-- dump date 20120504_142241 -- class Genbank::repeat_region -- table repeat_region_note -- id note 272563000003 IR 272563000004 IR 272563000006 similar to a region within skincd 272563000012 DR. ConTn target site 272563000017 DR. ConTn target site 272563000021 24 bp IR flanking transposase TlpA/B; there are 2 base pairs differences, at positions 5 and 21, between this IR and the others 272563000022 Direct repeat flanking Tn5397 272563000024 Direct repeat flanking Tn5397 272563000025 (gtaaataggatgtaaaa)15; The repeats at the 3' end of this region have 1 or 2 mismatches. 272563000034 similar to a region within skincd 272563000035 Repeat region encompassing (TATGTATAAAAGTGATGCATAAAAGTTTAATATATAGGAATTTAA)10 tandem 45bp imperfect repeats. 272563000047 IStron insertion site 272563000048 DR at the 5' and 3' ends of IStron 272563000049 24 bp IR flanking transposase TlpA/B 272563000050 24 bp IR flanking transposase TlpA/B 272563000051 3' end of CdISt1 272563000052 DR at the 5' and 3' ends of IStron 272563000087 (TTTATAGCAAGTAAGAAATTTAGGGAGTAGGAAGTTTAGTAATAA)17 45 bp tandem imperfect repeats 272563000109 (TGTAGTATAGTAACATATTAGAATATAATGTAGGATTTGTTA)11 42 bp tandem imperfect repeats. 272563000137 DR at the 5' and 3' ends of IStron 272563000138 DR at the 5' and 3' ends of IStron 272563000139 24 bp IR flanking transposase TlpA/B 272563000140 24 bp IR flanking transposase TlpA/B 272563000141 3' end of CdISt1 272563000142 DR at the 5' and 3' ends of IStron 272563000143 23 bp direct direct repeat generated by the insertion of the prophage 272563000146 similar to a region within skincd 272563000147 similar to a region within skincd 272563000148 similar to a region within skincd 272563000149 similar to a region within skincd 272563000151 Inverted repeat 272563000152 Inverted repeat 272563000153 CRISPR leader sequence 272563000154 CRISPR 272563000167 23 bp direct repeat generated by the insertion of the prophage 272563000169 IR 272563000170 direct repeat. The other copy is located at the 3' end of conjugative transposon 4 272563000171 direct repeat. The other copy is located within the conjugative transposon 4, downstream of CD1104. 272563000172 IR 272563000173 DR 272563000174 Imperfect inverted repeat located near the 5' and 3' ends of skincd 272563000175 Inverted repeat 272563000176 Inverted repeat 272563000177 CRISPR leader sequence 272563000178 IR 272563000179 IR 272563000180 CRISPR 272563000195 Imperfect inverted repeat located near the 5' and 3' ends of skincd 272563000196 DR at the 5' and 3' ends of IStron 272563000197 24 bp IR flanking transposase TlpA/B 272563000198 24 bp IR flanking transposase TlpA/B 272563000199 3' end of CdISt1 272563000200 DR at the 5' and 3' ends of IStron 272563000204 Inverted repeat 272563000205 Inverted repeat 272563000206 CRISPR leader sequence 272563000207 CRISPR 272563000220 DR at the 5' and 3' ends of IStron 272563000221 24 bp IR flanking transposase TlpA/B 272563000222 24 bp IR flanking transposase TlpA/B 272563000223 3' end of CdISt1 272563000224 DR at the 5' and 3' ends of IStron 272563000225 CRISPR leader sequence 272563000226 CRISPR 272563000236 DR at the 5' and 3' ends of IStron 272563000237 24 bp IR flanking transposase TlpA/B 272563000238 24 bp IR flanking transposase TlpA/B 272563000239 3' end of CdISt1 272563000240 DR at the 5' and 3' ends of IStron 272563000242 DR at the 5' and 3' ends of IStron 272563000243 24 bp IR flanking transposase TlpA/B 272563000244 24 bp IR flanking transposase TlpA/B 272563000245 3' end of CdISt1 272563000246 DR at the 5' and 3' ends of IStron 272563000247 DR 272563000248 DR 272563000249 CRISPR leader sequence 272563000250 CRISPR 272563000267 DR 272563000268 DR 272563000269 DR at the 5' and 3' ends of IStron 272563000270 24 bp IR flanking transposase TlpA/B 272563000271 24 bp IR flanking transposase TlpA/B 272563000272 3' end of CdISt1 272563000273 DR at the 5' and 3' ends of IStron 272563000274 DR at the 5' and 3' ends of IStron 272563000275 DR at the 5' and 3' ends of IStron; This DR has a 1 bp mismatch relative to all others DR 272563000276 24 bp IR flanking transposase TlpA/B 272563000277 24 bp IR flanking transposase TlpA/B 272563000278 3' end of CdISt1 272563000279 DR at the 5' and 3' ends of IStron 272563000282 direct repeat flanking the laterally acquired genomic island 272563000283 direct repeat flanking the laterally acquired genomic island 272563000284 direct repeat flanking the inserted geneomic island. 272563000285 direct repeat flanking the inserted geneomic island. 272563000286 CRISPR 272563000290 CRISPR leader sequence 272563000291 Tn5398 target sequence 272563000292 duplicated region within Tn5398 272563000293 duplicated region within Tn5398 272563000294 Tn5398 target sequence 272563000295 similar to a region within skin element 272563000296 DR 272563000297 DR 272563000315 similar to a region within skin element 272563000318 DR 272563000319 IR 272563000320 CRISPR 272563000336 CRISPR leader sequence 272563000337 Inverted repeat 272563000338 Inverted repeat 272563000339 3' end of IStron 272563000340 DR at the 5' and 3' ends of IStron 272563000341 24 bp IR flanking transposase TlpA/B 272563000342 DR 272563000343 DR 272563000344 DR 272563000345 DR 272563000346 DR 272563000347 DR 272563000348 IR 272563000349 DR 272563000350 similar (with 1 bp mismatch) to DR at the 5' and 3' ends of IStron 272563000351 17 bp flanking a mobile element 272563000352 CRISPR 272563000360 CRISPR leader sequence 272563000361 Inverted repeat 272563000362 Inverted repeat 272563000363 17 bp flanking a mobile element 272563000366 3' end of IS 272563000367 DR at the 5' and 3' ends of IStron 272563000368 24 bp IR flanking transposase TlpA/B 272563000369 24 bp IR flanking transposase TlpA/B 272563000370 DR at the 5' and 3' ends of IStron 272563000371 similar to a region within skin 272563000390 DR generated by the insertion of prophage. 272563000391 DR at the 5' and 3' ends of IStron 272563000394 10 29 bp direct repeats. The last 2 are not very well conserved; CRISPR 272563000397 Full of mismatches. Not vey well conserved. 272563000405 CRISPR leader sequence 272563000406 Inverted repeat 272563000407 Inverted repeat 272563000408 similar to a region within skincd 272563000409 similar to a region within skincd 272563000410 DR generated by the insertion of prophage. 272563000411 CRISPR 272563000430 CRISPR leader sequence 272563000431 similar (1 bp mismatch) to DR at the 5' and 3' ends of IStron 272563000451 similar to a region within skincd 272563000454 DR at the 5' and 3' ends of IStron 272563000455 DR at the 5' and 3' ends of IStron 272563000467 possible IR 272563000479 inverted repeat. The other copy is located near the 3' end of CD3387. 272563000481 (cctgttgct)3 272563000482 (ctcctgttg)3 272563000483 (tgctcctgt)4 272563000485 inverted repeat. The other copy is located near the 3' end of CD3333 272563000489 similar to a region within skin 272563000490 IR 272563000491 IR