e-12, 35.51% id in 428 aa
YP_111500.1	Weakly similar to Pseudomonas aeruginosa hypothetical protein Pa1656 SWALL:Q9I369 (EMBL:AE004593) (518 aa) fasta scores: E(): 8.7e-06, 25.93% id in 590 aa, and to Yersinia pestis hypothetical protein ypo1483 or y2687 SWALL:Q8ZG37 (EMBL:AJ414148) (533 aa) fasta scores: E(): 3.8e-05, 25.13% id in 378 aa
YP_111501.1	Similar to Rhizobium sp LcrB protein SWALL:Q53167 (EMBL:M38698) (238 aa) fasta scores: E(): 9.9e-34, 43.16% id in 234 aa, and to Agrobacterium tumefaciens Tiorf152 protein SWALL:BAA87777 (EMBL:AB016260) (253 aa) fasta scores: E(): 3.5e-32, 41% id in 239 aa, and to Agrobacterium tumefaciens regulatory protein VirG or atu6178 or agr_pti_15 SWALL:VIRG_AGRT5 (SWALL:P07545) (253 aa) fasta scores: E(): 3.5e-32, 41% id in 239 aa
YP_111502.1	Similar to Pseudomonas aeruginosa probable two-component sensor pa2571 SWALL:Q9I0R5 (EMBL:AE004685) (470 aa) fasta scores: E(): 4.9e-11, 26.43% id in 401 aa, and to Chlorobium tepidum sensor histidine kinase/response regulator ct1396 SWALL:AAM72624 (EMBL:AE012897) (808 aa) fasta scores: E(): 2.1e-06, 29.09% id in 409 aa, and to Anabaena sp. two-component hybrid sensor and regulator alr1968 SWALL:Q8YVK7 (EMBL:AP003587) (759 aa) fasta scores: E(): 2.3e-06, 29.8% id in 312 aa
YP_111503.1	Similar to Vibrio cholerae hypothetical protein Vca0107 SWALL:Q9KN58 (EMBL:AE004353) (168 aa) fasta scores: E(): 2.3e-28, 55.9% id in 161 aa, and to Pseudomonas aeruginosa hypothetical protein Pa1657 SWALL:Q9I368 (EMBL:AE004593) (168 aa) fasta scores: E(): 3.5e-28, 51.55% id in 161 aa, and to Yersinia pestis hypothetical protein Ypo3707 SWALL:Q8ZAT3 (EMBL:AJ414158) (165 aa) fasta scores: E(): 2.6e-24, 47.59% id in 166 aa
YP_111504.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa1658 SWALL:Q9I367 (EMBL:AE004593) (491 aa) fasta scores: E(): 9.7e-131, 66.03% id in 474 aa, and to Vibrio cholerae hypothetical protein Vca0108 SWALL:Q9KN57 (EMBL:AE004353) (492 aa) fasta scores: E(): 3.2e-123, 61.45% id in 480 aa, and to Yersinia pestis hypothetical protein ypo3706 or y0038 SWALL:Q8ZAT4 (EMBL:AJ414158) (493 aa) fasta scores: E(): 9.9e-120, 59.67% id in 491 aa
YP_111505.1	Similar to Yersinia pestis hypothetical protein ypo1470 or ypo0973 or y2700 or y3363 SWALL:Q8XGB3 (EMBL:AJ414148) (163 aa) fasta scores: E(): 0.0042, 24.84% id in 161 aa, and to Pseudomonas aeruginosa secreted protein Hcp (HcpB or pa5267) and (HcpC or pa0263) and (hc or pa1512) SWALL:Q9HI36 (EMBL:AE004939) (172 aa) fasta scores: E(): 0.013, 25.14% id in 175 aa
YP_111506.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa1659 SWALL:Q9I366 (EMBL:AE004593) (135 aa) fasta scores: E(): 0.00057, 29.24% id in 106 aa, and to Yersinia pestis hypothetical protein Ypo1488 SWALL:Q8ZG31 (EMBL:AJ414148) (150 aa) fasta scores: E(): 0.00084, 30.76% id in 117 aa
YP_111507.1	Similar to Vibrio cholerae hypothetical protein Vca0110 SWALL:Q9KN55 (EMBL:AE004353) (589 aa) fasta scores: E(): 1.4e-37, 33.77% id in 598 aa, and to Yersinia pestis hypothetical protein ypo1485 or y2684 SWALL:Q8ZG34 (EMBL:AJ414148) (587 aa) fasta scores: E(): 2.5e-37, 33.39% id in 587 aa
YP_111508.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa1661 pa1661 SWALL:Q9I364 (EMBL:AE004594) (335 aa) fasta scores: E(): 9e-25, 31.56% id in 320 aa, and to Xanthomonas axonopodis hypothetical protein Xac4141 xac4141 SWALL:AAM38976 (EMBL:AE012064) (346 aa) fasta scores: E(): 3.3e-21, 31.76% id in 318 aa
YP_111509.1	Similar to Yersinia enterocolitica clp protease-associated protein ClpB SWALL:Q9F746 (EMBL:AF285784) (890 aa) fasta scores: E(): 7.8e-55, 41.06% id in 962 aa, and to Ralstonia solanacearum ClpA/B-type chaperone protein rsp0749 or rs01959 SWALL:Q8XRT2 (EMBL:AL646080) (905 aa) fasta scores: E(): 4.1e-66, 47.08% id in 962 aa
YP_111510.1	Similar over its N-terminal half to Pseudomonas aeruginosa hypothetical protein Pa5266 SWALL:Q9HTT3 (EMBL:AE004939) (691 aa) fasta scores: E(): 3.8e-32, 30.61% id in 503 aa, and to Pseudomonas aeruginosa hypothetical protein Pa0095 SWALL:Q9I737 (EMBL:AE004448) (741 aa) fasta scores: E(): 1.5e-31, 26.39% id in 629 aa
YP_111511.1	Similar over its C-terminal region to Chlorobium tepidum pentapeptide repeat family protein ct1045 SWALL:AAM72278 (EMBL:AE012867) (549 aa) fasta scores: E(): 1.5e-08, 32.65% id in 346 aa, and to Caulobacter crescentus pentapeptide repeat family protein cc0587 SWALL:Q9AAL0 (EMBL:AE005733) (371 aa) fasta scores: E(): 2.2e-08, 32.08% id in 321 aa
YP_111512.1	N-terminal region is weakly similar to Synechocystis sp. hypothetical protein SLR1819 SWALL:YI19_SYNY3 (SWALL:P73709) (331 aa) fasta scores: E(): 1.1e-15, 28.8% id in 309 aa
YP_111513.1	Weakly similar to Rhizobium loti hypothetical protein Mlr1970 SWALL:Q98JF2 (EMBL:AP002998) (211 aa) fasta scores: E(): 5.6, 29.57% id in 186 aa
YP_111514.1	Weakly similar to Yersinia pestis hypothetical protein ypo0511a or y3662 SWALL:Q8ZII6 (EMBL:AJ414143) (121 aa) fasta scores: E(): 0.57, 28.84% id in 104 aa
YP_111515.1	Weakly similar to Ralstonia solanacearum transmembrane protein rsp0741 or rs01967 SWALL:Q8XRU0 (EMBL:AL646080) (193 aa) fasta scores: E(): 1.8, 25.52% id in 192 aa
YP_111516.1	Weakly similar to Salmonella typhi hypothetical protein Sty0304 SWALL:Q8Z966 (EMBL:AL627266) (447 aa) fasta scores: E(): 9.9e-06, 26.31% id in 475 aa
YP_111517.1	Similar over its N-terminal region to Ralstonia solanacearum probable transmembrane protein rsp0739 or rs01969 SWALL:Q8XRU2 (EMBL:AL646080) (263 aa) fasta scores: E(): 1.3e-06, 34.83% id in 155 aa, and to Yersinia pestis  membrane protein ypo1468 or ypo0975 or y2703 or y3366 SWALL:Q8XF18 (EMBL:AJ414148) (228 aa) fasta scores: E(): 0.047, 28.94% id in 190 aa
YP_111518.1	Similar to Ralstonia solanacearum probable transmembrane protein rsp0763 or rs01945 SWALL:Q8XRR8 (EMBL:AL646080) (1313 aa) fasta scores: E(): 4.4e-17, 25.47% id in 1162 aa, and to Rhizobium leguminosarum ImpL SWALL:Q93EC2 (EMBL:AF361470) (1158 aa) fasta scores: E(): 3.1e-11, 24.82% id in 1003 aa
YP_111520.1	No significant database matches. Doubtful CDS.
YP_111521.1	involved in the first step of tetrahydrofolate biosynthesis; catalyzes the formation of formate and 2-amino-4-hydroxy-6-(erythro-1,2, 3-trihydroxypropyl)dihydropteridine triphosphate from GTP and water; forms a homopolymer
YP_111524.1	Similar to N-terminal region of Xanthomonas oryzae transposase SWALL:Q93LQ4 (EMBL:AY035401) (344 aa) fasta scores: E(): 1.5e-07, 50% id in 66 aa
YP_111525.1	Similar to Burkholderia cepacia  transposase for insertion sequence element IS402 SWALL:T402_BURCE (SWALL:P24536) (211 aa) fasta scores: E(): 1.4e-21, 55.63% id in 133 aa, and to Pseudomonas glumae transposase SWALL:Q9KVZ9 (EMBL:AB046460) (265 aa) fasta scores: E(): 7.9e-20, 52.71% id in 129 aa
YP_111526.1	Weakly similar to Streptomyces coelicolor regulatory protein sco5017 or sck15.19 SWALL:Q9KY85 (EMBL:AL939122) (365 aa) fasta scores: E(): 4e-11, 28.89% id in 353 aa, and Pseudomonas aeruginosa probable transcriptional regulator pa4094 SWALL:Q9HWT4 (EMBL:AE004825) (319 aa) fasta scores: E(): 2e-09, 26.93% id in 323 aa
YP_111527.1	Weakly similar to Myxococcus xanthus  sigma-54 dependent transcriptional activator 221_mxA SWALL:Q50874 (EMBL:U49156) (140 aa) fasta scores: E(): 3.3, 27.88% id in 104 aa
YP_111528.1	Similar to Pseudomonas viridiflava response regulator GacA or RepB SWALL:GACA_PSEVI (SWALL:P95582) (214 aa) fasta scores: E(): 3.6e-17, 35.21% id in 213 aa, and to Yersinia pestis  two-component response regulator ypo0255 or y0512 SWALL:Q8ZJ69 (EMBL:AJ414141) (210 aa) fasta scores: E(): 9e-22, 40.58% id in 207 aa
YP_111529.1	Similar to Salmonella typhimurium SicP SWALL:O85300 (EMBL:AF060857) (116 aa) fasta scores: E(): 7.2e-06, 25.89% id in 112 aa, and to Escherichia coli O111:H- Tir chaperone CesT SWALL:CEST_ECO11 (SWALL:O30999) (156 aa) fasta scores: E(): 0.38, 26.11% id in 134 aa
YP_111530.1	Similar to Shigella flexneri intercellular spread protein icsb or cp0132 SWALL:ICSB_SHIFL (SWALL:P33546) (494 aa) fasta scores: E(): 1.6e-32, 31.7% id in 388 aa
YP_111531.1	Similar to Salmonella enterica subsp. VII G-nucleotide exchange factor SopE SWALL:Q8VSR1 (EMBL:AF378113) (240 aa) fasta scores: E(): 8.6e-08, 28.77% id in 212 aa, and to Salmonella gallinarum G-nucleotide exchange factor SopE SWALL:Q8VSQ6 (EMBL:AF380340) (240 aa) fasta scores: E(): 1.5e-07, 24.56% id in 228 aa
YP_111532.1	Similar to Salmonella typhi invasion protein IagB or sty3000 SWALL:IAGB_SALTI (SWALL:P43018) (160 aa) fasta scores: E(): 2e-11, 42.27% id in 123 aa, and to Burkholderia pseudomallei hypothetical 18.2 kDa protein SWALL:Q9ZF87 (EMBL:AF110185) (161 aa) fasta scores: E(): 5.2e-21, 47.68% id in 151 aa
YP_111533.1	Similar to Saccharopolyspora erythraea acyl carrier protein AcpP SWALL:ACP_SACER (SWALL:P11830) (95 aa) fasta scores: E(): 0.0043, 36.84% id in 76 aa, and to Thermotoga maritima acyl carrier protein AcpP or tm0662 SWALL:Q9WZD0 (EMBL:AE001739) (81 aa) fasta scores: E(): 9.7e-05, 31.88% id in 69 aa
YP_111535.1	Similar over the C-terminal region to Shigella flexneri 36 kDa membrane antigen IpaD or cp0126 SWALL:AAK18444 (EMBL:J04117) (332 aa) fasta scores: E(): 2e-09, 36.81% id in 182 aa, and to Shigella dysenteriae 37 kDa membrane antigen IpaD SWALL:IPAD_SHIDY (SWALL:Q03947) (332 aa) fasta scores: E(): 8.7e-09, 36.36% id in 187 aa
YP_111536.1	Similar to Ralstonia solanacearum  HNS-like transcription regulator protein rsp0029 or rs02004 SWALL:Q8XTS5 (EMBL:AL646076) (95 aa) fasta scores: E(): 3.7e-14, 58.33% id in 96 aa, and to Citrobacter rodentium lee-encoded regulator SWALL:Q93FM7 (EMBL:AF311901) (129 aa) fasta scores: E(): 0.0036, 26% id in 100 aa
YP_111537.1	Weakly similar to Bordetella bronchiseptica outer protein D BopD SWALL:Q9REZ6 (EMBL:AF207788) (313 aa) fasta scores: E(): 1.4, 25.7% id in 284 aa, and to Salmonella typhi SipC protein or sty3007 SWALL:Q56135 (EMBL:X82670) (409 aa) fasta scores: E(): 0.0039, 24.21% id in 285 aa
YP_111538.1	Similar to Shigella flexneri 62 kDa membrane antigen IpaB or cp0128 SWALL:CAC05803 (EMBL:J04117) (580 aa) fasta scores: E(): 2.1e-29, 29.81% id in 597 aa, and to Salmonella typhimurium, and Salmonella dublin SipB or stm2885 SWALL:Q56019 (EMBL:U25631) (593 aa) fasta scores: E(): 5.8e-41, 35.54% id in 543 aa
YP_111539.1	Similar to Salmonella typhimurium, Salmonella typhi, and Salmonella dublin surface presentation of antigens protein SpaT or SicA or stm2886 or sty3009 SWALL:SPAT_SALTY (SWALL:P40703) (165 aa) fasta scores: E(): 4.2e-37, 61.9% id in 147 aa, and to Shigella flexneri, and Shigella dysenteriae IppI or IpgC or cp0129 SWALL:IPPI_SHIFL (SWALL:P18008) (155 aa) fasta scores: E(): 2.4e-33, 50.32% id in 153 aa
YP_111540.1	Required for surface presentation of invasion plasmid antigens; required for invasion and for secretion of the three ipa proteins
YP_111541.1	Similar to Salmonella typhimurium surface presentation of antigens protein SpaR or stm2888 SWALL:SPAR_SALTY (SWALL:P40701) (263 aa) fasta scores: E(): 2.9e-32, 43.61% id in 227 aa, and to Yersinia enterocolitica YsaT SWALL:Q9KKH0 (EMBL:AF005744) (266 aa) fasta scores: E(): 3.3e-36, 46% id in 250 aa
YP_111542.1	Similar to Salmonella typhimurium, Salmonella typhi, Salmonella dublin, Salmonella enteritidis, Salmonella gallinarum, Salmonella senftenberg, and Salmonella typhisuis surface presentation of antigens protein SpaQ or stm2889 or sty3012 SWALL:SPAQ_SALTY (SWALL:P40704) (86 aa) fasta scores: E(): 3.7e-15, 54.21% id in 83 aa, and to Yersinia enterocolitica YsaS SWALL:Q93NK6 (EMBL:AF369954) (89 aa) fasta scores: E(): 7.6e-18, 65.06% id in 83 aa
YP_111543.1	part of a type III secretory system probably involved in invasion into eukaryotic cells
YP_111544.1	Similar to Salmonella typhimurium SpaO SWALL:Q57524 (EMBL:U29358) (303 aa) fasta scores: E(): 0.045, 28.34% id in 314 aa
YP_111545.1	No significant database matches to the full length protein
YP_111546.1	Weakly similar to Salmonella enterica SpaM SWALL:Q54062 (EMBL:U43314) (147 aa) fasta scores: E(): 3.7, 24.8% id in 125 aa
YP_111547.1	Invasion protein InvC; necessary for efficient entry of S.typhimurium into cultured epithelial cells. Probable catalytic subunit of a protein translocase
YP_111548.1	Similar to Salmonella typhimurium, and Salmonella typhi surface presentation of antigens protein SpaK or InvB or stm2895 or sty3018 SWALL:SPAK_SALTY (SWALL:P39443) (135 aa) fasta scores: E(): 4e-06, 27.61% id in 134 aa, and to Shigella sonnei surface presentation of antigens protein spak spak or spa15 SWALL:SPAK_SHISO (SWALL:Q55296) (133 aa) fasta scores: E(): 1.9e-05, 26.51% id in 132 aa
YP_111549.1	Similar to Salmonella typhimurium, and Salmonella typhi invasion protein InvA or stm2896 or sty3019 SWALL:INVA_SALTY (SWALL:P35657) (685 aa) fasta scores: E(): 7.7e-135, 56.05% id in 694 aa, and to Shigella flexneri, and Shigella sonnei MxiA protein or VirH or cp0147 SWALL:MXIA_SHIFL (SWALL:P35533) (686 aa) fasta scores: E(): 5.3e-133, 55.57% id in 691 aa
YP_111550.1	Similar to Salmonella typhimurium invasion protein InvE or stm2897 SWALL:INVE_SALTY (SWALL:P35671) (372 aa) fasta scores: E(): 3.8e-24, 33.81% id in 346 aa
YP_111551.1	Similar to Salmonella typhimurium InvG protein precursor InvG or stm2898 SWALL:INVG_SALTY (SWALL:P35672) (562 aa) fasta scores: E(): 1.8e-22, 44.5% id in 519 aa, and to Escherichia coli O157:H7 type III secretion apparatus protein z4197 or ecs3733 SWALL:Q8X6D6 (EMBL:AE005515) (567 aa) fasta scores: E(): 4e-36, 40.81% id in 517 aa
YP_111552.1	Similar to Salmonella typhimurium, and Salmonella typhi invasion protein InvF or stm2899 or sty3022 SWALL:INVF_SALTY (SWALL:P39437) (216 aa) fasta scores: E(): 3.5e-18, 36.01% id in 211 aa, and to Escherichia coli O157:H7  regulatory protein for type III secretion apparatus z4198 or ecs3734 SWALL:Q8X6D3 (EMBL:AE005515) (249 aa) fasta scores: E(): 4.4e-15, 36.84% id in 190 aa
YP_111553.1	Similar to Salmonella typhimurium PrgH protein or stm2874 SWALL:PRGH_SALTY (SWALL:P41783) (392 aa) fasta scores: E(): 9.1e-12, 23.74% id in 417 aa, and to Salmonella typhi pathogenicity 1 island effector protein PrgH or sty2995 SWALL:Q8Z499 (EMBL:AL627276) (392 aa) fasta scores: E(): 7e-12, 24.46% id in 417 aa
YP_111554.1	Similar to Salmonella typhimurium PrgI protein or stm2873 SWALL:PRGI_SALTY (SWALL:P41784) (80 aa) fasta scores: E(): 4.2e-12, 55.26% id in 76 aa, and to Shigella flexneri, and Shigella sonnei MxiH protein or cp0137 SWALL:MXIH_SHIFL (SWALL:Q06079) (83 aa) fasta scores: E(): 3.1e-10, 49.35% id in 77 aa
YP_111555.1	Similar to Shigella flexneri, and Shigella sonnei MxiI protein or cp0138 SWALL:MXII_SHIFL (SWALL:Q06080) (97 aa) fasta scores: E(): 0.00022, 37.37% id in 99 aa, and to Salmonella typhimurium PrgJ protein or stm2872 SWALL:PRGJ_SALTY (SWALL:P41785) (101 aa) fasta scores: E(): 0.00075, 37.83% id in 74 aa
YP_111556.1	Similar to Salmonella typhimurium lipoprotein PrgK precursor or stm2871 SWALL:PRGK_SALTY (SWALL:P41786) (252 aa) fasta scores: E(): 1.2e-25, 42.43% id in 238 aa, and to Shigella flexneri lipoprotein MxiJ precursor or cp0139 SWALL:MXIJ_SHIFL (SWALL:Q06081) (241 aa) fasta scores: E(): 1.1e-23, 47.89% id in 190 aa
YP_111557.1	Similar to Salmonella typhimurium oxygen-regulated invasion protein OrgA or stm2870 SWALL:ORGA_SALTY (SWALL:P58653) (199 aa) fasta scores: E(): 4.2e-08, 31.87% id in 160 aa
YP_111558.1	Similar to Salmonella typhimurium oxygen-regulated invasion protein OrgB or stm2869 SWALL:ORGB_SALTY (SWALL:P58654) (226 aa) fasta scores: E(): 2.9e-07, 27.4% id in 208 aa
YP_111559.1	No significant similarity over the entire length of the protein. Similar to Yersinia enterocolitica orf1 SWALL:Q9KKJ0 (EMBL:AF005744) (161 aa) fasta scores: E(): 0.0001, 39.09% id in 110 aa, and to Salmonella typhi possible transmembrane regulator sty0377 SWALL:Q8Z922 (EMBL:AL627266) (247 aa) fasta scores: E(): 0.03, 30.2% id in 149 aa
YP_111561.1	Similar to Streptomyces coelicolor metalloproteinase sco2474 or sc7a8.13 SWALL:Q9L2E5 (EMBL:AL939112) (547 aa) fasta scores: E(): 3.1e-52, 41.6% id in 572 aa, and to Xanthomonas axonopodis metalloproteinase xac0465 SWALL:AAM35356 (EMBL:AE011673) (540 aa) fasta scores: E(): 1.1e-61, 45.75% id in 518 aa
YP_111562.1	Similar to Ralstonia oxalatica  transcription regulator SWALL:CAD61124 (EMBL:AJ536756) (164 aa) fasta scores: E(): 1.4e-07, 34.17% id in 158 aa, and to Bacillus subtilis YetL protein yetL SWALL:O31541 (EMBL:Z99107) (167 aa) fasta scores: E(): 2e-07, 30.9% id in 165 aa
YP_111563.1	Similar to Caulobacter crescentus lactoylglutathione lyase,  cc1933 SWALL:Q9A6Z3 (EMBL:AE005867) (139 aa) fasta scores: E(): 0.00013, 31.61% id in 136 aa, and to Arabidopsis thaliana f9l1.33 protein f9l1.33 or at1g15380 SWALL:Q9XI31 (EMBL:AC007591) (174 aa) fasta scores: E(): 3.5e-05, 28.35% id in 134 aa
YP_111564.1	Similar to Escherichia coli alpha-ketoglutarate permease KgtP or WitA or b2587 SWALL:KGTP_ECOLI (SWALL:P17448) (432 aa) fasta scores: E(): 2.6e-80, 52.82% id in 407 aa, and to Ralstonia solanacearum alpha-ketoglutarate permease transmembrane protein KgtP2 or rsp0007 or rs01979 SWALL:Q8XTU7 (EMBL:AL646076) (447 aa) fasta scores: E(): 3.7e-108, 66.82% id in 416 aa
YP_111565.1	Similar to Yersinia pestis similar to hypothetical transcriptional regulator ypo1934 or y2377 SWALL:Q9ZC44 (EMBL:AL031866) (320 aa) fasta scores: E(): 5.2e-58, 55.67% id in 291 aa
YP_111566.1	Similar to Pseudomonas putida L(+)-mandelate dehydrogenase MdlB SWALL:MDLB_PSEPU (SWALL:P20932) (393 aa) fasta scores: E(): 5.7e-46, 38.36% id in 378 aa, and to Brucella melitensis L-lactate dehydrogenase bmeii0377 SWALL:Q8YD00 (EMBL:AE009675) (382 aa) fasta scores: E(): 4.5e-42, 35.67% id in 370 aa. CDS is extended at the N-terminus in comparison to orthologues.
YP_111567.1	Similar to Ralstonia solanacearum probable carboxypeptidase rsc1003 or rs04289 SWALL:Q8Y0P0 (EMBL:AL646062) (543 aa) fasta scores: E(): 2.7e-111, 56.51% id in 545 aa, and to Deinococcus radiodurans carboxypeptidase-related protein dr0964 SWALL:Q9RVQ8 (EMBL:AE001948) (500 aa) fasta scores: E(): 2.7e-33, 34.62% id in 517 aa
YP_111568.1	Similar to Bacillus subtilis kumamolysin kumA SWALL:Q8RR56 (EMBL:AB070740) (572 aa) fasta scores: E(): 6e-86, 50.64% id in 541 aa, and to Pseudomonas sp. pseudomonapepsin precursor Pcp SWALL:PICP_PSESR (SWALL:P42790) (587 aa) fasta scores: E(): 2.2e-29, 31.64% id in 534 aa
YP_111569.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa4507 pa4507 SWALL:Q9HVR4 (EMBL:AE004864) (210 aa) fasta scores: E(): 1.7e-31, 47.76% id in 201 aa, and to Ralstonia solanacearum probable transport transmembrane protein rsc0418 or rs03386 SWALL:Q8Y2B8 (EMBL:AL646059) (206 aa) fasta scores: E(): 5.4e-18, 35.78% id in 204 aa
YP_111570.1	Similar to Pseudomonas putida lrp-family transcriptional regulators MdeR SWALL:O33467 (EMBL:D89015) (159 aa) fasta scores: E(): 2.2e-26, 49.33% id in 150 aa, and to Pseudomonas putida transcriptional regulator, AsnC-family pp1307 SWALL:AAN66931 (EMBL:AE016778) (159 aa) fasta scores: E(): 1.4e-25, 48.66% id in 150 aa
YP_111571.1	Similar to Ralstonia solanacearum hypothetical protein rsp0181 or rs04693 SWALL:Q8XTD2 (EMBL:AL646077) (134 aa) fasta scores: E(): 6.4e-29, 57.81% id in 128 aa, and to Rhizobium meliloti hypothetical protein rb1133 or smb21007 SWALL:Q92UJ5 (EMBL:AL603646) (139 aa) fasta scores: E(): 5.6e-14, 37.58% id in 141 aa
YP_111572.1	Similar to Escherichia coli low-affinity inorganic phosphate transporter 1 PitA or Pit or b3493 or c4291 or z4893 or ecs4365 SWALL:PITA_ECOLI (SWALL:P37308) (499 aa) fasta scores: E(): 8.9e-26, 43.53% id in 503 aa, and to Pseudomonas aeruginosa probable phosphate transporter pa0450 SWALL:Q9I668 (EMBL:AE004482) (540 aa) fasta scores: E(): 6.9e-120, 64.97% id in 511 aa
YP_111573.1	Similar to Ralstonia solanacearum hypothetical protein rsc2567 or rs00763 SWALL:Q8XWA7 (EMBL:AL646070) (250 aa) fasta scores: E(): 5.7e-70, 71.93% id in 228 aa, and to Rhizobium loti hypothetical protein Mlr1862 SWALL:Q98JN4 (EMBL:AP002998) (247 aa) fasta scores: E(): 3.1e-62, 60.56% id in 246 aa
YP_111574.1	Similar to Rhizobium meliloti  long-chain fatty-acid-CoA ligase rb1358 or smb20650 SWALL:Q92TY5 (EMBL:AL603646) (515 aa) fasta scores: E(): 9.6e-51, 39.27% id in 522 aa, and to Rhizobium loti long chain acyl-CoA synthetase mll6742 SWALL:Q988H2 (EMBL:AP003010) (511 aa) fasta scores: E(): 1.2e-46, 37.35% id in 522 aa
YP_111575.1	Similar to Pseudomonas aeruginosa PhzR or pa1898 SWALL:Q9RMS5 (EMBL:AF190630) (237 aa) fasta scores: E(): 6.4e-14, 34.5% id in 200 aa, and to Rhizobium sp. hypothetical transcriptional regulator Y4qH SWALL:Y4QH_RHISN (SWALL:P55629) (326 aa) fasta scores: E(): 9.8e-17, 35.71% id in 182 aa
YP_111576.1	Similar to Burkholderia multivorans N-acyl homoserine lactone synthase SWALL:Q93NN9 (EMBL:AF364058) (202 aa) fasta scores: E(): 4.5e-23, 43.97% id in 191 aa, and to Burkholderia cepacia N-acyl homoserine lactone synthase cepI SWALL:Q9AM52 (EMBL:AF330017) (202 aa) fasta scores: E(): 8.3e-23, 44.19% id in 181 aa
YP_111577.1	Similar to Deinococcus radiodurans NADH oxidase-related protein dr2333 SWALL:Q9RRZ6 (EMBL:AE002064) (403 aa) fasta scores: E(): 1.2e-72, 50.12% id in 405 aa, and to Pseudomonas fluorescens MupC SWALL:Q8RL71 (EMBL:AF318063) (431 aa) fasta scores: E(): 7.5e-76, 50.82% id in 425 aa
YP_111578.1	Similar to Escherichia coli taurine transport system permease TauC or SsiC or b0367 SWALL:TAUC_ECOLI (SWALL:Q47539) (275 aa) fasta scores: E(): 8e-53, 59.1% id in 247 aa, and to Pseudomonas putida ABC-type transporter membrane permease component TauC SWALL:BAC00966 (EMBL:AB086390) (279 aa) fasta scores: E(): 3.9e-56, 57.14% id in 273 aa
YP_111579.1	Similar to Escherichia coli taurine transport ATP-binding protein TauB or SsiB or b0366 SWALL:TAUB_ECOLI (SWALL:Q47538) (255 aa) fasta scores: E(): 1.6e-41, 52.19% id in 251 aa, and to Pseudomonas aeruginosa probable ATP-binding component of ABC taurine transporter pa3937 SWALL:Q9HX79 (EMBL:AE004811) (263 aa) fasta scores: E(): 8.4e-49, 56.58% id in 258 aa
YP_111580.1	Similar to Escherichia coli taurine-binding periplasmic protein precursor TauA or SsiA or b0365 SWALL:TAUA_ECOLI (SWALL:Q47537) (320 aa) fasta scores: E(): 1.1e-51, 48.91% id in 323 aa, and to Pseudomonas aeruginosa probable periplasmic taurine-binding protein precursor pa3938 SWALL:Q9HX78 (EMBL:AE004811) (337 aa) fasta scores: E(): 6.5e-64, 55.45% id in 330 aa
YP_111581.1	catalyzes the conversion of taurine (2-aminoethanesulfonate) to sulfite and aminoacetaldehyde concurrently with the conversion of alpha-ketoglutarate to succinate and carbon dioxide; non-heme iron oxidase; allows the use of taurine as an alternative sulfur source; forms homodimers
YP_111582.1	Similar to Salmonella typhimurium, and Salmonella typhi  inner membrane protein yhju or stm3624 or sty4176 or bcsG SWALL:Q8XFY5 (EMBL:AE008867) (559 aa) fasta scores: E(): 2.6e-50, 35.3% id in 541 aa, and to Escherichia coli hypothetical protein yhju yhju or b3538 SWALL:YHJU_ECOLI (SWALL:P37659) (559 aa) fasta scores: E(): 8.5e-51, 36.34% id in 542 aa
YP_111583.1	Similar to Escherichia coli O157:H7 cellulose synthase catalytic subunit [UDP-forming] BcsA or z4948 or ecs4413 SWALL:Q8X5L7 (EMBL:AE005579) (888 aa) fasta scores: E(): 1.6e-156, 48.61% id in 833 aa, and to Salmonella typhimurium cellulose synthase catalytic subunit [udp-forming] bcsa or stm3619 SWALL:Q93IN2 (EMBL:AJ315770) (874 aa) fasta scores: E(): 2.1e-156, 48.03% id in 816 aa
YP_111584.1	Similar to the C-terminal region of Pseudomonas fluorescens WssA SWALL:Q8RSZ2 (EMBL:AY074776) (344 aa) fasta scores: E(): 2.3e-10, 30.56% id in 265 aa. Full length CDS is similar to Chromobacterium violaceum hypothetical protein SWALL:Q7NUL8 (EMBL:AE016919) (252 aa) fasta scores: E(): 2.5e-06, 29.6% id in 277 aa
YP_111585.1	No significant database matches. Doubtful CDS
YP_111586.1	No significant database matches to the full length protein
YP_111587.1	Similar to Acetobacter xylinus cellulose synthase 2 operon protein C precursor BcsciI SWALL:Q9WX71 (EMBL:AB015803) (1307 aa) fasta scores: E(): 3.8e-38, 28.41% id in 1327 aa, and to Acetobacter xylinus cellulose synthase operon protein c precursor acsC SWALL:ACSC_ACEXY (SWALL:P37718) (1319 aa) fasta scores: E(): 1.5e-08, 27.26% id in 1346 aa
YP_111588.1	catalyzes the hydrolysis of 1,4-beta-D-glucosidic linkages in cellulose, lichenin and cereal beta-D-glucans
YP_111589.1	binds the cellulose synthase activator, bis-(3'-5') cyclic diguanylic acid (c-di-GMP)
YP_111590.1	Weakly similar to Chromobacterium violaceum hypothetical protein CV0474 SWALL:Q7NPT2 (EMBL:AE016911) (184 aa) fasta scores: E(): 0.0084, 32.78% id in 183 aa. Doubtful CDS
YP_111591.1	N-terminal region is similar to Escherichia coli protein HipB or b1508 SWALL:HIPB_ECOLI (SWALL:P23873) (88 aa) fasta scores: E(): 0.16, 30% id in 80 aa, and Ralstonia solanacearum  transcription regulator protein HipB or rsp1252 or rs03197 SWALL:Q8XQH3 (EMBL:AL646083) (88 aa) fasta scores: E(): 0.0018, 46.26% id in 67 aa
YP_111592.1	Similar to Escherichia coli protein HipA or b1507 SWALL:HIPA_ECOLI (SWALL:P23874) (440 aa) fasta scores: E(): 1.1e-53, 38.82% id in 443 aa, and to Ralstonia solanacearum  HipA transcription regulator protein hipa or rsc1446 or rs03861 SWALL:Q8XZF5 (EMBL:AL646064) (445 aa) fasta scores: E(): 9.3e-87, 52.82% id in 443 aa
YP_111594.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa1145 SWALL:Q9I4J0 (EMBL:AE004544) (300 aa) fasta scores: E(): 7.1e-44, 41.41% id in 297 aa, and to Rhizobium loti transcriptional regulator mlr6990 SWALL:Q987M7 (EMBL:AP003010) (299 aa) fasta scores: E(): 1.3e-27, 32.42% id in 293 aa
YP_111595.1	Similar to Escherichia coli, Escherichia coli O157:H7, and Shigella flexneri agmatinase SpeB or b2937 or z4281 or ecs3812 or sf2927 SWALL:SPEB_ECOLI (SWALL:P16936) (306 aa) fasta scores: E(): 1.3e-23, 42.17% id in 294 aa, and to Pseudomonas aeruginosa agmatinase SpeB2 or pa1421 SWALL:Q9I3S3 (EMBL:AE004571) (319 aa) fasta scores: E(): 1.3e-89, 71.47% id in 319 aa
YP_111597.1	Similar to Pseudomonas putida hypothetical protein pp5399 SWALL:AAN70963 (EMBL:AE016794) (256 aa) fasta scores: E(): 7.6e-41, 46.18% id in 249 aa
YP_111600.1	Similar to Burkholderia pseudomallei SctC SWALL:Q93L02 (EMBL:AF074878) (588 aa) fasta scores: E(): 5.5e-34, 51.72% id in 609 aa, and to Xanthomonas campestris hypersensitivity response secretion protein Hrpa1 precursor hrpa1 SWALL:HRA1_XANCV (SWALL:P80151) (607 aa) fasta scores: E(): 1.5e-56, 46.31% id in 611 aa
YP_111601.1	Similar to Escherichia coli minor fimbrial subunit PilV SWALL:Q93AE4 (EMBL:AF422146) (454 aa) fasta scores: E(): 0.00091, 27.79% id in 385 aa, and to Salmonella typhi PilV or sty4550 SWALL:O51801 (EMBL:AF000001) (435 aa) fasta scores: E(): 1.4e-05, 24.45% id in 458 aa
YP_111602.1	Similar to Streptomyces coelicolor hypothetical protein sco7368 sco7368 or sc9h11.22 SWALL:Q9KYL9 (EMBL:AL939131) (187 aa) fasta scores: E(): 9.7, 32.33% id in 133 aa
YP_111603.1	Similar to Escherichia coli major pilin subunit PilS SWALL:Q93AE6 (EMBL:AF422146) (178 aa) fasta scores: E(): 0.00017, 25.64% id in 156 aa, and to Escherichia coli bundlin beta-1 BfpA SWALL:Q9F5V1 (EMBL:AF304471) (195 aa) fasta scores: E(): 3.2e-05, 28.31% id in 166 aa
YP_111604.1	Similar to Escherichia coli BfpE SWALL:Q47071 (EMBL:Z68186) (352 aa) fasta scores: E(): 3e-47, 38.06% id in 352 aa, and to Salmonella typhi, and Salmonella dublin PilR or sty4546 SWALL:Q9ZIV0 (EMBL:AF000001) (361 aa) fasta scores: E(): 9.3e-29, 34.07% id in 361 aa
YP_111605.1	Similar to Escherichia coli BfpD SWALL:Q47070 (EMBL:Z68186) (534 aa) fasta scores: E(): 3.2e-44, 35.28% id in 496 aa, and to Salmonella dublin PilQ SWALL:Q9KHW5 (EMBL:AF247502) (571 aa) fasta scores: E(): 2.5e-31, 33.33% id in 471 aa
YP_111607.1	Weakly similar to Escherichia coli PilO SWALL:Q93D65 (EMBL:AF399919) (415 aa) fasta scores: E(): 0.016, 29% id in 231 aa
YP_111608.1	Similar to Escherichia coli PilN protein SWALL:Q9F533 (EMBL:AP002527) (547 aa) fasta scores: E(): 2.3e-27, 32.99% id in 588 aa, and to Yersinia pseudotuberculosis lipoprotein PilN SWALL:Q8KR30 (EMBL:AY047316) (530 aa) fasta scores: E(): 5.2e-27, 35.94% id in 409 aa
YP_111609.1	Similar to Escherichia coli BfpG SWALL:Q47067 (EMBL:Z68186) (133 aa) fasta scores: E(): 0.0014, 34.94% id in 83 aa
YP_111610.1	Similar to Neisseria gonorrhoeae twitching motility protein PilT SWALL:PILT_NEIGO (SWALL:Q06581) (374 aa) fasta scores: E(): 2.1e-25, 34.02% id in 291 aa, and to Pseudomonas aeruginosa twitching mobility protein PilT or pa0395 SWALL:PILT_PSEAE (SWALL:P24559) (344 aa) fasta scores: E(): 2.8e-24, 31.61% id in 329 aa
YP_111611.1	Similar to Xanthomonas campestris hypersensitivity response secretion protein Hrpa1 precursor hrpa1 SWALL:HRA1_XANCV (SWALL:P80151) (607 aa) fasta scores: E(): 6.1e-11, 27.66% id in 459 aa, and to Yersinia enterocolitica yop proteins translocation protein C precursor YscC SWALL:YSCC_YEREN (SWALL:Q01244) (607 aa) fasta scores: E(): 3.4e-10, 30.98% id in 255 aa
YP_111612.1	Similar to Escherichia coli phosphate regulon transcriptional regulatory protein PhoB or b0399 or z0497 or ecs0449 SWALL:PHOB_ECOLI (SWALL:P08402) (229 aa) fasta scores: E(): 2e-20, 33.18% id in 226 aa, and to Klebsiella pneumoniae phosphate regulon transcriptional regulatory protein PhoB SWALL:PHOB_KLEPN (SWALL:P45605) (229 aa) fasta scores: E(): 4e-21, 33.62% id in 226 aa
YP_111613.1	Similar to Deinococcus radiodurans sensor histidine kinase dr1606 SWALL:Q9RTZ2 (EMBL:AE002004) (433 aa) fasta scores: E(): 4.8e-10, 30.22% id in 354 aa
YP_111615.1	Similar to Xanthomonas campestris HrpB1 SWALL:Q56781 (EMBL:U33548) (151 aa) fasta scores: E(): 9.6e-05, 28.07% id in 114 aa, and to Xanthomonas campestris HrpB1 protein or xcc1231 SWALL:AAM40529 (EMBL:AE012222) (151 aa) fasta scores: E(): 9.6e-05, 29.33% id in 150 aa
YP_111616.1	Similar to Agrobacterium tumefaciens acetyltransferase atu4896 or agr_l_4 SWALL:Q8U6B2 (EMBL:AE009417) (200 aa) fasta scores: E(): 7.2e-06, 26.08% id in 184 aa, and to Thermoanaerobacter tengcongensis acetyltransferases, including N-acetylases of ribosomal proteins riml or tte1540 SWALL:Q8R9Q9 (EMBL:AE013110) (185 aa) fasta scores: E(): 0.0013, 25.54% id in 184 aa
YP_111617.1	Similar to Gossypium hirsutum proline-rich cell wall protein SWALL:Q39789 (EMBL:L17308) (214 aa) fasta scores: E(): 1.3, 24.74% id in 198 aa
YP_111618.1	Similar to Ralstonia solanacearum regulatory protein HrpB or rsp0873 or rs01644 SWALL:HRPB_RALSO (SWALL:P31778) (477 aa) fasta scores: E(): 1e-53, 37.65% id in 486 aa, and to Burkholderia pseudomallei hypothetical 54.7 kDa protein SWALL:Q93L01 (EMBL:AF074878) (483 aa) fasta scores: E(): 2.9e-59, 41.17% id in 493 aa
YP_111619.1	Similar to Xanthomonas campestris HpaB SWALL:Q9WWG3 (EMBL:AF056246) (162 aa) fasta scores: E(): 2e-29, 53.84% id in 156 aa, and to Burkholderia pseudomallei hypothetical 16.8 kDa protein SWALL:Q93KY8 (EMBL:AF074878) (151 aa) fasta scores: E(): 2e-41, 68% id in 150 aa
YP_111621.1	Similar to Burkholderia pseudomallei hypothetical 8.8 kDa protein SWALL:Q93KY9 (EMBL:AF074878) (82 aa) fasta scores: E(): 0.0014, 37.34% id in 83 aa, and to Xanthomonas axonopodis HrpD6 protein or xac0398 SWALL:Q8PQC8 (EMBL:AE011666) (80 aa) fasta scores: E(): 8.1, 25.67% id in 74 aa
YP_111622.1	Similar to Burkholderia pseudomallei SctD SWALL:Q93KZ0 (EMBL:AF074878) (349 aa) fasta scores: E(): 2.3e-32, 42.38% id in 335 aa, and to Xanthomonas campestris Hrpd5 SWALL:Q9WWG0 (EMBL:AF056246) (312 aa) fasta scores: E(): 1.2e-14, 32.51% id in 326 aa
YP_111623.1	Similar to Xanthomonas campestris HpaA protein or xcc1224 SWALL:AAM40522 (EMBL:AE012221) (271 aa) fasta scores: E(): 0.00061, 29.91% id in 234 aa, and to Burkholderia pseudomallei hypothetical 34.4 kDa protein SWALL:Q9ZGQ9 (EMBL:AF074878) (317 aa) fasta scores: E(): 2.3e-06, 30.14% id in 282 aa
YP_111624.1	Similar to Burkholderia pseudomallei SctS SWALL:Q9ZGR0 (EMBL:AF074878) (87 aa) fasta scores: E(): 5.3e-16, 58.14% id in 86 aa, and to Xanthomonas oryzae pv. oryzicola HrcS SWALL:Q93MH8 (EMBL:AF404819) (86 aa) fasta scores: E(): 2.2e-15, 53.48% id in 86 aa
YP_111625.1	part of a set of proteins involved in the infection of eukaryotic cells; in plant pathogens involved in the hypersensitivity response
YP_111626.1	Similar to Burkholderia pseudomallei SctQ SWALL:Q9ZGR1 (EMBL:AF074878) (310 aa) fasta scores: E(): 4.5e-10, 32.7% id in 373 aa, and to Xanthomonas campestris HrcQ SWALL:Q9WWF7 (EMBL:AF056246) (268 aa) fasta scores: E(): 6.3e-07, 30.38% id in 316 aa
YP_111627.1	Similar to Burkholderia pseudomallei hypothetical 24.8 kDa protein SWALL:Q9ZGR2 (EMBL:AF074878) (227 aa) fasta scores: E(): 4.2e-08, 35.13% id in 222 aa, and to Ralstonia solanacearum Hrp associated protein HpaP or rsp0862 or rs01633 SWALL:HPAP_RALSO (SWALL:P35651) (197 aa) fasta scores: E(): 3.8e-06, 33.51% id in 188 aa
YP_111628.1	Similar to Ralstonia solanacearum hypersensitivity response secretion protein HrcV or HrpO or rsp0863 or rs01634 SWALL:HRCV_RALSO (SWALL:P35656) (690 aa) fasta scores: E(): 4.6e-146, 60.49% id in 681 aa, and to Acidovorax avenae subsp. avenae  HrpO SWALL:Q9F1J6 (EMBL:AB053454) (674 aa) fasta scores: E(): 6.3e-123, 55.78% id in 674 aa
YP_111629.1	Similar to Burkholderia pseudomallei SctU SWALL:Q93KZ2 (EMBL:AF074878) (351 aa) fasta scores: E(): 7.7e-60, 47.85% id in 349 aa, and to Ralstonia solanacearum hypersensitivity response secretion protein HrcU or HrpN or rsp0864 or rs01635 SWALL:HRCU_RALSO (SWALL:P35652) (357 aa) fasta scores: E(): 6.8e-54, 48.01% id in 352 aa
YP_111630.1	Similar to Burkholderia pseudomallei hypothetical 19.6 kDa protein SWALL:Q93KZ3 (EMBL:AF074878) (178 aa) fasta scores: E(): 2.1e-14, 35.29% id in 170 aa, and to Xanthomonas oryzae HrpBL SWALL:Q9K2Q2 (EMBL:AB045311) (151 aa) fasta scores: E(): 4.2e-05, 31.7% id in 123 aa
YP_111631.1	Similar to Xanthomonas oryzae Hrpb2 SWALL:Q9K3A4 (EMBL:AB045311) (130 aa) fasta scores: E(): 8.7e-06, 30.08% id in 123 aa, and to Xanthomonas campestris Hrpb2 SWALL:Q56782 (EMBL:U33548) (130 aa) fasta scores: E(): 1.9e-05, 29.26% id in 123 aa
YP_111632.1	Similar to Burkholderia pseudomallei SctJ SWALL:Q93KZ5 (EMBL:AF074878) (274 aa) fasta scores: E(): 8.5e-50, 60.44% id in 273 aa, and to Ralstonia solanacearum Hrp conserved lipoprotein HrcJ or rsp0867 or rs01638 SWALL:Q52492 (EMBL:AJ245811) (269 aa) fasta scores: E(): 5.4e-42, 54.51% id in 266 aa
YP_111633.1	Similar to Xanthomonas oryzae HrpB4 SWALL:Q9LBD4 (EMBL:AF026197) (209 aa) fasta scores: E(): 0.0038, 29.41% id in 204 aa, and to Ralstonia solanacearum HrpH protein or rsp0868 or rs01639 SWALL:Q52493 (EMBL:AJ245811) (209 aa) fasta scores: E(): 0.0068, 33.89% id in 177 aa
YP_111634.1	Similar to Burkholderia pseudomallei SctL SWALL:Q93KZ7 (EMBL:AF074878) (289 aa) fasta scores: E(): 1.6e-30, 45.79% id in 238 aa, and to Ralstonia solanacearum HrpF protein or rsp0869 or rs01640 SWALL:Q8XRH8 (EMBL:AL646081) (301 aa) fasta scores: E(): 2.8e-16, 38.26% id in 230 aa
YP_111635.1	Similar to Burkholderia pseudomallei SctN SWALL:Q93KZ8 (EMBL:AF074878) (449 aa) fasta scores: E(): 1.1e-115, 73.22% id in 437 aa, and to Xanthomonas campestris probable ATP synthase HrpB6 SWALL:HRB6_XANCV (SWALL:P80153) (442 aa) fasta scores: E(): 4.4e-106, 71.63% id in 416 aa
YP_111636.1	Similar to Burkholderia pseudomallei orf7 SWALL:Q93KZ9 (EMBL:AF074878) (168 aa) fasta scores: E(): 4.1e-08, 33.95% id in 162 aa, and to Ralstonia solanacearum HrpD protein SWALL:Q52496 (EMBL:AJ245811) (166 aa) fasta scores: E(): 0.0027, 32.14% id in 140 aa
YP_111637.1	Similar to Burkholderia pseudomallei SctT SWALL:Q93L00 (EMBL:AF074878) (240 aa) fasta scores: E(): 4.4e-34, 49.78% id in 231 aa, and to Xanthomonas campestris HrpB8 protein HrcT or xcc1238 SWALL:AAM40536 (EMBL:AE012222) (276 aa) fasta scores: E(): 5.2e-30, 43.12% id in 269 aa. CDS is extended at the C-terminus in comparison to similar proteins.
YP_111638.1	C-terminal region is similar to Ralstonia solanacearum hypothetical transmembrane protein rsp0101 or rs03022 SWALL:Q8XTK7 (EMBL:AL646076) (484 aa) fasta scores: E(): 6.2e-08, 27.91% id in 498 aa
YP_111639.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa2304 SWALL:Q9I1H1 (EMBL:AE004656) (362 aa) fasta scores: E(): 1.4e-39, 41.03% id in 290 aa, and to Streptomyces avermitilis SyrP-like protein SWALL:Q93H52 (EMBL:AB070951) (311 aa) fasta scores: E(): 1.4e-39, 40.7% id in 285 aa
YP_111640.1	Similar to Ralstonia solanacearum probable peptide synthetase rsp0641 or rs05860 SWALL:Q8XS40 (EMBL:AL646079) (6889 aa) fasta scores: E(): 0, 45.74% id in 4411 aa, and to Pseudomonas syringae syringomycin synthetase syrE SWALL:O85168 (EMBL:AF047828) (9376 aa) fasta scores: E(): 6.6e-215, 40.88% id in 5709 aa
YP_111641.1	Similar to Pseudomonas syringae syringomycin synthetase SyrE SWALL:O85168 (EMBL:AF047828) (9376 aa) fasta scores: E(): 5.4e-169, 43.97% id in 4498 aa, and to Xenorhabdus bovienii peptide synthetase XpsB SWALL:Q8VQF8 (EMBL:AF455810) (3316 aa) fasta scores: E(): 4.3e-157, 42.45% id in 3387 aa
YP_111642.1	Similar to Nostoc sp. GSV224 NosC SWALL:Q9RAH2 (EMBL:AF204805) (3317 aa) fasta scores: E(): 0, 36.9% id in 3390 aa, and to Ralstonia solanacearum probable peptide synthetase rsp0642 or rs05859 SWALL:Q8XS39 (EMBL:AL646079) (5953 aa) fasta scores: E(): 0, 47.91% id in 3304 aa
YP_111643.1	Similar over the N-terminal region to Rhizobium meliloti diaminobutyrate--2-oxoglutarate aminotransferase RhbA or RhsA or ra1258 or sma2400 SWALL:RHBA_RHIME (SWALL:Q9Z3R2) (470 aa) fasta scores: E(): 1.1e-81, 53.84% id in 429 aa, and to Pseudomonas aeruginosa probable class III aminotransferase pa2413 SWALL:Q9I168 (EMBL:AE004668) (469 aa) fasta scores: E(): 1.6e-82, 54.48% id in 435 aa
YP_111644.1	catalyzes the formation of acetate from pyruvate
YP_111645.1	Similar to Clostridium kluyveri 4-hydroxybutyrate coenzyme A transferase Cat2 SWALL:CAT2_CLOKL (SWALL:P38942) (429 aa) fasta scores: E(): 2.1e-59, 42.75% id in 428 aa, and to Yersinia pestis similar to 4-hydroxybutyrate CoA transferase ypo1926 or y2385 SWALL:Q9ZC36 (EMBL:AL031866) (440 aa) fasta scores: E(): 2.3e-102, 60.13% id in 439 aa
YP_111646.1	Similar to Salmonella enteritidis FkbR2 SWALL:Q93DX2 (EMBL:AF376036) (175 aa) fasta scores: E(): 3.6e-51, 74.28% id in 175 aa, and to Yersinia pestis similar to regulatory proteins ypo1927 SWALL:Q9ZC37 (EMBL:AL031866) (180 aa) fasta scores: E(): 1.2e-55, 76.57% id in 175 aa
YP_111647.1	Similar to Leuconostoc mesenteroides citrate lyase beta chain CitE SWALL:CILB_LEUMC (SWALL:O53078) (302 aa) fasta scores: E(): 3.9e-14, 33.09% id in 284 aa, and to Yersinia pestis similar to CitE ypo1928 or y2383 SWALL:Q9ZC38 (EMBL:AL031866) (280 aa) fasta scores: E(): 1.7e-36, 46.29% id in 270 aa
YP_111648.1	Similar to Brucella melitensis transcriptional regulatory protein, LysR family bmeii1077 SWALL:Q8YB24 (EMBL:AE009740) (294 aa) fasta scores: E(): 3.6e-60, 53.55% id in 295 aa, and to Ralstonia solanacearum probable transcription regulator protein rsp1267 or rs05312 SWALL:Q8XQG0 (EMBL:AL646083) (294 aa) fasta scores: E(): 2.9e-56, 52.54% id in 295 aa
YP_111649.1	Similar to Pseudomonas aeruginosa transcriptional regulator PtxR or pa2258 SWALL:PTXR_PSEAE (SWALL:P72131) (312 aa) fasta scores: E(): 7e-29, 35.21% id in 301 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa1312 SWALL:Q9I432 (EMBL:AE004560) (303 aa) fasta scores: E(): 4.2e-56, 55.1% id in 294 aa
YP_111650.1	Similar to Pseudomonas aeruginosa probable MFS transporter pa1313 SWALL:Q9I431 (EMBL:AE004560) (452 aa) fasta scores: E(): 2.3e-73, 51.78% id in 448 aa, and to Streptomyces coelicolor  efflux membrane protein sco2498 or scc121.01 or scc82.04 SWALL:CAD55309 (EMBL:AL939112) (481 aa) fasta scores: E(): 3.5e-27, 31.16% id in 430 aa
YP_111651.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa1314 SWALL:Q9I430 (EMBL:AE004560) (128 aa) fasta scores: E(): 2.4e-17, 48% id in 125 aa, and to Salmonella typhimurium  cytoplasmic protein stm2910 SWALL:Q8ZMH1 (EMBL:AE008832) (126 aa) fasta scores: E(): 3.5e-14, 41.86% id in 129 aa
YP_111652.1	Similar to Pseudomonas aeruginosa probable two-component sensor pa2571 SWALL:Q9I0R5 (EMBL:AE004685) (470 aa) fasta scores: E(): 1.4e-47, 46.91% id in 373 aa, and to Xanthomonas campestris histidine kinase xcc1957 SWALL:AAM41246 (EMBL:AE012299) (408 aa) fasta scores: E(): 2.1e-47, 50.95% id in 314 aa
YP_111653.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa1975 SWALL:Q9I2D0 (EMBL:AE004624) (387 aa) fasta scores: E(): 8.4e-50, 41.75% id in 364 aa, and to Rhizobium loti hypothetical protein Mlr1131 SWALL:Q98L89 (EMBL:AP002996) (361 aa) fasta scores: E(): 7.8e-48, 41.31% id in 351 aa
YP_111654.1	Similar to Pseudomonas aeruginosa probable two-component response regulator pa2572 SWALL:Q9I0R4 (EMBL:AE004685) (447 aa) fasta scores: E(): 1.5e-46, 37.41% id in 425 aa, and to Vibrio cholerae response regulator vc1087 SWALL:Q9KT18 (EMBL:AE004189) (447 aa) fasta scores: E(): 1.3e-18, 30.75% id in 439 aa
YP_111655.1	Similar over its C-terminal region to Dactylium dendroides galactose oxidase precursor GaoA SWALL:GAOA_DACDE (SWALL:Q01745) (680 aa) fasta scores: E(): 4.1e-70, 42.12% id in 489 aa, and partly to Polyangium cellulosum beta-mannanase SWALL:Q9ADL2 (EMBL:U24241) (502 aa) fasta scores: E(): 6.2e-10, 25.71% id in 350 aa
YP_111657.1	Similar to Ralstonia solanacearum  transmembrane protein rsc2292 or rs01263 SWALL:Q8XX26 (EMBL:AL646069) (207 aa) fasta scores: E(): 2e-09, 32.14% id in 168 aa
YP_111658.1	Similar to Anabaena sp. patatin-like protein all2302 SWALL:Q8YUN7 (EMBL:AP003589) (390 aa) fasta scores: E(): 1.4e-07, 27.57% id in 330 aa, and to Oryza sativa patatin-like protein p0506a10.15 or p0674h09.28 SWALL:Q8S0E1 (EMBL:AP003418) (411 aa) fasta scores: E(): 8.9e-06, 26.73% id in 318 aa
YP_111659.1	Similar over the C-terminal region to Ralstonia solanacearum  4-hydroxybenzoate transporter transmembrane protein rsp0896 or rs01667 SWALL:Q8XRF8 (EMBL:AL646081) (458 aa) fasta scores: E(): 4.2e-09, 38.4% id in 138 aa, and to Alcaligenes eutrophus orf TfdK SWALL:P70737 (EMBL:U16782) (460 aa) fasta scores: E(): 8.1e-08, 32.06% id in 131 aa
YP_111660.1	Similar to Rhodococcus sp. NCIMB 9784 cytochrome P450 Rhf p450rhF SWALL:Q8KU27 (EMBL:AF459424) (773 aa) fasta scores: E(): 8.5e-183, 62.83% id in 783 aa, and to Rhodococcus erythropolis cytochrome p450 116 ThcB or Cyp116 SWALL:THCB_RHOER (SWALL:P43492) (436 aa) fasta scores: E(): 1.1e-88, 56.08% id in 419 aa
YP_111662.1	Similar to Streptomyces atroolivaceus antibiotic transport protein SWALL:AAN85500 (EMBL:AF484556) (432 aa) fasta scores: E(): 1.4e-27, 31.64% id in 395 aa, and to Bradyrhizobium japonicum Blr5045 protein blr5045 SWALL:BAC50310 (EMBL:AP005953) (414 aa) fasta scores: E(): 2.4e-24, 32.39% id in 392 aa
YP_111663.1	Similar to Thermotoga neapolitana beta-glucosidase BglB SWALL:Q60038 (EMBL:Z77856) (720 aa) fasta scores: E(): 6.4e-57, 32.24% id in 732 aa, and to Cellvibrio gilvus beta-D-glucosidase precursor Cgb SWALL:P96316 (EMBL:D14068) (752 aa) fasta scores: E(): 4.6e-51, 42.05% id in 749 aa
YP_111664.1	No significant database matches. Possible alternative translational start sites
YP_111666.1	Similar to Ralstonia solanacearum hypothetical protein rsc2888 or rs00212 SWALL:Q8XVE3 (EMBL:AL646072) (152 aa) fasta scores: E(): 8.7e-20, 42.5% id in 160 aa, and to Yersinia pestis hypothetical protein ypo1877 or y2433 SWALL:Q8ZF41 (EMBL:AJ414150) (101 aa) fasta scores: E(): 2e-09, 42.7% id in 96 aa
YP_111668.1	Similar to Escherichia coli selenocysteine-specific elongation factor SelB or FdhA or b3590 SWALL:SELB_ECOLI (SWALL:P14081) (614 aa) fasta scores: E(): 1.4e-43, 42.45% id in 636 aa, and to Pseudomonas aeruginosa selenocysteine-specific elongation factor SelB or pa4807 SWALL:Q9HV02 (EMBL:AE004893) (641 aa) fasta scores: E(): 5.8e-97, 49.76% id in 639 aa
YP_111669.1	catalyzes the formation of selenocysteinyl-tRNA(Sec) from seryl-tRNA(Sec) and L-selenophosphate in selenoprotein biosynthesis
YP_111670.1	Similar to Escherichia coli protein FdhE or b3891 SWALL:FDHE_ECOLI (SWALL:P13024) (309 aa) fasta scores: E(): 4.8e-35, 39.67% id in 305 aa, and to Salmonella typhi protein FdhE or sty3843 SWALL:Q8Z2U4 (EMBL:AL627279) (309 aa) fasta scores: E(): 2.1e-35, 40.32% id in 305 aa
YP_111671.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 formate dehydrogenase, cytochrome B556 (FDO) subunit FdoI or b3892 or c4842 or z5434 or ecs4818 SWALL:FDOI_ECOLI (SWALL:P32174) (211 aa) fasta scores: E(): 4.6e-42, 54.32% id in 208 aa, and to Pseudomonas aeruginosa nitrate-inducible formate dehydrogenase, gamma subunit FdnI or pa4810 SWALL:Q9HUZ9 (EMBL:AE004894) (208 aa) fasta scores: E(): 1e-50, 62.81% id in 199 aa
YP_111672.1	Similar to Escherichia coli, Escherichia coli O6, and Shigella flexneri formate dehydrogenase-O, iron-sulfur subunit FdoH or b3893 or c4843 or sf3969 SWALL:FDOH_ECOLI (SWALL:P32175) (300 aa) fasta scores: E(): 2.4e-81, 68.21% id in 302 aa, and to Yersinia pestis formate dehydrogenase-o, iron-sulfur subunit fdoh or ypo4057 or y4077 SWALL:Q8Z9X8 (EMBL:AJ414160) (323 aa) fasta scores: E(): 1.8e-84, 72.26% id in 292 aa
YP_111673.1	Similar to Escherichia coli formate dehydrogenase-O, major subunit Fdog or b3894 SWALL:FDOG_ECOLI (SWALL:P32176) (1016 aa) fasta scores: E(): 0, 66.6% id in 1021 aa, and to Shigella flexneri formate dehydrogenase-O, major subunit Fdog or sf3970 SWALL:AAN45405 (EMBL:AE015404) (1016 aa) fasta scores: E(): 0, 66.69% id in 1021 aa. This CDS contains an in-frame opal codon, UGA, at position 197. This opal codon encodes selenocysteine, which forms the active-site of the protein
YP_111674.1	Similar to Ralstonia solanacearum probable lipoprotein transmembrane rsc0146 or rs01016 SWALL:Q8Y335 (EMBL:AL646057) (251 aa) fasta scores: E(): 2e-61, 59.6% id in 255 aa, and to Xanthomonas axonopodis hypothetical protein Xac1712 xac1712 SWALL:Q8PLS7 (EMBL:AE011803) (253 aa) fasta scores: E(): 2.8e-45, 50.78% id in 254 aa
YP_111675.1	Similar to Agrobacterium tumefaciens ABC transporter substrate binding protein atu3415 or agr_l_2813 SWALL:Q8UAF9 (EMBL:AE009272) (355 aa) fasta scores: E(): 3.3e-65, 58.11% id in 308 aa, and to Escherichia coli, and Escherichia coli O6 cystine-binding periplasmic protein precursor FliY or b1920 or c2335 SWALL:FLIY_ECOLI (SWALL:P39174) (266 aa) fasta scores: E(): 3.9e-07, 26.89% id in 238 aa. Note: Also similar to BPSS1674 (329 aa) fasta scores: E(): 1.4e-51, 57.097% identity in 310 aa overlap
YP_111676.1	Similar in its full length to Agrobacterium tumefaciens ABC transporter nucleotide binding/ATPase atu3417 or agr_l_2810 SWALL:Q8UAF7 (EMBL:AE009272) (592 aa) fasta scores: E(): 1.6e-59, 66.61% id in 626 aa, and in its N-terminal region to Streptomyces coelicolor ATP-binding protein AtrC or sco5258 or 2sc7g11.20C SWALL:Q9F3K7 (EMBL:AL939123) (253 aa) fasta scores: E(): 2.3e-39, 59.83% id in 249 aa
YP_111677.1	Similar to Chelatobacter heintzii nitrilotriacetate monooxygenase component A NtaA or NmoA SWALL:NTAA_CHEHE (SWALL:P54989) (453 aa) fasta scores: E(): 1.9e-48, 37.77% id in 450 aa, and to Agrobacterium tumefaciens monooxygenase atu3420 or agr_l_2804 SWALL:Q8UAF4 (EMBL:AE009272) (453 aa) fasta scores: E(): 1.1e-124, 72.45% id in 432 aa
YP_111678.1	Similar to Agrobacterium tumefaciens hypothetical protein catu3421 or agr_l_2803 SWALL:Q8UAF3 (EMBL:AE009272) (335 aa) fasta scores: E(): 5.2e-67, 56.88% id in 327 aa, and to Bacillus subtilis hypothetical protein YwcH or ipa-44D SWALL:YWCH_BACSU (SWALL:P39606) (333 aa) fasta scores: E(): 5.3e-37, 42.16% id in 332 aa
YP_111679.1	Similar to Agrobacterium tumefaciens ABC transporter substrate binding protein atu3415 or agr_l_2813 SWALL:Q8UAF9 (EMBL:AE009272) (355 aa) fasta scores: E(): 8.3e-65, 55.8% id in 310 aa, and to Escherichia coli, and Escherichia coli O6 cystine-binding periplasmic protein precursor FliY or b1920 or c2335 SWALL:FLIY_ECOLI (SWALL:P39174) (266 aa) fasta scores: E(): 8e-12, 32.91% id in 237 aa. Note: Also similar to BPSS1670 (312 aa) fasta scores: E(): 1.6e-56, 57.097% identity in 310 aa overlap
YP_111680.1	Similar to Agrobacterium tumefaciens acetyltransferase atu3418 or agr_l_2808 SWALL:Q8UAF6 (EMBL:AE009272) (181 aa) fasta scores: E(): 1.4e-29, 52.22% id in 180 aa, and to Streptomyces coelicolor acetyltransferase sco3175 or sce87.26 SWALL:Q9RKB2 (EMBL:AL939115) (161 aa) fasta scores: E(): 2.7e-06, 32.39% id in 142 aa
YP_111681.1	Similar to Agrobacterium tumefaciens hypothetical protein atu5238 or agr_pat_335 SWALL:Q8UK85 (EMBL:AE008946) (335 aa) fasta scores: E(): 2.1e-41, 40.92% id in 325 aa, and to Rhizobium meliloti hypothetical protein rb0421 or smb20435 SWALL:Q92WC2 (EMBL:AL603643) (331 aa) fasta scores: E(): 8.6e-39, 38.39% id in 323 aa
YP_111682.1	Similar to Ralstonia solanacearum hypothetical protein rsp0793 or rs01914 SWALL:Q8XRN8 (EMBL:AL646080) (73 aa) fasta scores: E(): 1.4e-10, 53.84% id in 65 aa
YP_111683.1	Similar to Ralstonia solanacearum  ribonuclease RNAse BN rsp1664 or rs02223 SWALL:Q8XPH6 (EMBL:AL646086) (324 aa) fasta scores: E(): 3.3e-35, 38.54% id in 288 aa, and to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 ribonuclease BN Rbn or b3886 or c4833 or z5425 or ecs4809 SWALL:RBN_ECOLI (SWALL:P32146) (290 aa) fasta scores: E(): 8.5e-07, 27.06% id in 303 aa
YP_111684.1	Similar to Ralstonia solanacearum probable porin signal peptide protein rsp0051 or rs02026 SWALL:Q8XTQ5 (EMBL:AL646076) (382 aa) fasta scores: E(): 6.7e-44, 44.33% id in 406 aa, and to Alcaligenes eutrophus hypothetical 40.6 kDa protein in gbd 3'region precursor SWALL:Q44021 (EMBL:L36817) (390 aa) fasta scores: E(): 1.4e-36, 42.71% id in 391 aa
YP_111685.1	Similar to Bordetella pertussis Bph2 SWALL:P94344 (EMBL:U82555) (145 aa) fasta scores: E(): 3.7e-26, 65.27% id in 144 aa, and to Xylella fastidiosa histone-like protein xf1943 SWALL:Q9PC42 (EMBL:AE004013) (130 aa) fasta scores: E(): 1.2e-18, 54.61% id in 130 aa
YP_111686.1	Similar to Bradyrhizobium japonicum protein blr2360 SWALL:BAC47625 (EMBL:AP005943) (393 aa) fasta scores: E(): 1.2e-44, 40.11% id in 359 aa, and to Rhizobium loti hypothetical protein mlr1941 SWALL:Q98JH3 (EMBL:AP002998) (388 aa) fasta scores: E(): 7.4e-19, 30.97% id in 381 aa
YP_111687.1	Similar to Bacillus subtilis UTP--glucose-1-phosphate uridylyltransferase GtaB SWALL:GTAB_BACSU (SWALL:Q05852) (292 aa) fasta scores: E(): 3.2e-52, 49.48% id in 289 aa, and to Burkholderia pseudomallei  UTP-glucose-1-phosphate uridylyltransferase SWALL:Q9F5N4 (EMBL:AF312223) (295 aa) fasta scores: E(): 5.5e-114, 98.64% id in 295 aa
YP_111688.1	Similar to Pseudomonas aeruginosa hypothetical protein pa5458 SWALL:Q9HTB2 (EMBL:AE004958) (380 aa) fasta scores: E(): 2.1e-11, 28.83% id in 385 aa, and to Rhizobium loti exopolysaccharide biosynthesis protein mlr6758 SWALL:Q988F9 (EMBL:AP003010) (395 aa) fasta scores: E(): 2.5e-09, 27.69% id in 343 aa
YP_111689.1	Possible fusion protein. N-terminal region similar to Salmonella enterica first mannosyl transferase SWALL:Q00483 (EMBL:X61917) (385 aa) fasta scores: E(): 1.9e-82, 60.11% id in 361 aa, and C-terminal region to Agrobacterium tumefaciens glycosyltransferase atu3560 or agr_l_2541 SWALL:Q8UA15 (EMBL:AE009285) (382 aa) fasta scores: E(): 1.6e-41, 39.94% id in 383 aa. CDS is extended at the N-terminus in comparison to some similar proteins with matches in this region
YP_111690.1	Similar to Shigella flexneri  O-antigen transporter RfbE or sf2100 SWALL:RFBE_SHIFL (SWALL:P37781) (418 aa) fasta scores: E(): 1.5e-24, 26.17% id in 424 aa, and to Salmonella typhi  O-antigen transporter RfbX or sty2297 SWALL:RFBX_SALTI (SWALL:Q99191) (432 aa) fasta scores: E(): 2.6e-05, 21.56% id in 422 aa
YP_111691.1	Similar to Anabaena sp. hypothetical protein all2038 SWALL:Q8YVE0 (EMBL:AP003588) (743 aa) fasta scores: E(): 3.3e-39, 38.99% id in 695 aa, and to Anabaena sp. hypothetical protein all3696 SWALL:Q8YQW5 (EMBL:AP003594) (379 aa) fasta scores: E(): 2.6e-45, 38.03% id in 376 aa
YP_111692.1	Similar to Rhizobium loti hypothetical protein mlr1941 SWALL:Q98JH3 (EMBL:AP002998) (388 aa) fasta scores: E(): 3.8e-18, 35.77% id in 355 aa, and to Corynebacterium glutamicum predicted acyltransferases cgl2858 SWALL:BAC00251 (EMBL:AP005283) (356 aa) fasta scores: E(): 1.2e-11, 29.73% id in 380 aa
YP_111693.1	Similar to Pseudomonas aeruginosa GDP-mannose 4,6-dehydratase Gca or pa5453 SWALL:GM4D_PSEAE (SWALL:Q51366) (323 aa) fasta scores: E(): 1.6e-62, 58.63% id in 336 aa, and to Xanthomonas campestris  GDP-mannose 4,6-dehydratase Gmd SWALL:Q93S88 (EMBL:AF204145) (344 aa) fasta scores: E(): 2.8e-105, 76.09% id in 343 aa
YP_111694.1	Similar to Xylella fastidiosa UDP-glucose 4-epimerase xf0610 SWALL:Q9PFP7 (EMBL:AE003906) (295 aa) fasta scores: E(): 9.9e-53, 53.71% id in 296 aa, and to Xanthomonas campestris UDP-glucose 4-epimerase Rmd or xcc0608 SWALL:AAM39924 (EMBL:AE012159) (312 aa) fasta scores: E(): 1.3e-49, 50.65% id in 304 aa
YP_111695.1	Similar to Pseudomonas aeruginosa hypothetical protein pa2490 SWALL:Q9I0Z2 (EMBL:AE004676) (124 aa) fasta scores: E(): 9.5e-16, 45.71% id in 105 aa, and to Xanthomonas axonopodis hypothetical protein xac0128 SWALL:AAM35020 (EMBL:AE011636) (123 aa) fasta scores: E(): 1.5e-15, 41.52% id in 118 aa
YP_111696.1	catalyzes the conversion of O-succinylhomoserine into homocysteine
YP_111697.1	Catalyzes first step of the de novo purine nucleotide biosynthetic pathway
YP_111698.1	Similar to Ralstonia solanacearum probable colicin V production transmembrane protein CvpA or rsc1977 or rs03551 SWALL:Q8XXY6 (EMBL:AL646067) (165 aa) fasta scores: E(): 1.7e-23, 45.34% id in 161 aa, and to Escherichia coli colicin V production protein CvpA or DedE or b2313 SWALL:CVPA_ECOLI (SWALL:P08550) (162 aa) fasta scores: E(): 1.4e-08, 35% id in 140 aa
YP_111699.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc1978 or rs03552 SWALL:Q8XXY5 (EMBL:AL646067) (273 aa) fasta scores: E(): 1.9e-08, 40.24% id in 241 aa, and to Salmonella typhimurium paral lipoprotein DedD or stm2364 SWALL:Q8ZNC1 (EMBL:AE008806) (224 aa) fasta scores: E(): 9e-05, 29.59% id in 223 aa
YP_111700.1	Similar to Escherichia coli folc bifunctional protein [includes: folylpolyglutamate synthase; dihydrofolate synthase] FolC or DedC or b2315 SWALL:FOLC_ECOLI (SWALL:P08192) (422 aa) fasta scores: E(): 2.1e-34, 43.02% id in 430 aa, and to Neisseria gonorrhoeae FolC protein SWALL:Q50990 (EMBL:Z68205) (424 aa) fasta scores: E(): 2.3e-74, 50.69% id in 434 aa
YP_111701.1	catalyzes the carboxylation of acetyl-CoA to malonyl-CoA; forms a tetramer of AccA2D2 subunits
YP_111702.1	catalyzes the formation of indole and glyceraldehyde 3-phosphate from indoleglycerol phosphate in tryptophan biosynthesis
YP_111703.1	Similar to Rhodobacter sphaeroides modification methylase RsrIM SWALL:MTR1_RHOSH (SWALL:P14751) (319 aa) fasta scores: E(): 4.1e-25, 38.96% id in 231 aa, and to Bacillus subtilis modification methylase BglIIM SWALL:MTB2_BACSU (SWALL:Q45489) (360 aa) fasta scores: E(): 3.3e-22, 35.03% id in 254 aa
YP_111704.1	catalyzes the formation of L-tryptophan from L-serine and 1-(indol-3-yl)glycerol 3-phosphate
YP_111705.2	catalyzes the formation of 1-(2-carboxyphenylamino)-1-deoxy-D-ribulose 5-phosphate from N-(5-phospho-beta-D-ribosyl)-anthranilate in tryptophan biosynthesis
YP_111706.1	mediates pseudouridylation (positions 38, 39, 40) at the tRNA anticodon region which contributes to the structural stability
YP_111707.1	Poor database matches. Alanine rich low complexity protein. Possible C-terminal region of a pseudogene, Possible N-terminal region is BPSS17023
YP_111708.1	Poor database matches. Alanine rich low complexity protein
YP_111709.1	catalyzes the formation of 4-aspartyl phosphate from aspartate 4-semialdehyde
YP_111710.1	catalyzes the oxidation of 3-isopropylmalate to 3-carboxy-4-methyl-2-oxopentanoate in leucine biosynthesis
YP_111711.1	catalyzes the isomerization between 2-isopropylmalate and 3-isopropylmalate in leucine biosynthesis; forms a heterodimer of LeuC/D
YP_111712.1	Similar to Escherichia coli, Escherichia coli O6, Escherichia coli O157:H7, and Shigella flexneri entericidin b precursor ecnb or b4147.2 or c5235 or z5754 or ecs5128.2 or sf4305 SWALL:ECNB_ECOLI (SWALL:P56549) (48 aa) fasta scores: E(): 0.55, 45.23% id in 42 aa
YP_111713.1	dehydratase component, catalyzes the isomerization between 2-isopropylmalate and 3-isopropylmalate
YP_111714.1	Similar to Chelatobacter heintzii nitrilotriacetate monooxygenase component A NtaA or NmoA SWALL:NTAA_CHEHE (SWALL:P54989) (453 aa) fasta scores: E(): 5.5e-53, 40.04% id in 447 aa, and to Agrobacterium tumefaciens nitrilotriacetate monooxygenase atu3450 or agr_l_2756 SWALL:Q8UAC4 (EMBL:AE009275) (435 aa) fasta scores: E(): 1.7e-54, 37.23% id in 427 aa
YP_111716.1	Similar to Pseudomonas putida bkd operon transcriptional regulator BkdR SWALL:BKDR_PSEPU (SWALL:P42179) (161 aa) fasta scores: E(): 2.5e-45, 76.73% id in 159 aa, and to Escherichia coli, Escherichia coli O6, Escherichia coli O157:H7, Shigella flexneri, and Enterobacter aerogenes leucine-responsive regulatory protein SWALL:LRP_ECOLI (SWALL:P19494) (163 aa) fasta scores: E(): 8.8e-22, 41.44% id in 152 aa
YP_111717.1	paralogs to the E1 component of pyruvate dehydrogenase subunit E1
YP_111718.1	Similar to Yersinia pestis hypothetical protein ypo2976 or y1506 SWALL:Q8ZCK7 (EMBL:AJ414154) (415 aa) fasta scores: E(): 1.2e-95, 57.49% id in 407 aa, and to Escherichia coli hypothetical protein YbiU or b0821 SWALL:YBIU_ECOLI (SWALL:P75791) (421 aa) fasta scores: E(): 3.6e-70, 45.3% id in 415 aa
YP_111719.1	Similar to Agrobacterium tumefaciens hypothetical protein atu4267 or agr_l_1189 SWALL:Q8U832 (EMBL:AE009355) (134 aa) fasta scores: E(): 4.7e-15, 43.65% id in 126 aa, and to Bradyrhizobium japonicum hypothetical protein blr0519 SWALL:BAC45784 (EMBL:AP005936) (128 aa) fasta scores: E(): 7.4e-14, 44.69% id in 132 aa
YP_111720.1	Similar to Agrobacterium tumefaciens transcriptional regulator, AraC family atu4297 or agr_l_1135 SWALL:Q8U802 (EMBL:AE009358) (313 aa) fasta scores: E(): 4.8e-31, 39.72% id in 287 aa, and to Vibrio cholerae transcriptional regulator, AraC/XylS family vc1260 SWALL:Q9KSJ6 (EMBL:AE004205) (299 aa) fasta scores: E(): 3.8e-21, 30.36% id in 303 aa
YP_111721.1	type II enzyme; in Escherichia coli this enzyme forms a trimer of dimers which is allosterically inhibited by NADH and competitively inhibited by alpha-ketoglutarate; allosteric inhibition is lost when Cys206 is chemically modified which also affects hexamer formation; forms oxaloacetate and acetyl-CoA and water from citrate and coenzyme A; functions in TCA cycle, glyoxylate cycle and respiration; enzyme from Helicobacter pylori is not inhibited by NADH
YP_111722.1	Similar to Ralstonia solanacearum hypothetical protein rsc1992 or rs03560 SWALL:Q8XXX1 (EMBL:AL646067) (95 aa) fasta scores: E(): 4.3e-22, 70.78% id in 89 aa
YP_111723.1	part of four member succinate dehydrogenase enzyme complex that forms a trimeric complex (trimer of tetramers); SdhA/B are the catalytic subcomplex and can exhibit succinate dehydrogenase activity in the absence of SdhC/D which are the membrane components and form cytochrome b556; SdhC binds ubiquinone; oxidizes succinate to fumarate while reducing ubiquinone to ubiquinol; the catalytic subunits are similar to fumarate reductase
YP_111724.1	part of four member succinate dehydrogenase enzyme complex that forms a trimeric complex (trimer of tetramers); SdhA/B are the catalytic subcomplex and can exhibit succinate dehydrogenase activity in the absence of SdhC/D which are the membrane components and form cytochrome b556; SdhC binds ubiquinone; oxidizes succinate to fumarate while reducing ubiquinone to ubiquinol
YP_111725.1	Similar to Ralstonia solanacearum  transmembrane succinate dehydrogenase sdhd or rsc1995 or rs03563 SWALL:Q8XXW8 (EMBL:AL646067) (121 aa) fasta scores: E(): 1.2e-35, 71.31% id in 122 aa, and to Escherichia coli, Escherichia coli O6, and Shigella flexneri succinate dehydrogenase hydrophobic membrane anchor protein sdhd or b0722 or c0800 or sf0575 SWALL:DHSD_ECOLI (SWALL:P10445) (115 aa) fasta scores: E(): 1.7e-10, 32.69% id in 104 aa
YP_111726.1	Similar to Ralstonia solanacearum  transmembrane succinate dehydrogenase SdhC or rsc1996 or rs03564 SWALL:Q8XXW7 (EMBL:AL646067) (140 aa) fasta scores: E(): 1.1e-30, 58.69% id in 138 aa, and to Escherichia coli, and Escherichia coli O157:H7 succinate dehydrogenase cytochrome b-556 subunit SdhC or CybA or b0721 or z0875 or ecs0746 SWALL:DHSC_ECOLI (SWALL:P10446) (129 aa) fasta scores: E(): 7.3e-11, 35.15% id in 128 aa
YP_111727.1	Similar to Ralstonia solanacearum probable transcription regulator protein rsc1997 or rs03565 SWALL:Q8XXW6 (EMBL:AL646067) (274 aa) fasta scores: E(): 4.4e-67, 67.66% id in 266 aa, and to Escherichia coli hypothetical transcriptional regulator YhfR or b3375 SWALL:YHFR_ECOLI (SWALL:P45544) (243 aa) fasta scores: E(): 5.6e-14, 29.49% id in 217 aa
YP_111728.1	catalyzes the oxidation of malate to oxaloacetate
YP_111729.1	Similar to Ralstonia solanacearum probable lyase rsc1999 or rs03567 SWALL:Q8XXW4 (EMBL:AL646067) (320 aa) fasta scores: E(): 8.8e-69, 58.17% id in 318 aa, and to Leptospira interrogans citrate lyase, beta subunit CitE or la2841 SWALL:AAN50040 (EMBL:AE011449) (342 aa) fasta scores: E(): 7.8e-59, 47.48% id in 318 aa
YP_111730.1	Similar to Ralstonia solanacearum probable signal peptide protein rsc2001 or rs03569 SWALL:Q8XXW2 (EMBL:AL646067) (185 aa) fasta scores: E(): 6.9e-20, 49.41% id in 170 aa
YP_111731.1	functions in propionate metabolism; involved in isomerization of (2S,3S)-methylcitrate to (2R,3S)-methylisocitrate; also encodes minor aconitase or dehydratase activity; aconitase C
YP_111732.1	catalyzes the conversion of citrate to isocitrate
YP_111733.1	Similar to the N-terminal region of Bordetella pertussis filamentous hemagglutinin FhaB SWALL:FHAB_BORPE (SWALL:P12255) (3591 aa) fasta scores: E(): 7e-34, 29.76% id in 897 aa, and to Bordetella pertussis Fha protein FhaB2 SWALL:Q8VV99 (EMBL:AJ420989) (3590 aa) fasta scores: E(): 7e-34, 29.76% id in 897 aa
YP_111734.1	Similar to Proteus mirabilis hemolysin activator protein precursor HpmB SWALL:HLYB_PROMI (SWALL:P16465) (561 aa) fasta scores: E(): 2.6e-21, 25.86% id in 549 aa, and to Bordetella pertussis hemolysin activator-like protein FhaC precursor SWALL:FHAC_BORPE (SWALL:P35077) (584 aa) fasta scores: E(): 1.9e-53, 33.15% id in 567 aa
YP_111735.1	Similar to Pseudomonas aeruginosa probable cytochrome C pa4571 SWALL:Q9HVL3 (EMBL:AE004870) (675 aa) fasta scores: E(): 1.6e-102, 64.84% id in 694 aa, and to Acetobacter polyoxogenes, and Acetobacter europaeus alcohol dehydrogenase cytochrome C subunit precursor AdhB SWALL:CYCA_ACEPO (SWALL:Q03318) (468 aa) fasta scores: E(): 4.8e-59, 42.85% id in 413 aa
YP_111736.1	Similar to Ralstonia solanacearum probable transmembrane protein rsp0612 or rs03755 SWALL:Q8XS69 (EMBL:AL646079) (122 aa) fasta scores: E(): 7.3e-28, 67.76% id in 121 aa, and to Pseudomonas aeruginosa hypothetical protein pa3386 SWALL:Q9HYL6 (EMBL:AE004760) (121 aa) fasta scores: E(): 0.0026, 35% id in 120 aa
YP_111737.1	Similar to Aspergillus oryzae tyrosinase MelO SWALL:TYRO_ASPOR (SWALL:Q00234) (539 aa) fasta scores: E(): 4.6e-35, 41.49% id in 535 aa, and to Agaricus bisporus tyrosinase Ppo2 SWALL:TYRO_AGABI (SWALL:O42713) (556 aa) fasta scores: E(): 2.1e-05, 28.1% id in 395 aa
YP_111739.1	Similar to Ralstonia solanacearum  transmembrane protein rsp1646 or rs02205 SWALL:Q8XPJ4 (EMBL:AL646086) (44 aa) fasta scores: E(): 5.2e-12, 68.18% id in 44 aa
YP_111740.1	Similar to Pseudomonas sp. pseudomonapepsin precursor Pcp SWALL:PICP_PSESR (SWALL:P42790) (587 aa) fasta scores: E(): 1.1e-143, 67.53% id in 579 aa, and to Xanthomonas sp. xanthomonapepsin precursor SWALL:XANP_XANS2 (SWALL:Q60106) (827 aa) fasta scores: E(): 4.4e-33, 43.66% id in 616 aa
YP_111741.1	Similar to Ralstonia solanacearum probable transmembrane ABC transporter protein rsc1731 or rs02919 SWALL:Q8XYM7 (EMBL:AL646066) (272 aa) fasta scores: E(): 4.3e-87, 86.76% id in 272 aa, and to Yersinia pestis  ABC transporter permease ypo2841 SWALL:Q8ZCW7 (EMBL:AJ414154) (282 aa) fasta scores: E(): 7.7e-54, 56.56% id in 274 aa. Note: This CDS is longer in its N-terminal region than most of its database matches
YP_111742.1	Similar to Ralstonia solanacearum probable transport system permease transmembrane protein rsc1732 or rs02920 SWALL:Q8XYM6 (EMBL:AL646066) (420 aa) fasta scores: E(): 1.2e-125, 80.52% id in 416 aa, and to Pseudomonas aeruginosa probable permease of ABC transporter pa0605 SWALL:Q9I5T3 (EMBL:AE004497) (415 aa) fasta scores: E(): 8.9e-92, 59.33% id in 423 aa
YP_111743.1	Similar to Ralstonia solanacearum  lipoprotein signal peptide rsc1733 or rs02921 SWALL:Q8XYM5 (EMBL:AL646066) (346 aa) fasta scores: E(): 2.4e-116, 86.09% id in 338 aa, and to Pseudomonas putida polyamine ABC transporter periplasmic polyamine-binding protein pp0412 SWALL:AAN66042 (EMBL:AE016775) (344 aa) fasta scores: E(): 2.2e-84, 62.09% id in 343 aa
YP_111744.1	Similar to Ralstonia solanacearum probable ATP-binding ABC transporter protein rsc1734 or rs02922 SWALL:Q8XYM4 (EMBL:AL646066) (363 aa) fasta scores: E(): 1.8e-102, 80.82% id in 365 aa, and to Pseudomonas aeruginosa probable ATP-binding component of ABC transporter pa0603 SWALL:Q9I5T5 (EMBL:AE004496) (369 aa) fasta scores: E(): 2e-69, 59.94% id in 362 aa
YP_111745.1	Similar to Ralstonia solanacearum  transcription regulator protein rsc0030 or rs01853 SWALL:Q8Y3F0 (EMBL:AL646057) (509 aa) fasta scores: E(): 2e-107, 57.08% id in 501 aa, and to Rhizobium meliloti probable rhizopine catabolism regulatory protein MocR SWALL:MOCR_RHIME (SWALL:P49309) (493 aa) fasta scores: E(): 6.7e-52, 38.54% id in 480 aa
YP_111746.1	acts as a molecular chaperone to fold and export lipase A
YP_111747.1	Similar to Burkholderia cepacia lipase precursor LipA SWALL:LIP_BURCE (SWALL:P22088) (364 aa) fasta scores: E(): 7.1e-111, 84.34% id in 364 aa, and to Pseudomonas sp. Lipase precursor Lip SWALL:LIP_PSES5 (SWALL:P25275) (364 aa) fasta scores: E(): 4.2e-110, 83.79% id in 364 aa
YP_111748.1	Similar to Pseudomonas putida outer membrane copper receptor OprC or pp4838 SWALL:AAN70407 (EMBL:AE016792) (688 aa) fasta scores: E(): 5.8e-81, 59.23% id in 655 aa, and to Pseudomonas stutzeri outer membrane protein NosA SWALL:Q8KLV2 (EMBL:AJ507426) (719 aa) fasta scores: E(): 9e-71, 49.48% id in 675 aa
YP_111750.1	Similar to Escherichia coli, and Shigella flexneri cytochrome b561 CybB or b1418 or sf1794 SWALL:C561_ECOLI (SWALL:P08732) (176 aa) fasta scores: E(): 5e-16, 34.7% id in 170 aa, and to Pseudomonas aeruginosa cytochrome b561 pa0918 SWALL:Q9I539 (EMBL:AE004526) (182 aa) fasta scores: E(): 1.9e-22, 41.86% id in 172 aa
YP_111751.1	Similar to Caulobacter crescentus hypothetical protein cc3427 SWALL:Q9A2X9 (EMBL:AE006002) (218 aa) fasta scores: E(): 4.5e-10, 35.36% id in 164 aa, and to Streptomyces coelicolor  integral membrane regulator sco3583 or sch66.04 SWALL:Q9X936 (EMBL:AL939117) (254 aa) fasta scores: E(): 8.3e-08, 33.33% id in 219 aa
YP_111752.1	Similar to Coxiella burnetii lipoprotein precursor NlpD SWALL:Q9KI20 (EMBL:AF244357) (230 aa) fasta scores: E(): 9e-17, 37.91% id in 240 aa, and to Pseudomonas aeruginosa lipoprotein NlpD/LppB homolog precursor pa3623 SWALL:NLPD_PSEAE (SWALL:P45682) (297 aa) fasta scores: E(): 6.8e-14, 36.53% id in 271 aa
YP_111753.1	Similar to Neisseria meningitidis hypothetical protein nma0001 SWALL:Q9JX93 (EMBL:AL162752) (106 aa) fasta scores: E(): 1.1e-27, 68.62% id in 102 aa, and to Pseudomonas aeruginosa hypothetical protein pa2490 SWALL:Q9I0Z2 (EMBL:AE004676) (124 aa) fasta scores: E(): 0.00015, 31.19% id in 109 aa
YP_111755.1	catalyzes the formation of D-ribulose 5-phosphate from 6-phospho-D-gluconate
YP_111756.1	Similar to Anabaena sp. hypothetical protein all0385 SWALL:Q8YZS2 (EMBL:AP003582) (210 aa) fasta scores: E(): 7e-37, 51.72% id in 203 aa, and to Synechocystis sp. hypothetical protein slr0065 SWALL:Q55157 (EMBL:D64001) (212 aa) fasta scores: E(): 2.1e-35, 49.75% id in 201 aa
YP_111757.1	Modulates the activities of several enzymes which are inactive in their acetylated form
YP_111758.1	Similar to Pseudomonas aeruginosa probable transporter pa5099 SWALL:Q9HU84 (EMBL:AE004922) (480 aa) fasta scores: E(): 2.1e-121, 67.79% id in 472 aa, and to Bacillus subtilis homologous to purine-cytosine permease YxlA SWALL:P94369 (EMBL:D83026) (457 aa) fasta scores: E(): 2.8e-59, 39.47% id in 461 aa
YP_111760.1	Similar to Methanosarcina mazei conserved protein mm0534 SWALL:AAM30230 (EMBL:AE013279) (391 aa) fasta scores: E(): 1.2e-23, 27.13% id in 387 aa, and to Rhizobium loti hypothetical protein mll7337 SWALL:Q986I8 (EMBL:AP003011) (398 aa) fasta scores: E(): 5.6e-22, 35.05% id in 388 aa. Possible alternative translational start site
YP_111761.1	sigma factors are initiation factors that promote the attachment of RNA polymerase to specific initiation sites and are then released; this is the primary sigma factor of bacteria
YP_111762.1	synthesizes RNA primers at the replication forks
YP_111763.1	Similar to Ralstonia solanacearum hypothetical protein rsc2217 or rs01382 SWALL:Q8XX99 (EMBL:AL646068) (149 aa) fasta scores: E(): 1.9e-33, 77.55% id in 147 aa, and to Bacillus subtilis hypothetical protein YqeY SWALL:YQEY_BACSU (SWALL:P54464) (148 aa) fasta scores: E(): 9.7e-14, 37.16% id in 148 aa
YP_111764.1	a small basic protein that is one of the last in the subunit assembly; omission does not prevent assembly but the subunit is inactive; binds central domain of 16S rRNA
YP_111765.1	Similar to Rhizobium meliloti hypothetical protein r00707 or smc00763 SWALL:Q92RY0 (EMBL:AL591784) (394 aa) fasta scores: E(): 2.8e-77, 55.16% id in 397 aa, and to Escherichia coli hypothetical protein YhiN or b3492 SWALL:YHIN_ECOLI (SWALL:P37631) (400 aa) fasta scores: E(): 1.2e-68, 48.47% id in 394 aa
YP_111766.1	in most organisms, only the N-terminal domain is present in a single polypeptide; in some archaea this domain is fused to a kinase domain; this gene is essential for growth in Escherichia coli and Bacillus subtilis; the secreted glycoprotease from Pasteurella haemolytica showed specificity for O-sialoglycosylated proteins; the Pyrococcus structure shows DNA-binding properties, iron-binding, ATP-binding, and AP endonuclease activity
YP_111767.1	similar protein in Methanocaldococcus converts GTP to 7,8-dihydro-D-neopterin 2',3'-cyclic phosphate as the first step in methanopterin biosynthesis
YP_111768.1	catalyzes the formation of 1-deoxy-D-xylulose 5-phosphate from pyruvate and D-glyceraldehyde 3-phosphate
YP_111769.1	Similar to Escherichia coli geranyltranstransferase IspA or b0421 SWALL:ISPA_ECOLI (SWALL:P22939) (299 aa) fasta scores: E(): 6.8e-41, 45.97% id in 298 aa, and to Salmonella typhi geranyltranstransferase sty0462 SWALL:Q8Z8X2 (EMBL:AL627266) (299 aa) fasta scores: E(): 1.5e-42, 46.98% id in 298 aa
YP_111770.1	catalyzes the bidirectional exonucleolytic cleavage of DNA
YP_111771.1	Similar to the eukaryotic Beta vulgaris choline monooxygenase, chloroplast precursor Cmo SWALL:CHMO_BETVU (SWALL:O22553) (446 aa) fasta scores: E(): 6e-12, 25.75% id in 365 aa, and to Ralstonia solanacearum probable dioxygenase rsc2224 or rs01375 SWALL:Q8XX92 (EMBL:AL646068) (365 aa) fasta scores: E(): 2e-115, 73.55% id in 363 aa
YP_111772.1	Similar to Escherichia coli 3-mercaptopyruvate sulfurtransferase SseA or b2521 SWALL:THTM_ECOLI (SWALL:P31142) (280 aa) fasta scores: E(): 3.6e-21, 33.09% id in 284 aa, and to Pseudomonas aeruginosa probable 3-mercaptopyruvate sulfurtransferase pa1292 SWALL:THTM_PSEAE (SWALL:Q9I452) (284 aa) fasta scores: E(): 1.5e-49, 50.17% id in 281 aa
YP_111773.1	Similar to Pseudomonas putida, and Pseudomonas sp. carboxymethylenebutenolidase ClcD SWALL:CLCD_PSEPU (SWALL:P11453) (236 aa) fasta scores: E(): 4e-07, 28.07% id in 228 aa, and to Escherichia coli carboxymethylenebutenolidase YsgA or b3830 SWALL:DLHH_ECOLI (SWALL:P56262) (271 aa) fasta scores: E(): 3.6e-52, 52.65% id in 264 aa
YP_111774.1	Similar to Ralstonia solanacearum probable transmembrane protein rsp1080 or rs02587 SWALL:Q8XQY8 (EMBL:AL646082) (541 aa) fasta scores: E(): 1.6e-38, 33.68% id in 576 aa, and to Rhizobium loti hypothetical protein mll7595 SWALL:Q985N8 (EMBL:AP003012) (589 aa) fasta scores: E(): 1.4e-28, 28.31% id in 611 aa
YP_111775.1	Similar to Escherichia coli NADH dehydrogenase Ndh or b1109 SWALL:DHNA_ECOLI (SWALL:P00393) (433 aa) fasta scores: E(): 9.1e-23, 45.43% id in 460 aa, and to Ralstonia solanacearum probable NADH dehydrogenase, membrane flavoprotein FAD NAD ubiquinone electron transport oxidoreductase Ndh or rsc2229 or rs01370 SWALL:Q8XX87 (EMBL:AL646069) (441 aa) fasta scores: E(): 3.1e-68, 62.66% id in 458 aa
YP_111776.1	has 3'-5' exonuclease, 5'-3' exonuclease and 5'-3'polymerase activities, primarily functions to fill gaps during DNA replication and repair
YP_111777.1	Similar to Neisseria meningitidis hypothetical protein nma2204 SWALL:Q9JSP2 (EMBL:AL162758) (210 aa) fasta scores: E(): 2.9e-35, 54.77% id in 199 aa, and to Corynebacterium glutamicum predicted Rossmann fold nucleotide-binding protein cgl1110 SWALL:BAB98503 (EMBL:AP005277) (256 aa) fasta scores: E(): 2.6e-34, 48.46% id in 196 aa
YP_111778.1	Similar to Ralstonia solanacearum probable signal peptide protein rsp0708 or rs01741 SWALL:Q8XRX3 (EMBL:AL646080) (106 aa) fasta scores: E(): 4.1e-05, 42.04% id in 88 aa, and to Bordetella pertussis Vrg-6 SWALL:Q45395 (EMBL:M77374) (105 aa) fasta scores: E(): 0.14, 40.59% id in 101 aa
YP_111779.1	Similar to Rhizobium meliloti hypothetical protein r00856 or smc00850 SWALL:Q92RL1 (EMBL:AL591785) (172 aa) fasta scores: E(): 4.6e-28, 53.12% id in 160 aa, and to Ralstonia solanacearum hypothetical protein rsc1374 or rs04657 SWALL:Q8XZM1 (EMBL:AL646064) (173 aa) fasta scores: E(): 3.2e-26, 50.62% id in 160 aa
YP_111781.1	Catalyzes the hydrolysis of AMP to form adenine and ribose 5-phosphate using water as the nucleophile
YP_111782.1	Similar to Ralstonia solanacearum  transmembrane protein rsc2232 or rs01367 SWALL:Q8XX84 (EMBL:AL646069) (139 aa) fasta scores: E(): 4.8e-07, 38.06% id in 134 aa
YP_111783.1	catalyzes the formation of O-phospho-L-homoserine from L-homoserine
YP_111784.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc2234 or rs01365 SWALL:Q8XX82 (EMBL:AL646069) (265 aa) fasta scores: E(): 2e-41, 45.92% id in 270 aa
YP_111785.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa2849 SWALL:Q9HZZ4 (EMBL:AE004711) (151 aa) fasta scores: E(): 1.8e-24, 53.24% id in 154 aa, and to Brucella suis transcriptional regulator, MarR family bra0886 SWALL:AAN34058 (EMBL:AE014582) (151 aa) fasta scores: E(): 1.7e-23, 52.02% id in 148 aa
YP_111786.1	Similar to Xanthomonas axonopodis organic hydroperoxide resistance protein Ohr or xac0282 SWALL:OHR_XANAC (SWALL:O68390) (142 aa) fasta scores: E(): 2.1e-31, 62.04% id in 137 aa, and to Pseudomonas putida organic hydroperoxide resistance protein Ohr or pp1859 SWALL:AAN67478 (EMBL:AE016780) (142 aa) fasta scores: E(): 1.5e-33, 67.4% id in 135 aa
YP_111788.1	Similar to Rhizobium loti polyhydroxybutyrate depolymerase mlr2444 SWALL:Q98IE0 (EMBL:AP002999) (371 aa) fasta scores: E(): 1.5e-18, 30.4% id in 296 aa, and to Pseudomonas lemoignei poly(3-hydroxyalkanoate) depolymerase C precursor PhaZ1 SWALL:PHA1_PSELE (SWALL:P52090) (414 aa) fasta scores: E(): 1.4e-15, 30.23% id in 258 aa
YP_111789.1	Similar to Aeromonas hydrophila hypothetical 28.2 kDa protein SWALL:Q9X647 (EMBL:AF131869) (264 aa) fasta scores: E(): 2e-19, 36.12% id in 227 aa, and to Klebsiella pneumoniae hypothetical 22.5 kDa protein in cps region SWALL:YC02_KLEPN (SWALL:Q48448) (209 aa) fasta scores: E(): 2.5e-14, 32.16% id in 199 aa
YP_111790.1	Similar to Ralstonia solanacearum molybdate-binding periplasmic signal peptide protein rsp0106 or rs06057 SWALL:Q8XTK2 (EMBL:AL646076) (257 aa) fasta scores: E(): 9.3e-52, 62.64% id in 257 aa, and to Methanosarcina acetivorans molybdenum ABC transporter solute-binding protein ma2280 SWALL:Q8TNK5 (EMBL:AE010915) (274 aa) fasta scores: E(): 5.8e-35, 48.3% id in 236 aa, and to Escherichia coli molybdate-binding periplasmic protein precursor ModA or b0763 SWALL:MODA_ECOLI (SWALL:P37329) (257 aa) fasta scores: E(): 1.2e-20, 36.11% id in 252 aa
YP_111791.1	Similar to Methanosarcina acetivorans molybdenum ABC transporter permease ModB or ma2281 SWALL:Q8TNK4 (EMBL:AE010915) (225 aa) fasta scores: E(): 3.1e-35, 48.83% id in 215 aa, and to Escherichia coli, and Escherichia coli O157:H7 molybdenum transport system permease ModB or ChlJ or b0764 or z0934 or ecs0792 SWALL:MODB_ECOLI (SWALL:P09834) (229 aa) fasta scores: E(): 6e-31, 45% id in 220 aa
YP_111792.1	Similar to Methanosarcina acetivorans molydbenum ABC transporter ATP-binding protein ModC or ma2282 SWALL:Q8TNK3 (EMBL:AE010915) (383 aa) fasta scores: E(): 1.7e-27, 44.15% id in 231 aa, and to Mycobacterium tuberculosis molybdenum transport ATP-binding protein ModC or rv1859 or mt1907 or mtcy359.14 SWALL:MODC_MYCTU (SWALL:P95155) (369 aa) fasta scores: E(): 2.9e-23, 43.77% id in 217 aa
YP_111793.1	Similar to Azotobacter vinelandii molybdenum transport protein ModE or ModA SWALL:MODE_AZOVI (SWALL:P37733) (270 aa) fasta scores: E(): 2.2e-34, 50.6% id in 249 aa, and to Escherichia coli, Escherichia coli O157:H7, and Shigella flexneri transcriptional regulator ModE or ModR or b0761 or z0931 or ecs0789 or sf0543 SWALL:MODE_ECOLI (SWALL:P46930) (262 aa) fasta scores: E(): 2.2e-23, 40.16% id in 244 aa
YP_111794.1	C-terminal region is similar to Caulobacter crescentus hypothetical protein cc3522 SWALL:Q9A2N4 (EMBL:AE006010) (509 aa) fasta scores: E(): 1.1e-13, 31.79% id in 519 aa, and to Rhizobium loti hypothetical protein mll9114 SWALL:Q982E5 (EMBL:AP003015) (500 aa) fasta scores: E(): 0.00016, 28.97% id in 421 aa
YP_111795.1	Similar to Streptomyces coelicolor hypothetical protein sco1037 or scg20a.17 SWALL:Q9K3M3 (EMBL:AL939107) (133 aa) fasta scores: E(): 4.5e-12, 40.62% id in 128 aa, and to Bacillus subtilis hypothetical protein YrdN SWALL:YRDN_BACSU (SWALL:P94502) (129 aa) fasta scores: E(): 4.6e-11, 34.64% id in 127 aa
YP_111796.1	Similar to Erwinia chrysanthemi pectinase gene transcriptional regulator PecT SWALL:PECT_ERWCH (SWALL:P52662) (316 aa) fasta scores: E(): 1e-16, 33.84% id in 260 aa, to Agrobacterium tumefaciens transcriptional regulator, LysR family HexA or atu3987 or agr_l_1733 SWALL:Q8U8V1 (EMBL:AE009329) (293 aa) fasta scores: E(): 1.1e-42, 49.64% id in 278 aa, and to Rhizobium loti transcriptional regulator mlr5687 SWALL:Q98B84 (EMBL:AP003007) (302 aa) fasta scores: E(): 3.9e-38, 47.42% id in 272 aa
YP_111797.1	Similar to Clostridium acetobutylicum predicted permease cac0076 SWALL:Q97MW5 (EMBL:AE007520) (303 aa) fasta scores: E(): 2e-43, 41.05% id in 285 aa, and to Brucella suis membrane protein,  br1507 SWALL:AAN30418 (EMBL:AE014445) (303 aa) fasta scores: E(): 2.1e-30, 35.78% id in 299 aa
YP_111798.1	Similar to parts of Ralstonia solanacearum probable composite two-component regulatory rsp1676 or rs02235 SWALL:Q8XPG5 (EMBL:AL646086) (796 aa) fasta scores: E(): 1e-19, 34.13% id in 249 aa, and of Anabaena sp. two-component hybrid sensor and regulator alr3442 SWALL:Q8YRK4 (EMBL:AP003593) (865 aa) fasta scores: E(): 3.8e-13, 29.43% id in 248 aa
YP_111799.1	Similar to Pseudomonas aeruginosa hypothetical protein pa5362 SWALL:Q9HTJ8 (EMBL:AE004948) (446 aa) fasta scores: E(): 2.8e-73, 51.38% id in 432 aa, and to Xanthomonas campestris hypothetical protein xcc1493 SWALL:AAM40789 (EMBL:AE012250) (454 aa) fasta scores: E(): 1.1e-41, 47.81% id in 435 aa, and to Bacillus subtilis hypothetical protein YhdP SWALL:YHDP_BACSU (SWALL:O07585) (444 aa) fasta scores: E(): 5e-37, 30.13% id in 438 aa
YP_111800.1	Similar to Ralstonia solanacearum thiamine-phosphate pyrophosphorylase ThiE2 or rsp0984 or rs02315 SWALL:Q8XR75 (EMBL:AL646082) (198 aa) fasta scores: E(): 4.6e-24, 44.79% id in 192 aa, and to Streptococcus pneumoniae, and Streptococcus pneumoniae probable thiamine-phosphate pyrophosphorylase 2 ThiE2 or ThiE or sp0725 or spr0637 SWALL:THE2_STRPN (SWALL:Q97RR8) (210 aa) fasta scores: E(): 9.8e-08, 29.41% id in 170 aa
YP_111801.1	Similar to Ralstonia solanacearum  maltooligosyl trehalose trehalohydrolase rsp0237 or rs05186 SWALL:Q8XT78 (EMBL:AL646077) (622 aa) fasta scores: E(): 7.3e-43, 36.26% id in 626 aa, and to Rhizobium sp. malto-oligosyltrehalose trehalohydrolase TreZ SWALL:TREZ_RHISP (SWALL:Q53238) (596 aa) fasta scores: E(): 1.6e-08, 30.13% id in 365 aa
YP_111802.1	Similar to Agrobacterium tumefaciens hypothetical protein atu5140 or agr_pat_202 SWALL:Q8UKG9 (EMBL:AE008938) (238 aa) fasta scores: E(): 9.5e-47, 60.6% id in 231 aa, and to Pseudomonas aeruginosa hypothetical protein pa2034 SWALL:Q9I281 (EMBL:AE004629) (224 aa) fasta scores: E(): 1.4e-16, 38.24% id in 217 aa
YP_111803.1	Similar to Salmonella typhimurium  cytoplasmic protein stm4549 SWALL:Q8ZJX0 (EMBL:AE008914) (152 aa) fasta scores: E(): 6.4e-34, 60.52% id in 152 aa, and to Pseudomonas aeruginosa hypothetical protein pa1357 SWALL:Q9I3Y7 (EMBL:AE004565) (158 aa) fasta scores: E(): 6.6e-34, 61.84% id in 152 aa
YP_111804.1	Similar to Escherichia coli L-lactate dehydrogenase LldD or LctD or b3605 SWALL:LLDD_ECOLI (SWALL:P33232) (396 aa) fasta scores: E(): 3.4e-45, 40.43% id in 366 aa, and to Pseudomonas putida L(+)-mandelate dehydrogenase MdlB SWALL:MDLB_PSEPU (SWALL:P20932) (393 aa) fasta scores: E(): 4.5e-46, 39.56% id in 369 aa
YP_111805.1	Similar to Methanosarcina mazei transposase mm2165 or mm3236 SWALL:AAM31861 (EMBL:AE013456) (168 aa) fasta scores: E(): 0.0016, 29.56% id in 115 aa, and to Sulfolobus solfataricus first ORF in transposon ISC1078 sso1384 SWALL:Q97YE2 (EMBL:AE006753) (152 aa) fasta scores: E(): 0.0043, 26.05% id in 119 aa
YP_111806.1	Similar to Rhizobium loti hypothetical protein Mll3530 mll3530 SWALL:Q98G16 (EMBL:AP003002) (208 aa) fasta scores: E(): 1.2e-33, 52.82% id in 195 aa, and to Pseudomonas putida conserved hypothetical protein pp3405 SWALL:AAN69008 (EMBL:AE016786) (209 aa) fasta scores: E(): 3.6e-10, 30.1% id in 196 aa. Note: This CDS has an alternative start codon at residue 12
YP_111807.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa2489 SWALL:Q9I0Z3 (EMBL:AE004676) (271 aa) fasta scores: E(): 2.3e-43, 44.01% id in 259 aa, and to Streptomyces coelicolor AraC-family regulatory protein sco2294 or scc30.02C SWALL:Q9L019 (EMBL:AL939112) (278 aa) fasta scores: E(): 1.6e-23, 32.95% id in 267 aa
YP_111809.1	Similar to Rhodobacter capsulatus hypothetical 19.0 kDa protein SWALL:O68026 (EMBL:AF010496) (190 aa) fasta scores: E(): 7.5e-10, 34.03% id in 191 aa, and to Escherichia coli hypothetical protein YfiK or b2578 SWALL:YFIK_ECOLI (SWALL:P38101) (195 aa) fasta scores: E(): 2.7e-07, 32.5% id in 160 aa
YP_111810.1	Similar to Pyrobaculum aerophilum hypothetical protein pae2796 SWALL:Q8ZUG4 (EMBL:AE009894) (110 aa) fasta scores: E(): 4.7e-12, 40.56% id in 106 aa, and to Clostridium acetobutylicum possible pectin degradation protein cac3376 SWALL:Q97DU5 (EMBL:AE007834) (114 aa) fasta scores: E(): 1.8e-06, 35.64% id in 101 aa
YP_111811.1	catalyzes the formation of pyruvate and acetaldehyde from 4-hydroxy-2-ketovaleric acid; involved in the degradation of phenylpropionate
YP_111812.1	catalyzes the formation of acetyl-CoA from acetalaldehyde
YP_111813.1	Similar to Pseudomonas aeruginosa probable thioesterase pa2425 SWALL:Q9I156 (EMBL:AE004670) (254 aa) fasta scores: E(): 1.2e-31, 41.46% id in 246 aa, and to Bacillus brevis gramicidin S biosynthesis GrsT protein SWALL:GRST_BACBR (SWALL:P14686) (256 aa) fasta scores: E(): 4e-31, 37.29% id in 244 aa
YP_111814.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 branched-chain amino acid aminotransferase IlvE or b3770 or c4692 or z5281 or ecs4704 SWALL:ILVE_ECOLI (SWALL:P00510) (308 aa) fasta scores: E(): 8.4e-55, 49.34% id in 304 aa, and to Vibrio cholerae branched-chain amino acid aminotransferase vc0029 SWALL:Q9KVV9 (EMBL:AE004094) (319 aa) fasta scores: E(): 2e-59, 52.11% id in 307 aa
YP_111815.1	Similar to Legionella pneumophila protein DlpA SWALL:DLPA_LEGPN (SWALL:Q48806) (615 aa) fasta scores: E(): 6.2e-12, 29.54% id in 220 aa, and to Ralstonia solanacearum  transferase rsp1231 or rs03175 SWALL:Q8XQJ4 (EMBL:AL646083) (216 aa) fasta scores: E(): 5.3e-09, 27.35% id in 223 aa
YP_111816.1	Similar to Bacillus brevis gramicidin S biosynthesis GrsT protein SWALL:GRST_BACBR (SWALL:P14686) (256 aa) fasta scores: E(): 6.4e-33, 36.84% id in 247 aa, and to Streptomyces coelicolor thioesterase sco5894 or sc3f7.14 SWALL:O54157 (EMBL:AL939125) (280 aa) fasta scores: E(): 2.3e-27, 37.87% id in 264 aa
YP_111817.1	Similar to Pseudomonas syringae syringomycin biosynthesis enzyme 2 SyrB2 SWALL:Q9RBY6 (EMBL:U25130) (310 aa) fasta scores: E(): 2e-50, 43.33% id in 300 aa, and to Pseudomonas syringae CmaB SWALL:O50472 (EMBL:U14657) (262 aa) fasta scores: E(): 8.9e-35, 40.81% id in 245 aa
YP_111818.1	Similar to the C-terminal region of Streptomyces antibioticus SimH SWALL:Q9F5J4 (EMBL:AF321122) (997 aa) fasta scores: E(): 0.067, 31.7% id in 82 aa, and of Streptomyces tendae NikP1 protein SWALL:Q9F2E7 (EMBL:AJ250581) (677 aa) fasta scores: E(): 0.076, 30.12% id in 83 aa
YP_111819.1	Similar to Streptomyces avermitilis non-ribosomal peptide synthetase SWALL:Q93H39 (EMBL:AB070952) (625 aa) fasta scores: E(): 4.2e-44, 38.2% id in 513 aa, and to Streptomyces coelicolor peptide synthase sco5891 or st3f7.11 SWALL:O54154 (EMBL:AL939125) (532 aa) fasta scores: E(): 1.8e-38, 32.47% id in 502 aa
YP_111820.1	Similar to Pseudomonas aurantiaca  transcriptional regulatory protein SWALL:AAN18029 (EMBL:AY135187) (107 aa) fasta scores: E(): 2.5e-21, 66.66% id in 96 aa, and to Streptomyces coelicolor  transcriptional regulator sco4059 or 2scd60.25 SWALL:Q9AK58 (EMBL:AL939118) (111 aa) fasta scores: E(): 3.2e-06, 40% id in 95 aa
YP_111821.1	Similar to Pseudomonas aurantiaca hypothetical protein SWALL:Q84H33 (EMBL:AY135187) (151 aa) fasta scores: E(): 6.7e-37, 62.66% id in 150 aa, and to Rhizobium meliloti hypothetical protein SMB21007 smb21007 SWALL:Q92UJ5 (EMBL:AL603646) (139 aa) fasta scores: E(): 0.00036, 28.76% id in 146 aa
YP_111822.1	Similar to Ralstonia solanacearum probable transmembrane protein rsp0410 or rs00867 SWALL:Q8XSQ7 (EMBL:AL646078) (224 aa) fasta scores: E(): 5e-45, 52.17% id in 207 aa, and to Deinococcus radiodurans hypothetical protein dr0351 SWALL:Q9RXG2 (EMBL:AE001895) (227 aa) fasta scores: E(): 6.6e-16, 31.05% id in 219 aa
YP_111823.1	Similar to Escherichia coli serine/threonine protein phosphatase 1 PphA or PrpA or b1838 SWALL:PRP1_ECOLI (SWALL:P55798) (218 aa) fasta scores: E(): 3e-17, 35.74% id in 221 aa, and to Salmonella typhimurium serine/threonine protein phosphatase PrpA or stm1853 SWALL:Q8ZNY9 (EMBL:AE008782) (216 aa) fasta scores: E(): 2.9e-13, 32.12% id in 221 aa
YP_111824.1	Similar to Rhizobium loti hypothetical protein mll2215 SWALL:Q98IW7 (EMBL:AP002999) (240 aa) fasta scores: E(): 5.3e-23, 37.38% id in 214 aa, and to Brucella melitensis hypothetical protein bmeii0978 SWALL:Q8YBC2 (EMBL:AE009731) (221 aa) fasta scores: E(): 1.7e-16, 34.34% id in 198 aa
YP_111825.1	Similar to Rhizobium sp. hypothetical 14.7 kDa protein y4oB SWALL:Y4OB_RHISN (SWALL:P55587) (129 aa) fasta scores: E(): 5.9e-21, 59.13% id in 115 aa, and to Brucella melitensis hypothetical protein bmeii0977 SWALL:Q8YBC3 (EMBL:AE009731) (158 aa) fasta scores: E(): 1.2e-15, 43.84% id in 130 aa
YP_111826.1	Similar to Pseudomonas aeruginosa hypothetical protein pa0830 SWALL:Q9I5A9 (EMBL:AE004517) (277 aa) fasta scores: E(): 7.1e-34, 38.57% id in 267 aa, and to Caulobacter crescentus FF domain protein cc1344 SWALL:Q9A8K9 (EMBL:AE005810) (285 aa) fasta scores: E(): 1.7e-29, 35.31% id in 286 aa
YP_111827.1	Similar to Neisseria meningitidis peptidyl-prolyl cis-trans isomerase Fbp or nmb0027 SWALL:FKBP_NEIMB (SWALL:P25138) (109 aa) fasta scores: E(): 2.6e-24, 66.66% id in 105 aa, and to Neurospora crassa FK506-binding protein 9g6.180 SWALL:FKBP_NEUCR (SWALL:P20080) (120 aa) fasta scores: E(): 1.3e-19, 53.5% id in 114 aa
YP_111828.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa3220 SWALL:Q9HZ20 (EMBL:AE004745) (254 aa) fasta scores: E(): 3.8e-21, 37.4% id in 254 aa, and to Photobacterium leiognathi probable transcriptional regulator LumQ SWALL:LUMQ_PHOLE (SWALL:Q51872) (248 aa) fasta scores: E(): 9.7e-13, 24.59% id in 248 aa
YP_111829.1	Similar to Anabaena sp. HepB or alr3698 SWALL:P70778 (EMBL:U68035) (389 aa) fasta scores: E(): 1.7e-42, 38.03% id in 376 aa, and to Mycobacterium tuberculosis hypothetical protein rv0486 or mt0504 or mtcy20g9.12 SWALL:Y486_MYCTU (SWALL:Q11152) (480 aa) fasta scores: E(): 1.4e-11, 33.89% id in 354 aa
YP_111830.1	Similar to Anabaena sp. glycosyltransferase alr2839 SWALL:Q8YT87 (EMBL:AP003591) (381 aa) fasta scores: E(): 3.1e-62, 47.25% id in 383 aa, and to Methanobacterium thermoautotrophicum LPS biosynthesis related protein mth450 SWALL:O26550 (EMBL:AE000829) (411 aa) fasta scores: E(): 2.7e-13, 27.87% id in 330 aa
YP_111831.1	Similar to Anabaena sp. hypothetical protein alr2841 SWALL:Q8YT85 (EMBL:AP003591) (474 aa) fasta scores: E(): 1.5e-53, 32.74% id in 455 aa
YP_111833.1	Similar to Anabaena sp. glycosyltransferase alr2840 SWALL:Q8YT86 (EMBL:AP003591) (315 aa) fasta scores: E(): 3.2e-53, 48.84% id in 303 aa, and to Archaeoglobus fulgidus succinoglycan biosynthesis protein af0620 SWALL:O29635 (EMBL:AE001062) (297 aa) fasta scores: E(): 1.9e-08, 30.73% id in 231 aa
YP_111834.1	Similar to Acinetobacter johnsonii tyrosine-protein kinase Ptk SWALL:PTK_ACIJO (SWALL:O52788) (733 aa) fasta scores: E(): 9.7e-68, 33.1% id in 728 aa, and to Escherichia coli tyrosine-protein kinase Wzc or b2060 SWALL:WZC_ECOLI (SWALL:P76387) (720 aa) fasta scores: E(): 4e-63, 36.25% id in 742 aa
YP_111835.1	Similar to Erwinia amylovora amylovoran export outer membrane protein AmsH precursor SWALL:AMSH_ERWAM (SWALL:Q46629) (377 aa) fasta scores: E(): 1.3e-34, 38.36% id in 391 aa, and to Escherichia coli, and Escherichia coli O157:H7  polysaccharide export protein Wza precursor b2062 or z3227 or ecs2867 SWALL:WZA_ECOLI (SWALL:P76388) (379 aa) fasta scores: E(): 7.2e-34, 36.45% id in 395 aa, and to Vibrio vulnificus capsular polysaccharide transport protein Wza SWALL:Q938A5 (EMBL:AY055488) (378 aa) fasta scores: E(): 3.3e-35, 38.94% id in 380 aa
YP_111836.1	Similar to Escherichia coli, and Escherichia coli O157:H7 low molecular weight protein-tyrosine-phosphatase Wzb or b2061 or z3226 or ecs2866 SWALL:WZB_ECOLI (SWALL:P77153) (147 aa) fasta scores: E(): 5.1e-16, 40.27% id in 144 aa, and to Acinetobacter johnsonii low molecular weight protein-tyrosine-phosphatase Ptp SWALL:PTP_ACIJO (SWALL:O52787) (142 aa) fasta scores: E(): 1.7e-16, 39.86% id in 143 aa. Note: Also similar to BPSL2779 (145 aa) fasta scores: E(): 5.1e-15, 41.259% identity in 143 aa overlap
YP_111837.1	Similar to Pseudomonas aeruginosa UDP-glucose 6-dehydrogenase Udg or Ugd or pa2022 SWALL:UDG_PSEAE (SWALL:O86422) (453 aa) fasta scores: E(): 5.7e-83, 51.97% id in 456 aa, and to Rhizobium meliloti UDP-glucose 6-dehydrogenase RkpK or r01082 or smc02641 SWALL:UDG_RHIME (SWALL:O54068) (437 aa) fasta scores: E(): 2.8e-70, 49.66% id in 453 aa. Note: Also similar to BPSL2511 Udg (467 aa) fasta scores: E(): 1.5e-121, 76.304% identity in 460 aa overlap
YP_111838.1	Similar to Escherichia coli  colanic biosynthesis UDP-glucose lipid carrier transferase WcaJ or b2047 SWALL:WCAJ_ECOLI (SWALL:P71241) (464 aa) fasta scores: E(): 2.5e-59, 39.65% id in 469 aa, and to Salmonella typhimurium  undecaprenylphosphate glucosephosphotransferase WcaJ or stm2103 SWALL:Q9F799 (EMBL:AF285085) (464 aa) fasta scores: E(): 2.8e-58, 38.92% id in 465 aa. Note: Also similar to BPSL0618 (473 aa) fasta scores: E(): 3.5e-96, 50.433% identity in 462 aa overlap
YP_111839.1	Similar to Salmonella enterica subsp. enterica GDP-mannose pyrophosphorylase ManC SWALL:Q9EXX7 (EMBL:AY012192) (482 aa) fasta scores: E(): 4.4e-76, 48.45% id in 485 aa, and to Escherichia coli O157:H7 mannose-1-phosphate guanylyltransferase ManC or z3195 or ecs2836 SWALL:MANC_ECO57 (SWALL:O85342) (482 aa) fasta scores: E(): 1.2e-75, 48.14% id in 486 aa. Note: Also similar to BPSL0605 ManC (531 aa) fasta scores: E(): 1.2e-105, 63.843% identity in 484 aa overlap
YP_111840.1	Similar in its N-terminal region to Shigella flexneri IS1650 ORFA s0204 SWALL:Q9AFP3 (EMBL:AF348706) (149 aa) fasta scores: E(): 5.5e-06, 37.77% id in 90 aa, and to Agrobacterium tumefaciens ORF3 protein SWALL:Q00429 (EMBL:X53945) (123 aa) fasta scores: E(): 1.1e-05, 35.6% id in 132 aa
YP_111841.1	Similar to Sulfolobus tokodaii hypothetical protein st2368 SWALL:Q96XZ9 (EMBL:AP000989) (188 aa) fasta scores: E(): 2.4e-09, 32.11% id in 137 aa, and to Sulfolobus solfataricus hypothetical protein sso2644 SWALL:Q97VH9 (EMBL:AE006859) (188 aa) fasta scores: E(): 3.9e-07, 32.84% id in 137 aa
YP_111842.1	Similar to Escherichia coli, and Escherichia coli O157:H7 anaerobic glycerol-3-phosphate dehydrogenase subunit C GlpC or b2243 or z3501 or ecs3128 SWALL:GLPC_ECOLI (SWALL:P13034) (396 aa) fasta scores: E(): 3e-22, 28.08% id in 413 aa, and to Salmonella typhimurium SN-glycerol-3-phosphate dehydrogenase stm2286 SWALL:Q8ZNG3 (EMBL:AE008802) (396 aa) fasta scores: E(): 1.3e-22, 28.7% id in 418 aa
YP_111843.1	Similar to the N-terminal region of Porphyromonas gingivalis rubrerythrin Rr or Rbr SWALL:RUBY_PORGI (SWALL:Q9AGG3) (200 aa) fasta scores: E(): 2.8e-17, 46.09% id in 141 aa, and of Desulfovibrio vulgaris rubrerythrin Rr SWALL:RUBY_DESVH (SWALL:P24931) (191 aa) fasta scores: E(): 5.8e-16, 45.58% id in 136 aa. Note: The C-terminal region of the database matches belongs to the rubredoxin family; this CDS presents no similarities to this region
YP_111844.1	Similar to Ralstonia solanacearum N-acetylmuramoyl-L-alanine amidase rsc1796 or rs04196 SWALL:Q8XYG2 (EMBL:AL646066) (343 aa) fasta scores: E(): 3.2e-86, 68.86% id in 334 aa, and to Escherichia coli probable N-acetylmuramoyl-L-alanine amidase YbjR or b0867 SWALL:YBJR_ECOLI (SWALL:P75820) (276 aa) fasta scores: E(): 5e-34, 41.72% id in 290 aa
YP_111845.1	Similar to Streptomyces coelicolor  RNA polymerase sigma factor sco4757 or sc6g4.35 SWALL:O86798 (EMBL:AL939121) (419 aa) fasta scores: E(): 1.7e-96, 65.4% id in 422 aa, and to Rhizobium loti sigma-70 factor, ECF subfamily mll7837 SWALL:Q984U6 (EMBL:AP003012) (417 aa) fasta scores: E(): 7.9e-52, 47.5% id in 421 aa
YP_111846.1	Similar to Rhizobium loti hypothetical protein mll4384 SWALL:Q98E68 (EMBL:AP003004) (175 aa) fasta scores: E(): 2.5e-14, 37.41% id in 155 aa
YP_111847.1	Similar to Pseudomonas aeruginosa hypothetical protein pa1354 SWALL:Q9I3Z0 (EMBL:AE004565) (141 aa) fasta scores: E(): 2.6e-25, 56.93% id in 137 aa, and to Ralstonia solanacearum hypothetical protein rsp0637 or rs03730 SWALL:Q8XS44 (EMBL:AL646079) (143 aa) fasta scores: E(): 3.5e-21, 50% id in 140 aa
YP_111848.1	Similar to Rhizobium loti hypothetical protein mlr2587 SWALL:Q98I36 (EMBL:AP003000) (134 aa) fasta scores: E(): 3e-08, 34.51% id in 113 aa, and to Pseudomonas putida conserved hypothetical protein pp4555 SWALL:AAN70128 (EMBL:AE016791) (114 aa) fasta scores: E(): 1.4e-07, 37.5% id in 112 aa
YP_111849.1	Similar to Xanthomonas axonopodis nuclease xac0274 SWALL:AAM35166 (EMBL:AE011652) (609 aa) fasta scores: E(): 1.3e-59, 39.51% id in 615 aa, and to Anabaena sp. hypothetical protein alr0276 SWALL:Q8Z027 (EMBL:AP003581) (2348 aa) fasta scores: E(): 4.1e-38, 43.57% id in 615 aa
YP_111850.1	Low similarity to Yersinia pestis  membrane protein ypo0570 or y3609 SWALL:Q8ZID5 (EMBL:AJ414143) (101 aa) fasta scores: E(): 0.0024, 30.43% id in 92 aa, and to Pseudomonas aeruginosa hypothetical protein pa2754 SWALL:Q9I089 (EMBL:AE004703) (109 aa) fasta scores: E(): 0.021, 28.7% id in 108 aa
YP_111851.1	Similar to Ralstonia solanacearum  lipoprotein rsc1878 or rs03438 SWALL:Q8XY85 (EMBL:AL646067) (200 aa) fasta scores: E(): 2.6e-34, 56.47% id in 193 aa, and to Xylella fastidiosa hypothetical protein xf0565 SWALL:Q9PFU2 (EMBL:AE003903) (301 aa) fasta scores: E(): 1.5e-06, 30.38% id in 181 aa
YP_111852.1	Similar to Pseudomonas aeruginosa hypothetical protein pa2651 SWALL:Q9I0I7 (EMBL:AE004694) (352 aa) fasta scores: E(): 3e-85, 64.7% id in 340 aa, and to Brucella suis membrane protein,  bra0460 SWALL:AAN33654 (EMBL:AE014544) (352 aa) fasta scores: E(): 4.3e-65, 48.82% id in 340 aa. Note: This CDS contains a possible alternative start codon at residue 13
YP_111854.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa0781 pa0781 SWALL:Q9I5F7 (EMBL:AE004513) (687 aa) fasta scores: E(): 4.9e-139, 56.81% id in 690 aa, and to Xanthomonas axonopodis outer membrane hemin receptor xac2829 SWALL:Q8PIR6 (EMBL:AE011924) (687 aa) fasta scores: E(): 2.9e-21, 33.37% id in 731 aa
YP_111855.1	Similar to Rhizobium meliloti  transmembrane transport protein ra1285 or sma2377 SWALL:Q92XG9 (EMBL:AE007314) (389 aa) fasta scores: E(): 2.8e-27, 32.34% id in 371 aa, and to Pseudomonas aeruginosa probable MFS transporter pa4136 SWALL:Q9HWP5 (EMBL:AE004830) (402 aa) fasta scores: E(): 1.3e-23, 31.65% id in 398 aa
YP_111856.1	Similar to Pseudomonas aeruginosa probable oxidoreductase pa1648 SWALL:Q9I377 (EMBL:AE004592) (334 aa) fasta scores: E(): 4.9e-54, 46.6% id in 339 aa, and to Rhizobium loti quinone oxidoreductase mlr6843 SWALL:Q987Z3 (EMBL:AP003010) (339 aa) fasta scores: E(): 5.7e-44, 43.1% id in 341 aa
YP_111857.1	Converts 2,5-dichloro-2,5-cyclohexadiene-1,4-diol to 2,5-dichlorohydroquinone
YP_111858.1	Similar to Pseudomonas aeruginosa probable short-chain dehydrogenase pa1828 SWALL:Q9I2R7 (EMBL:AE004609) (255 aa) fasta scores: E(): 3.1e-62, 66.66% id in 255 aa, and to Caulobacter crescentus oxidoreductase, short-chain dehydrogenase/reductase cc3076 SWALL:Q9A3X5 (EMBL:AE005971) (254 aa) fasta scores: E(): 3.1e-29, 39.2% id in 250 aa
YP_111859.1	Similar to Pseudomonas aeruginosa hypothetical protein pa1831 SWALL:Q9I2R4 (EMBL:AE004609) (236 aa) fasta scores: E(): 1.9e-19, 33.89% id in 236 aa
YP_111860.1	Similar to Pseudomonas aeruginosa hypothetical protein pa1829 SWALL:Q9I2R6 (EMBL:AE004609) (356 aa) fasta scores: E(): 2.3e-67, 51.36% id in 331 aa, and to Streptomyces coelicolor  phosphotransferase sco1689 or sci30a.10 SWALL:Q9S263 (EMBL:AL939109) (341 aa) fasta scores: E(): 1.4e-31, 38.11% id in 328 aa
YP_111861.1	Similar to Pseudomonas aeruginosa probable acyl-CoA dehydrogenase pa2550 SWALL:Q9I0T4 (EMBL:AE004683) (409 aa) fasta scores: E(): 6e-103, 63.52% id in 403 aa, and to Rattus norvegicus acyl-CoA dehydrogenase, medium-chain specific, mitochondrial precursor AcaDM SWALL:ACDM_RAT (SWALL:P08503) (421 aa) fasta scores: E(): 9.5e-27, 28.75% id in 400 aa
YP_111862.1	Similar to Burkholderia cepacia DntR SWALL:Q8VUD7 (EMBL:AF169302) (301 aa) fasta scores: E(): 9.3e-22, 30.4% id in 296 aa, and to Ralstonia solanacearum probable transcription regulator protein rsc2018 or rs03586 SWALL:Q8XXU5 (EMBL:AL646067) (321 aa) fasta scores: E(): 1.9e-38, 41.11% id in 304 aa
YP_111863.1	Similar to Xanthomonas campestris hypothetical protein xcc2716 SWALL:AAM41988 (EMBL:AE012384) (144 aa) fasta scores: E(): 6.4e-13, 42.01% id in 119 aa, and to Caulobacter crescentus hypothetical protein cc2998 SWALL:Q9A445 (EMBL:AE005963) (158 aa) fasta scores: E(): 2.3e-10, 38.39% id in 112 aa
YP_111865.1	Similar to Pseudomonas aeruginosa hypothetical protein pa2765 SWALL:Q9I078 (EMBL:AE004704) (299 aa) fasta scores: E(): 4.7e-77, 64.84% id in 293 aa, and to Escherichia coli hypothetical protein YfeX or b2431 SWALL:YFEX_ECOLI (SWALL:P76536) (299 aa) fasta scores: E(): 7.6e-18, 31.12% id in 257 aa
YP_111866.1	Similar to Rhizobium loti ATP-binding protein of ABC transporter mll0815 SWALL:Q98LY9 (EMBL:AP002995) (601 aa) fasta scores: E(): 1.6e-148, 71.28% id in 592 aa, and to Agrobacterium tumefaciens ABC transporter nucleotide binding/ATPase Exsa or atu4728 or agr_l_309 SWALL:Q8U6S8 (EMBL:AE009401) (600 aa) fasta scores: E(): 1.8e-141, 68.41% id in 592 aa
YP_111867.1	Similar to Anabaena sp. thij family protein all7521 SWALL:Q8ZSI9 (EMBL:AP003602) (226 aa) fasta scores: E(): 2.7e-43, 53.36% id in 208 aa, and to Streptomyces coelicolor hypothetical protein sco6747 sco6747 or sc5f2a.30 SWALL:Q9X7Q3 (EMBL:AL939129) (211 aa) fasta scores: E(): 7e-30, 43.81% id in 210 aa
YP_111868.1	Similar to Streptomyces coelicolor  transcriptional regulator sco6746 or sc5f2a.29 SWALL:Q9X7Q2 (EMBL:AL939129) (325 aa) fasta scores: E(): 2.3e-50, 50.94% id in 318 aa, and to Caulobacter crescentus transcriptional regulator, AraC family cc2960 SWALL:Q9A483 (EMBL:AE005960) (312 aa) fasta scores: E(): 5.1e-46, 47.92% id in 313 aa. Note: This CDS is longer in its N-terminal region than most of its database matches
YP_111869.1	catalyzes a two-step reaction, first charging a tryptophan molecule by linking its carboxyl group to the alpha-phosphate of ATP, followed by transfer of the aminoacyl-adenylate to its tRNA
YP_111870.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc1027 or rs04225 SWALL:Q8Y0L6 (EMBL:AL646062) (250 aa) fasta scores: E(): 8e-10, 32.11% id in 218 aa
YP_111871.1	Possible gene remnant. Similar to the c-terminal regions of Rhizobium meliloti  transcription factor SMA1454 SWALL:Q92YS0 (EMBL:AE007266) (356 aa) fasta scores: E(): 1.5, 30.4% id in 125 aa, and Pseudomonas putida transcriptional regulator, AraC family SWALL:Q88EF7 (EMBL:AE016790) (353 aa) fasta scores: E(): 0.49, 34.23% id in 111 aa
YP_111872.1	Similar to Clostridium acetobutylicum conserved membrane protein, possible homolog of CAAX-like membrane endopeptidase cac0420 SWALL:Q97LY0 (EMBL:AE007556) (276 aa) fasta scores: E(): 5.8e-12, 27.13% id in 269 aa, and to Caulobacter crescentus membrane protein,  cc2538 SWALL:Q9A5B2 (EMBL:AE005921) (309 aa) fasta scores: E(): 2.4e-11, 27.63% id in 304 aa
YP_111873.1	Similar to Xanthomonas campestris hypothetical protein xcc1977 SWALL:Q8P988 (EMBL:AE012302) (440 aa) fasta scores: E(): 6.5e-89, 61.11% id in 414 aa, and to Clostridium perfringens hypothetical protein cpe0590 SWALL:Q8XMU8 (EMBL:AP003187) (437 aa) fasta scores: E(): 4.1e-60, 44.98% id in 389 aa
YP_111874.1	Similar to Pseudomonas aeruginosa probable haloacid dehalogenase pa0810 SWALL:Q9I5C9 (EMBL:AE004516) (233 aa) fasta scores: E(): 1.6e-37, 48.08% id in 235 aa, and to Pseudomonas sp. 2-haloalkanoic acid dehalogenase I SWALL:HAD1_PSESP (SWALL:P24069) (227 aa) fasta scores: E(): 1e-08, 31.88% id in 207 aa
YP_111875.1	regulates chemotaxis by demethylation of methyl-accepting chemotaxis proteins
YP_111876.1	Similar to Thermotoga maritima chemotaxis protein CheA or tm0702 SWALL:CHEA_THEMA (SWALL:Q56310) (671 aa) fasta scores: E(): 2.2e-33, 27.4% id in 708 aa, and to Rhizobium loti chemotaxis histidine kinase mll9511 SWALL:Q98PD0 (EMBL:AP003017) (757 aa) fasta scores: E(): 1.1e-104, 49.07% id in 864 aa
YP_111877.1	Similar to Rhizobium loti hypothetical protein mll9513 SWALL:Q98PC9 (EMBL:AP003017) (234 aa) fasta scores: E(): 1.2e-21, 38.33% id in 240 aa, and the C-terminal region of Rhizobium meliloti chemotaxis protein CheW or r00640 or smc03008 SWALL:CHEW_RHIME (SWALL:Q52881) (155 aa) fasta scores: E(): 1.7e-05, 31.25% id in 144 aa
YP_111878.1	Similar to Ralstonia solanacearum methyltransferase rsp1647 or rs02206 SWALL:Q8XPJ3 (EMBL:AL646086) (466 aa) fasta scores: E(): 1.3e-45, 37.71% id in 684 aa, and to Myxococcus xanthus protein methyltransferase FrzF SWALL:FRZF_MYXXA (SWALL:P31759) (593 aa) fasta scores: E(): 7.1e-08, 27.28% id in 546 aa
YP_111879.1	Similar to Pseudomonas putida  purine-binding chemotaxis protein CheW3 SWALL:Q93A55 (EMBL:AF430345) (168 aa) fasta scores: E(): 1.2e-08, 39.61% id in 154 aa, and to Pseudomonas aeruginosa CheW or pa1464 SWALL:O87130 (EMBL:AB012767) (159 aa) fasta scores: E(): 0.00051, 35.44% id in 79 aa
YP_111880.1	Similar to Pseudomonas aeruginosa probable chemotaxis transducer pa3708 SWALL:Q9HXT3 (EMBL:AE004789) (542 aa) fasta scores: E(): 1.4e-91, 57.51% id in 539 aa, and to Pseudomonas aeruginosa protein PilJ or pa0411 SWALL:PILJ_PSEAE (SWALL:P42257) (682 aa) fasta scores: E(): 4.5e-21, 27.94% id in 526 aa
YP_111881.1	N-terminal region similar to Pseudomonas aeruginosa probable two-component response regulator pa3702 SWALL:Q9HXT9 (EMBL:AE004789) (347 aa) fasta scores: E(): 3.7e-29, 64.92% id in 134 aa, C-terminal region to Caulobacter crescentus sensory box histidine kinase, cc3327 SWALL:Q9A377 (EMBL:AE005994) (761 aa) fasta scores: E(): 9.5e-22, 37.61% id in 226 aa, and in full length to Mycobacterium leprae sensor-like histidine kinase SenX3 or ml2440 or b2168_c3_247 SWALL:SEX3_MYCLE (SWALL:P54883) (443 aa) fasta scores: E(): 1.9e-15, 29.85% id in 335 aa
YP_111884.1	Similar to Escherichia coli succinate-semialdehyde dehydrogenase [NADP+] GabD or b2661 SWALL:GABD_ECOLI (SWALL:P25526) (482 aa) fasta scores: E(): 5.2e-45, 36.61% id in 478 aa, and to Rhizobium sp. probable succinate-semialdehyde dehydrogenase [NADP+] GabD or y4sJ SWALL:GABD_RHISN (SWALL:P55653) (491 aa) fasta scores: E(): 1.6e-42, 34.51% id in 481 aa
YP_111885.1	catalyzes the condensation of two pyruvates to form acetolactate, implicated in pH homeostasis via the acetoin-2,3-butanediol pathway or in valine biosynthesis
YP_111886.1	Similar to Agrobacterium tumefaciens Na+/H+ antiporter atu3059 or agr_l_3497 SWALL:Q8UBF7 (EMBL:AE009236) (550 aa) fasta scores: E(): 7e-101, 53.2% id in 530 aa, and to Rhizobium loti Na+/H+ antiporter mll3064 SWALL:Q98H22 (EMBL:AP003001) (517 aa) fasta scores: E(): 8.4e-49, 36.46% id in 521 aa
YP_111887.1	Similar to Escherichia coli hypothetical protein YjiN or b4336 SWALL:YJIN_ECOLI (SWALL:P39385) (426 aa) fasta scores: E(): 1.1e-85, 54.34% id in 414 aa, and to Salmonella typhi  membrane protein sty4873 SWALL:Q8Z0X2 (EMBL:AL627284) (423 aa) fasta scores: E(): 2.2e-85, 53.86% id in 414 aa
YP_111888.1	Similar to Ralstonia solanacearum probable acetyltransferase rsp0265 or rs03701 SWALL:Q8XT50 (EMBL:AL646077) (184 aa) fasta scores: E(): 1.4e-07, 41.28% id in 109 aa, and to Myxococcus xanthus ActC SWALL:Q93P57 (EMBL:AF350253) (437 aa) fasta scores: E(): 1.7e-06, 37.31% id in 134 aa
YP_111889.1	Similar to Xanthomonas axonopodis cardiolipin synthase Cls or xac2871 SWALL:AAM37716 (EMBL:AE011929) (520 aa) fasta scores: E(): 1.5e-61, 41.13% id in 530 aa, and to Pseudomonas aeruginosa hypothetical protein pa5310 SWALL:Q9HTP4 (EMBL:AE004943) (529 aa) fasta scores: E(): 1.7e-61, 40.15% id in 528 aa
YP_111890.1	Similar to Ralstonia solanacearum  HIT-like protein rsp0494 or rs00372 SWALL:Q8XSI0 (EMBL:AL646079) (144 aa) fasta scores: E(): 6.9e-29, 58.08% id in 136 aa, and to Caulobacter crescentus HIT family protein cc2470 SWALL:Q9A5H7 (EMBL:AE005916) (144 aa) fasta scores: E(): 7.9e-23, 50.72% id in 138 aa
YP_111891.1	Similar to Rhodococcus erythropolis rhodocoxin reductase ThcD SWALL:THCD_RHOER (SWALL:P43494) (426 aa) fasta scores: E(): 1.7e-39, 37.1% id in 407 aa, and to Escherichia coli 3-phenylpropionate dioxygenase ferredoxin--NAD(+) reductase component (EC 1.18.1.3) HcaD or PhdA or HcaA4 or b2542 SWALL:HCAD_ECOLI (SWALL:P77650) (400 aa) fasta scores: E(): 4.7e-38, 37.83% id in 407 aa
YP_111892.1	Similar to Pseudomonas aeruginosa naphthalene 1,2-dioxygenase system ferredoxin component NdoA or PahA2 SWALL:NDOA_PSEAE (SWALL:Q51493) (103 aa) fasta scores: E(): 2.8e-13, 44% id in 100 aa, and to Pseudomonas putida, and Pseudomonas sp. naphthalene 1,2-dioxygenase system ferredoxin component NdoA or NahAB or DoxA or NdoC1 SWALL:NDOA_PSEPU (SWALL:P23082) (103 aa) fasta scores: E(): 1.1e-12, 42.26% id in 97 aa
YP_111893.1	Similar to Sphingomonas aromaticivorans small subunit aromatic oxygenase BphA2D SWALL:O85985 (EMBL:AF079317) (162 aa) fasta scores: E(): 7.8e-27, 50.36% id in 137 aa, and to Pseudomonas aeruginosa ortho-halobenzoate 1,2-dioxygenase beta-isp protein OhbA SWALL:Q9Z5W2 (EMBL:AF121970) (176 aa) fasta scores: E(): 8.4e-27, 48.36% id in 153 aa. Note: The N-terminal region of this CDS does not present similarities with the database matches hit by the rest of the CDS
YP_111894.1	Similar to Sphingomonas aromaticivorans large subunit aromatic oxygenase BphA1C SWALL:O85993 (EMBL:AF079317) (420 aa) fasta scores: E(): 5e-83, 49.88% id in 419 aa, and to Pseudomonas aeruginosa O-halobenzoate 1,2-dioxygenase large subunit OhbA SWALL:Q93AD8 (EMBL:AF422937) (401 aa) fasta scores: E(): 8.3e-72, 46.34% id in 397 aa
YP_111895.1	Similar to Ralstonia solanacearum probable transcription regulator protein rsc1832 or rs04267 SWALL:Q8XYC6 (EMBL:AL646067) (342 aa) fasta scores: E(): 1.7e-19, 33.62% id in 348 aa, and to Pseudomonas putida xylDLEGF operon transcriptional activator 1 XylS1 SWALL:XYS1_PSEPU (SWALL:Q04710) (321 aa) fasta scores: E(): 2.4e-14, 30.53% id in 298 aa. Possible alternative translational start sites.
YP_111896.1	Similar to Acinetobacter lwoffii probable cat1 operon transcriptional activator SWALL:CATR_ACILW (SWALL:O33945) (303 aa) fasta scores: E(): 5.3e-46, 47.29% id in 296 aa, and to Burkholderia sp. NK8 LysR-type transcriptional regulatory protein CbeR SWALL:Q9AQS6 (EMBL:AB024746) (306 aa) fasta scores: E(): 2.5e-53, 55.19% id in 279 aa
YP_111897.1	Similar to Acinetobacter lwoffii muconate cycloisomerase I 1 CatB1 SWALL:CTB1_ACILW (SWALL:O33946) (379 aa) fasta scores: E(): 7.3e-80, 62.53% id in 371 aa, and to Burkholderia sp. TH2 cis,cis-muconate lactonizing enzyme CatB2 SWALL:BAC16768 (EMBL:AB035325) (395 aa) fasta scores: E(): 3.5e-92, 73.76% id in 343 aa
YP_111898.1	Similar to Acinetobacter lwoffii catechol 1,2-dioxygenase 2 CatA2 SWALL:CTA2_ACILW (SWALL:O33950) (275 aa) fasta scores: E(): 4.6e-84, 81.22% id in 261 aa, and to Burkholderia sp. TH2 catechol 1,2-dioxygenase CatA2 SWALL:BAC16769 (EMBL:AB035325) (300 aa) fasta scores: E(): 3.4e-90, 74.66% id in 300 aa
YP_111899.1	Similar to Acinetobacter lwoffii muconolactone delta-isomerase 2 CatC2 SWALL:CTC2_ACILW (SWALL:O33951) (96 aa) fasta scores: E(): 2.9e-32, 80.2% id in 96 aa, and to Pseudomonas putida muconolactone delta-isomerase CatC SWALL:CATC_PSEPU (SWALL:P00948) (96 aa) fasta scores: E(): 4.4e-28, 73.95% id in 96 aa
YP_111900.1	Similar to Escherichia coli, Escherichia coli O157:H7, and Shigella flexneri cytochrome O ubiquinol oxidase CyoD or b0429 or z0532 or ecs0483 or sf0370 SWALL:CYOD_ECOLI (SWALL:P18403) (109 aa) fasta scores: E(): 2.7e-16, 49.5% id in 101 aa, and to Pseudomonas putida cytochrome O ubiquinol oxidase CyoD SWALL:CYOD_PSEPU (SWALL:Q9WWR4) (110 aa) fasta scores: E(): 2.7e-15, 42.72% id in 110 aa
YP_111901.1	Similar to Escherichia coli, Escherichia coli O6, and Shigella flexneri cytochrome O ubiquinol oxidase subunit III CyoC or b0430 or c0541 or sf0371 SWALL:CYOC_ECOLI (SWALL:P18402) (204 aa) fasta scores: E(): 1.1e-41, 53.6% id in 194 aa, and to Pseudomonas putida cytochrome O ubiquinol oxidase subunit III CyoC SWALL:CYOC_PSEPU (SWALL:Q9WWR3) (207 aa) fasta scores: E(): 5.3e-44, 55.72% id in 192 aa
YP_111902.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 ubiquinol oxidase polypeptide I CyoB or b0431 or c0542 or z0534 or ecs0485 SWALL:CYOB_ECOLI (SWALL:P18401) (663 aa) fasta scores: E(): 1.5e-189, 67.22% id in 653 aa, and to Acetobacter aceti ubiquinol oxidase polypeptide I precursor CyaA SWALL:QOX1_ACEAC (SWALL:P98009) (664 aa) fasta scores: E(): 4.4e-197, 69.06% id in 666 aa
YP_111903.1	Similar to Escherichia coli, and Escherichia coli O6 ubiquinol oxidase polypeptide II precursor CyoA or b0432 or c0543 SWALL:CYOA_ECOLI (SWALL:P18400) (315 aa) fasta scores: E(): 6e-66, 55.9% id in 288 aa, and to Acetobacter aceti ubiquinol oxidase polypeptide II precursor CyaB SWALL:QOX2_ACEAC (SWALL:P50653) (307 aa) fasta scores: E(): 7.3e-73, 63.76% id in 287 aa
YP_111904.1	Similar to Escherichia coli 2,4-dienoyl-CoA reductase [NADPH] FadH or b3081 SWALL:FADH_ECOLI (SWALL:P42593) (671 aa) fasta scores: E(): 3e-151, 60.71% id in 672 aa, and to Pseudomonas aeruginosa 2,4-dienoyl-CoA reductase FadH1 or pa3092 SWALL:Q9HZB6 (EMBL:AE004733) (679 aa) fasta scores: E(): 4.9e-170, 65.73% id in 677 aa
YP_111905.1	Similar to Pseudomonas aeruginosa ornithine utilization regulator OruR or pa0831 SWALL:ORUR_PSEAE (SWALL:P72171) (339 aa) fasta scores: E(): 2.5e-27, 33.23% id in 346 aa, and to Mycobacterium tuberculosis hypothetical transcriptional regulator rv1395 or mt1440 or mtcy21b4.12 SWALL:YD95_MYCTU (SWALL:P71663) (344 aa) fasta scores: E(): 1.7e-20, 29.88% id in 338 aa
YP_111906.1	Similar to Xanthomonas axonopodis transcriptional regulator LysR family xac4038 SWALL:Q8PFE5 (EMBL:AE012052) (304 aa) fasta scores: E(): 2e-63, 62.45% id in 293 aa, and to Agrobacterium tumefaciens transcriptional regulator, LysR family atu2191 or agr_c_3985 SWALL:Q8UDD6 (EMBL:AE009170) (314 aa) fasta scores: E(): 5.2e-57, 53.87% id in 310 aa
YP_111907.1	Similar to Xanthomonas axonopodis hypothetical protein xac4039 SWALL:Q8PFE4 (EMBL:AE012052) (330 aa) fasta scores: E(): 2.2e-79, 64.48% id in 321 aa, and to Ralstonia solanacearum hypothetical protein rsc3335 or rs02569 SWALL:Q8XU58 (EMBL:AL646074) (318 aa) fasta scores: E(): 9.4e-70, 59.04% id in 315 aa
YP_111908.1	Similar to Burkholderia sp. NK8 LysR-type transcriptional regulatory protein CbeR SWALL:Q9AQS6 (EMBL:AB024746) (306 aa) fasta scores: E(): 2.8e-94, 83.05% id in 301 aa, and to Acinetobacter calcoaceticus ben and cat operon transcriptional regulator BenM SWALL:BENM_ACICA (SWALL:O68014) (304 aa) fasta scores: E(): 8.9e-54, 47.69% id in 304 aa
YP_111909.1	Similar to Acinetobacter calcoaceticus benzoate 1,2-dioxygenase alpha subunit BenA SWALL:BENA_ACICA (SWALL:P07769) (461 aa) fasta scores: E(): 2.6e-150, 74.65% id in 438 aa, and to Pseudomonas putida benzoate 1,2-dioxygenase large subunit BenA SWALL:Q93SR8 (EMBL:AY026914) (455 aa) fasta scores: E(): 1.8e-142, 73.68% id in 437 aa
YP_111910.1	Similar to Acinetobacter calcoaceticus benzoate 1,2-dioxygenase beta subunit BenB SWALL:BENB_ACICA (SWALL:P07770) (169 aa) fasta scores: E(): 1.8e-48, 71.16% id in 163 aa, and to Pseudomonas putida benzoate 1,2-dioxygenase small subunit BenB SWALL:Q93SR7 (EMBL:AY026914) (162 aa) fasta scores: E(): 1.3e-42, 66.45% id in 155 aa
YP_111911.1	with BenAB catalyzes the formation of 2-hydro-1,2-dihydroxybenzoate from benzoate
YP_111912.1	catalyzes the degradation of 2-hydro-1,2-dihydroxy benzoate to catechol
YP_111913.1	Similar to Caulobacter crescentus carboxylesterase cc2298 SWALL:Q9A5Z9 (EMBL:AE005900) (289 aa) fasta scores: E(): 3.6e-36, 43.94% id in 289 aa, and to Xanthomonas campestris carboxylesterase xcc2285 SWALL:Q8P8F7 (EMBL:AE012336) (291 aa) fasta scores: E(): 7.3e-32, 44.07% id in 270 aa
YP_111914.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa3067 SWALL:Q9HZE1 (EMBL:AE004731) (147 aa) fasta scores: E(): 3.7e-41, 80.82% id in 146 aa, and to Mycobacterium tuberculosis hypothetical transcriptional regulator rv0880 or mt0903.1 or mtcy31.08 SWALL:Y880_MYCTU (SWALL:Q10542) (143 aa) fasta scores: E(): 4.2e-09, 36.23% id in 138 aa. Note: This CDS is longer in its C-terminal region than most of its database matches
YP_111915.1	Similar to Pseudomonas aeruginosa hypothetical protein pa3066 SWALL:Q9HZE2 (EMBL:AE004731) (190 aa) fasta scores: E(): 1e-53, 75.26% id in 190 aa, and to Ralstonia solanacearum  hydrolase rsp0438 or rs00897 SWALL:Q8XSM9 (EMBL:AL646078) (197 aa) fasta scores: E(): 2.8e-10, 35.17% id in 145 aa
YP_111916.1	Similar to Pseudomonas aeruginosa hypothetical protein pa3065 SWALL:Q9HZE3 (EMBL:AE004731) (328 aa) fasta scores: E(): 8e-70, 63.6% id in 327 aa
YP_111918.1	Similar to Bordetella parapertussis transposase for insertion sequence element IS1001 TnpA SWALL:TNPA_BORPA (SWALL:Q06126) (406 aa) fasta scores: E(): 6.2e-138, 78.07% id in 406 aa, and to Ralstonia solanacearum ISrso15-transposase rsp1547 or rs02103 or rsc2573 or rs00774 SWALL:Q8XFK1 (EMBL:AL646085) (406 aa) fasta scores: E(): 8.5e-161, 91.62% id in 406 aa
YP_111919.1	Similar to Escherichia coli lysine-specific permease LysP or CadR (WALL:P25737) (488 aa) fasta scores: E(): 5.6e-145, 75.05% id in 477 aa, and to Ralstonia solanacearum probable lysine-specific permease transmembrane protein rsc1758 or rs02945 SWALL:Q8XYK0 (EMBL:AL646066) (512 aa) fasta scores: E(): 1.5e-152, 78.79% id in 481 aa
YP_111920.1	Similar to Pseudomonas aeruginosa hypothetical protein pa1542 SWALL:Q9I3H1 (EMBL:AE004582) (278 aa) fasta scores: E(): 5.1e-33, 39.2% id in 278 aa, and to Ralstonia solanacearum hypothetical protein rsp1030 or rs02367 SWALL:Q8XR38 (EMBL:AL646082) (250 aa) fasta scores: E(): 2.7e-09, 29.63% id in 243 aa
YP_111921.1	Similar to Pseudomonas putida metallo-beta-lactamase pp3291 SWALL:AAN68898 (EMBL:AE016786) (455 aa) fasta scores: E(): 5.1e-93, 54.48% id in 457 aa, and to Chlorobium tepidum metallo-beta-lactamase superfamily protein ct0598 SWALL:Q8KET4 (EMBL:AE012833) (469 aa) fasta scores: E(): 3e-57, 38.01% id in 463 aa
YP_111922.1	Similar to Alcaligenes eutrophus acetoacetyl-CoA reductase PhbB SWALL:PHBB_ALCEU (SWALL:P14697) (246 aa) fasta scores: E(): 2.4e-46, 55.32% id in 244 aa, and to Zoogloea ramigera acetoacetyl-CoA reductase PhbB SWALL:PHBB_ZOORA (SWALL:P23238) (241 aa) fasta scores: E(): 3.9e-42, 53.25% id in 246 aa
YP_111923.1	Similar to Ralstonia solanacearum probable transcription regulator protein rsc0190 or rs00622 SWALL:Q8Y2Z1 (EMBL:AL646057) (266 aa) fasta scores: E(): 5e-49, 51.75% id in 257 aa, and to Escherichia coli, Escherichia coli O6, Escherichia coli O157:H7, and Shigella flexneri fumarate and nitrate reduction regulatory protein Fnr or NirR or b1334 or c1807 or z2433 or ecs1915 or sf1836 SWALL:FNR_ECOLI (SWALL:P03019) (250 aa) fasta scores: E(): 1.2e-33, 39.38% id in 226 aa. Note: This CDS is longer in its N-terminal region than most of its database matches
YP_111924.1	Similar to Ralstonia solanacearum probable alcohol dehydrogenase-like oxidoreductase rsc1505 or rs03800 SWALL:Q8XZ99 (EMBL:AL646064) (334 aa) fasta scores: E(): 4.3e-81, 66.26% id in 329 aa, and to Bacillus stearothermophilus alcohol dehydrogenase SWALL:ADH3_BACST (SWALL:P42328) (339 aa) fasta scores: E(): 8.8e-32, 34.02% id in 338 aa
YP_111928.1	Similar to Brucella melitensis 3-isopropylmalate dehydrogenase bmeii0271 SWALL:Q8YDA7 (EMBL:AE009665) (276 aa) fasta scores: E(): 1.5e-37, 44.36% id in 284 aa, and to Caulobacter crescentus hypothetical protein cc0810 SWALL:Q9AA01 (EMBL:AE005757) (260 aa) fasta scores: E(): 6.7e-37, 48.47% id in 262 aa. Possible alternative translational start site after codon 23
YP_111930.1	Similar to Ralstonia solanacearum hypothetical protein rsc0189 or rs00621 SWALL:Q8Y2Z2 (EMBL:AL646057) (215 aa) fasta scores: E(): 5.2e-36, 51.64% id in 213 aa, and to Escherichia coli, and Escherichia coli O6 osmotically inducible protein Y precursor OsmY or b4376 or c5457 SWALL:OSMY_ECOLI (SWALL:P27291) (201 aa) fasta scores: E(): 0.0034, 28.33% id in 180 aa
YP_111932.1	Similar to Bacillus halodurans probable adenylylsulfate kinase bh1489 SWALL:CYC1_BACHD (SWALL:Q9KCT0) (202 aa) fasta scores: E(): 1e-31, 48.24% id in 199 aa, and to Klebsiella aerogenes APS kinase CysC SWALL:Q9EYY1 (EMBL:AF308468) (201 aa) fasta scores: E(): 2.1e-29, 49.73% id in 189 aa
YP_111933.1	Similar to C-terminal region similar to C-terminal region of Escherichia coli methyl-accepting chemotaxis protein I Tsr or CheD or b4355 SWALL:MCP1_ECOLI (SWALL:P02942) (551 aa) fasta scores: E(): 1.7e-49, 47.9% id in 405 aa, and full length similar to Rahnella aquatilis  methyl-accepting chemotaxis protein I SWALL:Q93ET6 (EMBL:AF338038) (554 aa) fasta scores: E(): 2.9e-63, 43.33% id in 540 aa
YP_111934.1	Weakly similar to Streptomyces coelicolor polysaccharide deacetylase sco2710 or scc61a.31 SWALL:Q9KYG2 (EMBL:AL939113) (229 aa) fasta scores: E(): 4.1e-06, 28.21% id in 241 aa, and to Staphylococcus caprae IcaB SWALL:Q9AIQ6 (EMBL:AF246926) (289 aa) fasta scores: E(): 5.9e-06, 21.79% id in 234 aa
YP_111935.1	Similar to Chlorobium tepidum ABC-type export system, outer membrane channel protein ct0554 SWALL:AAM71796 (EMBL:AE012830) (500 aa) fasta scores: E(): 9.1e-73, 47.88% id in 472 aa, and to Ralstonia solanacearum probable outer membrane channel lipoprotein rsc0166 or rs01036 SWALL:Q8Y315 (EMBL:AL646057) (480 aa) fasta scores: E(): 7.8e-59, 44% id in 475 aa
YP_111936.1	Similar to Chlorobium tepidum ABC-type export system, membrane fusion protein ct0553 SWALL:AAM71795 (EMBL:AE012830) (314 aa) fasta scores: E(): 1.8e-24, 46.92% id in 358 aa, and to Escherichia coli hypothetical membrane protein YbhG or b0795 SWALL:YBHG_ECOLI (SWALL:P75777) (332 aa) fasta scores: E(): 1.9e-07, 30.1% id in 299 aa
YP_111937.1	Similar to Chlorobium tepidum ABC-type export system, ATP-binding subunit ct0552 SWALL:AAM71794 (EMBL:AE012830) (239 aa) fasta scores: E(): 2.7e-53, 68.26% id in 230 aa, and to Bacillus halodurans ABC transporter bh2699 SWALL:Q9K9E9 (EMBL:AP001516) (251 aa) fasta scores: E(): 4e-25, 38.46% id in 221 aa
YP_111938.1	Similar to Chlorobium tepidum ABC-type export system, membrane protein ct0551 SWALL:AAM71793 (EMBL:AE012830) (384 aa) fasta scores: E(): 1e-92, 64.28% id in 378 aa, and to Deinococcus radiodurans hypothetical protein dr0474 SWALL:Q9RX41 (EMBL:AE001906) (386 aa) fasta scores: E(): 2.5e-07, 24.61% id in 386 aa
YP_111940.1	Similar to Ralstonia solanacearum hypothetical protein rsp1561 or rs02117 SWALL:Q8XPS7 (EMBL:AL646085) (151 aa) fasta scores: E(): 1.5e-20, 49.66% id in 147 aa, and to Methanosarcina acetivorans universal stress protein ma4094 SWALL:Q8TIP8 (EMBL:AE011122) (153 aa) fasta scores: E(): 3.5e-11, 37.33% id in 150 aa. Note There is a possible alternative start codon 45 amino acid residues upstream
YP_111941.1	Similar to the N-terminal region of Ralstonia solanacearum  transcription regulator protein rsp1164 or rs05643 SWALL:Q8XQQ7 (EMBL:AL646083) (233 aa) fasta scores: E(): 2e-05, 57.53% id in 73 aa, and very low similarity to the full length Rhizobium loti transcriptional regulator mll4816 SWALL:Q98D84 (EMBL:AP003005) (244 aa) fasta scores: E(): 0.047, 27.14% id in 221 aa
YP_111942.1	Similar to Caulobacter crescentus efflux system protein cc0806 SWALL:Q9AA05 (EMBL:AE005757) (467 aa) fasta scores: E(): 3.7e-62, 44.9% id in 461 aa, and to Pseudomonas aeruginosa outer membrane protein precursor OprM or OprK or pa0427 SWALL:OPRM_PSEAE (SWALL:Q51487) (485 aa) fasta scores: E(): 3.7e-61, 42.56% id in 484 aa. CDS is extended at the N-terminus in comparison to orthologues
YP_111943.1	Similar to Pseudomonas aeruginosa hypothetical protein pa5232 SWALL:Q9HTV8 (EMBL:AE004935) (357 aa) fasta scores: E(): 4.4e-67, 60.51% id in 352 aa, and to Escherichia coli hypothetical protein precursor YhiI or b3487 SWALL:YHII_ECOLI (SWALL:P37626) (355 aa) fasta scores: E(): 1.3e-63, 58.4% id in 351 aa
YP_111944.1	Similar to Escherichia coli hypothetical ABC transporter ATP-binding protein YhiH or b3486 SWALL:YHIH_ECOLI (SWALL:P37624) (894 aa) fasta scores: E(): 2.2e-102, 56.16% id in 1063 aa, and to Agrobacterium tumefaciens ABC transporter nucleotide binding/ATPase atu4667 or agr_l_430 SWALL:Q8U6Y9 (EMBL:AE009395) (930 aa) fasta scores: E(): 1.4e-101, 55.46% id in 1071 aa. Note: This CDS presents no similarities in the database matches between approx. residue 510 and approx. residue 690
YP_111945.1	Similar to Escherichia coli, and Shigella flexneri hypothetical protein YhhJ or b3485 or sf3501 SWALL:YHHJ_ECOLI (SWALL:P31993) (374 aa) fasta scores: E(): 8.7e-92, 61.76% id in 374 aa, and to Pseudomonas aeruginosa probable permease of ABC transporter pa5230 SWALL:Q9HTW0 (EMBL:AE004935) (374 aa) fasta scores: E(): 6.6e-91, 63.1% id in 374 aa
YP_111946.1	Similar to Caulobacter crescentus sensory box histidine kinase/response regulator cc3225 SWALL:Q9A3H9 (EMBL:AE005986) (731 aa) fasta scores: E(): 9.5e-57, 35.17% id in 688 aa, and to Pseudomonas putida sensor histidine kinase/response regulator pp3651 SWALL:AAN69251 (EMBL:AE016787) (727 aa) fasta scores: E(): 6.1e-51, 33.19% id in 729 aa
YP_111947.1	Similar to Salmonella typhimurium methyl-accepting chemotaxis citrate transducer Tcp or stm3577 SWALL:MCPC_SALTY (SWALL:Q02755) (547 aa) fasta scores: E(): 4.1e-44, 42.75% id in 414 aa, and to Ralstonia solanacearum  methyl-accepting chemotaxis transducer transmembrane protein rsp1099 or rs02605 SWALL:Q8XQW9 (EMBL:AL646082) (513 aa) fasta scores: E(): 2.4e-84, 50.09% id in 515 aa
YP_111948.1	Similar to Ralstonia solanacearum probable transmembrane protein rsc0339 or rs03306 SWALL:Q8Y2J6 (EMBL:AL646058) (171 aa) fasta scores: E(): 4.6e-23, 46.78% id in 171 aa, and to Xanthomonas campestris hypothetical protein xcc3810 SWALL:AAM43484 (EMBL:AE012502) (165 aa) fasta scores: E(): 4.5e-13, 36% id in 150 aa
YP_111950.1	Similar to Rhizobium meliloti alcohol dehydrogenase AdhA or ra0704 or sma1296 SWALL:ADHA_RHIME (SWALL:O31186) (340 aa) fasta scores: E(): 3e-84, 64.37% id in 334 aa, and to Brucella melitensis alcohol dehydrogenase bmei1746 SWALL:Q8YEY1 (EMBL:AE009608) (373 aa) fasta scores: E(): 4.7e-95, 72.35% id in 340 aa
YP_111951.1	Similar to Thiobacillus ferrooxidans ATP synthase gamma chain AtpG SWALL:ATPG_THIFE (SWALL:P41169) (298 aa) fasta scores: E(): 4.9e-06, 24.91% id in 281 aa, and to Escherichia coli, Escherichia coli O6, Escherichia coli O157:H7, and Shigella flexneri ATP synthase gamma chain AtpG or UncG or PapC or b3733 or c4659 or z5231 or ecs4675 or sf3813 SWALL:ATPG_ECOLI (SWALL:P00837) (287 aa) fasta scores: E(): 0.00014, 22.66% id in 278 aa
YP_111952.1	produces ATP from ADP in the presence of a proton gradient across the membrane. The alpha chain is a catalytic subunit
YP_111953.1	Similar to the N-terminal region of Methanosarcina barkeri ATP synthase B subunit AtpF SWALL:O31081 (EMBL:AF028006) (386 aa) fasta scores: E(): 3.2e-08, 26.98% id in 252 aa, and of Methanosarcina acetivorans H(+)-transporting ATP synthase, subunit B ma2435 SWALL:Q8TN58 (EMBL:AE010936) (329 aa) fasta scores: E(): 2.8e-07, 26.12% id in 245 aa
YP_111954.1	produces ATP from ADP in the presence of a proton gradient across the membrane; subunit C is part of the membrane proton channel F0
YP_111955.1	produces ATP from ADP in the presence of a proton gradient across the membrane; subunit A is part of the membrane proton channel F0
YP_111957.1	Very low similarity to Methanosarcina barkeri ATP synthase gene 1 AtpI SWALL:O31077 (EMBL:AF028006) (112 aa) fasta scores: E(): 0.0029, 27% id in 100 aa, and to Chlorobium tepidum ATP synthase,  ct1031 SWALL:AAM72264 (EMBL:AE012866) (107 aa) fasta scores: E(): 0.0093, 25.77% id in 97 aa
YP_111958.1	produces ATP from ADP in the presence of a proton gradient across the membrane; the epsilon subunit is part of the catalytic core of the ATP synthase complex
YP_111959.1	produces ATP from ADP in the presence of a proton gradient across the membrane; the beta chain is a regulatory subunit
YP_111960.1	Similar to Azorhizobium caulinodans poly-beta-hydroxybutyrate polymerase PhbC SWALL:PHBC_AZOCA (SWALL:O66392) (583 aa) fasta scores: E(): 2e-73, 40.23% id in 517 aa, and to Methylobacterium extorquens poly(3-hydroxyalkanoate) polymerase PhaC SWALL:PHAC_METEX (SWALL:P52070) (605 aa) fasta scores: E(): 1e-72, 40.74% id in 535 aa
YP_111961.1	Catalyses the synthesis of acetylphosphate from acetyl-CoA and inorganic phosphate
YP_111962.1	Enables the production of acetyl-CoA by phosphorylating acetate in the presence of ATP and a divalent cation
YP_111963.1	Similar to Escherichia coli 6-phosphofructokinase isozyme 2 PfkB or b1723 SWALL:K6P2_ECOLI (SWALL:P06999) (309 aa) fasta scores: E(): 1.8e-31, 39.48% id in 309 aa, and to Salmonella typhimurium 6-phosphofructokinase II Pfkb or stm1326 SWALL:Q8ZPT5 (EMBL:AE008757) (310 aa) fasta scores: E(): 7e-32, 39.15% id in 309 aa
YP_111964.1	Similar to Ralstonia solanacearum hypothetical protein rsc0189 or rs00621 SWALL:Q8Y2Z2 (EMBL:AL646057) (215 aa) fasta scores: E(): 1e-29, 46.75% id in 216 aa, and very low similarity to Escherichia coli, and Escherichia coli O6 osmotically inducible protein Y precursor OsmY or b4376 or c5457 SWALL:OSMY_ECOLI (SWALL:P27291) (201 aa) fasta scores: E(): 0.00021, 31.72% id in 145 aa
YP_111965.1	Similar to Bacillus subtilis cytidine deaminase Cdd SWALL:CDD_BACSU (SWALL:P19079) (136 aa) fasta scores: E(): 3.4e-25, 55.9% id in 127 aa, and to Thermoanaerobacter tengcongensis cytidine deaminase tte0462 SWALL:Q8RCG7 (EMBL:AE013017) (135 aa) fasta scores: E(): 6.1e-27, 58.4% id in 125 aa
YP_111966.1	Catalyzes the reversible phosphorolysis of thymidine, deoxyuridine and their analogues to their respective bases and 2-deoxyribose 1-phosphate
YP_111968.1	catalyzes the formation of D-glyceraldehyde 3-phosphate and acetaldehyde from 2-deoxy-D-ribose-5-phosphate
YP_111969.1	Similar to Yersinia pestis  Na+ dependent nucleoside transporter-family protein ypo0435 SWALL:Q8ZIQ5 (EMBL:AJ414142) (423 aa) fasta scores: E(): 3.7e-85, 57.68% id in 423 aa, and to Escherichia coli hypothetical transport protein YeiM or b2164 SWALL:YEIM_ECOLI (SWALL:P33024) (416 aa) fasta scores: E(): 1.3e-81, 55.18% id in 424 aa
YP_111970.1	Similar to Pseudomonas aeruginosa hypothetical protein pa3036 SWALL:Q9HZH2 (EMBL:AE004728) (310 aa) fasta scores: E(): 2.6e-45, 49.19% id in 311 aa, and to Rhizobium meliloti hypothetical protein rb0009 or smb20006 SWALL:Q92XF2 (EMBL:AL603642) (317 aa) fasta scores: E(): 3.5e-41, 48.14% id in 297 aa. Note: C-terminal region presents no simi;arities to any of the database macthes and contains repeat regions
YP_111971.1	Similar to Pseudomonas putida glutathione S-transferase pp1162 SWALL:AAN66786 (EMBL:AE016778) (209 aa) fasta scores: E(): 5.7e-46, 63.18% id in 201 aa, and to Rhizobium leguminosarum GstA protein SWALL:GSTA_RHILE (SWALL:Q52828) (203 aa) fasta scores: E(): 1.6e-41, 57.5% id in 200 aa
YP_111972.1	Similar to Pseudomonas aeruginosa transcriptional regulator PtxR or pa2258 SWALL:PTXR_PSEAE (SWALL:P72131) (312 aa) fasta scores: E(): 4.6e-30, 39.73% id in 297 aa, and to Rhizobium loti transcriptional regulator mlr3418 SWALL:Q98GA5 (EMBL:AP003001) (311 aa) fasta scores: E(): 4.2e-38, 43.68% id in 293 aa
YP_111973.1	Similar to Streptomyces coelicolor  TetR-family transcriptional regulator sco0745 or scf81.04C SWALL:Q9RJE7 (EMBL:AL939106) (219 aa) fasta scores: E(): 4.2e-05, 28.64% id in 192 aa, and to Mycobacterium tuberculosis hypothetical protein rv0825c rv0825c or mt0847 or mtv043.17C SWALL:O53836 (EMBL:AL022004) (239 aa) fasta scores: E(): 5.2e-05, 29.06% id in 203 aa
YP_111974.1	Similar to Pseudomonas aeruginosa probable short-chain dehydrogenase pa1537 SWALL:Q9I3H6 (EMBL:AE004582) (295 aa) fasta scores: E(): 1.1e-54, 52.57% id in 291 aa, and to Mycobacterium tuberculosis oxidoreductase rv3085 or mtv013.06 or mt3170 SWALL:O53302 (EMBL:AL021309) (276 aa) fasta scores: E(): 1.4e-44, 48.18% id in 276 aa
YP_111975.1	Similar to Caulobacter crescentus monooxygenase, flavin-binding family cc2569 SWALL:Q9A588 (EMBL:AE005925) (498 aa) fasta scores: E(): 4.8e-120, 61% id in 500 aa, and to Emericella nidulans  sterigmatocystin biosynthesis monooxygenase StcW SWALL:STCW_EMENI (SWALL:Q00730) (488 aa) fasta scores: E(): 7.6e-17, 23.7% id in 443 aa. CDS is extended at the N-terminus in comparison to orthologues
YP_111976.1	Similar to Pseudomonas fluorescens lactone-specific esterase EstF1 SWALL:O87637 (EMBL:AF090329) (332 aa) fasta scores: E(): 3.4e-52, 47.11% id in 312 aa, and to Rhizobium loti  esterase mlr3816 SWALL:Q98FE1 (EMBL:AP003002) (355 aa) fasta scores: E(): 1.5e-21, 29.94% id in 334 aa
YP_111977.1	Similar in its full length to Ralstonia solanacearum probable transmembrane protein rsp1524 or rs04801 SWALL:Q8XPW2 (EMBL:AL646085) (505 aa) fasta scores: E(): 1.4e-75, 42.12% id in 489 aa, N-terminal region to Rhizobium loti two-component system histidine protein kinase mll4698 SWALL:Q98DH8 (EMBL:AP003004) (535 aa) fasta scores: E(): 3.6e-21, 32.24% id in 338 aa, and C-terminal region to Xanthomonas campestris response regulator xcc3729 SWALL:Q8P4H8 (EMBL:AE012493) (349 aa) fasta scores: E(): 4.1e-38, 38.46% id in 338 aa
YP_111979.1	Similar to Xanthomonas sp. xanthomonapepsin precursor SWALL:XANP_XANS2 (SWALL:Q60106) (827 aa) fasta scores: E(): 7.7e-91, 56.77% id in 627 aa, and to Pseudomonas sp. pseudomonapepsin precursor Pcp SWALL:PICP_PSESR (SWALL:P42790) (587 aa) fasta scores: E(): 2e-24, 48.81% id in 631 aa
YP_111980.1	C-terminal region similar to Ralstonia solanacearum hemagglutinin-related transmembrane protein rsp1094 or rs02600 SWALL:Q8XQX4 (EMBL:AL646082) (459 aa) fasta scores: E(): 8.5e-38, 41.25% id in 446 aa, and N-terminal region to Mycobacterium tuberculosis hypothetical pe-PGRS family protein precursor rv3508 or mtv023.15 SWALL:YZ08_MYCTU (SWALL:O53553) (1901 aa) fasta scores: E(): 3.7e-21, 31.42% id in 560 aa. Note: This CDS contains a repeat region between residue 44 and residue 199
YP_111983.1	Low similarity to Pseudomonas aeruginosa probable glycosyl hydrolase pa2237 SWALL:Q9I1N2 (EMBL:AE004649) (442 aa) fasta scores: E(): 9.6e-15, 25.65% id in 382 aa
YP_111984.1	Similar to Ralstonia solanacearum  tyrosine-protein kinase EpsB SWALL:EPB2_RALSO (SWALL:Q45409) (750 aa) fasta scores: E(): 3.4e-36, 30.28% id in 733 aa, and to Escherichia coli O157:H7 tyrosine-protein kinase Etk or z1398 or ecs1137 SWALL:ETK_ECO57 (SWALL:Q8XC28) (726 aa) fasta scores: E(): 9.6e-36, 28.78% id in 747 aa
YP_111986.1	No significant database matches. Possible alternative translational start sites
YP_111987.1	Similar to Serratia marcescens hypothetical 10.1 kDa protein in bioA 5'region SWALL:YOHL_SERMA (SWALL:P55757) (91 aa) fasta scores: E(): 3.4e-14, 53.84% id in 91 aa, and to Escherichia coli, and Escherichia coli O6 hypothetical protein YaiN or b0357 or c0466 SWALL:YAIN_ECOLI (SWALL:P55756) (91 aa) fasta scores: E(): 7.1e-10, 41.75% id in 91 aa
YP_111988.1	Similar to Agrobacterium tumefaciens cation efflux system protein atu0891 or agr_c_1625 SWALL:Q8UGZ4 (EMBL:AE009054) (338 aa) fasta scores: E(): 2.4e-36, 46.6% id in 412 aa, and to the N-terminal region of Escherichia coli zinc transporter ZitB or b0752 SWALL:ZITB_ECOLI (SWALL:P75757) (313 aa) fasta scores: E(): 4.1e-15, 39.24% id in 186 aa. Note: This CDS presents no similarities in the region between residue 170 and 280
YP_111989.1	Similar to eukaryotic proteins as Sus scrofa deoxyribonuclease II precursor DNAse2 or Dnl2 SWALL:DRN2_PIG (SWALL:O62855) (364 aa) fasta scores: E(): 1.8e-26, 30.55% id in 360 aa, and to Homo sapiens deoxyribonuclease II precursor DNAse2 or Dnl2 SWALL:DRN2_HUMAN (SWALL:O00115) (360 aa) fasta scores: E(): 5e-26, 29.32% id in 324 aa
YP_111995.1	Similar to Streptomyces coelicolor hypothetical protein sco7155 or sc9a4.17 SWALL:Q9FBT7 (EMBL:AL939130) (355 aa) fasta scores: E(): 5.4e-20, 32.93% id in 334 aa, and to Anabaena sp. hypothetical protein alr1577 SWALL:Q8YWM8 (EMBL:AP003586) (366 aa) fasta scores: E(): 3.6e-07, 28.19% id in 376 aa
YP_111996.1	Similar to Pseudomonas aeruginosa hypothetical aldolase class II protein pa3430 SWALL:YY30_PSEAE (SWALL:Q9HYH5) (259 aa) fasta scores: E(): 3.6e-60, 62.34% id in 247 aa, and to parts of Homo sapiens alpha adducin Add1 or AddA SWALL:ADDA_HUMAN (SWALL:P35611) (737 aa) fasta scores: E(): 3.3e-32, 41.03% id in 251 aa
YP_111997.1	Similar to Vibrio cholerae hypothetical protein vc0266 SWALL:Q9KV90 (EMBL:AE004115) (190 aa) fasta scores: E(): 3.8e-47, 61.9% id in 189 aa, and to Ralstonia solanacearum hypothetical protein rsc1329 or rs02851 SWALL:Q8XZR6 (EMBL:AL646064) (198 aa) fasta scores: E(): 1.2e-37, 53.4% id in 191 aa. Note: This CDS is longer in its N-terminal region than most of its database matches
YP_111998.1	catalyzes the removal of N-terminal dipeptides when proline is the penultimate residue
YP_111999.1	Previously sequenced as Burkholderia pseudomallei serine metalloprotease precursor SWALL:Q9F881 (EMBL:AF254803) (500 aa) fasta scores: E(): 7.7e-170, 100% id in 500 aa. Similar to Xanthomonas campestris extracellular protease precursor xcc0851 SWALL:EXPR_XANCP (SWALL:P23314) (580 aa) fasta scores: E(): 4.5e-65, 49.02% id in 463 aa
YP_112000.1	Similar to Burkholderia pseudomallei transcriptional activator protein IrlR SWALL:IRLR_BURPS (SWALL:O31395) (229 aa) fasta scores: E(): 2.6e-70, 73.24% id in 228 aa, and to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 transcriptional regulatory protein CusR or b0571 or c0657 or z0709 or ecs0609 SWALL:CUSR_ECOLI (SWALL:P77380) (227 aa) fasta scores: E(): 1.1e-52, 60.81% id in 222 aa
YP_112001.1	Similar to Burkholderia pseudomallei sensor protein IrlS SWALL:IRLS_BURPS (SWALL:O31396) (464 aa) fasta scores: E(): 6.3e-81, 49.78% id in 468 aa, and to Escherichia coli sensor kinase CusS or b0570 SWALL:CUSS_ECOLI (SWALL:P77485) (480 aa) fasta scores: E(): 8.6e-38, 33.94% id in 436 aa
YP_112003.1	Almost identical to the previously sequenced Burkholderia pseudomallei beta-lactamase precursor Oxa SWALL:CAD32565 (EMBL:AJ488303) (269 aa) fasta scores: E(): 2.2e-111, 99.62% id in 269 aa. Similar to Pseudomonas aeruginosa beta-lactamase Oxa-18 precursor SWALL:BLOI_PSEAE (SWALL:O07293) (275 aa) fasta scores: E(): 2.4e-37, 43.07% id in 267 aa
YP_112004.1	Similar to Anabaena sp. hypothetical protein alr1386 SWALL:Q8YX32 (EMBL:AP003585) (1001 aa) fasta scores: E(): 2.5e-60, 41.34% id in 1028 aa, and low similarity to Methanosarcina mazei ORF492 SWALL:Q50245 (EMBL:X84710) (491 aa) fasta scores: E(): 0.00018, 24.58% id in 301 aa
YP_112005.1	Similar to Rickettsia prowazekii hypothetical protein rp393 SWALL:Q9ZDD8 (EMBL:AJ235271) (282 aa) fasta scores: E(): 2.1e-27, 34.1% id in 258 aa, and to Brucella melitensis high-affinity iron permease bmeii0883 SWALL:Q8YBL6 (EMBL:AE009722) (278 aa) fasta scores: E(): 2.9e-16, 30.03% id in 273 aa
YP_112006.1	Similar to Rickettsia prowazekii hypothetical protein rp394 SWALL:Y394_RICPR (SWALL:Q9ZDD7) (125 aa) fasta scores: E(): 2e-06, 33.33% id in 81 aa, and to Brucella melitensis hypothetical protein bmeii0884 SWALL:Q8YBL5 (EMBL:AE009722) (124 aa) fasta scores: E(): 9e-06, 31.63% id in 98 aa
YP_112008.1	Similar to Pasteurella multocida hypothetical protein Pm1939 SWALL:Q9CJQ5 (EMBL:AE006230) (151 aa) fasta scores: E(): 6.5e-26, 50% id in 142 aa
YP_112009.1	Similar to Ralstonia solanacearum ISRso16-transposase OrfA protein Rsp0557 or Rs03922 SWALL:Q8XSC1 (EMBL:AL646079) (88 aa) fasta scores: E(): 1.1e-16, 67.07% id in 82 aa, and to Xanthomonas campestris truncated transposase tnP SWALL:Q8RJP9 (EMBL:U33548) (88 aa) fasta scores: E(): 1.1e-14, 62.19% id in 82 aa
YP_112011.1	Similar to Ralstonia solanacearum  transmembrane protein Rsc1400 or Rs05292 SWALL:Q8XZJ5 (EMBL:AL646064) (375 aa) fasta scores: E(): 4e-36, 36.54% id in 353 aa
YP_112012.1	Similar to Escherichia coli glucosamine--fructose-6-phosphate aminotransferase [isomerizing] GlmS or b3729 SWALL:GLMS_ECOLI (SWALL:P17169) (608 aa) fasta scores: E(): 6.3e-116, 52.86% id in 611 aa
YP_112017.1	No significant database matches. Possible alternative translational start sites
YP_112018.1	Similar to Listeria monocytogenes hypothetical protein Lmo0529 SWALL:Q8Y9J8 (EMBL:AL591975) (416 aa) fasta scores: E(): 4.9e-28, 29.22% id in 414 aa, and to Leptospira interrogans  glycosyl transferase La0627 SWALL:AAN47826 (EMBL:AE011249) (516 aa) fasta scores: E(): 1.3e-22, 28.13% id in 391 aa. CDS is extended at the N-terminus in comparison to similar proteins
YP_112019.1	Similar to Escherichia coli UDP-N-acetylglucosamine 2-epimerase WecB or RffE or NfrC or b3786 SWALL:WECB_ECOLI (SWALL:P27828) (376 aa) fasta scores: E(): 1.3e-81, 57.83% id in 370 aa
YP_112020.1	Similar to Vibrio cholerae transcriptional activator protein NhaR or HlyT or Vc0677 SWALL:NHAR_VIBCH (SWALL:P52692) (296 aa) fasta scores: E(): 3.7e-23, 31.72% id in 290 aa, and to Escherichia coli transcriptional activator protein nhar nhar or anto or b0020 SWALL:NHAR_ECOLI (SWALL:P10087) (301 aa) fasta scores: E(): 1.8e-22, 31.46% id in 286 aa
YP_112021.1	Similar to Agrobacterium tumefaciens hypothetical protein Atu4476 or Agr_l_786 SWALL:Q8U7H3 (EMBL:AE009376) (275 aa) fasta scores: E(): 1e-63, 66.13% id in 251 aa, and to Escherichia coli hypothetical protein YoaE or b1816 or c2222 or z2859 or ecs2525 SWALL:YOAE_ECOLI (SWALL:P76262) (518 aa) fasta scores: E(): 1.1e-48, 50.61% id in 243 aa
YP_112022.1	Similar to Caulobacter crescentus hypothetical protein Cc2510 SWALL:Q9A5E0 (EMBL:AE005919) (106 aa) fasta scores: E(): 1.2e-09, 38.73% id in 111 aa
YP_112023.1	Similar to Rhizobium loti hypothetical protein Mll0824 SWALL:Q98LY2 (EMBL:AP002995) (138 aa) fasta scores: E(): 3.4e-06, 29.1% id in 134 aa, and to Pseudomonas aeruginosa hypothetical protein Pa4177 SWALL:Q9HWK4 (EMBL:AE004834) (133 aa) fasta scores: E(): 4.4e-06, 37.36% id in 91 aa
YP_112024.1	Similar to Mus musculus sphingosine-1-phosphate lyase Sgpl1 SWALL:O54955 (EMBL:AF036894) (568 aa) fasta scores: E(): 6.1e-52, 37.34% id in 482 aa
YP_112025.1	No significant database matches. Possible alternative translation start sites
YP_112027.1	Similar to Anabaena sp. alcohol dehydrogenase All5334 SWALL:Q8YLG4 (EMBL:AP003599) (409 aa) fasta scores: E(): 3.1e-102, 65.42% id in 402 aa, and to Methylobacter marinus glutathione-dependent formaldehyde dehydrogenase Fdh SWALL:FADH_METMR (SWALL:P47734) (424 aa) fasta scores: E(): 5.2e-43, 44.41% id in 412 aa
YP_112028.1	Similar to Mus musculus sphingosine-1-phosphate lyase Sgpl1 SWALL:O54955 (EMBL:AF036894) (568 aa) fasta scores: E(): 6e-48, 37.71% id in 456 aa
YP_112029.1	Similar to Xanthomonas axonopodis xylulose kinase XylB or Xac4244 SWALL:AAM39079 (EMBL:AE012077) (532 aa) fasta scores: E(): 3.9e-60, 37.87% id in 536 aa, and to Brucella abortus erythritol kinase EryA SWALL:Q9ZB32 (EMBL:U57100) (519 aa) fasta scores: E(): 7.1e-19, 26.77% id in 534 aa
YP_112030.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa3178 SWALL:Q9HZ56 (EMBL:AE004742) (125 aa) fasta scores: E(): 2.3e-16, 48.27% id in 116 aa
YP_112031.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator Pa2885 SWALL:Q9HZW2 (EMBL:AE004714) (198 aa) fasta scores: E(): 1.6e-22, 40.21% id in 189 aa, and to Neisseria gonorrhoeae regulatory protein MtrR SWALL:MTRR_NEIGO (SWALL:P39897) (210 aa) fasta scores: E(): 0.0013, 28.77% id in 139 aa
YP_112032.1	Similar to Pseudomonas aeruginosa probable acyl-CoA dehydrogenase Pa1535 SWALL:Q9I3H8 (EMBL:AE004582) (382 aa) fasta scores: E(): 1e-70, 50% id in 380 aa, and to Rattus norvegicus acyl-CoA dehydrogenase, long-chain specific, mitochondrial precursor AcaDL SWALL:ACDL_RAT (SWALL:P15650) (430 aa) fasta scores: E(): 4.8e-43, 37.63% id in 380 aa
YP_112033.1	Similar to Pseudomonas aeruginosa probable short-chain dehydrogenase Pa2887 SWALL:Q9HZW0 (EMBL:AE004715) (292 aa) fasta scores: E(): 1.1e-58, 57.58% id in 290 aa, and to Gluconobacter oxydans gluconate 5-dehydrogenase Gno SWALL:GNO_GLUOX (SWALL:P50199) (256 aa) fasta scores: E(): 4.9e-21, 36.99% id in 246 aa
YP_112034.1	Similar to Myxococcus xanthus acetyl-CoA carboxylase carboxyltransferase AccB SWALL:Q9FAF6 (EMBL:AB039884) (538 aa) fasta scores: E(): 1.1e-112, 56.48% id in 540 aa
YP_112035.1	Similar to Pseudomonas aeruginosa probable acyl-CoA dehydrogenase Pa2889 SWALL:Q9HZV8 (EMBL:AE004715) (386 aa) fasta scores: E(): 1e-104, 65.87% id in 381 aa, and to Rattus norvegicus acyl-CoA dehydrogenase, long-chain specific, mitochondrial precursor AcaDL SWALL:ACDL_RAT (SWALL:P15650) (430 aa) fasta scores: E(): 3.2e-43, 35.88% id in 379 aa
YP_112036.1	Similar to Pseudomonas aeruginosa probable enoyl-CoA hydratase/isomerase Pa2890 SWALL:Q9HZV7 (EMBL:AE004715) (264 aa) fasta scores: E(): 4.4e-26, 44.09% id in 254 aa, and to Escherichia coli probable enoyl-CoA hydratase PaaG or b1394 SWALL:PAAG_ECOLI (SWALL:P77467) (262 aa) fasta scores: E(): 5.9e-15, 34.48% id in 261 aa
YP_112037.1	Similar to Mycobacterium tuberculosis acetyl-/propionyl-coenzyme A carboxylase alpha chain [includes: biotin carboxylase (EC 6.3.4.14); biotin carboxyl carrier protein (BccP)] protein AccA1 or BccA or Rv2501c or mt2576 or mtcy07a7.07C SWALL:BCCA_MYCTU (SWALL:P46401) (654 aa) fasta scores: E(): 2.6e-90, 45.97% id in 670 aa
YP_112038.1	Similar to many eg. Streptomyces coelicolor hypothetical protein SCO6298 or SCBAC8D1.11c SWALL:Q93RX4 (EMBL:AL939127) (308 aa) fasta scores: E(): 4.2e-17, 33.65% id in 315 aa
YP_112039.1	Similar to Pseudomonas aeruginosa probable AMP-binding enzyme Pa1617 SWALL:Q9I3A5 (EMBL:AE004589) (555 aa) fasta scores: E(): 3.1e-73, 48.55% id in 554 aa, and to Rhizobium leguminosarum malonyl CoA synthetase MatB SWALL:Q9ZIP5 (EMBL:AF117694) (504 aa) fasta scores: E(): 1.9e-16, 27.11% id in 472 aa
YP_112040.1	Similar to Streptomyces coelicolor  fatty acid desaturase SCO3128 or SCE66.07 SWALL:Q9K3T6 (EMBL:AL939115) (336 aa) fasta scores: E(): 4.2e-43, 40.98% id in 283 aa, and to Saccharomyces cerevisiae acyl-CoA desaturase 1 Ole1 or ygl055W SWALL:ACO1_YEAST (SWALL:P21147) (510 aa) fasta scores: E(): 5.7e-14, 27.83% id in 291 aa. Also similar to neighbouring CDS BPSS2040 (49.135% identity (50.000% ungapped) in 289 aa overlap).
YP_112041.1	Similar to Anabaena sp. polyketide synthase HetM or Alr5357 SWALL:HETM_ANASP (SWALL:P37693) (506 aa) fasta scores: E(): 2.5e-06, 48% id in 75 aa, and to Stigmatella aurantiaca MxaF SWALL:Q93TW6 (EMBL:AF319998) (2368 aa) fasta scores: E(): 0.00056, 40.9% id in 66 aa
YP_112042.1	Similar to Ralstonia solanacearum cyclopropane-mycolic acid synthase Rsp1657 or Rs02216 SWALL:Q8XPI3 (EMBL:AL646086) (290 aa) fasta scores: E(): 8e-24, 33.68% id in 282 aa, and to Mycobacterium tuberculosis cyclopropane-fatty-acyl-phospholipid synthase 1 CmaA1 or Cma1 or Rv3392c or mt3499 or mtv004.50 SWALL:CFA1_MYCTU (SWALL:Q11195) (287 aa) fasta scores: E(): 8.1e-20, 31.33% id in 300 aa
YP_112043.1	Similar to Ralstonia solanacearum  fatty acid desaturase transmembrane protein Rsp0792 or Rs01915 SWALL:Q8XRN9 (EMBL:AL646080) (301 aa) fasta scores: E(): 1.3e-38, 44.64% id in 271 aa, and to Synechococcus sp. delta-9 desaturase DesC SWALL:O07873 (EMBL:U36390) (277 aa) fasta scores: E(): 2e-11, 31.74% id in 252 aa. Also similar to neighbouring CDS BPSS2037 (49.135% identity (50.000% ungapped) in 289 aa overlap).
YP_112044.1	Similar to Streptomyces coelicolor hypothetical protein SCO4016 or 2SC10A7.20 SWALL:Q9ADP0 (EMBL:AL939118) (317 aa) fasta scores: E(): 0.00057, 28.57% id in 329 aa
YP_112045.1	Similar to Myxococcus xanthus saframycin MX1 synthetase B SafB SWALL:Q50857 (EMBL:U24657) (1770 aa) fasta scores: E(): 3.3e-77, 44.21% id in 588 aa, and to Streptomyces coelicolor polyketide synthase SCO5892 or SC3F7.12 SWALL:O54155 (EMBL:AL939125) (2297 aa) fasta scores: E(): 5.2e-47, 43.28% id in 603 aa, and to Mycobacterium tuberculosis  fatty-acid--CoA ligase FadD26 or Rv2930 or mt2999 or mtcy338.19 SWALL:FD26_MYCTU (SWALL:Q10976) (583 aa) fasta scores: E(): 2.1e-33, 34.11% id in 595 aa
YP_112046.1	Similar to Deinococcus radiodurans ComA-related protein Dr0847 SWALL:Q9RW22 (EMBL:AE001939) (119 aa) fasta scores: E(): 9.3e-23, 50.84% id in 118 aa, and to Bacillus subtilis ComA operon protein 2 YuxO or ComAB or ComA2 SWALL:CMA2_BACSU (SWALL:P14205) (126 aa) fasta scores: E(): 0.00047, 26.08% id in 115 aa
YP_112047.1	Similar to Ralstonia solanacearum  hydrolase RS04279 SWALL:Q8XYB7 (EMBL:AL646067) (295 aa) fasta scores: E(): 2.3e-24, 34.26% id in 286 aa, and to the C-terminal region of Caulobacter crescentus hypothetical protein CC2565 SWALL:Q9A592 (EMBL:AE005925) (475 aa) fasta scores: E(): 2.3e-25, 34.43% id in 302 aa
YP_112048.1	Similar to Xanthomonas axonopodis hypothetical protein Xac2731 SWALL:AAM37576 (EMBL:AE011912) (206 aa) fasta scores: E(): 1.7e-60, 78.42% id in 190 aa. CDS is extended at the N-terminus in comparison to orthologues
YP_112049.1	Similar to Rhizobium hedysari  transposase SWALL:O30982 (EMBL:AF023675) (250 aa) fasta scores: E(): 3.9e-32, 44.29% id in 228 aa, and to Pantoea agglomerans IS1327 containing a transposase TnpA SWALL:P94785 (EMBL:X87144) (234 aa) fasta scores: E(): 8.6e-23, 33.33% id in 228 aa
YP_112050.1	Similar to Streptomyces coelicolor  hydrolase SCO1984 or SC3C9.19c SWALL:Q93JH8 (EMBL:AL939111) (465 aa) fasta scores: E(): 6.7e-32, 32.52% id in 452 aa, and to Rhodococcus corallinus s-triazine hydrolase TrzA SWALL:TRZA_RHOCO (SWALL:Q52725) (476 aa) fasta scores: E(): 2e-17, 27.97% id in 454 aa
YP_112051.1	Similar to Caulobacter crescentus glutathione S-transferase Cc2647 SWALL:Q9A522 (EMBL:AE005932) (215 aa) fasta scores: E(): 6.4e-51, 57.94% id in 214 aa, and to Zea mays glutathione S-transferase III Gst3 SWALL:GTH3_MAIZE (SWALL:P04907) (221 aa) fasta scores: E(): 8e-11, 29.66% id in 209 aa
YP_112052.1	Similar to Rhizobium hedysari  transposase SWALL:O30982 (EMBL:AF023675) (250 aa) fasta scores: E(): 7.8e-32, 44.29% id in 228 aa, and to Pantoea agglomerans IS1327 containing a transposase TnpA SWALL:P94785 (EMBL:X87144) (234 aa) fasta scores: E(): 5e-22, 32.89% id in 228 aa
YP_112053.1	Similar to Ralstonia solanacearum  transposase Rsc3179 or Rs06078 SWALL:Q8XUK9 (EMBL:AL646074) (363 aa) fasta scores: E(): 5.9e-48, 41.71% id in 338 aa
YP_112054.1	Similar to Ralstonia solanacearum probable activation/secretion signal peptide protein Rsp0550 or Rs06123 SWALL:Q8XSC8 (EMBL:AL646079) (590 aa) fasta scores: E(): 9.6e-145, 62.7% id in 563 aa, and to Proteus mirabilis hemolysin activator protein precursor HpmB SWALL:HLYB_PROMI (SWALL:P16465) (561 aa) fasta scores: E(): 9.1e-28, 28.64% id in 412 aa, and to Serratia marcescens hemolysin activator protein precursor ShlB SWALL:HLYB_SERMA (SWALL:P15321) (557 aa) fasta scores: E(): 1.6e-25, 26.07% id in 510 aa. Possible alternative translational start sites
YP_112055.1	Similar to Ralstonia solanacearum probable hemagglutinin-related protein Rsc1775 or Rs04371 SWALL:Q8XYI3 (EMBL:AL646066) (3165 aa) fasta scores: E(): 3.8e-164, 33.54% id in 3258 aa, and to Yersinia pestis adhesin Ypo0599 or y3579 SWALL:Q8ZIA8 (EMBL:AJ414143) (3295 aa) fasta scores: E(): 3.1e-62, 30.38% id in 3383 aa
YP_112056.1	similar to Rhs-family proteins eg. Yersinia pestis hypothetical protein Ypo0762 SWALL:Q8ZHW7 (EMBL:AJ414144) (1438 aa) fasta scores: E(): 9e-190, 43.08% id in 1460 aa, and to Escherichia coli RhsB protein precursor or b3482 SWALL:RHSB_ECOLI (SWALL:P16917) (1411 aa) fasta scores: E(): 3.1e-34, 27.48% id in 1317 aa. Possibly membrane associated.
YP_112057.1	Similar to Yersinia pestis hypothetical protein Ypo0763 SWALL:Q8ZHW6 (EMBL:AJ414144) (439 aa) fasta scores: E(): 1.6e-69, 43.99% id in 416 aa
YP_112058.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa0095 SWALL:Q9I737 (EMBL:AE004448) (741 aa) fasta scores: E(): 2.4e-105, 41.24% id in 725 aa, and to Yersinia pestis hypothetical protein Ypo0764 or y3430 SWALL:Q8ZHW5 (EMBL:AJ414144) (741 aa) fasta scores: E(): 5.3e-62, 33.28% id in 706 aa
YP_112059.1	Similar to Burkholderia mallei transposase Tnp SWALL:Q9FDC1 (EMBL:AF285635) (386 aa) fasta scores: E(): 3.7e-163, 99.48% id in 386 aa, and to Bordetella parapertussis transposase for insertion sequence element IS1001 TnpA SWALL:TNPA_BORPA (SWALL:Q06126) (406 aa) fasta scores: E(): 2e-138, 78.32% id in 406 aa
YP_112060.1	May be truncated due to insertion of downstream IS element. Similar to the N-terminal portion of many transporters eg. Ralstonia solanacearum  glutamate symport transmembrane protein rsc1957 or rs03531 SWALL:Q8XY06 (EMBL:AL646067) (428 aa) fasta scores: E(): 1.5e-23, 50.75% id in 132 aa, and to Escherichia coli proton glutamate symport protein gltp or b4077 SWALL:GLTP_ECOLI (SWALL:P21345) (437 aa) fasta scores: E(): 2.4e-09, 36.6% id in 112 aa
YP_112061.1	Similar to many eg. Ralstonia solanacearum hypothetical protein Rsp1515 or Rs04792 SWALL:Q8XPX1 (EMBL:AL646085) (130 aa) fasta scores: E(): 6.7e-26, 61.98% id in 121 aa
YP_112062.1	Similar to Wolinella succinogenes L-asparaginase AnsA SWALL:ASPG_WOLSU (SWALL:P50286) (330 aa) fasta scores: E(): 1.2e-51, 48.32% id in 329 aa, and to Escherichia coli L-asparaginase II precursor AnsB or b2957 SWALL:ASG2_ECOLI (SWALL:P00805) (348 aa) fasta scores: E(): 1.5e-46, 47.23% id in 326 aa
YP_112063.1	Similar to Ralstonia solanacearum hypothetical protein Rsp1517 or Rs04794 SWALL:Q8XPW9 (EMBL:AL646085) (214 aa) fasta scores: E(): 1.5e-34, 53.17% id in 205 aa
YP_112064.1	Similar to Streptomyces coelicolor acetyltransferase SCO3363 or SCE94.14 SWALL:Q9X8M0 (EMBL:AL939116) (147 aa) fasta scores: E(): 1.6e-08, 38.73% id in 142 aa, and to the C-terminal region of Xanthomonas campestris acetyltransferase xcc4205 SWALL:Q8P373 (EMBL:AE012547) (203 aa) fasta scores: E(): 1.1e-05, 34.59% id in 159 aa
YP_112065.1	No significant database matches to the full length CDS. C-terminus is similar to the C-terminal regions of Pseudomonas alcaligenes hypothetical protein SWALL:Q9F127 (EMBL:AF173167) (282 aa) fasta scores: E(): 2e-20, 45% id in 140 aa, and to Pseudomonas syringae hypothetical protein SWALL:Q9L6V8 (EMBL:AF232005) (507 aa) fasta scores: E(): 2.2e-19, 45.92% id in 135 aa
YP_112067.1	Similar to Comamonas acidovorans outer membrane porin protein 32 precursor omp32 SWALL:OM32_COMAC (SWALL:P24305) (351 aa) fasta scores: E(): 6.7e-16, 28.64% id in 370 aa, and to Ralstonia solanacearum  porin signal peptide protein rsc2760 or rs00094 SWALL:Q8XVR9 (EMBL:AL646071) (353 aa) fasta scores: E(): 5.9e-46, 42.12% id in 349 aa. Similar to BPSL1029, 65.565% identity (66.854% ungapped) in 363 aa overlap
YP_112068.1	Similar to Vibrio harveyi fatty aldehyde dehydrogenase AldH SWALL:DHAF_VIBHA (SWALL:Q56694) (510 aa) fasta scores: E(): 9.7e-58, 40.3% id in 464 aa, and to Streptomyces coelicolor  aldehyde dehydrogenase SCO1871 or SCi39.18c SWALL:Q93RV5 (EMBL:AL939110) (509 aa) fasta scores: E(): 1.8e-61, 43.81% id in 477 aa
YP_112069.1	Similar to Yersinia pestis hypothetical protein ypo1289 SWALL:Q8ZGK2 (EMBL:AJ414147) (380 aa) fasta scores: E(): 3.3e-79, 55.95% id in 386 aa, and to Rhizobium loti hypothetical protein mll7369 SWALL:Q986G4 (EMBL:AP003011) (385 aa) fasta scores: E(): 2.2e-77, 54.92% id in 386 aa
YP_112070.1	Similar to Rhizobium meliloti hypothetical protein ra0037 or sma0077 SWALL:Q931A7 (EMBL:AE007198) (295 aa) fasta scores: E(): 1.8e-46, 44.33% id in 291 aa, and to Rhizobium loti hypothetical protein mll7370 SWALL:Q986G3 (EMBL:AP003011) (299 aa) fasta scores: E(): 3.6e-39, 40.97% id in 288 aa
YP_112071.1	Similar to Escherichia coli gluconate 5-dehydrogenase IdnO SWALL:IDNO_ECOLI (SWALL:P39345) (254 aa) fasta scores: E(): 3.4e-18, 30.46% id in 256 aa, and to Rhizobium loti probable oxidoreductase mll7371 SWALL:Q986G2 (EMBL:AP003011) (252 aa) fasta scores: E(): 6.2e-52, 58.96% id in 251 aa
YP_112072.1	Similar to Rhizobium loti ABC transporter ATP-binding protein mll7373 SWALL:Q986G1 (EMBL:AP003011) (243 aa) fasta scores: E(): 6.7e-53, 65.56% id in 241 aa, and to the C-terminal region of Escherichia coli ribose transport ATP-binding protein RbsA SWALL:RBSA_ECOLI (SWALL:P04983) (501 aa) fasta scores: E(): 1.8e-27, 41.07% id in 241 aa. CDS is extended at the N-terminus in comparison to orthologues
YP_112073.1	Similar to Escherichia coli ribose transport system permease RbsC SWALL:RBSC_ECOLI (SWALL:P04984) (321 aa) fasta scores: E(): 2.7e-21, 29.39% id in 296 aa, and to Rhizobium meliloti  ABC transporter permease ra0034 or sma0070 SWALL:Q931B0 (EMBL:AE007198) (327 aa) fasta scores: E(): 1.1e-72, 63.07% id in 325 aa
YP_112074.1	Similar to Escherichia coli D-allose-binding periplasmic protein precursor AlsB SWALL:ALSB_ECOLI (SWALL:P39265) (311 aa) fasta scores: E(): 2.2e-05, 23.74% id in 278 aa, and to Rhizobium loti hypothetical protein mll7376 SWALL:Q986F9 (EMBL:AP003011) (325 aa) fasta scores: E(): 1.2e-74, 59.94% id in 332 aa
YP_112075.1	Similar to Rhizobium loti hypothetical protein mll7377 SWALL:Q986F8 (EMBL:AP003011) (400 aa) fasta scores: E(): 4.6e-115, 71.17% id in 399 aa. Weakly similar to Escherichia coli starvation sensing protein RspA SWALL:RSPA_ECOLI (SWALL:P38104) (404 aa) fasta scores: E(): 1.6e-18, 24.68% id in 393 aa
YP_112076.1	Similar to Agrobacterium tumefaciens GntR family transcriptional regulator ATU0271 or AGR_C_464 SWALL:Q8UIM2 (EMBL:AE008999) (235 aa) fasta scores: E(): 5.4e-31, 43.36% id in 226 aa, and to Rhizobium loti transcriptional regulator mll7378 SWALL:Q986F7 (EMBL:AP003011) (224 aa) fasta scores: E(): 1e-29, 44.59% id in 222 aa
YP_112077.1	Similar to Oryctolagus cuniculus senescence marker protein-30 RGM or SMP30 SWALL:SM30_RABIT (SWALL:Q9TTJ6) (299 aa) fasta scores: E(): 2.7e-21, 29.73% id in 296 aa, and to Rhizobium loti regucalcin homolog mlr7379 SWALL:Q986F6 (EMBL:AP003011) (301 aa) fasta scores: E(): 1.7e-37, 40.83% id in 289 aa
YP_112078.1	Similar to Pseudomonas putida hypothetical protein SWALL:Q9R9V2 (EMBL:AJ245436) (192 aa) fasta scores: E(): 4.8e-23, 41.43% id in 181 aa, and to Rhizobium sp. hypothetical protein Y4hQ SWALL:Y4HQ_RHISN (SWALL:P50361) (194 aa) fasta scores: E(): 1.3e-17, 35.23% id in 193 aa. Possible alternative translational start site
YP_112079.1	Similar to Escherichia coli hypothetical protein Hp4 SWALL:O88118 (EMBL:AF081284) (115 aa) fasta scores: E(): 3.5e-32, 69.56% id in 115 aa, and to Shigella flexneri 2a hypothetical protein SWALL:Q93F14 (EMBL:AF326777) (115 aa) fasta scores: E(): 1.5e-31, 67.82% id in 115 aa
YP_112080.1	Similar to Escherichia coli hypothetical protein L0013 SWALL:O85620 (EMBL:AF071034) (133 aa) fasta scores: E(): 1.8e-10, 36.76% id in 136 aa, and to Shigella flexneri 2a hypothetical protein SWALL:Q93F13 (EMBL:AF326777) (133 aa) fasta scores: E(): 3.2e-10, 36.76% id in 136 aa
YP_112082.1	Similar to Escherichia coli alpha-galactosidase RafA SWALL:RAFA_ECOLI (SWALL:P16551) (708 aa) fasta scores: E(): 2.3e-105, 39.97% id in 718 aa, and to Yersinia pestis alpha-galactosidase ypo1581 SWALL:Q8ZFU7 (EMBL:AJ414149) (708 aa) fasta scores: E(): 3.6e-108, 40.16% id in 712 aa
YP_112083.1	Similar to Rhizobium meliloti  ABC transporter permease ra1243 or sma2309 SWALL:Q92XK1 (EMBL:AE007309) (273 aa) fasta scores: E(): 1.1e-63, 56.08% id in 271 aa, and to Thermus sp. T2 permease SWALL:O54314 (EMBL:Z93773) (274 aa) fasta scores: E(): 1.6e-44, 45.34% id in 258 aa
YP_112084.1	Similar to Rhizobium meliloti  ABC transporter permease ra1242 or sma2307 SWALL:Q92XK2 (EMBL:AE007309) (307 aa) fasta scores: E(): 3.5e-53, 51.08% id in 276 aa, and to Listeria monocytogenes, and Listeria innocua hypothetical protein lmo0179 or lin0218 SWALL:Q92F88 (EMBL:AL591973) (292 aa) fasta scores: E(): 1.4e-31, 34.83% id in 267 aa. CDS is extended at the N-terminus in comparison to orthologues
YP_112085.1	Similar to Bradyrhizobium japonicum Blr3389 protein blr3389 SWALL:BAC48654 (EMBL:AP005947) (420 aa) fasta scores: E(): 1.3e-19, 25.18% id in 417 aa. N-terminus is weakly similar to the N-terminal region of Streptococcus mutans multiple sugar-binding protein precursor MsmE SWALL:MSME_STRMU (SWALL:Q00749) (420 aa) fasta scores: E(): 1.3e-11, 24.66% id in 373 aa
YP_112086.1	No significant database matches to the full length CDS. C-terminal region is similar to Escherichia coli maltose/maltodextrin transport ATP-binding protein MalK SWALL:MALK_ECOLI (SWALL:P02914) (371 aa) fasta scores: E(): 3.4e-59, 50.8% id in 374 aa, and to Vibrio cholerae maltose/maltodextrin ABC transporter ATP-binding protein vca0946 SWALL:Q9KL04 (EMBL:AE004421) (373 aa) fasta scores: E(): 1.6e-62, 51.75% id in 371 aa. CDS is extended at the C-terminus in comparison to orthologues. Similar to BPSL0833, 51.482% identity (52.909% ungapped) in 371 aa overlap
YP_112088.1	Similar to Escherichia coli and Shigella flexneri transcriptional repressor CytR SWALL:CYTR_ECOLI (SWALL:P06964) (341 aa) fasta scores: E(): 1.1e-26, 31.95% id in 338 aa, and to Thermoanaerobacter tengcongensis transcriptional regulator tte2576 SWALL:Q8R748 (EMBL:AE013198) (341 aa) fasta scores: E(): 2.8e-33, 36.17% id in 340 aa
YP_112090.1	Poor database matches. Similar to an internal region of Ralstonia solanacearum  transposase rsc3179 or rs06078 SWALL:Q8XUK9 (EMBL:AL646074) (363 aa) fasta scores: E(): 1.8e-12, 37.64% id in 170 aa. Possible gene remnant. Similar to an internal region of PSS2051, 61.611% identity (75.581% ungapped) in 211 aa overlap
YP_112091.1	Possible gene remnant. No significant database matches. N-terminus is similar to the N-terminal regions of Yersinia pestis hypothetical protein ypo0762 SWALL:Q8ZHW7 (EMBL:AJ414144) (1438 aa) fasta scores: E(): 3.5e-18, 34.19% id in 193 aa, and Escherichia coli RhsD protein precursor b0497 SWALL:RHSD_ECOLI (SWALL:P16919) (1426 aa) fasta scores: E(): 2.4e-11, 33.15% id in 184 aa. N-terminal region is similar to an internal region of BPSS2054, 62.366% identity (62.366% ungapped) in 186 aa overlap
YP_112092.1	Similar to Pseudomonas aeruginosa hypothetical protein pa0095 SWALL:Q9I737 (EMBL:AE004448) (741 aa) fasta scores: E(): 9.6e-108, 42.52% id in 722 aa, and to Rhizobium loti hypothetical protein mll2357 SWALL:Q98IK7 (EMBL:AP002999) (775 aa) fasta scores: E(): 6.8e-92, 39.68% id in 751 aa. Similar to BPSS2056, 80.245% identity (80.245% ungapped) in 734 aa overlap
YP_112093.1	Similar to Escherichia coli ATPase subunit of an intracellular ATP-dependent protease ClpB or HtpM SWALL:CLPB_ECOLI (SWALL:P03815) (857 aa) fasta scores: E(): 1.1e-92, 38.66% id in 869 aa, and to Yersinia pestis Clp ATPase ypo2946 SWALL:Q8ZCN5 (EMBL:AJ414154) (891 aa) fasta scores: E(): 5.8e-161, 56.37% id in 855 aa. Similar to BPSL3101, 53.114% identity (53.539% ungapped) in 883 aa overlap, and to BPSS0174, 55.792% identity (60.624% ungapped) in 941 aa overlap, and to BPSS0116, 57.931% identity (58.810% ungapped) in 870 aa overlap
YP_112094.1	Similar to Xanthomonas axonopodis hypothetical protein xac4141 SWALL:AAM38976 (EMBL:AE012064) (346 aa) fasta scores: E(): 2.7e-18, 38.75% id in 400 aa, and to Pseudomonas aeruginosa hypothetical protein pa0089 SWALL:Q9I743 (EMBL:AE004447) (348 aa) fasta scores: E(): 6.4e-17, 41.93% id in 372 aa. Possible alternative translational start site
YP_112095.1	Similar to Pseudomonas aeruginosa hypothetical protein pa0088 SWALL:Q9I744 (EMBL:AE004447) (619 aa) fasta scores: E(): 4.4e-110, 47.77% id in 628 aa, and to Xanthomonas axonopodis hypothetical protein xac4142 SWALL:AAM38977 (EMBL:AE012064) (627 aa) fasta scores: E(): 9.1e-109, 46.74% id in 629 aa
YP_112096.1	Similar to Xanthomonas axonopodis hypothetical protein xac4143 SWALL:AAM38978 (EMBL:AE012064) (167 aa) fasta scores: E(): 4.3e-18, 40.96% id in 166 aa, and to Pseudomonas aeruginosa hypothetical protein pa0087 SWALL:Q9I745 (EMBL:AE004447) (169 aa) fasta scores: E(): 7.9e-18, 44.93% id in 158 aa
YP_112097.1	Similar to Pseudomonas aeruginosa hypothetical protein pa0085 SWALL:Q9I747 (EMBL:AE004447) (162 aa) fasta scores: E(): 5.4e-19, 40.24% id in 164 aa, and to Bradyrhizobium japonicum hypothetical protein bll3592 SWALL:BAC48857 (EMBL:AP005948) (161 aa) fasta scores: E(): 1.5e-18, 40.12% id in 162 aa
YP_112098.1	Similar to Pseudomonas aeruginosa hypothetical protein pa0084 SWALL:Q9I748 (EMBL:AE004447) (498 aa) fasta scores: E(): 3.9e-153, 72.83% id in 497 aa, and to Yersinia pestis hypothetical protein ypo2938 SWALL:Q8ZCP0 (EMBL:AJ414154) (500 aa) fasta scores: E(): 7e-153, 72.52% id in 495 aa. Similar to BPSS0098, 73.642% identity (73.790% ungapped) in 497 aa overlap, and to BPSS0172, 72.233% identity (72.672% ungapped) in 497 aa overlap, and to BPSS0517, 61.290% identity (61.414% ungapped) in 496 aa overlap
YP_112099.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa0083 SWALL:Q9I749 (EMBL:AE004447) (172 aa) fasta scores: E(): 2.7e-40, 68.82% id in 170 aa, and to Xanthomonas axonopodis hypothetical protein Xac4147 SWALL:AAM38982 (EMBL:AE012065) (169 aa) fasta scores: E(): 2e-38, 69.64% id in 168 aa, and to Salmonella typhi hypothetical protein Sty0297 SWALL:Q8Z970 (EMBL:AL627266) (180 aa) fasta scores: E(): 8.8e-38, 65.66% id in 166 aa. Similar to BPSS0097, 69.643% identity (70.482% ungapped) in 168 aa overlap, and to BPSS0173, 65.934% identity (65.934% ungapped) in 182 aa overlap
YP_112100.1	Similar to Xanthomonas axonopodis hypothetical protein Xac4112 SWALL:AAM38947 (EMBL:AE012060) (347 aa) fasta scores: E(): 5.7e-23, 38.96% id in 367 aa, and to Pseudomonas aeruginosa hypothetical protein Pa0082 SWALL:Q9I750 (EMBL:AE004447) (344 aa) fasta scores: E(): 3.8e-18, 35.79% id in 366 aa, and to Salmonella typhimurium, and Salmonella enterica subsp. enterica serovar Typhimurium  cytoplasmic protein stm0266 or sciA SWALL:Q93IT5 (EMBL:AE008707) (351 aa) fasta scores: E(): 1.4e-13, 31.94% id in 360 aa
YP_112101.1	No significant database matches to the full length CDS. N-terminus is similar to the N-terminal region of Deinococcus radiodurans  protein kinase dra0332 SWALL:Q9RYI0 (EMBL:AE001863) (524 aa) fasta scores: E(): 5.9e-16, 34.49% id in 403 aa. Internal region is weakly similar to an internal region of Streptomyces coelicolor multi-domain regulatory protein SCO2259 or SCC75A.05C SWALL:Q9RKR9 (EMBL:AL939112) (1334 aa) fasta scores: E(): 1.2e-07, 28.92% id in 491 aa
YP_112102.1	Similar to N-terminus of Pseudomonas aeruginosa hypothetical protein Pa0076 SWALL:Q9I756 (EMBL:AE004446) (226 aa) fasta scores: E(): 1.6e-05, 36.17% id in 141 aa, and to N-terminus of Rhizobium leguminosarum ImpM SWALL:Q93EC1 (EMBL:AF361470) (457 aa) fasta scores: E(): 2.4e-05, 28.98% id in 207 aa
YP_112103.1	Similar to Vibrio cholerae IcmF-related protein vca0120 or IcmF SWALL:Q9KN45 (EMBL:AE004353) (1181 aa) fasta scores: E(): 6.1e-46, 26.92% id in 1237 aa, and to Rhizobium loti hypothetical protein Mlr2360 SWALL:Q98IK4 (EMBL:AP002999) (1176 aa) fasta scores: E(): 3e-103, 33.08% id in 1209 aa, and to Xanthomonas axonopodis hypothetical protein Xac4119 SWALL:AAM38954 (EMBL:AE012061) (1176 aa) fasta scores: E(): 2.2e-77, 34.27% id in 1205 aa
YP_112104.1	Similar to Rhizobium leguminosarum ImpK SWALL:Q93EC3 (EMBL:AF361470) (510 aa) fasta scores: E(): 5.2e-19, 33.03% id in 451 aa, and to Pseudomonas aeruginosa hypothetical protein Pa0078 SWALL:Q9I754 (EMBL:AE004447) (449 aa) fasta scores: E(): 5.4e-63, 47.12% id in 452 aa, and to Xanthomonas axonopodis hypothetical protein Xac4120 SWALL:Q8PF65 (EMBL:AE012061) (451 aa) fasta scores: E(): 1.2e-45, 40.29% id in 412 aa
YP_112105.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa0079 SWALL:Q9I753 (EMBL:AE004447) (444 aa) fasta scores: E(): 1.8e-58, 49.88% id in 451 aa, and to Yersinia pestis hypothetical protein ypo2934 or y1549 SWALL:Q8ZCP3 (EMBL:AJ414154) (449 aa) fasta scores: E(): 1.2e-54, 37% id in 454 aa, and to Xanthomonas axonopodis hypothetical protein Xac4121 SWALL:AAM38956 (EMBL:AE012061) (444 aa) fasta scores: E(): 1e-53, 46.44% id in 450 aa
YP_112106.1	Similar to Salmonella typhimurium  outer membrane lipoprotein stm0280 SWALL:Q8ZRL4 (EMBL:AE008707) (178 aa) fasta scores: E(): 2.5e-15, 37.95% id in 166 aa, and to Salmonella enterica subsp. enterica serovar Typhimurium SciN protein precursor SWALL:Q93IS2 (EMBL:AJ320483) (163 aa) fasta scores: E(): 3.1e-15, 38.96% id in 154 aa, and to Salmonella typhi probable lipoprotein sty0303 SWALL:Q8Z967 (EMBL:AL627266) (178 aa) fasta scores: E(): 3.4e-15, 40.37% id in 161 aa
YP_112107.1	Similar to Bordetella parapertussis  lipoprotein SWALL:Q7W1G3 (EMBL:BX640425) (131 aa) fasta scores: E(): 6.1e-11, 41.07% id in 112 aa, and to Bordetella bronchiseptica  lipoprotein SWALL:Q7WP73 (EMBL:BX640439) (131 aa) fasta scores: E(): 6.1e-11, 41.07% id in 112 aa
YP_112108.1	Similar to Pseudomonas aeruginosa hypothetical protein Pa0081 SWALL:Q9I751 (EMBL:AE004447) (497 aa) fasta scores: E(): 3e-14, 28.71% id in 491 aa, and to Rhizobium loti hypothetical protein Mlr2345 SWALL:Q98IL9 (EMBL:AP002999) (486 aa) fasta scores: E(): 5.3e-11, 27.13% id in 468 aa, and to Xanthomonas axonopodis hypothetical protein Xac4122 SWALL:AAM38957 (EMBL:AE012061) (438 aa) fasta scores: E(): 8.7e-11, 25.54% id in 462 aa
YP_112109.1	Similar to Xylella fastidiosa hypothetical protein Xf1451 SWALL:Q9PDC8 (EMBL:AE003975) (636 aa) fasta scores: E(): 1.5e-39, 28.15% id in 618 aa, and to Xanthomonas axonopodis hypothetical protein Xac2007 SWALL:AAM36869 (EMBL:AE011836) (642 aa) fasta scores: E(): 4.2e-38, 27.45% id in 641 aa, and to Xanthomonas campestris hypothetical protein Xcc1973 SWALL:AAM41262 (EMBL:AE012301) (642 aa) fasta scores: E(): 1.5e-36, 27.07% id in 628 aa
YP_112110.1	Similar to Bradyrhizobium japonicum USDA 110 BLL2502 protein SWALL:Q89SA3 (EMBL:AP005944) (428 aa) fasta scores: E(): 9.2e-53, 42.39% id in 401 aa, and to Rhodopseudomonas palustris possible FAD-dependent monooxygenase SWALL:Q6N3V5 (EMBL:BX572604) (430 aa) fasta scores: E(): 2.6e-44, 37.79% id in 426 aa
YP_112112.1	Similar to Achromobacter xylosoxidans oxidoreductase SWALL:Q8RMC9 (EMBL:AJ431208) (234 aa) fasta scores: E(): 4.1e-44, 54.7% id in 234 aa, and to Bradyrhizobium japonicum oxidoreductase bll5294 SWALL:BAC50559 (EMBL:AP005954) (234 aa) fasta scores: E(): 1.7e-41, 52.56% id in 234 aa, and to Rhizobium meliloti oxidoreductase r01874 or smc00136 SWALL:Q92PA5 (EMBL:AL591788) (234 aa) fasta scores: E(): 3.3e-41, 50.42% id in 234 aa
YP_112113.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 glycine cleavage system transcriptional activator GcvA or b2808 or c3378 or z4125 or ecs3668 SWALL:GCVA_ECOLI (SWALL:P32064) (305 aa) fasta scores: E(): 4.9e-35, 40.94% id in 298 aa, and to Rhizobium loti probable transcriptional regulator mlr1832 SWALL:Q98JQ4 (EMBL:AP002998) (299 aa) fasta scores: E(): 3.6e-54, 54.93% id in 284 aa, and to Rhizobium loti glycine cleavage system transcription activator mlr1973 SWALL:Q98JE9 (EMBL:AP002998) (303 aa) fasta scores: E(): 2.4e-37, 40.78% id in 304 aa
YP_112114.1	catalyzes the formation of pyruvate from serine
YP_112115.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 glycine cleavage system transcriptional activator GcvA or b2808 or c3378 or z4125 or ecs3668 SWALL:GCVA_ECOLI (SWALL:P32064) (305 aa) fasta scores: E(): 2.1e-26, 35.48% id in 310 aa, and to Caulobacter crescentus transcriptional regulator, LysR family cc1117 SWALL:Q9A977 (EMBL:AE005790) (340 aa) fasta scores: E(): 2.3e-27, 37.01% id in 308 aa
YP_112116.1	Similar to Rhodopseudomonas palustris hypothetical protein SWALL:Q6N615 (EMBL:BX572602) (107 aa) fasta scores: E(): 1.5e-08, 35.05% id in 97 aa, and to Gloeobacter violaceus PCC 7421 GLL2745 protein SWALL:Q7NGZ2 (EMBL:AP006577) (104 aa) fasta scores: E(): 1.3e-07, 38.94% id in 95 aa
YP_112117.1	Similar to Streptomyces peucetius ORF1 and ORF2 SWALL:Q9ZF16 (EMBL:AJ005575) (226 aa) fasta scores: E(): 2.6e-27, 42.08% id in 221 aa, and to Mycobacterium tuberculosis hypothetical 23.8 kDa protein rv1674c or mtv047.09c or mt1712 SWALL:O53921 (EMBL:AL022002) (218 aa) fasta scores: E(): 7e-36, 51.83% id in 218 aa
YP_112118.1	Similar to N-terminus of Methanosarcina acetivorans metallo-beta-lactamase ma1794 SWALL:Q8TPW0 (EMBL:AE010859) (481 aa) fasta scores: E(): 5e-25, 36.75% id in 234 aa, and to entire protein of Sulfolobus solfataricus hypothetical protein sso2072 sso2072 or c06001 SWALL:P95849 (EMBL:Y08256) (247 aa) fasta scores: E(): 3.1e-29, 44.49% id in 236 aa, and to entire protein of Sulfolobus tokodaii hypothetical protein St1629 st1629 SWALL:Q970G3 (EMBL:AP000987) (246 aa) fasta scores: E(): 9.8e-29, 42.41% id in 224 aa
YP_112119.1	Similar to Streptococcus pneumoniae, and Streptococcus pneumoniae multi-drug resistance efflux pump PmrA or sp0972 or spr0875 SWALL:PMRA_STRPN (SWALL:Q9ZEX9) (399 aa) fasta scores: E(): 9.6e-08, 23.82% id in 382 aa, and to Halobacterium sp. similar to sulfolobus solfactaricus orf c06004 vng6457c or vng6068C SWALL:O54630 (EMBL:AF016485) (421 aa) fasta scores: E(): 6.1e-58, 39.9% id in 401 aa, and to Sulfolobus solfataricus transport protein,  sso2074 SWALL:Q97WP8 (EMBL:AE006814) (366 aa) fasta scores: E(): 2.4e-13, 28.93% id in 394 aa
YP_112120.1	Similar to Escherichia coli, Escherichia coli O6, Escherichia coli O157:H7, and Shigella flexneri cysteine desulfurase IscS or b2530 or c3056 or z3797 or ecs3396 or sf2577 SWALL:ISCS_ECOLI (SWALL:P39171) (404 aa) fasta scores: E(): 1.1e-52, 46.19% id in 368 aa, and to Thermoanaerobacter tengcongensis cysteine sulfinate desulfinase/cysteine desulfurase and related enzymes NifS2 or tte2465 SWALL:Q8R7E9 (EMBL:AE013188) (384 aa) fasta scores: E(): 2.7e-54, 44.94% id in 376 aa, and to Methanosarcina thermophila probable cysteine desulfurase IscS or NifS SWALL:ISCS_METTE (SWALL:P57795) (404 aa) fasta scores: E(): 5.5e-53, 45.3% id in 373 aa
YP_112122.1	Similar to Streptomyces avermitilis  MFS transporter SWALL:Q829Y1 (EMBL:AP005046) (434 aa) fasta scores: E(): 6.7e-58, 42.27% id in 414 aa, and to Pseudomonas aeruginosa probable MFS transporter SWALL:Q9HY31 (EMBL:AE004780) (469 aa) fasta scores: E(): 2e-63, 45.16% id in 434 aa
YP_112123.1	Similar to Escherichia coli, Escherichia coli O6, and Escherichia coli O157:H7 glycine cleavage system transcriptional activator GcvA or b2808 or c3378 or z4125 or ecs3668 SWALL:GCVA_ECOLI (SWALL:P32064) (305 aa) fasta scores: E(): 1.1e-20, 33.11% id in 305 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa2383 SWALL:Q9I196 (EMBL:AE004664) (306 aa) fasta scores: E(): 7e-54, 53.46% id in 303 aa, and to Ralstonia solanacearum probable transcription regulator protein rsc2665 or rs04540 SWALL:Q8XW10 (EMBL:AL646071) (296 aa) fasta scores: E(): 2.2e-32, 43.53% id in 294 aa
YP_112124.1	Similar to Neisseria meningitidis L-lactate dehydrogenase LldA or nma1592 SWALL:Q9JTX1 (EMBL:AL162756) (390 aa) fasta scores: E(): 8.4e-92, 61.93% id in 373 aa, and to Pseudomonas aeruginosa L-lactate dehydrogenase LldA or pa2382 SWALL:Q9I197 (EMBL:AE004664) (383 aa) fasta scores: E(): 1.4e-103, 72.41% id in 377 aa, and to Agrobacterium tumefaciens L-lactate dehydrogenase LldA or atu2318 or agr_c_4216 SWALL:Q8UD10 (EMBL:AE009181) (382 aa) fasta scores: E(): 3.7e-94, 64.17% id in 374 aa
YP_112125.1	Similar to Burkholderia cepacia 2,4-dinitrotoluene oxygenase DntG SWALL:Q8VUC7 (EMBL:AF169302) (281 aa) fasta scores: E(): 1e-27, 37.5% id in 272 aa, and to Yersinia pestis  hydrolase ypo1566 or y2599 SWALL:Q8ZFW1 (EMBL:AJ414149) (280 aa) fasta scores: E(): 5.5e-79, 69.42% id in 278 aa, and to Brucella melitensis 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase / 5-carboxymethyl-2-oxo-hex-3-ene-1,7-dioate decarboxylase bmei1708 SWALL:Q8YF19 (EMBL:AE009604) (301 aa) fasta scores: E(): 1.5e-72, 63.92% id in 280 aa
YP_112126.1	Similar to Escherichia coli transcriptional regulator KdgR or b1827 SWALL:KDGR_ECOLI (SWALL:P76268) (263 aa) fasta scores: E(): 1.3e-08, 26.86% id in 242 aa, and to Rhizobium meliloti  transcriptional regulator protein rb0681 or smb21102 SWALL:Q92VL9 (EMBL:AL603644) (260 aa) fasta scores: E(): 1.2e-41, 49.6% id in 256 aa. CDS is extended at the N-terminus in comparison to similar proteins
YP_112127.1	catalyzes the formation of indole-3-acetic acid from indole-3-acetamide
YP_112129.1	Similar to Pyrococcus furiosus acetyl-CoA synthetase AcdA or pf1540 SWALL:Q9Y8L1 (EMBL:AJ240061) (462 aa) fasta scores: E(): 3.9e-24, 30.9% id in 453 aa, and to Rhizobium loti hypothetical protein Mlr6591 SWALL:Q988U3 (EMBL:AP003009) (893 aa) fasta scores: E(): 1.3e-34, 33.88% id in 903 aa, and to Rhizobium meliloti hypothetical protein ra0619 or sma1146 SWALL:Q92Z73 (EMBL:AE007251) (899 aa) fasta scores: E(): 1.4e-32, 31.22% id in 903 aa
YP_112130.1	Similar to Ralstonia solanacearum  HNS-like transcription regulator protein rsp0335 or rs00711 SWALL:Q8XSY2 (EMBL:AL646078) (96 aa) fasta scores: E(): 1.6e-13, 50.51% id in 97 aa
YP_112132.1	Similar to Chromobacterium violaceum hypothetical protein CV3234 SWALL:Q7NT30 (EMBL:AE016921) (179 aa) fasta scores: E(): 6.4e-22, 43.94% id in 157 aa
YP_112133.1	Similar to Burkholderia sp. RP007 transcriptional regulator PhnR SWALL:Q9ZHH9 (EMBL:AF061751) (562 aa) fasta scores: E(): 5e-35, 40.37% id in 374 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa2005 SWALL:Q9I2A4 (EMBL:AE004627) (481 aa) fasta scores: E(): 2.6e-81, 58.6% id in 488 aa, and to Bacillus halodurans transcriptional regulator bh3899 SWALL:Q9K633 (EMBL:AP001520) (559 aa) fasta scores: E(): 1.7e-41, 35.3% id in 473 aa
YP_112134.1	Similar to Ralstonia solanacearum hypothetical transmembrane protein RS01064 SWALL:Q8XWF6 (EMBL:AL646070) (466 aa) fasta scores: E(): 5.3e-124, 73.19% id in 470 aa, and to Pseudomonas putida membrane protein,  SWALL:Q88IC5 (EMBL:AE016785) (463 aa) fasta scores: E(): 2.2e-122, 71.52% id in 467 aa
YP_112136.1	Similar to Xanthomonas axonopodis hypothetical protein Xac1749 SWALL:AAM36615 (EMBL:AE011807) (330 aa) fasta scores: E(): 3e-61, 54.25% id in 317 aa, and to Xanthomonas campestris hypothetical protein Xcc1731 SWALL:AAM41024 (EMBL:AE012274) (330 aa) fasta scores: E(): 4.6e-61, 52.87% id in 331 aa, and to Ralstonia solanacearum probable transmembrane protein rsp0396 or rs00824 SWALL:Q8XSS1 (EMBL:AL646078) (326 aa) fasta scores: E(): 2.4e-39, 38.9% id in 329 aa
YP_112137.1	Similar to Pseudomonas aeruginosa porin D precursor OprD or pa0958 SWALL:PORD_PSEAE (SWALL:P32722) (443 aa) fasta scores: E(): 2.2e-32, 35.58% id in 444 aa, and to Pseudomonas aeruginosa probable porin pa4501 SWALL:Q9HVS0 (EMBL:AE004864) (484 aa) fasta scores: E(): 2.8e-43, 33.66% id in 505 aa
YP_112138.1	Similar to Salmonella typhimurium oligopeptide transport ATP-binding protein OppF or stm1742 SWALL:OPPF_SALTY (SWALL:P08007) (334 aa) fasta scores: E(): 1e-57, 58.07% id in 322 aa, and to Yersinia pestis oligopeptide transport ATP-binding protein OppF or ypo2186 or y2030 SWALL:Q8ZEI4 (EMBL:AJ414151) (333 aa) fasta scores: E(): 1.1e-58, 59.31% id in 322 aa. CDS is extended at the N-terminus in comparison to orthologues
YP_112139.1	Similar to Salmonella typhimurium oligopeptide transport ATP-binding protein OppD or stm1743 SWALL:OPPD_SALTY (SWALL:P04285) (335 aa) fasta scores: E(): 1.3e-59, 57.45% id in 322 aa, and to Yersinia pestis oligopeptide transport ATP-binding protein OppD or ypo2185 or y2029 SWALL:Q8ZEI5 (EMBL:AJ414151) (333 aa) fasta scores: E(): 2.8e-61, 59% id in 322 aa, and to Salmonella typhi oligopeptide transport ATP-binding protein OppD sty1308 SWALL:Q8Z7E8 (EMBL:AL627269) (335 aa) fasta scores: E(): 8.8e-60, 57.76% id in 322 aa
YP_112140.1	Similar to Salmonella typhimurium oligopeptide transport system permease OppC or stm1744 SWALL:OPPC_SALTY (SWALL:P08006) (302 aa) fasta scores: E(): 1e-56, 54.74% id in 274 aa, and to Vibrio cholerae oligopeptide ABC transporter permease vc1093 SWALL:Q9KT12 (EMBL:AE004190) (300 aa) fasta scores: E(): 2.2e-57, 54.24% id in 271 aa, and to Haemophilus influenzae oligopeptide transport system permease OppC or hi1122 SWALL:OPPC_HAEIN (SWALL:P45053) (311 aa) fasta scores: E(): 7e-57, 54.01% id in 274 aa
YP_112141.1	Similar to Salmonella typhimurium oligopeptide transport system permease OppB or stm1745 SWALL:OPPB_SALTY (SWALL:P08005) (306 aa) fasta scores: E(): 1e-59, 48.71% id in 312 aa, and to Yersinia pestis oligopeptide transport system permease OppB or ypo2183 or y2027 SWALL:Q8ZEI7 (EMBL:AJ414151) (306 aa) fasta scores: E(): 2.1e-61, 51.6% id in 312 aa, and to Haemophilus influenzae oligopeptide transport system permease OppB or hi1123 SWALL:OPPB_HAEIN (SWALL:P45054) (306 aa) fasta scores: E(): 8.8e-61, 51.92% id in 312 aa
YP_112142.1	Similar to Salmonella typhimurium periplasmic oligopeptide-binding protein precursor OppA or stm1746 SWALL:OPPA_SALTY (SWALL:P06202) (543 aa) fasta scores: E(): 1e-86, 42.93% id in 545 aa, and to Escherichia coli O157:H7 oligopeptide transport, periplasmic binding protein OppA or z2019 or ecs1743 SWALL:Q8XDA4 (EMBL:AE005341) (543 aa) fasta scores: E(): 6.6e-87, 42.75% id in 545 aa
YP_112143.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa4987 SWALL:Q9HUH8 (EMBL:AE004911) (199 aa) fasta scores: E(): 1.2e-15, 35.71% id in 182 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa4499 SWALL:Q9HVS2 (EMBL:AE004863) (187 aa) fasta scores: E(): 5.9e-15, 32.58% id in 178 aa, and to Fusobacterium nucleatum transcriptional regulator, merr family fn1928 SWALL:Q8RHS0 (EMBL:AE010495) (184 aa) fasta scores: E(): 1.6e-13, 31.52% id in 184 aa
YP_112144.1	Similar to Lactococcus lactis di-/tripeptide transporter DtpT or ll0702 SWALL:DTPT_LACLA (SWALL:P36574) (497 aa) fasta scores: E(): 4e-21, 29.36% id in 453 aa, and to Salmonella typhimurium  pot family, peptide transport protein YdgR or stm1452 SWALL:Q8ZPM6 (EMBL:AE008763) (501 aa) fasta scores: E(): 8.5e-68, 39.66% id in 484 aa. Possible alternative translation start site after codon 18
YP_112146.1	Similar to Streptomyces coelicolor  secreted protein sco6608 or sc1f2.05 SWALL:O86542 (EMBL:AL939128) (552 aa) fasta scores: E(): 1.1e-11, 37.06% id in 580 aa, and to Clostridium acetobutylicum uncharaterized conserved protein, YomE b.subtilis ortholog cac2633 SWALL:Q97FU3 (EMBL:AE007760) (354 aa) fasta scores: E(): 1.3e-07, 28.15% id in 238 aa
YP_112147.1	Similar to Burkholderia cepacia DntR SWALL:Q8VUD7 (EMBL:AF169302) (301 aa) fasta scores: E(): 1.3e-33, 33.33% id in 297 aa, and to Agrobacterium tumefaciens transcriptional regulator, LysR family atu5197 or agr_pat_273 SWALL:Q8UKC6 (EMBL:AE008942) (325 aa) fasta scores: E(): 1.6e-35, 40.61% id in 293 aa, and to Ralstonia sp. U2 LysR-like regular protein NagR SWALL:Q9EXL7 (EMBL:AF036940) (301 aa) fasta scores: E(): 5.3e-34, 33.67% id in 297 aa
YP_112150.1	Similar to Mycobacterium smegmatis hypothetical 50.9 kDa protein SWALL:Q938D1 (EMBL:AY054120) (477 aa) fasta scores: E(): 1.7e-23, 29.83% id in 476 aa, and to Agrobacterium tumefaciens hypothetical protein atu3361 atu3361 or agr_l_2924 SWALL:Q8UAL2 (EMBL:AE009266) (448 aa) fasta scores: E(): 1.8e-21, 32.57% id in 442 aa, and to Methanobacterium thermoautotrophicum conserved protein mth965 SWALL:O27046 (EMBL:AE000870) (452 aa) fasta scores: E(): 3.2e-21, 32.25% id in 400 aa
YP_112151.1	Similar to Rhodococcus erythropolis citrate lyase SWALL:Q8VQP0 (EMBL:AF453714) (291 aa) fasta scores: E(): 4.1e-21, 33.92% id in 283 aa, and to Streptomyces coelicolor  citrate lyase beta chain sco2033 or sc4g6.02 SWALL:Q9S2U9 (EMBL:AL939111) (274 aa) fasta scores: E(): 4e-36, 46.15% id in 273 aa
YP_112152.1	Similar to Streptomyces coelicolor hypothetical protein sco2032 or sc3a3.10 SWALL:Q9S2Y3 (EMBL:AL939111) (404 aa) fasta scores: E(): 6.1e-99, 63.23% id in 408 aa, and to Caulobacter crescentus hypothetical protein Cc3562 SWALL:Q9A2J9 (EMBL:AE006014) (433 aa) fasta scores: E(): 3.3e-62, 43.46% id in 398 aa. CDS is extended at the N-terminus in comparison to some orthologues
YP_112153.1	Limited similarity to Methylobacterium extorquens alcohol dehydrogenase AdhA SWALL:Q49134 (EMBL:L48340) (432 aa) fasta scores: E(): 0.0066, 21.69% id in 378 aa
YP_112154.1	Similar to Streptomyces coelicolor  hydrolase sco0748 or scf81.07 SWALL:Q9RJE4 (EMBL:AL939106) (193 aa) fasta scores: E(): 3.4e-31, 52.15% id in 186 aa, and to Salmonella typhimurium, and Salmonella typhi isochorismatase YecD or stm1902 or sty2110 SWALL:Q8XEW8 (EMBL:AE008785) (188 aa) fasta scores: E(): 4.9e-25, 47.25% id in 182 aa, and to Bacillus subtilis hypothetical isochorismatase YwoC SWALL:YWOC_BACSU (SWALL:P94573) (189 aa) fasta scores: E(): 4.9e-24, 48.86% id in 176 aa
YP_112155.1	Similar to Streptomyces glaucescens tetracenomycin C resistance and export protein TcmA SWALL:TCMA_STRGA (SWALL:P39886) (538 aa) fasta scores: E(): 1.5e-23, 28.66% id in 450 aa, and to Bacillus subtilis hypothetical protein YwoD SWALL:P94574 (EMBL:Z82987) (452 aa) fasta scores: E(): 4.7e-41, 32.88% id in 447 aa, and to Burkholderia cepacia major facilitator superfamily transporter homolog SWALL:Q9RPH2 (EMBL:AF158699) (531 aa) fasta scores: E(): 1.3e-25, 29.67% id in 455 aa
YP_112156.1	Similar to Bacillus subtilis arabinose-proton symporter AraE SWALL:ARAE_BACSU (SWALL:P96710) (464 aa) fasta scores: E(): 3.7e-14, 23.21% id in 405 aa, and to Xanthomonas campestris MFS transporter xcc1685 SWALL:AAM40979 (EMBL:AE012270) (468 aa) fasta scores: E(): 8.4e-89, 53.72% id in 456 aa, and to Xanthomonas axonopodis MFS transporter xac1705 SWALL:AAM36572 (EMBL:AE011802) (474 aa) fasta scores: E(): 6.4e-87, 52.57% id in 466 aa
YP_112157.1	Similar to Streptomyces coelicolor hypothetical protein sco6307 sco6307 or scif3.09C SWALL:Q93RT4 (EMBL:AL939127) (320 aa) fasta scores: E(): 2.6e-12, 36.18% id in 351 aa
YP_112158.1	Similar to Streptomyces coelicolor hypothetical protein sco2032 or sc3a3.10 SWALL:Q9S2Y3 (EMBL:AL939111) (404 aa) fasta scores: E(): 1.3e-58, 43.32% id in 397 aa, and to Caulobacter crescentus hypothetical protein Cc3562 SWALL:Q9A2J9 (EMBL:AE006014) (433 aa) fasta scores: E(): 4.4e-54, 38.26% id in 426 aa, and to Ralstonia solanacearum hypothetical protein rsc1197 or rs05729 SWALL:Q8Y047 (EMBL:AL646063) (405 aa) fasta scores: E(): 4.9e-50, 40.9% id in 396 aa. Selfmatch to BPSS2151 fasta scores: E():2.2e-59, 45.3% id in 404 aa.
YP_112159.1	Similar to Pseudomonas putida efflux pump regulator SrpS SWALL:Q9R9U0 (EMBL:AF061937) (259 aa) fasta scores: E(): 1.1e-06, 31.81% id in 154 aa, and to Rhodococcus globerulus  regulatory protein hppR SWALL:O05148 (EMBL:U89712) (206 aa) fasta scores: E(): 1e-11, 34.61% id in 182 aa, and to Corynebacterium glutamicum transcriptional regulator cgl1314 SWALL:BAB98707 (EMBL:AP005278) (235 aa) fasta scores: E(): 1.4e-10, 28.64% id in 206 aa
YP_112160.1	Similar to Leuconostoc mesenteroides citrate lyase beta chain CitE SWALL:CILB_LEUMC (SWALL:O53078) (302 aa) fasta scores: E(): 2.9e-19, 30.24% id in 291 aa, and to Rhizobium loti probable similar to beta subunit of citrate lyase msi180 SWALL:CAD31585 (EMBL:AL672113) (304 aa) fasta scores: E(): 3.5e-37, 46.07% id in 280 aa, and to Caulobacter crescentus citrate lyase beta subunit,  cc3659 SWALL:Q9A2A7 (EMBL:AE006024) (295 aa) fasta scores: E(): 8.1e-23, 36.82% id in 296 aa
YP_112161.1	Similar to Burkholderia cepacia major porin protein Opcp1 SWALL:Q45106 (EMBL:D63823) (361 aa) fasta scores: E(): 3.7e-15, 31.59% id in 383 aa, and to Ralstonia solanacearum  outer membrane porin signal peptide protein rsc2855 or rs00250 SWALL:Q8XVH6 (EMBL:AL646072) (389 aa) fasta scores: E(): 7.3e-30, 34.77% id in 394 aa, and to Ralstonia solanacearum  porin signal peptide protein rsc2933 or rs00157 SWALL:Q8XV98 (EMBL:AL646072) (379 aa) fasta scores: E(): 4.4e-21, 32.46% id in 345 aa
YP_112162.1	Similar to Aeropyrum pernix hypothetical protein Ape2147 SWALL:Q9Y9Z2 (EMBL:AP000063) (479 aa) fasta scores: E(): 1.8e-57, 39.46% id in 446 aa, and to Pyrobaculum aerophilum propionate catabolism protein PrpD pae1717 SWALL:Q8ZWM4 (EMBL:AE009835) (453 aa) fasta scores: E(): 2.4e-50, 36.46% id in 447 aa, and to Corynebacterium glutamicum uncharacterized protein involved in propionate catabolism cgl2538 SWALL:BAB99931 (EMBL:AP005282) (457 aa) fasta scores: E(): 3.2e-39, 31.17% id in 433 aa
YP_112163.1	Similar to Bradyrhizobium japonicum Blr1102 protein SWALL:BAC46367 (EMBL:AP005939) (415 aa) fasta scores: E(): 6.4e-18, 28.65% id in 349 aa, and to Rhodobacter sphaeroides quorum sensing OpgC SWALL:Q9FA51 (EMBL:AF016298) (399 aa) fasta scores: E(): 1.1e-16, 29.82% id in 342 aa, and to Rhizobium meliloti hypothetical transmembrane protein smc04381 r03285 or smc04381 SWALL:Q92L11 (EMBL:AL591793) (385 aa) fasta scores: E(): 1.3e-16, 25.38% id in 327 aa
YP_112164.1	Similar to Pseudomonas aeruginosa chloramphenicol-sensitive protein RarD or pa3473 SWALL:RARD_PSEAE (SWALL:O68827) (299 aa) fasta scores: E(): 7.6e-52, 54.79% id in 292 aa, and to Haemophilus influenzae hypothetical protein Hi0680 SWALL:Y680_HAEIN (SWALL:Q57389) (298 aa) fasta scores: E(): 3.4e-31, 39% id in 282 aa, and to Haemophilus influenzae hypothetical protein Hi0223 SWALL:Y223_HAEIN (SWALL:P44579) (300 aa) fasta scores: E(): 2.9e-30, 33.9% id in 292 aa
YP_112165.1	catalyzes the hydrolysis of acylphosphate
YP_112166.1	Similar to Zymomonas mobilis HpnA protein SWALL:O34285 (EMBL:AJ001401) (337 aa) fasta scores: E(): 1.2e-74, 64.41% id in 326 aa, and to Synechocystis sp. dihydroflavonol-4-reductase slr1706 SWALL:DFRA_SYNY3 (SWALL:P73212) (343 aa) fasta scores: E(): 6.6e-42, 43.11% id in 334 aa
YP_112167.1	N-terminus is similar to the C-terminal region of Frankia sp. CpI1 hypothetical protein SWALL:Q9AEZ8 (EMBL:AY027524) (471 aa) fasta scores: E(): 2.7e-16, 42.3% id in 416 aa. CDS contains alanine rich region, residues 25 to 413
YP_112168.1	Similar to Synechocystis sp. hypothetical protein slr1566 SWALL:P74597 (EMBL:D90916) (395 aa) fasta scores: E(): 2.2e-66, 48.49% id in 398 aa, and to Anabaena sp. hypothetical protein alr0776 SWALL:Q8YYS0 (EMBL:AP003583) (396 aa) fasta scores: E(): 1.2e-55, 49.74% id in 396 aa
YP_112169.1	catalyzes the conversion of 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate into isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP); functions in the nonmevalonate isoprenoid biosynthesis pathway
YP_112170.1	Similar to Anabaena sp. hypothetical protein alr4269 SWALL:Q8YPC9 (EMBL:AP003595) (338 aa) fasta scores: E(): 2.6e-79, 56.17% id in 324 aa, and to Streptomyces coelicolor hypothetical protein SCO6766 or SC6A5.15 SWALL:Q9X7W1 (EMBL:AL939129) (340 aa) fasta scores: E(): 1.1e-73, 50.29% id in 340 aa. CDS is extended at the C-terminus in comparison to orthologues
YP_112171.1	Similar to Anabaena sp. hypothetical protein alr0056 SWALL:Q8Z0N5 (EMBL:AP003581) (120 aa) fasta scores: E(): 1.1e-21, 52.33% id in 107 aa, and to Rhizobium loti hypothetical protein mll2280 SWALL:Q98IR7 (EMBL:AP002999) (137 aa) fasta scores: E(): 2.7e-14, 41.96% id in 112 aa
YP_112172.1	catalyzes the formation of 5-aminovulinate from (S)-4-amino-5-oxopentanoate
YP_112174.1	Similar to Ralstonia solanacearum hypothetical protein RSC0023 SWALL:Q8Y3F7 (EMBL:AL646057) (64 aa) fasta scores: E(): 1.3e-16, 72.13% id in 61 aa, and to Pseudomonas putida hypothetical protein SWALL:Q88E28 (EMBL:AE016791) (65 aa) fasta scores: E(): 9.7e-17, 68.11% id in 69 aa
YP_112175.1	Similar to Escherichia coli carbon starvation protein A CstA SWALL:CSTA_ECOLI (SWALL:P15078) (701 aa) fasta scores: E(): 1.2e-186, 69.8% id in 702 aa, and to Ralstonia solanacearum probable carbon starvation A transmembrane protein rsc0022 or rs01844 SWALL:Q8Y3F8 (EMBL:AL646057) (686 aa) fasta scores: E(): 1e-208, 79.32% id in 682 aa
YP_112176.1	Similar to Methylococcus capsulatus cytochrome P460 Cyp SWALL:O87646 (EMBL:AF091435) (161 aa) fasta scores: E(): 8.9e-17, 44.17% id in 163 aa
YP_112177.1	Similar to Rhizobium meliloti  epoxide hydrolase rb0209 or smb20216 SWALL:Q92WW8 (EMBL:AL603642) (348 aa) fasta scores: E(): 8.5e-91, 66.76% id in 352 aa, and to Rhizobium loti epoxide hydrolase mlr3288 SWALL:Q98GK2 (EMBL:AP003001) (341 aa) fasta scores: E(): 6.3e-84, 64.24% id in 344 aa
YP_112178.1	Similar to Ralstonia solanacearum hypothetical protein rsp1573 or rs02129 SWALL:Q8XPR5 (EMBL:AL646085) (494 aa) fasta scores: E(): 1.1e-113, 61.69% id in 496 aa, and to Rhizobium loti hypothetical protein mlr6294 SWALL:Q989S9 (EMBL:AP003008) (525 aa) fasta scores: E(): 6e-73, 43.81% id in 493 aa
YP_112179.1	Similar to Ralstonia solanacearum probable transcriptional regulator protein rsp1571 or rs02127 SWALL:Q8XPR7 (EMBL:AL646085) (324 aa) fasta scores: E(): 1.5e-43, 40.82% id in 316 aa, and to Escherichia coli cyn operon transcriptional activator CynR or b0338 SWALL:CYNR_ECOLI (SWALL:P27111) (311 aa) fasta scores: E(): 5.9e-14, 26.12% id in 310 aa
YP_112180.1	Similar to Ralstonia solanacearum hypothetical protein rsp1249 or rs03193 SWALL:Q8XQH6 (EMBL:AL646083) (127 aa) fasta scores: E(): 1.8e-37, 69.29% id in 127 aa, and to Anabaena sp. hypothetical protein all3014 SWALL:Q8YSS0 (EMBL:AP003591) (120 aa) fasta scores: E(): 4.2e-17, 48.33% id in 120 aa
YP_112183.1	Similar to Caulobacter crescentus hypothetical protein cc2891 SWALL:Q9A4E3 (EMBL:AE005953) (241 aa) fasta scores: E(): 8.7e-45, 48.73% id in 238 aa
YP_112184.1	Similar to Bacteriophage P22 bactoprenol glucosyl transferase GtrB SWALL:GTRB_BPP22 (SWALL:P57022) (310 aa) fasta scores: E(): 2.1e-62, 54.45% id in 303 aa, and to Bacteriophage SFX bactoprenol glucosyl transferase GtrB SWALL:GTRB_BPSFX (SWALL:Q9T1D6) (305 aa) fasta scores: E(): 3.7e-61, 54.45% id in 303 aa. CDS is extended at the C-terminus in comparison to orthologues
YP_112185.1	Similar to Chlorobium tepidum hypothetical protein ct0439 SWALL:AAM71684 (EMBL:AE012821) (454 aa) fasta scores: E(): 7.1e-38, 35.04% id in 408 aa, and to Chlorobium tepidum hypothetical protein ct0441 SWALL:AAM71686 (EMBL:AE012821) (317 aa) fasta scores: E(): 2.3e-26, 37.3% id in 319 aa. Possible alternative translational start site. CDS is extended at the C-terminus in comparison to some similar proteins
YP_112186.1	Similar to Chlorobium tepidum hypothetical protein ct0440 SWALL:AAM71685 (EMBL:AE012821) (406 aa) fasta scores: E(): 9.8e-35, 36.72% id in 403 aa, and to Chlorobium tepidum hypothetical protein ct0439 SWALL:AAM71684 (EMBL:AE012821) (454 aa) fasta scores: E(): 1.9e-34, 36.22% id in 403 aa. Possible alternative translational start site after codon 11
YP_112187.1	Similar to Caulobacter crescentus pilus subunit protein PilA or cc2948 SWALL:Q9L720 (EMBL:AF229646) (59 aa) fasta scores: E(): 9.7e-08, 54% id in 50 aa, and to Ralstonia solanacearum  pilin protein rsp1092 or rs02598 SWALL:Q8XQX6 (EMBL:AL646082) (58 aa) fasta scores: E(): 7.6e-06, 53.33% id in 45 aa. Note: Also similar to BPSS2186 (73 aa) fasta scores: E(): 3.3e-10, 70.213% identity in 47 aa overlap
YP_112188.1	Similar to Caulobacter crescentus pilus subunit protein PilA or cc2948 SWALL:Q9L720 (EMBL:AF229646) (59 aa) fasta scores: E(): 5.1e-05, 51.06% id in 47 aa. Note: Also similar to BPSS2185 (57 aa) fasta scores: E(): 4.7e-09, 70.213% identity in 47 aa overlap. CDS is extended at the N-terminus in comparison to orthologues
YP_112189.1	Similar to Ralstonia solanacearum probable prepilin peptidase transmembrane protein CpaA1 or rsc0657 or rs01561 SWALL:Q8Y1N3 (EMBL:AL646060) (172 aa) fasta scores: E(): 1.2e-20, 48.21% id in 168 aa, and to Burkholderia pseudomallei type 4 prepilin-like proteins leader peptide processing enzyme SWALL:LEP4_BURPS (SWALL:Q9ZF70) (275 aa) fasta scores: E(): 0.004, 35.5% id in 138 aa
YP_112190.1	Similar to Methanopyrus kandleri predicted AAA+ class ATPase with chaperone activity mk0708 SWALL:Q8TXG6 (EMBL:AE010363) (585 aa) fasta scores: E(): 3.4e-25, 33.03% id in 333 aa, and to Methanobacterium thermoautotrophicum conserved protein mth616 SWALL:O26713 (EMBL:AE000843) (442 aa) fasta scores: E(): 6.9e-22, 28.5% id in 407 aa
YP_112191.1	Similar to Ralstonia solanacearum probable pilus assembly transmembrane protein CpaB or rsc0656 or rs01560 SWALL:Q8Y1N4 (EMBL:AL646060) (288 aa) fasta scores: E(): 3.3e-33, 63.23% id in 291 aa, and to Agrobacterium tumefaciens components of type IV pilus CtpC or atu0222 or agr_c_380 SWALL:Q8UIS0 (EMBL:AE008995) (268 aa) fasta scores: E(): 1.2e-09, 30.58% id in 255 aa
YP_112192.1	Similar to Ralstonia solanacearum probable outer membrane channel protein CpaC or rsc0655 or rs01559 SWALL:Q8Y1N5 (EMBL:AL646060) (634 aa) fasta scores: E(): 6.2e-45, 54.45% id in 617 aa, and to Caulobacter crescentus PilQ (pilus assembly protein CpaC) or cc2945 SWALL:Q9L717 (EMBL:AF229646) (560 aa) fasta scores: E(): 1.3e-10, 30.64% id in 558 aa
YP_112193.1	Similar to Ralstonia solanacearum probable lipoprotein rsc0654 or rs01558 SWALL:Q8Y1N6 (EMBL:AL646060) (102 aa) fasta scores: E(): 4.3e-11, 46.59% id in 88 aa
YP_112197.1	Similar to Ralstonia solanacearum  pilus assembly protein CpaE1 or rsc0653 or rs01557 SWALL:Q8Y1N7 (EMBL:AL646060) (397 aa) fasta scores: E(): 1.8e-49, 39.59% id in 394 aa, and to Caulobacter crescentus CpaE SWALL:Q9L715 (EMBL:AF229646) (517 aa) fasta scores: E(): 6.4e-14, 29.53% id in 369 aa
YP_112198.1	Similar to Chlorobium tepidum type II secretion system protein ct0434 SWALL:AAM71680 (EMBL:AE012821) (480 aa) fasta scores: E(): 1.1e-92, 60.33% id in 416 aa, and to Agrobacterium tumefaciens component of type IV pilus CtpG or atu0218 or agr_c_373 SWALL:Q8UIS4 (EMBL:AE008995) (491 aa) fasta scores: E(): 4e-73, 48.49% id in 431 aa
YP_112199.1	Similar to Ralstonia solanacearum  tight adherence TadB-related transmembrane protein rsc0651 or rs01555 SWALL:Q8Y1N9 (EMBL:AL646060) (325 aa) fasta scores: E(): 6.1e-57, 46.34% id in 328 aa, and to Agrobacterium tumefaciens components of type IV pilus CtpH or atu0217 or agr_c_372 SWALL:Q8UIS5 (EMBL:AE008995) (334 aa) fasta scores: E(): 1.9e-21, 28.35% id in 335 aa
YP_112200.1	Similar to Ralstonia solanacearum  tight adherence TadC-related transmembrane protein rsc0650 or rs01554 SWALL:Q8Y1P0 (EMBL:AL646060) (315 aa) fasta scores: E(): 2.5e-53, 50.48% id in 311 aa, and to Agrobacterium tumefaciens components of type IV pilus CtpI or atu0216 or agr_c_371 SWALL:Q8UIS6 (EMBL:AE008995) (328 aa) fasta scores: E(): 4.2e-23, 31.56% id in 320 aa
YP_112201.1	Similar to Pseudomonas aeruginosa probable transcriptional regulator pa2082 SWALL:Q9I233 (EMBL:AE004636) (158 aa) fasta scores: E(): 3.2e-34, 56.12% id in 155 aa, and to Bacillus subtilis transcriptional regulator AzlB SWALL:AZLB_BACSU (SWALL:O07920) (157 aa) fasta scores: E(): 2.2e-15, 34.45% id in 148 aa. Note: Also similar to BPSL0849 (168 aa) fasta scores: E(): 3.2e-29, 52.500% identity in 160 aa overlap
YP_112202.1	catalyzes the formation of L-glutamate and an aromatic oxo acid from an aromatic amino acid and 2-oxoglutarate
YP_112203.1	Similar to Rhizobium meliloti  translation initiation inhibitor protein rb0363 or smb20377 SWALL:Q92WH6 (EMBL:AL603643) (127 aa) fasta scores: E(): 1.1e-11, 40.32% id in 124 aa, to Xanthomonas axonopodis translation initiation inhibitor xac3392 SWALL:AAM38235 (EMBL:AE011985) (126 aa) fasta scores: E(): 4.9e-08, 36.03% id in 111 aa, and to Escherichia coli, Escherichia coli O6, and Shigella flexneri TdcF protein or b3113 or c3871 or sf3153 SWALL:TDCF_ECOLI (SWALL:P42631) (129 aa) fasta scores: E(): 7.8e-06, 33.91% id in 115 aa
YP_112204.1	Similar to Ralstonia solanacearum probable porin signal peptide protein rsc2108 or rs01496 SWALL:Q8XXK5 (EMBL:AL646068) (381 aa) fasta scores: E(): 2.3e-16, 31.94% id in 385 aa, and to Bordetella pertussis outer membrane porin protein precursor SWALL:OMP_BORPE (SWALL:Q04064) (385 aa) fasta scores: E(): 8.5e-11, 30.78% id in 393 aa
YP_112205.1	Similar to Bacillus subtilis amino-acid permease RocC or ipa-78D SWALL:ROCC_BACSU (SWALL:P39636) (470 aa) fasta scores: E(): 2.4e-57, 37.3% id in 453 aa, and to Escherichia coli probable S-methylmethionine permease MmuP or b0260 SWALL:MMUP_ECOLI (SWALL:Q47689) (467 aa) fasta scores: E(): 8.4e-57, 37.69% id in 451 aa
YP_112206.1	Similar to Rhizobium meliloti  transcriptional regulator, GntR family protein rb1031 or smb21591 SWALL:Q92UR2 (EMBL:AL603645) (244 aa) fasta scores: E(): 5.6e-15, 34.66% id in 225 aa, and to Escherichia coli galactonate operon transcriptional repressor DgoR or b3694/b3695 SWALL:DGOR_ECOLI (SWALL:P31460) (229 aa) fasta scores: E(): 2.2e-07, 25.11% id in 219 aa. Note: This CDS is longer in its N-terminal region than most of its database matches
YP_112207.1	Similar to Ralstonia solanacearum hypothetical protein rsp1573 or rs02129 SWALL:Q8XPR5 (EMBL:AL646085) (494 aa) fasta scores: E(): 1.5e-114, 60.8% id in 495 aa, and to Brucella melitensis hypothetical cytosolic protein bmeii0539 SWALL:Q8YCI9 (EMBL:AE009689) (489 aa) fasta scores: E(): 1.9e-34, 30.2% id in 500 aa
YP_112208.1	Similar to the plasmid-borne Agrobacterium vitis tartrate transporter TtuB SWALL:TUB3_AGRVI (SWALL:P70786) (449 aa) fasta scores: E(): 3.9e-69, 43.63% id in 424 aa, and to Pseudomonas putida phthalate transporter Pht1 SWALL:PHT1_PSEPU (SWALL:Q05181) (451 aa) fasta scores: E(): 1.5e-62, 41.45% id in 427 aa
YP_112209.1	Similar to Ralstonia solanacearum probable transcriptional regulator protein rsp1571 or rs02127 SWALL:Q8XPR7 (EMBL:AL646085) (324 aa) fasta scores: E(): 4e-38, 37.17% id in 304 aa, and to Pseudomonas sp. transcriptional regulator ORF99 SWALL:Q936X4 (EMBL:U66917) (322 aa) fasta scores: E(): 4.8e-19, 34.25% id in 289 aa
YP_112212.1	Similar to Pseudomonas aeruginosa probable transporter pa2135 SWALL:Q9I1Y0 (EMBL:AE004641) (454 aa) fasta scores: E(): 1.6e-32, 39.95% id in 463 aa, and to Methanosarcina mazei Na(+)/H(+) antiporter mm1891 SWALL:AAM31587 (EMBL:AE013425) (437 aa) fasta scores: E(): 5.1e-05, 29.97% id in 447 aa, and to Escherichia coli Na(+)/H(+) exchanger YjcE or b4065 SWALL:YJCE_ECOLI (SWALL:P32703) (549 aa) fasta scores: E(): 0.00014, 29.67% id in 273 aa
YP_112213.1	Similar to Pseudomonas aeruginosa probable ATP-dependent DNA ligase pa2138 SWALL:Q9I1X7 (EMBL:AE004641) (840 aa) fasta scores: E(): 3.9e-54, 42.03% id in 1123 aa, and to Xanthomonas campestris ATP-dependent DNA ligase xcc0105 SWALL:Q8PE76 (EMBL:AE012104) (1001 aa) fasta scores: E(): 4.3e-34, 35.13% id in 1147 aa. Note: There are some fragments in this CDS that present no similarities to any of the database matches
YP_112214.1	Similar to Pseudomonas aeruginosa hypothetical protein pa2150 SWALL:Q9I1W5 (EMBL:AE004642) (293 aa) fasta scores: E(): 1.6e-40, 48.67% id in 302 aa, and to Xanthomonas campestris hypothetical protein xcc0104 SWALL:AAM39423 (EMBL:AE012104) (313 aa) fasta scores: E(): 3.3e-29, 39.2% id in 278 aa. Note: This CDS is longer in its C-terminal region than most of its database matches
YP_112215.1	Similar to Rhizobium meliloti hypothetical membrane-anchored protein rb0938 or smb21362 SWALL:Q92UZ6 (EMBL:AL603645) (146 aa) fasta scores: E(): 1.4e-07, 30.07% id in 143 aa, and to Bacillus halodurans hypothetical protein bh1232 SWALL:Q9KDI1 (EMBL:AP001511) (218 aa) fasta scores: E(): 1.4e-07, 29.73% id in 148 aa
YP_112216.1	Catalase HPII; monofunctional catalase that decomposes hydrogen peroxide into water and oxygen; serves to protect cells from the toxic effects of hydrogen peroxide
YP_112218.1	Similar to Ralstonia solanacearum probable transmembrane protein RS02225 SWALL:Q8XPH4 (EMBL:AL646086) (72 aa) fasta scores: E(): 2.1e-11, 74.13% id in 58 aa, and to Bordetella pertussis  membrane protein SWALL:Q7VXL6 (EMBL:BX640416) (53 aa) fasta scores: E(): 4.3e-10, 69.81% id in 53 aa. Possible alternative translational start site after codon 16
YP_112219.1	Similar to Rhizobium loti hypothetical protein msr0042 SWALL:Q98NP7 (EMBL:AP002994) (62 aa) fasta scores: E(): 5.3e-11, 68.85% id in 61 aa, and to Brucella melitensis hypothetical cytosolic protein bmei1136 SWALL:Q8YGM2 (EMBL:AE009553) (65 aa) fasta scores: E(): 2.7e-10, 68.33% id in 60 aa
YP_112220.1	sigma factors are initiation factors that promote the attachment of RNA polymerase to specific initiation sites and are then released; sigma 54 factor is responsible for the expression of enzymes involved in nitrogen assimilation and metabolism; the rhizobia often have 2 copies of this sigma factor; in Rhizobium etli RpoN1 shown to be involved in the assimilation of several nitrogen and carbon sources during free-living aerobic growth and RpoN2 is involved in symbiotic nitrogen fixation; in Bradyrhizobium both RpoN1 and N2 are functional in free-living and symbiotic conditions, rpoN1 gene was regulated in response to oxygen
YP_112222.1	Similar to Pseudomonas aeruginosa hypothetical protein pa2185 SWALL:Q9I1T0 (EMBL:AE004645) (294 aa) fasta scores: E(): 3.2e-48, 56.31% id in 293 aa, and to Salmonella typhi hypothetical protein sty1320 SWALL:Q8Z7E1 (EMBL:AL627269) (292 aa) fasta scores: E(): 4e-46, 53.4% id in 294 aa. Note: This CDS seems to lack a fragment of approx 50 residues at residue 37
YP_112223.1	Similar to Pseudomonas aeruginosa hypothetical protein pa2184 SWALL:Q9I1T1 (EMBL:AE004645) (169 aa) fasta scores: E(): 2.5e-34, 59.76% id in 169 aa, and to Escherichia coli protein YciE or b1257 SWALL:YCIE_ECOLI (SWALL:P21363) (168 aa) fasta scores: E(): 4.7e-25, 49.39% id in 164 aa
YP_112224.1	C-terminal region is similar to Ralstonia solanacearum hypothetical protein ssp0486 or rs00364 SWALL:Q8XSI8 (EMBL:AL646078) (148 aa) fasta scores: E(): 7.6e-11, 42.3% id in 130 aa
YP_112225.1	Similar to Agrobacterium tumefaciens agr_c_1796 SWALL:Q8U5G0 (EMBL:AE008028) (286 aa) fasta scores: E(): 4.9e-20, 29.56% id in 274 aa, and to Rhizobium loti hypothetical protein mlr1332 SWALL:Q98KT3 (EMBL:AP002997) (289 aa) fasta scores: E(): 4.7e-18, 29.83% id in 238 aa
YP_112229.1	Similar to the C-terminal region of Ralstonia solanacearum hypothetical protein rsp1523 or rs04800 SWALL:Q8XPW3 (EMBL:AL646085) (91 aa) fasta scores: E(): 0.5, 37.87% id in 66 aa, and of Mycobacterium tuberculosis hypothetical protein mt3313 SWALL:Q8VJ47 (EMBL:AE007143) (150 aa) fasta scores: E(): 3.2, 29.41% id in 68 aa. Similar to Rhizobium loti hypothetical protein Msl3106 msl3106 SWALL:Q98GZ3 (EMBL:AP003001) (86 aa) fasta scores: E(): 3.4, 32.85% id in 70 aa. Possible gene remanat
YP_112230.1	N-terminus is weakly similar to the C-terminal region of Rhizobium loti hypothetical protein msl3425 SWALL:Q98GA0 (EMBL:AP003002) (51 aa) fasta scores: E(): 0.37, 36.95% id in 46 aa
YP_112232.1	Similar to Pseudomonas aeruginosa hypothetical protein pa2159 SWALL:Q9I1V6 (EMBL:AE004642) (138 aa) fasta scores: E(): 1.5e-21, 50.36% id in 137 aa, and to Bacillus halodurans hypothetical protein bh2605 SWALL:Q9K9P0 (EMBL:AP001516) (142 aa) fasta scores: E(): 1.2e-14, 37.85% id in 140 aa
YP_112233.1	Similar to Methanosarcina mazei hypothetical protein mm1793 SWALL:AAM31489 (EMBL:AE013416) (135 aa) fasta scores: E(): 1.3e-21, 49.6% id in 125 aa, and to Agrobacterium tumefaciens agr_c_723 SWALL:Q8U5M3 (EMBL:AE007978) (142 aa) fasta scores: E(): 1.3e-12, 40.17% id in 117 aa
YP_112234.1	Partially similar to Brucella suis polar differentiation response regulator DivK or bra0612 SWALL:AAN33801 (EMBL:AE014558) (123 aa) fasta scores: E(): 1.8e-07, 27.58% id in 116 aa, and to Streptomyces coelicolor  regulatory protein sco5351 or scbac5h2.20 SWALL:Q9ADB7 (EMBL:AL939123) (167 aa) fasta scores: E(): 3.7e-07, 36.36% id in 110 aa
YP_112236.1	Similar to Rhizobium loti hypothetical protein mll5147 SWALL:Q98CH6 (EMBL:AP003005) (223 aa) fasta scores: E(): 1.1e-28, 47.34% id in 188 aa, and to Zymomonas mobilis hypothetical protein SWALL:Q9RNL0 (EMBL:AF180145) (206 aa) fasta scores: E(): 6e-28, 43.14% id in 197 aa
YP_112237.1	Similar to Bradyrhizobium japonicum Blr6117 protein SWALL:BAC51382 (EMBL:AP005957) (450 aa) fasta scores: E(): 4.1e-64, 47.4% id in 405 aa, and to Ralstonia solanacearum probable manganese transport protein MntH or rsp0520 or rs00399 SWALL:MNTH_RALSO (SWALL:Q8XSF6) (442 aa) fasta scores: E(): 1.1e-11, 27.19% id in 445 aa
YP_112238.1	Similar to Methylobacter marinus glutathione-dependent formaldehyde dehydrogenase Fdh SWALL:FADH_METMR (SWALL:P47734) (424 aa) fasta scores: E(): 1.8e-78, 53.07% id in 390 aa, and to Pseudomonas putida glutathione-independent formaldehyde dehydrogenase FdhA SWALL:FADH_PSEPU (SWALL:P46154) (398 aa) fasta scores: E(): 4.7e-20, 32.5% id in 403 aa
YP_112240.1	Similar to Pseudomonas aeruginosa hypothetical protein pa2134 SWALL:Q9I1Y1 (EMBL:AE004641) (190 aa) fasta scores: E(): 3.5e-13, 44% id in 150 aa
YP_112241.1	Similar to Anabaena sp. oxidoreductase alr5182 SWALL:Q8YLW4 (EMBL:AP003599) (285 aa) fasta scores: E(): 3.4e-62, 60.28% id in 277 aa, and to Pseudomonas aeruginosa probable short-chain dehydrogenase pa2142 SWALL:Q9I1X3 (EMBL:AE004641) (286 aa) fasta scores: E(): 3.5e-58, 57.34% id in 286 aa
YP_112243.1	C-terminal region similar to Anabaena sp. hypothetical protein Asl3383 asl3383 SWALL:Q8YRR0 (EMBL:AP003592) (65 aa) fasta scores: E(): 2.8e-06, 46.66% id in 60 aa, and to Methanosarcina mazei hypothetical protein mm0228 SWALL:AAM29924 (EMBL:AE013247) (62 aa) fasta scores: E(): 4.5e-05, 44.06% id in 59 aa
YP_112245.1	Similar to Xanthomonas campestris glucose 1-dehydrogenase homolog YxnA or xcc1992 SWALL:AAM41281 (EMBL:AE012304) (292 aa) fasta scores: E(): 6.3e-44, 51.15% id in 260 aa, and to Actinosynnema pretiosum glucose 1-dehydrogenase asm27 SWALL:AAM54105 (EMBL:AF453501) (341 aa) fasta scores: E(): 1e-33, 43.51% id in 262 aa, and to Bacillus subtilis hypothetical oxidoreductase YqjQ SWALL:YQJQ_BACSU (SWALL:P54554) (259 aa) fasta scores: E(): 4.7e-16, 31.43% id in 264 aa
YP_112247.1	Similar to Nostoc punctiforme  sucrose-phosphate synthase SpsA SWALL:Q937E5 (EMBL:AJ316587) (423 aa) fasta scores: E(): 1.1e-44, 36.34% id in 421 aa, and to Mycobacterium tuberculosis hypothetical protein rv0486 or mt0504 or mtcy20g9.12 SWALL:Y486_MYCTU (SWALL:Q11152) (480 aa) fasta scores: E(): 8.9e-24, 36.23% id in 425 aa
YP_112248.1	Similar to Pseudomonas aeruginosa similar to NAD dependent epimerase/dehydratase SWALL:AAM27842 (EMBL:AF498418) (318 aa) fasta scores: E(): 1.4e-87, 69.5% id in 305 aa, and to Synechocystis sp. dTDP-glucose 4-6-dehydratase RfbB or slr0809 SWALL:P74036 (EMBL:D90911) (328 aa) fasta scores: E(): 1.6e-73, 61.09% id in 311 aa
YP_112249.1	Similar to Anabaena sp. two-component hybrid sensor and regulator alr3442 SWALL:Q8YRK4 (EMBL:AP003593) (865 aa) fasta scores: E(): 1.3e-49, 30.58% id in 680 aa, and to Ralstonia solanacearum probable composite two-component regulatory rsp1676 or rs02235 SWALL:Q8XPG5 (EMBL:AL646086) (796 aa) fasta scores: E(): 1e-42, 32.65% id in 640 aa
YP_112251.1	Similar to Streptomyces coelicolor  transferase sco6190 or sc2g5.11 SWALL:Q9Z5B2 (EMBL:AL939126) (298 aa) fasta scores: E(): 9.1e-54, 51.56% id in 287 aa, and to Clostridium acetobutylicum predicted glycosyltransferase cac2171 SWALL:Q97H42 (EMBL:AE007717) (299 aa) fasta scores: E(): 8.4e-09, 24.26% id in 239 aa
YP_112252.1	Similar to Ralstonia solanacearum probable sigma-54 interacting response regulator transcription regulator protein rsp1667 or rs02226 SWALL:Q8XPH3 (EMBL:AL646086) (491 aa) fasta scores: E(): 2.6e-102, 62.63% id in 455 aa, and to Escherichia coli acetoacetate metabolism regulatory protein AtoC or Az or b2220 SWALL:ATOC_ECOLI (SWALL:Q06065) (461 aa) fasta scores: E(): 7.5e-55, 39.52% id in 458 aa. Note: Also similar in its C-terminal region to the upstream CDS BPSS2250 (323 aa) fasta scores: E(): 7.7e-44, 47.352% identity in 321 aa overlap
YP_112253.1	Similar to Ralstonia solanacearum probable sigma-54 interacting transcription regulator protein rsp1668 or rs02227 SWALL:Q8XPH2 (EMBL:AL646086) (384 aa) fasta scores: E(): 2.7e-56, 52.59% id in 308 aa, and to Zymomonas mobilis nitrogen assimilation regulatory protein ntrC SWALL:Q9RNP2 (EMBL:AF179611) (372 aa) fasta scores: E(): 8.3e-41, 52.08% id in 240 aa. Note: Also similar to the C-terminal region of BPSS2249 (468 aa) fasta scores: E(): 1e-48, 47.664% identity in 321 aa overlap
YP_112254.1	Similar to Streptomyces coelicolor  transferase sco6184 or sc2g5.05 SWALL:Q9Z5B8 (EMBL:AL939126) (316 aa) fasta scores: E(): 5.4e-22, 39.81% id in 324 aa, and low similarity to Halobacterium sp. LPS glycosyltransferase Lpg or vng0060G SWALL:Q9HSV4 (EMBL:AE004975) (333 aa) fasta scores: E(): 1.7e-06, 24.19% id in 248 aa
YP_112255.1	Similar to Rhizobium loti ADP-heptose-LPS heptosyltransferase mlr2566 SWALL:Q98I51 (EMBL:AP003000) (335 aa) fasta scores: E(): 4e-13, 28.53% id in 347 aa, and to Escherichia coli ADP-heptose--LPS heptosyltransferase II RfaF or WaaF or b3620 SWALL:RFAF_ECOLI (SWALL:P37692) (348 aa) fasta scores: E(): 3.1e-08, 27.21% id in 305 aa. Note: This CDS is longer in its N-terminal region than most of its database matches
YP_112256.1	Similar to Streptomyces coelicolor  transferase sco6181 or sc2g5.02 SWALL:Q9Z5C1 (EMBL:AL939126) (344 aa) fasta scores: E(): 2e-31, 40.41% id in 334 aa, and to Methanosarcina mazei glycosyltransferase mm2102 SWALL:AAM31798 (EMBL:AE013451) (327 aa) fasta scores: E(): 1.1e-10, 26.84% id in 231 aa
YP_112257.1	Similar to Rhizobium sp. nodulation protein NolO or y4hD SWALL:NOLO_RHISN (SWALL:P55474) (680 aa) fasta scores: E(): 3.9e-56, 39.72% id in 584 aa, and to Methanopyrus kandleri predicted carbamoyl transferase, NodU family mk0097 SWALL:Q8TZ42 (EMBL:AE010309) (515 aa) fasta scores: E(): 1.8e-44, 33.08% id in 526 aa. Note: This CDS is shorter in its C-terminal region than most of its database matches
YP_112258.1	Poor database matches. C-terminal region is weakly similar to Streptomyces coelicolor  transferase SCO6183 or SC2G5.04 SWALL:Q9Z5B9 (EMBL:AL939126) (335 aa) fasta scores: E(): 3.2e-10, 29.08% id in 471 aa
YP_112259.1	Similar to Yersinia pestis hypothetical protein ypo1074 SWALL:Q8ZH37 (EMBL:AJ414146) (188 aa) fasta scores: E(): 4.2e-15, 32.75% id in 174 aa, and to Escherichia coli and Shigella flexneri hypothetical protein YaeD SWALL:YAED_ECOLI (SWALL:P31546) (191 aa) fasta scores: E(): 1.2e-14, 35.03% id in 157 aa. CDS is extended at the C-terminus in comparison to some orthologues
YP_112260.1	Similar to Methanosarcina acetivorans 3-oxoacyl-[acyl-carrier protein] reductase ma2686 SWALL:Q8TMH4 (EMBL:AE010965) (239 aa) fasta scores: E(): 7.2e-19, 33.61% id in 238 aa. N-terminus is similar to the N-terminal region of to Pseudomonas paucimobilis 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase LinX SWALL:LINX_PSEPA (SWALL:P50198) (250 aa) fasta scores: E(): 8.3e-16, 34.46% id in 206 aa
YP_112262.1	No significant database matches to the full length CDS. N-terminal region is similar to Ralstonia solanacearum probable composite ATP-binding transmembrane ABC transporter protein rsc0478 or rs04417 SWALL:Q8Y258 (EMBL:AL646059) (592 aa) fasta scores: E(): 3.2e-84, 50.42% id in 591 aa, and to Yersinia pestis  ABC transport protein ypo2588 SWALL:Q8ZDI0 (EMBL:AJ414152) (631 aa) fasta scores: E(): 6.9e-74, 47.04% id in 576 aa. C-terminal region is Similar to Ralstonia solanacearum probable composite two-component regulatory rsp1676 or rs02235 SWALL:Q8XPG5 (EMBL:AL646086) (796 aa) fasta scores: E(): 3.9e-09, 28.02% id in 339 aa. Similar to BPSL0655, 51.007% identity (53.427% ungapped) in 596 aa overlap
YP_112263.1	Poor database matches. Weakly similar to an internal region of Deinococcus radiodurans hypothetical protein dr0392 SWALL:Q9RXC3 (EMBL:AE001899) (465 aa) fasta scores: E(): 7.2e-09, 28.05% id in 385 aa
YP_112264.1	No significant database matches to the full length CDS. C-terminus is similar to the C-terminal region of Schizosaccharomyces pombe phosphatidylserine decarboxylase proenzyme 2 precursor SPAC31G5.15 SWALL:O14111 (EMBL:Z98979) (980 aa) fasta scores: E(): 4.9e-09, 33.33% id in 204 aa
YP_112265.1	part of four member succinate dehydrogenase enzyme complex that forms a trimeric complex (trimer of tetramers); SdhA/B are the catalytic subcomplex and can exhibit succinate dehydrogenase activity in the absence of SdhC/D which are the membrane components and form cytochrome b556; SdhC binds ubiquinone; oxidizes succinate to fumarate while reducing ubiquinone to ubiquinol; the catalytic subunits are similar to fumarate reductase
YP_112266.1	Poor database matches. C-terminal region is weakly similar to Ralstonia solanacearum hypothetical protein rsp0643 or rs05579 SWALL:Q8XS38 (EMBL:AL646080) (103 aa) fasta scores: E(): 2.3, 29.73% id in 74 aa
YP_112267.1	Similar to Escherichia coli 2-hydroxy-3-oxopropionate reductase GlxR or GlxB1 SWALL:GLXR_ECOLI (SWALL:P77161) (292 aa) fasta scores: E(): 6.2e-18, 30.42% id in 286 aa, and to Helicobacter pylori J99  3-hydroxyacid dehydrogenase jhp0585 SWALL:Q9ZLJ4 (EMBL:AE001491) (285 aa) fasta scores: E(): 2.7e-24, 34.03% id in 285 aa
YP_112268.1	Similar to Chelatobacter heintzii nitrilotriacetate monooxygenase component A NtaA or NmoA SWALL:NTAA_CHEHE (SWALL:P54989) (453 aa) fasta scores: E(): 9.8e-53, 40.22% id in 455 aa, and to Agrobacterium tumefaciens monooxygenase ATU3420 or AGR_L_2804 SWALL:Q8UAF4 (EMBL:AE009272) (453 aa) fasta scores: E(): 3.2e-114, 63.71% id in 441 aa. Similar to BPSS1672, 64.865% identity (65.753% ungapped) in 444 aa overlap
YP_112269.1	Similar to Anabaena sp. 4'-phosphopantetheinyl transferase HetI SWALL:HETI_ANASP (SWALL:P37695) (237 aa) fasta scores: E(): 7.9e-15, 31.5% id in 200 aa, and to Stigmatella aurantiaca MtaA protein SWALL:Q9RFL1 (EMBL:AF188287) (277 aa) fasta scores: E(): 1.5e-37, 43.08% id in 253 aa
YP_112270.1	Similar to Oxalobacter formigenes oxalate:formate antiporter OxlT SWALL:OXLT_OXAFO (SWALL:Q51330) (417 aa) fasta scores: E(): 1.7e-11, 22.41% id in 406 aa, and to Rhizobium meliloti  transport transmembrane protein r01093 or smc02603 SWALL:Q92R34 (EMBL:AL591786) (412 aa) fasta scores: E(): 3e-54, 42.85% id in 392 aa
YP_112271.1	No significant database matches to the full length CDS. C-terminal region is similar to Agrobacterium tumefaciens actinorhodin polyketide dimerase ATU2531 or AGR_C_4599 SWALL:Q8UCF6 (EMBL:AE009199) (179 aa) fasta scores: E(): 1e-13, 37.8% id in 164 aa, and to the C-terminal region of Rhizobium etli probable 4-hydroxyphenylacetate-3-monooxygenase YP049 SWALL:Q8KL32 (EMBL:U80928) (208 aa) fasta scores: E(): 8.8e-17, 40.69% id in 145 aa. Possible alternative translational start site
YP_112272.1	C-terminus region is weakly similar to the C-terminal region of Burkholderia cepacia transcriptional activator BviR SWALL:Q9AHP7 (EMBL:AF296284) (237 aa) fasta scores: E(): 0.025, 24.87% id in 193 aa, and to Pseudomonas chlororaphis transcriptional activator CsaR SWALL:Q939D1 (EMBL:AY040629) (241 aa) fasta scores: E(): 1.3, 25.76% id in 229 aa. Similar to BPSS1804, 52.208% identity (58.601% ungapped) in 385 aa overlap
YP_112273.1	E3 component of the branched-chain alpha-keto acid dehydrogenase complex; catalyzes the oxidation of dihydrolipoamide to lipoamide
YP_112274.1	Catalyzes the transfer of acetyl from acetyldihydrolipoamide to coenzyme A to form acetyl CoA
YP_112275.1	Similar to Pseudomonas putida 2-oxoisovalerate dehydrogenase beta subunit BkdA2 SWALL:ODBB_PSEPU (SWALL:P09061) (339 aa) fasta scores: E(): 3.9e-125, 87.83% id in 337 aa, and to Pseudomonas aeruginosa 2-oxoisovalerate dehydrogenase pa2248 SWALL:Q9I1M1 (EMBL:AE004650) (350 aa) fasta scores: E(): 4.7e-122, 82.37% id in 346 aa. Possible alternative translational start site
YP_112276.1	Similar to Pseudomonas putida 2-oxoisovalerate dehydrogenase alpha subunit BkdA1 SWALL:ODBA_PSEPU (SWALL:P09060) (410 aa) fasta scores: E(): 1.6e-139, 80% id in 410 aa, and to Pseudomonas aeruginosa 2-oxoisovalerate dehydrogenase pa2247 SWALL:Q9I1M2 (EMBL:AE004650) (410 aa) fasta scores: E(): 6.2e-145, 83.9% id in 410 aa
YP_112277.1	Weakly similar to Mycobacterium tuberculosis hypothetical protein rv1919c or mt1970 or mtv050.03C SWALL:O53961 (EMBL:AL022020) (161 aa) fasta scores: E(): 0.0014, 26.27% id in 137 aa, and to Mycobacterium leprae hypothetical protein ml1983 SWALL:Q9CBH1 (EMBL:AL583924) (155 aa) fasta scores: E(): 0.0099, 25.56% id in 133 aa
YP_112278.1	Similar to Pseudomonas aeruginosa hypothetical protein pa2122 SWALL:Q9I1Z3 (EMBL:AE004639) (378 aa) fasta scores: E(): 1.8e-81, 53.53% id in 368 aa
YP_112279.1	Similar to Pseudomonas putida transcriptional activator protein NahR SWALL:NAHR_PSEPU (SWALL:P10183) (300 aa) fasta scores: E(): 3.1e-30, 34.48% id in 290 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa2121 SWALL:Q9I1Z4 (EMBL:AE004639) (301 aa) fasta scores: E(): 8.6e-77, 67.56% id in 296 aa
YP_112281.1	Similar to Mycobacterium leprae  cholesterol oxidase ml0389 SWALL:Q9CCV1 (EMBL:AL583918) (569 aa) fasta scores: E(): 2.8e-82, 44.79% id in 547 aa. Weakly similar to the C-terminal region of Phanerochaete chrysosporium cellobiose dehydrogenase precursor Cdh-1 and Cdh-2 SWALL:CDH_PHACH (SWALL:Q01738) (773 aa) fasta scores: E(): 0.011, 19.96% id in 571 aa
YP_112282.1	No significant database matches to the full length CDS, probable gene fusion. N-terminal region is similar to Mycobacterium tuberculosis hypothetical protein rv1869c or mtcy359.04 or mt1918 SWALL:P95146 (EMBL:Z83859) (411 aa) fasta scores: E(): 3.4e-38, 33.66% id in 407 aa, and to Pseudomonas putida putidaredoxin reductase CamA SWALL:CAMA_PSEPU (SWALL:P16640) (422 aa) fasta scores: E(): 4.7e-29, 29.68% id in 411 aa. C-terminal region is similar to Rhizobium loti hypothetical protein mlr3635 SWALL:Q98FS8 (EMBL:AP003002) (361 aa) fasta scores: E(): 1.5e-27, 31.84% id in 336 aa. Possible alternative translational start sites
YP_112283.1	Similar to Ralstonia solanacearum hypothetical protein rsc1511 or rs03793 SWALL:Q8XZ93 (EMBL:AL646065) (122 aa) fasta scores: E(): 6.2e-06, 36.92% id in 130 aa, and to the C-terminal region of Escherichia coli, and Shigella flexneri DnaK suppressor protein SWALL:DKSA_ECOLI (SWALL:P18274) (151 aa) fasta scores: E(): 0.0069, 28.81% id in 118 aa
YP_112284.1	Similar to Alcaligenes eutrophus intracellular PHB depolymerase PhaZre SWALL:O87189 (EMBL:AB017612) (419 aa) fasta scores: E(): 6.3e-54, 38.47% id in 421 aa, and to Xanthomonas campestris PHB depolymerase xcc1353 SWALL:AAM40651 (EMBL:AE012234) (466 aa) fasta scores: E(): 3.5e-56, 39.26% id in 438 aa
YP_112285.1	class I; catalyzes the formation of deoxyribonucleotides from their corresponding ribonucleotides
YP_112286.1	Similar to Chlorobium tepidum hypothetical protein ct0831 SWALL:AAM72067 (EMBL:AE012850) (515 aa) fasta scores: E(): 3e-53, 37.37% id in 495 aa, and to Pseudomonas aeruginosa hypothetical protein pa4701 SWALL:Q9HV96 (EMBL:AE004884) (520 aa) fasta scores: E(): 4.6e-49, 36.63% id in 505 aa. CDS is extended at the N-terminus in comparison to orthologues
YP_112287.1	Similar to Streptomyces coelicolor hypothetical protein SCO0162 or SCJ1.11 SWALL:Q9RJ03 (EMBL:AL939104) (330 aa) fasta scores: E(): 1.5e-26, 37.3% id in 319 aa, and to Streptomyces coelicolor hypothetical protein SCO0215 or SCJ12.27c SWALL:Q9RI33 (EMBL:AL939104) (335 aa) fasta scores: E(): 2.3e-23, 34.28% id in 315 aa. CDS is extended at the N-terminus in comparison to some orthologues
YP_112288.1	Similar to the C-terminal region of Stylosanthes hamata high affinity sulphate transporter 2 ST2 SWALL:SUT2_STYHA (SWALL:P53392) (662 aa) fasta scores: E(): 4.5e-28, 25% id in 584 aa. Similar to Corynebacterium glutamicum sulfate permease and related transporters cgl1051 SWALL:BAB98444 (EMBL:AP005277) (579 aa) fasta scores: E(): 3.4e-34, 35.87% id in 577 aa. CDS is extended at the N-terminus in comparison to orthologues
YP_112289.1	Poor similarity to Aeropyrum pernix hypothetical protein ape2489 SWALL:Q9Y8Z5 (EMBL:AP000064) (150 aa) fasta scores: E(): 1.6e-10, 39.39% id in 132 aa, and to Pyrobaculum aerophilum conserved protein with 2 CBS domains pae2961 SWALL:Q8ZU39 (EMBL:AE009903) (139 aa) fasta scores: E(): 7.6e-08, 28.98% id in 138 aa
YP_112290.1	Similar to Methanopyrus kandleri nitroreductase mk1490 SWALL:Q8TVA2 (EMBL:AE010439) (233 aa) fasta scores: E(): 0.00036, 32.21% id in 208 aa. C-terminal region is weakly similar to Pyrococcus abyssi hypothetical protein Pab1763 pab1763 SWALL:Q9V092 (EMBL:AJ248285) (196 aa) fasta scores: E(): 3.7e-07, 28.57% id in 196 aa
YP_112291.1	Similar to Chenopodium rubrum 18.3 kDa class I heat shock protein HSP18 SWALL:HS11_CHERU (SWALL:Q05832) (161 aa) fasta scores: E(): 2.8e-10, 37.06% id in 143 aa, and to Ralstonia solanacearum  small heat shock protein rsc0200 or rs00632 SWALL:Q8Y2Y1 (EMBL:AL646058) (140 aa) fasta scores: E(): 8.7e-23, 52.44% id in 143 aa
YP_112292.1	Similar to Bordetella pertussis outer membrane porin protein precursor SWALL:OMP_BORPE (SWALL:Q04064) (385 aa) fasta scores: E(): 2e-06, 27.79% id in 421 aa, and to Ralstonia solanacearum probable porin transmembrane protein rsc1084 or rs04103 SWALL:Q8Y0G0 (EMBL:AL646062) (364 aa) fasta scores: E(): 1.9e-17, 31.41% id in 382 aa
YP_112293.1	Similar to Pseudomonas oleovorans medium-chain-fatty-acid--CoA ligase AlkK SWALL:ALKK_PSEOL (SWALL:Q00594) (546 aa) fasta scores: E(): 2.6e-29, 31.56% id in 583 aa, and to Pseudomonas aeruginosa probable medium-chain acyl-CoA ligase pa3924 SWALL:Q9HX89 (EMBL:AE004810) (560 aa) fasta scores: E(): 2.5e-63, 47.77% id in 584 aa
YP_112294.1	Weakly similar to Klebsiella pneumoniae AcoK SWALL:Q48411 (EMBL:U10553) (921 aa) fasta scores: E(): 1.8e-39, 28.42% id in 943 aa, and to Pseudomonas oleovorans regulatory protein AlkS SWALL:ALKS_PSEOL (SWALL:P17051) (882 aa) fasta scores: E(): 8.1e-12, 23.02% id in 925 aa
YP_112296.1	Similar to Escherichia coli quinone oxidoreductase Qor or Hcz SWALL:QOR_ECOLI (SWALL:P28304) (327 aa) fasta scores: E(): 6.7e-49, 46.93% id in 326 aa, and to Ralstonia solanacearum probable NADPH:quinone reductase, zeta-crystallin homolog oxidoreductase qor or rsc2184 or rs01415 SWALL:Q8XXD1 (EMBL:AL646068) (324 aa) fasta scores: E(): 3.7e-69, 58.51% id in 323 aa. Similar to BPSL1169, 56.037% identity (56.037% ungapped) in 323 aa overlap
YP_112297.1	Similar to Escherichia coli alpha-ketoglutarate-dependent taurine dioxygenase TauD or SsiD SWALL:TAUD_ECOLI (SWALL:P37610) (282 aa) fasta scores: E(): 4.3e-28, 39.86% id in 291 aa, and to Pseudomonas aeruginosa taurine dioxygenase pa3935 SWALL:Q9HX81 (EMBL:AE004811) (277 aa) fasta scores: E(): 1.3e-28, 42.06% id in 290 aa
YP_112298.1	Weakly similar to Rhizobium loti hypothetical protein mll0106 SWALL:Q98NK0 (EMBL:AP002994) (309 aa) fasta scores: E(): 1.9e-08, 25.55% id in 313 aa, and to Thermoanaerobacter tengcongensis hypothetical protein tte0719 SWALL:Q8RBU0 (EMBL:AE013040) (275 aa) fasta scores: E(): 3e-07, 28.88% id in 315 aa
YP_112299.1	Similar to Caulobacter crescentus major facilitator family transporter cc0336 SWALL:Q9AB95 (EMBL:AE005706) (438 aa) fasta scores: E(): 1.8e-23, 30.71% id in 394 aa, and weakly similar to Bacillus subtilis hexuronate transporter ExuT SWALL:EXUT_BACSU (SWALL:O34456) (422 aa) fasta scores: E(): 9.6e-15, 24.62% id in 398 aa
YP_112300.1	Similar to Caulobacter crescentus hypothetical protein cc2185 SWALL:Q9A6A9 (EMBL:AE005890) (207 aa) fasta scores: E(): 3.8e-23, 45.72% id in 199 aa, and to Deinococcus radiodurans hypothetical protein dr0945 SWALL:Q9RVS7 (EMBL:AE001947) (195 aa) fasta scores: E(): 6.2e-21, 43.78% id in 185 aa
YP_112301.1	Similar to the C-terminal region of Caulobacter crescentus hypothetical protein cc1843 SWALL:Q9A783 (EMBL:AE005858) (214 aa) fasta scores: E(): 1.2e-16, 31.53% id in 222 aa, and to Rhizobium meliloti hypothetical protein r01644 or smc00952 SWALL:Q92PT6 (EMBL:AL591787) (221 aa) fasta scores: E(): 3.1e-15, 32.35% id in 204 aa. CDS is extended at the N-terminus in comparison to orthologues
YP_112302.1	Similar to Aquifex aeolicus DMS reductase chain A AQ_1234 SWALL:O67280 (EMBL:AE000730) (984 aa) fasta scores: E(): 1.3e-171, 49.21% id in 949 aa. Weakly similar to Salmonella typhimurium thiosulfate reductase precursor PhsA or stm2065 SWALL:PHSA_SALTY (SWALL:P37600) (758 aa) fasta scores: E(): 1.3e-15, 24.03% id in 903 aa. CDS is truncated at the N-terminus in comparison to some orthologues
YP_112303.1	N-terminus is similar to the N-terminal regions of Escherichia coli anaerobic dimethyl sulfoxide reductase chain B DmsB SWALL:DMSB_ECOLI (SWALL:P18776) (204 aa) fasta scores: E(): 5.4e-16, 38.41% id in 177 aa, and Aquifex aeolicus DMSO reductase chain B AQ_1232 SWALL:O67279 (EMBL:AE000730) (254 aa) fasta scores: E(): 1.2e-47, 66.82% id in 205 aa. Similarity with Aquifex aeolicus and other proteins ends at a glycine rich region, residues 209 to 227. Possible fusion protein
YP_112304.1	Similar to Rhizobium loti DMSO reductase chain C mll5612 SWALL:Q98BE5 (EMBL:AP003007) (311 aa) fasta scores: E(): 5.9e-26, 36.42% id in 324 aa. N-terminus is weakly similar to the N-terminal region of Escherichia coli anaerobic dimethyl sulfoxide reductase chain C DmsC SWALL:DMSC_ECOLI (SWALL:P18777) (287 aa) fasta scores: E(): 0.03, 27.67% id in 224 aa
YP_112305.1	Weakly similar to Leptospira interrogans polysaccharide deacetylase la1998 SWALL:AAN49197 (EMBL:AE011373) (300 aa) fasta scores: E(): 5e-16, 27.75% id in 245 aa. C-terminal region is weakly similar to Lactococcus lactis hypothetical protein SWALL:Q8VUB1 (EMBL:AF188107) (250 aa) fasta scores: E(): 9.4e-13, 27.34% id in 245 aa. Similar to BPSS1928, 55.512% identity (57.317% ungapped) in 254 aa overlap
YP_112306.1	No significant database matches to the full length CDS. C-terminus is similar to the C-terminal region of Fusobacterium nucleatum hypothetical cytosolic protein fn0456 SWALL:Q8RG61 (EMBL:AE010557) (380 aa) fasta scores: E(): 3.9e-29, 33.64% id in 324 aa, and Borrelia burgdorferi hypothetical protein Bb0165 bb0165 SWALL:O51187 (EMBL:AE001127) (614 aa) fasta scores: E(): 4.5e-11, 28.86% id in 336 aa
YP_112307.1	Internal region is similar to an internal region of Escherichia coli penicillin-binding protein 1A MrcA or PonA SWALL:PBPA_ECOLI (SWALL:P02918) (850 aa) fasta scores: E(): 1.4e-21, 30.8% id in 737 aa. C-terminal region is similar to Chlorobium tepidum penicillin-binding protein 1 CT0176 SWALL:AAM71424 (EMBL:AE012797) (763 aa) fasta scores: E(): 1.5e-58, 36.31% id in 771 aa
YP_112308.1	Similar to Xanthomonas axonopodis disulphide-isomerase xac3878 SWALL:AAM38720 (EMBL:AE012037) (526 aa) fasta scores: E(): 3.7e-46, 36.06% id in 524 aa, and to Xanthomonas campestris disulphide-isomerase xcc3823 SWALL:AAM43059 (EMBL:AE012503) (525 aa) fasta scores: E(): 4.2e-41, 34.04% id in 517 aa
YP_112309.1	Similar to Bordetella pertussis outer membrane porin protein precursor SWALL:OMP_BORPE (SWALL:Q04064) (385 aa) fasta scores: E(): 1.9e-19, 35.01% id in 377 aa, and to Ralstonia solanacearum probable porin transmembrane protein rsc1082 or rs04105 SWALL:Q8Y0G2 (EMBL:AL646062) (394 aa) fasta scores: E(): 1.4e-45, 43.18% id in 389 aa. Similar to BPSS1679, 57.069% identity (58.421% ungapped) in 389 aa overlap, and to BPSS0252, 51.451% identity (54.167% ungapped) in 379 aa overlap
YP_112310.1	catalyzes the hydrolysis of a monocarboxylic acid amid to form a monocarboxylate and ammonia
YP_112312.1	Similar to Agrobacterium tumefaciens acetyltransferase ATU2080 or AGR_C_3768 SWALL:Q8UDP1 (EMBL:AE009158) (177 aa) fasta scores: E(): 5.5e-19, 43.42% id in 175 aa, and to Escherichia coli hypothetical acetyltransferase YhhY SWALL:YHHY_ECOLI (SWALL:P46854) (162 aa) fasta scores: E(): 1.1e-17, 43.29% id in 164 aa. CDS is extended at the N-terminus in comparison to some orthologues
YP_112313.1	Similar to Pseudomonas aeruginosa hypothetical protein pa1377 SWALL:Q9I3W7 (EMBL:AE004567) (177 aa) fasta scores: E(): 1.1e-13, 32.92% id in 164 aa, and to Salmonella typhimurium  transferase stm3546 SWALL:Q8ZLG1 (EMBL:AE008863) (162 aa) fasta scores: E(): 5.9e-13, 35.36% id in 164 aa
YP_112314.1	Similar to Pseudomonas aeruginosa hypothetical protein pa2530 SWALL:Q9I0V3 (EMBL:AE004680) (441 aa) fasta scores: E(): 4.3e-78, 50.45% id in 436 aa, and to Anabaena sp. hypothetical protein all1089 SWALL:Q8YXW8 (EMBL:AP003584) (448 aa) fasta scores: E(): 9.4e-50, 36.01% id in 422 aa
YP_112315.1	Similar to Pseudomonas aeruginosa hypothetical protein pa2529 SWALL:Q9I0V4 (EMBL:AE004680) (477 aa) fasta scores: E(): 5.3e-102, 60.87% id in 478 aa. Weakly similar to Escherichia coli, and Shigella flexneri TldD protein SWALL:TLDD_ECOLI (SWALL:P46473) (481 aa) fasta scores: E(): 1.6e-12, 27.23% id in 437 aa
YP_112316.1	Similar to Ralstonia solanacearum probable transmembrane sensor histidine kinase transcription regulator protein rsc0021 or rs01843 SWALL:Q8Y3F9 (EMBL:AL646057) (487 aa) fasta scores: E(): 5.6e-64, 51.92% id in 468 aa. C-terminus is similar to the C-terminal region of Bacillus subtilis sensor protein DegS or SacU SWALL:DEGS_BACSU (SWALL:P13799) (385 aa) fasta scores: E(): 1.4e-19, 34.83% id in 267 aa
YP_112317.1	Similar to Escherichia coli, and Shigella flexneri nitrate/nitrite response regulator protein NarL or FrdR SWALL:NARL_ECOLI (SWALL:P10957) (216 aa) fasta scores: E(): 2.5e-21, 38.53% id in 205 aa, and to Brucella melitensis transcriptional regulatory protein bmei1582 SWALL:Q8YFE0 (EMBL:AE009594) (213 aa) fasta scores: E(): 3.7e-28, 46.53% id in 202 aa
YP_112318.1	Similar to Ralstonia solanacearum probable signal peptide protein rsc2958 or rs01342 SWALL:Q8XV73 (EMBL:AL646072) (211 aa) fasta scores: E(): 8.3e-26, 40.59% id in 202 aa, and to Neisseria meningitidis hypothetical protein nmb1963 SWALL:Q9JXN1 (EMBL:AE002544) (196 aa) fasta scores: E(): 2.4e-13, 30.3% id in 198 aa
YP_112319.1	Similar to Pseudomonas aeruginosa hypothetical protein pa0862 SWALL:Q9I579 (EMBL:AE004521) (260 aa) fasta scores: E(): 1.6e-52, 50.83% id in 240 aa
YP_112320.1	Similar to Rhizobium loti hypothetical protein mlr3171 SWALL:Q98GU5 (EMBL:AP003001) (832 aa) fasta scores: E(): 6.3e-114, 39.3% id in 804 aa, and to Pseudomonas aeruginosa hypothetical protein pa0861 SWALL:Q9I580 (EMBL:AE004521) (818 aa) fasta scores: E(): 1.2e-112, 39.82% id in 786 aa. Possible alternative translational start site
YP_112321.1	Similar to Burkholderia cepacia lipase precursor LipA SWALL:LIP_BURCE (SWALL:P22088) (364 aa) fasta scores: E(): 2.1e-83, 65.65% id in 364 aa, and to Pseudomonas sp. lipase precursor Lip SWALL:LIP_PSES5 (SWALL:P25275) (364 aa) fasta scores: E(): 5.4e-84, 66.2% id in 364 aa. Similar to BPSS1741, 67.397% identity (70.690% ungapped) in 365 aa overlap
YP_112322.1	C-terminal region is similar to Anabaena sp. 4'-phosphopantetheinyl transferase HetI SWALL:HETI_ANASP (SWALL:P37695) (237 aa) fasta scores: E(): 2.3e-15, 32.75% id in 229 aa, and Ralstonia solanacearum phosphopantetheinyl transferase rsp0163 or rs05515 SWALL:Q8XTF0 (EMBL:AL646076) (272 aa) fasta scores: E(): 2.8e-12, 34.22% id in 225 aa. Possible alternative translational start sites
YP_112323.1	Poor database matches. Weakly similar to the C-terminal region of Vibrio cholerae hypothetical protein vca1012 SWALL:Q9KKT8 (EMBL:AE004427) (155 aa) fasta scores: E(): 0.79, 28.92% id in 121 aa
YP_112325.1	Similar to Escherichia coli O157:H7 hypothetical protein z1555 or ecs1295 SWALL:Q8XAK5 (EMBL:AE005305) (262 aa) fasta scores: E(): 1.5e-24, 33.33% id in 261 aa, and to Vibrio cholerae hypothetical protein vca0853 SWALL:Q9KL93 (EMBL:AE004413) (247 aa) fasta scores: E(): 5.5e-15, 27.63% id in 228 aa
YP_112326.1	Weakly similar to Vibrio cholerae hypothetical protein vca0854 SWALL:Q9KL92 (EMBL:AE004413) (419 aa) fasta scores: E(): 1.3e-11, 25.1% id in 470 aa, and to Borrelia burgdorferi hypothetical protein bbj27 SWALL:O50782 (EMBL:AE000787) (411 aa) fasta scores: E(): 1.6e-06, 21.8% id in 477 aa
YP_112327.1	Similar to Streptomyces coelicolor ABC-transporter ATP binding protein SCO5870 or SC2E9.11 SWALL:O54136 (EMBL:AL939125) (230 aa) fasta scores: E(): 2.5e-33, 52.48% id in 221 aa, and to Thermotoga maritima hypothetical ABC transporter ATP-binding protein tm0352 SWALL:Y352_THEMA (SWALL:Q9WYI7) (234 aa) fasta scores: E(): 4.7e-33, 48.01% id in 227 aa
YP_112328.1	Similar to Caulobacter crescentus monooxygenase, flavin-binding family cc0774 SWALL:Q9AA34 (EMBL:AE005753) (458 aa) fasta scores: E(): 2e-54, 38.84% id in 466 aa, and to the N-terminal region of Homo sapiens dimethylaniline monooxygenase [N-oxide forming] 1 FMO1 SWALL:FMO1_HUMAN (SWALL:Q01740) (531 aa) fasta scores: E(): 1.2e-22, 34.43% id in 424 aa. CDS is extended at the N-terminus in comparison to orthologues
YP_112329.1	No significant database matches to the full length CDS. N-terminal region is similar to Bacillus halodurans cytochrome P450 hydroxylase bh0579 SWALL:Q9KFA6 (EMBL:AP001509) (453 aa) fasta scores: E(): 3.6e-38, 32.75% id in 461 aa, and to the N-terminal region of Bacillus megaterium bifunctional P-450:NADPH-p450 reductase Cyp102A1 or Cyp102 SWALL:CPXB_BACME (SWALL:P14779) (1048 aa) fasta scores: E(): 1.1e-24, 25.57% id in 606 aa
YP_112330.1	Internal regions are weakly similar to the N-terminal region of Streptomyces coelicolor  multi-domain beta keto-acyl synthase sco0126 or scj21.07 SWALL:Q9S200 (EMBL:AL939104) (2082 aa) fasta scores: E(): 2.9e-31, 28.89% id in 1059 aa, and to the C-terminal region of Streptomyces avermitilis modular polyketide synthase SWALL:Q93HH9 (EMBL:AB070941) (2365 aa) fasta scores: E(): 7.5e-23, 27.79% id in 1903 aa
YP_112331.1	Similar to internal regions of Streptomyces avermitilis modular polyketide synthase PteA1 SWALL:Q93H87 (EMBL:AB070949) (6048 aa) fasta scores: E(): 2e-14, 28.35% id in 529 aa, and to Streptomyces venezuelae type I polyketide synthase PikAI SWALL:Q9ZGI5 (EMBL:AF079138) (4613 aa) fasta scores: E(): 3e-13, 27.83% id in 521 aa
YP_112332.1	Similar to Ralstonia solanacearum probable lipoprotein transmembrane rsp0362 or rs00775 SWALL:Q8XSV5 (EMBL:AL646078) (805 aa) fasta scores: E(): 2.2e-07, 24.28% id in 873 aa. C-terminal region is similar to Zymomonas mobilis hypothetical protein SWALL:O69016 (EMBL:AF086791) (169 aa) fasta scores: E(): 1.1e-25, 55.28% id in 161 aa
YP_112333.1	Similar to Ralstonia solanacearum probable lipoprotein precursor rsc2959 or rs01340 SWALL:Q8XV72 (EMBL:AL646072) (269 aa) fasta scores: E(): 2e-29, 48.99% id in 249 aa, and to Pseudomonas aeruginosa hypothetical protein pa2800 SWALL:Q9I043 (EMBL:AE004707) (234 aa) fasta scores: E(): 3.9e-20, 40.69% id in 231 aa. CDS is extended at the C-terminus in comparison to orthologues
YP_112335.1	Similar to Bacillus sphaericus adenosylmethionine-8-amino-7-oxononanoate aminotransferase BioA SWALL:BIOA_BACSH (SWALL:P22805) (455 aa) fasta scores: E(): 1.3e-45, 33.48% id in 430 aa, and to Ralstonia solanacearum  aminotransferase rsc0082 or rs02256 SWALL:Q8Y398 (EMBL:AL646057) (450 aa) fasta scores: E(): 3.7e-128, 73.03% id in 445 aa
YP_112336.1	Weakly similar to Penicillium chrysogenum acyl-coenzyme A:6-aminopenicillanic-acid-acyltransferase precursor Aat or pendE SWALL:AAAA_PENCH (SWALL:P15802) (357 aa) fasta scores: E(): 1.5e-07, 26.45% id in 344 aa. Similar to Ralstonia solanacearum hypothetical protein rsc1742 rsc1742 or rs02930 SWALL:Q8XYL6 (EMBL:AL646066) (350 aa) fasta scores: E(): 1.1e-52, 47.73% id in 331 aa
YP_112337.1	similar to ATP-binding component of ABC transporters
YP_112338.1	similar to permease component of ABC transporters; mutations impair ability of Escherichia coli to transport and utilize glutamine
YP_112339.1	similar to periplasmic-binding component of ABC transporters
YP_112340.1	Weakly similar to Synechocystis sp. hypothetical protein slr1977 SWALL:P74128 (EMBL:D90912) (244 aa) fasta scores: E(): 0.0058, 25.86% id in 232 aa
YP_112341.1	Similar to Zymomonas mobilis squalene--hopene cyclase Shc SWALL:SQHC_ZYMMO (SWALL:P33990) (658 aa) fasta scores: E(): 7.5e-169, 62.28% id in 647 aa, and to Rhodopseudomonas palustris squalene-hopene cyclase Shc SWALL:O69790 (EMBL:Y09979) (654 aa) fasta scores: E(): 1.7e-182, 66.19% id in 639 aa
YP_112342.1	Similar to the C-terminal region of Capsicum annuum phytoene synthase, chloroplast precursor PSY1 SWALL:PSY_CAPAN (SWALL:P37272) (419 aa) fasta scores: E(): 8.8e-16, 32.72% id in 272 aa, and the full length to Bradyrhizobium japonicum hypothetical protein SWALL:O06002 (EMBL:X86552) (279 aa) fasta scores: E(): 9.1e-55, 55.84% id in 265 aa
YP_112343.1	Similar to Burkholderia gladioli esterase EstC SWALL:Q9LAB8 (EMBL:AF144381) (298 aa) fasta scores: E(): 2.3e-65, 64.78% id in 284 aa, and to Oryza sativa PIR7B protein SWALL:PI7B_ORYSA (SWALL:Q43360) (268 aa) fasta scores: E(): 2.3e-05, 29.43% id in 299 aa
YP_112344.1	Similar to the C-terminal region of Thermoanaerobacter tengcongensis diguanylate cyclase/phosphodiesterase domain 1 tte1100 SWALL:Q8RAU5 (EMBL:AE013073) (670 aa) fasta scores: E(): 8e-21, 32.66% id in 300 aa. C-terminus is similar to the C-terminal region of Agrobacterium tumefaciens GGDEF family protein ATU2179 or AGR_C_3960 SWALL:Q8UDE8 (EMBL:AE009168) (400 aa) fasta scores: E(): 3.1e-22, 34.67% id in 274 aa
YP_112345.1	Weakly similar to Vibrio cholerae hypothetical protein vc1083 SWALL:Q9KT22 (EMBL:AE004189) (194 aa) fasta scores: E(): 1.3e-08, 29.55% id in 203 aa, and to Bacillus halodurans inhibition of CheR-mediated methylation of MCPs bh2434 SWALL:Q9KA56 (EMBL:AP001515) (209 aa) fasta scores: E(): 0.017, 25.11% id in 211 aa. Possible C-terminal portion of a pseudogene. CDS is similar to the C-terminal regions of larger proteins, including Vibrio cholerae response regulator vca0189 SWALL:Q9KMX7 (EMBL:AE004359) (334 aa) fasta scores: E(): 4.5e-12, 29.79% id in 198 aa. Upstream CDS, BPSS2344, is similar to the N-terminal regions of the same proteins
YP_112346.1	Similar to Listeria monocytogenes, and Listeria innocua chemotaxis protein lmo0691 or lin0699 SWALL:CHEY_LISMO (SWALL:Q48767) (119 aa) fasta scores: E(): 5e-06, 33.33% id in 117 aa, and to Vibrio cholerae response regulator vc1082 SWALL:Q9KT23 (EMBL:AE004189) (121 aa) fasta scores: E(): 7.6e-20, 50.83% id in 120 aa. Possible N-terminal portion of a pseudogene. CDS is also similar to the N-terminal regions of larger proteins, including Vibrio cholerae response regulator vca0189 SWALL:Q9KMX7 (EMBL:AE004359) (334 aa) fasta scores: E(): 8.1e-16, 43.96% id in 116 aa. Downstream CDS, BPSS2343, is similar to the C-terminal regions of the same proteins. Similar to BPSS0814, 62.810% identity (62.810% ungapped) in 121 aa overlap
YP_112347.1	No significant database matches to the full length CDS. C-terminus is similar to the C-terminal regions of Brucella melitensis sensory transduction protein kinase bmei0947 SWALL:Q8YH57 (EMBL:AE009535) (767 aa) fasta scores: E(): 1.7e-39, 35.64% id in 418 aa, and Caulobacter crescentus sensory box histidine kinase/response regulator cc2874 SWALL:Q9A4G0 (EMBL:AE005952) (794 aa) fasta scores: E(): 1.6e-34, 33.82% id in 541 aa. Possible alternative translational start site
YP_112348.1	Similar to Xanthomonas campestris hypothetical protein xcc1433 SWALL:AAM40730 (EMBL:AE012243) (184 aa) fasta scores: E(): 7.5e-36, 55.8% id in 181 aa, and to Chlorobium tepidum hypothetical protein ct1462 SWALL:AAM72690 (EMBL:AE012903) (187 aa) fasta scores: E(): 2.1e-35, 56.28% id in 183 aa
YP_112349.1	Bacteria have multiple sigma factors which are active under specific conditions; the sigma factor binds with the catalytic core of RNA polymerase to produce the holoenzyme and directs bacterial core RNA polymerase to specific promoter elements to initiate transcription
YP_112350.1	Similar to Ralstonia solanacearum hypothetical protein rsc0035 or rs01858 SWALL:Q8Y3E5 (EMBL:AL646057) (65 aa) fasta scores: E(): 3.7e-06, 45.16% id in 62 aa, and to Neisseria meningitidis hypothetical protein nmb2145 SWALL:Q9JXA7 (EMBL:AE002562) (59 aa) fasta scores: E(): 0.0052, 34% id in 50 aa
YP_112351.1	Similar to Escherichia coli, and Shigella flexneri arsenate reductase ArsC or ArsG SWALL:ARSC_ECOLI (SWALL:P37311) (141 aa) fasta scores: E(): 7.5e-12, 41.07% id in 112 aa, and to Vibrio cholerae arsenate reductase vc2165 SWALL:Q9KQ39 (EMBL:AE004288) (116 aa) fasta scores: E(): 2.3e-17, 53.98% id in 113 aa. CDS is truncated at the C-terminus in comparison to some orthologues
YP_112352.1	Similar to Ralstonia solanacearum probable partition protein rsp0003 or rs01975 SWALL:Q8XTV1 (EMBL:AL646076) (222 aa) fasta scores: E(): 8.1e-26, 38.18% id in 220 aa, and to Chlorobium limicola hypothetical protein Hyp7H SWALL:P94650 (EMBL:U77780) (209 aa) fasta scores: E(): 1.4e-19, 34.43% id in 212 aa
YP_112353.1	C-terminal region is similar to the C-terminal region of Ralstonia solanacearum  partitioning protein rsp0004 or rs01976 SWALL:Q8XTV0 (EMBL:AL646076) (334 aa) fasta scores: E(): 2.6e-19, 31.06% id in 264 aa, and to the full length Bacillus subtilis stage 0 sporulation protein J Spo0J SWALL:SP0J_BACSU (SWALL:P26497) (282 aa) fasta scores: E(): 4.4e-06, 24.35% id in 271 aa
YP_112354.1	Similar to Paracoccus versutus replication protein Rep SWALL:Q8VS80 (EMBL:AF390867) (419 aa) fasta scores: E(): 1e-08, 26.81% id in 440 aa. C-terminal region is weakly similar to Coxiella burnetii hypothetical protein SWALL:Q9S6J8 (EMBL:AF131076) (433 aa) fasta scores: E(): 7.6e-08, 21.42% id in 448 aa