-- dump date 20140619_131106 -- class Genbank::Gene -- table gene_note -- id note 4411216 Hypothetical lipoprotein; frameshift, N-term 4411513 Conserved hypothetical lipoprotein, part (C-term); frameshift, C-term 4411514 transposase, IS1533; may be translated through ribosomal slippage mechanism 4411523 Transposase, ISLbp1, part (N-term) 4411271 Transposase, IS1533; inframe stop 4411188 Conserved hypothetical protein 4411100 Hypothetical protein, part (N-term) 4411102 2'-5' RNA ligase, inframe stop; inframe stop 4410762 Hypothetical protein, part (C-term) 4410731 Malate dehydrogenase (oxaloacetate decarboxylating) 4410663 Acetyl-CoA acetyltransferase 4410321 Zn-dependent oxidoreductase 4410283 Hypothetical protein 4410236 Hypothetical protein 4410238 Short chain dehydrogenase, part (C-term) 4410130 Permease of the major facilitator superfamily 4410135 2-dehydropantoate 2-reductase 4410063 Fatty acid desaturase related protein, part (N- term) 4410064 Signal transduction protein 4409938 Conserved hypothetical protein, part (C-term) 4409939 Sodium/hydrogen antiporter 4409860 Conserved hypothetical protein 4409861 RNA polymerase sigma subunit 4409867 23S ribosomal RNA, contains intron 4409871 Restriction endonuclease S subunit 4409900 Permease, inframe stop 4409909 TPR-repeat-containing protein 4409912 Hypothetical lipoprotein, inframe stop 4409246 2-isopropylmalate synthase 4409256 Sensor histidine kinase 4409258 Conserved hypothetical protein, inframe stop; inframe stop 4409266 Hypothetical protein 4409273 Acetyl-CoA carboxylase 4409307 ATP-dependent DNA helicase, recG-related 4409312 Hypothetical protein 4409325 transposase, IS1501a; may be translated through ribosomal slippage mechanism 4409326 transposase, IS1501a; may be translated through ribosomal slippage mechanism 4409338 Adenylate cyclase family protein, part (N-term) 4409339 Adenylate cyclase family protein, part (middle) 4409340 Adenylate cyclase family protein, part (C-term) 4409343 Deoxyuridine 5'-triphosphate nucleotidohydrolase, part (N-term) 4409347 Conserved hypothetical protein 4409356 Conserved hypothetical protein, part (C-term) 4409357 Conserved hypothetical protein, part (N-term) 4409361 Hypothetical lipoprotein 4409368 Hydrolase (HAD superfamily) 4409393 Acetyltransferase, part (N-term) 4409394 Transposase, YhgA-like 4409413 Hypothetical protein 4409419 Hypothetical lipoprotein, part (C-term) 4409440 Hypothetical protein 4409443 Rhodanese-related thiosulfate sulfurtransferase, part (fragment) 4409451 Transposase, YhgA-like, part (C-term) 4409464 Conserved hypothetical protein 4409469 Transposase, ISLbp12; inframe stop 4409470 Acetyl-CoA acetyltransferase 4409472 CrcB-like protein, part (N-term) 4409482 TolC-related protein 4409483 Cation transporter 4409487 Glutathione S-transferase, inframe stop 4409490 Peptide methionine sulfoxide reductase, part (truncated) 4409503 Sensor histidine kinase of a two component response regulator 4409505 CrcB-like protein, part (C-term) 4409522 Conserved hypothetical protein 4409532 Single-strand DNA binding protein family 4409533 Conserved hypothetical protein 4409553 possible pseudogene, frameshift in the region agaagatttcgaaagattcatacaa, sequence checked, distinct but sharing similarity with carboxy termini from L. interrogans (paralogs?) 4409579 ATP-binding protein of an ABC transporter complex, part (C-term) 4409605 Adenylate/guanylate cyclase 4409615 TonB dependent receptor, inframe stop 4409617 LipL48, lipoprotein 4409632 Dipeptidase, part (N-term) 4409648 Hypothetical protein 4409670 Hypothetical protein, part (C-term) 4409674 transposase, ISLbp5; may be translated through ribosomal slippage mechanism 4409675 Transposase, IS1533, inframe stop; inframe stop 4409709 Leucine-rich repeat protein 4409710 Leucine-rich repeat protein, part (C-term); frameshift, C-term 4409712 Conserved hypothetical protein, inframe stop; inframe stop 4409713 Conserved hypothetical protein 4409714 Conserved hypothetical protein 4409721 Transposase, IS1501, part (C-term); truncated 4409724 23S ribosomal RNA, contains intron 4409726 Transposase, ISLbp2, part (C-term); truncated 4409729 Hypothetical protein, part (N-term) 4409746 Transposase, IS1533, part (N-term) 4409747 Transposase, ISLbp5 4409749 Transposase, IS1533, part (remnant) 4409753 Transposase, YhgA-like, part (C-term); truncated 4409754 Hypothetical protein, part (C-term) 4409755 Universal stress protein UspA 4409758 Dipeptidase 4409760 Transcriptional regulator, HTH domain 4409768 Conserved hypothetical protein; frameshift, C-term 4409770 Acyltransferase; frameshift, C-term 4409778 Transposase, IS1533, part (remnant) 4409780 Transposase, IS1533, part (C-term) 4409836 Fatty acid/phospholipid biosynthesis enzyme 4409848 Transposase, part (N-term) 4409850 Hypothetical protein 4409927 Conserved hypothetical lipoprotein, part (C-term); interrupted by IS1533, C-term 4409928 Conserved hypothetical lipoprotein 4409930 OMA87 related protein 4409932 Alpha-beta hydrolase 4412048 Metal-dependent hydrolase 4412051 Conserved hypothetical protein 4412052 Lipoprotein releasing system, LolE permease component, inframe stop; inframe stop 4412030 Hypothetical protein, inframe stop 4412033 transposase, ISLbp9; may be translated through ribosomal slippage mechanism 4412034 Transposase, ISLbp5 4412008 TonB dependent receptor; frameshift, N-term 4412013 Hypothetical protein, part (N-term); frameshift, N-term 4412014 Hypothetical protein, part (C-term); frameshift, C-term 4411830 Conserved hypothetical protein, inframe stop 4411833 Transposase, IS1533, inframe stop; inframe stop 4411834 Sensor histidine kinase of a two component response regulator; interrupted by IS1533, middle and recombination 4411892 Transposase, ISLbp5 4411893 Transposase, IS1501a, part (N-term) 4411897 Transposase, IS1533; frameshift inframe stop 4411898 Sensor histidine kinase of a two component response regulator, part (N-term); interrupted by IS1533, N-term and recombination 4411858 Hypothetical protein; frameshift, N-term 4411337 Glycosyltransferase; frameshift, N-term 4411350 Transposase, IS1533, part (C-term); truncated, C-term 4411281 Transposase, ISLbp2, part (remnant) 4411282 transposase, ISLbp5; may be translated through ribosomal slippage mechanism 4411135 Transposase, ISLbp5, part (C-term) 4411136 Transposase, IS1533, part (C-term) 4411137 Transposase, ISlin1, part (remnant) 4411056 Hypothetical protein, part (N-term) 4411057 Hypothetical protein, part (C-term) 4411069 Signal transduction histidine kinase, inframe stop; inframe stop 4411018 ATP-binding protein of an ABC transporter complex, part (C-term) 4411019 Signal transduction protein 4411030 Hypothetical protein; frameshift, N-term 4411031 Hypothetical protein, part (C-term) 4411032 Hypothetical protein, part (C-term); frameshift, C-term 4410970 Conserved hypothetical protein, part (C-term) 4410972 Cation efflux system protein1) 4410977 Transposase, ISLbp8, part (N-term) 4410776 Transposase, IS1501a; truncated 4410777 Transposase, ISLbp3, part (N-term); truncated 4410778 Transposase, ISLbp5 4410779 Hypothetical protein, part (C-term) 4410782 Transposase, IS1533, part C-term; truncated 4410197 Hypothetical protein 4410199 Hypothetical protein 4410201 Long-chain-fatty-acid--CoA ligase, part (N-term) 4410160 Hypothetical protein 4409973 Transposase, ISLbp5, part (remnant) 4409983 Alkylglycerone-phosphate synthase 4409984 Glycerol-3-phosphate dehydrogenase 4409965 transposase, IS1501a; may be translated through ribosomal slippage mechanism 4409966 Transposase, ISLbp3, part (N-term); truncated 4410038 ATPase with chaperone activity 4411678 Conserved hypothetical protein 4411689 Cation efflux protein 4411482 Hypothetical protein 4411412 transposase, ISLbp5; may be translated through ribosomal slippage mechanism 4411421 Hypothetical protein, part (C-term) 4411383 Hypothetical protein, inframe stop; inframe stop 4411390 Hypothetical protein 4411245 Serine phosphatase RsbU, regulator of sigma subunit, inframe stop; inframe stop 4411249 Adenylate cyclase related protein 4411250 Transposase, ISLbp6, part (remnant) 4411083 Sterol desaturase 4411085 Glutathione transferase, part (N-term) 4411089 Enoyl-CoA hydratase/isomerase family protein 4411047 Transposase, IS1533, inframe stop; inframe stop 4410804 Signal transduction histidine kinase, part (C- term) 4410805 Transposase, IS1533, inframe stop; inframe stop 4410932 Receiver domain of a two-component regulator complex 4410528 Hemolysin-coregulated protein, part (C-term) 4410491 Hypothetical protein 4410498 Conserved hypothetical protein 4410500 Deoxyribodipyrimidine photolyase; frameshift, C-term 4410216 Conserved hypothetical protein, part (N-term) 4410217 Transposase, ISLbp3, part (remnant); trucated 4410218 Hypothetical protein 4410223 Ribonuclease BN 4410229 Transposase, IS3 family, part (N-term); trucated 4410343 KefB related transport protein 4410347 transposase, IS1501a; may be translated through ribosomal slippage mechanism 4410324 Two component response regulator, part (middle) 4410325 Two component response regulator, part 4410328 Chemotaxis protein histidine kinase 4410340 Efflux pump, AcrB family 4410086 Iron-regulated membrane protein; frameshift; C-term 4410087 transposase, ISLbp5; may be translated through ribosomal slippage mechanism 4410093 Enoyl-CoA hydratase/isomerase family protein, part (C-term) 4410094 transposase, IS1501a; may be translated through ribosomal slippage mechanism 4410097 Hypothetical lipoprotein; frameshift, N-term 4410100 Long-chain-fatty-acid--CoA ligase 4409993 Transposase, ISLbp7, part (remnant) 4409994 Transposase, ISLbp6, part (remnant); truncated 4412160 Epimerase; frameshift, C-term 4411453 Hypothetical protein; frameshift, C-term 4411455 transposase, IS1501a; may be translated through ribosomal slippage mechanism 4411391 Transposase, IS1533, part (remnant); truncated 4411393 Transposase, IS1533, part (C-term); truncated 4410431 Magnesium and cobalt transport protein 4410433 Conserved hypothetical protein, inframe stop; inframe stop 4410435 Conserved hypothetical protein, inframe stop; inframe stop 4410904 transposase, ISLbp5; may be translated through ribosomal slippage mechanism 4410908 Sensor histidine kinase of a two component response regulator, inframe stop; inframe stop 4410918 Hypothetical protein 4410919 Hypothetical protein, part (C-term) 4410867 Leucine-rich repeat containing protein 4410869 Conserved hypothetical protein 4410878 Transcriptional regulator, MarR family; frameshift, N-term 4410839 Transposase, IS1533, part (N-term); truncated 4410394 Adenylate/guanylate cyclase, part (Remnant of C- term) 4410412 Lipoprotein releasing system, LolE permease component 4410385 Cation/multidrug efflux pump 4410388 Transposase, YhgA-like, part (C-term); truncated, inframe stop 4410389 transposase, ISLbp5; may be translated through ribosomal slippage mechanism 4410363 ADP-ribose pyrophosphatase, part (C-term) 4410367 Hypothetical protein, inframe stop 4410262 Transposase, ISlin1, part (C-term) 4410265 Acetyl-CoA synthetase 4412119 ATPase/Protein kinase; frameshift, C-term 4412121 Conserved hypothetical protein 4412075 Sensor protein of a two component response regulator 4411917 TonB dependent receptor 4411639 Hypothetical protein 4411640 Transposase, YhgA-like; truncated 4411642 Transporter transmembrane protein 4411430 Component of an ABC transporter system 4411432 Hypothetical lipoprotein 4411318 transposase, ISLbp5; may be translated through ribosomal slippage mechanism 4411320 Transposase, part (C-term); truncated 4411325 Transposase, ISLbp5, part (remnant) 4411332 Hypothetical protein; frameshift, N-term 4410978 Hypothetical protein 4410950 Receiver component of a two component response regulator 4410578 Phosphohydrolase; frameshift, C-term 4410586 Transposase, ISLbp10, part (remnant); truncated 4410589 Hypothetical protein 4410590 Hypothetical lipoprotein 4410454 Hypothetical protein; frameshift, C-term 4410458 Transposase, ISLbp10, inframe stop; inframe stop 4410423 Cytochrome c peroxidase 4410424 Transposase, IS1533, part (N-term); truncated 4410024 Zn-dependent oxidoreductase 4411303 Conserved hypothetical protein 4411308 Hypothetical protein, part (N-term) 4412196 Hypothetical protein 4412198 Transposase, YhgA-like; truncated 4412199 Adenylate/guanylate cyclase, part (C-term) 4412201 Leucine-rich repeat protein, part (N-term) 4412202 Conserved hypothetical lipoprotein 4412203 O-methyltransferase 4411930 Na+ transporter 4411500 AcrA-related membrane protein, part 4411501 Cation efflux system protein 4411503 Sensor histidine kinase of a two component response regulator 4410504 transposase, IS1533; may be translated through ribosomal slippage mechanism 4410505 Hypothetical protein, part (C-term) 4410506 Metal-dependent hydrolase 4410508 Cation/multidrug efflux pump 4412109 Conserved hypothetical lipoprotein, part (N-tern) 4411629 Transcriptional regulator, AraC family; frameshift, N-term 4411633 [Protein-PII] uridylyltransferase; frameshift, N-term 4411635 Conserved hypothetical protein 4411804 Conserved hypothetical protein; frameshift, C-term 4411807 Cytochrome c peroxidase, inframe stop; inframe stop 4411707 transposase, ISLbp5; may be translated through ribosomal slippage mechanism 4411655 Hypothetical protein, part (C-term); truncated by IS1533 4411669 Conserved hypothetical protein; frameshift, N-term 4411612 Transcriptional regulator containing CBS domains; frameshift, N-term 4411206 Sensor histidine kinase and response regulator of a two component complex; frameshift, N-term 4411123 Conserved hypothetical protein, part (C-term); truncated, C-term 4411105 Hypothetical protein; frameshift, N-term 4411106 Transposase, IS1533 4410888 Leucine-rich repeat protein, part (C-term) 4410890 Conserved hypothetical protein; frameshift, C-term 4410897 Hypothetical protein, part (C-term) 4410901 ATP-binding protein of an ABC transporter complex, part (N-term) LOA2966 4410637 Zn-dependent hydrolase 4410070 Transposase, ISlin1, part (remnant); truncated 4410190 Hypothetical protein; frameshift, N-term 4410191 Flavoprotein, inframe stop; inframe stop 4410849 Strictosidine synthase 4410858 Hydrolase / acyltransferase 4412147 Conserved hypothetical protein, part (N-term) 4412148 Oxidoreductase, part (N-term) 4411976 Conserved hypothetical lipoprotein, part (C-term); frameshift, C-term 4411843 NAD-dependent aldehyde dehydrogenase, inframe stop; inframe stop 4411844 Monooxygenase, part (C-term); truncated; C-term 4411762 ATP-binding protein of an ABC transporter complex, part (C-term); interrupted by IS1533, C-term and recombination 4411588 transposase, ISLbp2; may be translated through ribosomal slippage mechanism 4411232 transposase, IS1501a; may be translated through ribosomal slippage mechanism 4410613 Hypothetical lipoprotein, inframe stop; inframe stop 4410618 Beta-galactosidase, inframe stop; inframe stop 4410624 Transposase, ISLbp1, part (N-term); truncated 4410625 Transposase, IS1533, part (C-term); truncated; C-term 4410156 Transposase, ISLbp1, part (C-term) 4412247 Hypothetical protein 4412454 Bacteriophage-related protein 4412468 Transposase, ISLbp3 4412423 Transposase, ISlin1, part (N-term); truncated, N-term 4412424 Transposase, ISLbp15, part (C-term) 4412425 Sodium-solute symporter 4412429 Hypothetical protein, part (C-term) 4412430 Adenylate/Guanylate cyclase 4412431 Chromate transporter 4412379 Short chain dehydrogenase 4412399 XerD related protein (integrase family) 4412390 Sodium-dependent transporter 4412391 Transposase, ISlin1, part (C-term); truncated, C-term 4412392 Transposase, IS1533, inframe stop; inframe stop 4412393 Hypothetical lipoprotein, part (C-term) 4412343 Hypothetical lipoprotein, part (N-term) 4412339 Conserved hypothetical protein 4412264 Transposase, IS1533, part (C-term); truncated, C-term 4412266 Transposase, ISlin13, part (remnant) 4412306 Transposase, IS1533, part (C-term); truncated, C-term 4412307 Transposase, IS1533, part (middle); truncated, middle 4412310 Transposase, ISLbp8, part (N-term); truncated, N-term 4412320 Acetyl-CoA hydrolase 4412322 Glutamate synthase domain 2 protein 4412268 Hypothetical protein 4412284 Conserved hypothetical protein, part (C-term) 4412285 Conserved hypothetical protein, part (N-term)