-- dump date 20140619_042044 -- class Genbank::repeat_region -- table repeat_region_note -- id note 637910000001 Insertion sequence ISCro4. No inverted or direct repeats apparent. 1 of 13 100% identical ISCro4 elements in CR chromosome 637910000002 Insertion sequence ISCro5. Has 13 bp perfect, subterminal inverted repeats but no direct repeats. 1 of 5 100% identical ISCro5 elements in CR chromosome, ISCro5 includes 7 bp 5' and 3 bp 3' outside of the inverted repeats, common to the IS1111 subgroup of the IS110 family. Each IS element is flanked by the same 4 bp sequence 5' and 7 bp sequence 3' which likely represents its target sequence 637910000003 13 bp subterminal inverted repeat of ISCro5 637910000004 13 bp subterminal inverted repeat of ISCro5 637910000005 9 bp direct repeat flanking ISCro1 637910000006 Insertion sequence ISCro1. 1 of 21 intact ISCro1 elements in CR chromosome, all have 30 bp inverted repeats which contain 12 mismatches, and are flanked by direct repeats of varying length. This element has 9 bp direct repeats 637910000007 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000008 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000009 9 bp direct repeat flanking ISCro1 637910000010 10 bp direct repeat flanking ISCro6 637910000011 Insertion sequence ISCro6. Flanked by 18 bp inverted repeats which contain 3 mismatches, and 10 bp direct repeats. 1 of 6 ISCro6 elements in CR chromosome, of which two are intact, two have been disrupted by ISCro1 insertion, and two have frameshift mutated transposases; The transposase of this copy has been truncated by a frameshift mutation 637910000012 18 bp terminal inverted repeat of ISCro6, contains 3 mismatches 637910000013 18 bp terminal inverted repeat of ISCro6, contains 3 mismatches 637910000014 10 bp direct repeat flanking ISCro6 637910000015 11 bp direct repeat flanking ISCro3 637910000016 Insertion sequence ISCro3. 1 of 11 intact ISCro3 elements in CR chromosome, all have 18 bp inverted repeats containing 2 bp mismatches, and are flanked by direct repeats of varying length. This element has 11 bp direct repeats 637910000017 18 bp terminal inverted repeat of ISCro3, contains 2 mismatches 637910000018 18 bp terminal inverted repeat of ISCro3, contains 2 mismatches 637910000019 11 bp direct repeat flanking ISCro3 637910000020 9 bp direct repeat flanking IS102 637910000021 Insertion sequence IS102 first identified in Escherichia coli pSC101 (IS5 family). 100% ID at DNA level (blastn), 100% ID at protein level (tblastx). Has 18 bp perfect inverted repeats and is flanked by 9 bp direct repeats. 1 of 12 identical IS102 elements in CR chromosome 637910000022 18 bp terminal inverted repeat of IS102 637910000023 18 bp terminal inverted repeat of IS102 637910000024 9 bp direct repeat flanking IS102 637910000025 40 bp inverted repeat flanking GI1. This is an imperfect repeat (last 2 bp mismatch) of the 40 bp at 5' terminus of ISEc14 which is also repeated 0-2 times in tandem adjacent to each copy of this IS element in the CR genome, immediately upstream and/or inverted downstream. 637910000026 IS3 family insertion sequence fragment. 85% DNA ID to IS911 637910000027 40 bp inverted repeat flanking GI1. This is a perfect repeat of the 40 bp at 5' terminus of ISEc14 which is also repeated 0-2 times in tandem adjacent to each copy of this IS element in the CR genome, immediately upstream and/or inverted downstream. 637910000028 Insertion sequence ISCro5. Has 13 bp perfect, subterminal inverted repeats but no direct repeats. 1 of 5 100% identical ISCro5 elements in CR chromosome, ISCro5 includes 7 bp 5' and 3 bp 3' outside of the inverted repeats, common to the IS1111 subgroup of the IS110 family. Each IS element is flanked by the same 4 bp sequence 5' and 7 bp sequence 3' which likely represents its target sequence 637910000029 13 bp subterminal inverted repeat of ISCro5 637910000030 13 bp subterminal inverted repeat of ISCro5 637910000031 9 bp direct repeat flanking IS102 637910000032 Insertion sequence IS102 first identified in Escherichia coli pSC101 (IS5 family). 100% ID at DNA level (blastn), 100% ID at protein level (tblastx). Has 18 bp perfect inverted repeats and is flanked by 9 bp direct repeats. 1 of 12 identical IS102 elements in CR chromosome 637910000033 18 bp terminal inverted repeat of IS102 637910000034 18 bp terminal inverted repeat of IS102 637910000035 9 bp direct repeat flanking IS102 637910000036 4 bp direct repeat 637910000037 region repeated at 4076550..4078622 637910000038 3 bp direct repeat flanking ISEc14 637910000039 Insertion sequence ISEc14 first identified in Escherichia coli B (IS3 family). 98% ID at DNA level (blastn), 97% ID at protein level (tblastx), contains 2 transposases which have 98% ID to ISEc14 (blastp). Flanked by 26bp inverted repeats which contain 4 mismatches. 1 of 6 identical (100%) intact ISEc14 elements in CR chromosome. 40 bp at 5' terminus of ISEc14 are repeated 0-2 times in tandem adjacent to this IS element, immediately upstream and/or inverted downstream; Flanked by 3 bp direct repeats. No repeats of the first 40bp at 5' end of ISEc14 immediately adjacent to this IS element 637910000040 26 bp terminal inverted repeat of ISEc14, contains 4 mismatches 637910000041 40 bp region of ISEc14, repeated 0-2 times in tandem direct or inverted repeats adjacent to ISEc14 in other locations of the CR genome, but not this copy 637910000042 26 bp terminal inverted repeat of ISEc14, contains 4 mismatches 637910000043 3 bp direct repeat flanking ISEc14 637910000044 4 bp direct repeat 637910000045 11 bp direct repeat flanking ISCro6 637910000046 Insertion sequence ISCro6. Flanked by 18 bp inverted repeats which contain 3 mismatches, and 11 bp direct repeats. 1 of 5 ISCro6 elements in CR chromosome, of which two are intact, two have been disrupted by ISCro1 insertion, and two have frameshift mutated transposases; this copy has been disrupted by the insertion of ISCro1 637910000047 18 bp terminal inverted repeat of ISCro6, contains 3 mismatches 637910000048 8 bp direct repeat flanking ISCro1 637910000049 Insertion sequence ISCro1. 1 of 21 intact ISCro1 elements in CR chromosome, all have 30 bp inverted repeats which contain 12 mismatches, and are flanked by direct repeats of varying length. This element has 8 bp direct repeats 637910000050 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000051 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000052 8 bp direct repeat flanking ISCro1 637910000053 18 bp terminal inverted repeat of ISCro6, contains 3 mismatches 637910000054 11 bp direct repeat flanking ISCro6 637910000055 8 bp direct repeat flanking ISCro1 637910000056 Insertion sequence ISCro1. 1 of 21 intact ISCro1 elements in CR chromosome, all have 30 bp inverted repeats which contain 12 mismatches, and are flanked by direct repeats of varying length. This element has 8 bp direct repeats 637910000057 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000058 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000059 8 bp direct repeat flanking ISCro1 637910000060 10 bp direct repeat flanking ISCro2 637910000061 Insertion sequence ISCro2. Flanked by 20 bp inverted repeats which contain 2 mismatches, and 10 bp direct repeats. 1 of 3 identical ISCro2 elements in CR chromosome 637910000062 20 bp terminal inverted repeat of ISCro2, contains 3 mismatches (2 mismatches common to all ISCro2 inverted repeats plus one unique mismatch) 637910000063 20 bp terminal inverted repeat of ISCro2, contains 2 mismatches 637910000064 10 bp direct repeat flanking ISCro2 637910000065 11 bp direct repeat flanking ISCro6 637910000066 Insertion sequence ISCro6. Flanked by 18 bp inverted repeats which contain 3 mismatches, and 11 bp direct repeats. 1 of 5 ISCro6 elements in CR chromosome, of which two are intact, two have been disrupted by ISCro1 insertion, and two have frameshift mutated transposases; this IS element is intact 637910000067 18 bp terminal inverted repeat of ISCro6, contains 3 mismatches 637910000068 18 bp terminal inverted repeat of ISCro6, contains 3 mismatches 637910000069 11 bp direct repeat flanking ISCro6 637910000070 10 bp direct repeat flanking ISCro3 637910000071 Insertion sequence ISCro3. 1 of 11 intact ISCro3 elements in CR chromosome, all have 18 bp inverted repeats containing 2 bp mismatches, and are flanked by direct repeats of varying length. This element has 10 bp direct repeats 637910000072 18 bp terminal inverted repeat of ISCro3, contains 2 mismatches 637910000073 18 bp terminal inverted repeat of ISCro3, contains 2 mismatches 637910000074 10 bp direct repeat flanking ISCro3 637910000075 22 bp inverted repeat of prophage CRP99 invertible tail fibre region 637910000076 8 bp direct repeat flanking ISCro1 637910000077 Insertion sequence ISCro1. 1 of 21 intact ISCro1 elements in CR chromosome, all have 30 bp inverted repeats which contain 12 mismatches, and are flanked by direct repeats of varying length. This element has 8 bp direct repeats 637910000078 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000079 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000080 8 bp direct repeat flanking ISCro1 637910000081 22 bp inverted repeat of prophage CRP99 invertible tail fibre region 637910000082 70 bp direct repeat 637910000083 8 bp direct repeat flanking ISCro1 637910000084 Insertion sequence ISCro1. 1 of 21 intact ISCro1 elements in CR chromosome, all have 30 bp inverted repeats which contain 12 mismatches, and are flanked by direct repeats of varying length. This element has 8 bp direct repeats 637910000085 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000086 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000087 8 bp direct repeat flanking ISCro1 637910000088 70 bp perfect direct repeat of insertion site at RODt18 637910000089 direct repeat of 70 bp insertion site at RODt18, 1 bp deletion and 3 bp mismatch 637910000090 IS200 family insertion sequence fragment. 94% DNA ID to IS200I. 5' end of IS element found at 1189291..1189738. 637910000091 18 bp direct repeat, 1 bp mismatch 637910000092 IS200 family insertion sequence. 92% DNA ID to IS200I 637910000093 Insertion sequence ISCro3 fragment. 5' end of ISCro3, but missing inverted repeat ends. Disrupted by IS200I-like element insertion and subsequent degradation. The 3' end is found downstream of the interrupting IS element 637910000094 IS200 family insertion sequence fragment. 88% DNA ID to IS200F. 5' end of this element has been deleted, possibly by adjacent ISCro3, and is found at 1160533..1160713. 637910000095 Insertion sequence ISCro3 fragment. 3' end of ISCro3, but missing inverted repeat ends. Disrupted by IS200-family element insertion and subsequent degradation. The 5' end is found upstream of the interrupting IS element 637910000096 IS21 family insertion sequence fragment. 93% DNA ID to ISSso4 637910000097 18 bp direct repeat, 1 bp mismatch 637910000098 Insertion sequence ISCro4. No inverted or direct repeats apparent. 1 of 13 100% identical ISCro4 elements in CR chromosome 637910000099 11 bp direct repeat flanking ISCro3 637910000100 Insertion sequence ISCro3. 1 of 11 intact ISCro3 elements in CR chromosome, all have 18 bp inverted repeats containing 2 bp mismatches, and are flanked by direct repeats of varying length. This element has 11 bp direct repeats 637910000101 18 bp terminal inverted repeat of ISCro3, contains 2 mismatches 637910000102 18 bp terminal inverted repeat of ISCro3, contains 2 mismatches 637910000103 11 bp direct repeat flanking ISCro3 637910000104 12 bp direct repeat 637910000105 12 bp direct repeat 637910000106 Insertion sequence ISCro4. No inverted or direct repeats apparent. 1 of 13 100% identical ISCro4 elements in CR chromosome 637910000107 Insertion sequence ISCro5. Has 13 bp perfect, subterminal inverted repeats but no direct repeats. 1 of 5 100% identical ISCro5 elements in CR chromosome, ISCro5 includes 7 bp 5' and 3 bp 3' outside of the inverted repeats, common to the IS1111 subgroup of the IS110 family. Each IS element is flanked by the same 4 bp sequence 5' and 7 bp sequence 3' which likely represents its target sequence 637910000108 13 bp subterminal inverted repeat of ISCro5 637910000109 13 bp subterminal inverted repeat of ISCro5 637910000110 8 bp direct repeat flanking ISCro1 637910000111 Insertion sequence ISCro1. 1 of 21 intact ISCro1 elements in CR chromosome, all have 30 bp inverted repeats which contain 12 mismatches, and are flanked by direct repeats of varying length. This element has 8 bp direct repeats 637910000112 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000113 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000114 8 bp direct repeat flanking ISCro1 637910000115 Insertion sequence ISCro4. No inverted or direct repeats apparent. 1 of 13 100% identical ISCro4 elements in CR chromosome 637910000116 8 bp direct repeat flanking ISCro1 637910000117 Insertion sequence ISCro1. 1 of 21 intact ISCro1 elements in CR chromosome, all have 30 bp inverted repeats which contain 12 mismatches, and are flanked by direct repeats of varying length. This element has 8 bp direct repeats 637910000118 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000119 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000120 8 bp direct repeat flanking ISCro1 637910000121 25 bp direct repeat, 2 bp mismatches 637910000122 direct repeat of first 40bp (5') of ISEc14 637910000123 Insertion sequence ISEc14 first identified in Escherichia coli B (IS3 family). 98% ID at DNA level (blastn), 97% ID at protein level (tblastx), contains 2 transposases which have 98% ID to ISEc14 (blastp). Flanked by 26bp inverted repeats which contain 4 mismatches. 1 of 6 identical (100%) intact ISEc14 elements in CR chromosome. 40 bp at 5' terminus of ISEc14 are repeated 0-2 times in tandem adjacent to this IS element, immediately upstream and/or inverted downstream; 1 perfect repeat of the first 40bp at 5' end of ISEc14 immediately adjacent to IS element, this is a direct repeat found in tandem upstream 637910000124 40 bp region of ISEc14, repeated once in tandem adjacent to this copy of ISEc14 immediately upstream 637910000125 26 bp terminal inverted repeat of ISEc14, contains 4 mismatches 637910000126 26 bp terminal inverted repeat of ISEc14, contains 4 mismatches 637910000127 insertion sequence fragment. 5' end deleted by adjacent ISEc14 insertion, 3' end missing. intact copy found at 2083514..2084209 (98% DNA ID) 637910000128 25 bp direct repeat, 2 bp mismatches 637910000129 11 bp direct repeat flanking ISCro3 637910000130 Insertion sequence ISCro3. 1 of 11 intact ISCro3 elements in CR chromosome, all have 18 bp inverted repeats containing 2 bp mismatches, and are flanked by direct repeats of varying length. This element has 11 bp direct repeats 637910000131 18 bp terminal inverted repeat of ISCro3, contains 2 mismatches 637910000132 18 bp terminal inverted repeat of ISCro3, contains 2 mismatches 637910000133 11 bp direct repeat flanking ISCro3 637910000134 10 bp direct repeat flanking ISCro3 637910000135 Insertion sequence ISCro3. 1 of 11 intact ISCro3 elements in CR chromosome, all have 18 bp inverted repeats containing 2 bp mismatches, and are flanked by direct repeats of varying length. This element has 10 bp direct repeats 637910000136 18 bp terminal inverted repeat of ISCro3, contains 2 mismatches 637910000137 18 bp terminal inverted repeat of ISCro3, contains 2 mismatches 637910000138 10 bp direct repeat flanking ISCro3 637910000139 insertion sequence element. intact version of fragment found at 1766879..1767574 (98% ID) 637910000140 8 bp direct repeat. attR of prophage-like element CRP20 637910000141 8 bp direct repeat. attL of prophage-like element CRP20 637910000142 19 bp direct repeat, 1 bp mismatch 637910000143 19 bp direct repeat, 1 bp mismatch 637910000144 88 bp perfect inverted repeat of RODt30 and RODt31 637910000145 9 bp direct repeat flanking IS102 637910000146 Insertion sequence IS102 first identified in Escherichia coli pSC101 (IS5 family). 100% ID at DNA level (blastn), 100% ID at protein level (tblastx). Has 18 bp perfect inverted repeats and is flanked by 9 bp direct repeats. 1 of 12 identical IS102 elements in CR chromosome 637910000147 18 bp terminal inverted repeat of IS102 637910000148 18 bp terminal inverted repeat of IS102 637910000149 9 bp direct repeat flanking IS102 637910000150 88 bp perfect inverted repeat of RODt30 and RODt31 637910000151 IS200 family insertion sequence. 93% DNA ID to IS200I 637910000152 Insertion sequence ISCro3. 1 of 11 intact ISCro3 elements in CR chromosome, all have 18 bp inverted repeats containing 2 bp mismatches, and are flanked by direct repeats of varying length. This element has no direct repeats 637910000153 18 bp terminal inverted repeat of ISCro3, contains 2 mismatches 637910000154 18 bp terminal inverted repeat of ISCro3, contains 2 mismatches 637910000155 Insertion sequence ISCro5. Has 13 bp perfect, subterminal inverted repeats but no direct repeats. 1 of 5 100% identical ISCro5 elements in CR chromosome, ISCro5 includes 7 bp 5' and 3 bp 3' outside of the inverted repeats, common to the IS1111 subgroup of the IS110 family. Each IS element is flanked by the same 4 bp sequence 5' and 7 bp sequence 3' which likely represents its target sequence 637910000156 13 bp subterminal inverted repeat of ISCro5 637910000157 13 bp subterminal inverted repeat of ISCro5 637910000158 Insertion sequence ISCro4. No inverted or direct repeats apparent. 1 of 13 100% identical ISCro4 elements in CR chromosome 637910000159 Insertion sequence ISCro1. 1 of 21 intact ISCro1 elements in CR chromosome, all have 30 bp inverted repeats which contain 12 mismatches, and are flanked by direct repeats of varying length. This element has no direct repeats 637910000160 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000161 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000162 Insertion sequence ISCro4. No inverted or direct repeats apparent. 1 of 13 100% identical ISCro4 elements in CR chromosome 637910000163 11 bp direct repeat flanking ISCro3 637910000164 Insertion sequence ISCro3. 1 of 11 intact ISCro3 elements in CR chromosome, all have 18 bp inverted repeats containing 2 bp mismatches, and are flanked by direct repeats of varying length. This element has 11 bp direct repeats 637910000165 18 bp terminal inverted repeat of ISCro3, contains 2 mismatches 637910000166 18 bp terminal inverted repeat of ISCro3, contains 2 mismatches 637910000167 11 bp direct repeat flanking ISCro3 637910000168 25 bp direct repeat. attR of prophage phiNP (3' end of ssrA) 637910000169 25 bp direct repeat. attL of prophage phiNP 637910000170 2nd direct repeat in tandem of first 40bp (5') of ISEc14 637910000171 direct repeat of first 40bp (5') of ISEc14 637910000172 Insertion sequence ISEc14 first identified in Escherichia coli B (IS3 family). 98% ID at DNA level (blastn), 97% ID at protein level (tblastx), contains 2 transposases which have 98% ID to ISEc14 (blastp). Flanked by 26bp inverted repeats which contain 4 mismatches. 1 of 6 identical (100%) intact ISEc14 elements in CR chromosome. 40 bp at 5' terminus of ISEc14 are repeated 0-2 times in tandem adjacent to this IS element, immediately upstream and/or inverted downstream; 3 repeats of the first 40bp at 5' end of ISEc14 immediately adjacent to IS element, 2 of these are perfect direct repeats found in tandem upstream, the other one is an imperfect (1bp change) inverted repeat downstream 637910000173 40 bp region of ISEc14, repeated twice in tandem adjacent to this copy of ISEc14 immediately upstream and once inverted downstream 637910000174 26 bp terminal inverted repeat of ISEc14, contains 4 mismatches 637910000175 26 bp terminal inverted repeat of ISEc14, contains 4 mismatches 637910000176 inverted repeat of first 40bp (5') of ISEc14, contains 1 mismatch (final base is changed from T to G) 637910000177 IS3 family insertion sequence fragment (90% DNA ID to ISSen1). Also found at ROD48791. 5' end has been deleted by ISEc14 insertion 637910000178 IS3 family insertion sequence fragment. 89% DNA ID to ISEhe3. 3' region deleted by another IS3 family IS element insertion 637910000179 Insertion sequence ISCro1. 1 of 21 intact ISCro1 elements in CR chromosome, all have 30 bp inverted repeats which contain 12 mismatches, and are flanked by direct repeats of varying length. This element has no direct repeats 637910000180 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000181 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000182 8 bp direct repeat flanking ISCro1 637910000183 Insertion sequence ISCro1. 1 of 21 intact ISCro1 elements in CR chromosome, all have 30 bp inverted repeats which contain 12 mismatches, and are flanked by direct repeats of varying length. This element has 8 bp direct repeats 637910000184 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000185 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000186 8 bp direct repeat flanking ISCro1 637910000187 10 bp direct repeat flanking ISCro6 637910000188 Insertion sequence ISCro6. Flanked by 18 bp inverted repeats which contain 3 mismatches, and 10 bp direct repeats. 1 of 5 ISCro6 elements in CR chromosome, of which two are intact, two have been disrupted by ISCro1 insertion, and two have frameshift mutated transposases; this IS element is intact 637910000189 18 bp terminal inverted repeat of ISCro6, contains 3 mismatches 637910000190 18 bp terminal inverted repeat of ISCro6, contains 3 mismatches 637910000191 10 bp direct repeat flanking ISCro6 637910000192 10 bp direct repeat flanking ISCro2 637910000193 Insertion sequence ISCro2. Flanked by 20 bp inverted repeats which contain 2 mismatches, and 10 bp direct repeats. 1 of 3 identical ISCro2 elements in CR chromosome 637910000194 20 bp terminal inverted repeat of ISCro2, contains 2 mismatches 637910000195 20 bp terminal inverted repeat of ISCro2, contains 2 mismatches 637910000196 10 bp direct repeat flanking ISCro2 637910000197 Insertion sequence ISCro1. 1 of 21 intact ISCro1 elements in CR chromosome, all have 30 bp inverted repeats which contain 12 mismatches, and are flanked by direct repeats of varying length. This element has no direct repeats 637910000198 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000199 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000200 Insertion sequence ISCro1. 1 of 21 intact ISCro1 elements in CR chromosome, all have 30 bp inverted repeats which contain 12 mismatches, and are flanked by direct repeats of varying length. This element has no direct repeats 637910000201 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000202 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000203 Insertion sequence ISCro4. No inverted or direct repeats apparent. 1 of 13 100% identical ISCro4 elements in CR chromosome 637910000204 9 bp direct repeat flanking IS102 637910000205 Insertion sequence IS102 first identified in Escherichia coli pSC101 (IS5 family). 100% ID at DNA level (blastn), 100% ID at protein level (tblastx). Has 18 bp perfect inverted repeats and is flanked by 9 bp direct repeats. 1 of 12 identical IS102 elements in CR chromosome 637910000206 18 bp terminal inverted repeat of IS102 637910000207 18 bp terminal inverted repeat of IS102 637910000208 9 bp direct repeat flanking IS102 637910000209 9 bp direct repeat flanking IS102 637910000210 Insertion sequence IS102 first identified in Escherichia coli pSC101 (IS5 family). 100% ID at DNA level (blastn), 100% ID at protein level (tblastx). Has 18 bp perfect inverted repeats and is flanked by 9 bp direct repeats. 1 of 12 identical IS102 elements in CR chromosome 637910000211 18 bp terminal inverted repeat of IS102 637910000212 18 bp terminal inverted repeat of IS102 637910000213 9 bp direct repeat flanking IS102 637910000214 9 bp direct repeat flanking IS102 637910000215 Insertion sequence IS102 first identified in Escherichia coli pSC101 (IS5 family). 100% ID at DNA level (blastn), 100% ID at protein level (tblastx). Has 18 bp perfect inverted repeats and is flanked by 9 bp direct repeats. 1 of 12 identical IS102 elements in CR chromosome; Comparison with S. typhimurium indicates that the insertion of this IS element has caused the deletion of 2 genes; a transcriptional regulator, and a secreted protein, with no disruption to the 2 adjacent genes n either side 637910000216 18 bp terminal inverted repeat of IS102 637910000217 18 bp terminal inverted repeat of IS102 637910000218 9 bp direct repeat flanking IS102 637910000219 9 bp direct repeat flanking IS102 637910000220 Insertion sequence IS102 first identified in Escherichia coli pSC101 (IS5 family). 100% ID at DNA level (blastn), 100% ID at protein level (tblastx). Has 18 bp perfect inverted repeats and is flanked by 9 bp direct repeats. 1 of 12 identical IS102 elements in CR chromosome 637910000221 18 bp terminal inverted repeat of IS102 637910000222 18 bp terminal inverted repeat of IS102 637910000223 9 bp direct repeat flanking IS102 637910000224 inverted repeat of first 40bp (5') of ISEc14 637910000225 Insertion sequence ISEc14 first identified in Escherichia coli B (IS3 family). 98% ID at DNA level (blastn), 97% ID at protein level (tblastx), contains 2 transposases which have 98% ID to ISEc14 (blastp). Flanked by 26bp inverted repeats which contain 4 mismatches. 1 of 6 identical (100%) intact ISEc14 elements in CR chromosome. 40 bp at 5' terminus of ISEc14 are repeated 0-2 times in tandem adjacent to this IS element, immediately upstream and/or inverted downstream; 3 perfect repeats of the first 40bp at 5' end of ISEc14 immediately adjacent to IS element, 2 of these are direct repeats found in tandem upstream, the other one is an inverted repeat downstream 637910000226 26 bp terminal inverted repeat of ISEc14, contains 4 mismatches 637910000227 40 bp region of ISEc14, repeated twice in tandem adjacent to this copy of ISEc14 immediately upstream and once inverted downstream 637910000228 26 bp terminal inverted repeat of ISEc14, contains 4 mismatches 637910000229 direct repeat of first 40bp (5') of ISEc14 637910000230 2nd direct repeat in tandem of first 40bp (5') of ISEc14 637910000231 IS256 family insertion sequence remnant (83% DNA ID to IS285) flanked by 29 bp inverted repeats which contain 9 mismatches. Downstream is a region of 31 direct repeats of 7 bp, possibly associated with the insertion of this IS element 637910000232 29 bp terminal inverted repeat of IS285 remnant, contains 9 mismatches 637910000233 29 bp terminal inverted repeat of IS285 remnant, contains 9 mismatches 637910000234 Insertion sequence ISCro1. 1 of 21 intact ISCro1 elements in CR chromosome, all have 30 bp inverted repeats which contain 12 mismatches, and are flanked by direct repeats of varying length. This element has no direct repeats 637910000235 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000236 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000237 Insertion sequence ISCro4. No inverted or direct repeats apparent. 1 of 13 100% identical ISCro4 elements in CR chromosome 637910000238 CRISPR_2. DR consensus GTGTTCCCCGCGCCAGCGGGGATAAACCG, DR length 29 bp, Number of spacers 16 637910000239 CRISPR_1. DR consensus TAAGTTCCCCGCGCGAGCGGGGATAGACCGT, DR length 31, Number of spacers 7 637910000240 9 bp direct repeat flanking IS102 637910000241 Insertion sequence IS102 first identified in Escherichia coli pSC101 (IS5 family). 100% ID at DNA level (blastn), 100% ID at protein level (tblastx). Has 18 bp perfect inverted repeats and is flanked by 9 bp direct repeats. 1 of 12 identical IS102 elements in CR chromosome 637910000242 18 bp terminal inverted repeat of IS102 637910000243 18 bp terminal inverted repeat of IS102 637910000244 9 bp direct repeat flanking IS102 637910000245 IS66 family insertion sequence fragment. 90% DNA ID to ISEc23. Missing 5' amd 3' ends 637910000246 IS3 family insertion sequence fragment. 89% DNA ID to ISEam1 637910000247 Insertion sequence ISCro1. 1 of 21 intact ISCro1 elements in CR chromosome, all have 30 bp inverted repeats which contain 12 mismatches, and are flanked by direct repeats of varying length. This element has no direct repeats 637910000248 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000249 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000250 Insertion sequence ISCro4. No inverted or direct repeats apparent. 1 of 13 100% identical ISCro4 elements in CR chromosome 637910000251 51 bp direct repeat, 1 bp mismatch 637910000252 9 bp direct repeat flanking IS102 637910000253 Insertion sequence IS102 first identified in Escherichia coli pSC101 (IS5 family). 100% ID at DNA level (blastn), 100% ID at protein level (tblastx). Has 18 bp perfect inverted repeats and is flanked by 9 bp direct repeats. 1 of 12 identical IS102 elements in CR chromosome 637910000254 18 bp terminal inverted repeat of IS102 637910000255 18 bp terminal inverted repeat of IS102 637910000256 9 bp direct repeat flanking IS102 637910000257 51 bp direct repeat, 1 bp mismatch 637910000258 direct repeat of first 40bp (5') of ISEc14 637910000259 Insertion sequence ISEc14 first identified in Escherichia coli B (IS3 family). 98% ID at DNA level (blastn), 97% ID at protein level (tblastx), contains 2 transposases which have 98% ID to ISEc14 (blastp). Flanked by 26bp inverted repeats which contain 4 mismatches. 1 of 6 identical (100%) intact ISEc14 elements in CR chromosome. 40 bp at 5' terminus of ISEc14 are repeated 0-2 times in tandem adjacent to this IS element, immediately upstream and/or inverted downstream; 1 perfect repeat of the first 40bp at 5' end of ISEc14 immediately adjacent to IS element, this is a direct repeat found in tandem upstream 637910000260 40 bp region of ISEc14, repeated once in tandem adjacent to this copy of ISEc14 immediately upstream 637910000261 26 bp terminal inverted repeat of ISEc14, contains 4 mismatches 637910000262 26 bp terminal inverted repeat of ISEc14, contains 4 mismatches 637910000263 IS3 family insertion sequence fragment. 85% DNA ID to IS911 637910000264 IS200 family insertion sequence fragment. 94% DNA ID to IS200F. 3' end deleted by ISCro1, 5' end is found adjacent to another ISCro1 element at 3815007..3815526 637910000265 Insertion sequence ISCro1. 1 of 21 intact ISCro1 elements in CR chromosome, all have 30 bp inverted repeats which contain 12 mismatches, and are flanked by direct repeats of varying length. This element has no direct repeats 637910000266 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000267 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000268 Insertion sequence ISCro6 fragment, this is the 5' end of the ISCro6 fragment located at 3818227..3819600 637910000269 18 bp terminal inverted repeat of ISCro6, contains 3 mismatches 637910000270 11 bp direct repeat flanking ISCro6 637910000271 Insertion sequence ISCro4. No inverted or direct repeats apparent. 1 of 13 100% identical ISCro4 elements in CR chromosome 637910000272 9 bp direct repeat flanking IS102 637910000273 Insertion sequence IS102 first identified in Escherichia coli pSC101 (IS5 family). 100% ID at DNA level (blastn), 100% ID at protein level (tblastx). Has 18 bp perfect inverted repeats and is flanked by 9 bp direct repeats. 1 of 12 identical IS102 elements in CR chromosome 637910000274 18 bp terminal inverted repeat of IS102 637910000275 18 bp terminal inverted repeat of IS102 637910000276 9 bp direct repeat flanking IS102 637910000277 Insertion sequence ISCro1. 1 of 21 intact ISCro1 elements in CR chromosome, all have 30 bp inverted repeats which contain 12 mismatches, and are flanked by direct repeats of varying length. This element has no direct repeats 637910000278 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000279 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000280 Insertion sequence ISCro4. No inverted or direct repeats apparent. 1 of 13 100% identical ISCro4 elements in CR chromosome 637910000281 IS200 family insertion sequence fragment. 94% DNA ID to IS200E. 3' end of this element has been deleted by ISCro1, and is found adjacent to another ISCro1 element at 3618890..3619080. 637910000282 Insertion sequence ISCro1. 1 of 21 intact ISCro1 elements in CR chromosome, all have 30 bp inverted repeats which contain 12 mismatches, and are flanked by direct repeats of varying length. This element has no direct repeats 637910000283 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000284 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000285 Insertion sequence ISCro6 3' fragment. The 5' end of this copy of ISCro6 has been disrupted by the adjacent ISCro1, and is found adjacent to another ISCro1 element at 3621778..3621829. The transposase is truncated by a frameshift mutation. Flanked by 18 bp inverted repeats which contain 2 mismatches, and 11 bp direct repeats. 1 of 5 ISCro6 elements in CR chromosome, of which two are intact, two have been disrupted by ISCro1 insertion, and two have frameshift mutated transposases 637910000286 18 bp terminal inverted repeat of ISCro6, contains 3 mismatches 637910000287 11 bp direct repeat flanking ISCro6 637910000288 12 bp inverted repeat of prophage CRP38 invertible tail fibre region 637910000289 12 bp inverted repeat of prophage CRP38 invertible tail fibre region 637910000290 Insertion sequence ISCro4. No inverted or direct repeats apparent. 1 of 13 100% identical ISCro4 elements in CR chromosome 637910000291 Insertion sequence ISCro5. Has 13 bp perfect, subterminal inverted repeats but no direct repeats. 1 of 5 100% identical ISCro5 elements in CR chromosome, ISCro5 includes 7 bp 5' and 3 bp 3' outside of the inverted repeats, common to the IS1111 subgroup of the IS110 family. Each IS element is flanked by the same 4 bp sequence 5' and 7 bp sequence 3' which likely represents its target sequence 637910000292 13 bp subterminal inverted repeat of ISCro5 637910000293 13 bp subterminal inverted repeat of ISCro5 637910000294 10 bp direct repeat flanking ISCro2 637910000295 Insertion sequence ISCro2. Flanked by 20 bp inverted repeats which contain 2 mismatches, and 10 bp direct repeats. 1 of 3 identical ISCro2 elements in CR chromosome 637910000296 20 bp terminal inverted repeat of ISCro2, contains 2 mismatches 637910000297 20 bp terminal inverted repeat of ISCro2, contains 2 mismatches 637910000298 10 bp direct repeat flanking ISCro2 637910000299 4 bp direct repeat 637910000300 region repeated at 635889..639095 637910000301 4 bp direct repeat 637910000302 8 bp direct repeat flanking ISCro1 637910000303 Insertion sequence ISCro1. 1 of 21 intact ISCro1 elements in CR chromosome, all have 30 bp inverted repeats which contain 12 mismatches, and are flanked by direct repeats of varying length. This element has 8 bp direct repeats 637910000304 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000305 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000306 8 bp direct repeat flanking ISCro1 637910000307 Insertion sequence ISCro4. No inverted or direct repeats apparent. 1 of 13 100% identical ISCro4 elements in CR chromosome 637910000308 11 bp direct repeat flanking ISCro3 637910000309 Insertion sequence ISCro3. 1 of 11 intact ISCro3 elements in CR chromosome, all have 18 bp inverted repeats containing 2 bp mismatches, and are flanked by direct repeats of varying length. This element has 11 bp direct repeats 637910000310 18 bp terminal inverted repeat of ISCro3, contains 2 mismatches 637910000311 18 bp terminal inverted repeat of ISCro3, contains 2 mismatches 637910000312 11 bp direct repeat flanking ISCro3 637910000313 8 bp direct repeat flanking ISCro1 637910000314 Insertion sequence ISCro1. 1 of 21 intact ISCro1 elements in CR chromosome, all have 30 bp inverted repeats which contain 12 mismatches, and are flanked by direct repeats of varying length. This element has 8 bp direct repeats 637910000315 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000316 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000317 8 bp direct repeat flanking ISCro1 637910000318 Insertion sequence ISCro3 fragment. 3' end of ISCro3, containing 3' inverted repeat end 637910000319 18 bp terminal inverted repeat of ISCro3, contains 2 mismatches 637910000320 IS3 family insertion sequence fragment. 85% DNA ID to IS3G 637910000321 IS4 family insertion sequence. similar to ISSfl1 637910000322 Insertion sequence ISCro3. 1 of 11 intact ISCro3 elements in CR chromosome, all have 18 bp inverted repeats containing 2 bp mismatches, and are flanked by direct repeats of varying length. This element has no direct repeats 637910000323 18 bp terminal inverted repeat of ISCro3, contains 2 mismatches 637910000324 18 bp terminal inverted repeat of ISCro3, contains 2 mismatches 637910000325 12 bp direct repeat flanking ISCro3 637910000326 Insertion sequence ISCro3. 1 of 11 intact ISCro3 elements in CR chromosome, all have 18 bp inverted repeats containing 2 bp mismatches, and are flanked by direct repeats of varying length. This element has 12 bp direct repeats 637910000327 18 bp terminal inverted repeat of ISCro3, contains 2 mismatches 637910000328 18 bp terminal inverted repeat of ISCro3, contains 2 mismatches 637910000329 12 bp direct repeat flanking ISCro3 637910000330 9 bp direct repeat flanking IS102 637910000331 Insertion sequence IS102 first identified in Escherichia coli pSC101 (IS5 family). 100% ID at DNA level (blastn), 100% ID at protein level (tblastx). Has 18 bp perfect inverted repeats and is flanked by 9 bp direct repeats. 1 of 12 identical IS102 elements in CR chromosome 637910000332 18 bp terminal inverted repeat of IS102 637910000333 18 bp terminal inverted repeat of IS102 637910000334 9 bp direct repeat flanking IS102 637910000335 8 bp direct repeat flanking ISCro1 637910000336 Insertion sequence ISCro1. 1 of 21 intact ISCro1 elements in CR chromosome, all have 30 bp inverted repeats which contain 12 mismatches, and are flanked by direct repeats of varying length. This element has 8 bp direct repeats 637910000337 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000338 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000339 8 bp direct repeat flanking ISCro1 637910000340 4 bp direct repeat flanking prophage CRP49 637910000341 28 bp terminal inverted repeat of prophage CRP49, contains 8 mismatches 637910000342 11 bp direct repeat flanking ISCro3 637910000343 Insertion sequence ISCro3. 1 of 11 intact ISCro3 elements in CR chromosome, all have 18 bp inverted repeats containing 2 bp mismatches, and are flanked by direct repeats of varying length. This element has 11 bp direct repeats 637910000344 18 bp terminal inverted repeat of ISCro3, contains 2 mismatches 637910000345 18 bp terminal inverted repeat of ISCro3, contains 2 mismatches 637910000346 11 bp direct repeat flanking ISCro3 637910000347 28 bp inverted repeat of prophage CRP49 invertible tail fibre region, contains 1 mismatch 637910000348 28 bp inverted repeat of prophage CRP49 invertible tail fibre region, contains 1 mismatch 637910000349 28 bp terminal inverted repeat of prophage CRP49, contains 8 mismatches 637910000350 4 bp direct repeat flanking prophage CRP49 637910000351 8 bp direct repeat flanking ISCro1 637910000352 Insertion sequence ISCro1. 1 of 21 intact ISCro1 elements in CR chromosome, all have 30 bp inverted repeats which contain 12 mismatches, and are flanked by direct repeats of varying length. This element has 8 bp direct repeats 637910000353 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000354 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000355 8 bp direct repeat flanking ISCro1 637910000356 IS3 family insertion sequence fragment. 91% DNA ID to ISEhe3 637910000357 IS21 family insertion sequence fragment. 85% DNA ID to IS100kyp 637910000358 IS3 family insertion sequence fragment. 86% DNA ID to IS911. Internal deletion has truncated both transposases 637910000359 22 bp direct repeat, 4 bp mismatches 637910000360 Insertion sequence ISEc14 first identified in Escherichia coli B (IS3 family). 98% ID at DNA level (blastn), 97% ID at protein level (tblastx), contains 2 transposases which have 98% ID to ISEc14 (blastp). Flanked by 26bp inverted repeats which contain 4 mismatches. 1 of 6 identical (100%) intact ISEc14 elements in CR chromosome. 40 bp at 5' terminus of ISEc14 are repeated 0-2 times in tandem adjacent to this IS element, immediately upstream and/or inverted downstream; no repeats of the first 40bp at 5' end of ISEc14 immediately adjacent to this IS element, and no direct target repeats 637910000361 26 bp terminal inverted repeat of ISEc14, contains 4 mismatches 637910000362 40 bp region of ISEc14, repeated 0-2 times in tandem direct or inverted repeats adjacent to ISEc14 in other locations of the CR genome, but not this copy 637910000363 26 bp terminal inverted repeat of ISEc14, contains 4 mismatches 637910000364 IS3 family insertion sequence fragment. (91% DNA ID to ISSen1) 637910000365 IS3 family insertion sequence. 82% DNA ID to ISEc11 637910000366 22 bp direct repeat, 4 bp mismatches 637910000367 21 bp perfect direct repeat 637910000368 21 bp perfect direct repeat 637910000369 17 bp direct repeat 637910000370 Insertion sequence IS3 637910000371 8 bp direct repeat 637910000372 Insertion sequence IS679 (96% DNA ID to IS679 of EcB171) 637910000373 30 bp terminal inverted repeat, contains 13 mismatches (1 extra mismatch than the inverted repeats of ISCro1 elements in CR) 637910000374 30 bp inverted repeat, 11 bp mismatch 637910000375 8 bp direct repeat 637910000376 Insertion sequence ISEc23 fragment. 98% DNA ID to Ec ISEc23 637910000377 Insertion sequence ISCro1 5' fragment. Has 91% identity to ISCro1 over 184 bp. 1 of 3 ISCro1 remnants in CR chromosome all located within a 6 kb region. This is probably part of the missing 5' end of the large ISCro1 fragment upstream 637910000378 Insertion sequence IS4 fragment. 99% DNA ID to EcK12 IS4 637910000379 Insertion sequence ISCro1 3' fragment, includes 3' inverted repeat end. Has 92% identity to ISCro1 over 174 bp. 1 of 3 ISCro1 remnants in CR chromosome all located within a 6 kb region 637910000380 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000381 17 bp direct repeat 637910000382 Insertion sequence IS102 first identified in Escherichia coli pSC101 (IS5 family). 100% ID at DNA level (blastn), 100% ID at protein level (tblastx). Has 18 bp perfect inverted repeats but this copy has no flanking direct repeats. 1 of 12 identical IS102 elements in CR chromosome 637910000383 18 bp terminal inverted repeat of IS102 637910000384 18 bp terminal inverted repeat of IS102 637910000385 inverted repeat IR1 637910000386 Rep region repeat 637910000387 inverted repeat IR1 637910000388 Rep region repeat 637910000389 Rep region repeat 637910000390 Rep region repeat 637910000391 Rep region repeat 637910000392 direct repeat DR1 637910000393 direct repeat DR1 637910000394 inverted repeat IR2 637910000395 inverted repeat IR2 637910000396 inverted repeat IR3 637910000397 inverted repeat IR3 637910000398 inverted repeat IR4 637910000399 inverted repeat IR4 637910000400 IS91 family insertion sequence fragment. 92% DNA ID to IS91 637910000401 direct repeat DR2 637910000402 direct repeat DR2 637910000403 direct repeat DR3 - 43bp 637910000404 direct repeat DR3 - 43bp 637910000405 direct repeat DR4 - 185bp 637910000406 direct repeat DR4 - 185bp 637910000407 direct repeat DR4 - 185bp 637910000408 direct repeat DR4 - 185bp 637910000409 direct repeat DR4 - 185bp 637910000410 direct repeat DR4 - 185bp 637910000411 direct repeat DR5 - 57bp 637910000412 direct repeat DR5 - 57bp 637910000413 direct repeat DR4 - 185bp 637910000414 direct repeat DR4 - 185bp 637910000415 direct repeat DR6 637910000416 direct repeat DR6 637910000417 direct repeat DR6 637910000418 IS256 family insertion sequence fragment. 90% DNA ID to IS1414 637910000419 inverted repeat 637910000420 inverted repeat 637910000421 direct repeat 637910000422 direct repeat 637910000423 Insertion sequence ISCro1. Has 30 bp inverted repeats which contain 12 mismatches and has no flanking direct repeats. 21 additional intact copies of ISCro1 in CR chromosome 637910000424 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000425 30 bp terminal inverted repeat of ISCro1, contains 12 mismatches 637910000426 (t)8 637910000427 (t)8 637910000428 putative iteron 637910000429 putative iteron 637910000430 putative iteron 637910000431 putative iteron 637910000432 putative iteron 637910000433 DR2 637910000434 DR2 637910000435 putative iteron 637910000436 (a)9 637910000437 (a)8 637910000438 (a)8 637910000439 (gt)4 637910000440 (at)5 637910000441 (a)8 637910000442 (a)8 637910000443 (ccg)5 637910000444 (a)8 637910000445 9 bp direct repeat flanking IS102 637910000446 Insertion sequence IS102. 100% ID to IS102 from E. coli pSC101 (IS5 family). Has 18 bp perfect inverted repeats and is flanked by 9 bp direct repeats. CR chromosome contains an additional 12 identical IS102 elements 637910000447 18 bp inverted repeat of IS102 637910000448 18 bp inverted repeat of IS102 637910000449 9 bp direct repeat flanking IS102 637910000450 (t)8 637910000451 Rep region repeat 637910000452 Rep region repeat 637910000453 Rep region repeat 637910000454 Rep region repeat 637910000455 Rep region repeat 637910000456 Rep region repeat 637910000457 Rep region repeat 637910000458 Rep region repeat 637910000459 Rep region repeat 637910000460 Rep region repeat 637910000461 Rep region repeat 637910000462 (t)8