-- dump date 20140619_151439 -- class Genbank::misc_feature -- table misc_feature_note -- id note 717522000001 chromosomal replication initiator protein DnaA; Region: DnaA; TIGR00362 717522000002 The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009 717522000003 Walker A motif; other site 717522000004 ATP binding site [chemical binding]; other site 717522000005 Walker B motif; other site 717522000006 arginine finger; other site 717522000007 C-terminal domain of bacterial DnaA proteins. The DNA-binding C-terminal domain of DnaA contains a helix-turn-helix motif that specifically interacts with the DnaA box, a 9-mer motif that occurs repetitively in the replication origin oriC. Multiple...; Region: Bac_DnaA_C; cd06571 717522000008 DnaA box-binding interface [nucleotide binding]; other site 717522000009 DNA polymerase III subunit beta; Validated; Region: PRK07761 717522000010 Beta clamp domain. The beta subunit (processivity factor) of DNA polymerase III holoenzyme, refered to as the beta clamp, forms a ring shaped dimer that encircles dsDNA (sliding clamp) in bacteria. The beta-clamp is structurally similar to the trimeric...; Region: beta_clamp; cd00140 717522000011 putative DNA binding surface [nucleotide binding]; other site 717522000012 dimer interface [polypeptide binding]; other site 717522000013 beta-clamp/clamp loader binding surface; other site 717522000014 beta-clamp/translesion DNA polymerase binding surface; other site 717522000015 recF protein; Region: recf; TIGR00611 717522000016 ATP-binding cassette domain of RecF; Region: ABC_RecF; cd03242 717522000017 Walker A/P-loop; other site 717522000018 ATP binding site [chemical binding]; other site 717522000019 Q-loop/lid; other site 717522000020 ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201 717522000021 ABC transporter signature motif; other site 717522000022 Walker B; other site 717522000023 D-loop; other site 717522000024 H-loop/switch region; other site 717522000025 hypothetical protein; Provisional; Region: PRK03195 717522000026 DNA gyrase subunit B; Validated; Region: gyrB; PRK05644 717522000027 Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075 717522000028 Mg2+ binding site [ion binding]; other site 717522000029 G-X-G motif; other site 717522000030 TopoIIA_Trans_DNA_gyrase: Transducer domain, having a ribosomal S5 domain 2-like fold, of the type found in proteins of the type IIA family of DNA topoisomerases similar to the B subunits of E. coli DNA gyrase and E. coli Topoisomerase IV which are; Region: TopoII_Trans_DNA_gyrase; cd00822 717522000031 anchoring element; other site 717522000032 dimer interface [polypeptide binding]; other site 717522000033 ATP binding site [chemical binding]; other site 717522000034 TOPRIM_TopoIIA_GyrB: topoisomerase-primase (TOPRIM) nucleotidyl transferase/hydrolase domain of the type found in proteins of the type IIA family of DNA topoisomerases similar to the Escherichia coli GyrB subunit. TopoIIA enzymes cut both strands of the...; Region: TOPRIM_TopoIIA_GyrB; cd03366 717522000035 active site 717522000036 putative metal-binding site [ion binding]; other site 717522000037 DNA gyrase B subunit, carboxyl terminus; Region: DNA_gyraseB_C; pfam00986 717522000038 DNA gyrase subunit A; Validated; Region: PRK05560 717522000039 DNA Topoisomerase, subtype IIA; domain A'; bacterial DNA topoisomerase IV (C subunit, ParC), bacterial DNA gyrases (A subunit, GyrA),mammalian DNA toposiomerases II. DNA topoisomerases are essential enzymes that regulate the conformational changes...; Region: TOP4c; cd00187 717522000040 CAP-like domain; other site 717522000041 active site 717522000042 primary dimer interface [polypeptide binding]; other site 717522000043 DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989 717522000044 DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989 717522000045 DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989 717522000046 DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989 717522000047 DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989 717522000048 DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989 717522000049 Transmembrane domain of unknown function (DUF3566); Region: DUF3566; pfam12089 717522000050 Protein of unknown function (DUF2562); Region: DUF2562; pfam10814 717522000051 cyclophilin: cyclophilin-type peptidylprolyl cis- trans isomerases. This family contains eukaryotic, bacterial and archeal proteins which exhibit a peptidylprolyl cis- trans isomerases activity (PPIase, Rotamase) and in addition bind the...; Region: cyclophilin; cd00317 717522000052 active site 717522000053 Protein of unknown function (DUF2581); Region: DUF2581; pfam10756 717522000054 putative septation inhibitor protein; Reviewed; Region: PRK00159 717522000055 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3879 717522000056 Bacterial protein of unknown function (DUF881); Region: DUF881; pfam05949 717522000057 Type 1 glutamine amidotransferase (GATase1) domain found in Anthranilate synthase; Region: GATase1_Anthranilate_Synthase; cd01743 717522000058 Glutamine amidotransferase class-I; Region: GATase; pfam00117 717522000059 glutamine binding [chemical binding]; other site 717522000060 catalytic triad [active] 717522000061 Serine/Threonine protein kinases, catalytic domain; Region: S_TKc; smart00220 717522000062 Catalytic domain of Protein Kinases; Region: PKc; cd00180 717522000063 active site 717522000064 ATP binding site [chemical binding]; other site 717522000065 substrate binding site [chemical binding]; other site 717522000066 activation loop (A-loop); other site 717522000067 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2815 717522000068 PASTA domain of bacterial serine/threonine kinase pknB-like proteins. PknB is a member of a group of related transmembrane sensor kinases present in many gram positive bacteria, which has been shown to regulate cell shape in Mycobacterium tubercolosis; Region: PASTA_pknB; cd06577 717522000069 PASTA domain of bacterial serine/threonine kinase pknB-like proteins. PknB is a member of a group of related transmembrane sensor kinases present in many gram positive bacteria, which has been shown to regulate cell shape in Mycobacterium tubercolosis; Region: PASTA_pknB; cd06577 717522000070 PASTA domain of bacterial serine/threonine kinase pknB-like proteins. PknB is a member of a group of related transmembrane sensor kinases present in many gram positive bacteria, which has been shown to regulate cell shape in Mycobacterium tubercolosis; Region: PASTA_pknB; cd06577 717522000071 PASTA domain of bacterial serine/threonine kinase pknB-like proteins. PknB is a member of a group of related transmembrane sensor kinases present in many gram positive bacteria, which has been shown to regulate cell shape in Mycobacterium tubercolosis; Region: PASTA_pknB; cd06577 717522000072 There is no tandem duplication of DU1 in BCG Mexico like that present in BCG Pasteur 717522000073 Serine/Threonine protein kinases, catalytic domain; Region: S_TKc; smart00220 717522000074 Catalytic domain of Protein Kinases; Region: PKc; cd00180 717522000075 active site 717522000076 ATP binding site [chemical binding]; other site 717522000077 substrate binding site [chemical binding]; other site 717522000078 activation loop (A-loop); other site 717522000079 Cell division protein FtsI/penicillin-binding protein 2 [Cell envelope biogenesis, outer membrane]; Region: FtsI; COG0768 717522000080 Penicillin binding protein transpeptidase domain; Region: Transpeptidase; pfam00905 717522000081 Bacterial cell division membrane protein [Cell division and chromosome partitioning]; Region: FtsW; COG0772 717522000082 Serine/threonine phosphatases, family 2C, catalytic domain; The protein architecture and deduced catalytic mechanism of PP2C phosphatases are similar to the PP1, PP2A, PP2B family of protein Ser/Thr phosphatases, with which PP2C shares no sequence...; Region: PP2Cc; cd00143 717522000083 active site 717522000084 FOG: FHA domain [Signal transduction mechanisms]; Region: COG1716 717522000085 Forkhead associated domain (FHA); found in eukaryotic and prokaryotic proteins. Putative nuclear signalling domain. FHA domains may bind phosphothreonine, phosphoserine and sometimes phosphotyrosine. In eukaryotes, many FHA domain-containing proteins...; Region: FHA; cd00060 717522000086 phosphopeptide binding site; other site 717522000087 Protein of unknown function (DUF2662); Region: DUF3662; pfam12401 717522000088 Forkhead associated domain (FHA); found in eukaryotic and prokaryotic proteins. Putative nuclear signalling domain. FHA domains may bind phosphothreonine, phosphoserine and sometimes phosphotyrosine. In eukaryotes, many FHA domain-containing proteins...; Region: FHA; cd00060 717522000089 FOG: FHA domain [Signal transduction mechanisms]; Region: COG1716 717522000090 phosphopeptide binding site; other site 717522000091 Nitronate monooxygenase; Region: NMO; pfam03060 717522000092 2-Nitropropane dioxygenase (NPD), one of the nitroalkane oxidizing enzyme families, catalyzes oxidative denitrification of nitroalkanes to their corresponding carbonyl compounds and nitrites. NDP is a member of the NAD(P)H-dependent flavin oxidoreductase...; Region: NPD_like; cd04730 717522000093 FMN binding site [chemical binding]; other site 717522000094 substrate binding site [chemical binding]; other site 717522000095 putative catalytic residue [active] 717522000096 Transcription factor WhiB; Region: Whib; pfam02467 717522000097 Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396 717522000098 Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093 717522000099 non-specific DNA binding site [nucleotide binding]; other site 717522000100 salt bridge; other site 717522000101 sequence-specific DNA binding site [nucleotide binding]; other site 717522000103 Domain of unknown function (DUF4226); Region: DUF4226; pfam10774 717522000104 Domain of unknown function (DUF4226); Region: DUF4226; pfam10774 717522000105 Protein of unknown function (DUF2580); Region: DUF2580; pfam10824 717522000106 Protein of unknown function (DUF2694); Region: DUF2694; pfam10904 717522000107 Protein of unknown function (DUF2710); Region: DUF2710; pfam10921 717522000108 Acetyltransferase (GNAT) domain; Region: Acetyltransf_6; pfam13480 717522000109 7-keto-8-aminopelargonate synthetase and related enzymes [Coenzyme metabolism]; Region: BioF; COG0156 717522000110 pyridoxal phosphate-dependent acyltransferase, putative; Region: gly_Cac_T_rel; TIGR01825 717522000111 pyridoxal 5'-phosphate binding pocket [chemical binding]; other site 717522000112 catalytic residue [active] 717522000113 Acyl carrier protein [Lipid metabolism / Secondary metabolites biosynthesis, transport, and catabolism]; Region: AcpP; COG0236 717522000114 Ketosteroid isomerase-related protein [General function prediction only]; Region: COG3631 717522000115 Acyl-CoA synthetases (AMP-forming)/AMP-acid ligases II [Lipid metabolism / Secondary metabolites biosynthesis, transport, and catabolism]; Region: CaiC; COG0318 717522000116 Fatty acyl-AMP ligase (FAAL); Region: FAAL; cd05931 717522000117 acyl-activating enzyme (AAE) consensus motif; other site 717522000118 active site 717522000119 Mycothiol maleylpyruvate isomerase N-terminal domain; Region: MDMPI_N; pfam11716 717522000120 H+ Antiporter protein; Region: 2A0121; TIGR00900 717522000121 hypothetical protein; Validated; Region: PRK00228 717522000122 Probable lipoprotein LpqN; Region: Lpp-LpqN; pfam10738 717522000123 leucyl-tRNA synthetase; Validated; Region: leuS; PRK00390 717522000124 nucleotidyl transferase superfamily; Region: nt_trans; cl00015 717522000125 active site 717522000126 HIGH motif; other site 717522000127 nucleotide binding site [chemical binding]; other site 717522000128 Leucyl-tRNA synthetase, Domain 2; Region: tRNA-synt_1_2; pfam13603 717522000129 nucleotidyl transferase superfamily; Region: nt_trans; cl00015 717522000130 nucleotidyl transferase superfamily; Region: nt_trans; cl00015 717522000131 active site 717522000132 KMSKS motif; other site 717522000133 Anticodon-binding domain of bacterial and eukaryotic mitochondrial leucyl tRNA synthetases; Region: Anticodon_Ia_Leu_BEm; cd07958 717522000134 tRNA binding surface [nucleotide binding]; other site 717522000135 helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347 717522000136 MarR family; Region: MarR; pfam01047 717522000137 Transcriptional regulators [Transcription]; Region: FadR; COG2186 717522000138 Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377 717522000139 DNA-binding site [nucleotide binding]; DNA binding site 717522000140 probable F420-dependent oxidoreductase, MSMEG_2906 family; Region: F420_MSMEG_2906; TIGR03856 717522000141 Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cl07892 717522000142 Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596 717522000143 Myo-inositol-1-phosphate synthase [Lipid metabolism]; Region: INO1; COG1260 717522000144 Myo-inositol-1-phosphate synthase; Region: NAD_binding_5; cl00554 717522000145 Predicted transcriptional regulators [Transcription]; Region: COG1695 717522000146 Transcriptional regulator PadR-like family; Region: PadR; pfam03551 717522000147 Domain of unknown function (DUF1707); Region: DUF1707; pfam08044 717522000148 Transglycosylase; Region: Transgly; pfam00912 717522000149 penicillin-binding protein, 1A family; Region: PBP_1a_fam; TIGR02074 717522000150 Penicillin binding protein transpeptidase domain; Region: Transpeptidase; pfam00905 717522000151 Predicted integral membrane protein [Function unknown]; Region: COG5650 717522000152 Type 1 glutamine amidotransferase (GATase1)-like domain found in a subgroup of proteins similar to PfpI from Pyrococcus furiosus; Region: GATase1_PfpI_2; cd03139 717522000153 conserved cys residue [active] 717522000154 30S ribosomal protein S6; Reviewed; Region: rpsF; PRK00453 717522000155 Single-stranded DNA-binding protein [DNA replication, recombination, and repair]; Region: Ssb; COG0629 717522000156 SSB_OBF: A subfamily of OB folds similar to the OB fold of ssDNA-binding protein (SSB). SSBs bind with high affinity to ssDNA. They bind to and protect ssDNA intermediates during DNA metabolic pathways. All bacterial and eukaryotic SSBs studied to date...; Region: SSB_OBF; cd04496 717522000157 dimer interface [polypeptide binding]; other site 717522000158 ssDNA binding site [nucleotide binding]; other site 717522000159 tetramer (dimer of dimers) interface [polypeptide binding]; other site 717522000160 30S ribosomal protein S18; Reviewed; Region: rpsR; PRK00391 717522000161 50S ribosomal protein L9; Reviewed; Region: rplI; PRK00137 717522000162 Ribosomal protein L9, N-terminal domain; Region: Ribosomal_L9_N; pfam01281 717522000163 Ribosomal protein L9, C-terminal domain; Region: Ribosomal_L9_C; pfam03948 717522000164 replicative DNA helicase; Validated; Region: PRK07773 717522000165 DnaB-like helicase N terminal domain; Region: DnaB; pfam00772 717522000166 DnaB helicase C terminal domain. The hexameric helicase DnaB unwinds the DNA duplex at the chromosome replication fork. Although the mechanism by which DnaB both couples ATP hydrolysis to translocation along DNA and denatures the duplex is unknown, a...; Region: DnaB_C; cd00984 717522000167 Walker A motif; other site 717522000168 ATP binding site [chemical binding]; other site 717522000169 Walker B motif; other site 717522000170 DNA binding loops [nucleotide binding] 717522000171 Hedgehog/Intein domain, found in Hedgehog proteins as well as proteins which contain inteins and undergo protein splicing (e.g. DnaB, RIR1-2, GyrA and Pol). In protein splicing an intervening polypeptide sequence - the intein - is excised from a protein; Region: Hint; cd00081 717522000172 protein-splicing catalytic site; other site 717522000173 thioester formation/cholesterol transfer; other site 717522000174 Hedgehog/Intein domain, found in Hedgehog proteins as well as proteins which contain inteins and undergo protein splicing (e.g. DnaB, RIR1-2, GyrA and Pol). In protein splicing an intervening polypeptide sequence - the intein - is excised from a protein; Region: Hint; cd00081 717522000175 protein-splicing catalytic site; other site 717522000176 RecA-like NTPases. This family includes the NTP binding domain of F1 and V1 H+ATPases, DnaB and related helicases as well as bacterial RecA and related eukaryotic and archaeal recombinases. This group also includes bacterial conjugation proteins and...; Region: RecA-like_NTPases; cl17233 717522000177 Macro domain, Poa1p_like family. The macro domain is a high-affinity ADP-ribose binding module found in a variety of proteins as a stand-alone domain or in combination with other domains like in histone macroH2A and some PARPs (poly ADP-ribose...; Region: Macro_Poa1p_like; cd02901 717522000178 ADP-ribose binding site [chemical binding]; other site 717522000179 Predicted phosphatase homologous to the C-terminal domain of histone macroH2A1 [General function prediction only]; Region: COG2110 717522000180 Glycosyl hydrolases family 6; Region: Glyco_hydro_6; pfam01341 717522000181 FAD/FMN-containing dehydrogenases [Energy production and conversion]; Region: GlcD; COG0277 717522000182 FAD binding domain; Region: FAD_binding_4; pfam01565 717522000183 Berberine and berberine like; Region: BBE; pfam08031 717522000184 hypothetical protein; Provisional; Region: PRK12438 717522000185 hypothetical protein; Validated; Region: PRK00068 717522000186 PIN domain of the Pyrobaculum aerophilum Pae0151 and Pae2754 proteins and homologs; Region: PIN_Pae0151; cd09873 717522000187 homotetrameric interface [polypeptide binding]; other site 717522000188 putative active site [active] 717522000189 metal binding site [ion binding]; metal-binding site 717522000190 Monomeric isocitrate dehydrogenase [Energy production and conversion]; Region: Icd; COG2838 717522000191 Monomeric isocitrate dehydrogenase; Region: IDH; pfam03971 717522000192 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522000193 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522000194 short chain dehydrogenase; Provisional; Region: PRK06197 717522000195 retinol dehydrogenase (retinol-DH), Light dependent Protochlorophyllide (Pchlide) OxidoReductase (LPOR) and related proteins, classical (c) SDRs; Region: retinol-DH_like_SDR_c_like; cd05327 717522000196 putative NAD(P) binding site [chemical binding]; other site 717522000197 active site 717522000198 L-serine dehydratase, iron-sulfur-dependent, single chain form; Region: sda_mono; TIGR00720 717522000199 Serine dehydratase beta chain; Region: SDH_beta; pfam03315 717522000200 Serine dehydratase alpha chain; Region: SDH_alpha; pfam03313 717522000201 serine hydroxymethyltransferase; Reviewed; Region: glyA; PRK00011 717522000202 Serine-glycine hydroxymethyltransferase (SHMT). This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). SHMT carries out interconversion of serine and glycine; it catalyzes the transfer of hydroxymethyl...; Region: SHMT; cd00378 717522000203 dimer interface [polypeptide binding]; other site 717522000204 active site 717522000205 glycine-pyridoxal phosphate binding site [chemical binding]; other site 717522000206 folate binding site [chemical binding]; other site 717522000207 Retron-type reverse transcriptase [DNA replication, recombination, and repair]; Region: COG3344 717522000208 RT_G2_intron: Reverse transcriptases (RTs) with group II intron origin. RT transcribes DNA using RNA as template. Proteins in this subfamily are found in bacterial and mitochondrial group II introns. Their most probable ancestor was a retrotransposable...; Region: RT_G2_intron; cd01651 717522000209 putative NTP binding site [chemical binding]; other site 717522000210 MacB-like periplasmic core domain; Region: MacB_PCD; pfam12704 717522000211 ATP-binding cassette domain of the transporters involved in export of lipoprotein and macrolide, and cell division protein; Region: ABC_MJ0796_LolCDE_FtsE; cd03255 717522000212 ABC-type antimicrobial peptide transport system, ATPase component [Defense mechanisms]; Region: SalX; COG1136 717522000213 Walker A/P-loop; other site 717522000214 ATP binding site [chemical binding]; other site 717522000215 Q-loop/lid; other site 717522000216 ABC transporter signature motif; other site 717522000217 Walker B; other site 717522000218 D-loop; other site 717522000219 H-loop/switch region; other site 717522000220 cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases [Signal transduction mechanisms]; Region: Crp; COG0664 717522000221 effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038 717522000222 ligand binding site [chemical binding]; other site 717522000223 flexible hinge region; other site 717522000224 Imidazolonepropionase and related amidohydrolases [Secondary metabolites biosynthesis, transport, and catabolism]; Region: HutI; COG1228 717522000225 Superfamily of metallo-dependent hydrolases (also called amidohydrolase superfamily) is a large group of proteins that show conservation in their 3-dimensional fold (TIM barrel) and in details of their active site. The vast majority of the members have a...; Region: metallo-dependent_hydrolases; cl00281 717522000226 Metallo-dependent hydrolases, subgroup A is part of the superfamily of metallo-dependent hydrolases, a large group of proteins that show conservation in their 3-dimensional fold (TIM barrel) and in details of their active site. The vast majority of the...; Region: Met_dep_hydrolase_A; cd01299 717522000227 active site 717522000228 Bifunctional PLP-dependent enzyme with beta-cystathionase and maltose regulon repressor activities [Amino acid transport and metabolism]; Region: MalY; COG1168 717522000229 Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609 717522000230 pyridoxal 5'-phosphate binding site [chemical binding]; other site 717522000231 homodimer interface [polypeptide binding]; other site 717522000232 catalytic residue [active] 717522000233 Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596 717522000234 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522000235 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522000236 Pyridoxamine 5'-phosphate oxidase; Region: Pyridox_ox_2; pfam12900 717522000237 Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090 717522000238 dimerization interface [polypeptide binding]; other site 717522000239 putative DNA binding site [nucleotide binding]; other site 717522000240 putative Zn2+ binding site [ion binding]; other site 717522000241 Ni,Fe-hydrogenase III small subunit [Energy production and conversion]; Region: COG3260 717522000242 hydrogenase 4 subunit B; Validated; Region: PRK06521 717522000243 NADH-Ubiquinone/plastoquinone (complex I), various chains; Region: Oxidored_q1; pfam00361 717522000244 Formate hydrogenlyase subunit 4 [Energy production and conversion]; Region: HyfC; COG0650 717522000245 NADH dehydrogenase; Region: NADHdh; cl00469 717522000246 Hydrogenase 4 membrane component (E) [Energy production and conversion]; Region: HyfE; COG4237 717522000247 NADH-Ubiquinone/plastoquinone (complex I), various chains; Region: Oxidored_q1; pfam00361 717522000248 Ni,Fe-hydrogenase III component G [Energy production and conversion]; Region: HycE; COG3262 717522000249 Ni,Fe-hydrogenase III large subunit [Energy production and conversion]; Region: HycE; COG3261 717522000250 NADH dehydrogenase subunit D; Validated; Region: PRK06075; cl17338 717522000251 Coenzyme F420-reducing hydrogenase, alpha subunit [Energy production and conversion]; Region: FrhA; COG3259 717522000252 Ligand-binding SRPBCC domain of an uncharacterized subfamily of proteins; Region: SRPBCC_7; cd07825 717522000253 putative hydrophobic ligand binding site [chemical binding]; other site 717522000254 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522000255 S-adenosylmethionine binding site [chemical binding]; other site 717522000256 Predicted membrane protein [Function unknown]; Region: COG3305 717522000257 Phosphorylase superfamily; Region: PNP_UDP_1; cl00303 717522000258 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase; Region: MTA/SAH-Nsdase; TIGR01704 717522000259 Cation transport ATPase [Inorganic ion transport and metabolism]; Region: ZntA; COG2217 717522000260 Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371 717522000261 metal-binding site [ion binding] 717522000262 E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122 717522000263 Soluble P-type ATPase [General function prediction only]; Region: COG4087 717522000264 Predicted integral membrane protein [Function unknown]; Region: COG5660 717522000265 Putative zinc-finger; Region: zf-HC2; pfam13490 717522000266 Domain of unknown function (DUF222); Region: DUF222; pfam02720 717522000267 HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085 717522000268 active site 717522000269 Domain of unknown function (DUF222); Region: DUF222; pfam02720 717522000270 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522000271 PPE family; Region: PPE; pfam00823 717522000272 Probable taurine catabolism dioxygenase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: TauD; COG2175 717522000273 Taurine catabolism dioxygenase TauD, TfdA family; Region: TauD; pfam02668 717522000274 FcoT-like thioesterase domain; Region: FcoT; pfam10862 717522000275 acyl-CoA synthetase; Validated; Region: PRK05857 717522000276 Adenylate forming domain, Class I; Region: AFD_class_I; cl17068 717522000277 Adenylate forming domain, Class I; Region: AFD_class_I; cd04433 717522000278 acyl-activating enzyme (AAE) consensus motif; other site 717522000279 acyl-activating enzyme (AAE) consensus motif; other site 717522000280 AMP binding site [chemical binding]; other site 717522000281 active site 717522000282 CoA binding site [chemical binding]; other site 717522000283 Phosphopantetheine attachment site; Region: PP-binding; pfam00550 717522000284 AMP-binding enzyme; Region: AMP-binding; pfam00501 717522000285 Adenylate forming domain, Class I; Region: AFD_class_I; cl17068 717522000286 Adenylate forming domain, Class I; Region: AFD_class_I; cl17068 717522000287 acyl-activating enzyme (AAE) consensus motif; other site 717522000288 acyl-activating enzyme (AAE) consensus motif; other site 717522000289 active site 717522000290 AMP binding site [chemical binding]; other site 717522000291 CoA binding site [chemical binding]; other site 717522000292 Phosphopantetheine attachment site; Region: PP-binding; pfam00550 717522000293 Condensation domain; Region: Condensation; pfam00668 717522000294 Non-ribosomal peptide synthetase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: EntF; COG1020 717522000295 HxxPF-repeated domain; Region: HxxPF_rpt; pfam13745 717522000296 The adenylation domain of nonribosomal peptide synthetases (NRPS); Region: A_NRPS; cd05930 717522000297 acyl-activating enzyme (AAE) consensus motif; other site 717522000298 AMP binding site [chemical binding]; other site 717522000299 Phosphopantetheine attachment site; Region: PP-binding; pfam00550 717522000300 Putative dehydrogenase domain of multifunctional non-ribosomal peptide synthetases and related enzymes [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3320 717522000301 extended (e) SDRs, subgroup 1; Region: SDR_e1; cd05235 717522000302 putative NAD(P) binding site [chemical binding]; other site 717522000303 active site 717522000304 putative substrate binding site [chemical binding]; other site 717522000305 Predicted membrane protein [Function unknown]; Region: COG3336 717522000306 Cation transport ATPase [Inorganic ion transport and metabolism]; Region: ZntA; COG2217 717522000307 Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371 717522000308 metal-binding site [ion binding] 717522000309 E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122 717522000310 Soluble P-type ATPase [General function prediction only]; Region: COG4087 717522000311 cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases [Signal transduction mechanisms]; Region: Crp; COG0664 717522000312 effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038 717522000313 ligand binding site [chemical binding]; other site 717522000314 flexible hinge region; other site 717522000315 50S ribosomal protein L28; Reviewed; Region: rpmB; PRK00359 717522000316 Putative GTPases (G3E family) [General function prediction only]; Region: COG0523 717522000317 Cobalamin synthesis protein cobW C-terminal domain; Region: CobW_C; smart00833 717522000318 Cation transport ATPase [Inorganic ion transport and metabolism]; Region: MgtA; COG0474 717522000319 E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122 717522000320 Putative hydrolase of sodium-potassium ATPase alpha subunit; Region: Hydrolase_like2; pfam13246 717522000321 Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427 717522000322 motif II; other site 717522000323 Cation transporting ATPase, C-terminus; Region: Cation_ATPase_C; pfam00689 717522000324 PE family; Region: PE; pfam00934 717522000325 Rhomboid family; Region: Rhomboid; pfam01694 717522000326 Predicted acyltransferases [Lipid metabolism]; Region: COG1835 717522000327 SGNH_hydrolase, or GDSL_hydrolase, is a diverse family of lipases and esterases. The tertiary fold of the enzyme is substantially different from that of the alpha/beta hydrolase family and unique among all known hydrolases; its active site closely...; Region: SGNH_hydrolase; cl01053 717522000328 active site 717522000329 catalytic triad [active] 717522000330 Nucleoside-diphosphate-sugar epimerases [Cell envelope biogenesis, outer membrane / Carbohydrate transport and metabolism]; Region: WcaG; COG0451 717522000331 GDP-mannose 4,6 dehydratase, extended (e) SDRs; Region: GDP_MD_SDR_e; cd05260 717522000332 NADP-binding site; other site 717522000333 homotetramer interface [polypeptide binding]; other site 717522000334 substrate binding site [chemical binding]; other site 717522000335 homodimer interface [polypeptide binding]; other site 717522000336 active site 717522000337 Phosphoheptose isomerase is a member of the SIS (Sugar ISomerase) superfamily. Phosphoheptose isomerase catalyzes the isomerization of sedoheptulose 7-phosphate into D-glycero-D-mannoheptose 7-phosphate. This is the first step of the biosynthesis of...; Region: SIS_GmhA; cd05006 717522000338 dimer interface [polypeptide binding]; other site 717522000339 active site 717522000340 histidinol-phosphate phosphatase family domain; Region: Histidinol-ppas; TIGR01656 717522000341 Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427 717522000342 active site 717522000343 motif I; other site 717522000344 motif II; other site 717522000345 Predicted kinase related to galactokinase and mevalonate kinase [General function prediction only]; Region: COG2605 717522000346 Uncharacterized protein conserved in bacteria [Function unknown]; Region: ErfK; COG1376 717522000347 IgD-like repeat domain of mycobacterial L,D-transpeptidases; Region: LDT_IgD_like_1; cd13431 717522000348 L,D-transpeptidase catalytic domain; Region: YkuD; pfam03734 717522000349 Transcriptional regulator [Transcription]; Region: LysR; COG0583 717522000350 Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126 717522000351 The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466 717522000352 dimerization interface [polypeptide binding]; other site 717522000353 putative oxalyl-CoA decarboxylase; Validated; Region: PRK09259 717522000354 Pyrimidine (PYR) binding domain of POX and related proteins; Region: TPP_PYR_POX_like; cd07035 717522000355 PYR/PP interface [polypeptide binding]; other site 717522000356 dimer interface [polypeptide binding]; other site 717522000357 TPP binding site [chemical binding]; other site 717522000358 Thiamine pyrophosphate enzyme, central domain; Region: TPP_enzyme_M; pfam00205 717522000359 Thiamine pyrophosphate (TPP) family, BZL_OCoD_HPCL subfamily, TPP-binding module; composed of proteins similar to benzaldehyde lyase (BZL), oxalyl-CoA decarboxylase (OCoD) and 2-hydroxyphytanoyl-CoA lyase (2-HPCL). Pseudomonas fluorescens biovar I BZL...; Region: TPP_BZL_OCoD_HPCL; cd02004 717522000360 TPP-binding site; other site 717522000361 dimer interface [polypeptide binding]; other site 717522000362 acyl-CoA synthetase; Validated; Region: PRK05852 717522000363 Adenylate forming domain, Class I; Region: AFD_class_I; cl17068 717522000364 Subfamily of fatty acid CoA ligase (FACL) similar to Fum10p of Gibberella moniliformis; Region: FACL_fum10p_like; cd05926 717522000365 acyl-activating enzyme (AAE) consensus motif; other site 717522000366 acyl-activating enzyme (AAE) consensus motif; other site 717522000367 putative AMP binding site [chemical binding]; other site 717522000368 putative active site [active] 717522000369 putative CoA binding site [chemical binding]; other site 717522000370 Elongation factor G (EF-G) family; Region: EF-G_bact; cd04170 717522000371 elongation factor G; Reviewed; Region: PRK12740 717522000372 G1 box; other site 717522000373 putative GEF interaction site [polypeptide binding]; other site 717522000374 GTP/Mg2+ binding site [chemical binding]; other site 717522000375 Switch I region; other site 717522000376 G2 box; other site 717522000377 G3 box; other site 717522000378 Switch II region; other site 717522000379 G4 box; other site 717522000380 G5 box; other site 717522000381 EFG_mtEFG_II: this subfamily represents the domain II of elongation factor G (EF-G) in bacteria and, the C-terminus of mitochondrial Elongation factor G1 (mtEFG1) and G2 (mtEFG2)_like proteins found in eukaryotes. During the process of peptide synthesis...; Region: EFG_mtEFG_II; cd04088 717522000382 EFG_mtEFG1_IV: domains similar to domain IV of the bacterial translational elongation factor (EF) EF-G. Included in this group is a domain of mitochondrial Elongation factor G1 (mtEFG1) proteins homologous to domain IV of EF-G. Eukaryotic cells harbor 2...; Region: EFG_mtEFG1_IV; cd01434 717522000383 EFG_mtEFG_C: domains similar to the C-terminal domain of the bacterial translational elongation factor (EF) EF-G. Included in this group is the C-terminus of mitochondrial Elongation factor G1 (mtEFG1) and G2 (mtEFG2) proteins. Eukaryotic cells harbor 2...; Region: EFG_mtEFG_C; cd03713 717522000384 PPOX class probable F420-dependent enzyme, Rv0121 family; Region: Rv0121_F420; TIGR03668 717522000385 PE family; Region: PE; pfam00934 717522000386 Trypsin-like serine proteases, typically periplasmic, contain C-terminal PDZ domain [Posttranslational modification, protein turnover, chaperones]; Region: DegQ; COG0265 717522000387 Trypsin-like peptidase domain; Region: Trypsin_2; pfam13365 717522000388 PDZ domain of tryspin-like serine proteases, such as DegP/HtrA, which are oligomeric proteins involved in heat-shock response, chaperone function, and apoptosis. May be responsible for substrate recognition and/or binding, as most PDZ domains bind...; Region: PDZ_serine_protease; cd00987 717522000389 trehalose synthase; Region: treS_nterm; TIGR02456 717522000390 Alpha amylase catalytic domain found in Trehalose synthetase; Region: AmyAc_TreS; cd11334 717522000391 active site 717522000392 catalytic site [active] 717522000393 trehalose synthase-fused probable maltokinase; Region: TreS_Cterm; TIGR02457 717522000394 Uncharacterized protein, probably involved in trehalose biosynthesis [Carbohydrate transport and metabolism]; Region: Ble; COG3281 717522000395 Predicted membrane protein [Function unknown]; Region: COG3619 717522000396 Predicted esterase [General function prediction only]; Region: COG0627 717522000397 NodN (nodulation factor N) contains a single hot dog fold similar to those of the peroxisomal Hydratase-Dehydrogenase-Epimerase (HDE) protein, and the fatty acid synthase beta subunit. Rhizobium and related species form nodules on the roots of their...; Region: NodN; cd03450 717522000398 putative active site [active] 717522000399 putative catalytic site [active] 717522000400 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522000401 Acyl-CoA dehydrogenase; Region: ACAD; cl09933 717522000402 active site 717522000403 F420-dependent oxidoreductase, G6PDH family; Region: F420_G6P_family; TIGR03557 717522000404 N5,N10-methylenetetrahydromethanopterin reductase (Mer) catalyzes the reduction of N5,N10-methylenetetrahydromethanopterin with reduced coenzyme F420 to N5-methyltetrahydromethanopterin and oxidized coenzyme F420; Region: Tetrahydromethanopterin_reductase; cd01097 717522000405 Acetyltransferase (GNAT) domain; Region: Acetyltransf_7; pfam13508 717522000406 Coenzyme A binding pocket [chemical binding]; other site 717522000410 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522000411 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522000412 Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124 717522000413 Cytochrome P450; Region: p450; cl12078 717522000414 methionine sulfoxide reductase A; Provisional; Region: PRK14054 717522000415 SnoaL-like domain; Region: SnoaL_2; pfam12680 717522000416 hopanoid-associated sugar epimerase; Region: HpnA; TIGR03466 717522000417 Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931 717522000418 NAD(P) binding site [chemical binding]; other site 717522000419 active site 717522000420 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2343 717522000421 Ketosteroid isomerase-related protein [General function prediction only]; Region: COG3631 717522000422 3-methyladenine DNA glycosylase/8-oxoguanine DNA glycosylase [DNA replication, recombination, and repair]; Region: AlkA; COG0122 717522000423 endonuclease III; includes endonuclease III (DNA-(apurinic or apyrimidinic site) lyase), alkylbase DNA glycosidases (Alka-family) and other DNA glycosidases; Region: ENDO3c; cd00056 717522000424 minor groove reading motif; other site 717522000425 helix-hairpin-helix signature motif; other site 717522000426 active site 717522000427 Chloride channel protein EriC [Inorganic ion transport and metabolism]; Region: EriC; COG0038 717522000428 CLC voltage-gated chloride channel. The ClC chloride channels catalyse the selective flow of Cl- ions across cell membranes, thereby regulating electrical excitation in skeletal muscle and the flow of salt and water across epithelial barriers. This...; Region: Voltage_gated_ClC; cd00400 717522000429 Cl- selectivity filter; other site 717522000430 Cl- binding residues [ion binding]; other site 717522000431 pore gating glutamate residue; other site 717522000432 dimer interface [polypeptide binding]; other site 717522000433 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522000434 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522000435 O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315 717522000436 methyltransferase, TIGR00027 family; Region: mthyl_TIGR00027 717522000437 O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315 717522000438 methyltransferase, TIGR00027 family; Region: mthyl_TIGR00027 717522000439 aldehyde dehydrogenase family protein; Provisional; Region: PTZ00381 717522000440 ALDH subfamily: Coniferyl aldehyde dehydrogenase, ALDH families 3, 13, and 14, and other related proteins; Region: ALDH_F3-13-14_CALDH-like; cd07087 717522000441 NAD(P) binding site [chemical binding]; other site 717522000442 catalytic residues [active] 717522000443 short chain dehydrogenase; Provisional; Region: PRK07791 717522000444 (3R)-hydroxyacyl-CoA dehydrogenase-like, classical(c)-like SDRs; Region: hydroxyacyl-CoA-like_DH_SDR_c-like; cd05353 717522000445 NAD binding site [chemical binding]; other site 717522000446 homodimer interface [polypeptide binding]; other site 717522000447 active site 717522000448 NADPH:quinone reductase and related Zn-dependent oxidoreductases [Energy production and conversion / General function prediction only]; Region: Qor; COG0604 717522000449 Quinone oxidoreductase (QOR); Region: QOR1; cd08241 717522000450 NAD(P) binding site [chemical binding]; other site 717522000451 PE family; Region: PE; pfam00934 717522000452 PE-PPE domain; Region: PE-PPE; pfam08237 717522000453 PE-PPE domain; Region: PE-PPE; pfam08237 717522000454 Protein tyrosine/serine phosphatase [Signal transduction mechanisms]; Region: COG2365 717522000455 Protein tyrosine phosphatases (PTP) catalyze the dephosphorylation of phosphotyrosine peptides; they regulate phosphotyrosine levels in signal transduction pathways. The depth of the active site cleft renders the enzyme specific for phosphorylated Tyr; Region: PTPc; cl00053 717522000456 Tyrosine phosphatase family C-terminal region; Region: Y_phosphatase3C; pfam13348 717522000457 Acyl-CoA dehydrogenases similar to fadE2; Region: ACAD_FadE2; cd01155 717522000458 FAD binding site [chemical binding]; other site 717522000459 substrate binding site [chemical binding]; other site 717522000460 catalytic base [active] 717522000461 NAD/NADP transhydrogenase alpha subunit [Energy production and conversion]; Region: PntA; COG3288 717522000462 Rubrum transdehydrogenase NAD-binding and catalytic domains; Region: Rubrum_tdh; cd05304 717522000463 ligand binding site [chemical binding]; other site 717522000464 homodimer interface [polypeptide binding]; other site 717522000465 NAD(P) binding site [chemical binding]; other site 717522000466 trimer interface B [polypeptide binding]; other site 717522000467 trimer interface A [polypeptide binding]; other site 717522000468 NAD/NADP transhydrogenase alpha subunit [Energy production and conversion]; Region: PntA; COG3288 717522000469 Domain of unknown function (DUF3814); Region: DUF3814; pfam12769 717522000470 NAD/NADP transhydrogenase beta subunit [Energy production and conversion]; Region: PntB; COG1282 717522000471 NAD(P) transhydrogenase beta subunit; Region: PNTB; pfam02233 717522000472 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522000473 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522000474 QacR-like protein, C-terminal region; Region: TetR_C_5; pfam08360 717522000475 PE family; Region: PE; pfam00934 717522000476 PE-PPE domain; Region: PE-PPE; pfam08237 717522000477 PE family; Region: PE; pfam00934 717522000478 PE-PPE domain; Region: PE-PPE; pfam08237 717522000479 FAD/FMN-containing dehydrogenases [Energy production and conversion]; Region: GlcD; COG0277 717522000480 FAD binding domain; Region: FAD_binding_4; pfam01565 717522000481 Zn-dependent alcohol dehydrogenases, class III [Energy production and conversion]; Region: AdhC; COG1062 717522000482 Medium chain reductase/dehydrogenase (MDR)/zinc-dependent alcohol dehydrogenase-like family; Region: MDR; cl16912 717522000483 NAD(P) binding site [chemical binding]; other site 717522000484 4-hydroxybenzoyl-CoA thioesterase (4HBT). Catalyzes the final step in the 4-chlorobenzoate degradation pathway in which 4-chlorobenzoate is converted to 4-hydroxybenzoate in certain soil-dwelling bacteria. 4HBT forms a homotetramer with four active sites; Region: 4HBT; cd00586 717522000485 active site 717522000486 Ligand-binding SRPBCC domain of an uncharacterized subfamily of proteins; Region: SRPBCC_2; cd07819 717522000487 putative hydrophobic ligand binding site [chemical binding]; other site 717522000488 Transcriptional regulators [Transcription]; Region: GntR; COG1802 717522000489 Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377 717522000490 DNA-binding site [nucleotide binding]; DNA binding site 717522000491 FCD domain; Region: FCD; pfam07729 717522000492 long-chain-fatty-acid--CoA ligase; Validated; Region: PRK07786 717522000493 Adenylate forming domain, Class I; Region: AFD_class_I; cl17068 717522000494 Bacterial Bile acid CoA ligases and similar proteins; Region: BACL_like; cd05929 717522000495 acyl-activating enzyme (AAE) consensus motif; other site 717522000496 acyl-activating enzyme (AAE) consensus motif; other site 717522000497 putative AMP binding site [chemical binding]; other site 717522000498 putative active site [active] 717522000499 putative CoA binding site [chemical binding]; other site 717522000500 ABC-type transport system involved in resistance to organic solvents, permease component [Secondary metabolites biosynthesis, transport, and catabolism]; Region: Ttg2B; COG0767 717522000501 Permease; Region: Permease; pfam02405 717522000502 ABC-type transport system involved in resistance to organic solvents, permease component [Secondary metabolites biosynthesis, transport, and catabolism]; Region: Ttg2B; COG0767 717522000503 Permease; Region: Permease; pfam02405 717522000504 virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996 717522000505 mce related protein; Region: MCE; pfam02470 717522000506 Protein of unknown function (DUF3407); Region: DUF3407; pfam11887 717522000507 virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996 717522000508 mce related protein; Region: MCE; pfam02470 717522000509 Protein of unknown function (DUF3407); Region: DUF3407; pfam11887 717522000510 virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996 717522000511 mce related protein; Region: MCE; pfam02470 717522000512 virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996 717522000513 mce related protein; Region: MCE; pfam02470 717522000514 virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996 717522000515 mce related protein; Region: MCE; pfam02470 717522000516 virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996 717522000517 mce related protein; Region: MCE; pfam02470 717522000518 RDD family; Region: RDD; pfam06271 717522000519 Predicted periplasmic protein (DUF2233); Region: DUF2233; pfam09992 717522000520 Predicted membrane protein [Function unknown]; Region: COG1511 717522000521 YhgE/Pip N-terminal domain; Region: pip_yhgE_Nterm; TIGR03061 717522000522 YhgE/Pip C-terminal domain; Region: pip_yhgE_Cterm; TIGR03062 717522000523 Pirin-related protein [General function prediction only]; Region: COG1741 717522000524 Pirin; Region: Pirin; pfam02678 717522000525 RNA polymerase factor sigma-70; Validated; Region: PRK08241 717522000526 Sigma-70 region 2; Region: Sigma70_r2; pfam04542 717522000527 Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171 717522000528 DNA binding residues [nucleotide binding] 717522000529 SnoaL-like domain; Region: SnoaL_2; pfam12680 717522000530 Lysophospholipase [Lipid metabolism]; Region: PldB; COG2267 717522000531 Putative lysophospholipase; Region: Hydrolase_4; pfam12146 717522000532 Protein of unknown function (DUF2786); Region: DUF2786; pfam10979 717522000533 putative metallohydrolase, TIGR04338 family; Region: HEXXH_Rv0185 717522000534 Glycosyl hydrolase family 3 N terminal domain; Region: Glyco_hydro_3; pfam00933 717522000535 Beta-glucosidase-related glycosidases [Carbohydrate transport and metabolism]; Region: BglX; COG1472 717522000536 Glycosyl hydrolase family 3 C-terminal domain; Region: Glyco_hydro_3_C; pfam01915 717522000537 Fibronectin type III-like domain; Region: Fn3-like; pfam14310 717522000538 Predicted O-methyltransferase [General function prediction only]; Region: COG4122 717522000539 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522000540 S-adenosylmethionine binding site [chemical binding]; other site 717522000541 SPW repeat; Region: SPW; pfam03779 717522000542 SPW repeat; Region: SPW; pfam03779 717522000543 dihydroxy-acid dehydratase; Provisional; Region: PRK00911 717522000544 6-phosphogluconate dehydratase; Region: edd; TIGR01196 717522000545 Transcriptional regulators CsoR (copper-sensitive operon repressor), RcnR, and FrmR, and related domains; this domain superfamily was previously known as DUF156; Region: CsoR-like_DUF156; cd10148 717522000546 putative homodimer interface [polypeptide binding]; other site 717522000547 putative homotetramer interface [polypeptide binding]; other site 717522000548 putative allosteric switch controlling residues; other site 717522000549 putative metal binding site [ion binding]; other site 717522000550 putative homodimer-homodimer interface [polypeptide binding]; other site 717522000551 Arabinose efflux permease [Carbohydrate transport and metabolism]; Region: AraJ; COG2814 717522000552 The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174 717522000553 putative substrate translocation pore; other site 717522000554 Uncharacterized protein conserved in bacteria [Function unknown]; Region: ErfK; COG1376 717522000555 IgD-like repeat domain of mycobacterial L,D-transpeptidases; Region: LDT_IgD_like_1; cd13431 717522000556 L,D-transpeptidase catalytic domain; Region: YkuD; pfam03734 717522000557 ABC-type multidrug transport system, ATPase and permease components [Defense mechanisms]; Region: MdlB; COG1132 717522000558 ABC transporter transmembrane region; Region: ABC_membrane; pfam00664 717522000559 ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201 717522000560 Walker A/P-loop; other site 717522000561 ATP binding site [chemical binding]; other site 717522000562 Q-loop/lid; other site 717522000563 ABC transporter signature motif; other site 717522000564 Walker B; other site 717522000565 D-loop; other site 717522000566 H-loop/switch region; other site 717522000567 ABC-type multidrug transport system, ATPase and permease components [Defense mechanisms]; Region: MdlB; COG1132 717522000568 ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201 717522000569 Walker A/P-loop; other site 717522000570 ATP binding site [chemical binding]; other site 717522000571 Q-loop/lid; other site 717522000572 ABC transporter signature motif; other site 717522000573 Walker B; other site 717522000574 D-loop; other site 717522000575 H-loop/switch region; other site 717522000576 Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197 717522000577 C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170 717522000578 dimerization interface [polypeptide binding]; other site 717522000579 DNA binding residues [nucleotide binding] 717522000580 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522000581 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522000582 Anaerobic dehydrogenases, typically selenocysteine-containing [Energy production and conversion]; Region: BisC; COG0243 717522000583 The MopB_1 CD includes a group of related uncharacterized bacterial molybdopterin-binding oxidoreductase-like domains with a putative N-terminal iron-sulfur [4Fe-4S] cluster binding site and molybdopterin cofactor binding site. These members belong to...; Region: MopB_1; cd02762 717522000584 putative [Fe4-S4] binding site [ion binding]; other site 717522000585 putative molybdopterin cofactor binding site [chemical binding]; other site 717522000586 Molybdopterin-Binding (MopB) domain of the MopB superfamily of proteins, a large, diverse, heterogeneous superfamily of enzymes that, in general, bind molybdopterin as a cofactor. The MopB domain is found in a wide variety of molybdenum- and...; Region: Molybdopterin-Binding; cl09928 717522000587 The MopB_CT_1 CD includes a group of related uncharacterized bacterial molybdopterin-binding oxidoreductase-like domains with a putative N-terminal iron-sulfur [4Fe-4S] cluster binding site and molybdopterin cofactor binding site. This CD is of the...; Region: MopB_CT_1; cd02782 717522000588 putative molybdopterin cofactor binding site; other site 717522000589 Predicted metalloendopeptidase [Posttranslational modification, protein turnover, chaperones]; Region: PepO; COG3590 717522000590 Peptidase family M13 includes neprilysin, endothelin-converting enzyme I; Region: M13; cd08662 717522000591 active site 717522000592 Zn binding site [ion binding]; other site 717522000593 Predicted drug exporters of the RND superfamily [General function prediction only]; Region: COG2409 717522000594 Sterol-sensing domain of SREBP cleavage-activation; Region: Sterol-sensing; pfam12349 717522000595 Predicted integral membrane protein [Function unknown]; Region: COG0392 717522000596 Predicted permease, member of the PurR regulon [General function prediction only]; Region: yhhT; COG0628 717522000597 Domain of unknown function DUF20; Region: UPF0118; pfam01594 717522000598 MMPL family; Region: MMPL; pfam03176 717522000599 MMPL family; Region: MMPL; pfam03176 717522000600 LabA_like proteins; Region: LabA_like; cd06167 717522000601 putative metal binding site [ion binding]; other site 717522000602 Putative methyltransferase; Region: Methyltransf_4; pfam02390 717522000603 Phosphoenolpyruvate carboxykinase (PEPCK), a critical gluconeogenic enzyme, catalyzes the first committed step in the diversion of tricarboxylic acid cycle intermediates toward gluconeogenesis. It catalyzes the reversible decarboxylation and...; Region: PEPCK_GTP; cd00819 717522000604 active site 717522000605 substrate-binding site [chemical binding]; other site 717522000606 metal-binding site [ion binding] 717522000607 GTP binding site [chemical binding]; other site 717522000608 nicotinamide-nucleotide adenylyltransferase, NadR type; Region: nadR_NMN_Atrans; TIGR01526 717522000609 Nicotinamide/nicotinate mononucleotide adenylyltransferase of bifunctional NadR-like proteins; Region: NMNAT_NadR; cd02167 717522000610 active site 717522000611 (T/H)XGH motif; other site 717522000612 Predicted ATPase/kinase involved in NAD metabolism [Coenzyme metabolism]; Region: NadR; COG3172 717522000613 B12 binding domain_like associated with radical SAM domain. This domain shows similarity with B12 (adenosylcobamide) binding domains found in several enzymes, such as glutamate mutase, methionine synthase and methylmalonyl-CoA mutase, but it lacks the...; Region: radical_SAM_B12_BD; cd02068 717522000614 Elongator protein 3, MiaB family, Radical SAM; Region: Elp3; smart00729 717522000615 Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335 717522000616 FeS/SAM binding site; other site 717522000617 long-chain-fatty-acid--CoA ligase; Validated; Region: PRK08276 717522000618 Adenylate forming domain, Class I; Region: AFD_class_I; cl17068 717522000619 Bacterial Bile acid CoA ligases and similar proteins; Region: BACL_like; cd05929 717522000620 acyl-activating enzyme (AAE) consensus motif; other site 717522000621 acyl-activating enzyme (AAE) consensus motif; other site 717522000622 putative AMP binding site [chemical binding]; other site 717522000623 putative active site [active] 717522000624 putative CoA binding site [chemical binding]; other site 717522000625 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522000626 Acyl-CoA dehydrogenase; Region: ACAD; cl09933 717522000627 active site 717522000628 FkbR2 is a Streptomyces hygroscopicus protein with a hot dog fold that belongs to a conserved family of proteins found in prokaryotes and archaea but not in eukaryotes. FkbR2 has sequence similarity to (R)-specific enoyl-CoA hydratase, the peroxisomal...; Region: FkbR2; cd03451 717522000629 putative active site [active] 717522000630 putative catalytic site [active] 717522000631 The hotdog fold was initially identified in the E. coli FabA (beta-hydroxydecanoyl-acyl carrier protein (ACP)-dehydratase) structure and subsequently in 4HBT (4-hydroxybenzoyl-CoA thioesterase) from Pseudomonas. A number of other seemingly unrelated...; Region: hot_dog; cl00509 717522000632 active site 2 [active] 717522000633 active site 1 [active] 717522000634 Esterases and lipases (includes fungal lipases, cholinesterases, etc.) These enzymes act on carboxylic esters (EC: 3.1.1.-). The catalytic apparatus involves three residues (catalytic triad): a serine, a glutamate or aspartate and a histidine.These...; Region: Esterase_lipase; cd00312 717522000635 alpha/beta hydrolase fold; Region: Abhydrolase_3; pfam07859 717522000636 Sulfite oxidase and related enzymes [General function prediction only]; Region: COG2041 717522000637 Sulfite oxidase (SO) family, molybdopterin binding domain. This molybdopterin cofactor (Moco) binding domain is found in a variety of oxidoreductases, main members of this family are nitrate reductase (NR) and sulfite oxidase (SO). SO catalyzes the...; Region: SO_family_Moco; cd00321 717522000638 Moco binding site; other site 717522000639 metal coordination site [ion binding]; other site 717522000640 alpha/beta hydrolase fold; Region: Abhydrolase_3; pfam07859 717522000641 Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326 717522000642 Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007 717522000643 NAD(P)+-dependent aldehyde dehydrogenase superfamily; Region: ALDH-SF; cl11961 717522000644 NAD(P) binding site [chemical binding]; other site 717522000645 catalytic residues [active] 717522000646 RD10 Region of difference RD10, deleted region in Mycobacterium bovis BCG Pasteur, BCG Tokyo, BCG Mexico and Mycobacterium bovis AF2122/97 compared to Mycobacterium tuberculosis H37Rv. Removes gene Rv0222 and truncates genes Rv0221 and Rv0223 717522000647 NAD(P)+-dependent aldehyde dehydrogenase superfamily; Region: ALDH-SF; cl11961 717522000648 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522000649 S-adenosylmethionine binding site [chemical binding]; other site 717522000650 This family is most closely related to the GT1 family of glycosyltransferases and named after YqgM in Bacillus licheniformis about which little is known. Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to...; Region: GT1_YqgM_like; cd03801 717522000651 Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438 717522000652 Protein of unknown function (DUF3068); Region: DUF3068; pfam11271 717522000653 Predicted acyltransferases [Lipid metabolism]; Region: COG1835 717522000654 PIN domain of the Rv0301 toxin of Mycobacterium tuberculosis and other uncharacterized, annotated PilT protein domain proteins; Region: PIN_MtRv0301; cd09882 717522000655 putative active site [active] 717522000656 Phosphotriesterase (PTE) catalyzes the hydrolysis of organophosphate nerve agents, including the chemical warfare agents VX, soman, and sarin as well as the insecticide paraoxon. PTE exists as a homodimer with one active site per monomer. The active site...; Region: PTE; cd00530 717522000657 active site 717522000658 substrate binding pocket [chemical binding]; other site 717522000659 homodimer interaction site [polypeptide binding]; other site 717522000660 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522000661 Acyl-CoA dehydrogenase; Region: ACAD; cd00567 717522000662 active site 717522000663 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522000664 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522000665 Ribonucleotide Reductase R2-like protein, Mn/Fe-binding domain; Region: RNRR2_Rv0233_like; cd07911 717522000666 active site 717522000667 diiron metal binding site [ion binding]; other site 717522000668 NAD(P)+-dependent aldehyde dehydrogenase superfamily; Region: ALDH-SF; cl11961 717522000669 NAD-dependent aldehyde dehydrogenases [Energy production and conversion]; Region: PutA; COG1012 717522000670 Mycobacterium tuberculosis succinate-semialdehyde dehydrogenase 1-like; Region: ALDH_SSADH1_GabD1; cd07100 717522000671 NAD(P) binding site [chemical binding]; other site 717522000672 catalytic residues [active] 717522000673 Lipase maturation factor; Region: LMF1; pfam06762 717522000674 Domain of unknown function (DUF3367); Region: DUF3367; pfam11847 717522000675 Protein of unknown function (DUF2613); Region: DUF2613; pfam11021 717522000676 Beta-glucosidase-related glycosidases [Carbohydrate transport and metabolism]; Region: BglX; COG1472 717522000677 Glycosyl hydrolase family 3 N terminal domain; Region: Glyco_hydro_3; cl07971 717522000678 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522000679 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522000680 Mycobacterium tuberculosis PIN domain family; Region: Mtu_PIN_fam; TIGR00028 717522000681 The hotdog fold was initially identified in the E. coli FabA (beta-hydroxydecanoyl-acyl carrier protein (ACP)-dehydratase) structure and subsequently in 4HBT (4-hydroxybenzoyl-CoA thioesterase) from Pseudomonas. A number of other seemingly unrelated...; Region: hot_dog; cl00509 717522000682 MaoC like domain; Region: MaoC_dehydratas; pfam01575 717522000683 active site 2 [active] 717522000684 active site 1 [active] 717522000685 3-ketoacyl-(acyl-carrier-protein) reductase; Provisional; Region: fabG; PRK08261 717522000686 Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931 717522000687 NAD(P) binding site [chemical binding]; other site 717522000688 active site 717522000689 acetyl-CoA acetyltransferase; Provisional; Region: PRK09268 717522000690 Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751 717522000691 dimer interface [polypeptide binding]; other site 717522000692 active site 717522000693 Acyl-CoA dehydrogenase N terminal; Region: AcylCoA_DH_N; pfam12418 717522000694 acyl-CoA dehydrogenase; Provisional; Region: PTZ00456 717522000695 Putative acyl-CoA dehydrogenases similar to fadE5; Region: ACAD_fadE5; cd01153 717522000696 FAD binding site [chemical binding]; other site 717522000697 substrate binding site [chemical binding]; other site 717522000698 catalytic residues [active] 717522000699 Acetyl-CoA dehydrogenase C-terminal like; Region: Acyl-CoA_dh_C; pfam12806 717522000700 Flavin reductase like domain; Region: Flavin_Reduct; smart00903 717522000701 fumarate reductase iron-sulfur subunit; Provisional; Region: PRK12386 717522000702 2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207 717522000703 catalytic loop [active] 717522000704 iron binding site [ion binding]; other site 717522000705 succinate dehydrogenase flavoprotein subunit; Reviewed; Region: sdhA; PRK07803 717522000706 L-aspartate oxidase; Provisional; Region: PRK06175 717522000707 Fumarate reductase flavoprotein C-term; Region: Succ_DH_flav_C; pfam02910 717522000708 Molecular chaperone (small heat shock protein) [Posttranslational modification, protein turnover, chaperones]; Region: IbpA; COG0071 717522000709 Alpha-crystallin domain (ACD) of alpha-crystallin-type small(s) heat shock proteins (Hsps). sHsps are small stress induced proteins with monomeric masses between 12 -43 kDa, whose common feature is the Alpha-crystallin domain (ACD). sHsps are generally...; Region: ACD_sHsps-like; cd06464 717522000710 putative dimer interface [polypeptide binding]; other site 717522000711 nitrite reductase [NAD(P)H], large subunit; Region: nitri_red_nirB; TIGR02374 717522000712 Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070 717522000713 BFD-like [2Fe-2S] binding domain; Region: Fer2_BFD; pfam04324 717522000714 Nitrite/Sulfite reductase ferredoxin-like half domain; Region: NIR_SIR_ferr; pfam03460 717522000715 Assimilatory nitrite reductase (NirD) family, Rieske domain; Assimilatory nitrate and nitrite reductases convert nitrate through nitrite to ammonium. Members include bacterial and fungal proteins. The bacterial NirD contains a single Rieske domain while...; Region: Rieske_NirD; cd03529 717522000716 Adenosylcobinamide kinase / adenosylcobinamide phosphate guanyltransferase (CobU). CobU is bifunctional cobalbumin biosynthesis enzymes which display adenosylcobinamide kinase and adenosylcobinamide phosphate guanyltransferase activity. This enzyme is a...; Region: CobU; cd00544 717522000717 homotrimer interface [polypeptide binding]; other site 717522000718 Walker A motif; other site 717522000719 GTP binding site [chemical binding]; other site 717522000720 Walker B motif; other site 717522000721 cobyric acid synthase; Provisional; Region: PRK00784 717522000722 Dethiobiotin synthetase [Coenzyme metabolism]; Region: BioD; COG0132 717522000723 Type 1 glutamine amidotransferase (GATase1) domain found in Cobyric Acid Synthase (CobQ); Region: GATase1_CobQ; cd01750 717522000724 catalytic triad [active] 717522000725 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522000726 PPE family; Region: PPE; pfam00823 717522000727 Sirohydrochlorin ferrochelatase [Inorganic ion transport and metabolism]; Region: COG2138 717522000728 Sirohydrochlorin cobalt chelatase (CbiX) and sirohydrochlorin iron chelatase (SirB), N-terminal domain. SirB catalyzes the ferro-chelation of sirohydrochlorin to siroheme, the prosthetic group of sulfite and nitrite reductases. CbiX is a cobaltochelatase; Region: CbiX_SirB_N; cd03416 717522000729 putative active site [active] 717522000730 Sirohydrochlorin cobalt chelatase (CbiX) and sirohydrochlorin iron chelatase (SirB), C-terminal domain. SirB catalyzes the ferro-chelation of sirohydrochlorin to siroheme, the prosthetic group of sulfite and nitrite reductases. CbiX is a cobaltochelatase; Region: CbiX_SirB_C; cd03414 717522000731 putative active site [active] 717522000732 bifunctional uroporphyrinogen-III synthetase/response regulator domain protein; Validated; Region: PRK07239 717522000733 Uroporphyrinogen-III synthase (HemD) catalyzes the asymmetrical cyclization of tetrapyrrole (linear) to uroporphyrinogen-III, the fourth step in the biosynthesis of heme. This ubiquitous enzyme is present in eukaryotes, bacteria and archaea. Mutations in...; Region: HemD; cd06578 717522000734 active site 717522000735 DNA-binding winged-HTH domains [Transcription]; Region: CadC; COG3710 717522000736 DNA binding site [nucleotide binding] 717522000737 Nitrate/nitrite transporter [Inorganic ion transport and metabolism]; Region: NarK; COG2223 717522000738 N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301 717522000739 Coenzyme A binding pocket [chemical binding]; other site 717522000740 Allophanate hydrolase subunit 2; Region: AHS2; cl00865 717522000741 Allophanate hydrolase subunit 1 [Amino acid transport and metabolism]; Region: DUR1; COG2049 717522000742 Allophanate hydrolase subunit 1; Region: AHS1; smart00796 717522000743 ABC-type Fe3+-hydroxamate transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: FepB; COG0614 717522000744 Helical backbone metal receptor (TroA-like domain). These proteins have been shown to function in the ABC transport of ferric siderophores and metal ions such as Mn2+, Fe3+, Cu2+ and/or Zn2+. Their ligand binding site is formed in the interface between...; Region: TroA-like; cl00262 717522000745 intersubunit interface [polypeptide binding]; other site 717522000746 5-oxoprolinase; Region: PLN02666 717522000747 Hydantoinase/oxoprolinase N-terminal region; Region: Hydant_A_N; pfam05378 717522000748 Hydantoinase/oxoprolinase; Region: Hydantoinase_A; pfam01968 717522000749 N-methylhydantoinase B/acetone carboxylase, alpha subunit [Amino acid transport and metabolism / Secondary metabolites biosynthesis, transport, and catabolism]; Region: HyuB; COG0146 717522000750 Nitrate/nitrite transporter [Inorganic ion transport and metabolism]; Region: NarK; COG2223 717522000751 Antitoxin of toxin-antitoxin stability system [Cell division and chromosome partitioning]; Region: StbD; COG2161 717522000752 LigD_Pol_like_2: Polymerase (Pol) domain of bacterial LigD proteins similar to Pseudomonas aeruginosa (Pae) LigD, subgroup 2. The LigD Pol domain belongs to the archaeal/eukaryal primase (AEP) superfamily. In prokaryotes, LigD along with Ku is required...; Region: LigD_Pol_like_2; cd04865 717522000753 nucleotide binding site [chemical binding]; other site 717522000754 acyl-CoA synthetase; Validated; Region: PRK07788 717522000755 Adenylate forming domain, Class I; Region: AFD_class_I; cl17068 717522000756 Adenylate forming domain, Class I; Region: AFD_class_I; cl17068 717522000757 active site 717522000758 CoA binding site [chemical binding]; other site 717522000759 AMP binding site [chemical binding]; other site 717522000760 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522000761 Acyl-CoA dehydrogenase; Region: ACAD; cl09933 717522000762 Putative acyl-CoA dehydrogenases similar to fadE6, fadE17, and fadE26; Region: ACAD_fadE6_17_26; cd01152 717522000763 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522000764 FAD binding site [chemical binding]; other site 717522000765 substrate binding site [chemical binding]; other site 717522000766 catalytic base [active] 717522000767 Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697 717522000768 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522000769 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522000770 N-terminal domain of Sphingobium chlorophenolicum 2,6-dichloro-p-hydroquinone 1,2-dioxygenase (PcpA), and similar proteins; Region: PcpA_N_like; cd08346 717522000771 Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903 717522000772 Zn binding site [ion binding]; other site 717522000773 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3662 717522000774 Mycobacterium tuberculosis PIN domain family; Region: Mtu_PIN_fam; TIGR00028 717522000775 putative active site [active] 717522000777 PE family; Region: PE; pfam00934 717522000778 I-RD01 Region of difference I-RD01, inserted region in Mycobacterium bovis BCG Pasteur, BCG Tokyo, BCG Mexico and Mycobacterium bovis AF2122/97 compared to Mycobacterium tuberculosis H37Rv2. Duplicates PE_PGRS3 717522000779 PE family; Region: PE; pfam00934 717522000780 PE family; Region: PE; pfam00934 717522000781 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522000782 PPE family; Region: PPE; pfam00823 717522000783 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522000784 O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315 717522000785 methyltransferase, TIGR00027 family; Region: mthyl_TIGR00027 717522000786 type VII secretion AAA-ATPase EccA; Region: T7SS_EccA; TIGR03922 717522000787 The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009 717522000788 Walker A motif; other site 717522000789 ATP binding site [chemical binding]; other site 717522000790 Walker B motif; other site 717522000791 arginine finger; other site 717522000792 Protein of unknown function (DUF690); Region: DUF690; pfam05108 717522000793 type VII secretion protein EccCa; Region: T7SS_EccC_a; TIGR03924 717522000794 FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580 717522000795 type VII secretion protein EccCb; Region: T7SS_EccC_b; TIGR03925 717522000796 FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580 717522000797 FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580 717522000798 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522000799 PPE family; Region: PPE; pfam00823 717522000800 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4842 717522000801 EspG family; Region: ESX-1_EspG; pfam14011 717522000802 type VII secretion integral membrane protein EccD; Region: T7SS_EccD; TIGR03920 717522000803 Peptidase domain in the S8 and S53 families; Region: Peptidases_S8_S53; cl10459 717522000804 type VII secretion-associated serine protease mycosin; Region: T7SS_mycosin; TIGR03921 717522000805 active site 717522000806 catalytic residues [active] 717522000807 type VII secretion protein EccE; Region: T7SS_EccE; TIGR03923 717522000808 Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697 717522000809 Uncharacterized conserved protein (DUF2048); Region: DUF2048; pfam09752 717522000810 Trans-aconitate methyltransferase [General function prediction only]; Region: Tam; COG4106 717522000811 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522000812 S-adenosylmethionine binding site [chemical binding]; other site 717522000813 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4424 717522000814 Arylsulfatase A and related enzymes [Inorganic ion transport and metabolism]; Region: AslA; COG3119 717522000815 Sulfatase; Region: Sulfatase; cl17466 717522000816 hypothetical protein; Region: PHA01748 717522000817 PIN domain of the Rv0301 toxin of Mycobacterium tuberculosis and other uncharacterized, annotated PilT protein domain proteins; Region: PIN_MtRv0301; cd09882 717522000818 putative active site [active] 717522000819 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522000820 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522000821 light-dependent protochlorophyllide reductase (LPOR)-like, classical (c)-like SDRs; Region: LPOR_like_SDR_c_like; cd09810 717522000822 protochlorophyllide reductase; Region: PLN00015 717522000823 putative NAD(P) binding site [chemical binding]; other site 717522000824 active site 717522000825 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522000826 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522000827 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522000828 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522000829 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522000830 PPE family; Region: PPE; pfam00823 717522000831 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522000832 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522000833 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522000834 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522000835 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522000836 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522000837 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522000838 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522000839 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522000840 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522000841 Subfamily of the nitroreductase family that includes BluB protein in Rhodobacter capsulatus is involved in the conversion of cobinamide to cobalamin in Cobalamin (vitamin B12) biosynthesis. Nitroreductases typically reduce their substrates by using NAD(P)...; Region: BluB; cd02145 717522000842 putative FMN binding site [chemical binding]; other site 717522000843 PAP2_like_2 proteins. PAP2 is a super-family of phosphatases and haloperoxidases. This subgroup, which is specific to bacteria, lacks functional characterization and may act as a membrane-associated lipid phosphatase; Region: PAP2_like_2; cd03392 717522000844 Membrane-associated phospholipid phosphatase [Lipid metabolism]; Region: PgpB; COG0671 717522000845 active site 717522000846 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3786 717522000847 SnoaL-like domain; Region: SnoaL_4; pfam13577 717522000848 SnoaL-like domain; Region: SnoaL_3; pfam13474 717522000849 Molecular chaperone [Posttranslational modification, protein turnover, chaperones]; Region: DnaK; COG0443 717522000850 Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cl17037 717522000851 nucleotide binding site [chemical binding]; other site 717522000852 Molecular chaperone, HSP90 family [Posttranslational modification, protein turnover, chaperones]; Region: HtpG; COG0326 717522000853 Protein of unknown function (DUF3060); Region: DUF3060; pfam11259 717522000854 Beta-glucanase/Beta-glucan synthetase [Carbohydrate transport and metabolism]; Region: SKN1; COG2273 717522000855 Laminarinase, member of the glycosyl hydrolase family 16; Region: GH16_laminarinase_like; cd08023 717522000856 active site 717522000857 catalytic residues [active] 717522000858 Muconolactone delta-isomerase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CatC1; COG4829 717522000859 Muconolactone delta-isomerase; Region: MIase; cl01992 717522000860 Glycerophosphodiester phosphodiesterase domain of Streptomyces coelicolor cytoplasmic phosphodiesterases UgpQ2 and similar proteins; Region: GDPD_cytoplasmic_ScUgpQ2_like; cd08561 717522000861 Glycerophosphoryl diester phosphodiesterase family; Region: GDPD; pfam03009 717522000862 putative active site [active] 717522000863 catalytic site [active] 717522000864 putative metal binding site [ion binding]; other site 717522000865 Predicted divalent heavy-metal cations transporter [Inorganic ion transport and metabolism]; Region: COG0428 717522000866 Pyroglutamyl peptidase (PGP) type I, also known as pyrrolidone carboxyl peptidase (pcp) type I: Enzymes responsible for cleaving pyroglutamate (pGlu) from the N-terminal end of specialized proteins. The N-terminal pGlu protects these proteins from...; Region: Peptidase_C15; cd00501 717522000867 putative substrate binding pocket [chemical binding]; other site 717522000868 AC domain interface; other site 717522000869 catalytic triad [active] 717522000870 AB domain interface; other site 717522000871 interchain disulfide; other site 717522000872 Trimeric dUTP diphosphatases; Region: trimeric_dUTPase; cd07557 717522000873 trimer interface [polypeptide binding]; other site 717522000874 active site 717522000875 Predicted UDP-glucose 6-dehydrogenase [Cell envelope biogenesis, outer membrane]; Region: Ugd; COG1004 717522000876 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain; Region: 3HCDH_N; pfam02737 717522000877 UDP-glucose/GDP-mannose dehydrogenase family, central domain; Region: UDPG_MGDP_dh; pfam00984 717522000878 UDP binding domain; Region: UDPG_MGDP_dh_C; smart00984 717522000879 Uncharacterized proteins, LmbE homologs [Function unknown]; Region: COG2120 717522000880 Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090 717522000881 dimerization interface [polypeptide binding]; other site 717522000882 putative DNA binding site [nucleotide binding]; other site 717522000883 putative Zn2+ binding site [ion binding]; other site 717522000884 Rhodanese Homology Domain (RHOD); an alpha beta fold domain found duplicated in the rhodanese protein. The cysteine containing enzymatically active version of the domain is also found in the Cdc25 class of protein phosphatases and a variety of proteins...; Region: RHOD; cd00158 717522000885 active site residue [active] 717522000886 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522000887 S-adenosylmethionine binding site [chemical binding]; other site 717522000888 Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124 717522000889 Cytochrome P450; Region: p450; cl12078 717522000890 transcriptional repressor BetI; Region: betaine_BetI; TIGR03384 717522000891 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522000892 Bacterial transcriptional repressor; Region: TetR_C_6; pfam13977 717522000893 Methyltransferase domain; Region: Methyltransf_23; pfam13489 717522000894 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522000895 S-adenosylmethionine binding site [chemical binding]; other site 717522000896 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522000897 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522000898 Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox_2; pfam07992 717522000899 uncharacterized Actinobacterial protein TIGR03083; Region: TIGR03083 717522000900 Mycothiol maleylpyruvate isomerase N-terminal domain; Region: MDMPI_N; pfam11716 717522000901 SnoaL-like domain; Region: SnoaL_2; pfam12680 717522000902 G1P_TT_short is the short form of glucose-1-phosphate thymidylyltransferase; Region: G1P_TT_short; cd02538 717522000903 glucose-1-phosphate thymidylyltransferase, short form; Region: rmlA; TIGR01207 717522000904 substrate binding site; other site 717522000905 tetramer interface; other site 717522000906 PE family; Region: PE; pfam00934 717522000907 Domain of unknown function (DUF222); Region: DUF222; pfam02720 717522000908 HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085 717522000909 active site 717522000910 aminotransferase AlaT; Validated; Region: PRK09265 717522000911 Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609 717522000912 pyridoxal 5'-phosphate binding site [chemical binding]; other site 717522000913 homodimer interface [polypeptide binding]; other site 717522000914 catalytic residue [active] 717522000915 Fe-S oxidoreductase [Energy production and conversion]; Region: GlpC; COG0247 717522000916 4Fe-4S binding domain; Region: Fer4; pfam00037 717522000917 Cysteine-rich domain; Region: CCG; pfam02754 717522000918 Cysteine-rich domain; Region: CCG; pfam02754 717522000919 C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170 717522000920 Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197 717522000921 DNA binding residues [nucleotide binding] 717522000922 dimerization interface [polypeptide binding]; other site 717522000923 Predicted GTPases (dynamin-related) [General function prediction only]; Region: COG0699 717522000924 Rat sarcoma (Ras)-like superfamily of small guanosine triphosphatases (GTPases); Region: Ras_like_GTPase; cl17170 717522000925 G3 box; other site 717522000926 Switch II region; other site 717522000927 GTP/Mg2+ binding site [chemical binding]; other site 717522000928 G4 box; other site 717522000929 G5 box; other site 717522000930 Predicted GTPases (dynamin-related) [General function prediction only]; Region: COG0699 717522000931 Rat sarcoma (Ras)-like superfamily of small guanosine triphosphatases (GTPases); Region: Ras_like_GTPase; cl17170 717522000932 G1 box; other site 717522000933 GTP/Mg2+ binding site [chemical binding]; other site 717522000934 G2 box; other site 717522000935 Switch I region; other site 717522000936 G3 box; other site 717522000937 Switch II region; other site 717522000938 Uncharacterized MobA-related protein [General function prediction only]; Region: COG2068 717522000939 active site 717522000940 Gamma-aminobutyrate permease and related permeases [Amino acid transport and metabolism]; Region: AnsP; COG1113 717522000941 TIGR04255 family protein; Region: sporadTIGR04255 717522000942 molecular chaperone DnaK; Provisional; Region: dnaK; PRK00290 717522000943 Nucleotide-binding domain of human HSPA9 and similar proteins; Region: HSPA9-Ssq1-like_NBD; cd10234 717522000944 nucleotide binding site [chemical binding]; other site 717522000945 NEF interaction site [polypeptide binding]; other site 717522000946 SBD interface [polypeptide binding]; other site 717522000947 Molecular chaperone GrpE (heat shock protein) [Posttranslational modification, protein turnover, chaperones]; Region: GrpE; COG0576 717522000948 GrpE is the adenine nucleotide exchange factor of DnaK (Hsp70)-type ATPases. The GrpE dimer binds to the ATPase domain of Hsp70 catalyzing the dissociation of ADP, which enables rebinding of ATP, one step in the Hsp70 reaction cycle in protein folding; Region: GrpE; cd00446 717522000949 dimer interface [polypeptide binding]; other site 717522000950 hsp70 (ATPase domain) interactions [polypeptide binding]; other site 717522000951 chaperone protein DnaJ; Provisional; Region: PRK14279 717522000952 DnaJ domain or J-domain. DnaJ/Hsp40 (heat shock protein 40) proteins are highly conserved and play crucial roles in protein translation, folding, unfolding, translocation, and degradation. They act primarily by stimulating the ATPase activity of Hsp70s; Region: DnaJ; cd06257 717522000953 HSP70 interaction site [polypeptide binding]; other site 717522000954 Zinc finger domain of DnaJ and HSP40; Region: DnaJ_zf; cd10719 717522000955 Zn binding sites [ion binding]; other site 717522000956 C-terminal substrate binding domain of DnaJ and HSP40; Region: DnaJ_C; cd10747 717522000957 dimer interface [polypeptide binding]; other site 717522000958 Helix-Turn-Helix DNA binding domain of HspR-like transcription regulators; Region: HTH_HspR-like; cd01279 717522000959 DNA binding residues [nucleotide binding] 717522000960 MerR HTH family regulatory protein; Region: MerR_1; pfam13411 717522000961 putative dimer interface [polypeptide binding]; other site 717522000962 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522000963 PPE family; Region: PPE; pfam00823 717522000964 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522000965 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522000966 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522000967 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522000968 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522000969 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522000970 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522000971 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522000972 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522000973 PaaI_thioesterase is a tetrameric acyl-CoA thioesterase with a hot dog fold and one of several proteins responsible for phenylacetic acid (PA) degradation in bacteria. Although orthologs of PaaI exist in archaea and eukaryotes, their function has not...; Region: PaaI_thioesterase; cd03443 717522000974 CoenzymeA binding site [chemical binding]; other site 717522000975 subunit interaction site [polypeptide binding]; other site 717522000976 PHB binding site; other site 717522000977 Adenylosuccinate synthetase; Region: Adenylsucc_synt; smart00788 717522000978 Adenylosuccinate synthetase (AdSS) catalyzes the first step in the de novo biosynthesis of AMP. IMP and L-aspartate are conjugated in a two-step reaction accompanied by the hydrolysis of GTP to GDP in the presence of Mg2+. In the first step, the...; Region: AdSS; cd03108 717522000979 GDP-binding site [chemical binding]; other site 717522000980 ACT binding site; other site 717522000981 IMP binding site; other site 717522000982 Uncharacterized homologs of Site-2 protease (S2P), zinc metalloproteases (MEROPS family M50) which cleave transmembrane domains of substrate proteins, regulating intramembrane proteolysis (RIP) of diverse signal transduction mechanisms. Members of the...; Region: S2P-M50_like_1; cd06158 717522000983 Peptidase family M50; Region: Peptidase_M50; pfam02163 717522000984 active site 717522000985 putative substrate binding region [chemical binding]; other site 717522000986 Protein of unknown function (DUF3151); Region: DUF3151; pfam11349 717522000987 Mg/Co/Ni transporter MgtE (contains CBS domain) [Inorganic ion transport and metabolism]; Region: MgtE; COG2239 717522000988 MgtE intracellular N domain; Region: MgtE_N; pfam03448 717522000989 This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domain in the magnesium transporter, MgtE. MgtE and its homologs are found in eubacteria, archaebacteria, and eukaryota. Members of this family transport Mg2+ or other...; Region: CBS_pair_Mg_transporter; cd04606 717522000990 Divalent cation transporter; Region: MgtE; pfam01769 717522000991 fructose-bisphosphate aldolase; Provisional; Region: PRK09197 717522000992 fructose-bisphosphate aldolase, class II, yeast/E. coli subtype; Region: FruBisAldo_II_A; TIGR01520 717522000993 active site 717522000994 intersubunit interface [polypeptide binding]; other site 717522000995 zinc binding site [ion binding]; other site 717522000996 Na+ binding site [ion binding]; other site 717522000997 Uncharacterized membrane-associated protein [Function unknown]; Region: DedA; COG0586 717522000998 SNARE associated Golgi protein; Region: SNARE_assoc; cl00429 717522000999 Predicted glycosyl hydrolase [Carbohydrate transport and metabolism]; Region: COG4833 717522001000 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4185 717522001001 AAA domain; Region: AAA_33; pfam13671 717522001002 Protein of unknown function (DUF3423); Region: DUF3423; pfam11903 717522001003 VWA domain containing CoxE-like protein; Region: VWA_CoxE; pfam05762 717522001004 von Willebrand factor (vWF) type A domain; Region: VWA; smart00327 717522001005 metal ion-dependent adhesion site (MIDAS); other site 717522001006 Ligand-binding SRPBCC domain of an uncharacterized subfamily of proteins; Region: SRPBCC_5; cd07823 717522001007 putative hydrophobic ligand binding site [chemical binding]; other site 717522001008 MoxR-like ATPases [General function prediction only]; Region: COG0714 717522001009 GT_2_like_f is a subfamily of the glycosyltransferase family 2 (GT-2) with unknown function; Region: GT_2_like_f; cd04182 717522001010 Ligand binding site; other site 717522001011 metal-binding site 717522001012 Xanthine and CO dehydrogenases maturation factor, XdhC/CoxF family [Posttranslational modification, protein turnover, chaperones]; Region: XdhC; COG1975 717522001013 XdhC and CoxI family; Region: XdhC_CoxI; pfam02625 717522001014 XdhC Rossmann domain; Region: XdhC_C; pfam13478 717522001015 carbon-monoxide dehydrogenase, large subunit; Region: CO_dehy_Mo_lg; TIGR02416 717522001016 Aldehyde oxidase and xanthine dehydrogenase, a/b hammerhead domain; Region: Ald_Xan_dh_C; pfam01315 717522001017 Molybdopterin-binding domain of aldehyde dehydrogenase; Region: Ald_Xan_dh_C2; pfam02738 717522001018 Aerobic-type carbon monoxide dehydrogenase, small subunit CoxS/CutS homologs [Energy production and conversion]; Region: CoxS; COG2080 717522001019 2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207 717522001020 catalytic loop [active] 717522001021 iron binding site [ion binding]; other site 717522001022 [2Fe-2S] binding domain; Region: Fer2_2; pfam01799 717522001023 Aerobic-type carbon monoxide dehydrogenase, middle subunit CoxM/CutM homologs [Energy production and conversion]; Region: CoxM; COG1319 717522001024 CO dehydrogenase flavoprotein C-terminal domain; Region: CO_deh_flav_C; pfam03450 717522001025 XdhC and CoxI family; Region: XdhC_CoxI; pfam02625 717522001026 Xanthine and CO dehydrogenases maturation factor, XdhC/CoxF family [Posttranslational modification, protein turnover, chaperones]; Region: XdhC; COG1975 717522001027 XdhC and CoxI family; Region: XdhC_CoxI; pfam02625 717522001028 XdhC Rossmann domain; Region: XdhC_C; pfam13478 717522001029 Transcriptional regulator [Transcription]; Region: LysR; COG0583 717522001030 Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126 717522001031 LysR substrate binding domain; Region: LysR_substrate; pfam03466 717522001032 dimerization interface [polypeptide binding]; other site 717522001033 Uncharacterized conserved protein [Function unknown]; Region: COG3360 717522001034 rRNA methylases [Translation, ribosomal structure and biogenesis]; Region: SpoU; COG0566 717522001035 SpoU rRNA Methylase family; Region: SpoU_methylase; pfam00588 717522001036 Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223 717522001037 active site 717522001038 ATP-dependent chaperone ClpB; Region: chaperone_ClpB; TIGR03346 717522001039 Clp amino terminal domain; Region: Clp_N; pfam02861 717522001040 Clp amino terminal domain; Region: Clp_N; pfam02861 717522001041 The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009 717522001042 Walker A motif; other site 717522001043 ATP binding site [chemical binding]; other site 717522001044 Walker B motif; other site 717522001045 arginine finger; other site 717522001046 The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009 717522001047 Walker A motif; other site 717522001048 ATP binding site [chemical binding]; other site 717522001049 Walker B motif; other site 717522001050 arginine finger; other site 717522001051 C-terminal, D2-small domain, of ClpB protein; Region: ClpB_D2-small; pfam10431 717522001052 Globins are heme proteins, which bind and transport oxygen. This family summarizes a diverse set of homologous protein domains, including: (1) tetrameric vertebrate hemoglobins, which are the major protein component of erythrocytes and transport oxygen...; Region: globin; cd01040 717522001053 bifunctional nitric oxide dioxygenase/dihydropteridine reductase 2; Provisional; Region: PRK13289 717522001054 heme-binding site [chemical binding]; other site 717522001055 The oxygenase reductase FAD/NADH binding domain acts as part of the multi-component bacterial oxygenases which oxidize hydrocarbons using oxygen as the oxidant. Electron transfer is from NADH via FAD (in the oxygenase reductase) and an [2FE-2S]...; Region: O2ase_reductase_like; cd06187 717522001056 FAD binding pocket [chemical binding]; other site 717522001057 FAD binding motif [chemical binding]; other site 717522001058 phosphate binding motif [ion binding]; other site 717522001059 beta-alpha-beta structure motif; other site 717522001060 NAD binding pocket [chemical binding]; other site 717522001061 Adenylate cyclase, family 3 (some proteins contain HAMP domain) [Signal transduction mechanisms]; Region: CyaA; COG2114 717522001062 cyclase homology domain; Region: CHD; cd07302 717522001063 nucleotidyl binding site; other site 717522001064 metal binding site [ion binding]; metal-binding site 717522001065 dimer interface [polypeptide binding]; other site 717522001066 Predicted ATPase [General function prediction only]; Region: COG3903 717522001067 RecA-like NTPases. This family includes the NTP binding domain of F1 and V1 H+ATPases, DnaB and related helicases as well as bacterial RecA and related eukaryotic and archaeal recombinases. This group also includes bacterial conjugation proteins and...; Region: RecA-like_NTPases; cl17233 717522001068 Walker A motif; other site 717522001069 ATP binding site [chemical binding]; other site 717522001070 Walker B motif; other site 717522001071 Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197 717522001072 C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170 717522001073 DNA binding residues [nucleotide binding] 717522001074 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522001075 PPE family; Region: PPE; pfam00823 717522001076 Formate-dependent phosphoribosylglycinamide formyltransferase (GAR transformylase) [Nucleotide transport and metabolism]; Region: PurT; COG0027 717522001077 Orn/Lys/Arg decarboxylase, N-terminal domain; Region: OKR_DC_1_N; pfam03709 717522001078 ATP-grasp domain; Region: ATP-grasp_4; cl17255 717522001079 Member of the Rhodanese Homology Domain superfamily, subgroup 1. This CD includes the putative rhodanese-related sulfurtransferases of several uncharacterized proteins; Region: RHOD_1; cd01522 717522001080 active site residue [active] 717522001081 O-succinylhomoserine sulfhydrylase; Provisional; Region: PRK07810 717522001082 CGS_like: Cystathionine gamma-synthase is a PLP dependent enzyme and catalyzes the committed step of methionine biosynthesis. This pathway is unique to microorganisms and plants, rendering the enzyme an attractive target for the development of...; Region: CGS_like; cd00614 717522001083 homodimer interface [polypeptide binding]; other site 717522001084 substrate-cofactor binding pocket; other site 717522001085 pyridoxal 5'-phosphate binding site [chemical binding]; other site 717522001086 catalytic residue [active] 717522001087 NADH dehydrogenase, FAD-containing subunit [Energy production and conversion]; Region: Ndh; COG1252 717522001088 NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500 717522001089 Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070 717522001090 Domain of unknown function (DUF222); Region: DUF222; pfam02720 717522001091 HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085 717522001092 active site 717522001093 PLD-like domain; Region: PLDc_2; pfam13091 717522001094 Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680 717522001095 Beta-lactamase; Region: Beta-lactamase; pfam00144 717522001096 Glutaryl-CoA dehydrogenase; Region: GCD; cd01151 717522001097 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522001098 FAD binding site [chemical binding]; other site 717522001099 substrate binding pocket [chemical binding]; other site 717522001100 catalytic base [active] 717522001101 Protein of unknown function (DUF3054); Region: DUF3054; pfam11255 717522001102 MMPL family; Region: MMPL; pfam03176 717522001103 MMPL family; Region: MMPL; pfam03176 717522001104 Mycobacterium membrane protein; Region: Mycobact_memb; pfam05423 717522001105 acyl-CoA synthetase; Validated; Region: PRK05850 717522001106 Fatty acyl-AMP ligase (FAAL); Region: FAAL; cd05931 717522001107 acyl-activating enzyme (AAE) consensus motif; other site 717522001108 active site 717522001109 Acyl carrier protein [Lipid metabolism / Secondary metabolites biosynthesis, transport, and catabolism]; Region: AcpP; COG0236 717522001110 Polyketide synthase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3321 717522001111 polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833 717522001112 active site 717522001113 Condensing enzymes; Family of enzymes that catalyze a (decarboxylating or non-decarboxylating) Claisen-like condensation reaction. Members are share strong structural similarity, and are involved in the synthesis and degradation of fatty acids, and the...; Region: cond_enzymes; cl09938 717522001114 malonyl CoA-acyl carrier protein transacylase; Region: fabD; TIGR00128 717522001115 Acyl transferase domain in polyketide synthase (PKS) enzymes; Region: PKS_AT; smart00827 717522001116 Phosphopantetheine attachment site; Region: PKS_PP; smart00823 717522001117 Thioesterase; Region: PKS_TE; smart00824 717522001118 Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849 717522001119 glucose-6-phosphate dehydrogenase (coenzyme-F420); Region: F420_G6P_DH; TIGR03554 717522001120 probable F420-dependent oxidoreductase, MSMEG_4141 family; Region: F420_MSMEG_4141; TIGR03620 717522001121 N5,N10-methylenetetrahydromethanopterin reductase (Mer) catalyzes the reduction of N5,N10-methylenetetrahydromethanopterin with reduced coenzyme F420 to N5-methyltetrahydromethanopterin and oxidized coenzyme F420; Region: Tetrahydromethanopterin_reductase; cd01097 717522001122 phosphate acetyltransferase; Reviewed; Region: PRK05632 717522001123 DRTGG domain; Region: DRTGG; pfam07085 717522001124 phosphotransacetylase; Reviewed; Region: eutD; PRK09653 717522001125 propionate/acetate kinase; Provisional; Region: PRK12379 717522001126 acetate kinase A/propionate kinase 2; Reviewed; Region: PRK00180 717522001127 Serine/Threonine protein kinases, catalytic domain; Region: S_TKc; smart00220 717522001128 Catalytic domain of Protein Kinases; Region: PKc; cd00180 717522001129 active site 717522001130 ATP binding site [chemical binding]; other site 717522001131 substrate binding site [chemical binding]; other site 717522001132 activation loop (A-loop); other site 717522001133 Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134 717522001134 Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497 717522001135 substrate binding pocket [chemical binding]; other site 717522001136 membrane-bound complex binding site; other site 717522001137 hinge residues; other site 717522001138 NUDIX domain; Region: NUDIX; pfam00293 717522001139 nudix motif; other site 717522001140 Thiamine monophosphate synthase (TMP synthase)/TenI. TMP synthase catalyzes an important step in the thiamine biosynthesis pathway, the substitution of the pyrophosphate of 2-methyl-4-amino-5- hydroxymethylpyrimidine pyrophosphate by 4-methyl-5-; Region: TMP_TenI; cd00564 717522001141 thiamine phosphate binding site [chemical binding]; other site 717522001142 active site 717522001143 pyrophosphate binding site [ion binding]; other site 717522001144 NADP oxidoreductase coenzyme F420-dependent; Region: F420_oxidored; cl17232 717522001145 glycine oxidase ThiO; Region: thiamin_ThiO; TIGR02352 717522001146 ThiaminS ubiquitin-like sulfur carrier protein; Region: ThiS; cd00565 717522001147 thiS-thiF/thiG interaction site; other site 717522001148 Thiazole synthase (ThiG) is the tetrameric enzyme that is involved in the formation of the thiazole moiety of thiamin pyrophosphate, an essential ubiquitous cofactor that plays an important role in carbohydrate and amino acid metabolism. ThiG catalyzes...; Region: ThiG; cd04728 717522001149 ThiS interaction site; other site 717522001150 putative active site [active] 717522001151 tetramer interface [polypeptide binding]; other site 717522001152 Predicted aminopeptidases [General function prediction only]; Region: Iap; COG2234 717522001153 Zinc peptidases M18, M20, M28, and M42; Region: Zinc_peptidase_like; cl14876 717522001154 PA_SaNapH_like: Protease-associated domain containing proteins like Streptomyces anulatus N-acetylpuromycin N-acetylhydrolase (SaNapH).This group contains various PA domain-containing proteins similar SaNapH. Proteins in this group belong to the...; Region: PA_SaNapH_like; cd04816 717522001155 PA/protease or protease-like domain interface [polypeptide binding]; other site 717522001156 M28 Zn-peptidase Streptomyces griseus Aminopeptidase and similar proteins; Region: M28_SGAP_like; cd03876 717522001157 active site 717522001158 metal binding site [ion binding]; metal-binding site 717522001159 Predicted metalloprotease [General function prediction only]; Region: COG2321 717522001160 Peptidase Gluzincin family (thermolysin-like proteinases, TLPs) includes peptidases M1, M2, M3, M4, M13, M32 and M36 (fungalysins); Region: GluZincin; cl14813 717522001161 Zn binding site [ion binding]; other site 717522001162 Alpha/beta hydrolase family; Region: Abhydrolase_5; pfam12695 717522001163 4-amino-5-hydroxymethyl-2-methyl-pyrimidine phosphate kinase (HMPP-kinase) catalyzes two consecutive phosphorylation steps in the thiamine phosphate biosynthesis pathway, leading to the synthesis of vitamin B1. The first step is the phosphorylation of...; Region: HMPP_kinase; cd01169 717522001164 dimer interface [polypeptide binding]; other site 717522001165 substrate binding site [chemical binding]; other site 717522001166 ATP binding site [chemical binding]; other site 717522001167 thiamine biosynthesis protein ThiC; Provisional; Region: PRK09284 717522001168 ThiC-associated domain; Region: ThiC-associated; pfam13667 717522001169 ThiC family; Region: ThiC; pfam01964 717522001170 E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122 717522001171 ATPase, P-type (transporting), HAD superfamily, subfamily IC; Region: ATPase_P-type; TIGR01494 717522001172 Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427 717522001173 motif II; other site 717522001174 Cation transporting ATPase, C-terminus; Region: Cation_ATPase_C; pfam00689 717522001175 Escherichia coli exonuclease III (ExoIII) and Neisseria meningitides NExo-like subfamily of the ExoIII family purinic/apyrimidinic (AP) endonucleases; Region: ExoIII-like_AP-endo; cd09086 717522001176 putative catalytic site [active] 717522001177 putative phosphate binding site [ion binding]; other site 717522001178 active site 717522001179 metal binding site A [ion binding]; metal-binding site 717522001180 DNA binding site [nucleotide binding] 717522001181 putative AP binding site [nucleotide binding]; other site 717522001182 putative metal binding site B [ion binding]; other site 717522001183 Polypeptide or peptide deformylase; a family of metalloenzymes that catalyzes the removal of the N-terminal formyl group in a growing polypeptide chain following translation initiation during protein synthesis in prokaryotes. These enzymes utilize Fe(II)...; Region: Pep_deformylase; cd00487 717522001184 active site 717522001185 catalytic residues [active] 717522001186 metal binding site [ion binding]; metal-binding site 717522001187 Protein of unknown function (DUF3263); Region: DUF3263; pfam11662 717522001188 LytR cell envelope-related transcriptional attenuator; Region: LytR_C; pfam13399 717522001189 Cu/Zn superoxide dismutase [Inorganic ion transport and metabolism]; Region: SodC; COG2032 717522001190 Copper/zinc superoxide dismutase (SOD). superoxide dismutases catalyse the conversion of superoxide radicals to molecular oxygen. Three evolutionarily distinct families of SODs are known, of which the copper/zinc-binding family is one. Defects in the...; Region: Cu-Zn_Superoxide_Dismutase; cd00305 717522001191 E-class dimer interface [polypeptide binding]; other site 717522001192 P-class dimer interface [polypeptide binding]; other site 717522001193 active site 717522001194 Cu2+ binding site [ion binding]; other site 717522001195 Zn2+ binding site [ion binding]; other site 717522001196 carboxylate-amine ligase; Provisional; Region: PRK13517 717522001197 carboxylate-amine ligase, YbdK family; Region: gshA_cyan_rel; TIGR02050 717522001198 Uncharacterized protein, similar to the N-terminal domain of Lon protease [General function prediction only]; Region: COG2802 717522001199 AAA family ATPase, CDC48 subfamily; Region: CDC48; TIGR01243 717522001200 Cell division protein 48 (CDC48), N-terminal domain; Region: CDC48_N; pfam02359 717522001201 The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009 717522001202 Walker A motif; other site 717522001203 ATP binding site [chemical binding]; other site 717522001204 Walker B motif; other site 717522001205 arginine finger; other site 717522001206 The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009 717522001207 Walker A motif; other site 717522001208 ATP binding site [chemical binding]; other site 717522001209 Walker B motif; other site 717522001210 arginine finger; other site 717522001211 Phosphatidylserine synthase [Lipid metabolism]; Region: PssA; COG1183 717522001212 CDP-alcohol phosphatidyltransferase; Region: CDP-OH_P_transf; pfam01066 717522001213 phosphatidylserine decarboxylase; Provisional; Region: PRK05305 717522001214 Molybdopterin biosynthesis enzyme [Coenzyme metabolism]; Region: MoeA; COG0303 717522001215 MoeA family. Members of this family are involved in biosynthesis of the molybdenum cofactor (MoCF), an essential cofactor of a diverse group of redox enzymes. MoCF biosynthesis is an evolutionarily conserved pathway present in eubacteria, archaea and...; Region: MoeA; cd00887 717522001216 dimer interface [polypeptide binding]; other site 717522001217 putative functional site; other site 717522001218 putative MPT binding site; other site 717522001219 short chain dehydrogenase; Provisional; Region: PRK06197 717522001220 retinol dehydrogenase (retinol-DH), Light dependent Protochlorophyllide (Pchlide) OxidoReductase (LPOR) and related proteins, classical (c) SDRs; Region: retinol-DH_like_SDR_c_like; cd05327 717522001221 putative NAD(P) binding site [chemical binding]; other site 717522001222 active site 717522001223 chaperonin GroEL; Reviewed; Region: groEL; PRK12849 717522001224 GroEL_like type I chaperonin. Chaperonins are involved in productive folding of proteins. They share a common general morphology, a double toroid of 2 stacked rings, each composed of 7-9 subunits. The symmetry of type I is seven-fold and they are found...; Region: GroEL; cd03344 717522001225 ring oligomerisation interface [polypeptide binding]; other site 717522001226 ATP/Mg binding site [chemical binding]; other site 717522001227 stacking interactions; other site 717522001228 hinge regions; other site 717522001229 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522001230 PPE family; Region: PPE; pfam00823 717522001231 Protein of unknown function (DUF664); Region: DUF664; pfam04978 717522001232 DinB superfamily; Region: DinB_2; pfam12867 717522001233 putative anti-sigmaE protein; Provisional; Region: PRK13920 717522001234 Anti-sigma-K factor rskA; Region: RskA; pfam10099 717522001235 RNA polymerase sigma factor SigK; Reviewed; Region: PRK09646 717522001236 Sigma-70 region 2; Region: Sigma70_r2; pfam04542 717522001237 Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171 717522001238 DNA binding residues [nucleotide binding] 717522001239 Steroid 5-alpha reductase family enzyme [General function prediction only]; Region: COG3752 717522001240 Mycolic acid cyclopropane synthetase; Region: CMAS; pfam02353 717522001241 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522001242 S-adenosylmethionine binding site [chemical binding]; other site 717522001243 Uncharacterized conserved protein [Function unknown]; Region: COG3496 717522001244 Predicted NAD/FAD-binding protein [General function prediction only]; Region: COG2907 717522001245 Subunit A of Class III extradiol dioxygenases; Region: Extradiol_Dioxygenase_3A_like; cl06673 717522001246 dimer interface [polypeptide binding]; other site 717522001247 Transport protein; Region: actII; TIGR00833 717522001248 Mycobacterium membrane protein; Region: Mycobact_memb; pfam05423 717522001249 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522001250 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522001251 PPE family; Region: PPE; pfam00823 717522001252 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522001253 Protein of unknown function (DUF2782); Region: DUF2782; pfam11191 717522001254 enoyl-CoA hydratase; Provisional; Region: PRK12478 717522001255 Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558 717522001256 substrate binding site [chemical binding]; other site 717522001257 oxyanion hole (OAH) forming residues; other site 717522001258 trimer interface [polypeptide binding]; other site 717522001259 PemK-like protein; Region: PemK; pfam02452 717522001260 Serine proteases of the peptidase family S9A [Amino acid transport and metabolism]; Region: COG1505 717522001261 Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326 717522001262 Ralstonia eutrophus NAD+-dependent acetaldehyde dehydrogenase II-like; Region: ALDH_ACDHII-AcoD; cd07116 717522001263 Aldehyde dehydrogenase family; Region: Aldedh; pfam00171 717522001264 NAD(P) binding site [chemical binding]; other site 717522001265 catalytic residues [active] 717522001266 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3564 717522001267 dihydrolipoamide dehydrogenase; Reviewed; Region: PRK07818 717522001268 Anaerobic glycerol-3-phosphate dehydrogenase [Amino acid transport and metabolism]; Region: GlpB; cl17730 717522001269 Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070 717522001270 Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852 717522001271 Uncharacterized conserved protein [Function unknown]; Region: COG2128 717522001272 Carboxymuconolactone decarboxylase family; Region: CMD; pfam02627 717522001273 Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396 717522001274 Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093 717522001275 non-specific DNA binding site [nucleotide binding]; other site 717522001276 salt bridge; other site 717522001277 sequence-specific DNA binding site [nucleotide binding]; other site 717522001278 Predicted transcriptional regulator [General function prediction only]; Region: COG3800 717522001279 Domain of unknown function (DUF955); Region: DUF955; pfam06114 717522001280 Predicted transcriptional regulator (DUF2083); Region: DUF2083; pfam09856 717522001281 Acyl-ACP thioesterase [Lipid metabolism]; Region: FatA; COG3884 717522001282 4-hydroxybenzoyl-CoA thioesterase (4HBT). Catalyzes the final step in the 4-chlorobenzoate degradation pathway in which 4-chlorobenzoate is converted to 4-hydroxybenzoate in certain soil-dwelling bacteria. 4HBT forms a homotetramer with four active sites; Region: 4HBT; cd00586 717522001283 active site 717522001284 The hotdog fold was initially identified in the E. coli FabA (beta-hydroxydecanoyl-acyl carrier protein (ACP)-dehydratase) structure and subsequently in 4HBT (4-hydroxybenzoyl-CoA thioesterase) from Pseudomonas. A number of other seemingly unrelated...; Region: hot_dog; cl00509 717522001285 active site 2 [active] 717522001286 isocitrate lyase; Provisional; Region: PRK15063 717522001287 Members of the ICL/PEPM_KPHMT enzyme superfamily catalyze the formation and cleavage of either P-C or C-C bonds. Typical members are phosphoenolpyruvate mutase (PEPM), phosphonopyruvate hydrolase (PPH), carboxyPEP mutase (CPEP mutase), oxaloacetate...; Region: ICL_KPHMT; cd06556 717522001288 oligomerization interface [polypeptide binding]; other site 717522001289 active site 717522001290 metal binding site [ion binding]; metal-binding site 717522001291 3-hydroxybutyryl-CoA dehydrogenase; Validated; Region: PRK07819 717522001292 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain; Region: 3HCDH_N; pfam02737 717522001293 3-hydroxyacyl-CoA dehydrogenase, C-terminal domain; Region: 3HCDH; pfam00725 717522001294 Mycolic acid cyclopropane synthetase; Region: CMAS; pfam02353 717522001295 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522001296 S-adenosylmethionine binding site [chemical binding]; other site 717522001297 Mycolic acid cyclopropane synthetase; Region: CMAS; pfam02353 717522001298 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cl17173 717522001299 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522001300 S-adenosylmethionine binding site [chemical binding]; other site 717522001301 1,4-dihydroxy-2-naphthoate octaprenyltransferase [Coenzyme metabolism]; Region: MenA; cl17224 717522001302 UbiA prenyltransferase family; Region: UbiA; pfam01040 717522001303 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522001304 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522001305 Predicted membrane protein [Function unknown]; Region: COG2733 717522001306 Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396 717522001307 Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093 717522001308 non-specific DNA binding site [nucleotide binding]; other site 717522001309 salt bridge; other site 717522001310 sequence-specific DNA binding site [nucleotide binding]; other site 717522001311 Protein of unknown function (DUF2516); Region: DUF2516; pfam10724 717522001312 Protein of unknown function (DUF2599); Region: DUF2599; pfam10783 717522001313 2-deoxyribose-5-phosphate aldolase (DERA) of the DeoC family; Region: DeoC; cd00959 717522001314 intersubunit interface [polypeptide binding]; other site 717522001315 active site 717522001316 catalytic residue [active] 717522001317 Protein of unknown function (DUF2993); Region: DUF2993; pfam11209 717522001318 Predicted amidohydrolase [General function prediction only]; Region: COG0388 717522001319 Uncharacterized subgroup of the nitrilase superfamily (putative class 13 nitrilases); Region: nitrilase_3; cd07581 717522001320 putative active site [active] 717522001321 catalytic triad [active] 717522001322 putative dimer interface [polypeptide binding]; other site 717522001323 Protein of unknown function (DUF2505); Region: DUF2505; pfam10698 717522001324 UDP-N-acetylenolpyruvoylglucosamine reductase; Provisional; Region: murB; PRK13903 717522001325 FAD binding domain; Region: FAD_binding_4; pfam01565 717522001326 UDP-N-acetylenolpyruvoylglucosamine reductase, C-terminal domain; Region: MurB_C; pfam02873 717522001327 IgD-like repeat domain of mycobacterial L,D-transpeptidases; Region: LDT_IgD_like_1; cd13431 717522001328 Uncharacterized protein conserved in bacteria [Function unknown]; Region: ErfK; COG1376 717522001329 IgD-like repeat domain of mycobacterial L,D-transpeptidases; Region: LDT_IgD_like_2; cd13432 717522001330 L,D-transpeptidase catalytic domain; Region: YkuD; pfam03734 717522001331 Short-chain alcohol dehydrogenase of unknown specificity [General function prediction only]; Region: COG4221 717522001332 Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931 717522001333 NAD(P) binding site [chemical binding]; other site 717522001334 active site 717522001335 Transcriptional regulator/sugar kinase [Transcription / Carbohydrate transport and metabolism]; Region: NagC; COG1940 717522001336 Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cl17037 717522001337 This family is most closely related to the GT1 family of glycosyltransferases. The sucrose-phosphate synthases in this family may be unique to plants and photosynthetic bacteria. This enzyme catalyzes the synthesis of sucrose 6-phosphate from fructose...; Region: GT1_Sucrose_synthase; cd03800 717522001338 D-inositol-3-phosphate glycosyltransferase; Region: mycothiol_MshA; TIGR03449 717522001339 putative ADP-binding pocket [chemical binding]; other site 717522001340 Putative bacterial sensory transduction regulator; Region: YbjN; pfam10722 717522001341 VNTR0577 is located between Rv0487 and Rv0488. Differs from BCG Pasteur and BCG Mexico by a 58-bp in VNTR0577 locus of BCG Tokyo. The copy number of the 58-bp unit is 3 in BCG Tokyo and 4 in BCG Pasteur and BCG Mexico 717522001342 L-lysine exporter; Region: 2a75; TIGR00948 717522001343 Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067 717522001344 catalytic core [active] 717522001345 Histidine phosphatase domain found in a functionally diverse set of proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP; cd07040 717522001346 Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082 717522001347 dimer interface [polypeptide binding]; other site 717522001348 phosphorylation site [posttranslational modification] 717522001349 Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075 717522001350 ATP binding site [chemical binding]; other site 717522001351 Mg2+ binding site [ion binding]; other site 717522001352 G-X-G motif; other site 717522001353 Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745 717522001354 Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156 717522001355 active site 717522001356 phosphorylation site [posttranslational modification] 717522001357 intermolecular recognition site; other site 717522001358 dimerization interface [polypeptide binding]; other site 717522001359 Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383 717522001360 DNA binding site [nucleotide binding] 717522001361 GMC oxidoreductase; Region: GMC_oxred_N; pfam00732 717522001362 GMC oxidoreductase; Region: GMC_oxred_C; pfam05199 717522001363 Transcriptional regulators [Transcription]; Region: FadR; COG2186 717522001364 Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377 717522001365 DNA-binding site [nucleotide binding]; DNA binding site 717522001366 FCD domain; Region: FCD; pfam07729 717522001367 exopolyphosphatase; Region: exo_poly_only; TIGR03706 717522001368 Ppx/GppA phosphatase family; Region: Ppx-GppA; pfam02541 717522001369 Sugar phosphate isomerases/epimerases [Carbohydrate transport and metabolism]; Region: IolE; COG1082 717522001370 AP endonuclease family 2; These endonucleases play a role in DNA repair. Cleave phosphodiester bonds at apurinic or apyrimidinic sites; the alignment also contains hexulose-6-phosphate isomerases, enzymes that catalyze the epimerization of...; Region: AP2Ec; cl12060 717522001371 Thioesterase-like superfamily; Region: 4HBT_3; pfam13622 717522001372 Diacylglycerol kinase catalytic domain (presumed); Region: DAGKc; smart00046 717522001373 pyrroline-5-carboxylate reductase; Reviewed; Region: PRK11880 717522001374 NADP oxidoreductase coenzyme F420-dependent; Region: F420_oxidored; pfam03807 717522001375 NADP oxidoreductase coenzyme F420-dependent; Region: F420_oxidored; cl17232 717522001376 DNA binding domain, excisionase family; Region: excise; TIGR01764 717522001377 Nucleoside-diphosphate-sugar epimerases [Cell envelope biogenesis, outer membrane / Carbohydrate transport and metabolism]; Region: WcaG; COG0451 717522001378 UDP-glucose 4 epimerase (G4E), subgroup 3, extended (e) SDRs; Region: UDP_G4E_3_SDR_e; cd05240 717522001379 putative NAD(P) binding site [chemical binding]; other site 717522001380 active site 717522001381 putative substrate binding site [chemical binding]; other site 717522001382 1-acyl-sn-glycerol-3-phosphate acyltransferase [Lipid metabolism]; Region: PlsC; COG0204 717522001383 Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: MGAT-like; Region: LPLAT_MGAT-like; cd07987 717522001384 putative acyl-acceptor binding pocket; other site 717522001385 Mycolic acid cyclopropane synthetase; Region: CMAS; pfam02353 717522001386 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cl17173 717522001387 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522001388 S-adenosylmethionine binding site [chemical binding]; other site 717522001389 (R)-hydratase [(R)-specific enoyl-CoA hydratase]. Catalyzes the hydration of trans-2-enoyl CoA to (R)-3-hydroxyacyl-CoA as part of the PHA (polyhydroxyalkanoate) biosynthetic pathway. The structure of the monomer includes a five-strand antiparallel...; Region: R_hydratase_like; cd03441 717522001390 active site 717522001391 catalytic site [active] 717522001392 Phosphoserine phosphatase [Amino acid transport and metabolism]; Region: SerB; COG0560 717522001393 HAD-superfamily subfamily IB hydrolase, TIGR01490; Region: HAD-SF-IB-hyp1 717522001394 Mycobacterium membrane protein; Region: Mycobact_memb; pfam05423 717522001395 Predicted drug exporters of the RND superfamily [General function prediction only]; Region: COG2409 717522001396 Glutaredoxin-like domain (DUF836); Region: DUF836; pfam05768 717522001397 glutamyl-tRNA reductase; Region: hemA; TIGR01035 717522001398 NADP-binding domain of glutamyl-tRNA reductase; Region: NAD_bind_Glutamyl_tRNA_reduct; cd05213 717522001399 tRNA; other site 717522001400 putative tRNA binding site [nucleotide binding]; other site 717522001401 putative NADP binding site [chemical binding]; other site 717522001402 Glutamyl-tRNAGlu reductase, dimerisation domain; Region: GlutR_dimer; pfam00745 717522001403 porphobilinogen deaminase; Reviewed; Region: hemC; PRK00072 717522001404 Hydroxymethylbilane synthase (HMBS), also known as porphobilinogen deaminase (PBGD), is an intermediate enzyme in the biosynthetic pathway of tetrapyrrolic ring systems, such as heme, chlorophylls, and vitamin B12. HMBS catalyzes the conversion of...; Region: HMBS; cd00494 717522001405 domain interfaces; other site 717522001406 active site 717522001407 S-AdoMet dependent tetrapyrrole methylases; Region: TP_methylase; cd09815 717522001408 active site 717522001409 homodimer interface [polypeptide binding]; other site 717522001410 SAM binding site [chemical binding]; other site 717522001411 Uroporphyrinogen-III synthase [Coenzyme metabolism]; Region: HemD; COG1587 717522001412 Uroporphyrinogen-III synthase (HemD) catalyzes the asymmetrical cyclization of tetrapyrrole (linear) to uroporphyrinogen-III, the fourth step in the biosynthesis of heme. This ubiquitous enzyme is present in eukaryotes, bacteria and archaea. Mutations in...; Region: HemD; cd06578 717522001413 active site 717522001414 Porphobilinogen synthase (PBGS), which is also called delta-aminolevulinic acid dehydratase (ALAD), catalyzes the condensation of two 5-aminolevulinic acid (ALA) molecules to form the pyrrole porphobilinogen (PBG), which is the second step in the...; Region: ALAD_PBGS; cd00384 717522001415 dimer interface [polypeptide binding]; other site 717522001416 active site 717522001417 Schiff base residues; other site 717522001418 Domain of unknown function (DUF222); Region: DUF222; pfam02720 717522001419 HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085 717522001420 active site 717522001421 Sulphate Transporter and Anti-Sigma factor antagonist) domain of anti-anti-sigma factors, key regulators of anti-sigma factors by phosphorylation; Region: STAS_anti-anti-sigma_factors; cd07043 717522001422 anti sigma factor interaction site; other site 717522001423 regulatory phosphorylation site [posttranslational modification]; other site 717522001424 Predicted acyltransferases [Lipid metabolism]; Region: COG1835 717522001425 SGNH_hydrolase, or GDSL_hydrolase, is a diverse family of lipases and esterases. The tertiary fold of the enzyme is substantially different from that of the alpha/beta hydrolase family and unique among all known hydrolases; its active site closely...; Region: SGNH_hydrolase; cd00229 717522001426 active site 717522001427 catalytic triad [active] 717522001428 oxyanion hole [active] 717522001429 Enterochelin esterase and related enzymes [Inorganic ion transport and metabolism]; Region: Fes; COG2382 717522001430 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522001431 Methyltransferase domain; Region: Methyltransf_31; pfam13847 717522001432 Gamma-aminobutyrate permease and related permeases [Amino acid transport and metabolism]; Region: AnsP; COG1113 717522001433 Domain of unknown function (DUF385); Region: DUF385; pfam04075 717522001434 glutamate-1-semialdehyde aminotransferase; Provisional; Region: PRK00062 717522001435 Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes. PLP combines with an alpha-amino acid to form a compound called a Schiff base or aldimine intermediate, which depending on the reaction, is the...; Region: AAT_I; cl00321 717522001436 pyridoxal 5'-phosphate binding pocket [chemical binding]; other site 717522001437 catalytic residue [active] 717522001438 Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067 717522001439 catalytic core [active] 717522001440 TlpA-like family; composed of TlpA, ResA, DsbE and similar proteins. TlpA, ResA and DsbE are bacterial protein disulfide reductases with important roles in cytochrome maturation. They are membrane-anchored proteins with a soluble TRX domain containing a...; Region: TlpA_like_family; cd02966 717522001441 Thioredoxin-like; Region: Thioredoxin_8; pfam13905 717522001442 catalytic residues [active] 717522001443 Cytochrome c biogenesis protein [Posttranslational modification, protein turnover, chaperones]; Region: CcdA; COG0785 717522001444 Cytochrome C biogenesis protein transmembrane region; Region: DsbD; cl15788 717522001445 ResB protein required for cytochrome c biosynthesis [Posttranslational modification, protein turnover, chaperones]; Region: ResB; COG1333 717522001446 ResB-like family; Region: ResB; pfam05140 717522001447 cytochrome c-type biogenesis protein CcsB; Region: cytochr_II_ccsB; TIGR03144 717522001448 ParA and ParB of Caulobacter crescentus belong to a conserved family of bacterial proteins implicated in chromosome segregation. ParB binds to DNA sequences adjacent to the origin of replication and localizes to opposite cell poles shortly following the...; Region: ParA; cd02042 717522001449 AAA domain; Region: AAA_31; pfam13614 717522001450 P-loop; other site 717522001451 Magnesium ion binding site [ion binding]; other site 717522001452 Type 1 glutamine amidotransferase (GATase1)-like domain; Region: GAT_1; cl00020 717522001453 Protein of unknown function (DUF4229); Region: DUF4229; pfam14012 717522001455 3-oxoacyl-(acyl-carrier-protein) synthase III; Region: fabH; TIGR00747 717522001456 Ketoacyl-acyl carrier protein synthase III (KASIII) initiates the elongation in type II fatty acid synthase systems. It is found in bacteria and plants. Elongation of fatty acids in the type II systems occurs by Claisen condensation of malonyl-acyl...; Region: KAS_III; cd00830 717522001457 dimer interface [polypeptide binding]; other site 717522001458 active site 717522001459 CoA binding pocket [chemical binding]; other site 717522001460 1,4-dihydroxy-2-naphthoate octaprenyltransferase; Region: menA; TIGR00751 717522001461 UbiA prenyltransferase family; Region: UbiA; pfam01040 717522001462 5'-methylthioadenosine phosphorylase; Validated; Region: PRK07823 717522001463 Nucleoside-diphosphate-sugar epimerases [Cell envelope biogenesis, outer membrane / Carbohydrate transport and metabolism]; Region: WcaG; COG0451 717522001464 Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931 717522001465 NAD(P) binding site [chemical binding]; other site 717522001466 active site 717522001467 DPM_DPG-synthase_like is a member of the Glycosyltransferase 2 superfamily; Region: DPM_DPG-synthase_like; cd04179 717522001468 Ligand binding site; other site 717522001469 Putative Catalytic site; other site 717522001470 DXD motif; other site 717522001471 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3222 717522001472 O-succinylbenzoic acid--CoA ligase; Provisional; Region: PRK07824 717522001473 Adenylate forming domain, Class I; Region: AFD_class_I; cl17068 717522001474 Adenylate forming domain, Class I; Region: AFD_class_I; cl17068 717522001475 acyl-activating enzyme (AAE) consensus motif; other site 717522001476 acyl-activating enzyme (AAE) consensus motif; other site 717522001477 AMP binding site [chemical binding]; other site 717522001478 active site 717522001479 CoA binding site [chemical binding]; other site 717522001480 Protein of unknown function (DUF3349); Region: DUF3349; pfam11829 717522001481 Phosphate/sulphate permeases [Inorganic ion transport and metabolism]; Region: PitA; COG0306 717522001482 Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903 717522001483 This domain superfamily is found in a variety of structurally related metalloproteins, including the type I extradiol dioxygenases, glyoxalase I and a group of antibiotic resistance proteins; Region: Glo_EDI_BRP_like; cd06587 717522001484 active site 717522001485 short chain dehydrogenase; Provisional; Region: PRK05866 717522001486 classical (c) SDRs; Region: SDR_c; cd05233 717522001487 NAD(P) binding site [chemical binding]; other site 717522001488 active site 717522001489 Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558 717522001490 Enoyl-CoA hydratase/isomerase family; Region: ECH; pfam00378 717522001491 substrate binding site [chemical binding]; other site 717522001492 oxyanion hole (OAH) forming residues; other site 717522001493 trimer interface [polypeptide binding]; other site 717522001495 PIN domain of the Pyrobaculum aerophilum Pae0151 and Pae2754 proteins and homologs; Region: PIN_Pae0151; cd09873 717522001496 putative active site [active] 717522001497 homotetrameric interface [polypeptide binding]; other site 717522001498 Post-segregation antitoxin (ccd killing mechanism protein) encoded by the F plasmid [General function prediction only]; Region: COG5302 717522001499 acyl-CoA synthetase; Validated; Region: PRK06188 717522001500 Bacterial Bile acid CoA ligases and similar proteins; Region: BACL_like; cd05929 717522001501 putative active site [active] 717522001502 putative CoA binding site [chemical binding]; other site 717522001503 putative AMP binding site [chemical binding]; other site 717522001504 Predicted metal-dependent hydrolase with the TIM-barrel fold [General function prediction only]; Region: COG1574 717522001505 YtcJ_like metal dependent amidohydrolases. YtcJ is a Bacillus subtilis ORF of unknown function. The Arabidopsis homolog LAF3 has been identified as a factor required for photochrome A signalling; Region: YtcJ_like; cd01300 717522001506 active site 717522001507 O-succinylbenzoate synthase; Provisional; Region: PRK02901 717522001508 o-Succinylbenzoate synthase (OSBS) catalyzes the conversion of 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate (SHCHC) to 4-(2'-carboxyphenyl)-4-oxobutyrate (o-succinylbenzoate or OSB), a reaction in the menaquinone biosynthetic pathway; Region: OSBS; cd03320 717522001509 active site 717522001510 Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596 717522001511 homoserine O-acetyltransferase; Provisional; Region: metX; cl17114 717522001512 TAP-like protein; Region: Abhydrolase_4; pfam08386 717522001513 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1- carboxylate synthase; Validated; Region: PRK07449 717522001514 Pyrimidine (PYR) binding domain of 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexadiene-1- carboxylate synthase (MenD) and related proteins; Region: TPP_PYR_MenD; cd07037 717522001515 dimer interface [polypeptide binding]; other site 717522001516 tetramer interface [polypeptide binding]; other site 717522001517 PYR/PP interface [polypeptide binding]; other site 717522001518 TPP binding site [chemical binding]; other site 717522001519 Thiamine pyrophosphate (TPP) family, SHCHC synthase subfamily, TPP-binding module; composed of proteins similar to Escherichia coli 2-succinyl-6-hydroxyl-2,4-cyclohexadiene-1-carboxylic acid (SHCHC) synthase (also called MenD). SHCHC synthase plays a key...; Region: TPP_SHCHC_synthase; cd02009 717522001520 TPP-binding site; other site 717522001521 Protein of unknown function (DUF3592); Region: DUF3592; pfam12158 717522001522 Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438 717522001523 This family is most closely related to the GT1 family of glycosyltransferases. Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. The acceptor molecule can...; Region: GT1_like_2; cd03814 717522001524 Methylase involved in ubiquinone/menaquinone biosynthesis [Coenzyme metabolism]; Region: UbiE; COG2226 717522001525 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522001526 S-adenosylmethionine binding site [chemical binding]; other site 717522001527 Protein of unknown function (DUF732); Region: DUF732; pfam05305 717522001528 Methyltransferase domain; Region: Methyltransf_23; pfam13489 717522001529 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522001530 S-adenosylmethionine binding site [chemical binding]; other site 717522001531 geranylgeranyl reductase family; Region: GG-red-SF; TIGR02032 717522001532 ubiquinone biosynthesis hydroxylase family protein; Provisional; Region: PRK07608; cl17314 717522001533 Geranylgeranyl pyrophosphate synthase [Coenzyme metabolism]; Region: IspA; COG0142 717522001534 Trans-Isoprenyl Diphosphate Synthases, head-to-tail; Region: Trans_IPPS_HT; cd00685 717522001535 substrate binding pocket [chemical binding]; other site 717522001536 chain length determination region; other site 717522001537 substrate-Mg2+ binding site; other site 717522001538 catalytic residues [active] 717522001539 aspartate-rich region 1; other site 717522001540 active site lid residues [active] 717522001541 aspartate-rich region 2; other site 717522001542 heat shock protein HtpX; Provisional; Region: PRK03072 717522001543 NAD(P)H-dependent glycerol-3-phosphate dehydrogenase; Provisional; Region: PRK12439 717522001544 NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus; Region: NAD_Gly3P_dh_N; pfam01210 717522001545 NAD-dependent glycerol-3-phosphate dehydrogenase C-terminus; Region: NAD_Gly3P_dh_C; pfam07479 717522001546 Predicted flavoprotein involved in K+ transport [Inorganic ion transport and metabolism]; Region: TrkA; COG2072 717522001547 Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox_3; pfam13738 717522001548 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG1666 717522001549 Proteins similar to Escherichia coli YajQ; Region: YajQ_like; cd11740 717522001550 O-methyltransferase; Region: Methyltransf_2; pfam00891 717522001551 Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124 717522001552 Cytochrome P450; Region: p450; cl12078 717522001553 Domain of unknown function (DUF1918); Region: DUF1918; pfam08940 717522001554 ATP cone domain; Region: ATP-cone; pfam03477 717522001555 Ribonucleotide reductase, all-alpha domain; Region: Ribonuc_red_lgN; pfam00317 717522001556 ribonucleoside-diphosphate reductase, adenosylcobalamin-dependent; Region: NrdJ_Z; TIGR02504 717522001557 Class II ribonucleotide reductase, dimeric form; Region: RNR_II_dimer; cd02888 717522001558 active site 717522001559 dimer interface [polypeptide binding]; other site 717522001560 effector binding site; other site 717522001561 Ribonucleotide reductase and Pyruvate formate lyase; Region: RNR_PFL; cl09939 717522001562 Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223 717522001563 active site 717522001564 Putative lysophospholipase; Region: Hydrolase_4; pfam12146 717522001565 Alpha/beta hydrolase family; Region: Abhydrolase_5; pfam12695 717522001566 nicotinate phosphoribosyltransferase; Provisional; Region: PRK12484 717522001567 Nicotinate phosphoribosyltransferase (NAPRTase), subgroup A. Nicotinate phosphoribosyltransferase catalyses the formation of NAMN and PPi from 5-phosphoribosy -1-pyrophosphate (PRPP) and nicotinic acid, this is the first, and also rate limiting, reaction...; Region: NAPRTase_A; cd01570 717522001568 active site 717522001569 Putative enzyme of poly-gamma-glutamate biosynthesis (capsule formation) [Cell envelope biogenesis, outer membrane]; Region: PgsA; COG2843 717522001570 CapA and related proteins, metallophosphatase domain; Region: MPP_CapA; cd07381 717522001571 putative active site [active] 717522001572 putative metal binding site [ion binding]; other site 717522001573 hypothetical protein; Provisional; Region: PRK07588 717522001574 ubiquinone biosynthesis hydroxylase family protein; Provisional; Region: PRK07608; cl17314 717522001575 Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090 717522001576 dimerization interface [polypeptide binding]; other site 717522001577 putative DNA binding site [nucleotide binding]; other site 717522001578 putative Zn2+ binding site [ion binding]; other site 717522001579 Putative hydrophobic ligand-binding SRPBCC domain of Micromonospora echinospora CalC, human Aha1, and related proteins; Region: SRPBCC_CalC_Aha1-like; cd07814 717522001580 putative hydrophobic ligand binding site [chemical binding]; other site 717522001581 uncharacterized Actinobacterial protein TIGR03083; Region: TIGR03083 717522001582 TIGR03086 family protein; Region: TIGR03086 717522001583 N-terminal domain of Streptomyces griseus SgaA (suppression of growth disturbance caused by A-factor at a high concentration under high osmolality during early growth phase), and similar domains; Region: SgaA_N_like; cd07247 717522001584 Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903 717522001585 N-terminal domain of Streptomyces griseus SgaA (suppression of growth disturbance caused by A-factor at a high concentration under high osmolality during early growth phase), and similar domains; Region: SgaA_N_like; cd07247 717522001586 PE family; Region: PE; pfam00934 717522001587 Ub domain fused to Mut7-C; Region: Ub-Mut7C; pfam14451 717522001588 Uncharacterized conserved protein [Function unknown]; Region: COG1656 717522001589 Protein of unknown function DUF82; Region: DUF82; pfam01927 717522001590 Ribbon-helix-helix protein, copG family; Region: RHH_1; pfam01402 717522001591 PIN domain of ribonucleases (toxins), VapC, FitB, and PAE0151 of bacterial and archaeal toxin/antitoxin-like operons, and other similar homologs; Region: PIN_VapC-like; cd09861 717522001592 putative active site [active] 717522001593 Probable lipoprotein LpqN; Region: Lpp-LpqN; pfam10738 717522001594 Putative alpha-1,2-mannosidase [Carbohydrate transport and metabolism]; Region: COG3537 717522001595 Glycosyl hydrolase family 92; Region: Glyco_hydro_92; pfam07971 717522001596 Uncharacterized protein family (UPF0104); Region: UPF0104; pfam03706 717522001597 Transcriptional regulators [Transcription]; Region: FadR; COG2186 717522001598 Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377 717522001599 DNA-binding site [nucleotide binding]; DNA binding site 717522001600 FCD domain; Region: FCD; pfam07729 717522001601 ABC-type transport system involved in resistance to organic solvents, permease component [Secondary metabolites biosynthesis, transport, and catabolism]; Region: Ttg2B; COG0767 717522001602 Permease; Region: Permease; pfam02405 717522001603 ABC-type transport system involved in resistance to organic solvents, permease component [Secondary metabolites biosynthesis, transport, and catabolism]; Region: Ttg2B; COG0767 717522001604 Permease; Region: Permease; pfam02405 717522001605 virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996 717522001606 mce related protein; Region: MCE; pfam02470 717522001607 Protein of unknown function (DUF3407); Region: DUF3407; pfam11887 717522001608 ABC-type transport system involved in resistance to organic solvents, periplasmic component [Secondary metabolites biosynthesis, transport, and catabolism]; Region: Ttg2C; COG1463 717522001609 mce related protein; Region: MCE; pfam02470 717522001610 Protein of unknown function (DUF3407); Region: DUF3407; pfam11887 717522001611 virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996 717522001612 mce related protein; Region: MCE; pfam02470 717522001613 virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996 717522001614 mce related protein; Region: MCE; pfam02470 717522001615 Protein of unknown function (DUF3407); Region: DUF3407; pfam11887 717522001616 virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996 717522001617 mce related protein; Region: MCE; pfam02470 717522001618 virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996 717522001619 mce related protein; Region: MCE; pfam02470 717522001620 PIN domain of ribonucleases (toxins), VapC and FitB, of prokaryotic toxin/antitoxin operons, Pyrococcus horikoshii protein PH0500, and other similar bacterial and archaeal homologs; Region: PIN_VapC-FitB; cd09881 717522001621 oligomeric interface; other site 717522001622 putative active site [active] 717522001623 homodimer interface [polypeptide binding]; other site 717522001624 Antitoxin of toxin-antitoxin stability system [Cell division and chromosome partitioning]; Region: Phd; COG4118 717522001625 Predicted ATPase (AAA+ superfamily) [General function prediction only]; Region: COG1373 717522001626 AAA domain; Region: AAA_14; pfam13173 717522001627 Regulators of stationary/sporulation gene expression [Transcription]; Region: AbrB; COG2002 717522001628 looped-hinge helix DNA binding domain, AbrB family; Region: lp_hng_hel_AbrB; TIGR01439 717522001629 Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642 717522001630 Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075 717522001631 ATP binding site [chemical binding]; other site 717522001632 Mg2+ binding site [ion binding]; other site 717522001633 G-X-G motif; other site 717522001634 Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225 717522001635 dimerization interface [polypeptide binding]; other site 717522001636 Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745 717522001637 Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156 717522001638 active site 717522001639 phosphorylation site [posttranslational modification] 717522001640 intermolecular recognition site; other site 717522001641 dimerization interface [polypeptide binding]; other site 717522001642 Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383 717522001643 DNA binding site [nucleotide binding] 717522001644 Domain of Unknown Function (DUF1259); Region: DUF1529; pfam07485 717522001645 Domain of Unknown Function (DUF1259); Region: DUF1529; pfam07485 717522001646 Predicted site-specific integrase-resolvase [DNA replication, recombination, and repair]; Region: COG2452 717522001647 Serine Recombinase (SR) family, IS607-like transposase subfamily, catalytic domain; members contain a DNA binding domain with homology to MerR/SoxR located N-terminal to the catalytic domain. Serine recombinases catalyze site-specific recombination of...; Region: SR_IS607_transposase_like; cd03769 717522001648 catalytic residues [active] 717522001649 catalytic nucleophile [active] 717522001650 Helix-turn-helix domain; Region: HTH_OrfB_IS605; pfam12323 717522001651 Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG0675 717522001652 Probable transposase; Region: OrfB_IS605; pfam01385 717522001653 Rv0623-like transcription factor; Region: PSK_trans_fac; pfam07704 717522001654 PIN domain of the VapC-like UPF0110 protein Mb0640 and homologs; Region: PIN_UPF0110; cd09871 717522001655 putative active site [active] 717522001656 SEC-C motif; Region: SEC-C; pfam02810 717522001657 PIN domain of ribonucleases (toxins), VapC and FitB, of prokaryotic toxin/antitoxin operons, Pyrococcus horikoshii protein PH0500, and other similar bacterial and archaeal homologs; Region: PIN_VapC-FitB-like; cd09875 717522001658 putative active site [active] 717522001659 Galactose-1-phosphate uridyl transferase (GalT): This enzyme plays a key role in galactose metabolism by catalysing the transfer of a uridine 5'-phosphoryl group from UDP-galactose 1-phosphate. The structure of E.coli GalT reveals that the enzyme...; Region: GalT; cd00608 717522001660 dimer interface [polypeptide binding]; other site 717522001661 Galactose-1-phosphate uridylyltransferase [Energy production and conversion]; Region: GalT; COG1085 717522001662 active site 717522001663 galactokinase; Provisional; Region: PRK00555 717522001664 Galactokinase galactose-binding signature; Region: GalKase_gal_bdg; pfam10509 717522001665 Protein of unknown function (DUF732); Region: DUF732; pfam05305 717522001666 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4423 717522001667 PIN domain of the VapC-like UPF0110 protein Mb0640 and homologs; Region: PIN_UPF0110; cd09871 717522001668 putative active site [active] 717522001669 Uncharacterized conserved protein [Function unknown]; Region: COG0398 717522001670 SNARE associated Golgi protein; Region: SNARE_assoc; pfam09335 717522001671 Antitoxin of toxin-antitoxin stability system [Cell division and chromosome partitioning]; Region: Phd; COG4118 717522001672 PIN domain of ribonucleases (toxins), VapC and FitB, of prokaryotic toxin/antitoxin operons, Pyrococcus horikoshii protein PH0500, and other similar bacterial and archaeal homologs; Region: PIN_VapC-FitB; cd09881 717522001673 oligomeric interface; other site 717522001674 putative active site [active] 717522001675 homodimer interface [polypeptide binding]; other site 717522001676 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4398 717522001677 FIST N domain; Region: FIST; pfam08495 717522001678 FIST C domain; Region: FIST_C; pfam10442 717522001679 exodeoxyribonuclease V, alpha subunit; Region: recD; TIGR01447 717522001680 AAA domain; Region: AAA_30; pfam13604 717522001681 Family description; Region: UvrD_C_2; pfam13538 717522001683 UvrD/REP helicase N-terminal domain; Region: UvrD-helicase; pfam00580 717522001684 UvrD-like helicase C-terminal domain; Region: UvrD_C; pfam13361 717522001685 exodeoxyribonuclease V, gamma subunit; Region: recC; TIGR01450 717522001686 exonuclease V subunit gamma; Provisional; Region: recC; PRK11069 717522001687 Enoyl-CoA hydratase/carnithine racemase [Lipid metabolism]; Region: CaiD; COG1024 717522001688 Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558 717522001689 substrate binding site [chemical binding]; other site 717522001690 oxyanion hole (OAH) forming residues; other site 717522001691 trimer interface [polypeptide binding]; other site 717522001692 Metallo-beta-lactamase superfamily; Region: Lactamase_B; cl00446 717522001693 Transcription regulator of the Arc/MetJ class [Transcription]; Region: COG5450 717522001694 50S ribosomal protein L33; Validated; Region: rpmG; PRK00504 717522001695 (R)-hydratase [(R)-specific enoyl-CoA hydratase]. Catalyzes the hydration of trans-2-enoyl CoA to (R)-3-hydroxyacyl-CoA as part of the PHA (polyhydroxyalkanoate) biosynthetic pathway. The structure of the monomer includes a five-strand antiparallel...; Region: R_hydratase_like; cd03441 717522001696 active site 717522001697 catalytic site [active] 717522001698 SAV4209_like. Similar in sequence to the Streptomyces avermitilis SAV4209 protein, with a hot dog fold that is similar to those of (R)-specific enoyl-CoA hydratase, the peroxisomal Hydratase-Dehydrogenase-Epimerase (HDE) protein, and the fatty acid...; Region: SAV4209_like; cd03453 717522001699 active site 717522001700 catalytic site [active] 717522001701 (R)-hydratase [(R)-specific enoyl-CoA hydratase]. Catalyzes the hydration of trans-2-enoyl CoA to (R)-3-hydroxyacyl-CoA as part of the PHA (polyhydroxyalkanoate) biosynthetic pathway. The structure of the monomer includes a five-strand antiparallel...; Region: R_hydratase_like; cd03441 717522001702 active site 717522001703 catalytic site [active] 717522001704 preprotein translocase subunit SecE; Reviewed; Region: secE; PRK07597 717522001705 transcription antitermination protein NusG; Validated; Region: nusG; PRK05609 717522001706 Bacterial N-Utilization Substance G (NusG) N-terminal (NGN) domain, subgroup 1; Region: NGN_Bact_1; cd09891 717522001707 putative homodimer interface [polypeptide binding]; other site 717522001708 NusG contains an NGN domain at its N-terminus and KOW motif at its C-terminus; Region: KOW_NusG; cd06091 717522001709 heterodimer interface [polypeptide binding]; other site 717522001710 homodimer interface [polypeptide binding]; other site 717522001711 50S ribosomal protein L11; Validated; Region: rplK; PRK00140 717522001712 Ribosomal protein L11. Ribosomal protein L11, together with proteins L10 and L7/L12, and 23S rRNA, form the L7/L12 stalk on the surface of the large subunit of the ribosome. The homologous eukaryotic cytoplasmic protein is also called 60S ribosomal...; Region: Ribosomal_L11; cd00349 717522001713 23S rRNA interface [nucleotide binding]; other site 717522001714 L7/L12 interface [polypeptide binding]; other site 717522001715 putative thiostrepton binding site; other site 717522001716 L25 interface [polypeptide binding]; other site 717522001717 Ribosomal protein L1. The L1 protein, located near the E-site of the ribosome, forms part of the L1 stalk along with 23S rRNA. In bacteria and archaea, L1 functions both as a ribosomal protein that binds rRNA, and as a translation repressor that binds...; Region: Ribosomal_L1; cd00403 717522001718 mRNA/rRNA interface [nucleotide binding]; other site 717522001719 Mycolic acid cyclopropane synthetase; Region: CMAS; pfam02353 717522001720 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522001721 S-adenosylmethionine binding site [chemical binding]; other site 717522001722 Mycolic acid cyclopropane synthetase; Region: CMAS; pfam02353 717522001723 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cl17173 717522001724 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522001725 S-adenosylmethionine binding site [chemical binding]; other site 717522001726 Mycolic acid cyclopropane synthetase; Region: CMAS; pfam02353 717522001727 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cl17173 717522001728 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522001729 S-adenosylmethionine binding site [chemical binding]; other site 717522001730 Mycolic acid cyclopropane synthetase; Region: CMAS; pfam02353 717522001731 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cl17173 717522001732 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522001733 S-adenosylmethionine binding site [chemical binding]; other site 717522001734 Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596 717522001735 TAP-like protein; Region: Abhydrolase_4; pfam08386 717522001736 2-polyprenylphenol 6-hydroxylase; Region: UbiB; TIGR01982 717522001737 ABC1 family; Region: ABC1; cl17513 717522001738 RvD6 Region of difference RvD6, inserted region in Mycobacterium bovis BCG Pasteur, BCG Tokyo, BCG Mexico and Mycobacterium bovis AF2122/97 compared to Mycobacterium tuberculosis H37Rv2 where this sequence has been deleted. Also present in Mycobacterium tuberculosis CDC1551. Leads to BCG_0697 being longer at N-terminus than Rv0648 by 183 aa 717522001739 N-terminal catalytic domain of class II alpha-mannosidases and similar proteins; glycoside hydrolase family 38 (GH38); Region: GH38N_AMII_like; cd10786 717522001740 active site 717522001741 catalytic site [active] 717522001742 Alpha-mannosidase [Carbohydrate transport and metabolism]; Region: AMS1; COG0383 717522001743 Alpha mannosidase, middle domain; Region: Alpha-mann_mid; smart00872 717522001744 NPCBM-associated, NEW3 domain of alpha-galactosidase; Region: NPCBM_assoc; pfam10633 717522001745 Transcriptional regulator/sugar kinase [Transcription / Carbohydrate transport and metabolism]; Region: NagC; COG1940 717522001746 Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cl17037 717522001747 Ribosomal protein L10 family, L10 subfamily; composed of bacterial 50S ribosomal protein and eukaryotic mitochondrial 39S ribosomal protein, L10. L10 occupies the L7/L12 stalk of the ribosome. The N-terminal domain (NTD) of L10 interacts with L11 protein...; Region: Ribosomal_L10; cd05797 717522001748 23S rRNA interface [nucleotide binding]; other site 717522001749 Interface with L7/L12 ribosomal proteins [polypeptide binding]; other site 717522001750 Ribosomal protein L7/L12. Ribosomal protein L7/L12 refers to the large ribosomal subunit proteins L7 and L12, which are identical except that L7 is acetylated at the N terminus. It is a component of the L7/L12 stalk, which is located at the surface of...; Region: Ribosomal_L7_L12; cd00387 717522001751 core dimer interface [polypeptide binding]; other site 717522001752 peripheral dimer interface [polypeptide binding]; other site 717522001753 L10 interface [polypeptide binding]; other site 717522001754 L11 interface [polypeptide binding]; other site 717522001755 putative EF-Tu interaction site [polypeptide binding]; other site 717522001756 putative EF-G interaction site [polypeptide binding]; other site 717522001757 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522001758 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522001759 WHG domain; Region: WHG; pfam13305 717522001760 Lignostilbene-alpha,beta-dioxygenase and related enzymes [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3670 717522001761 Retinal pigment epithelial membrane protein; Region: RPE65; pfam03055 717522001762 ABC-type transport system involved in resistance to organic solvents, ATPase component [Secondary metabolites biosynthesis, transport, and catabolism]; Region: Ttg2A; COG1127 717522001763 ATP-binding cassette transport system involved in resistant to organic solvents; Region: ABC_Org_Solvent_Resistant; cd03261 717522001764 Walker A/P-loop; other site 717522001765 ATP binding site [chemical binding]; other site 717522001766 Q-loop/lid; other site 717522001767 ABC transporter signature motif; other site 717522001768 Walker B; other site 717522001769 D-loop; other site 717522001770 H-loop/switch region; other site 717522001771 PIN (PilT N terminus) domain: Superfamily; Region: PIN_SF; cl14812 717522001772 putative active site [active] 717522001773 Transcription regulator of the Arc/MetJ class [Transcription]; Region: COG5450 717522001774 Predicted metal-dependent membrane protease [General function prediction only]; Region: COG1266 717522001775 Growth inhibitor [Signal transduction mechanisms]; Region: MazF; COG2337 717522001776 Predicted nucleic acid-binding protein, contains PIN domain [General function prediction only]; Region: COG1848 717522001777 Arylsulfatase A and related enzymes [Inorganic ion transport and metabolism]; Region: AslA; COG3119 717522001778 Sulfatase; Region: Sulfatase; pfam00884 717522001779 Concanavalin A-like lectin/glucanases superfamily; Region: Laminin_G_3; pfam13385 717522001780 PIN (PilT N terminus) domain: Superfamily; Region: PIN_SF; cl14812 717522001781 putative active site [active] 717522001782 DNA-directed RNA polymerase subunit beta; Reviewed; Region: rpoB; PRK00405 717522001783 RNA polymerase beta subunit. RNA polymerases catalyse the DNA dependent polymerization of RNA. Prokaryotes contain a single RNA polymerase compared to three in eukaryotes (not including mitochondrial. and chloroplast polymerases). Each RNA polymerase...; Region: RNA_pol_B_RPB2; cl17585 717522001784 RNA polymerase Rpb2, domain 2; Region: RNA_pol_Rpb2_2; pfam04561 717522001785 RNA polymerase beta subunit. RNA polymerases catalyse the DNA dependent polymerization of RNA. Prokaryotes contain a single RNA polymerase compared to three in eukaryotes (not including mitochondrial. and chloroplast polymerases). Each RNA polymerase...; Region: RNA_pol_B_RPB2; cd00653 717522001786 RNA polymerase beta subunit. RNA polymerases catalyse the DNA dependent polymerization of RNA. Prokaryotes contain a single RNA polymerase compared to three in eukaryotes (not including mitochondrial. and chloroplast polymerases). Each RNA polymerase...; Region: RNA_pol_B_RPB2; cd00653 717522001787 RPB10 interaction site [polypeptide binding]; other site 717522001788 RPB1 interaction site [polypeptide binding]; other site 717522001789 RPB11 interaction site [polypeptide binding]; other site 717522001790 RPB3 interaction site [polypeptide binding]; other site 717522001791 RPB12 interaction site [polypeptide binding]; other site 717522001792 RNA polymerase Rpb1, domain 1; Region: RNA_pol_Rpb1_1; pfam04997 717522001793 RNA polymerase I subunit A N-terminus; Region: RPOLA_N; smart00663 717522001794 RNA polymerase Rpb1, domain 3; Region: RNA_pol_Rpb1_3; pfam04983 717522001795 RNA polymerase Rpb1, domain 4; Region: RNA_pol_Rpb1_4; pfam05000 717522001796 RNA polymerase Rpb1, domain 5; Region: RNA_pol_Rpb1_5; pfam04998 717522001797 Largest subunit (beta') of Bacterial DNA-dependent RNA polymerase (RNAP), C-terminal domain; Region: RNAP_beta'_C; cd02655 717522001798 Rpb1 (beta') - Rpb6 (omega) interaction site [polypeptide binding]; other site 717522001799 G-loop; other site 717522001800 Largest subunit (beta') of Bacterial DNA-dependent RNA polymerase (RNAP), C-terminal domain; Region: RNAP_beta'_C; cd02655 717522001801 DNA binding site [nucleotide binding] 717522001802 Rpb1 (beta') - Rpb2 (beta) interaction site [polypeptide binding]; other site 717522001803 Neutral/alkaline non-lysosomal ceramidase; Region: Ceramidase_alk; pfam04734 717522001804 endonuclease IV; Provisional; Region: PRK01060 717522001805 AP endonuclease family 2; These endonucleases play a role in DNA repair. Cleave phosphodiester bonds at apurinic or apyrimidinic sites; the alignment also contains hexulose-6-phosphate isomerases, enzymes that catalyze the epimerization of...; Region: AP2Ec; cd00019 717522001806 AP (apurinic/apyrimidinic) site pocket; other site 717522001807 DNA interaction; other site 717522001808 Metal-binding active site; metal-binding site 717522001809 Poly(3-hydroxybutyrate) depolymerase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: LpqC; COG3509 717522001810 Fructose/tagarose-bisphosphate aldolase class II. This family includes fructose-1,6-bisphosphate (FBP) and tagarose 1,6-bisphosphate (TBP) aldolases. FBP-aldolase is homodimeric and used in gluconeogenesis and glycolysis; the enzyme controls the...; Region: FTBP_aldolase_II; cl17181 717522001811 isovaleryl CoA dehydrogenase; Provisional; Region: PRK11561 717522001812 Acyl-CoA dehydrogenase; Region: ACAD; cl09933 717522001813 active site 717522001814 enoyl-CoA hydratase; Provisional; Region: PRK12478 717522001815 Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558 717522001816 substrate binding site [chemical binding]; other site 717522001817 oxyanion hole (OAH) forming residues; other site 717522001818 trimer interface [polypeptide binding]; other site 717522001819 Phenylacetic acid-responsive transcriptional repressor [Transcription]; Region: PaaX; COG3327 717522001820 PaaX-like protein; Region: PaaX; pfam07848 717522001821 PaaX-like protein C-terminal domain; Region: PaaX_C; pfam08223 717522001822 Enoyl-CoA hydratase/carnithine racemase [Lipid metabolism]; Region: CaiD; COG1024 717522001823 Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558 717522001824 substrate binding site [chemical binding]; other site 717522001825 oxyanion hole (OAH) forming residues; other site 717522001826 trimer interface [polypeptide binding]; other site 717522001827 Predicted drug exporters of the RND superfamily [General function prediction only]; Region: COG2409 717522001828 Mycobacterium membrane protein; Region: Mycobact_memb; pfam05423 717522001829 Protein of unknown function (DUF3060); Region: DUF3060; pfam11259 717522001830 Protein of unknown function (DUF3060); Region: DUF3060; pfam11259 717522001831 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522001832 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522001833 WHG domain; Region: WHG; pfam13305 717522001834 S12-like family, 30S ribosomal protein S12 subfamily; S12 is located at the interface of the large and small ribosomal subunits of prokaryotes, chloroplasts and mitochondria, where it plays an important role in both tRNA and ribosomal subunit...; Region: Ribosomal_S12; cd03368 717522001835 S17 interaction site [polypeptide binding]; other site 717522001836 S8 interaction site; other site 717522001837 16S rRNA interaction site [nucleotide binding]; other site 717522001838 streptomycin interaction site [chemical binding]; other site 717522001839 23S rRNA interaction site [nucleotide binding]; other site 717522001840 aminoacyl-tRNA interaction site (A-site) [nucleotide binding]; other site 717522001841 30S ribosomal protein S7; Validated; Region: PRK05302 717522001842 elongation factor G; Reviewed; Region: PRK00007 717522001843 Elongation factor G (EF-G) family involved in both the elongation and ribosome recycling phases of protein synthesis; Region: EF-G; cd01886 717522001844 G1 box; other site 717522001845 putative GEF interaction site [polypeptide binding]; other site 717522001846 GTP/Mg2+ binding site [chemical binding]; other site 717522001847 Switch I region; other site 717522001848 G2 box; other site 717522001849 G3 box; other site 717522001850 Switch II region; other site 717522001851 G4 box; other site 717522001852 G5 box; other site 717522001853 EFG_mtEFG_II: this subfamily represents the domain II of elongation factor G (EF-G) in bacteria and, the C-terminus of mitochondrial Elongation factor G1 (mtEFG1) and G2 (mtEFG2)_like proteins found in eukaryotes. During the process of peptide synthesis...; Region: EFG_mtEFG_II; cd04088 717522001854 EFG_mtEFG1_IV: domains similar to domain IV of the bacterial translational elongation factor (EF) EF-G. Included in this group is a domain of mitochondrial Elongation factor G1 (mtEFG1) proteins homologous to domain IV of EF-G. Eukaryotic cells harbor 2...; Region: EFG_mtEFG1_IV; cd01434 717522001855 EFG_mtEFG_C: domains similar to the C-terminal domain of the bacterial translational elongation factor (EF) EF-G. Included in this group is the C-terminus of mitochondrial Elongation factor G1 (mtEFG1) and G2 (mtEFG2) proteins. Eukaryotic cells harbor 2...; Region: EFG_mtEFG_C; cd03713 717522001856 elongation factor Tu; Reviewed; Region: PRK00049 717522001857 Elongation Factor Tu (EF-Tu) GTP-binding proteins; Region: EF_Tu; cd01884 717522001858 G1 box; other site 717522001859 GEF interaction site [polypeptide binding]; other site 717522001860 GTP/Mg2+ binding site [chemical binding]; other site 717522001861 Switch I region; other site 717522001862 G2 box; other site 717522001863 G3 box; other site 717522001864 Switch II region; other site 717522001865 G4 box; other site 717522001866 G5 box; other site 717522001867 Translation_Factor_II_like: Elongation factor Tu (EF-Tu) domain II-like proteins. Elongation factor Tu consists of three structural domains, this family represents the second domain. Domain II adopts a beta barrel structure and is involved in binding to...; Region: Translation_Factor_II_like; cl02787 717522001868 Domain III of elongation factor (EF) Tu. Ef-Tu consists of three structural domains, designated I, II and III. Domain III adopts a beta barrel structure. Domain III is involved in binding to both charged tRNA and binding to elongation factor Ts (EF-Ts); Region: EFTU_III; cd03707 717522001869 Antibiotic Binding Site [chemical binding]; other site 717522001870 Short C-terminal domain; Region: SHOCT; pfam09851 717522001871 oxidoreductase, SDR family; Region: SDR_subfam_1; TIGR03971 717522001872 classical (c) SDRs; Region: SDR_c; cd05233 717522001873 NAD(P) binding site [chemical binding]; other site 717522001874 active site 717522001875 Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox_2; pfam07992 717522001876 Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070 717522001877 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4427 717522001878 mycofactocin system transcriptional regulator; Region: mycofact_TetR; TIGR03968 717522001879 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522001880 putative mycofactocin binding protein MftB; Region: mycofact_MftB; TIGR03967 717522001881 mycofactocin radical SAM maturase; Region: mycofact_rSAM; TIGR03962 717522001882 Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335 717522001883 FeS/SAM binding site; other site 717522001884 radical SAM additional 4Fe4S-binding SPASM domain; Region: rSAM_more_4Fe4S; TIGR04085 717522001885 heme/flavin dehydrogenase, mycofactocin system; Region: actino_HemFlav; TIGR03966 717522001886 TIM barrel proteins share a structurally conserved phosphate binding motif and in general share an eight beta/alpha closed barrel structure. Specific for this family is the conserved phosphate binding site at the edges of strands 7 and 8. The phosphate...; Region: TIM_phosphate_binding; cl17186 717522001887 phosphate binding site [ion binding]; other site 717522001888 mycofactocin system creatininase family protein; Region: mycofact_creat; TIGR03964 717522001889 mycofactocin system glycosyltransferase; Region: mycofact_glyco; TIGR03965 717522001890 Subfamily of Glycosyltransferase Family GT2 of unknown function; Region: GT_2_like_c; cd04186 717522001891 Probable Catalytic site; other site 717522001892 metal-binding site 717522001893 dehydrogenase, Rv0697 family; Region: Rv0697; TIGR03970 717522001894 GMC oxidoreductase; Region: GMC_oxred_C; pfam05199 717522001895 30S ribosomal protein S10; Reviewed; Region: rpsJ; PRK00596 717522001896 50S ribosomal protein L3; Validated; Region: rplC; PRK00001 717522001897 50S ribosomal protein L4; Provisional; Region: rplD; PRK05319 717522001898 50S ribosomal protein L23; Reviewed; Region: rplW; PRK05738 717522001899 50S ribosomal protein L2; Validated; Region: rplB; PRK09374 717522001900 Ribosomal Proteins L2, RNA binding domain; Region: Ribosomal_L2; pfam00181 717522001901 Ribosomal Proteins L2, C-terminal domain; Region: Ribosomal_L2_C; pfam03947 717522001902 30S ribosomal protein S19; Reviewed; Region: rpsS; PRK00357 717522001903 Ribosomal protein L22/L17e. L22 (L17 in eukaryotes) is a core protein of the large ribosomal subunit. It is the only ribosomal protein that interacts with all six domains of 23S rRNA, and is one of the proteins important for directing the proper...; Region: Ribosomal_L22; cd00336 717522001904 putative translocon binding site; other site 717522001905 protein-rRNA interface [nucleotide binding]; other site 717522001906 30S ribosomal protein S3; Reviewed; Region: rpsC; PRK00310 717522001907 K homology RNA-binding (KH) domain of the prokaryotic 30S small ribosomal subunit protein S3. S3 is part of the head region of the 30S ribosomal subunit and is believed to interact with mRNA as it threads its way from the latch into the channel. The KH...; Region: 30S_S3_KH; cd02412 717522001908 G-X-X-G motif; other site 717522001909 Ribosomal protein S3, C-terminal domain; Region: Ribosomal_S3_C; pfam00189 717522001910 Ribosomal_L16_L10e: L16 is an essential protein in the large ribosomal subunit of bacteria, mitochondria, and chloroplasts. Large subunits that lack L16 are defective in peptidyl transferase activity, peptidyl-tRNA hydrolysis activity, association with...; Region: Ribosomal_L16_L10e; cd01433 717522001911 23S rRNA interface [nucleotide binding]; other site 717522001912 5S rRNA interface [nucleotide binding]; other site 717522001913 putative antibiotic binding site [chemical binding]; other site 717522001914 L25 interface [polypeptide binding]; other site 717522001915 L27 interface [polypeptide binding]; other site 717522001916 Ribosomal L29 protein/HIP. L29 is a protein of the large ribosomal Subunit. A homolog, called heparin/heparan sulfate interacting protein (HIP), has also been identified in mammals. L29 is located on the surface of the large ribosomal subunit, where it...; Region: Ribosomal_L29_HIP; cd00427 717522001917 putative translocon interaction site; other site 717522001918 23S rRNA interface [nucleotide binding]; other site 717522001919 signal recognition particle (SRP54) interaction site; other site 717522001920 L23 interface [polypeptide binding]; other site 717522001921 trigger factor interaction site; other site 717522001922 30S ribosomal protein S17; Reviewed; Region: rpsQ; PRK05610 717522001923 Arylsulfatase A and related enzymes [Inorganic ion transport and metabolism]; Region: AslA; COG3119 717522001924 Sulfatase; Region: Sulfatase; pfam00884 717522001925 Laminin G domain; Laminin G-like domains are usually Ca++ mediated receptors that can have binding sites for steroids, beta1 integrins, heparin, sulfatides, fibulin-1, and alpha-dystroglycans. Proteins that contain LamG domains serve a variety of...; Region: LamG; cl17353 717522001926 Uncharacterized conserved protein [Function unknown]; Region: COG1262 717522001927 Formylglycine-generating sulfatase enzyme; Region: FGE-sulfatase; pfam03781 717522001928 50S ribosomal protein L14; Validated; Region: rplN; PRK05483 717522001929 50S ribosomal protein L24; Reviewed; Region: rplX; PRK00004 717522001930 KOW motif of Ribosomal Protein L26; Region: KOW_RPL26; cd06089 717522001931 RNA binding site [nucleotide binding]; other site 717522001932 50S ribosomal protein L5; Validated; Region: rplE; PRK00010 717522001933 Ribosomal protein L5; Region: Ribosomal_L5; pfam00281 717522001934 ribosomal L5P family C-terminus; Region: Ribosomal_L5_C; pfam00673 717522001935 30S ribosomal protein S14; Reviewed; Region: rpsN; PRK08061 717522001936 RDMex01 Deleted region in Mycobacterium bovis BCG Mexico compared to Mycobacterium tuberculosis H37Rv 717522001937 30S ribosomal protein S8; Validated; Region: rpsH; PRK00136 717522001938 50S ribosomal protein L6; Validated; Region: rplF; PRK05498 717522001939 Ribosomal protein L6; Region: Ribosomal_L6; pfam00347 717522001940 Ribosomal protein L6; Region: Ribosomal_L6; pfam00347 717522001941 Ribosomal L18/L5e: L18 (L5e) is a ribosomal protein found in the central protuberance (CP) of the large subunit. L18 binds 5S rRNA and induces a conformational change that stimulates the binding of L5 to 5S rRNA. Association of 5S rRNA with 23S rRNA...; Region: Ribosomal_L18_L5e; cd00432 717522001942 5S rRNA interface [nucleotide binding]; other site 717522001943 23S rRNA interface [nucleotide binding]; other site 717522001944 L5 interface [polypeptide binding]; other site 717522001945 30S ribosomal protein S5; Validated; Region: rpsE; PRK00550 717522001946 Ribosomal protein S5, N-terminal domain; Region: Ribosomal_S5; pfam00333 717522001947 Ribosomal protein S5, C-terminal domain; Region: Ribosomal_S5_C; pfam03719 717522001948 Ribosomal protein L30, which is found in eukaryotes and prokaryotes but not in archaea, is one of the smallest ribosomal proteins with a molecular mass of about 7kDa. L30 binds the 23SrRNA as well as the 5S rRNA and is one of five ribosomal proteins that...; Region: Ribosomal_L30; cd01658 717522001949 23S rRNA binding site [nucleotide binding]; other site 717522001950 50S ribosomal protein L15; Reviewed; Region: rplO; PRK05592 717522001951 Signal peptide peptidase A (SppA) 67K type, a serine protease, has catalytic Ser-Lys dyad; Region: S49_SppA_67K_type; cd07018 717522001952 tandem repeat interface [polypeptide binding]; other site 717522001953 signal peptide peptidase SppA, 36K type; Region: SppA_dom; TIGR00706 717522001954 oligomer interface [polypeptide binding]; other site 717522001955 active site residues [active] 717522001956 signal peptide peptidase SppA, 36K type; Region: SppA_dom; TIGR00706 717522001957 Signal peptide peptidase A (SppA), a serine protease, has catalytic Ser-Lys dyad; Region: S49_Sppa_N_C; cd07023 717522001958 tandem repeat interface [polypeptide binding]; other site 717522001959 oligomer interface [polypeptide binding]; other site 717522001960 active site residues [active] 717522001961 O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315 717522001962 methyltransferase, TIGR00027 family; Region: mthyl_TIGR00027 717522001963 O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315 717522001964 methyltransferase, TIGR00027 family; Region: mthyl_TIGR00027 717522001965 Class II Aldolase and Adducin head (N-terminal) domain. Aldolases are ubiquitous enzymes catalyzing central steps of carbohydrate metabolism. Based on enzymatic mechanisms, this superfamily has been divided into two distinct classes (Class I and II); Region: Aldolase_II; cd00398 717522001966 intersubunit interface [polypeptide binding]; other site 717522001967 active site 717522001968 Zn2+ binding site [ion binding]; other site 717522001969 Phosphoglycerate dehydrogenase and related dehydrogenases [Amino acid transport and metabolism]; Region: SerA; COG0111 717522001970 Formate/glycerate dehydrogenases, D-specific 2-hydroxy acid dehydrogenases and related dehydrogenases; Region: FDH_GDH_like; cl17240 717522001971 NAD binding site [chemical binding]; other site 717522001972 Sugar (pentulose and hexulose) kinases [Carbohydrate transport and metabolism]; Region: XylB; COG1070 717522001973 Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cl17037 717522001974 nucleotide binding site [chemical binding]; other site 717522001975 Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302 717522001976 N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301 717522001977 Coenzyme A binding pocket [chemical binding]; other site 717522001978 O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315 717522001979 methyltransferase, TIGR00027 family; Region: mthyl_TIGR00027 717522001980 preprotein translocase subunit SecY; Reviewed; Region: secY; PRK09204 717522001981 SecY translocase; Region: SecY; pfam00344 717522001982 adenylate kinase; Reviewed; Region: adk; PRK00279 717522001983 Adenylate kinase (ADK) catalyzes the reversible phosphoryl transfer from adenosine triphosphates (ATP) to adenosine monophosphates (AMP) and to yield adenosine diphosphates (ADP). This enzyme is required for the biosynthesis of ADP and is essential for...; Region: ADK; cd01428 717522001984 AMP-binding site [chemical binding]; other site 717522001985 ATP-AMP (Ap5A)-binding site [chemical binding]; other site 717522001986 Methionine Aminopeptidase 1. E.C. 3.4.11.18. Also known as methionyl aminopeptidase and Peptidase M. Catalyzes release of N-terminal amino acids, preferentially methionine, from peptides and arylamides; Region: MetAP1; cd01086 717522001987 active site 717522001988 RNA polymerase sigma factor SigL; Provisional; Region: PRK09645 717522001989 Sigma-70 region 2; Region: Sigma70_r2; pfam04542 717522001990 Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171 717522001991 DNA binding residues [nucleotide binding] 717522001992 Predicted transmembrane transcriptional regulator (anti-sigma factor) [Transcription]; Region: COG5662 717522001993 Putative zinc-finger; Region: zf-HC2; pfam13490 717522001994 helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347 717522001995 MarR family; Region: MarR; pfam01047 717522001996 uncharacterized Actinobacterial protein TIGR03083; Region: TIGR03083 717522001997 TIGR03086 family protein; Region: TIGR03086 717522001998 Domain of unknown function (DUF4226); Region: DUF4226; pfam10774 717522001999 Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3464 717522002000 Transposase; Region: DDE_Tnp_ISL3; pfam01610 717522002001 Helix-turn-helix domain; Region: HTH_17; pfam12728 717522002002 helicase/secretion neighborhood putative DEAH-box helicase; Region: DECH_helic; TIGR03817 717522002003 PE family; Region: PE; pfam00934 717522002004 Ribbon-helix-helix protein, copG family; Region: RHH_1; pfam01402 717522002005 Mycobacterium tuberculosis PIN domain family; Region: Mtu_PIN_fam; TIGR00028 717522002006 6-phosphogluconate dehydrogenase-like protein; Reviewed; Region: PRK09599 717522002007 3-hydroxyisobutyrate dehydrogenase; Region: HIBADH; TIGR01692 717522002008 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522002009 Isobutyryl-CoA dehydrogenase; Region: IBD; cd01162 717522002010 substrate binding pocket [chemical binding]; other site 717522002011 FAD binding site [chemical binding]; other site 717522002012 catalytic base [active] 717522002013 Methylmalonate semialdehyde dehydrogenase and ALDH family members 6A1 and 6B2; Region: ALDH_F6_MMSDH; cd07085 717522002014 methylmalonic acid semialdehyde dehydrogenase; Region: MMSDH; TIGR01722 717522002015 tetrameric interface [polypeptide binding]; other site 717522002016 NAD binding site [chemical binding]; other site 717522002017 catalytic residues [active] 717522002018 Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067 717522002019 catalytic core [active] 717522002020 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522002021 PPE family; Region: PPE; pfam00823 717522002022 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522002023 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522002024 Helix-turn-helix domain; Region: HTH_28; pfam13518 717522002025 Winged helix-turn helix; Region: HTH_29; pfam13551 717522002026 Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745 717522002027 Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156 717522002028 active site 717522002029 phosphorylation site [posttranslational modification] 717522002030 intermolecular recognition site; other site 717522002031 dimerization interface [polypeptide binding]; other site 717522002032 Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383 717522002033 DNA binding site [nucleotide binding] 717522002034 Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225 717522002035 dimerization interface [polypeptide binding]; other site 717522002036 Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082 717522002037 dimer interface [polypeptide binding]; other site 717522002038 phosphorylation site [posttranslational modification] 717522002039 Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075 717522002040 ATP binding site [chemical binding]; other site 717522002041 Mg2+ binding site [ion binding]; other site 717522002042 G-X-G motif; other site 717522002043 Diadenosine tetraphosphate (Ap4A) hydrolase and other HIT family hydrolases [Nucleotide transport and metabolism / Carbohydrate transport and metabolism / General function prediction only]; Region: Hit; COG0537 717522002044 nucleotide binding site/active site [active] 717522002045 HIT family signature motif; other site 717522002046 catalytic residue [active] 717522002047 Nuclear transport factor 2 (NTF2) domain; Region: NTF2; pfam02136 717522002048 oxidoreductase, Rxyl_3153 family; Region: Rxyl_3153; TIGR03989 717522002049 Class III alcohol dehydrogenase; Region: Zn_ADH_class_III; cd08279 717522002050 NAD binding site [chemical binding]; other site 717522002051 catalytic Zn binding site [ion binding]; other site 717522002052 substrate binding site [chemical binding]; other site 717522002053 structural Zn binding site [ion binding]; other site 717522002054 Nuclear transport factor 2 (NTF2-like) superfamily. This family includes members of the NTF2 family, Delta-5-3-ketosteroid isomerases, Scytalone Dehydratases, and the beta subunit of Ring hydroxylating dioxygenases. This family is a classic example of...; Region: NTF2_like; cl09109 717522002055 Ferredoxin [Energy production and conversion]; Region: Fer; COG1141 717522002056 Protein of unknown function (DUF1271); Region: DUF1271; cl01443 717522002057 Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124 717522002058 Cytochrome P450; Region: p450; cl12078 717522002059 short chain dehydrogenase; Provisional; Region: PRK07775 717522002060 classical (c) SDRs; Region: SDR_c; cd05233 717522002061 NAD(P) binding site [chemical binding]; other site 717522002062 active site 717522002063 Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124 717522002064 Cytochrome P450; Region: p450; cl12078 717522002065 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522002066 aldehyde dehydrogenase, Rv0768 family; Region: aldehy_Rv0768; TIGR04284 717522002067 Rhodococcus ruber 6-oxolauric acid dehydrogenase-like and related proteins; Region: ALDH_CddD-AldA-like; cd07089 717522002068 NAD binding site [chemical binding]; other site 717522002069 catalytic residues [active] 717522002070 short chain dehydrogenase; Provisional; Region: PRK07774 717522002071 classical (c) SDRs; Region: SDR_c; cd05233 717522002072 NAD(P) binding site [chemical binding]; other site 717522002073 active site 717522002074 6-phosphogluconate dehydrogenase-like protein; Reviewed; Region: PRK09599 717522002075 NAD binding domain of 6-phosphogluconate dehydrogenase; Region: NAD_binding_2; pfam03446 717522002076 Uncharacterized homolog of gamma-carboxymuconolactone decarboxylase subunit [Function unknown]; Region: COG0599 717522002077 phosphoribosylamine--glycine ligase; Provisional; Region: PRK00885 717522002078 Phosphoribosylglycinamide synthetase, N domain; Region: GARS_N; pfam02844 717522002079 Phosphoribosylglycinamide synthetase, ATP-grasp (A) domain; Region: GARS_A; pfam01071 717522002080 Phosphoribosylglycinamide synthetase, C domain; Region: GARS_C; pfam02843 717522002081 Gamma-glutamyltransferase [Amino acid transport and metabolism]; Region: Ggt; COG0405 717522002082 Gamma-glutamyltranspeptidase; Region: G_glu_transpept; pfam01019 717522002083 Predicted esterase [General function prediction only]; Region: COG0627 717522002084 S-formylglutathione hydrolase; Region: PLN02442 717522002085 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3226 717522002086 Predicted nuclease (RNAse H fold) [General function prediction only]; Region: COG4328 717522002087 Adenylsuccinate lyase (ASL)_subgroup 2; Region: Adenylsuccinate_lyase_2; cd03302 717522002088 Adenylosuccinate lyase [Nucleotide transport and metabolism]; Region: PurB; COG0015 717522002089 tetramer interface [polypeptide binding]; other site 717522002090 active site 717522002091 Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124 717522002092 Cytochrome P450; Region: p450; cl12078 717522002093 non-metazoan 5-aminoimidazole-4-(N-succinylcarboxamide) ribonucleotide (SAICAR) synthase; Region: SAICAR_synt_Sc; cd01414 717522002094 ATP binding site [chemical binding]; other site 717522002095 active site 717522002096 substrate binding site [chemical binding]; other site 717522002097 Protease II [Amino acid transport and metabolism]; Region: PtrB; COG1770 717522002098 Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326 717522002099 drug resistance transporter, EmrB/QacA subfamily; Region: efflux_EmrB; TIGR00711 717522002100 The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174 717522002101 putative substrate translocation pore; other site 717522002102 The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174 717522002103 Predicted deacetylase [General function prediction only]; Region: COG3233 717522002104 Putative catalytic domain of uncharacterized bacterial proteins from the carbohydrate esterase 4 superfamily; Region: CE4_u10; cd11374 717522002105 putative active site [active] 717522002106 putative Zn binding site [ion binding]; other site 717522002107 potential frameshift: common BLAST hit: gi|253797732|ref|YP_003030733.1| FAD-binding dehydrogenase 717522002108 putative FAD-binding dehydrogenase; Reviewed; Region: PRK12834 717522002109 putative FAD-binding dehydrogenase; Reviewed; Region: PRK12834 717522002110 Metallo-beta-lactamase superfamily; Region: Lactamase_B; cl00446 717522002111 phosphoribosylformylglycinamidine synthase subunit PurS; Reviewed; Region: PRK05974 717522002112 phosphoribosylformylglycinamidine synthase I; Provisional; Region: PRK03619 717522002113 Type 1 glutamine amidotransferase (GATase1)-like domain found in Formylglycinamide ribonucleotide amidotransferase; Region: GATase1_FGAR_AT; cd01740 717522002114 putative active site [active] 717522002115 catalytic triad [active] 717522002116 Transglutaminase-like enzymes, putative cysteine proteases [Amino acid transport and metabolism]; Region: COG1305 717522002117 Transglutaminase/protease-like homologues; Region: TGc; smart00460 717522002118 Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cl07892 717522002119 probable F420-dependent oxidoreductase, Rv1855c family; Region: F420_Rv1855c; TIGR03560 717522002120 N5,N10-methylenetetrahydromethanopterin reductase (Mer) catalyzes the reduction of N5,N10-methylenetetrahydromethanopterin with reduced coenzyme F420 to N5-methyltetrahydromethanopterin and oxidized coenzyme F420; Region: Tetrahydromethanopterin_reductase; cd01097 717522002121 Transcriptional regulators [Transcription]; Region: PhnF; COG2188 717522002122 Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377 717522002123 DNA-binding site [nucleotide binding]; DNA binding site 717522002124 UTRA domain; Region: UTRA; pfam07702 717522002125 Uncharacterized conserved protein [Function unknown]; Region: COG1359 717522002126 Pyruvate/2-oxoglutarate dehydrogenase complex, dihydrolipoamide dehydrogenase (E3) component, and related enzymes [Energy production and conversion]; Region: Lpd; COG1249 717522002127 Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852 717522002128 Pyruvate/2-oxoglutarate dehydrogenase complex, dihydrolipoamide dehydrogenase (E3) component, and related enzymes [Energy production and conversion]; Region: Lpd; COG1249 717522002129 Formate/glycerate dehydrogenases, D-specific 2-hydroxy acid dehydrogenases and related dehydrogenases; Region: FDH_GDH_like; cl17240 717522002130 Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070 717522002131 Transposase; Region: DEDD_Tnp_IS110; pfam01548 717522002132 Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3547 717522002133 Transposase IS116/IS110/IS902 family; Region: Transposase_20; pfam02371 717522002134 Uncharacterized protein, linocin/CFP29 homolog [Function unknown]; Region: COG1659 717522002135 Dyp-type peroxidase family; Region: Dyp_perox; pfam04261 717522002136 M18 Peptidase Aspartyl aminopeptidase; Region: M18_DAP; cd05658 717522002137 Aminopeptidase I zinc metalloprotease (M18); Region: Peptidase_M18; pfam02127 717522002138 active site 717522002139 metal binding site [ion binding]; metal-binding site 717522002140 This domain superfamily is found in a variety of structurally related metalloproteins, including the type I extradiol dioxygenases, glyoxalase I and a group of antibiotic resistance proteins; Region: Glo_EDI_BRP_like; cd06587 717522002141 active site 717522002142 Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903 717522002143 Acetyltransferases, including N-acetylases of ribosomal proteins [Translation, ribosomal structure and biogenesis]; Region: RimL; COG1670 717522002144 N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182 717522002145 phosphoribosylformylglycinamidine synthase II; Provisional; Region: PRK01213 717522002146 PurL subunit of the formylglycinamide ribonucleotide amidotransferase (FGAR-AT), first repeat. FGAR-AT catalyzes the ATP-dependent conversion of formylglycinamide ribonucleotide (FGAR) and glutamine to formylglycinamidine ribonucleotide (FGAM), ADP; Region: PurL_repeat1; cd02203 717522002147 dimerization interface [polypeptide binding]; other site 717522002148 ATP binding site [chemical binding]; other site 717522002149 PurL subunit of the formylglycinamide ribonucleotide amidotransferase (FGAR-AT), second repeat. FGAR-AT catalyzes the ATP-dependent conversion of formylglycinamide ribonucleotide (FGAR) and glutamine to formylglycinamidine ribonucleotide (FGAM), ADP; Region: PurL_repeat2; cd02204 717522002150 dimerization interface [polypeptide binding]; other site 717522002151 ATP binding site [chemical binding]; other site 717522002152 CAAX protease self-immunity; Region: Abi; pfam02517 717522002153 Predicted phosphohydrolases [General function prediction only]; Region: Icc; COG1409 717522002154 Enterobacter aerogenes GpdQ and related proteins, metallophosphatase domain; Region: MPP_GpdQ; cd07402 717522002155 active site 717522002156 metal binding site [ion binding]; metal-binding site 717522002157 hexamer interface [polypeptide binding]; other site 717522002158 Protein of unknown function (DUF3184); Region: DUF3184; pfam11380 717522002159 amidophosphoribosyltransferase; Provisional; Region: PRK07847 717522002160 Glutamine amidotransferases class-II (GN-AT)_GPAT- type. This domain is found at the N-terminus of glutamine phosphoribosylpyrophosphate (Prpp) amidotransferase (GPATase) . The glutaminase domain catalyzes amide nitrogen transfer from glutamine to the...; Region: GPATase_N; cd00715 717522002161 active site 717522002162 tetramer interface [polypeptide binding]; other site 717522002163 Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223 717522002164 active site 717522002165 phosphoribosylaminoimidazole synthetase; Region: purM; TIGR00878 717522002166 PurM (Aminoimidazole Ribonucleotide [AIR] synthetase), one of eleven enzymes required for purine biosynthesis, catalyzes the conversion of formylglycinamide ribonucleotide (FGAM) and ATP to AIR, ADP, and Pi, the fifth step in de novo purine biosynthesis; Region: PurM; cd02196 717522002167 dimerization interface [polypeptide binding]; other site 717522002168 putative ATP binding site [chemical binding]; other site 717522002169 Protein of unknown function (DUF3073); Region: DUF3073; pfam11273 717522002170 Predicted aminomethyltransferase related to GcvT [General function prediction only]; Region: COG0354 717522002171 folate-binding protein YgfZ; Region: ygfZ_signature; TIGR03317 717522002172 Branched-chain amino acid aminotransferase/4-amino-4-deoxychorismate lyase [Amino acid transport and metabolism / Coenzyme metabolism]; Region: IlvE; COG0115 717522002173 ADCL_like: 4-Amino-4-deoxychorismate lyase: is a member of the fold-type IV of PLP dependent enzymes that converts 4-amino-4-deoxychorismate (ADC) to p-aminobenzoate and pyruvate. Based on the information available from the crystal structure, most...; Region: ADCL_like; cd01559 717522002174 pyridoxal 5'-phosphate binding site [chemical binding]; other site 717522002175 catalytic residue [active] 717522002176 nitrobindin heme-binding domain; Region: nitrobindin; cd07828 717522002177 heme-binding site [chemical binding]; other site 717522002178 Protein of unknown function (DUF1416); Region: DUF1416; pfam07210 717522002179 Rhodanese-related sulfurtransferase [Inorganic ion transport and metabolism]; Region: SseA; COG2897 717522002180 Thiosulfate sulfurtransferase (TST), N-terminal, inactive domain. TST contains 2 copies of the Rhodanese Homology Domain; this is the 1st repeat, which does not contain the catalytically active Cys residue. The role of the 1st repeat is uncertain, but it...; Region: TST_Repeat_1; cd01448 717522002181 active site residue [active] 717522002182 Thiosulfate sulfurtransferase (TST), C-terminal, catalytic domain. TST contains 2 copies of the Rhodanese Homology Domain; this is the second repeat. Only the second repeat contains the catalytically active Cys residue; Region: TST_Repeat_2; cd01449 717522002183 active site residue [active] 717522002184 TRX family; composed of two groups: Group I, which includes proteins that exclusively encode a TRX domain; and Group II, which are composed of fusion proteins of TRX and additional domains. Group I TRX is a small ancient protein that alter the redox...; Region: TRX_family; cd02947 717522002185 catalytic residues [active] 717522002186 Protein of unknown function (DUF2993); Region: DUF2993; pfam11209 717522002187 Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745 717522002188 Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383 717522002189 DNA binding site [nucleotide binding] 717522002190 mycothiol synthase; Region: mycothiol_MshD; TIGR03448 717522002191 N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301 717522002192 Coenzyme A binding pocket [chemical binding]; other site 717522002193 ATP-binding cassette domain of the phosphate transport system; Region: ABC_PstB_phosphate_transporter; cd03260 717522002194 Walker A/P-loop; other site 717522002195 ATP binding site [chemical binding]; other site 717522002196 Q-loop/lid; other site 717522002198 phosphate transport system regulatory protein PhoU; Region: phoU_full; TIGR02135 717522002199 PhoU domain; Region: PhoU; pfam01895 717522002200 PhoU domain; Region: PhoU; pfam01895 717522002201 cell envelope-related function transcriptional attenuator common domain; Region: lytR_cpsA_psr; TIGR00350 717522002202 LytR cell envelope-related transcriptional attenuator; Region: LytR_C; pfam13399 717522002203 putative TIM-barrel protein, nifR3 family; Region: nifR3_yhdG; TIGR00737 717522002204 Dihydrouridine synthase-like (DUS-like) FMN-binding domain. Members of this family catalyze the reduction of the 5,6-double bond of a uridine residue on tRNA. Dihydrouridine modification of tRNA is widely observed in prokaryotes and eukaryotes, and also...; Region: DUS_like_FMN; cd02801 717522002205 FMN binding site [chemical binding]; other site 717522002206 active site 717522002207 catalytic residues [active] 717522002208 substrate binding site [chemical binding]; other site 717522002209 Fatty acid desaturase; Region: FA_desaturase_2; pfam03405 717522002210 Acyl ACP desaturase, ferritin-like diiron-binding domain; Region: Acyl_ACP_Desat; cd01050 717522002211 homodimer interface [polypeptide binding]; other site 717522002212 putative substrate binding pocket [chemical binding]; other site 717522002213 diiron center [ion binding]; other site 717522002214 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522002215 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3662 717522002216 Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090 717522002217 dimerization interface [polypeptide binding]; other site 717522002218 putative DNA binding site [nucleotide binding]; other site 717522002219 putative Zn2+ binding site [ion binding]; other site 717522002220 Nucleoside deaminases include adenosine, guanine and cytosine deaminases. These enzymes are Zn dependent and catalyze the deamination of nucleosides. The zinc ion in the active site plays a central role in the proposed catalytic mechanism, activating a...; Region: nucleoside_deaminase; cd01285 717522002221 dimer interface [polypeptide binding]; other site 717522002222 catalytic motif [active] 717522002223 nucleoside/Zn binding site; other site 717522002224 Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG0675 717522002225 O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315 717522002226 methyltransferase, TIGR00027 family; Region: mthyl_TIGR00027 717522002227 TIGR04255 family protein; Region: sporadTIGR04255 717522002228 PE family; Region: PE; pfam00934 717522002229 PE family; Region: PE; pfam00934 717522002230 PknH-like extracellular domain; Region: PknH_C; pfam14032 717522002231 Predicted nucleotidyltransferase [General function prediction only]; Region: COG4849 717522002232 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4861 717522002233 Uncharacterized protein conserved in bacteria (DUF2186); Region: DUF2186; pfam09952 717522002234 D-ala-D-ala dipeptidase; Region: Peptidase_M15; cl00813 717522002235 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522002236 S-adenosylmethionine binding site [chemical binding]; other site 717522002237 proline-specific peptidase, Bacillus coagulans-type subfamily; Region: pro_imino_pep_2; TIGR01250 717522002238 The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174 717522002239 putative substrate translocation pore; other site 717522002240 Major Facilitator Superfamily; Region: MFS_1; pfam07690 717522002241 Pyruvate/2-oxoglutarate dehydrogenase complex, dehydrogenase (E1) component, eukaryotic type, alpha subunit [Energy production and conversion]; Region: AcoA; COG1071 717522002242 Thiamine pyrophosphate (TPP) family, E1 of PDC_ADC_BCADC subfamily, TPP-binding module; composed of proteins similar to the E1 components of the human pyruvate dehydrogenase complex (PDC), the acetoin dehydrogenase complex (ADC) and the branched chain...; Region: TPP_E1_PDC_ADC_BCADC; cd02000 717522002243 tetramer interface [polypeptide binding]; other site 717522002244 TPP-binding site [chemical binding]; other site 717522002245 heterodimer interface [polypeptide binding]; other site 717522002246 phosphorylation loop region [posttranslational modification] 717522002247 Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197 717522002248 Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156 717522002249 active site 717522002250 phosphorylation site [posttranslational modification] 717522002251 intermolecular recognition site; other site 717522002252 dimerization interface [polypeptide binding]; other site 717522002253 C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170 717522002254 DNA binding residues [nucleotide binding] 717522002255 dimerization interface [polypeptide binding]; other site 717522002256 Signal transduction histidine kinase [Signal transduction mechanisms]; Region: COG4585 717522002257 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase; Region: HATPase_c; pfam02518 717522002258 Putative multicopper oxidases [Secondary metabolites biosynthesis, transport, and catabolism]; Region: SufI; COG2132 717522002259 Multicopper oxidase; Region: Cu-oxidase_3; pfam07732 717522002260 Multicopper oxidase; Region: Cu-oxidase; pfam00394 717522002261 Multicopper oxidase; Region: Cu-oxidase_2; pfam07731 717522002262 Cysteine synthase [Amino acid transport and metabolism]; Region: CysK; COG0031 717522002263 CBS_like: This subgroup includes Cystathionine beta-synthase (CBS) and Cysteine synthase. CBS is a unique heme-containing enzyme that catalyzes a pyridoxal 5'-phosphate (PLP)-dependent condensation of serine and homocysteine to give cystathionine; Region: CBS_like; cd01561 717522002264 dimer interface [polypeptide binding]; other site 717522002265 pyridoxal 5'-phosphate binding site [chemical binding]; other site 717522002266 catalytic residue [active] 717522002267 The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174 717522002268 multidrug resistance protein MdtH; Provisional; Region: PRK11646 717522002269 putative substrate translocation pore; other site 717522002270 Helix-turn-helix domain of transposase family ISL3; Region: HTH_Tnp_ISL3; pfam13542 717522002271 short chain dehydrogenase; Provisional; Region: PRK05876 717522002272 classical (c) SDRs; Region: SDR_c; cd05233 717522002273 NAD(P) binding site [chemical binding]; other site 717522002274 active site 717522002275 Adenylate forming domain, Class I; Region: AFD_class_I; cl17068 717522002276 Pyruvate decarboxylase and related thiamine pyrophosphate-requiring enzymes [Carbohydrate transport and metabolism / Coenzyme metabolism / General function prediction only]; Region: COG3961 717522002277 Pyrimidine (PYR) binding domain of pyruvate decarboxylase (PDC), indolepyruvate decarboxylase (IPDC) and related proteins; Region: TPP_PYR_PDC_IPDC_like; cd07038 717522002278 dimer interface [polypeptide binding]; other site 717522002279 PYR/PP interface [polypeptide binding]; other site 717522002280 TPP binding site [chemical binding]; other site 717522002281 Thiamine pyrophosphate enzyme, central domain; Region: TPP_enzyme_M; pfam00205 717522002282 Thiamine pyrophosphate (TPP) family, PDC_IPDC subfamily, TPP-binding module; composed of proteins similar to pyruvate decarboxylase (PDC) and indolepyruvate decarboxylase (IPDC). PDC, a key enzyme in alcoholic fermentation, catalyzes the conversion of...; Region: TPP_PDC_IPDC; cd02005 717522002283 TPP-binding site [chemical binding]; other site 717522002284 dimer interface [polypeptide binding]; other site 717522002285 Ligand-binding SRPBCC domain of an uncharacterized subfamily of proteins; Region: SRPBCC_2; cd07819 717522002286 putative hydrophobic ligand binding site [chemical binding]; other site 717522002287 Predicted acyl-CoA transferases/carnitine dehydratase [Energy production and conversion]; Region: CaiB; COG1804 717522002288 CoA-transferase family III; Region: CoA_transf_3; pfam02515 717522002289 Ligand-binding SRPBCC domain of an uncharacterized subfamily of proteins; Region: SRPBCC_2; cd07819 717522002290 putative hydrophobic ligand binding site [chemical binding]; other site 717522002291 Ligand-binding SRPBCC domain of an uncharacterized subfamily of proteins; Region: SRPBCC_2; cd07819 717522002292 putative hydrophobic ligand binding site [chemical binding]; other site 717522002293 aminotransferase; Validated; Region: PRK07777 717522002294 Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609 717522002295 pyridoxal 5'-phosphate binding site [chemical binding]; other site 717522002296 homodimer interface [polypeptide binding]; other site 717522002297 catalytic residue [active] 717522002298 acetyl-CoA acetyltransferase; Validated; Region: PRK08242 717522002299 Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751 717522002300 dimer interface [polypeptide binding]; other site 717522002301 active site 717522002302 multifunctional fatty acid oxidation complex subunit alpha; Reviewed; Region: fadB; PRK11730 717522002303 Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558 717522002304 substrate binding site [chemical binding]; other site 717522002305 oxyanion hole (OAH) forming residues; other site 717522002306 trimer interface [polypeptide binding]; other site 717522002307 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain; Region: 3HCDH_N; pfam02737 717522002308 3-hydroxyacyl-CoA dehydrogenase, C-terminal domain; Region: 3HCDH; pfam00725 717522002309 Helicase conserved C-terminal domain; Region: Helicase_C_3; pfam13625 717522002310 DNA or RNA helicases of superfamily II [Transcription / DNA replication, recombination, and repair]; Region: SSL2; COG1061 717522002311 DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046 717522002312 ATP binding site [chemical binding]; other site 717522002313 putative Mg++ binding site [ion binding]; other site 717522002314 Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079 717522002315 nucleotide binding region [chemical binding]; other site 717522002316 ATP-binding site [chemical binding]; other site 717522002317 Helicase conserved C-terminal domain; Region: Helicase_C_3; pfam13625 717522002318 WYL domain; Region: WYL; pfam13280 717522002319 MoaC family, prokaryotic and eukaryotic. Members of this family are involved in molybdenum cofactor (Moco) biosynthesis, an essential cofactor of a diverse group of redox enzymes. MoaC, a small hexameric protein, converts, together with MoaA, a guanosine...; Region: MoaC_PE; cd01420 717522002320 trimer interface [polypeptide binding]; other site 717522002321 dimer interface [polypeptide binding]; other site 717522002322 putative active site [active] 717522002323 MogA_MoaB family. Members of this family are involved in biosynthesis of the molybdenum cofactor (MoCF) an essential cofactor of a diverse group of redox enzymes. MoCF biosynthesis is an evolutionarily conserved pathway present in eubacteria, archaea; Region: MogA_MoaB; cd00886 717522002324 MPT binding site; other site 717522002325 trimer interface [polypeptide binding]; other site 717522002326 MoaE family. Members of this family are involved in biosynthesis of the molybdenum cofactor (Moco), an essential cofactor for a diverse group of redox enzymes. Moco biosynthesis is an evolutionarily conserved pathway present in eubacteria, archaea and...; Region: MoaE; cd00756 717522002327 MoaE homodimer interface [polypeptide binding]; other site 717522002328 MoaD interaction [polypeptide binding]; other site 717522002329 active site residues [active] 717522002330 Transglycosylase-like domain; Region: Transglycosylas; pfam06737 717522002331 Ubiquitin domain of MoaD-like proteins; Region: MoaD; cd00754 717522002332 MoaE interaction surface [polypeptide binding]; other site 717522002333 MoeB interaction surface [polypeptide binding]; other site 717522002334 thiocarboxylated glycine; other site 717522002335 molybdenum cofactor biosynthesis protein A; Reviewed; Region: moaA; PRK00164 717522002336 Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335 717522002337 FeS/SAM binding site; other site 717522002338 Molybdenum Cofactor Synthesis C; Region: Mob_synth_C; pfam06463 717522002339 hypothetical protein; Provisional; Region: PRK11770 717522002340 Domain of unknown function (DUF307); Region: DUF307; pfam03733 717522002341 Domain of unknown function (DUF307); Region: DUF307; pfam03733 717522002342 Cold-Shock Protein (CSP) contains an S1-like cold-shock domain (CSD) that is found in eukaryotes, prokaryotes, and archaea. CSP's include the major cold-shock proteins CspA and CspB in bacteria and the eukaryotic gene regulatory factor Y-box...; Region: CSP_CDS; cd04458 717522002343 DNA-binding site [nucleotide binding]; DNA binding site 717522002344 RNA-binding motif; other site 717522002345 PE family; Region: PE; pfam00934 717522002346 Acyl-CoA dehydrogenase; Region: ACAD; cl09933 717522002347 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522002348 active site 717522002349 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4398 717522002350 FIST N domain; Region: FIST; pfam08495 717522002351 FIST C domain; Region: FIST_C; pfam10442 717522002352 Protein of unknown function (DUF2771); Region: DUF2771; pfam10969 717522002353 H+ Antiporter protein; Region: 2A0121; TIGR00900 717522002354 Protein of unknown function (DUF3027); Region: DUF3027; pfam11228 717522002355 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522002356 PPE family; Region: PPE; pfam00823 717522002357 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522002358 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522002359 Protein of unknown function (DUF2530); Region: DUF2530; pfam10745 717522002360 helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347 717522002361 MarR family; Region: MarR; pfam01047 717522002362 NAD(P)+-dependent aldehyde dehydrogenase superfamily; Region: ALDH-SF; cl11961 717522002363 rRNA methylases [Translation, ribosomal structure and biogenesis]; Region: SpoU; COG0566 717522002364 SpoU rRNA Methylase family; Region: SpoU_methylase; pfam00588 717522002365 Protein of unknown function (DUF2537); Region: DUF2537; pfam10801 717522002366 Protein of unknown function (DUF3071); Region: DUF3071; pfam11268 717522002367 phosphoserine aminotransferase, putative; Region: serC_3; TIGR01366 717522002368 pyridoxal 5'-phosphate binding pocket [chemical binding]; other site 717522002369 catalytic residue [active] 717522002370 P-aminobenzoate N-oxygenase AurF; Region: AurF; pfam11583 717522002371 Ferredoxin [Energy production and conversion]; Region: COG1146 717522002372 4Fe-4S binding domain; Region: Fer4; pfam00037 717522002373 ferredoxin-NADP+ reductase; Region: PLN02852 717522002374 NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450 717522002375 This conserved domain belongs to a superfamily including the bleomycin resistance protein, glyoxalase I, and type I ring-cleaving dioxygenases; Region: Glo_EDI_BRP_like_8; cd07246 717522002376 putative dimer interface [polypeptide binding]; other site 717522002377 Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903 717522002378 Exonuclease-Endonuclease-Phosphatase (EEP) domain superfamily; Region: EEP; cl00490 717522002379 putative catalytic site [active] 717522002380 putative phosphate binding site [ion binding]; other site 717522002381 putative metal binding site [ion binding]; other site 717522002382 Bacillus subtilis (Bs) citrate synthase CS-I_like. CS catalyzes the condensation of acetyl coenzyme A (AcCoA) and oxalacetate (OAA) to form citrate and coenzyme A (CoA), the first step in the citric acid cycle (TCA or Krebs cycle). 2MCS catalyzes the...; Region: BsCS-I_like; cd06109 717522002383 dimer interface [polypeptide binding]; other site 717522002384 Citrate synthase; Region: Citrate_synt; pfam00285 717522002385 active site 717522002386 citrylCoA binding site [chemical binding]; other site 717522002387 oxalacetate/citrate binding site [chemical binding]; other site 717522002388 coenzyme A binding site [chemical binding]; other site 717522002389 catalytic triad [active] 717522002390 Predicted ATPase [General function prediction only]; Region: COG3903 717522002391 Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197 717522002392 C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170 717522002393 DNA binding residues [nucleotide binding] 717522002394 dimerization interface [polypeptide binding]; other site 717522002395 Adenylate cyclase, family 3 (some proteins contain HAMP domain) [Signal transduction mechanisms]; Region: CyaA; COG2114 717522002396 cyclase homology domain; Region: CHD; cd07302 717522002397 nucleotidyl binding site; other site 717522002398 metal binding site [ion binding]; metal-binding site 717522002399 dimer interface [polypeptide binding]; other site 717522002400 Predicted flavoprotein involved in K+ transport [Inorganic ion transport and metabolism]; Region: TrkA; COG2072 717522002401 Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox_3; pfam13738 717522002402 O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315 717522002403 methyltransferase, TIGR00027 family; Region: mthyl_TIGR00027 717522002404 AAA ATPase domain; Region: AAA_16; pfam13191 717522002405 Predicted ATPase [General function prediction only]; Region: COG3903 717522002406 acyltransferase, WS/DGAT/MGAT; Region: acyl_WS_DGAT; TIGR02946 717522002407 Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007 717522002408 Escherichia coli (Ec) citrate synthase (CS) GltA_like. CS catalyzes the condensation of acetyl coenzyme A (AcCoA) and oxalacetate (OAA) to form citrate and coenzyme A (CoA), the first step in the citric acid cycle (TCA or Krebs cycle). The overall CS...; Region: EcCS_like; cd06114 717522002409 Citrate synthase [Energy production and conversion]; Region: GltA; COG0372 717522002410 dimer interface [polypeptide binding]; other site 717522002411 active site 717522002412 citrylCoA binding site [chemical binding]; other site 717522002413 NADH binding [chemical binding]; other site 717522002414 cationic pore residues; other site 717522002415 oxalacetate/citrate binding site [chemical binding]; other site 717522002416 coenzyme A binding site [chemical binding]; other site 717522002417 catalytic triad [active] 717522002418 Phytoene dehydrogenase and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG1233 717522002419 NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450 717522002420 Protein of unknown function (DUF2630); Region: DUF2630; pfam10944 717522002421 BON domain; Region: BON; pfam04972 717522002422 Outer membrane protein and related peptidoglycan-associated (lipo)proteins [Cell envelope biogenesis, outer membrane]; Region: OmpA; COG2885 717522002423 Peptidoglycan binding domains similar to the C-terminal domain of outer-membrane protein OmpA; Region: OmpA_C-like; cd07185 717522002424 ligand binding site [chemical binding]; other site 717522002425 Ribosomal protein L4/L1 family; Region: Ribosomal_L4; cl00325 717522002426 Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642 717522002427 Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225 717522002428 dimerization interface [polypeptide binding]; other site 717522002429 Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082 717522002430 dimer interface [polypeptide binding]; other site 717522002431 phosphorylation site [posttranslational modification] 717522002432 Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075 717522002433 Mg2+ binding site [ion binding]; other site 717522002434 G-X-G motif; other site 717522002435 Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745 717522002436 Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156 717522002437 active site 717522002438 phosphorylation site [posttranslational modification] 717522002439 intermolecular recognition site; other site 717522002440 dimerization interface [polypeptide binding]; other site 717522002441 Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383 717522002442 DNA binding site [nucleotide binding] 717522002443 Carboxyl transferase domain; Region: Carboxyl_trans; pfam01039 717522002444 Acetyl-CoA carboxylase alpha subunit [Lipid metabolism]; Region: AccA; COG0825 717522002445 Enoyl-CoA hydratase/carnithine racemase [Lipid metabolism]; Region: CaiD; COG1024 717522002446 Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558 717522002447 substrate binding site [chemical binding]; other site 717522002448 oxyanion hole (OAH) forming residues; other site 717522002449 trimer interface [polypeptide binding]; other site 717522002450 Predicted Zn-dependent hydrolases of the beta-lactamase fold [General function prediction only]; Region: COG2220 717522002451 Beta-lactamase superfamily domain; Region: Lactamase_B_2; pfam12706 717522002452 Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680 717522002453 Beta-lactamase; Region: Beta-lactamase; pfam00144 717522002454 Domain of unknown function (DUF3471); Region: DUF3471; pfam11954 717522002455 Cation transport ATPase [Inorganic ion transport and metabolism]; Region: MgtA; COG0474 717522002456 E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122 717522002457 Soluble P-type ATPase [General function prediction only]; Region: COG4087 717522002458 MT0933-like antitoxin protein; Region: MT0933_antitox; pfam14013 717522002459 START/RHO_alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) ligand-binding domain superfamily; Region: SRPBCC; cd07812 717522002460 hydrophobic ligand binding site; other site 717522002461 N-terminal domain of Streptomyces griseus SgaA (suppression of growth disturbance caused by A-factor at a high concentration under high osmolality during early growth phase), and similar domains; Region: SgaA_N_like; cd07247 717522002462 Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903 717522002463 N-terminal domain of Streptomyces griseus SgaA (suppression of growth disturbance caused by A-factor at a high concentration under high osmolality during early growth phase), and similar domains; Region: SgaA_N_like; cd07247 717522002464 Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903 717522002465 Lignostilbene-alpha,beta-dioxygenase and related enzymes [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3670 717522002466 Retinal pigment epithelial membrane protein; Region: RPE65; pfam03055 717522002467 acetyl-CoA acetyltransferase; Provisional; Region: PRK06289 717522002468 Thiolase domain associated with sterol carrier protein (SCP)-x isoform and related proteins; SCP-2 has multiple roles in intracellular lipid circulation and metabolism. The N-terminal presequence in the SCP-x isoform represents a peroxisomal...; Region: SCP-x_thiolase; cd00829 717522002469 active site 717522002470 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522002471 PPE family; Region: PPE; pfam00823 717522002472 PE family; Region: PE; pfam00934 717522002473 BCCT family transporter; Region: BCCT; pfam02028 717522002474 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4453 717522002475 N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301 717522002476 Coenzyme A binding pocket [chemical binding]; other site 717522002477 Transposase, Mutator family; Region: Transposase_mut; pfam00872 717522002478 MULE transposase domain; Region: MULE; pfam10551 717522002479 Predicted site-specific integrase-resolvase [DNA replication, recombination, and repair]; Region: COG2452 717522002480 Serine Recombinase (SR) family, IS607-like transposase subfamily, catalytic domain; members contain a DNA binding domain with homology to MerR/SoxR located N-terminal to the catalytic domain. Serine recombinases catalyze site-specific recombination of...; Region: SR_IS607_transposase_like; cd03769 717522002481 catalytic residues [active] 717522002482 catalytic nucleophile [active] 717522002483 Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG0675 717522002484 Probable transposase; Region: OrfB_IS605; pfam01385 717522002485 GGCT-like domains, also called AIG2-like family. Gamma-glutamyl cyclotransferase (GGCT) catalyzes the formation of pyroglutamic acid (5-oxoproline) from dipeptides containing gamma-glutamyl, and is a dimeric protein. In Homo sapiens, the protein is...; Region: GGCT_like; cd06661 717522002486 putative active site pocket [active] 717522002487 dimerization interface [polypeptide binding]; other site 717522002488 putative catalytic residue [active] 717522002489 Phage-related replication protein [General function prediction only]; Region: COG4195 717522002490 manganese transport protein MntH; Reviewed; Region: PRK00701 717522002491 Natural resistance-associated macrophage protein; Region: Nramp; pfam01566 717522002492 Multimeric flavodoxin WrbA [General function prediction only]; Region: WrbA; COG0655 717522002493 NADPH-dependent FMN reductase; Region: FMN_red; pfam03358 717522002494 Uncharacterized conserved protein related to dihydrodipicolinate reductase [Function unknown]; Region: COG3804 717522002495 short chain dehydrogenase; Provisional; Region: PRK07814 717522002496 classical (c) SDRs; Region: SDR_c; cd05233 717522002497 NAD(P) binding site [chemical binding]; other site 717522002498 active site 717522002499 phosphate ABC transporter, phosphate-binding protein; Region: 3a0107s03; TIGR00975 717522002500 phosphate ABC transporter, permease protein PstC; Region: phosphate_pstC; TIGR02138 717522002501 Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261 717522002502 dimer interface [polypeptide binding]; other site 717522002503 conserved gate region; other site 717522002504 putative PBP binding loops; other site 717522002505 ABC-ATPase subunit interface; other site 717522002506 ABC-type phosphate transport system, permease component [Inorganic ion transport and metabolism]; Region: PstA; COG0581 717522002507 Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261 717522002508 dimer interface [polypeptide binding]; other site 717522002509 conserved gate region; other site 717522002510 putative PBP binding loops; other site 717522002511 Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cl00427 717522002512 ABC-ATPase subunit interface; other site 717522002513 Uncharacterized conserved protein [Function unknown]; Region: COG3391 717522002514 NHL repeat; Region: NHL; pfam01436 717522002515 NHL repeat; Region: NHL; pfam01436 717522002516 NHL repeat; Region: NHL; pfam01436 717522002517 NHL repeat; Region: NHL; pfam01436 717522002518 NHL repeat; Region: NHL; pfam01436 717522002519 Serine/Threonine protein kinases, catalytic domain; Region: S_TKc; smart00220 717522002520 Catalytic domain of Protein Kinases; Region: PKc; cd00180 717522002521 active site 717522002522 ATP binding site [chemical binding]; other site 717522002523 substrate binding site [chemical binding]; other site 717522002524 Protein Kinases, catalytic domain; Region: PKc_like; cl09925 717522002525 substrate binding site [chemical binding]; other site 717522002526 activation loop (A-loop); other site 717522002527 activation loop (A-loop); other site 717522002528 PBP superfamily domain; Region: PBP_like_2; cl17296 717522002529 ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201 717522002530 Walker A/P-loop; other site 717522002531 ATP binding site [chemical binding]; other site 717522002532 ATP-binding cassette domain of the phosphate transport system; Region: ABC_PstB_phosphate_transporter; cd03260 717522002533 Q-loop/lid; other site 717522002534 ABC transporter signature motif; other site 717522002535 Walker B; other site 717522002536 D-loop; other site 717522002537 H-loop/switch region; other site 717522002538 phosphate ABC transporter, phosphate-binding protein; Region: 3a0107s03; TIGR00975 717522002539 phosphate ABC transporter, permease protein PstC; Region: phosphate_pstC; TIGR02138 717522002540 Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261 717522002541 dimer interface [polypeptide binding]; other site 717522002542 conserved gate region; other site 717522002543 putative PBP binding loops; other site 717522002544 ABC-ATPase subunit interface; other site 717522002545 ABC-type phosphate transport system, permease component [Inorganic ion transport and metabolism]; Region: PstA; COG0581 717522002546 Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261 717522002547 dimer interface [polypeptide binding]; other site 717522002548 conserved gate region; other site 717522002549 putative PBP binding loops; other site 717522002550 ABC-ATPase subunit interface; other site 717522002551 Ku protein, prokaryotic; Region: Ku_bact; TIGR02772 717522002552 Ku-core domain, Ku-like subfamily; composed of prokaryotic homologs of the eukaryotic DNA binding protein Ku. The alignment includes the core domain shared by the prokaryotic YkoV-like proteins and the eukaryotic Ku70 and Ku80. The prokaryotic Ku...; Region: KU_like; cd00789 717522002553 putative DNA binding site [nucleotide binding]; other site 717522002554 putative homodimer interface [polypeptide binding]; other site 717522002555 ATP-dependent DNA ligase; Reviewed; Region: PRK09632 717522002556 MtLigD_Pol_like: Polymerase (Pol) domain of bacterial LigD proteins similar to Mycobacterium tuberculosis (Mt)LigD. The LigD Pol domain belongs to the archaeal/eukaryal primase (AEP) superfamily. In prokaryotes, LigD along with Ku is required for...; Region: MtLigD_Pol_like; cd04863 717522002557 nucleotide binding site [chemical binding]; other site 717522002558 DNA ligase D, 3'-phosphoesterase domain; Region: LigD_PE_dom; TIGR02777 717522002559 Adenylation domain of Mycobacterium tuberculosis LigD and LigC-like ATP-dependent DNA ligases; Region: Adenylation_DNA_ligase_LigD_LigC; cd07906 717522002560 active site 717522002561 DNA binding site [nucleotide binding] 717522002562 The Oligonucleotide/oligosaccharide binding (OB)-fold domain of ATP-dependent DNA ligase LigD is a DNA-binding module that is part of the catalytic core unit; Region: OBF_DNA_ligase_LigD; cd07971 717522002563 DNA binding site [nucleotide binding] 717522002564 2-keto-4-pentenoate hydratase/2-oxohepta-3-ene-1,7-dioic acid hydratase (catechol pathway) [Secondary metabolites biosynthesis, transport, and catabolism]; Region: MhpD; COG0179 717522002565 Fumarylacetoacetate (FAA) hydrolase family; Region: FAA_hydrolase; pfam01557 717522002566 Zn-dependent hydrolases, including glyoxylases [General function prediction only]; Region: GloB; COG0491 717522002567 probable F420-dependent oxidoreductase, Rv2161c family; Region: F420_Rv2161c; TIGR03619 717522002568 Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cl07892 717522002569 Sulphate Transporter and Anti-Sigma factor antagonist) domain of anti-anti-sigma factors, key regulators of anti-sigma factors by phosphorylation; Region: STAS_anti-anti-sigma_factors; cd07043 717522002570 anti sigma factor interaction site; other site 717522002571 regulatory phosphorylation site [posttranslational modification]; other site 717522002572 Predicted flavoprotein involved in K+ transport [Inorganic ion transport and metabolism]; Region: TrkA; COG2072 717522002573 Formamidopyrimidine-DNA glycosylase [DNA replication, recombination, and repair]; Region: Nei; COG0266 717522002574 Formamidopyrimidine-DNA glycosylase H2TH domain; Region: H2TH; pfam06831 717522002575 Zinc finger found in FPG and IleRS; Region: zf-FPG_IleRS; pfam06827 717522002576 short chain dehydrogenase; Provisional; Region: PRK08251 717522002577 classical (c) SDR, subgroup 6; Region: SDR_c6; cd05350 717522002578 putative NAD(P) binding site [chemical binding]; other site 717522002579 active site 717522002580 glucose-6-phosphate isomerase; Reviewed; Region: pgi; PRK00179 717522002581 Phosphoglucose isomerase (PGI) contains two SIS (Sugar ISomerase) domains. This classification is based on the alignment of the first SIS domain. PGI is a multifunctional enzyme which as an intracellular dimer catalyzes the reversible isomerization of...; Region: SIS_PGI_1; cd05015 717522002582 active site 717522002583 dimer interface [polypeptide binding]; other site 717522002584 Phosphoglucose isomerase (PGI) contains two SIS (Sugar ISomerase) domains. This classification is based on the alignment of the second SIS domain. PGI is a multifunctional enzyme which as an intracellular dimer catalyzes the reversible isomerization of...; Region: SIS_PGI_2; cd05016 717522002585 dimer interface [polypeptide binding]; other site 717522002586 active site 717522002587 hypothetical protein; Provisional; Region: PRK07857 717522002588 ATP-dependent DNA helicase PcrA; Region: pcrA; TIGR01073 717522002589 Part of AAA domain; Region: AAA_19; pfam13245 717522002590 Family description; Region: UvrD_C_2; pfam13538 717522002591 Membrane proteins related to metalloendopeptidases [Cell envelope biogenesis, outer membrane]; Region: NlpD; COG0739 717522002592 Peptidase family M23; Region: Peptidase_M23; pfam01551 717522002593 succinyl-CoA synthetase subunit beta; Provisional; Region: sucC; PRK00696 717522002594 ATP-grasp domain; Region: ATP-grasp_2; pfam08442 717522002595 CoA-ligase; Region: Ligase_CoA; pfam00549 717522002596 succinyl-CoA synthetase subunit alpha; Validated; Region: PRK05678 717522002597 CoA binding domain; Region: CoA_binding; smart00881 717522002598 CoA-ligase; Region: Ligase_CoA; pfam00549 717522002599 probable F420-dependent oxidoreductase, Rv2161c family; Region: F420_Rv2161c; TIGR03619 717522002600 Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cl07892 717522002601 phosphoribosylglycinamide formyltransferase; Reviewed; Region: purN; PRK05647 717522002602 Phosphoribosylglycinamide formyltransferase (GAR transformylase, GART); Region: FMT_core_GART; cd08645 717522002603 active site 717522002604 substrate binding site [chemical binding]; other site 717522002605 cosubstrate binding site; other site 717522002606 catalytic site [active] 717522002607 bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase; Provisional; Region: purH; PRK00881 717522002608 Inosine monophosphate cyclohydrolase domain. This is the N-terminal domain in the purine biosynthesis pathway protein ATIC (purH). The bifunctional ATIC protein contains a C-terminal ATIC formylase domain that formylates...; Region: IMPCH; cd01421 717522002609 purine monophosphate binding site [chemical binding]; other site 717522002610 dimer interface [polypeptide binding]; other site 717522002611 putative catalytic residues [active] 717522002612 AICARFT/IMPCHase bienzyme; Region: AICARFT_IMPCHas; smart00798 717522002613 AICARFT/IMPCHase bienzyme; Region: AICARFT_IMPCHas; cl03362 717522002614 Mg-chelatase subunit ChlI [Coenzyme metabolism]; Region: ChlI; COG1239 717522002615 Magnesium chelatase, subunit ChlI; Region: Mg_chelatase; pfam01078 717522002616 Uncharacterized protein with a von Willebrand factor type A (vWA) domain [General function prediction only]; Region: COG4867 717522002617 Von Willebrand factor type A (vWA) domain was originally found in the blood coagulation protein von Willebrand factor (vWF). Typically, the vWA domain is made up of approximately 200 amino acid residues folded into a classic a/b para-rossmann type of...; Region: vWFA; cl00057 717522002618 metal ion-dependent adhesion site (MIDAS); other site 717522002619 PIN domain of the Pyrobaculum aerophilum Pae0151 and Pae2754 proteins and homologs; Region: PIN_Pae0151; cd09873 717522002620 homotetrameric interface [polypeptide binding]; other site 717522002621 putative active site [active] 717522002622 metal binding site [ion binding]; metal-binding site 717522002623 Alpha/beta hydrolase; Region: Abhydrolase_8; pfam06259 717522002624 Domain of unknown function (DUF1707); Region: DUF1707; pfam08044 717522002625 Thermus thermophilus CsoR, a Cu(I)-sensing transcriptional regulator, and related domains; this domain family was previously known as part of DUF156; Region: TthCsoR-like_DUF156; cd10151 717522002626 putative homodimer interface [polypeptide binding]; other site 717522002627 putative homotetramer interface [polypeptide binding]; other site 717522002628 allosteric switch controlling residues; other site 717522002629 putative metal binding site [ion binding]; other site 717522002630 putative homodimer-homodimer interface [polypeptide binding]; other site 717522002631 Protein of unknown function (DUF1490); Region: DUF1490; pfam07371 717522002632 copper-(or silver)-translocating P-type ATPase; Region: ATPase-IB1_Cu; TIGR01511 717522002633 E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122 717522002634 Soluble P-type ATPase [General function prediction only]; Region: COG4087 717522002635 enoyl-CoA hydratase; Provisional; Region: PRK07827 717522002636 Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558 717522002637 substrate binding site [chemical binding]; other site 717522002638 oxyanion hole (OAH) forming residues; other site 717522002639 trimer interface [polypeptide binding]; other site 717522002640 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522002641 Acyl-CoA dehydrogenase; Region: ACAD; cd00567 717522002642 active site 717522002643 Acetyl/propionyl-CoA carboxylase, alpha subunit [Lipid metabolism]; Region: COG4770 717522002644 Carbamoyl-phosphate synthase L chain, N-terminal domain; Region: CPSase_L_chain; pfam00289 717522002645 ATP-grasp domain; Region: ATP-grasp_4; cl17255 717522002646 Biotin carboxylase C-terminal domain; Region: Biotin_carb_C; smart00878 717522002647 The biotinyl-domain or biotin carboxyl carrier protein (BCCP) domain is present in all biotin-dependent enzymes, such as acetyl-CoA carboxylase, pyruvate carboxylase, propionyl-CoA carboxylase, methylcrotonyl-CoA carboxylase, geranyl-CoA carboxylase; Region: biotinyl_domain; cd06850 717522002648 carboxyltransferase (CT) interaction site; other site 717522002649 biotinylation site [posttranslational modification]; other site 717522002650 Acetyl-CoA carboxylase, carboxyltransferase component (subunits alpha and beta) [Lipid metabolism]; Region: COG4799 717522002651 Acetyl-CoA carboxylase alpha subunit [Lipid metabolism]; Region: AccA; cl17345 717522002652 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522002653 Acyl-CoA dehydrogenase; Region: ACAD; cl09933 717522002654 active site 717522002655 Protein of unknown function (DUF1446); Region: DUF1446; pfam07287 717522002656 PE family; Region: PE; pfam00934 717522002657 PE family; Region: PE; pfam00934 717522002658 Uncharacterized conserved protein [Function unknown]; Region: COG3391 717522002659 40-residue YVTN family beta-propeller repeat; Region: beta_rpt_yvtn; TIGR02276 717522002660 40-residue YVTN family beta-propeller repeat; Region: beta_rpt_yvtn; TIGR02276 717522002661 PE family; Region: PE; pfam00934 717522002662 Uncharacterized conserved protein [Function unknown]; Region: COG3391 717522002663 40-residue YVTN family beta-propeller repeat; Region: beta_rpt_yvtn; TIGR02276 717522002664 40-residue YVTN family beta-propeller repeat; Region: beta_rpt_yvtn; TIGR02276 717522002665 40-residue YVTN family beta-propeller repeat; Region: beta_rpt_yvtn; TIGR02276 717522002666 Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745 717522002667 Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156 717522002668 active site 717522002669 phosphorylation site [posttranslational modification] 717522002670 intermolecular recognition site; other site 717522002671 dimerization interface [polypeptide binding]; other site 717522002672 Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383 717522002673 DNA binding site [nucleotide binding] 717522002674 heavy metal sensor kinase; Region: cztS_silS_copS; TIGR01386 717522002675 Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225 717522002676 dimerization interface [polypeptide binding]; other site 717522002677 Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082 717522002678 dimer interface [polypeptide binding]; other site 717522002679 phosphorylation site [posttranslational modification] 717522002680 Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075 717522002681 ATP binding site [chemical binding]; other site 717522002682 Mg2+ binding site [ion binding]; other site 717522002683 G-X-G motif; other site 717522002684 periplasmic serine protease, Do/DeqQ family; Region: degP_htrA_DO; TIGR02037 717522002685 Trypsin-like peptidase domain; Region: Trypsin_2; pfam13365 717522002686 MogA_MoaB family. Members of this family are involved in biosynthesis of the molybdenum cofactor (MoCF) an essential cofactor of a diverse group of redox enzymes. MoCF biosynthesis is an evolutionarily conserved pathway present in eubacteria, archaea; Region: MogA_MoaB; cd00886 717522002687 MPT binding site; other site 717522002688 trimer interface [polypeptide binding]; other site 717522002689 large-conductance mechanosensitive channel; Reviewed; Region: mscL; PRK00567 717522002690 Large-conductance mechanosensitive channel, MscL; Region: MscL; pfam01741 717522002691 ABC-type antimicrobial peptide transport system, ATPase component [Defense mechanisms]; Region: SalX; COG1136 717522002692 ATP-binding cassette domain of the transporters involved in export of lipoprotein and macrolide, and cell division protein; Region: ABC_MJ0796_LolCDE_FtsE; cd03255 717522002693 Walker A/P-loop; other site 717522002694 ATP binding site [chemical binding]; other site 717522002695 Q-loop/lid; other site 717522002696 ABC transporter signature motif; other site 717522002697 Walker B; other site 717522002698 D-loop; other site 717522002699 H-loop/switch region; other site 717522002700 ABC-type transport system, involved in lipoprotein release, permease component [Cell envelope biogenesis, outer membrane]; Region: LolE; COG4591 717522002701 MacB-like periplasmic core domain; Region: MacB_PCD; pfam12704 717522002702 FtsX-like permease family; Region: FtsX; pfam02687 717522002703 MacB-like periplasmic core domain; Region: MacB_PCD; pfam12704 717522002704 ABC-type antimicrobial peptide transport system, permease component [Defense mechanisms]; Region: SalY; COG0577 717522002705 FtsX-like permease family; Region: FtsX; pfam02687 717522002706 Predicted secreted hydrolase [General function prediction only]; Region: COG5621 717522002707 Geranylgeranyl pyrophosphate synthase [Coenzyme metabolism]; Region: IspA; COG0142 717522002708 Trans-Isoprenyl Diphosphate Synthases, head-to-tail; Region: Trans_IPPS_HT; cd00685 717522002709 substrate binding pocket [chemical binding]; other site 717522002710 chain length determination region; other site 717522002711 substrate-Mg2+ binding site; other site 717522002712 catalytic residues [active] 717522002713 aspartate-rich region 1; other site 717522002714 active site lid residues [active] 717522002715 aspartate-rich region 2; other site 717522002716 SAF domains of the flagella basal body P-ring formation protein FlgA and the flp pilus assembly CpaB; Region: SAF_CpaB_FlgA_like; cd11614 717522002717 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2331 717522002718 5-formyltetrahydrofolate cyclo-ligase [Coenzyme metabolism]; Region: COG0212 717522002719 5-formyltetrahydrofolate cyclo-ligase family; Region: 5-FTHF_cyc-lig; pfam01812 717522002720 UDP-glucose pyrophosphorylase [Cell envelope biogenesis, outer membrane]; Region: GalU; COG1210 717522002721 dTDP-glucose pyrophosphorylase [Cell envelope biogenesis, outer membrane]; Region: RfbA; COG1209 717522002722 active site 717522002723 Molybdopterin biosynthesis enzyme [Coenzyme metabolism]; Region: MoeA; COG0303 717522002724 MoeA family. Members of this family are involved in biosynthesis of the molybdenum cofactor (MoCF), an essential cofactor of a diverse group of redox enzymes. MoCF biosynthesis is an evolutionarily conserved pathway present in eubacteria, archaea and...; Region: MoeA; cd00887 717522002725 dimer interface [polypeptide binding]; other site 717522002726 putative functional site; other site 717522002727 putative MPT binding site; other site 717522002728 N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182 717522002729 Acetyltransferases, including N-acetylases of ribosomal proteins [Translation, ribosomal structure and biogenesis]; Region: RimL; COG1670 717522002730 cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases [Signal transduction mechanisms]; Region: Crp; COG0664 717522002731 effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038 717522002732 ligand binding site [chemical binding]; other site 717522002733 flexible hinge region; other site 717522002734 Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302 717522002735 N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301 717522002736 Coenzyme A binding pocket [chemical binding]; other site 717522002737 Alkylated DNA repair protein [DNA replication, recombination, and repair]; Region: AlkB; COG3145 717522002738 arginine deiminase; Provisional; Region: PRK01388 717522002739 Dolichyl-phosphate-mannose--protein O-mannosyl transferase [Posttranslational modification, protein turnover, chaperones]; Region: PMT1; COG1928 717522002740 Dolichyl-phosphate-mannose-protein mannosyltransferase; Region: PMT_2; cl17364 717522002741 Predicted methyltransferases [General function prediction only]; Region: COG0313 717522002742 Ribosomal RNA small subunit methyltransferase I, also known as rRNA (cytidine-2'-O-)-methyltransferase RsmI; Region: RsmI; cd11648 717522002743 putative SAM binding site [chemical binding]; other site 717522002744 putative homodimer interface [polypeptide binding]; other site 717522002745 aminodeoxychorismate synthase component I; Provisional; Region: PRK05877 717522002746 aminodeoxychorismate synthase, component I, bacterial clade; Region: pabB; TIGR00553 717522002747 methionyl-tRNA synthetase; Reviewed; Region: PRK11893 717522002748 catalytic core domain of methioninyl-tRNA synthetases; Region: MetRS_core; cd00814 717522002749 active site 717522002750 HIGH motif; other site 717522002751 KMSKS motif; other site 717522002752 Anticodon-binding domain of methionyl tRNA synthetases; Region: Anticodon_Ia_Met; cd07957 717522002753 tRNA binding surface [nucleotide binding]; other site 717522002754 anticodon binding site; other site 717522002755 Predicted metal-dependent hydrolases with the TIM-barrel fold [General function prediction only]; Region: COG1099 717522002756 TatD like proteins; E.coli TatD is a cytoplasmic protein, shown to have magnesium dependent DNase activity; Region: TatD_DNAse; cd01310 717522002757 active site 717522002758 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3583 717522002759 Domain of unknown function (DUF348); Region: DUF348; pfam03990 717522002760 Domain of unknown function (DUF348); Region: DUF348; pfam03990 717522002761 G5 domain; Region: G5; pfam07501 717522002762 Transglycosylase-like domain; Region: Transglycosylas; pfam06737 717522002763 16S ribosomal RNA methyltransferase KsgA/Dim1 family protein; Reviewed; Region: ksgA; PRK00274 717522002764 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522002765 S-adenosylmethionine binding site [chemical binding]; other site 717522002766 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase; Provisional; Region: PRK03188 717522002767 Increased loss of mitochondrial DNA protein 1; Region: Ilm1; pfam10311 717522002768 GHMP kinases C terminal; Region: GHMP_kinases_C; pfam08544 717522002769 long-chain-fatty-acid--CoA ligase; Validated; Region: PRK07768 717522002770 Adenylate forming domain, Class I; Region: AFD_class_I; cl17068 717522002771 acyl-activating enzyme (AAE) consensus motif; other site 717522002772 AMP binding site [chemical binding]; other site 717522002773 active site 717522002774 CoA binding site [chemical binding]; other site 717522002775 Peptidyl-tRNA hydrolase (PTH) is a monomeric protein that cleaves the ester bond linking the nascent peptide and tRNA when peptidyl-tRNA is released prematurely from the ribosome. This ensures the recycling of peptidyl-tRNAs into tRNAs produced through...; Region: PTH; cd00462 717522002776 putative active site [active] 717522002777 catalytic residue [active] 717522002778 Ribosomal L25/TL5/CTC N-terminal 5S rRNA binding domain; Region: Ribosomal_L25_TL5_CTC; cd00495 717522002779 ribosomal protein L25, Ctc-form; Region: ctc_TL5; TIGR00731 717522002780 5S rRNA interface [nucleotide binding]; other site 717522002781 CTC domain interface [polypeptide binding]; other site 717522002782 L16 interface [polypeptide binding]; other site 717522002783 Probable lipoprotein LpqN; Region: Lpp-LpqN; pfam10738 717522002784 N-terminal domain of ribose phosphate pyrophosphokinase; Region: Pribosyltran_N; pfam13793 717522002785 ribose-phosphate pyrophosphokinase; Provisional; Region: PRK03092 717522002786 Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223 717522002787 active site 717522002788 bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase; Provisional; Region: glmU; PRK14352 717522002789 N-terminal domain of bacterial GlmU; Region: GT2_GlmU_N_bac; cd02540 717522002790 Substrate binding site; other site 717522002791 Mg++ binding site; other site 717522002792 N-acetyl-glucosamine-1-phosphate uridyltransferase (GlmU), C-terminal left-handed beta-helix (LbH) acetyltransferase domain: GlmU is also known as UDP-N-acetylglucosamine pyrophosphorylase. It is a bifunctional bacterial enzyme that catalyzes two...; Region: LbH_GlmU_C; cd03353 717522002793 active site 717522002794 substrate binding site [chemical binding]; other site 717522002795 CoA binding site [chemical binding]; other site 717522002796 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522002797 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522002798 Transcription-repair coupling factor (superfamily II helicase) [DNA replication, recombination, and repair / Transcription]; Region: Mfd; COG1197 717522002799 CarD-like/TRCF domain; Region: CarD_TRCF; smart01058 717522002800 DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046 717522002801 ATP binding site [chemical binding]; other site 717522002802 putative Mg++ binding site [ion binding]; other site 717522002803 Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079 717522002804 nucleotide binding region [chemical binding]; other site 717522002805 ATP-binding site [chemical binding]; other site 717522002806 This domain is found in proteins necessary for strand-specific repair in DNA such as TRCF in Escherichia coli; Region: TRCF; smart00982 717522002807 nucleoside triphosphate pyrophosphohydrolase; Reviewed; Region: PRK12334 717522002808 Nucleoside Triphosphate Pyrophosphohydrolase (EC 3.6.1.8) N-terminal tandem-domain of MazG proteins from Escherichia coli and bacterial homologs; Region: NTP-PPase_MazG_Nterm; cd11528 717522002809 homodimer interface [polypeptide binding]; other site 717522002810 metal binding site [ion binding]; metal-binding site 717522002811 Nucleoside Triphosphate Pyrophosphohydrolase (EC 3.6.1.8) MazG-like domain superfamily; Region: NTP-PPase; cl16941 717522002812 Membrane-bound lytic murein transglycosylase B [Cell envelope biogenesis, outer membrane]; Region: MltB; COG2951 717522002813 Lytic Transglycosylase (LT) and Goose Egg White Lysozyme (GEWL) domain. Members include the soluble and insoluble membrane-bound LTs in bacteria, the LTs in bacteriophage lambda, as well as, the eukaryotic "goose-type" lysozymes (GEWL). LTs...; Region: LT_GEWL; cd00254 717522002814 N-acetyl-D-glucosamine binding site [chemical binding]; other site 717522002815 enolase; Provisional; Region: eno; PRK00077 717522002816 Enolase: Enolases are homodimeric enzymes that catalyse the reversible dehydration of 2-phospho-D-glycerate to phosphoenolpyruvate as part of the glycolytic and gluconeogenesis pathways. The reaction is facilitated by the presence of metal ions; Region: enolase; cd03313 717522002817 dimer interface [polypeptide binding]; other site 717522002818 metal binding site [ion binding]; metal-binding site 717522002819 substrate binding pocket [chemical binding]; other site 717522002820 Septum formation initiator [Cell division and chromosome partitioning]; Region: COG2919 717522002821 Septum formation initiator; Region: DivIC; pfam04977 717522002822 Uncharacterized conserved protein [Function unknown]; Region: COG1507 717522002823 exopolyphosphatase; Region: exo_poly_only; TIGR03706 717522002824 Ppx/GppA phosphatase family; Region: Ppx-GppA; pfam02541 717522002825 DNA-binding transcriptional activator KdpE; Provisional; Region: PRK10529 717522002826 Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156 717522002827 active site 717522002828 phosphorylation site [posttranslational modification] 717522002829 intermolecular recognition site; other site 717522002830 dimerization interface [polypeptide binding]; other site 717522002831 Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383 717522002832 DNA binding site [nucleotide binding] 717522002833 Osmosensitive K+ channel histidine kinase [Signal transduction mechanisms]; Region: KdpD; COG2205 717522002834 Osmosensitive K+ channel His kinase sensor domain; Region: KdpD; pfam02702 717522002835 USP domain is located between the N-terminal sensor domain and C-terminal catalytic domain of this Osmosensitive K+ channel histidine kinase family. The family of KdpD sensor kinase proteins regulates the kdpFABC operon responsible for potassium...; Region: USP_OKCHK; cd01987 717522002836 Ligand Binding Site [chemical binding]; other site 717522002837 Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082 717522002838 dimer interface [polypeptide binding]; other site 717522002839 phosphorylation site [posttranslational modification] 717522002840 Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075 717522002841 ATP binding site [chemical binding]; other site 717522002842 Mg2+ binding site [ion binding]; other site 717522002843 G-X-G motif; other site 717522002844 K+-transporting ATPase, KdpA; Region: kdpA; TIGR00680 717522002845 potassium-transporting ATPase subunit B; Provisional; Region: PRK01122 717522002846 E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122 717522002847 Soluble P-type ATPase [General function prediction only]; Region: COG4087 717522002848 potassium-transporting ATPase subunit C; Provisional; Region: PRK14001 717522002849 Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642 717522002850 Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082 717522002851 dimer interface [polypeptide binding]; other site 717522002852 phosphorylation site [posttranslational modification] 717522002853 Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075 717522002854 ATP binding site [chemical binding]; other site 717522002855 Mg2+ binding site [ion binding]; other site 717522002856 G-X-G motif; other site 717522002857 Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745 717522002858 Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156 717522002859 active site 717522002860 phosphorylation site [posttranslational modification] 717522002861 intermolecular recognition site; other site 717522002862 dimerization interface [polypeptide binding]; other site 717522002863 Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383 717522002864 DNA binding site [nucleotide binding] 717522002865 Transposase and inactivated derivatives, IS5 family [DNA replication, recombination, and repair]; Region: COG3039 717522002866 Transposase DDE domain; Region: DDE_Tnp_1_6; pfam13751 717522002867 Transposase and inactivated derivatives, IS5 family [DNA replication, recombination, and repair]; Region: COG3039 717522002868 Proteins of 100 residues with WXG; Region: WXG100; pfam06013 717522002869 WXG100 family type VII secretion target; Region: WXG100_ESAT6; TIGR03930 717522002870 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522002871 PPE family; Region: PPE; pfam00823 717522002872 Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484 717522002873 PE family; Region: PE; pfam00934 717522002874 Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484 717522002876 Putative transposase of IS4/5 family (DUF4096); Region: DUF4096; pfam13340 717522002877 Trypsin-like serine proteases, typically periplasmic, contain C-terminal PDZ domain [Posttranslational modification, protein turnover, chaperones]; Region: DegQ; COG0265 717522002878 Trypsin-like peptidase domain; Region: Trypsin_2; pfam13365 717522002879 Predicted transcriptional regulator [Transcription]; Region: COG5340 717522002880 Domain of unknown function (DUF4095); Region: DUF4095; pfam13338 717522002881 Nucleotidyl transferase of unknown function (DUF1814); Region: DUF1814; pfam08843 717522002882 Transposase, Mutator family; Region: Transposase_mut; pfam00872 717522002883 MULE transposase domain; Region: MULE; pfam10551 717522002884 Transcriptional regulators [Transcription]; Region: MarR; COG1846 717522002885 MarR family; Region: MarR_2; pfam12802 717522002886 Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931 717522002887 This enzymatic domain is part of bacterial polyketide synthases; Region: PKS_KR; smart00822 717522002888 NAD(P) binding site [chemical binding]; other site 717522002889 active site 717522002890 Nucleotidyl transferase of unknown function (DUF1814); Region: DUF1814; pfam08843 717522002891 Helix-turn-helix domain; Region: HTH_17; pfam12728 717522002892 DNA breaking-rejoining enzymes, C-terminal catalytic domain. The DNA breaking-rejoining enzyme superfamily includes type IB topoisomerases and tyrosine recombinases that share the same fold in their catalytic domain containing six conserved active site...; Region: DNA_BRE_C; cl00213 717522002893 Domain of unknown function (DUF427); Region: DUF427; cl00998 717522002894 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2343 717522002895 Uncharacterized conserved protein [Function unknown]; Region: COG3391 717522002896 long-chain-fatty-acid--CoA ligase; Validated; Region: PRK06187 717522002897 Fatty acyl-CoA synthetases similar to LC-FACS from Thermus thermophiles; Region: ttLC_FACS_AlkK_like; cd12119 717522002898 dimer interface [polypeptide binding]; other site 717522002899 acyl-activating enzyme (AAE) consensus motif; other site 717522002900 putative active site [active] 717522002901 AMP binding site [chemical binding]; other site 717522002902 putative CoA binding site [chemical binding]; other site 717522002903 Uncharacterized conserved protein related to dihydrodipicolinate reductase [Function unknown]; Region: COG3804 717522002904 Polyketide cyclase / dehydrase and lipid transport; Region: Polyketide_cyc2; pfam10604 717522002905 hydrophobic ligand binding site; other site 717522002906 Predicted glutamine amidotransferase [General function prediction only]; Region: COG0121 717522002907 Glutamine amidotransferases class-II (Gn-AT)_YafJ-type. YafJ is a glutamine amidotransferase-like protein of unknown function found in prokaryotes, eukaryotes and archaea. YafJ has a conserved structural fold similar to those of other class II...; Region: YafJ; cd01908 717522002908 putative active site [active] 717522002909 putative dimer interface [polypeptide binding]; other site 717522002910 Patatin-like phospholipase; Region: Patatin; pfam01734 717522002911 Predicted esterase of the alpha-beta hydrolase superfamily [General function prediction only]; Region: RssA; COG1752 717522002912 nucleophile elbow; other site 717522002913 hypothetical protein; Provisional; Region: PRK10279 717522002914 Bacterial patatin-like phospholipase domain containing protein 6; Region: Pat_NTE_like_bacteria; cd07228 717522002915 active site 717522002916 nucleophile elbow; other site 717522002917 Cysteine dioxygenase type I; Region: CDO_I; pfam05995 717522002918 Rhodanese Homology Domain (RHOD); an alpha beta fold domain found duplicated in the rhodanese protein. The cysteine containing enzymatically active version of the domain is also found in the Cdc25 class of protein phosphatases and a variety of proteins...; Region: RHOD; cl00125 717522002919 active site residue [active] 717522002920 PE family; Region: PE; pfam00934 717522002921 PE family; Region: PE; pfam00934 717522002922 I-RD02 Region of difference I-RD02,inserted region in Mycobacterium bovis BCG Pasteur, Mycobacterium bovis AF2122/97, BCG Tokyo, and BCG Mexico compared to Mycobacterium tuberculosis H37Rv. In-frame insertion in PE_PGRS20 gene(Rv1068c) in Mycobacterium bovis, Mycobacterium BCG Pasteur and BCG Mexico, and frame-shift insertion in Mycobacterium BCG Tokyo. As a result, the both gene of Mycobacterium bovis (2193bp, Mycobacterium BCG Pasteur (2193bp) and BCG Mexico (2193bp) became longer than that of M. truberculosis (1392bp), and the gene of BCG Tokyo divided into two parts 717522002923 Predicted membrane protein [Function unknown]; Region: COG4425 717522002924 Predicted membrane protein (DUF2319); Region: DUF2319; pfam10081 717522002925 enoyl-CoA hydratase; Provisional; Region: PRK05862 717522002926 Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558 717522002927 substrate binding site [chemical binding]; other site 717522002928 oxyanion hole (OAH) forming residues; other site 717522002929 trimer interface [polypeptide binding]; other site 717522002930 3-hydroxyisobutyryl-CoA hydrolase; Provisional; Region: PRK05617 717522002931 Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558 717522002932 substrate binding site [chemical binding]; other site 717522002933 oxyanion hole (OAH) forming residues; other site 717522002934 trimer interface [polypeptide binding]; other site 717522002935 2-enoyl-CoA Hydratase C-terminal region; Region: ECH_C; pfam13766 717522002936 Predicted membrane protein [Function unknown]; Region: COG4760 717522002937 Domain of unknown function (DUF4095); Region: DUF4095; pfam13338 717522002938 Superfamily of nucleases including Short Patch Repair (Vsr) Endonucleases, archaeal Holliday junction resolvases, MutH methy-directed DNA mismatch-repair endonucleases, and catalytic domains of many restriction endonucleases, such as EcoRI, BamHI, and...; Region: Restriction_endonuclease_like; cl00277 717522002939 acetyl-CoA acetyltransferase; Provisional; Region: PRK07851 717522002940 Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751 717522002941 dimer interface [polypeptide binding]; other site 717522002942 active site 717522002943 SGNH_hydrolase subfamily, FeeA, FeeB and similar esterases/lipases. FeeA and FeeB are part of a biosynthetic gene cluster and may participate in the biosynthesis of long-chain N-acyltyrosines by providing saturated and unsaturated fatty acids, which it...; Region: FeeA_FeeB_like; cd01836 717522002944 active site 717522002945 catalytic triad [active] 717522002946 oxyanion hole [active] 717522002947 Esterase/lipase [Lipid metabolism]; Region: Aes; COG0657 717522002948 Protein of unknown function (DUF2424); Region: DUF2424; pfam10340 717522002949 cystathionine beta-synthase; Region: cysta_beta; TIGR01137 717522002950 CBS_like: This subgroup includes Cystathionine beta-synthase (CBS) and Cysteine synthase. CBS is a unique heme-containing enzyme that catalyzes a pyridoxal 5'-phosphate (PLP)-dependent condensation of serine and homocysteine to give cystathionine; Region: CBS_like; cd01561 717522002951 dimer interface [polypeptide binding]; other site 717522002952 pyridoxal 5'-phosphate binding site [chemical binding]; other site 717522002953 catalytic residue [active] 717522002954 This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains associated with the pyridoxal-phosphate (PALP) dependent enzyme domain upstream. The vitamin B6 complex comprises pyridoxine, pyridoxal, and pyridoxamine, as well...; Region: CBS_pair_PALP_assoc2; cd04609 717522002955 RDD family; Region: RDD; pfam06271 717522002956 cystathionine gamma-synthase; Provisional; Region: PRK07811 717522002957 CGS_like: Cystathionine gamma-synthase is a PLP dependent enzyme and catalyzes the committed step of methionine biosynthesis. This pathway is unique to microorganisms and plants, rendering the enzyme an attractive target for the development of...; Region: CGS_like; cd00614 717522002958 homodimer interface [polypeptide binding]; other site 717522002959 substrate-cofactor binding pocket; other site 717522002960 pyridoxal 5'-phosphate binding site [chemical binding]; other site 717522002961 catalytic residue [active] 717522002962 transcription elongation factor GreA; Reviewed; Region: greA; PRK00226 717522002963 Transcription elongation factor, N-terminal; Region: GreA_GreB_N; pfam03449 717522002964 Transcription elongation factor, GreA/GreB, C-term; Region: GreA_GreB; pfam01272 717522002965 Domain of unknown function (DUF4307); Region: DUF4307; pfam14155 717522002966 mycothiol conjugate amidase Mca; Region: mycothiol_Mca; TIGR03446 717522002967 Highly conserved protein containing a thioredoxin domain [Posttranslational modification, protein turnover, chaperones]; Region: COG1331 717522002968 TRX domain, SSP411 protein family; members of this family are highly conserved proteins present in eukaryotes, bacteria and archaea, about 600-800 amino acids in length, which contain a TRX domain with a redox active CXXC motif. The human/rat protein; Region: SSP411; cd02955 717522002969 catalytic residues [active] 717522002970 AGE domain; N-acyl-D-glucosamine 2-epimerase domain; Responsible for intermediate epimerization during biosynthesis of N-acetylneuraminic acid. Catalytic mechanism is believed to be via nucleotide elimination and readdition and is ATP modulated. AGE is...; Region: AGE; cl00183 717522002971 Predicted membrane protein, hemolysin III homolog [General function prediction only]; Region: COG1272 717522002972 channel protein, hemolysin III family; Region: hlyIII; TIGR01065 717522002973 Undecaprenyl pyrophosphate synthase [Lipid metabolism]; Region: UppS; COG0020 717522002974 Cis (Z)-Isoprenyl Diphosphate Synthases (cis-IPPS); homodimers which catalyze the successive 1'-4 condensation of the isopentenyl diphosphate (IPP) molecule to trans,trans-farnesyl diphosphate (FPP) or to cis,trans-FPP to form long-chain polyprenyl...; Region: CIS_IPPS; cd00475 717522002975 catalytic residue [active] 717522002976 putative FPP diphosphate binding site; other site 717522002977 putative FPP binding hydrophobic cleft; other site 717522002978 dimer interface [polypeptide binding]; other site 717522002979 putative IPP diphosphate binding site; other site 717522002980 PE family; Region: PE; pfam00934 717522002981 Undecaprenyl pyrophosphate synthase [Lipid metabolism]; Region: UppS; COG0020 717522002982 Cis (Z)-Isoprenyl Diphosphate Synthases (cis-IPPS); homodimers which catalyze the successive 1'-4 condensation of the isopentenyl diphosphate (IPP) molecule to trans,trans-farnesyl diphosphate (FPP) or to cis,trans-FPP to form long-chain polyprenyl...; Region: CIS_IPPS; cl00230 717522002983 putative IPP diphosphate binding site; other site 717522002984 PE family; Region: PE; pfam00934 717522002985 Glycosyl hydrolase family 12; Region: Glyco_hydro_12; pfam01670 717522002986 PE family; Region: PE; pfam00934 717522002987 pantothenate kinase; Provisional; Region: PRK05439 717522002988 Pantothenate kinase (PanK) catalyzes the phosphorylation of pantothenic acid to form 4'-phosphopantothenic, which is the first of five steps in coenzyme A (CoA) biosynthetic pathway. The reaction carried out by this enzyme is a key regulatory point...; Region: PanK; cd02025 717522002989 ATP-binding site [chemical binding]; other site 717522002990 CoA-binding site [chemical binding]; other site 717522002991 Mg2+-binding site [ion binding]; other site 717522002992 serine hydroxymethyltransferase; Reviewed; Region: glyA; PRK00011 717522002993 Serine-glycine hydroxymethyltransferase (SHMT). This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). SHMT carries out interconversion of serine and glycine; it catalyzes the transfer of hydroxymethyl...; Region: SHMT; cd00378 717522002994 dimer interface [polypeptide binding]; other site 717522002995 active site 717522002996 glycine-pyridoxal phosphate binding site [chemical binding]; other site 717522002997 folate binding site [chemical binding]; other site 717522002998 Ferritin-like superfamily of diiron-containing four-helix-bundle proteins; Region: Ferritin_like; cl00264 717522002999 dinuclear metal binding motif [ion binding]; other site 717522003000 NYN ribonuclease and ATPase of PhoH family domains [General function prediction only]; Region: COG1875 717522003001 PIN domain of bacterial Smg6-like homologs with PhoH-like ATPase domains; Region: PIN_PhoHL-ATPase; cd09883 717522003002 putative active site [active] 717522003003 PhoH-like protein; Region: PhoH; pfam02562 717522003004 Predicted xylanase/chitin deacetylase [Carbohydrate transport and metabolism]; Region: CDA1; COG0726 717522003005 Catalytic NodB homology domain of rhizobial NodB-like proteins; Region: CE4_NodB_like_6s_7s; cd10917 717522003006 NodB motif; other site 717522003007 active site 717522003008 catalytic site [active] 717522003009 metal binding site [ion binding]; metal-binding site 717522003010 fumarate hydratase; Reviewed; Region: fumC; PRK00485 717522003011 Class II fumarases; Region: Fumarase_classII; cd01362 717522003012 active site 717522003013 tetramer interface [polypeptide binding]; other site 717522003014 Bacterial fructose-1,6-bisphosphatase, glpX-encoded; Region: FBPase_glpX; pfam03320 717522003015 Bacterial fructose-1,6-bisphosphatase, glpX-encoded. A dimeric enzyme dependent on Mg(2+). glpX-encoded FPBase (FBPase class II) differs from other members of the inositol-phosphatase superfamily by permutation of secondary structure elements. The core...; Region: FBPase_glpX; cd01516 717522003016 putative active site [active] 717522003017 Protein of unknown function (DUF4245); Region: DUF4245; pfam14030 717522003018 Predicted permease, member of the PurR regulon [General function prediction only]; Region: yhhT; COG0628 717522003019 Domain of unknown function DUF20; Region: UPF0118; pfam01594 717522003020 Growth inhibitor [Signal transduction mechanisms]; Region: MazF; COG2337 717522003021 Carboxylesterase type B [Lipid metabolism]; Region: PnbA; COG2272 717522003022 Esterases and lipases (includes fungal lipases, cholinesterases, etc.) These enzymes act on carboxylic esters (EC: 3.1.1.-). The catalytic apparatus involves three residues (catalytic triad): a serine, a glutamate or aspartate and a histidine.These...; Region: Esterase_lipase; cd00312 717522003023 Esterases and lipases (includes fungal lipases, cholinesterases, etc.) These enzymes act on carboxylic esters (EC: 3.1.1.-). The catalytic apparatus involves three residues (catalytic triad): a serine, a glutamate or aspartate and a histidine.These...; Region: Esterase_lipase; cd00312 717522003024 3beta-hydroxysteroid dehydrogenases (3b-HSD)-like, extended (e) SDRs; Region: 3b-HSD-like_SDR_e; cd05241 717522003025 3-beta hydroxysteroid dehydrogenase/isomerase family; Region: 3Beta_HSD; pfam01073 717522003026 putative NAD(P) binding site [chemical binding]; other site 717522003027 active site 717522003028 putative substrate binding site [chemical binding]; other site 717522003029 exodeoxyribonuclease VII, small subunit; Region: xseB; TIGR01280 717522003030 Exonuclease VII, large subunit [DNA replication, recombination, and repair]; Region: XseA; COG1570 717522003031 ExoVII_LU_OBF: A subfamily of OB folds corresponding to the N-terminal OB-fold domain of Escherichia coli exodeoxyribonuclease VII (ExoVII) large subunit. E. coli ExoVII is composed of two non-identical subunits. E. coli ExoVII is a...; Region: ExoVII_LU_OBF; cd04489 717522003032 generic binding surface II; other site 717522003033 generic binding surface I; other site 717522003034 4-Hydroxy-3-methylbut-2-enyl diphosphate reductase IspH [Lipid metabolism]; Region: lytB; COG0761 717522003035 4-hydroxy-3-methylbut-2-enyl diphosphate reductase; Reviewed; Region: ispH; PRK01045 717522003036 Yip1 domain; Region: Yip1; pfam04893 717522003037 GTP-binding protein YchF; Reviewed; Region: PRK09601 717522003038 YchF GTPase; Region: YchF; cd01900 717522003039 G1 box; other site 717522003040 GTP/Mg2+ binding site [chemical binding]; other site 717522003041 Switch I region; other site 717522003042 G2 box; other site 717522003043 Switch II region; other site 717522003044 G3 box; other site 717522003045 G4 box; other site 717522003046 G5 box; other site 717522003047 TGS_YchF_C: This subfamily represents TGS domain-containing YchF GTP-binding protein, a universally conserved GTPase whose function is unknown. The N-terminal domain of the YchF protein belongs to the Obg-like family of GTPases, and some members of the...; Region: TGS_YchF_C; cd04867 717522003048 Uncharacterized protein conserved in bacteria (DUF2191); Region: DUF2191; pfam09957 717522003049 Predicted nucleic acid-binding protein, contains PIN domain [General function prediction only]; Region: VapC; COG1487 717522003050 putative active site [active] 717522003051 Uncharacterized conserved protein [Function unknown]; Region: COG1359 717522003052 Adenylate cyclase, family 3 (some proteins contain HAMP domain) [Signal transduction mechanisms]; Region: CyaA; COG2114 717522003053 cyclase homology domain; Region: CHD; cd07302 717522003054 nucleotidyl binding site; other site 717522003055 metal binding site [ion binding]; metal-binding site 717522003056 dimer interface [polypeptide binding]; other site 717522003057 glucose-6-phosphate 1-dehydrogenase; Region: zwf; TIGR00871 717522003058 Glucose-6-phosphate dehydrogenase, NAD binding domain; Region: G6PD_N; pfam00479 717522003059 Glucose-6-phosphate dehydrogenase, C-terminal domain; Region: G6PD_C; pfam02781 717522003060 6-phosphogluconate dehydrogenase-like protein; Reviewed; Region: PRK09599 717522003061 6-phosphogluconate dehydrogenase (decarboxylating); Region: gnd_rel; TIGR00872 717522003062 Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697 717522003063 Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596 717522003064 Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007 717522003065 pyruvate phosphate dikinase; Provisional; Region: PRK05878 717522003066 Pyruvate phosphate dikinase, PEP/pyruvate binding domain; Region: PPDK_N; pfam01326 717522003067 PEP-utilising enzyme, mobile domain; Region: PEP-utilizers; cl17700 717522003068 Domain of unknown function (DUF222); Region: DUF222; pfam02720 717522003069 HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085 717522003070 active site 717522003071 Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396 717522003072 Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093 717522003073 non-specific DNA binding site [nucleotide binding]; other site 717522003074 salt bridge; other site 717522003075 sequence-specific DNA binding site [nucleotide binding]; other site 717522003076 Predicted transcriptional regulator [General function prediction only]; Region: COG3800 717522003077 Domain of unknown function (DUF955); Region: DUF955; pfam06114 717522003078 Predicted transcriptional regulator (DUF2083); Region: DUF2083; pfam09856 717522003079 Uncharacterized protein involved in propionate catabolism [General function prediction only]; Region: PrpD; COG2079 717522003080 citrate synthase; Provisional; Region: PRK14033 717522003081 Citrate synthase (CS), citryl-CoA lyase (CCL), the C-terminal portion of the single-subunit type ATP-citrate lyase (ACL) and the C-terminal portion of the large subunit of the two-subunit type ACL. CS catalyzes the condensation of acetyl coenzyme A; Region: CS_ACL-C_CCL; cl00416 717522003082 oxalacetate binding site [chemical binding]; other site 717522003083 citrylCoA binding site [chemical binding]; other site 717522003084 coenzyme A binding site [chemical binding]; other site 717522003085 catalytic triad [active] 717522003086 Transmembrane protein of unknown function (DUF3556); Region: DUF3556; pfam12077 717522003087 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase; Provisional; Region: PRK05222 717522003088 CIMS - Cobalamine-independent methonine synthase, or MetE, N-terminal domain_like. Many members have been characterized as 5-methyltetrahydropteroyltriglutamate-homocysteine methyltransferases, EC:2.1.1.14, mostly from bacteria and plants. This enzyme...; Region: CIMS_N_terminal_like; cd03312 717522003089 THF binding site; other site 717522003090 CIMS - Cobalamine-independent methonine synthase, or MetE, C-terminal domain_like. Many members have been characterized as 5-methyltetrahydropteroyltriglutamate-homocysteine methyltransferases, EC:2.1.1.14, mostly from bacteria and plants. This enzyme...; Region: CIMS_C_terminal_like; cd03311 717522003091 substrate binding site [chemical binding]; other site 717522003092 THF binding site; other site 717522003093 zinc-binding site [ion binding]; other site 717522003094 PPE family; Region: PPE; pfam00823 717522003095 Condensing enzymes; Family of enzymes that catalyze a (decarboxylating or non-decarboxylating) Claisen-like condensation reaction. Members are share strong structural similarity, and are involved in the synthesis and degradation of fatty acids, and the...; Region: cond_enzymes; cl09938 717522003096 active site 717522003097 Enoyl-CoA hydratase/carnithine racemase [Lipid metabolism]; Region: CaiD; COG1024 717522003098 Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558 717522003099 substrate binding site [chemical binding]; other site 717522003100 oxyanion hole (OAH) forming residues; other site 717522003101 Dehydrogenases (flavoproteins) [Energy production and conversion]; Region: FixC; COG0644 717522003102 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG1755 717522003103 CAAX protease self-immunity; Region: Abi; pfam02517 717522003104 enoyl-CoA hydratase; Provisional; Region: PRK06688 717522003105 Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cl15762 717522003106 Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558 717522003107 trimer interface [polypeptide binding]; other site 717522003108 enoyl-CoA hydratase; Provisional; Region: PRK06688 717522003109 Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558 717522003110 substrate binding site [chemical binding]; other site 717522003111 oxyanion hole (OAH) forming residues; other site 717522003112 trimer interface [polypeptide binding]; other site 717522003113 Predicted acyl-CoA transferases/carnitine dehydratase [Energy production and conversion]; Region: CaiB; COG1804 717522003114 CoA-transferase family III; Region: CoA_transf_3; pfam02515 717522003115 17hydroxysteroid dehydrogenase type 10 (HSD10)-like, classical (c) SDRs; Region: HSD10-like_SDR_c; cd05371 717522003116 NAD binding site [chemical binding]; other site 717522003117 homodimer interface [polypeptide binding]; other site 717522003118 homotetramer interface [polypeptide binding]; other site 717522003119 active site 717522003120 MMPL family; Region: MMPL; pfam03176 717522003121 MMPL family; Region: MMPL; pfam03176 717522003122 Domain of unknown function (DUF222); Region: DUF222; pfam02720 717522003123 HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085 717522003124 active site 717522003125 Putative transposase of IS4/5 family (DUF4096); Region: DUF4096; pfam13340 717522003127 NAD-dependent deacetylase; Provisional; Region: PRK00481 717522003128 SIRT5_Af1_CobB: Eukaryotic, archaeal and prokaryotic group (class3) which includes human sirtuin SIRT5, Archaeoglobus fulgidus Sir2-Af1, and E. coli CobB; and are members of the SIR2 family of proteins, silent information regulator 2 (Sir2) enzymes which...; Region: SIRT5_Af1_CobB; cd01412 717522003129 NAD+ binding site [chemical binding]; other site 717522003130 substrate binding site [chemical binding]; other site 717522003131 Zn binding site [ion binding]; other site 717522003132 Predicted transcriptional regulators [Transcription]; Region: COG1725 717522003133 Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377 717522003134 DNA-binding site [nucleotide binding]; DNA binding site 717522003135 O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315 717522003136 Leucine carboxyl methyltransferase; Region: LCM; pfam04072 717522003137 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3797 717522003138 PPOX class probable F420-dependent enzyme; Region: Rv1155_F420; TIGR03618 717522003139 uncharacterized HhH-GPD family protein; Region: TIGR03252 717522003140 minor groove reading motif; other site 717522003141 helix-hairpin-helix signature motif; other site 717522003142 mannosyltransferase; Provisional; Region: pimE; PRK13375 717522003143 PCD_DCoH: The bifunctional protein pterin-4alpha-carbinolamine dehydratase (PCD), also known as DCoH (dimerization cofactor of hepatocyte nuclear factor-1), is both a transcription activator and a metabolic enzyme. DCoH stimulates gene expression by...; Region: PCD_DCoH; cd00488 717522003144 aromatic arch; other site 717522003145 DCoH dimer interaction site [polypeptide binding]; other site 717522003146 DCoH /HNF-1 dimer interaction site [polypeptide binding]; other site 717522003147 DCoH tetramer interaction site [polypeptide binding]; other site 717522003148 substrate binding site [chemical binding]; other site 717522003149 The MutT pyrophosphohydrolase is a prototypical Nudix hydrolase that catalyzes the hydrolysis of nucleoside and deoxynucleoside triphosphates (NTPs and dNTPs) by substitution at a beta-phosphorus to yield a nucleotide monophosphate (NMP) and inorganic...; Region: MutT_pyrophosphohydrolase; cd03425 717522003150 active site 717522003151 8-oxo-dGMP binding site [chemical binding]; other site 717522003152 nudix motif; other site 717522003153 metal binding site [ion binding]; metal-binding site 717522003154 Nitrate reductase alpha subunit [Energy production and conversion]; Region: NarG; COG5013 717522003155 Respiratory nitrate reductase A (NarGHI), alpha chain (NarG) and related proteins. Under anaerobic conditions in the presence of nitrate, E. coli synthesizes the cytoplasmic membrane-bound quinol-nitrate oxidoreductase (NarGHI), which reduces nitrate to...; Region: MopB_Nitrate-R-NarG-like; cd02750 717522003156 [4Fe-4S] binding site [ion binding]; other site 717522003157 Molybdopterin-Binding (MopB) domain of the MopB superfamily of proteins, a large, diverse, heterogeneous superfamily of enzymes that, in general, bind molybdopterin as a cofactor. The MopB domain is found in a wide variety of molybdenum- and...; Region: Molybdopterin-Binding; cl09928 717522003158 Molybdopterin-Binding (MopB) domain of the MopB superfamily of proteins, a large, diverse, heterogeneous superfamily of enzymes that, in general, bind molybdopterin as a cofactor. The MopB domain is found in a wide variety of molybdenum- and...; Region: Molybdopterin-Binding; cl09928 717522003159 Molybdopterin-Binding (MopB) domain of the MopB superfamily of proteins, a large, diverse, heterogeneous superfamily of enzymes that, in general, bind molybdopterin as a cofactor. The MopB domain is found in a wide variety of molybdenum- and...; Region: Molybdopterin-Binding; cl09928 717522003160 Respiratory nitrate reductase A (NarGHI), alpha chain (NarG) and related proteins. Under anaerobic conditions in the presence of nitrate, E. coli synthesizes the cytoplasmic membrane-bound quinol-nitrate oxidoreductase (NarGHI), which reduces nitrate to...; Region: MopB_CT_Nitrate-R-NarG-like; cd02776 717522003161 molybdopterin cofactor binding site; other site 717522003162 Nitrate reductase beta subunit [Energy production and conversion]; Region: NarY; COG1140 717522003163 nitrate reductase molybdenum cofactor assembly chaperone; Region: narJ; TIGR00684 717522003164 Nitrate reductase gamma subunit; Region: Nitrate_red_gam; pfam02665 717522003165 Predicted membrane GTPase involved in stress response [Signal transduction mechanisms]; Region: TypA; COG1217 717522003166 Tyrosine phosphorylated protein A (TypA)/BipA family belongs to ribosome-binding GTPases; Region: TypA_BipA; cd01891 717522003167 G1 box; other site 717522003168 putative GEF interaction site [polypeptide binding]; other site 717522003169 GTP/Mg2+ binding site [chemical binding]; other site 717522003170 Switch I region; other site 717522003171 G2 box; other site 717522003172 G3 box; other site 717522003173 Switch II region; other site 717522003174 G4 box; other site 717522003175 G5 box; other site 717522003176 BipA_TypA_II: domain II of BipA (also called TypA) having homology to domain II of the elongation factors (EFs) EF-G and EF-Tu. BipA is a highly conserved protein with global regulatory properties in Escherichia coli. BipA is phosphorylated on a...; Region: BipA_TypA_II; cd03691 717522003177 BipA_TypA_C: a C-terminal portion of BipA or TypA having homology to the C terminal domains of the elongation factors EF-G and EF-2. A member of the ribosome binding GTPase superfamily, BipA is widely distributed in bacteria and plants. BipA is a highly...; Region: BipA_TypA_C; cd03710 717522003178 ABC-type dipeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: DdpA; COG0747 717522003179 The substrate-binding domain of mycobacterial lipoprotein Lpqw contains type 2 periplasmic binding fold; Region: PBP2_Lpqw; cd08501 717522003180 The substrate-binding domain of an ABC-type nickel/oligopeptide-like import system contains the type 2 periplasmic binding fold; Region: PBP2_NikA_DppA_OppA_like; cl01709 717522003181 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522003182 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522003184 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522003185 PPE family; Region: PPE; pfam00823 717522003186 PE family; Region: PE; pfam00934 717522003187 N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D- glucopyranoside deacetylase; Region: mycothiol_MshB; TIGR03445 717522003188 PE family; Region: PE; pfam00934 717522003189 FO synthase; Reviewed; Region: fbiC; PRK09234 717522003190 Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335 717522003191 FeS/SAM binding site; other site 717522003192 Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335 717522003193 FeS/SAM binding site; other site 717522003194 NADH:flavin oxidoreductases, Old Yellow Enzyme family [Energy production and conversion]; Region: NemA; COG1902 717522003195 2,4-dienoyl-CoA reductase (DCR) FMN-binding domain. DCR in E. coli is an iron-sulfur flavoenzyme which contains FMN, FAD, and a 4Fe-4S cluster. It is also a monomer, unlike that of its eukaryotic counterparts which form homotetramers and lack the...; Region: DCR_FMN; cd02930 717522003196 active site 717522003197 FMN binding site [chemical binding]; other site 717522003198 2,4-decadienoyl-CoA binding site; other site 717522003199 catalytic residue [active] 717522003200 4Fe-4S cluster binding site [ion binding]; other site 717522003201 Uncharacterized NAD(FAD)-dependent dehydrogenases [General function prediction only]; Region: HcaD; COG0446 717522003202 Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070 717522003203 Predicted transcriptional regulators [Transcription]; Region: COG1695 717522003204 Transcriptional regulator PadR-like family; Region: PadR; pfam03551 717522003205 Virulence activator alpha C-term; Region: Vir_act_alpha_C; pfam10400 717522003206 4Fe-4S dicluster domain; Region: Fer4_9; pfam13187 717522003207 4Fe-4S binding domain; Region: Fer4; pfam00037 717522003208 N-succinyldiaminopimelate aminotransferase; Reviewed; Region: PRK07865 717522003209 Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609 717522003210 pyridoxal 5'-phosphate binding site [chemical binding]; other site 717522003211 homodimer interface [polypeptide binding]; other site 717522003212 catalytic residue [active] 717522003213 DNA or RNA helicases of superfamily II [Transcription / DNA replication, recombination, and repair]; Region: SSL2; COG1061 717522003214 Type III restriction enzyme, res subunit; Region: ResIII; pfam04851 717522003215 DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cl17251 717522003216 ATP binding site [chemical binding]; other site 717522003217 putative Mg++ binding site [ion binding]; other site 717522003218 Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cl17351 717522003219 ATP-binding site [chemical binding]; other site 717522003220 Polyketide synthase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3321 717522003221 polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833 717522003222 active site 717522003223 Acyl transferase domain in polyketide synthase (PKS) enzymes; Region: PKS_AT; smart00827 717522003224 Dehydratase domain in polyketide synthase (PKS) enzymes; Region: PKS_DH; smart00826 717522003225 Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931 717522003226 enoyl reductase of polyketide synthase; Region: enoyl_red; cd05195 717522003227 Enoylreductase; Region: PKS_ER; smart00829 717522003228 NAD(P) binding site [chemical binding]; other site 717522003229 KR domain; Region: KR; pfam08659 717522003230 beta-ketoacyl reductase (KR) domain of fatty acid synthase (FAS), subgroup 2, complex (x); Region: KR_2_FAS_SDR_x; cd08955 717522003231 putative NADP binding site [chemical binding]; other site 717522003232 active site 717522003233 Phosphopantetheine attachment site; Region: PKS_PP; smart00823 717522003234 Non-ribosomal peptide synthetase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: EntF; COG1020 717522003235 Predicted drug exporters of the RND superfamily [General function prediction only]; Region: COG2409 717522003236 PE-PPE domain; Region: PE-PPE; pfam08237 717522003237 acyl-CoA synthetase; Validated; Region: PRK05850 717522003238 Fatty acyl-AMP ligase (FAAL); Region: FAAL; cd05931 717522003239 acyl-activating enzyme (AAE) consensus motif; other site 717522003240 active site 717522003241 Regulator of polyketide synthase expression [Signal transduction mechanisms / Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG2508 717522003242 PucR C-terminal helix-turn-helix domain; Region: HTH_30; pfam13556 717522003243 Delta(1)-pyrroline-5-carboxylate dehydrogenase, ALDH families 4 and 17; Region: ALDH_F4-17_P5CDH; cd07123 717522003244 delta-1-pyrroline-5-carboxylate dehydrogenase, group 1; Region: D1pyr5carbox1; TIGR01236 717522003245 Glutamate binding site [chemical binding]; other site 717522003246 NAD binding site [chemical binding]; other site 717522003247 catalytic residues [active] 717522003248 Proline dehydrogenase; Region: Pro_dh; pfam01619 717522003249 RNA polymerase sigma factor SigI; Provisional; Region: sigI; PRK09635 717522003250 Sigma-70 region 2; Region: Sigma70_r2; pfam04542 717522003251 Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171 717522003252 DNA binding residues [nucleotide binding] 717522003253 Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697 717522003254 N-RD18 Region of Difference N-RD18, deleted region in Mycobacterium bovis BCG Pasteur and BCG Mexico compared to Mycobacterium tuberculosis H37Rv2 and Mycobacterium bovis AF2122/97, sigI (290 aa) and Rv1189/Mb1221 (304 aa) exist as two genes. Removes gene Rv1190 and merges truncated genes Rv1189 and Rv1191. 717522003255 Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697 717522003256 PGAP1-like protein; Region: PGAP1; pfam07819 717522003257 acyl-CoA synthetase; Validated; Region: PRK07787 717522003258 Adenylate forming domain, Class I; Region: AFD_class_I; cl17068 717522003259 acyl-activating enzyme (AAE) consensus motif; other site 717522003260 AMP binding site [chemical binding]; other site 717522003261 active site 717522003262 CoA binding site [chemical binding]; other site 717522003263 Regulator of polyketide synthase expression [Signal transduction mechanisms / Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG2508 717522003264 PucR C-terminal helix-turn-helix domain; Region: HTH_30; pfam13556 717522003265 PE family; Region: PE; pfam00934 717522003266 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522003267 PPE family; Region: PPE; pfam00823 717522003268 Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484 717522003269 WXG100 family type VII secretion target; Region: WXG100_ESAT6; TIGR03930 717522003270 Proteins of 100 residues with WXG; Region: WXG100; pfam06013 717522003271 Transposase, Mutator family; Region: Transposase_mut; pfam00872 717522003272 MULE transposase domain; Region: MULE; pfam10551 717522003273 metabolite-proton symporter; Region: 2A0106; TIGR00883 717522003274 The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174 717522003275 putative substrate translocation pore; other site 717522003276 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase; Region: DapD_actino; TIGR03535 717522003277 Putative 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate (THDP) N-succinyltransferase (THP succinyltransferase), C-terminal left-handed parallel alpha-helix (LbH) domain: This group is composed of mostly uncharacterized proteins containing an N-terminal...; Region: LbH_THP_succinylT_putative; cd04649 717522003278 putative trimer interface [polypeptide binding]; other site 717522003279 putative CoA binding site [chemical binding]; other site 717522003280 succinyl-diaminopimelate desuccinylase; Reviewed; Region: PRK13007 717522003281 M20 Peptidase actinobacterial DapE encoded N-succinyl-L,L-diaminopimelic acid desuccinylase; Region: M20_DapE_actinobac; cd05647 717522003282 metal binding site [ion binding]; metal-binding site 717522003283 putative dimer interface [polypeptide binding]; other site 717522003284 TIGR00730 family protein; Region: TIGR00730 717522003285 long-chain-acyl-CoA synthetase; Validated; Region: PRK08279 717522003286 Fatty acid transport proteins (FATP) play dual roles as fatty acid transporters and its activation enzymes; Region: FATP_FACS; cd05940 717522003287 acyl-activating enzyme (AAE) consensus motif; other site 717522003288 putative AMP binding site [chemical binding]; other site 717522003289 putative active site [active] 717522003290 putative CoA binding site [chemical binding]; other site 717522003291 DHPS subgroup of Pterin binding enzymes. DHPS (dihydropteroate synthase), a functional homodimer, catalyzes the condensation of p-aminobenzoic acid (pABA) in the de novo biosynthesis of folate, which is an essential cofactor in both nucleic acid and...; Region: DHPS; cd00739 717522003292 dihydropteroate synthase; Region: DHPS; TIGR01496 717522003293 substrate binding pocket [chemical binding]; other site 717522003294 dimer interface [polypeptide binding]; other site 717522003295 inhibitor binding site; inhibition site 717522003296 putative glucosyl-3-phosphoglycerate synthase; Provisional; Region: PRK13915 717522003297 Glycosyltransferases involved in cell wall biogenesis [Cell envelope biogenesis, outer membrane]; Region: WcaA; COG0463 717522003298 DivIVA domain; Region: DivI1A_domain; TIGR03544 717522003299 DNA-3-methyladenine glycosylase I; Region: tag; TIGR00624 717522003300 Protein of unknown function (DUF3117); Region: DUF3117; pfam11314 717522003301 glycogen synthase, Corynebacterium family; Region: glgA_Coryne; TIGR02149 717522003302 This family is most closely related to the GT1 family of glycosyltransferases and named after YqgM in Bacillus licheniformis about which little is known. Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to...; Region: GT1_YqgM_like; cd03801 717522003303 glucose-1-phosphate adenylyltransferase; Provisional; Region: glgC; PRK00844 717522003304 ADP-glucose pyrophosphorylase is involved in the biosynthesis of glycogen or starch; Region: ADP_Glucose_PP; cd02508 717522003305 ligand binding site; other site 717522003306 oligomer interface; other site 717522003307 Glucose-1-phosphate adenylyltransferase, C-terminal Left-handed parallel beta helix (LbH) domain: Glucose-1-phosphate adenylyltransferase is also known as ADP-glucose synthase or ADP-glucose pyrophosphorylase. It catalyzes the first committed and...; Region: LbH_G1P_AT_C; cd04651 717522003308 dimer interface [polypeptide binding]; other site 717522003309 N-terminal domain interface [polypeptide binding]; other site 717522003310 sulfate 1 binding site; other site 717522003311 PE family; Region: PE; pfam00934 717522003312 putative hydrolase, CocE/NonD family; Region: /NonD; TIGR00976 717522003313 Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326 717522003314 X-Pro dipeptidyl-peptidase C-terminal non-catalytic domain; Region: PepX_C; smart00939 717522003315 Putative protein-S-isoprenylcysteine methyltransferase [Posttranslational modification, protein turnover, chaperones]; Region: STE14; COG2020 717522003316 Putative exporter of polyketide antibiotics [Cell envelope biogenesis, outer membrane]; Region: TnrB3; COG3559 717522003317 ABC-type multidrug transport system, ATPase component [Defense mechanisms]; Region: CcmA; COG1131 717522003318 ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230 717522003319 Walker A/P-loop; other site 717522003320 ATP binding site [chemical binding]; other site 717522003321 Q-loop/lid; other site 717522003322 ABC transporter signature motif; other site 717522003323 Walker B; other site 717522003324 D-loop; other site 717522003325 H-loop/switch region; other site 717522003326 Domain of unknown function (DUF4162); Region: DUF4162; pfam13732 717522003327 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522003328 Predicted O-methyltransferase [General function prediction only]; Region: COG4122 717522003329 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522003330 S-adenosylmethionine binding site [chemical binding]; other site 717522003331 RNA polymerase sigma factor SigE; Reviewed; Region: PRK09647 717522003332 Sigma-70 region 2; Region: Sigma70_r2; pfam04542 717522003333 Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171 717522003334 DNA binding residues [nucleotide binding] 717522003335 Trypsin-like serine proteases, typically periplasmic, contain C-terminal PDZ domain [Posttranslational modification, protein turnover, chaperones]; Region: DegQ; COG0265 717522003336 Trypsin-like peptidase domain; Region: Trypsin_2; pfam13365 717522003337 PDZ domain of tryspin-like serine proteases, such as DegP/HtrA, which are oligomeric proteins involved in heat-shock response, chaperone function, and apoptosis. May be responsible for substrate recognition and/or binding, as most PDZ domains bind...; Region: PDZ_serine_protease; cd00987 717522003338 protein binding site [polypeptide binding]; other site 717522003339 sec-independent translocase; Provisional; Region: PRK03100 717522003340 Predicted sugar phosphatases of the HAD superfamily [Carbohydrate transport and metabolism]; Region: NagD; COG0647 717522003341 Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427 717522003342 active site 717522003343 motif I; other site 717522003344 motif II; other site 717522003345 Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427 717522003346 Predicted membrane protein [Function unknown]; Region: COG3428 717522003347 Bacterial PH domain; Region: DUF304; pfam03703 717522003348 Uncharacterized conserved protein [Function unknown]; Region: COG3402 717522003349 Domain of unknown function DUF59; Region: DUF59; cl00941 717522003350 ATPases involved in chromosome partitioning [Cell division and chromosome partitioning]; Region: Mrp; COG0489 717522003351 MRP (Multiple Resistance and pH adaptation) is a homologue of the Fer4_NifH superfamily. Like the other members of the superfamily, MRP contains a ATP-binding domain at the N-termini. It is found in bacteria as a membrane-spanning protein and functions...; Region: MRP-like; cd02037 717522003352 Membrane-bound lytic murein transglycosylase B [Cell envelope biogenesis, outer membrane]; Region: MltB; COG2951 717522003353 Lytic Transglycosylase (LT) and Goose Egg White Lysozyme (GEWL) domain. Members include the soluble and insoluble membrane-bound LTs in bacteria, the LTs in bacteriophage lambda, as well as, the eukaryotic "goose-type" lysozymes (GEWL). LTs...; Region: LT_GEWL; cd00254 717522003354 N-acetyl-D-glucosamine binding site [chemical binding]; other site 717522003355 catalytic residue [active] 717522003356 Predicted membrane protein [Function unknown]; Region: COG4420 717522003357 Mg/Co/Ni transporter MgtE (contains CBS domain) [Inorganic ion transport and metabolism]; Region: MgtE; COG2239 717522003358 MgtE intracellular N domain; Region: MgtE_N; smart00924 717522003359 This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domain in the magnesium transporter, MgtE. MgtE and its homologs are found in eubacteria, archaebacteria, and eukaryota. Members of this family transport Mg2+ or other...; Region: CBS_pair_Mg_transporter; cd04606 717522003360 Domain of unknown function (DUF4190); Region: DUF4190; pfam13828 717522003361 ABC-type sugar transport system, periplasmic component [Carbohydrate transport and metabolism]; Region: UgpB; COG1653 717522003362 Bacterial extracellular solute-binding protein; Region: SBP_bac_1; pfam01547 717522003363 Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261 717522003364 dimer interface [polypeptide binding]; other site 717522003365 conserved gate region; other site 717522003366 putative PBP binding loops; other site 717522003367 ABC-ATPase subunit interface; other site 717522003368 ABC-type sugar transport system, permease component [Carbohydrate transport and metabolism]; Region: UgpE; COG0395 717522003369 Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261 717522003370 dimer interface [polypeptide binding]; other site 717522003371 conserved gate region; other site 717522003372 ABC-ATPase subunit interface; other site 717522003373 glycerol-3-phosphate transporter ATP-binding subunit; Provisional; Region: ugpC; PRK11650 717522003374 The N-terminal ATPase domain of the maltose transporter, MalK; Region: ABC_MalK_N; cd03301 717522003375 Walker A/P-loop; other site 717522003376 ATP binding site [chemical binding]; other site 717522003377 Q-loop/lid; other site 717522003378 ABC transporter signature motif; other site 717522003379 Walker B; other site 717522003380 D-loop; other site 717522003381 H-loop/switch region; other site 717522003382 Mg2+ and Co2+ transporters [Inorganic ion transport and metabolism]; Region: CorA; COG0598 717522003383 Mycobacterium tuberculosis CorA-like subfamily; Region: MtCorA-like; cd12830 717522003384 oligomer interface [polypeptide binding]; other site 717522003385 metal binding site [ion binding]; metal-binding site 717522003386 metal binding site [ion binding]; metal-binding site 717522003387 putative Cl binding site [ion binding]; other site 717522003388 basic sphincter; other site 717522003389 hydrophobic gate; other site 717522003390 periplasmic entrance; other site 717522003391 malate dehydrogenase; Provisional; Region: PRK05442 717522003392 Chloroplast-like malate dehydrogenases; Region: MDH_choloroplast_like; cd01338 717522003393 NAD(P) binding site [chemical binding]; other site 717522003394 dimer interface [polypeptide binding]; other site 717522003395 malate binding site [chemical binding]; other site 717522003396 Mycobacterium tuberculosis PIN domain family; Region: Mtu_PIN_fam; TIGR00028 717522003397 PE family; Region: PE; pfam00934 717522003398 Substrate binding domain of ABC-type glycine betaine transport system; Region: OpuAC; pfam04069 717522003399 Short-chain alcohol dehydrogenase of unknown specificity [General function prediction only]; Region: COG4221 717522003400 Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931 717522003401 NAD(P) binding site [chemical binding]; other site 717522003402 active site 717522003403 Cytotoxic translational repressor of toxin-antitoxin stability system [Translation, ribosomal structure and biogenesis / Cell division and chromosome partitioning]; Region: RelE; COG2026 717522003404 Antitoxin of toxin-antitoxin stability system [Cell division and chromosome partitioning]; Region: StbD; COG2161 717522003405 alpha-ketoglutarate decarboxylase; Reviewed; Region: kgd; PRK12270 717522003406 2-oxoacid dehydrogenases acyltransferase (catalytic domain); Region: 2-oxoacid_dh; pfam00198 717522003407 Thiamine pyrophosphate (TPP) family, E1 of OGDC-like subfamily, TPP-binding module; composed of proteins similar to the E1 component of the 2-oxoglutarate dehydrogenase multienzyme complex (OGDC). OGDC catalyzes the oxidative decarboxylation of...; Region: TPP_E1_OGDC_like; cd02016 717522003408 TPP-binding site [chemical binding]; other site 717522003409 Transketolase, pyrimidine binding domain; Region: Transket_pyr; pfam02779 717522003410 dimer interface [polypeptide binding]; other site 717522003411 PYR/PP interface [polypeptide binding]; other site 717522003412 TPP binding site [chemical binding]; other site 717522003413 drug resistance transporter, EmrB/QacA subfamily; Region: efflux_EmrB; TIGR00711 717522003414 The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174 717522003415 putative substrate translocation pore; other site 717522003416 The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174 717522003417 Predicted nuclease (RecB family) [General function prediction only]; Region: COG2251 717522003418 RNase_H superfamily; Region: RNase_H_2; pfam13482 717522003419 Superfamily I DNA and RNA helicases and helicase subunits [DNA replication, recombination, and repair]; Region: COG1112 717522003420 Part of AAA domain; Region: AAA_19; pfam13245 717522003421 AAA domain; Region: AAA_12; pfam13087 717522003422 LppP/LprE lipoprotein; Region: Lipoprotein_21; pfam14041 717522003423 Superfamily II DNA and RNA helicases [DNA replication, recombination, and repair / Transcription / Translation, ribosomal structure and biogenesis]; Region: SrmB; COG0513 717522003424 DEAD-box helicases. A diverse family of proteins involved in ATP-dependent RNA unwinding, needed in a variety of cellular processes including splicing, ribosome biogenesis and RNA degradation. The name derives from the sequence of the Walker B motif; Region: DEADc; cd00268 717522003425 ATP binding site [chemical binding]; other site 717522003426 Mg++ binding site [ion binding]; other site 717522003427 motif III; other site 717522003428 Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079 717522003429 nucleotide binding region [chemical binding]; other site 717522003430 ATP-binding site [chemical binding]; other site 717522003431 RNA recognition motif in Escherichia coli cold-shock DEAD box protein A (CsdA) and similar proteins; Region: RRM_EcCsdA_like; cd12499 717522003432 putative RNA binding site [nucleotide binding]; other site 717522003433 Acyltransferase family; Region: Acyl_transf_3; pfam01757 717522003434 RD13 Region of difference RD13, deleted region in Mycobacterium bovis BCG Pasteur, BCG Tokyo, BCG Mexico and Mycobacterium bovis AF2122/97 compared to Mycobacterium tuberculosis H37Rv. Removes gene Rv1256c and merges truncated genes Rv1257c and Rv1255c 717522003435 The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174 717522003436 H+ Antiporter protein; Region: 2A0121; TIGR00900 717522003437 putative substrate translocation pore; other site 717522003438 Family-5 Uracil-DNA glycosylases (UDG), found in thermophilic organisms; Region: UDG_F5_TTUDGB_like; cd10031 717522003439 Fe-S cluster binding site [ion binding]; other site 717522003440 DNA binding site [nucleotide binding] 717522003441 active site 717522003442 hypothetical protein; Provisional; Region: PRK07236 717522003443 ubiquinone biosynthesis hydroxylase family protein; Provisional; Region: PRK07608; cl17314 717522003444 Domain of unknown function (DUF385); Region: DUF385; pfam04075 717522003445 HINT (histidine triad nucleotide-binding protein) subgroup: Members of this CD belong to the superfamily of histidine triad hydrolases that act on alpha-phosphate of ribonucleotides. This subgroup includes members from all three forms of cellular life; Region: HINT_subgroup; cd01277 717522003446 HIT family signature motif; other site 717522003447 catalytic residue [active] 717522003448 amidase; Provisional; Region: PRK12470 717522003449 Amidase; Region: Amidase; pfam01425 717522003450 Adenylate cyclase, family 3 (some proteins contain HAMP domain) [Signal transduction mechanisms]; Region: CyaA; COG2114 717522003451 cyclase homology domain; Region: CHD; cd07302 717522003452 nucleotidyl binding site; other site 717522003453 metal binding site [ion binding]; metal-binding site 717522003454 dimer interface [polypeptide binding]; other site 717522003455 Serine/Threonine protein kinases, catalytic domain; Region: S_TKc; smart00220 717522003456 Catalytic domain of Protein Kinases; Region: PKc; cd00180 717522003457 active site 717522003458 ATP binding site [chemical binding]; other site 717522003459 substrate binding site [chemical binding]; other site 717522003460 activation loop (A-loop); other site 717522003461 PknH-like extracellular domain; Region: PknH_C; pfam14032 717522003462 DNA-binding transcriptional activator of the SARP family [Signal transduction mechanisms]; Region: DnrI; COG3629 717522003463 Transcriptional regulatory protein, C terminal; Region: Trans_reg_C; pfam00486 717522003464 DNA binding site [nucleotide binding] 717522003465 Forkhead associated domain (FHA); found in eukaryotic and prokaryotic proteins. Putative nuclear signalling domain. FHA domains may bind phosphothreonine, phosphoserine and sometimes phosphotyrosine. In eukaryotes, many FHA domain-containing proteins...; Region: FHA; cd00060 717522003466 FOG: FHA domain [Signal transduction mechanisms]; Region: COG1716 717522003467 phosphopeptide binding site; other site 717522003468 Peptidase family C39 mostly contains bacteriocin-processing endopeptidases from bacteria. The cysteine peptidases in family C39 cleave the "double-glycine" leader peptides from the precursors of various bacteriocins (mostly non-lantibiotic); Region: Peptidase_C39_like; cl00296 717522003469 putative active site [active] 717522003470 Domain of unknown function (DUF4189); Region: DUF4189; pfam13827 717522003471 Protein of unknown function (DUF1396); Region: DUF1396; pfam07161 717522003472 Protein of unknown function (DUF732); Region: DUF732; pfam05305 717522003473 ABC transporter transmembrane region; Region: ABC_membrane; pfam00664 717522003474 ATP-binding cassette domain of glucan transporter and related proteins, subfamily C; Region: ABCC_Glucan_exporter_like; cd03254 717522003475 ABC-type cobalt transport system, ATPase component [Inorganic ion transport and metabolism]; Region: CbiO; COG1122 717522003476 Walker A/P-loop; other site 717522003477 ATP binding site [chemical binding]; other site 717522003478 Q-loop/lid; other site 717522003479 ABC transporter signature motif; other site 717522003480 Walker B; other site 717522003481 D-loop; other site 717522003482 H-loop/switch region; other site 717522003483 ABC-type multidrug transport system, ATPase and permease components [Defense mechanisms]; Region: MdlB; COG1132 717522003484 ABC transporter transmembrane region; Region: ABC_membrane; pfam00664 717522003485 ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201 717522003486 Walker A/P-loop; other site 717522003487 ATP binding site [chemical binding]; other site 717522003488 Q-loop/lid; other site 717522003489 ABC transporter signature motif; other site 717522003490 Walker B; other site 717522003491 D-loop; other site 717522003492 H-loop/switch region; other site 717522003493 Protein of unknown function (DUF3558); Region: DUF3558; pfam12079 717522003494 Protein of unknown function (DUF3558); Region: DUF3558; pfam12079 717522003495 Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067 717522003496 catalytic core [active] 717522003497 DNA repair exonuclease [DNA replication, recombination, and repair]; Region: SbcD; COG0420 717522003498 Mre11 nuclease, N-terminal metallophosphatase domain; Region: MPP_Mre11_N; cd00840 717522003499 active site 717522003500 metal binding site [ion binding]; metal-binding site 717522003501 DNA binding site [nucleotide binding] 717522003502 ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201 717522003503 Walker A/P-loop; other site 717522003504 ATP binding site [chemical binding]; other site 717522003505 choline dehydrogenase; Validated; Region: PRK02106 717522003506 NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500 717522003507 GMC oxidoreductase; Region: GMC_oxred_C; pfam05199 717522003508 ABC-type dipeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: DdpA; COG0747 717522003509 The substrate-binding domain of mycobacterial lipoprotein Lpqw contains type 2 periplasmic binding fold; Region: PBP2_Lpqw; cd08501 717522003510 glutathione transporter ATP-binding protein; Provisional; Region: PRK10261 717522003511 ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257 717522003512 Walker A/P-loop; other site 717522003513 ATP binding site [chemical binding]; other site 717522003514 Q-loop/lid; other site 717522003515 ABC transporter signature motif; other site 717522003516 Walker B; other site 717522003517 D-loop; other site 717522003518 H-loop/switch region; other site 717522003519 Oligopeptide/dipeptide transporter, C-terminal region; Region: oligo_HPY; cl07097 717522003520 ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257 717522003521 Walker A/P-loop; other site 717522003522 ATP binding site [chemical binding]; other site 717522003523 Q-loop/lid; other site 717522003524 ABC transporter signature motif; other site 717522003525 Walker B; other site 717522003526 D-loop; other site 717522003527 H-loop/switch region; other site 717522003528 Oligopeptide/dipeptide transporter, C-terminal region; Region: oligo_HPY; pfam08352 717522003529 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppC; COG1173 717522003530 Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261 717522003531 dimer interface [polypeptide binding]; other site 717522003532 conserved gate region; other site 717522003533 putative PBP binding loops; other site 717522003534 ABC-ATPase subunit interface; other site 717522003535 oligopeptide transporter permease; Reviewed; Region: oppB; PRK09471 717522003536 Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261 717522003537 dimer interface [polypeptide binding]; other site 717522003538 conserved gate region; other site 717522003539 putative PBP binding loops; other site 717522003540 ABC-ATPase subunit interface; other site 717522003541 Carbonic anhydrases (CA) are zinc-containing enzymes that catalyze the reversible hydration of carbon dioxide in a two-step mechanism in which the nucleophilic attack of a zinc-bound hydroxide ion on carbon dioxide is followed by the regeneration of an...; Region: beta_CA_cladeD; cd03379 717522003542 active site clefts [active] 717522003543 zinc binding site [ion binding]; other site 717522003544 dimer interface [polypeptide binding]; other site 717522003545 sulfate adenylyltransferase, small subunit; Region: CysD; TIGR02039 717522003546 This domain is found in phosphoadenosine phosphosulphate (PAPS) reductase enzymes or PAPS sulphotransferase. PAPS reductase is part of the adenine nucleotide alpha hydrolases superfamily also including N type ATP PPases and ATP sulphurylases. A highly...; Region: PAPS_reductase; cd01713 717522003547 Active Sites [active] 717522003548 bifunctional sulfate adenylyltransferase subunit 1/adenylylsulfate kinase protein; Provisional; Region: PRK05506 717522003549 CysN, together with protein CysD, forms the ATP sulfurylase (ATPS) complex; Region: CysN_ATPS; cd04166 717522003550 CysD dimerization site [polypeptide binding]; other site 717522003551 G1 box; other site 717522003552 putative GEF interaction site [polypeptide binding]; other site 717522003553 GTP/Mg2+ binding site [chemical binding]; other site 717522003554 Switch I region; other site 717522003555 G2 box; other site 717522003556 G3 box; other site 717522003557 Switch II region; other site 717522003558 G4 box; other site 717522003559 G5 box; other site 717522003560 CysN_NodQ_II: This subfamily represents the domain II of the large subunit of ATP sulfurylase (ATPS): CysN or the N-terminal portion of NodQ, found mainly in proteobacteria and homologous to the domain II of EF-Tu. Escherichia coli ATPS consists of CysN...; Region: CysN_NodQ_II; cd03695 717522003561 TCysN_NoDQ_II: This subfamily represents the domain II of the large subunit of ATP sulfurylase (ATPS): CysN or the N-terminal portion of NodQ, found mainly in proteobacteria and homologous to the domain II of EF-Tu. Escherichia coli ATPS consists of CysN...; Region: CysN_NoDQ_III; cd04095 717522003562 ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201 717522003563 Adenosine 5'-phosphosulfate kinase (APSK) catalyzes the phosphorylation of adenosine 5'-phosphosulfate to form 3'-phosphoadenosine 5'-phosphosulfate (PAPS). The end-product PAPS is a biologically "activated" sulfate form...; Region: APSK; cd02027 717522003564 Walker A/P-loop; other site 717522003565 ligand-binding site [chemical binding]; other site 717522003566 ATP binding site [chemical binding]; other site 717522003567 Rrf2 family protein; Region: rrf2_super; TIGR00738 717522003568 Transcriptional regulator; Region: Rrf2; pfam02082 717522003569 Lysine Motif is a small domain involved in binding peptidoglycan; Region: LysM; cd00118 717522003570 Lysine Motif is a small domain involved in binding peptidoglycan; Region: LysM; cd00118 717522003571 Putative esterase; Region: Esterase; pfam00756 717522003572 Predicted hydrolase of the alpha/beta superfamily [General function prediction only]; Region: COG2819 717522003573 Predicted membrane protein [Function unknown]; Region: COG4325 717522003574 Predicted membrane protein (DUF2254); Region: DUF2254; pfam10011 717522003575 Protein of unknown function (DUF732); Region: DUF732; pfam05305 717522003576 arginyl-tRNA synthetase; Reviewed; Region: argS; PRK01611 717522003577 Arginyl tRNA synthetase N terminal dom; Region: Arg_tRNA_synt_N; smart01016 717522003578 catalytic core domain of arginyl-tRNA synthetases; Region: ArgRS_core; cd00671 717522003579 active site 717522003580 HIGH motif; other site 717522003581 KMSK motif region; other site 717522003582 Anticodon-binding domain of arginyl tRNA synthetases; Region: Anticodon_Ia_Arg; cd07956 717522003583 tRNA binding surface [nucleotide binding]; other site 717522003584 anticodon binding site; other site 717522003585 diaminopimelate decarboxylase; Region: lysA; TIGR01048 717522003586 Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzyme Diaminopimelate Decarboxylase; Region: PLPDE_III_DapDC; cd06828 717522003587 active site 717522003588 pyridoxal 5'-phosphate (PLP) binding site [chemical binding]; other site 717522003589 substrate binding site [chemical binding]; other site 717522003590 catalytic residues [active] 717522003591 dimer interface [polypeptide binding]; other site 717522003592 homoserine dehydrogenase; Provisional; Region: PRK06349 717522003593 Homoserine dehydrogenase, NAD binding domain; Region: NAD_binding_3; pfam03447 717522003594 Homoserine dehydrogenase; Region: Homoserine_dh; pfam00742 717522003595 ACT_HSDH_Hom CD includes the C-terminal ACT domain of the NAD(P)H-dependent, homoserine dehydrogenase (HSDH) and related domains; Region: ACT_HSDH-Hom; cd04881 717522003596 threonine synthase; Reviewed; Region: PRK06721 717522003597 Threonine synthase is a pyridoxal phosphate (PLP) dependent enzyme that catalyses the last reaction in the synthesis of threonine from aspartate. It proceeds by converting O-phospho-L-homoserine (OPH) into threonine and inorganic phosphate. In plants; Region: Thr-synth_1; cd01563 717522003598 homodimer interface [polypeptide binding]; other site 717522003599 pyridoxal 5'-phosphate binding site [chemical binding]; other site 717522003600 catalytic residue [active] 717522003601 Homoserine kinase [Amino acid transport and metabolism]; Region: ThrB; COG0083 717522003602 transcription termination factor Rho; Provisional; Region: PRK12678 717522003603 Rho termination factor, N-terminal domain; Region: Rho_N; smart00959 717522003604 S1_like: Ribosomal protein S1-like RNA-binding domain. Found in a wide variety of RNA-associated proteins. Originally identified in S1 ribosomal protein. This superfamily also contains the Cold Shock Domain (CSD), which is a homolog of the S1 domain; Region: S1_like; cl09927 717522003605 RNA binding site [nucleotide binding]; other site 717522003606 Transcription termination factor rho is a bacterial ATP-dependent RNA/DNA helicase. It is a homohexamer. Each monomer consists of an N-terminal domain of the OB fold, which is responsible for binding to cysteine rich nucleotides. This alignment is of the...; Region: rho_factor; cd01128 717522003607 multimer interface [polypeptide binding]; other site 717522003608 Walker A motif; other site 717522003609 ATP binding site [chemical binding]; other site 717522003610 Walker B motif; other site 717522003611 50S ribosomal protein L31; Reviewed; Region: rpmE; PRK00019 717522003612 peptide chain release factor 1; Region: prfA; TIGR00019 717522003613 This domain is found in peptide chain release factors; Region: PCRF; smart00937 717522003614 RF-1 domain; Region: RF-1; pfam00472 717522003615 N5-glutamine S-adenosyl-L-methionine-dependent methyltransferase; Provisional; Region: PRK09328 717522003616 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522003617 S-adenosylmethionine binding site [chemical binding]; other site 717522003618 Putative translation factor (SUA5) [Translation, ribosomal structure and biogenesis]; Region: SUA5; COG0009 717522003619 UDP-N-acetylmuramyl pentapeptide phosphotransferase/UDP-N- acetylglucosamine-1-phosphate transferase [Cell envelope biogenesis, outer membrane]; Region: Rfe; COG0472 717522003620 This subfamily contains Escherichia coli WecA, Bacillus subtilis TagO and related proteins. WecA is an UDP-N-acetylglucosamine (GlcNAc):undecaprenyl-phosphate (Und-P) GlcNAc-1-phosphate transferase that catalyzes the formation of a phosphodiester bond...; Region: GT_WecA_like; cd06853 717522003621 Mg++ binding site [ion binding]; other site 717522003622 putative catalytic motif [active] 717522003623 substrate binding site [chemical binding]; other site 717522003624 F0F1-type ATP synthase, subunit a [Energy production and conversion]; Region: AtpB; COG0356 717522003625 F0F1 ATP synthase subunit A; Validated; Region: PRK05815 717522003626 F0F1 ATP synthase subunit C; Validated; Region: PRK05880 717522003627 F0F1 ATP synthase subunit B; Validated; Region: PRK05759 717522003628 F0F1-type ATP synthase, subunit b [Energy production and conversion]; Region: AtpF; COG0711 717522003629 F0F1 ATP synthase subunit delta; Provisional; Region: PRK13428 717522003630 F0F1 ATP synthase subunit B; Validated; Region: PRK05759 717522003631 F0F1 ATP synthase subunit delta; Provisional; Region: PRK13430 717522003632 F0F1 ATP synthase subunit alpha; Validated; Region: PRK09281 717522003633 ATP synthase alpha/beta family, beta-barrel domain; Region: ATP-synt_ab_N; pfam02874 717522003634 RecA-like NTPases. This family includes the NTP binding domain of F1 and V1 H+ATPases, DnaB and related helicases as well as bacterial RecA and related eukaryotic and archaeal recombinases. This group also includes bacterial conjugation proteins and...; Region: RecA-like_NTPases; cl17233 717522003635 Walker A motif; other site 717522003636 ATP binding site [chemical binding]; other site 717522003637 Walker B motif; other site 717522003638 ATP synthase alpha/beta chain, C terminal domain; Region: ATP-synt_ab_C; pfam00306 717522003639 mitochondrial ATP synthase gamma subunit; Region: F1-ATPase_gamma; cd12151 717522003640 core domain interface [polypeptide binding]; other site 717522003641 delta subunit interface [polypeptide binding]; other site 717522003642 epsilon subunit interface [polypeptide binding]; other site 717522003643 F0F1 ATP synthase subunit beta; Validated; Region: PRK09280 717522003644 ATP synthase alpha/beta family, beta-barrel domain; Region: ATP-synt_ab_N; pfam02874 717522003645 F1 ATP synthase beta subunit, nucleotide-binding domain. The F-ATPase is found in bacterial plasma membranes, mitochondrial inner membranes and in chloroplast thylakoid membranes. It has also been found in the archaea Methanosarcina barkeri. It uses a...; Region: F1-ATPase_beta; cd01133 717522003646 alpha subunit interaction interface [polypeptide binding]; other site 717522003647 Walker A motif; other site 717522003648 ATP binding site [chemical binding]; other site 717522003649 Walker B motif; other site 717522003650 inhibitor binding site; inhibition site 717522003651 ATP synthase alpha/beta chain, C terminal domain; Region: ATP-synt_ab_C; pfam00306 717522003652 F0F1 ATP synthase subunit epsilon; Validated; Region: atpC; PRK00571 717522003653 mitochondrial ATP synthase delta subunit; Region: F1-ATPase_delta; cd12152 717522003654 gamma subunit interface [polypeptide binding]; other site 717522003655 epsilon subunit interface [polypeptide binding]; other site 717522003656 LBP interface [polypeptide binding]; other site 717522003657 Protein of unknown function (DUF2550); Region: DUF2550; pfam10739 717522003658 Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3464 717522003659 Transposase; Region: DDE_Tnp_ISL3; pfam01610 717522003660 Helix-turn-helix domain of transposase family ISL3; Region: HTH_Tnp_ISL3; pfam13542 717522003661 Transposase; Region: DDE_Tnp_ISL3; pfam01610 717522003662 cob(I)alamin adenosyltransferase [Coenzyme transport and metabolism]; Region: COG2096 717522003663 UDP-N-acetylglucosamine 1-carboxyvinyltransferase; Region: murA; TIGR01072 717522003664 UDP-N-acetylglucosamine enolpyruvyl transferase catalyzes enolpyruvyl transfer as part of the first step in the biosynthesis of peptidoglycan, a component of the bacterial cell wall. The reaction is phosphoenolpyruvate + UDP-N-acetyl-D-glucosamine =...; Region: UdpNAET; cd01555 717522003665 hinge; other site 717522003666 active site 717522003667 methylated-DNA--protein-cysteine methyltransferase; Provisional; Region: PRK00901 717522003668 6-O-methylguanine DNA methyltransferase, ribonuclease-like domain; Region: Methyltransf_1N; pfam02870 717522003669 The DNA repair protein O6-alkylguanine-DNA alkyltransferase (ATase; also known as AGT, AGAT and MGMT) reverses O6-alkylation DNA damage by transferring O6-alkyl adducts to an active site cysteine irreversibly, without inducing DNA strand breaks. ATases...; Region: ATase; cd06445 717522003670 DNA binding site [nucleotide binding] 717522003671 active site 717522003672 Adenosine deaminase [Nucleotide transport and metabolism]; Region: Ada; COG2169 717522003673 Metal binding domain of Ada; Region: Ada_Zn_binding; pfam02805 717522003674 AlkA N-terminal domain; Region: AlkA_N; pfam06029 717522003675 3-methyladenine DNA glycosylase/8-oxoguanine DNA glycosylase [DNA replication, recombination, and repair]; Region: AlkA; COG0122 717522003676 endonuclease III; includes endonuclease III (DNA-(apurinic or apyrimidinic site) lyase), alkylbase DNA glycosidases (Alka-family) and other DNA glycosidases; Region: ENDO3c; cd00056 717522003677 minor groove reading motif; other site 717522003678 helix-hairpin-helix signature motif; other site 717522003679 substrate binding pocket [chemical binding]; other site 717522003680 active site 717522003681 HAMP domain; Region: HAMP; pfam00672 717522003682 Adenylate cyclase, family 3 (some proteins contain HAMP domain) [Signal transduction mechanisms]; Region: CyaA; COG2114 717522003683 cyclase homology domain; Region: CHD; cd07302 717522003684 nucleotidyl binding site; other site 717522003685 metal binding site [ion binding]; metal-binding site 717522003686 dimer interface [polypeptide binding]; other site 717522003687 Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225 717522003688 dimerization interface [polypeptide binding]; other site 717522003689 Adenylate cyclase, family 3 (some proteins contain HAMP domain) [Signal transduction mechanisms]; Region: CyaA; COG2114 717522003690 cyclase homology domain; Region: CHD; cd07302 717522003691 nucleotidyl binding site; other site 717522003692 metal binding site [ion binding]; metal-binding site 717522003693 dimer interface [polypeptide binding]; other site 717522003694 Methyl-accepting chemotaxis protein [Cell motility and secretion / Signal transduction mechanisms]; Region: Tar; COG0840 717522003695 Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225 717522003696 dimerization interface [polypeptide binding]; other site 717522003697 Adenylate cyclase, family 3 (some proteins contain HAMP domain) [Signal transduction mechanisms]; Region: CyaA; COG2114 717522003698 cyclase homology domain; Region: CHD; cd07302 717522003699 nucleotidyl binding site; other site 717522003700 metal binding site [ion binding]; metal-binding site 717522003701 dimer interface [polypeptide binding]; other site 717522003702 Predicted nuclease of the RecB family [DNA replication, recombination, and repair]; Region: COG1637 717522003703 hypothetical protein; Provisional; Region: PRK03298 717522003704 Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903 717522003705 Methylmalonyl-CoA epimerase (MMCE); Region: MMCE; cd07249 717522003706 dimer interface [polypeptide binding]; other site 717522003707 substrate binding site [chemical binding]; other site 717522003708 metal binding site [ion binding]; metal-binding site 717522003709 putative acyltransferase; Provisional; Region: PRK05790 717522003710 Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751 717522003711 dimer interface [polypeptide binding]; other site 717522003712 active site 717522003713 Thioredoxin domain-containing protein [Posttranslational modification, protein turnover, chaperones]; Region: COG3118 717522003714 ybbN protein family; ybbN is a hypothetical protein containing a redox-inactive TRX-like domain. Its gene has been sequenced from several gammaproteobacteria and actinobacteria; Region: ybbN; cd02956 717522003715 PE family; Region: PE; pfam00934 717522003716 glycogen branching enzyme; Provisional; Region: PRK05402 717522003717 N-terminal Early set domain associated with the catalytic domain of prokaryotic glycogen branching enzyme; Region: E_set_GBE_prok_N; cd02855 717522003718 Alpha amylase catalytic domain found in the Glycogen branching enzyme (also called 1,4-alpha-glucan branching enzyme); Region: AmyAc_Glg_BE; cd11322 717522003719 active site 717522003720 catalytic site [active] 717522003721 Alpha amylase, C-terminal all-beta domain; Region: Alpha-amylase_C; pfam02806 717522003722 Domain of unknown function (DUF3416); Region: DUF3416; pfam11896 717522003723 Alpha amylase catalytic domain found in GlgE-like proteins; Region: AmyAc_GlgE_like; cd11344 717522003724 Glycosidases [Carbohydrate transport and metabolism]; Region: AmyA; COG0366 717522003725 active site 717522003726 homodimer interface [polypeptide binding]; other site 717522003727 catalytic site [active] 717522003728 acceptor binding site [chemical binding]; other site 717522003729 This family is most closely related to the oligosaccharide phosphorylase domain family and other unidentified sequences. Oligosaccharide phosphorylase catalyzes the breakdown of oligosaccharides into glucose-1-phosphate units. They are important...; Region: GT1_Glycogen_Phosphorylase_like; cd04299 717522003730 putative homodimer interface [polypeptide binding]; other site 717522003731 putative active site pocket [active] 717522003732 alpha-glucan phosphorylases; Region: more_P_ylases; TIGR02094 717522003733 Rad3-related DNA helicases [Transcription / DNA replication, recombination, and repair]; Region: DinG; COG1199 717522003734 DEAD/DEAH box helicase; Region: DEAD; pfam00270 717522003735 DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cl17251 717522003736 Helicase C-terminal domain; Region: Helicase_C_2; pfam13307 717522003737 nicotinate phosphoribosyltransferase; Validated; Region: PRK09243 717522003738 Nicotinate phosphoribosyltransferase (NAPRTase), subgroup A. Nicotinate phosphoribosyltransferase catalyses the formation of NAMN and PPi from 5-phosphoribosy -1-pyrophosphate (PRPP) and nicotinic acid, this is the first, and also rate limiting, reaction...; Region: NAPRTase_A; cd01570 717522003739 active site 717522003740 ATP-dependent Clp protease adaptor protein ClpS; Reviewed; Region: clpS; PRK00033 717522003741 Domain of unknown function (DUF2017); Region: DUF2017; pfam09438 717522003742 nylC-like family; composed of proteins with similarity to Flavobacterium endo-type 6-aminohexanoate-oligomer hydrolase (EIII), the product of the nylon oligomer degradation gene, nylC. EIII is an amide hydrolase that catalyzes the degradation of...; Region: nylC_like; cd02252 717522003743 nylC-like family; composed of proteins with similarity to Flavobacterium endo-type 6-aminohexanoate-oligomer hydrolase (EIII), the product of the nylon oligomer degradation gene, nylC. EIII is an amide hydrolase that catalyzes the degradation of...; Region: nylC_like; cd02252 717522003744 putative active site pocket [active] 717522003745 cleavage site 717522003746 Mpr1p, Pad1p N-terminal (MPN) domains with catalytic isopeptidase activity (metal-binding); Region: MPN_like; cd08070 717522003747 MPN+ (JAMM) motif; other site 717522003748 Zinc-binding site [ion binding]; other site 717522003749 Ubiquitin domain of MoaD-like proteins; Region: MoaD; cd00754 717522003750 MoaE interaction surface [polypeptide binding]; other site 717522003751 MoeB interaction surface [polypeptide binding]; other site 717522003752 thiocarboxylated glycine; other site 717522003753 Cysteine synthase [Amino acid transport and metabolism]; Region: CysK; COG0031 717522003754 CBS_like: This subgroup includes Cystathionine beta-synthase (CBS) and Cysteine synthase. CBS is a unique heme-containing enzyme that catalyzes a pyridoxal 5'-phosphate (PLP)-dependent condensation of serine and homocysteine to give cystathionine; Region: CBS_like; cd01561 717522003755 dimer interface [polypeptide binding]; other site 717522003756 pyridoxal 5'-phosphate binding site [chemical binding]; other site 717522003757 catalytic residue [active] 717522003758 Rhomboid family; Region: Rhomboid; pfam01694 717522003759 glutamate racemase; Provisional; Region: PRK00865 717522003760 Metal-dependent hydrolases of the beta-lactamase superfamily III [General function prediction only]; Region: ElaC; COG1234 717522003761 ribonuclease PH; Reviewed; Region: rph; PRK00173 717522003762 Ribonuclease PH; Region: RNase_PH_bact; cd11362 717522003763 hexamer interface [polypeptide binding]; other site 717522003764 active site 717522003765 NTPase/HAM1. This family consists of the HAM1 protein and pyrophosphate-releasing xanthosine/ inosine triphosphatase. HAM1 protects the cell against mutagenesis by the base analog 6-N-hydroxylaminopurine (HAP) in E. Coli and S. cerevisiae. A...; Region: HAM1; cd00515 717522003766 active site 717522003767 dimerization interface [polypeptide binding]; other site 717522003768 Domain of unknown function (DUF3817); Region: DUF3817; pfam12823 717522003769 Glucitol operon activator [Transcription]; Region: GutM; COG4578 717522003770 acyl carrier protein; Validated; Region: PRK05883 717522003771 long-chain-fatty-acid--[acyl-carrier-protein] ligase; Validated; Region: PRK05851 717522003772 Fatty acyl-AMP ligase (FAAL); Region: FAAL; cd05931 717522003773 acyl-activating enzyme (AAE) consensus motif; other site 717522003774 active site 717522003775 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522003776 Acyl-CoA dehydrogenase; Region: ACAD; cl09933 717522003777 active site 717522003778 Acetyltransferase (GNAT) domain; Region: Acetyltransf_8; pfam13523 717522003779 Siderophore biosynthesis protein domain; Region: AlcB; smart01006 717522003780 Siderophore-interacting protein [Inorganic ion transport and metabolism]; Region: ViuB; COG2375 717522003781 Siderophore interacting proteins share the domain structure of the ferredoxin reductase like family. Siderophores are produced in various bacteria (and some plants) to extract iron from hosts. Binding constants are high, so iron can be pilfered from...; Region: siderophore_interacting; cd06193 717522003782 FAD binding pocket [chemical binding]; other site 717522003783 FAD binding motif [chemical binding]; other site 717522003784 phosphate binding motif [ion binding]; other site 717522003785 NAD binding pocket [chemical binding]; other site 717522003786 ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201 717522003787 Predicted ATPase involved in cell division [Cell division and chromosome partitioning]; Region: FtsE; COG2884 717522003788 Walker A/P-loop; other site 717522003789 ATP binding site [chemical binding]; other site 717522003790 Q-loop/lid; other site 717522003791 ABC transporter signature motif; other site 717522003792 Walker B; other site 717522003793 D-loop; other site 717522003794 H-loop/switch region; other site 717522003795 ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201 717522003796 ABC-type antimicrobial peptide transport system, ATPase component [Defense mechanisms]; Region: SalX; COG1136 717522003797 Walker A/P-loop; other site 717522003798 ATP binding site [chemical binding]; other site 717522003799 Q-loop/lid; other site 717522003800 ABC transporter signature motif; other site 717522003801 Walker B; other site 717522003802 D-loop; other site 717522003803 H-loop/switch region; other site 717522003804 3-ketoacyl-(acyl-carrier-protein) reductase; Validated; Region: fabG; PRK05653 717522003805 Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931 717522003806 NAD(P) binding site [chemical binding]; other site 717522003807 active site 717522003808 tetracycline repressor protein TetR; Provisional; Region: PRK13756 717522003809 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522003810 Tetracyclin repressor, C-terminal all-alpha domain; Region: TetR_C; pfam02909 717522003811 FOG: GAF domain [Signal transduction mechanisms]; Region: FhlA; COG2203 717522003812 GAF domain; Region: GAF; pfam01590 717522003813 c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal transduction mechanisms]; Region: COG2199 717522003814 Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949 717522003815 metal binding site [ion binding]; metal-binding site 717522003816 active site 717522003817 I-site; other site 717522003818 EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2). The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948 717522003819 hypothetical protein; Provisional; Region: PRK07877 717522003820 Superfamily of activating enzymes (E1) of the ubiquitin-like proteins. This family includes classical ubiquitin-activating enzymes E1, ubiquitin-like (ubl) activating enzymes and other mechanistic homologes, like MoeB, Thif1 and others. The common...; Region: E1_enzyme_family; cd01483 717522003821 ATP binding site [chemical binding]; other site 717522003822 substrate interface [chemical binding]; other site 717522003823 Proteins of this family catalyze the reduction of flavin or nitrocompounds using NAD(P)H as electron donor in a obligatory two-electron transfer, utilizing FMN or FAD as cofactor. They are often found to be homodimers. Enzymes of this family are...; Region: Nitro_FMN_reductase; cl00514 717522003824 EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2). The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948 717522003825 Adenylate cyclase, family 3 (some proteins contain HAMP domain) [Signal transduction mechanisms]; Region: CyaA; COG2114 717522003826 cyclase homology domain; Region: CHD; cd07302 717522003827 nucleotidyl binding site; other site 717522003828 dimer interface [polypeptide binding]; other site 717522003829 metal binding site [ion binding]; metal-binding site 717522003830 AAA ATPase domain; Region: AAA_16; pfam13191 717522003831 Predicted ATPase [General function prediction only]; Region: COG3903 717522003832 Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197 717522003833 C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170 717522003834 DNA binding residues [nucleotide binding] 717522003835 dimerization interface [polypeptide binding]; other site 717522003836 Adenylate cyclase, family 3 (some proteins contain HAMP domain) [Signal transduction mechanisms]; Region: CyaA; COG2114 717522003837 cyclase homology domain; Region: CHD; cd07302 717522003838 probable F420-dependent oxidoreductase, Rv3093c family; Region: F420_Rv3093c; TIGR03841 717522003839 N5,N10-methylenetetrahydromethanopterin reductase (Mer) catalyzes the reduction of N5,N10-methylenetetrahydromethanopterin with reduced coenzyme F420 to N5-methyltetrahydromethanopterin and oxidized coenzyme F420; Region: Tetrahydromethanopterin_reductase; cd01097 717522003840 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522003841 PPE family; Region: PPE; pfam00823 717522003842 Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484 717522003843 PAS fold; Region: PAS_4; pfam08448 717522003844 PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130 717522003845 putative active site [active] 717522003846 heme pocket [chemical binding]; other site 717522003847 Serine phosphatase RsbU, regulator of sigma subunit [Signal transduction mechanisms / Transcription]; Region: RsbU; COG2208 717522003848 Stage II sporulation protein E (SpoIIE); Region: SpoIIE; pfam07228 717522003849 Anti-sigma regulatory factor (Ser/Thr protein kinase) [Signal transduction mechanisms]; Region: RsbW; COG2172 717522003850 Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cl00075 717522003851 Sulphate Transporter and Anti-Sigma factor antagonist) domain of anti-anti-sigma factors, key regulators of anti-sigma factors by phosphorylation; Region: STAS_anti-anti-sigma_factors; cd07043 717522003852 anti sigma factor interaction site; other site 717522003853 regulatory phosphorylation site [posttranslational modification]; other site 717522003854 Sulphate Transporter and Anti-Sigma factor antagonist) domain of anti-anti-sigma factors, key regulators of anti-sigma factors by phosphorylation; Region: STAS_anti-anti-sigma_factors; cd07043 717522003855 anti sigma factor interaction site; other site 717522003856 regulatory phosphorylation site [posttranslational modification]; other site 717522003857 Nucleotidyltransferase (NT) domain of RelA- and SpoT-like ppGpp synthetases and hydrolases; Region: NT_Rel-Spo_like; cd05399 717522003858 synthetase active site [active] 717522003859 NTP binding site [chemical binding]; other site 717522003860 metal binding site [ion binding]; metal-binding site 717522003861 Beta-lactamase; Region: Beta-lactamase; pfam00144 717522003862 Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680 717522003863 Protein of unknown function (DUF1396); Region: DUF1396; pfam07161 717522003864 Cytochrome b5-like Heme/Steroid binding domain; Region: Cyt-b5; pfam00173 717522003865 Fatty acid desaturase [Lipid metabolism]; Region: DesA; COG3239 717522003866 The membrane fatty acid desaturase (Membrane_FADS)-like CD includes membrane FADSs, alkane hydroxylases, beta carotene ketolases (CrtW-like), hydroxylases (CrtR-like), and other related proteins. They are present in all groups of organisms with the...; Region: Membrane-FADS-like; cl00615 717522003867 putative di-iron ligands [ion binding]; other site 717522003868 Predicted naringenin-chalcone synthase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: BcsA; COG3424 717522003869 Chalcone and stilbene synthases; plant-specific polyketide synthases (PKS) and related enzymes, also called type III PKSs. PKS generate an array of different products, dependent on the nature of the starter molecule. They share a common chemical strategy; Region: CHS_like; cd00831 717522003870 malonyl-CoA binding site [chemical binding]; other site 717522003871 dimer interface [polypeptide binding]; other site 717522003872 active site 717522003873 product binding site; other site 717522003874 Sulfotransferase domain; Region: Sulfotransfer_1; pfam00685 717522003875 Dehydroquinate synthase-like (DHQ-like) and iron-containing alcohol dehydrogenases (Fe-ADH); Region: DHQ_Fe-ADH; cl02872 717522003876 uncharacterized domain; Region: TIGR00702 717522003877 YcaO-like family; Region: YcaO; pfam02624 717522003878 Uncharacterized conserved protein [Function unknown]; Region: COG3482 717522003879 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522003880 S-adenosylmethionine binding site [chemical binding]; other site 717522003881 Domain of unknown function (DUF222); Region: DUF222; pfam02720 717522003882 HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085 717522003883 active site 717522003884 bifunctional pyrimidine regulatory protein PyrR uracil phosphoribosyltransferase; Provisional; Region: PRK05205 717522003885 Pyrimidine operon attenuation protein/uracil phosphoribosyltransferase [Nucleotide transport and metabolism]; Region: PyrR; COG2065 717522003886 aspartate carbamoyltransferase catalytic subunit; Provisional; Region: pyrB; PRK00856 717522003887 Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding domain; Region: OTCace_N; pfam02729 717522003888 Aspartate/ornithine carbamoyltransferase, Asp/Orn binding domain; Region: OTCace; pfam00185 717522003889 dihydroorotase; Validated; Region: pyrC; PRK09357 717522003890 Superfamily of metallo-dependent hydrolases (also called amidohydrolase superfamily) is a large group of proteins that show conservation in their 3-dimensional fold (TIM barrel) and in details of their active site. The vast majority of the members have a...; Region: metallo-dependent_hydrolases; cl00281 717522003891 Dihydroorotase (DHOase), subgroup IIa; DHOases catalyze the reversible interconversion of carbamoyl aspartate to dihydroorotate, a key reaction in pyrimidine biosynthesis. This subgroup also contains proteins that lack the active site, like unc-33, a C; Region: DHOase_IIa; cd01317 717522003892 active site 717522003893 carbamoyl phosphate synthase small subunit; Reviewed; Region: PRK12564 717522003894 Carbamoyl-phosphate synthase small chain, CPSase domain; Region: CPSase_sm_chain; smart01097 717522003895 Small chain of the glutamine-dependent form of carbamoyl phosphate synthase, CPSase II; Region: GATase1_CPSase; cd01744 717522003896 catalytic site [active] 717522003897 subunit interface [polypeptide binding]; other site 717522003898 carbamoyl phosphate synthase large subunit; Reviewed; Region: carB; PRK05294 717522003899 Carbamoyl-phosphate synthase L chain, N-terminal domain; Region: CPSase_L_chain; pfam00289 717522003900 ATP-grasp domain; Region: ATP-grasp_4; cl17255 717522003901 Carbamoyl-phosphate synthetase large chain, oligomerisation domain; Region: CPSase_L_D3; pfam02787 717522003902 Carbamoyl-phosphate synthase L chain, N-terminal domain; Region: CPSase_L_chain; pfam00289 717522003903 ATP-grasp domain; Region: ATP-grasp_4; cl17255 717522003904 Methylglyoxal synthase-like domain from type II glutamine-dependent carbamoyl phosphate synthetase (CSP). CSP, a CarA and CarB heterodimer, catalyzes the production of carbamoyl phosphate which is subsequently employed in the metabolic pathways...; Region: MGS_CPS_II; cd01424 717522003905 IMP binding site; other site 717522003906 dimer interface [polypeptide binding]; other site 717522003907 interdomain contacts; other site 717522003908 partial ornithine binding site; other site 717522003909 Orotidine 5'-phosphate decarboxylase (ODCase) is a dimeric enzyme that decarboxylates orotidine 5'-monophosphate (OMP) to form uridine 5'-phosphate (UMP), an essential step in the pyrimidine biosynthetic pathway. In mammals, UMP synthase...; Region: OMP_decarboxylase_like; cd04725 717522003910 active site 717522003911 dimer interface [polypeptide binding]; other site 717522003912 PE family; Region: PE; pfam00934 717522003913 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522003914 PPE family; Region: PPE; pfam00823 717522003915 Guanylate kinase [Nucleotide transport and metabolism]; Region: Gmk; COG0194 717522003916 Guanosine monophosphate kinase (GMPK, EC 2.7.4.8), also known as guanylate kinase (GKase), catalyzes the reversible phosphoryl transfer from adenosine triphosphate (ATP) to guanosine monophosphate (GMP) to yield adenosine diphosphate (ADP) and guanosine...; Region: GMPK; cd00071 717522003917 catalytic site [active] 717522003918 G-X2-G-X-G-K; other site 717522003919 DNA-directed RNA polymerase, omega subunit; Region: rpoZ; TIGR00690 717522003920 bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate synthase; Validated; Region: PRK05579 717522003921 Flavoprotein; Region: Flavoprotein; pfam02441 717522003922 DNA / pantothenate metabolism flavoprotein; Region: DFP; pfam04127 717522003923 S-adenosylmethionine synthetase, N-terminal domain; Region: S-AdoMet_synt_N; pfam00438 717522003924 S-adenosylmethionine synthetase; Validated; Region: PRK05250 717522003925 S-adenosylmethionine synthetase, central domain; Region: S-AdoMet_synt_M; pfam02772 717522003926 S-adenosylmethionine synthetase, C-terminal domain; Region: S-AdoMet_synt_C; pfam02773 717522003927 Predicted flavoprotein involved in K+ transport [Inorganic ion transport and metabolism]; Region: TrkA; COG2072 717522003928 Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox_3; pfam13738 717522003929 Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124 717522003930 Cytochrome P450; Region: p450; cl12078 717522003931 Arabinose-binding domain of AraC transcription regulator, N-term; Region: Arabinose_bd; pfam12625 717522003932 helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342 717522003933 Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165 717522003934 PE family; Region: PE; pfam00934 717522003935 PIN domain of ribonucleases (toxins), VapC and FitB, of prokaryotic toxin/antitoxin operons, Pyrococcus horikoshii protein PH0500, and other similar bacterial and archaeal homologs; Region: PIN_VapC-FitB; cd09881 717522003936 oligomeric interface; other site 717522003937 putative active site [active] 717522003938 homodimer interface [polypeptide binding]; other site 717522003939 Ribbon-helix-helix protein, copG family; Region: RHH_1; pfam01402 717522003940 Esterases and lipases (includes fungal lipases, cholinesterases, etc.) These enzymes act on carboxylic esters (EC: 3.1.1.-). The catalytic apparatus involves three residues (catalytic triad): a serine, a glutamate or aspartate and a histidine.These...; Region: Esterase_lipase; cd00312 717522003941 alpha/beta hydrolase fold; Region: Abhydrolase_3; pfam07859 717522003942 substrate binding pocket [chemical binding]; other site 717522003943 Esterases and lipases (includes fungal lipases, cholinesterases, etc.) These enzymes act on carboxylic esters (EC: 3.1.1.-). The catalytic apparatus involves three residues (catalytic triad): a serine, a glutamate or aspartate and a histidine.These...; Region: Esterase_lipase; cd00312 717522003944 alpha/beta hydrolase fold; Region: Abhydrolase_3; pfam07859 717522003945 substrate binding pocket [chemical binding]; other site 717522003946 Predicted membrane protein [Function unknown]; Region: COG3714 717522003947 primosome assembly protein PriA; Provisional; Region: PRK14873 717522003948 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522003949 S-adenosylmethionine binding site [chemical binding]; other site 717522003950 helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347 717522003951 MarR family; Region: MarR; pfam01047 717522003952 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522003953 S-adenosylmethionine binding site [chemical binding]; other site 717522003954 methionyl-tRNA formyltransferase; Reviewed; Region: fmt; PRK00005 717522003955 Methionyl-tRNA formyltransferase, N-terminal hydrolase domain; Region: FMT_core_Met-tRNA-FMT_N; cd08646 717522003956 putative active site [active] 717522003957 substrate binding site [chemical binding]; other site 717522003958 putative cosubstrate binding site; other site 717522003959 catalytic site [active] 717522003960 C-terminal domain of Formyltransferase and other enzymes; Region: Met_tRNA_FMT_C; cd08704 717522003961 substrate binding site [chemical binding]; other site 717522003962 N-terminal RNA binding domain of the methyltransferase Sun. The rRNA-specific 5-methylcytidine transferase Sun, also known as RrmB or Fmu shares the RNA-binding non-catalytic domain with the transcription termination factor NusB. The precise biological...; Region: Methyltransferase_Sun; cd00620 717522003963 NOL1/NOP2/sun family; Region: Nol1_Nop2_Fmu; pfam01189 717522003964 NOL1/NOP2/sun family putative RNA methylase; Region: nop2p; TIGR00446 717522003965 Ribulose-5-phosphate 3-epimerase (RPE). This enzyme catalyses the interconversion of D-ribulose 5-phosphate (Ru5P) into D-xylulose 5-phosphate, as part of the Calvin cycle (reductive pentose phosphate pathway) in chloroplasts and in the oxidative pentose...; Region: RPE; cd00429 717522003966 ribulose-phosphate 3-epimerase; Region: rpe; TIGR01163 717522003967 substrate binding site [chemical binding]; other site 717522003968 hexamer interface [polypeptide binding]; other site 717522003969 metal binding site [ion binding]; metal-binding site 717522003970 riboflavin biosynthesis protein RibD; Region: eubact_ribD; TIGR00326 717522003971 Riboflavin-specific deaminase. Riboflavin biosynthesis protein RibD (Diaminohydroxyphosphoribosylaminopyrimidine deaminase) catalyzes the deamination of 2,5-diamino-6-ribosylamino-4(3H)-pyrimidinone 5'-phosphate, which is an intermediate step in the...; Region: Riboflavin_deaminase-reductase; cd01284 717522003972 catalytic motif [active] 717522003973 Zn binding site [ion binding]; other site 717522003974 RibD C-terminal domain; Region: RibD_C; pfam01872 717522003975 drug resistance transporter, EmrB/QacA subfamily; Region: efflux_EmrB; TIGR00711 717522003976 The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174 717522003977 putative substrate translocation pore; other site 717522003978 Protein of unknown function (DUF1396); Region: DUF1396; pfam07161 717522003979 riboflavin synthase subunit alpha; Provisional; Region: PRK09289 717522003980 Lumazine binding domain; Region: Lum_binding; pfam00677 717522003981 Lumazine binding domain; Region: Lum_binding; pfam00677 717522003982 Predicted amino acid aldolase or racemase [Amino acid transport and metabolism]; Region: COG3616 717522003983 Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzymes; Region: PLPDE_III; cl00261 717522003984 Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzymes; Region: PLPDE_III; cl00261 717522003985 Predicted amino acid aldolase or racemase [Amino acid transport and metabolism]; Region: COG3616 717522003986 bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II protein; Provisional; Region: PRK09311 717522003987 3,4-dihydroxy-2-butanone 4-phosphate synthase; Region: DHBP_synthase; pfam00926 717522003988 GTP cyclohydrolase II (RibA). GTP cyclohydrolase II catalyzes the conversion of GTP to 2,5-diamino-6-ribosylamino-4(3H)-pyrimidinone 5' phosphate, formate, pyrophosphate (APy), and GMP in the biosynthetic pathway of riboflavin. Riboflavin is the...; Region: GTP_cyclohydro2; cd00641 717522003989 dimerization interface [polypeptide binding]; other site 717522003990 active site 717522003991 lumazine synthase (6,7-dimethyl-8-ribityllumazine synthase, LS), catalyzes the penultimate step in the biosynthesis of riboflavin (vitamin B2); type-I; Region: Lumazine_synthase-I; cd09209 717522003992 homopentamer interface [polypeptide binding]; other site 717522003993 active site 717522003994 Protein of unknown function (DUF2581); Region: DUF2581; pfam10756 717522003995 PknH-like extracellular domain; Region: PknH_C; pfam14032 717522003996 Ricin-type beta-trefoil lectin domain; Region: Ricin_B_lectin; pfam00652 717522003997 Ricin-type beta-trefoil; Carbohydrate-binding domain formed from presumed gene triplication. The domain is found in a variety of molecules serving diverse functions such as enzymatic activity, inhibitory toxicity and signal transduction. Highly specific...; Region: RICIN; cd00161 717522003998 putative sugar binding sites [chemical binding]; other site 717522003999 Q-X-W motif; other site 717522004000 excinuclease ABC subunit C; Validated; Region: uvrC; PRK00558 717522004001 Catalytic GIY-YIG domain of nucleotide excision repair endonucleases UvrC, Cho, and similar proteins; Region: GIY-YIG_UvrC_Cho; cd10434 717522004002 GIY-YIG motif/motif A; other site 717522004003 active site 717522004004 catalytic site [active] 717522004005 putative DNA binding site [nucleotide binding]; other site 717522004006 metal binding site [ion binding]; metal-binding site 717522004007 UvrB/uvrC motif; Region: UVR; pfam02151 717522004008 UvrC Helix-hairpin-helix N-terminal; Region: UvrC_HhH_N; pfam08459 717522004009 Helix-hairpin-helix motif; Region: HHH; pfam00633 717522004010 P-loop ATPase protein family; Region: ATP_bind_2; pfam03668 717522004011 conserved hypothetical protein, cofD-related; Region: CofD_related; TIGR01826 717522004012 family of mostly uncharacterized proteins similar to B.subtilis YvcK; Region: YvcK_like; cd07187 717522004013 phosphate binding site [ion binding]; other site 717522004014 putative substrate binding pocket [chemical binding]; other site 717522004015 dimer interface [polypeptide binding]; other site 717522004016 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG1481 717522004017 Sporulation Regulator WhiA N terminal; Region: WhiA_N; pfam10298 717522004018 acyltransferase, WS/DGAT/MGAT; Region: acyl_WS_DGAT; TIGR02946 717522004019 Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007 717522004020 alpha/beta hydrolase fold; Region: Abhydrolase_3; pfam07859 717522004021 Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326 717522004022 acyl-CoA synthetase; Provisional; Region: PRK13382 717522004023 Bacterial Bile acid CoA ligases and similar proteins; Region: BACL_like; cd05929 717522004024 acyl-activating enzyme (AAE) consensus motif; other site 717522004025 putative AMP binding site [chemical binding]; other site 717522004026 putative active site [active] 717522004027 putative CoA binding site [chemical binding]; other site 717522004028 1-acyl-sn-glycerol-3-phosphate acyltransferase [Lipid metabolism]; Region: PlsC; COG0204 717522004029 Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: MGAT-like; Region: LPLAT_MGAT-like; cd07987 717522004030 putative acyl-acceptor binding pocket; other site 717522004031 Regulator of polyketide synthase expression [Signal transduction mechanisms / Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG2508 717522004032 PucR C-terminal helix-turn-helix domain; Region: HTH_30; pfam13556 717522004033 PE family; Region: PE; pfam00934 717522004034 PE-PPE domain; Region: PE-PPE; pfam08237 717522004035 Transmembrane protein of unknown function (DUF3556); Region: DUF3556; pfam12077 717522004036 Phytoene dehydrogenase and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG1233 717522004037 NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450 717522004038 IgD-like repeat domain of mycobacterial L,D-transpeptidases; Region: LDT_IgD_like_1; cd13431 717522004039 Uncharacterized protein conserved in bacteria [Function unknown]; Region: ErfK; COG1376 717522004040 L,D-transpeptidase catalytic domain; Region: YkuD; pfam03734 717522004041 Glyceraldehyde-3-phosphate dehydrogenase/erythrose-4-phosphate dehydrogenase [Carbohydrate transport and metabolism]; Region: GapA; COG0057 717522004042 Glyceraldehyde 3-phosphate dehydrogenase, NAD binding domain; Region: Gp_dh_N; pfam00044 717522004043 Glyceraldehyde 3-phosphate dehydrogenase, C-terminal domain; Region: Gp_dh_C; pfam02800 717522004044 Phosphoglycerate kinase; Region: PGK; pfam00162 717522004045 Phosphoglycerate kinase (PGK) is a monomeric enzyme which catalyzes the transfer of the high-energy phosphate group of 1,3-bisphosphoglycerate to ADP, forming ATP and 3-phosphoglycerate. This reaction represents the first of the two substrate-level...; Region: Phosphoglycerate_kinase; cd00318 717522004046 substrate binding site [chemical binding]; other site 717522004047 hinge regions; other site 717522004048 ADP binding site [chemical binding]; other site 717522004049 catalytic site [active] 717522004050 triosephosphate isomerase; Provisional; Region: PRK14567 717522004051 Triosephosphate isomerase (TIM) is a glycolytic enzyme that catalyzes the interconversion of dihydroxyacetone phosphate and D-glyceraldehyde-3-phosphate. The reaction is very efficient and requires neither cofactors nor metal ions. TIM, usually...; Region: TIM; cd00311 717522004052 substrate binding site [chemical binding]; other site 717522004053 dimer interface [polypeptide binding]; other site 717522004054 catalytic triad [active] 717522004055 SnoaL-like domain; Region: SnoaL_2; pfam12680 717522004056 Preprotein translocase SecG subunit; Region: SecG; cl09123 717522004057 PE family; Region: PE; pfam00934 717522004058 The MopB_DMSOR-BSOR-TMAOR CD contains dimethylsulfoxide reductase (DMSOR), biotin sulfoxide reductase (BSOR), trimethylamine N-oxide reductase (TMAOR) and other related proteins. DMSOR always catalyzes the reduction of DMSO to dimethylsulfide, but its...; Region: MopB_DMSOR-BSOR-TMAOR; cd02769 717522004059 molybdopterin guanine dinucleotide-containing S/N-oxide reductases; Region: bisC_fam; TIGR00509 717522004060 molybdopterin cofactor binding site [chemical binding]; other site 717522004061 substrate binding site [chemical binding]; other site 717522004062 The MopB_DMSOR-BSOR-TMAOR CD contains dimethylsulfoxide reductase (DMSOR), biotin sulfoxide reductase (BSOR), trimethylamine N-oxide reductase (TMAOR) and other related proteins. DMSOR always catalyzes the reduction of DMSO to dimethylsulfide, but its...; Region: MopB_CT_DMSOR-BSOR-TMAOR; cd02793 717522004063 molybdopterin cofactor binding site; other site 717522004064 START/RHO_alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) ligand-binding domain superfamily; Region: SRPBCC; cl14643 717522004065 hydrophobic ligand binding site; other site 717522004066 7bp deletion in BCG Tokyo after 191:C of the Mb region, and 15-bp deletion in BCG Pasteur and BCG Mexico after 189:C of the Mb region. In Mb, 19-bp insertion after 197:C from the 3' end of Rv1444c in the intergenic region between Rv1143c and Rv1444c of Mycobacterium tuberculosis H37Rv. 23Cs in BCG Tokyo, 17Cs in BCG Pasteur and BCG Mexico. 717522004067 Proteins of 100 residues with WXG; Region: WXG100; cl02005 717522004068 6-phosphogluconolactonase/Glucosamine-6-phosphate isomerase/deaminase [Carbohydrate transport and metabolism]; Region: NagB; COG0363 717522004069 6PGL: 6-Phosphogluconolactonase (6PGL) subfamily; 6PGL catalyzes the second step of the oxidative phase of the pentose phosphate pathway, the hydrolyzation of 6-phosphoglucono-1,5-lactone (delta form) to 6-phosphogluconate. 6PGL is thought to guard...; Region: 6PGL; cd01400 717522004070 putative active site [active] 717522004071 glucose-6-phosphate dehydrogenase assembly protein OpcA; Region: OpcA; TIGR00534 717522004072 Glucose-6-P dehydrogenase subunit [Carbohydrate transport and metabolism]; Region: COG3429 717522004073 glucose-6-phosphate 1-dehydrogenase; Validated; Region: PRK05722 717522004074 Glucose-6-phosphate dehydrogenase, NAD binding domain; Region: G6PD_N; pfam00479 717522004075 Glucose-6-phosphate dehydrogenase, C-terminal domain; Region: G6PD_C; pfam02781 717522004076 Transaldolase-like proteins from plants and bacteria; Region: Transaldolase_like; cd00955 717522004077 putative active site [active] 717522004078 transaldolase; Provisional; Region: PRK03903 717522004079 catalytic residue [active] 717522004080 Transketolase [Carbohydrate transport and metabolism]; Region: TktA; COG0021 717522004081 Thiamine pyrophosphate (TPP) family, Transketolase (TK) subfamily, TPP-binding module; TK catalyzes the transfer of a two-carbon unit from ketose phosphates to aldose phosphates. In heterotrophic organisms, TK provides a link between glycolysis and the...; Region: TPP_TK; cd02012 717522004082 TPP-binding site [chemical binding]; other site 717522004083 dimer interface [polypeptide binding]; other site 717522004084 Pyrimidine (PYR) binding domain of 1-deoxy-D-xylulose-5-phosphate synthase (DXS), transketolase (TK), and related proteins; Region: TPP_PYR_DXS_TK_like; cd07033 717522004085 PYR/PP interface [polypeptide binding]; other site 717522004086 dimer interface [polypeptide binding]; other site 717522004087 TPP binding site [chemical binding]; other site 717522004088 PE family; Region: PE; pfam00934 717522004089 protoheme IX farnesyltransferase; Provisional; Region: PRK04375 717522004090 UbiA prenyltransferase family; Region: UbiA; pfam01040 717522004091 PE family; Region: PE; pfam00934 717522004092 Regulator of polyketide synthase expression [Signal transduction mechanisms / Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG2508 717522004093 PucR C-terminal helix-turn-helix domain; Region: HTH_30; pfam13556 717522004094 Quinone oxidoreductase (QOR); Region: QOR2; cd05286 717522004095 quinone oxidoreductase, NADPH-dependent; Provisional; Region: PRK10754 717522004096 NADP binding site [chemical binding]; other site 717522004097 dimer interface [polypeptide binding]; other site 717522004098 Uncharacterized protein required for cytochrome oxidase assembly [Posttranslational modification, protein turnover, chaperones]; Region: CtaA; COG1612 717522004099 Cytochrome oxidase assembly protein; Region: COX15-CtaA; pfam02628 717522004100 ABC transporter efflux protein, DrrB family; Region: Mtu_efflux; TIGR00025 717522004101 ABC-2 family transporter protein; Region: ABC2_membrane_3; pfam12698 717522004102 ABC-type multidrug transport system, ATPase component [Defense mechanisms]; Region: CcmA; COG1131 717522004103 ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230 717522004104 Walker A/P-loop; other site 717522004105 ATP binding site [chemical binding]; other site 717522004106 Q-loop/lid; other site 717522004107 ABC transporter signature motif; other site 717522004108 Walker B; other site 717522004109 D-loop; other site 717522004110 H-loop/switch region; other site 717522004111 carotene biosynthesis associated membrane protein; Region: crt_membr; TIGR03459 717522004112 Predicted transcriptional regulator [Transcription]; Region: COG2345 717522004113 Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090 717522004114 putative DNA binding site [nucleotide binding]; other site 717522004115 putative Zn2+ binding site [ion binding]; other site 717522004116 Transcriptional regulator PadR-like family; Region: PadR; cl17335 717522004117 cysteine desulfurase activator complex subunit SufB; Provisional; Region: PRK11814; cl03223 717522004118 Hedgehog/Intein domain, found in Hedgehog proteins as well as proteins which contain inteins and undergo protein splicing (e.g. DnaB, RIR1-2, GyrA and Pol). In protein splicing an intervening polypeptide sequence - the intein - is excised from a protein; Region: Hint; cd00081 717522004119 protein-splicing catalytic site; other site 717522004120 thioester formation/cholesterol transfer; other site 717522004121 Intein/homing endonuclease [DNA replication, recombination, and repair]; Region: COG1372 717522004122 Hint (Hedgehog/Intein) domain C-terminal region; Region: HintC; smart00305 717522004123 cysteine desulfurase activator complex subunit SufB; Provisional; Region: PRK11814; cl03223 717522004124 Cysteine desulfurase activator SufB [Posttranslational modification, protein turnover, chaperones]; Region: SufB; COG0719 717522004125 FeS assembly protein SufD; Region: sufD; TIGR01981 717522004126 Cysteine desulfurase activator ATPase [Posttranslational modification, protein turnover, chaperones]; Region: sufC; COG0396 717522004127 ABC-type transport system involved in Fe-S cluster assembly, ATPase component; Region: ABC_FeS_Assembly; cd03217 717522004128 Walker A/P-loop; other site 717522004129 ATP binding site [chemical binding]; other site 717522004130 Q-loop/lid; other site 717522004131 ABC transporter signature motif; other site 717522004132 Walker B; other site 717522004133 D-loop; other site 717522004134 H-loop/switch region; other site 717522004135 Selenocysteine lyase/Cysteine desulfurase [Posttranslational modification, protein turnover, chaperones]; Region: csdA; COG0520 717522004136 Cysteine desulfurase (SufS)-like. This family belongs to the pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to cysteine desulfurase (SufS) and selenocysteine lyase. SufS...; Region: SufS_like; cd06453 717522004137 pyridoxal 5'-phosphate binding pocket [chemical binding]; other site 717522004138 catalytic residue [active] 717522004139 NifU homolog involved in Fe-S cluster formation [Energy production and conversion]; Region: IscU; COG0822 717522004140 Iron-sulfur cluster scaffold-like proteins; Region: IscU_like; cd06664 717522004141 trimerization site [polypeptide binding]; other site 717522004142 active site 717522004143 Predicted metal-sulfur cluster biosynthetic enzyme [General function prediction only]; Region: PaaD; COG2151 717522004144 acyl-CoA dehydrogenase; Provisional; Region: PTZ00456 717522004145 Acyl-CoA dehydrogenase N terminal; Region: AcylCoA_DH_N; pfam12418 717522004146 Acyl-CoA dehydrogenase; Region: ACAD; cl09933 717522004147 active site 717522004148 Acetyl-CoA dehydrogenase C-terminal like; Region: Acyl-CoA_dh_C; pfam12806 717522004149 PE family; Region: PE; pfam00934 717522004150 heavy metal-(Cd/Co/Hg/Pb/Zn)-translocating P-type ATPase; Region: ATPase-IB2_Cd; TIGR01512 717522004151 E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122 717522004152 TRX family; composed of two groups: Group I, which includes proteins that exclusively encode a TRX domain; and Group II, which are composed of fusion proteins of TRX and additional domains. Group I TRX is a small ancient protein that alter the redox...; Region: TRX_family; cd02947 717522004153 catalytic residues [active] 717522004154 TRX family; composed of two groups: Group I, which includes proteins that exclusively encode a TRX domain; and Group II, which are composed of fusion proteins of TRX and additional domains. Group I TRX is a small ancient protein that alter the redox...; Region: TRX_family; cd02947 717522004155 catalytic residues [active] 717522004156 enoyl-CoA hydratase; Provisional; Region: PRK05864 717522004157 Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558 717522004158 substrate binding site [chemical binding]; other site 717522004159 oxyanion hole (OAH) forming residues; other site 717522004160 trimer interface [polypeptide binding]; other site 717522004161 ATPase components of ABC transporters with duplicated ATPase domains [General function prediction only]; Region: Uup; COG0488 717522004162 ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201 717522004163 Walker A/P-loop; other site 717522004164 ATP binding site [chemical binding]; other site 717522004165 Q-loop/lid; other site 717522004166 ABC transporter signature motif; other site 717522004167 Walker B; other site 717522004168 D-loop; other site 717522004169 H-loop/switch region; other site 717522004170 ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221 717522004171 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522004172 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522004173 aconitate hydratase; Validated; Region: PRK09277 717522004174 Aconitase catalytic domain; Aconitase catalyzes the reversible isomerization of citrate and isocitrate as part of the TCA cycle; Region: Aconitase; cl00285 717522004175 substrate binding site [chemical binding]; other site 717522004176 ligand binding site [chemical binding]; other site 717522004177 Aconitase A swivel domain. This is the major form of the TCA cycle enzyme aconitate hydratase, also known as aconitase and citrate hydro-lyase. It includes bacterial and archaeal aconitase A, and the eukaryotic cytosolic form of aconitase. This group...; Region: AcnA_IRP_Swivel; cd01580 717522004178 substrate binding site [chemical binding]; other site 717522004179 Cell wall-associated hydrolases (invasion-associated proteins) [Cell envelope biogenesis, outer membrane]; Region: Spr; COG0791 717522004180 NlpC/P60 family; Region: NLPC_P60; pfam00877 717522004181 Cell wall-associated hydrolases (invasion-associated proteins) [Cell envelope biogenesis, outer membrane]; Region: Spr; COG0791 717522004182 NlpC/P60 family; Region: NLPC_P60; pfam00877 717522004183 MoxR-like ATPases [General function prediction only]; Region: COG0714 717522004184 The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009 717522004185 Walker A motif; other site 717522004186 ATP binding site [chemical binding]; other site 717522004187 Walker B motif; other site 717522004188 arginine finger; other site 717522004189 Uncharacterized conserved protein (some members contain a von Willebrand factor type A (vWA) domain) [General function prediction only]; Region: COG1721 717522004190 Protein of unknown function DUF58; Region: DUF58; pfam01882 717522004191 hypothetical protein; Provisional; Region: PRK13685 717522004192 Von Willebrand factor type A (vWA) domain was originally found in the blood coagulation protein von Willebrand factor (vWF). Typically, the vWA domain is made up of approximately 200 amino acid residues folded into a classic a/b para-rossmann type of...; Region: vWFA; cd00198 717522004193 metal ion-dependent adhesion site (MIDAS); other site 717522004194 Domain of unknown function (DUF4095); Region: DUF4095; pfam13338 717522004195 beta-Keto acyl carrier protein reductase (BKR), involved in Type II FAS, classical (c) SDRs; Region: BKR_SDR_c; cd05333 717522004196 3-oxoacyl-(acyl-carrier-protein) reductase; Region: 3oxo_ACP_reduc; TIGR01830 717522004197 NAD(P) binding site [chemical binding]; other site 717522004198 homotetramer interface [polypeptide binding]; other site 717522004199 homodimer interface [polypeptide binding]; other site 717522004200 active site 717522004201 enoyl-(acyl carrier protein) reductase; Provisional; Region: PRK07889 717522004202 Enoyl acyl carrier protein (ACP) reductase (ENR), divergent SDR; Region: ENR_SDR; cd05372 717522004203 NAD binding site [chemical binding]; other site 717522004204 homotetramer interface [polypeptide binding]; other site 717522004205 homodimer interface [polypeptide binding]; other site 717522004206 substrate binding site [chemical binding]; other site 717522004207 active site 717522004208 ferrochelatase; Reviewed; Region: hemH; PRK00035 717522004209 Ferrochelatase, N-terminal domain: Ferrochelatase (protoheme ferrolyase or HemH) is the terminal enzyme of the heme biosynthetic pathway. It catalyzes the insertion of ferrous iron into the protoporphyrin IX ring yielding protoheme. This enzyme is...; Region: Ferrochelatase_N; cd03411 717522004210 C-terminal domain interface [polypeptide binding]; other site 717522004211 active site 717522004212 Ferrochelatase, C-terminal domain: Ferrochelatase (protoheme ferrolyase or HemH) is the terminal enzyme of the heme biosynthetic pathway. It catalyzes the insertion of ferrous iron into the protoporphyrin IX ring yielding protoheme. This enzyme is...; Region: Ferrochelatase_C; cd00419 717522004213 active site 717522004214 N-terminal domain interface [polypeptide binding]; other site 717522004215 NfeD-like C-terminal, partner-binding; Region: NfeD; pfam01957 717522004216 Membrane protease subunits, stomatin/prohibitin homologs [Posttranslational modification, protein turnover, chaperones]; Region: HflC; COG0330 717522004217 Band_7_stomatin_like: A subgroup of the band 7 domain of flotillin (reggie) like proteins similar to stomatin and podicin (two lipid raft-associated integral membrane proteins). Individual proteins of this band 7 domain family may cluster to form...; Region: Band_7_stomatin_like; cd03403 717522004218 Coenzyme B12-dependent-methylmalonyl coenzyme A (CoA) mutase (MCM)-like family; contains proteins similar to MCM, and the large subunit of Streptomyces coenzyme B12-dependent isobutyryl-CoA mutase (ICM). MCM catalyzes the isomerization of...; Region: MM_CoA_mutase; cl00817 717522004219 Uncharacterized conserved protein [Function unknown]; Region: COG0398 717522004220 SNARE associated Golgi protein; Region: SNARE_assoc; pfam09335 717522004221 methylmalonyl-CoA mutase, heterodimeric type, beta chain; Region: mmCoA_mut_beta; TIGR00642 717522004222 Coenzyme B12-dependent-methylmalonyl coenzyme A (CoA) mutase (MCM) family, Beta subunit-like subfamily; contains bacterial proteins similar to the beta subunit of MCMs from Propionbacterium shermanni and Streptomyces cinnamonensis, which are alpha/beta...; Region: MM_CoA_mutase_beta; cd03677 717522004223 heterodimer interface [polypeptide binding]; other site 717522004224 substrate interaction site [chemical binding]; other site 717522004225 Methylmalonyl-CoA mutase, C-terminal domain/subunit (cobalamin-binding) [Lipid metabolism]; Region: Sbm; COG2185 717522004226 methylmalonyl-CoA mutase; Reviewed; Region: PRK09426 717522004227 Coenzyme B12-dependent-methylmalonyl coenzyme A (CoA) mutase (MCM) family, Alpha subunit-like subfamily; contains proteins similar to the alpha subunit of Propionbacterium shermanni MCM, as well as human and E. coli MCM. Members of this subfamily contain...; Region: MM_CoA_mutase_alpha_like; cd03679 717522004228 active site 717522004229 substrate binding site [chemical binding]; other site 717522004230 coenzyme B12 binding site [chemical binding]; other site 717522004231 methylmalonyl CoA mutase B12 binding domain. This domain binds to B12 (adenosylcobamide), which initiates the conversion of succinyl CoA and methylmalonyl CoA by forming an adenosyl radical, which then undergoes a rearrangement exchanging a hydrogen atom...; Region: MM_CoA_mut_B12_BD; cd02071 717522004232 B12 binding site [chemical binding]; other site 717522004233 cobalt ligand [ion binding]; other site 717522004234 Growth inhibitor [Signal transduction mechanisms]; Region: MazF; COG2337 717522004235 membrane ATPase/protein kinase; Provisional; Region: PRK09435 717522004236 The function of this protein family is unkown. The protein sequences are similar to the ArgK protein in E. coli. ArgK protein is a membrane ATPase which is required for transporting arginine, ornithine and lysine into the cells by the arginine and...; Region: ArgK-like; cd03114 717522004237 Walker A; other site 717522004238 Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680 717522004239 Beta-lactamase; Region: Beta-lactamase; pfam00144 717522004240 Methyltransferase domain; Region: Methyltransf_31; pfam13847 717522004241 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522004242 S-adenosylmethionine binding site [chemical binding]; other site 717522004243 Dodecin; Region: Dodecin; pfam07311 717522004244 undecaprenyl phosphate 4-deoxy-4-formamido-L-arabinose transferase; Provisional; Region: PRK10714 717522004245 Bacterial DPM1_like enzymes are related to eukaryotic DPM1; Region: DPM1_like_bac; cd04187 717522004246 Ligand binding site; other site 717522004247 Putative Catalytic site; other site 717522004248 DXD motif; other site 717522004249 Protein involved in biosynthesis of mitomycin antibiotics/polyketide fumonisin [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG5285 717522004250 Glycosyl hydrolase families 32 and 68, which for the clan GH-J; Region: GH_J; cd08979 717522004251 active site 717522004252 Predicted pyridoxal phosphate-dependent enzyme apparently involved in regulation of cell wall biogenesis [Cell envelope biogenesis, outer membrane]; Region: WecE; COG0399 717522004253 3-amino-5-hydroxybenzoic acid synthase family (AHBA_syn). AHBA_syn family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The members of this CD are involved in various biosynthetic pathways for secondary...; Region: AHBA_syn; cd00616 717522004254 inhibitor-cofactor binding pocket; inhibition site 717522004255 pyridoxal 5'-phosphate binding site [chemical binding]; other site 717522004256 catalytic residue [active] 717522004257 Putative Acyltransferase (AT), Left-handed parallel beta-Helix (LbH) domain; This group is composed of mostly uncharacterized proteins containing an N-terminal helical subdomain followed by a LbH domain. The alignment contains 6 turns, each containing...; Region: LbH_AT_putative; cd03360 717522004258 sugar O-acyltransferase, sialic acid O-acetyltransferase NeuD family; Region: NeuD_NnaD; TIGR03570 717522004259 putative trimer interface [polypeptide binding]; other site 717522004260 putative CoA binding site [chemical binding]; other site 717522004261 RD4 Region of difference RD4, deleted region in Mycobacterium bovis BCG Pasteur, BCG Tokyo, BCG Mexico and Mycobacterium bovis AF2122/97 compared to Mycobacterium tuberculosis H37Rv2. Removes genes Rv1506-Rv1516 717522004262 Protein of unknown function (DUF2910); Region: DUF2910; pfam11139 717522004263 Glycosyltransferases involved in cell wall biogenesis [Cell envelope biogenesis, outer membrane]; Region: WcaA; COG0463 717522004264 Glycosyl transferase family 2; Region: Glycos_transf_2; pfam00535 717522004265 active site 717522004266 Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394 717522004267 Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes. PLP combines with an alpha-amino acid to form a compound called a Schiff base or aldimine intermediate, which depending on the reaction, is the...; Region: AAT_I; cl00321 717522004268 Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394 717522004269 Glycosyltransferases involved in cell wall biogenesis [Cell envelope biogenesis, outer membrane]; Region: WcaA; COG0463 717522004270 active site 717522004271 acyl-CoA synthetase; Validated; Region: PRK05850 717522004272 Fatty acyl-AMP ligase (FAAL); Region: FAAL; cd05931 717522004273 acyl-activating enzyme (AAE) consensus motif; other site 717522004274 active site 717522004275 Transport protein; Region: actII; TIGR00833 717522004276 Methyltransferase domain; Region: Methyltransf_23; pfam13489 717522004277 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522004278 S-adenosylmethionine binding site [chemical binding]; other site 717522004279 Glycosyl transferases, related to UDP-glucuronosyltransferase [Carbohydrate transport and metabolism / Signal transduction mechanisms]; Region: COG1819 717522004280 This family includes the Gtfs, a group of homologous glycosyltransferases involved in the final stages of the biosynthesis of antibiotics vancomycin and related chloroeremomycin. Gtfs transfer sugar moieties from an activated NDP-sugar donor to the...; Region: GT1_Gtf_like; cd03784 717522004281 homodimer interface [polypeptide binding]; other site 717522004282 active site 717522004283 TDP-binding site; other site 717522004284 acceptor substrate-binding pocket; other site 717522004285 Predicted glycosyltransferases [General function prediction only]; Region: COG1216 717522004286 Subfamily of Glycosyltransferase Family GT2 of unknown function; Region: GT_2_like_c; cd04186 717522004287 Probable Catalytic site; other site 717522004288 metal-binding site 717522004289 Glycosyl transferases, related to UDP-glucuronosyltransferase [Carbohydrate transport and metabolism / Signal transduction mechanisms]; Region: COG1819 717522004290 This family includes the Gtfs, a group of homologous glycosyltransferases involved in the final stages of the biosynthesis of antibiotics vancomycin and related chloroeremomycin. Gtfs transfer sugar moieties from an activated NDP-sugar donor to the...; Region: GT1_Gtf_like; cd03784 717522004291 homodimer interface [polypeptide binding]; other site 717522004292 active site 717522004293 TDP-binding site; other site 717522004294 acceptor substrate-binding pocket; other site 717522004295 Polyketide synthase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3321 717522004296 polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833 717522004297 active site 717522004298 Acyl transferase domain; Region: Acyl_transf_1; pfam00698 717522004299 Dehydratase domain in polyketide synthase (PKS) enzymes; Region: PKS_DH; smart00826 717522004300 Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931 717522004301 enoyl reductase of polyketide synthase; Region: enoyl_red; cd05195 717522004302 Enoylreductase; Region: PKS_ER; smart00829 717522004303 NAD(P) binding site [chemical binding]; other site 717522004304 beta-ketoacyl reductase (KR) domain of fatty acid synthase (FAS), subgroup 2, complex (x); Region: KR_2_FAS_SDR_x; cd08955 717522004305 This enzymatic domain is part of bacterial polyketide synthases; Region: PKS_KR; smart00822 717522004306 putative NADP binding site [chemical binding]; other site 717522004307 active site 717522004308 Phosphopantetheine attachment site; Region: PKS_PP; smart00823 717522004309 acyl-CoA synthetase; Validated; Region: PRK05850 717522004310 Fatty acyl-AMP ligase (FAAL); Region: FAAL; cd05931 717522004311 acyl-activating enzyme (AAE) consensus motif; other site 717522004312 active site 717522004313 Threonine dehydrogenase and related Zn-dependent dehydrogenases [Amino acid transport and metabolism / General function prediction only]; Region: Tdh; COG1063 717522004314 Medium chain reductase/dehydrogenase (MDR)/zinc-dependent alcohol dehydrogenase-like family; Region: MDR; cl16912 717522004315 NAD(P) binding site [chemical binding]; other site 717522004316 Uncharacterized conserved protein [Function unknown]; Region: COG2128 717522004317 Carboxymuconolactone decarboxylase family; Region: CMD; pfam02627 717522004318 PaaI_thioesterase is a tetrameric acyl-CoA thioesterase with a hot dog fold and one of several proteins responsible for phenylacetic acid (PA) degradation in bacteria. Although orthologs of PaaI exist in archaea and eukaryotes, their function has not...; Region: PaaI_thioesterase; cd03443 717522004319 CoenzymeA binding site [chemical binding]; other site 717522004320 subunit interaction site [polypeptide binding]; other site 717522004321 PHB binding site; other site 717522004322 Nitronate monooxygenase; Region: NMO; pfam03060 717522004323 2-Nitropropane dioxygenase (NPD), one of the nitroalkane oxidizing enzyme families, catalyzes oxidative denitrification of nitroalkanes to their corresponding carbonyl compounds and nitrites. NDP is a member of the NAD(P)H-dependent flavin oxidoreductase...; Region: NPD_like; cd04730 717522004324 FMN binding site [chemical binding]; other site 717522004325 substrate binding site [chemical binding]; other site 717522004326 putative catalytic residue [active] 717522004327 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522004328 isoleucyl-tRNA synthetase; Reviewed; Region: ileS; PRK06039 717522004329 catalytic core domain of isoleucyl-tRNA synthetases; Region: IleRS_core; cd00818 717522004330 HIGH motif; other site 717522004331 catalytic core domain of isoleucyl-tRNA synthetases; Region: IleRS_core; cd00818 717522004332 active site 717522004333 KMSKS motif; other site 717522004334 Anticodon-binding domain of archaeal, bacterial, and eukaryotic cytoplasmic isoleucyl tRNA synthetases; Region: Anticodon_Ia_Ile_ABEc; cd07961 717522004335 tRNA binding surface [nucleotide binding]; other site 717522004336 anticodon binding site; other site 717522004337 DNA polymerase IV; Provisional; Region: PRK03348 717522004338 DNA Polymerase IV/Kappa; Region: PolY_Pol_IV_kappa; cd03586 717522004339 active site 717522004340 DNA binding site [nucleotide binding] 717522004341 Type II (periplasmic) bacterial L-asparaginase; Region: L-asparaginase_II; cd08964 717522004342 active site 717522004343 homodimer interface [polypeptide binding]; other site 717522004344 homotetramer interface [polypeptide binding]; other site 717522004345 lipoprotein signal peptidase; Provisional; Region: PRK14764 717522004346 lipoprotein signal peptidase; Provisional; Region: PRK14787 717522004347 Pseudouridylate synthases, 23S RNA-specific [Translation, ribosomal structure and biogenesis]; Region: RluA; COG0564 717522004348 Pseudouridine synthase, RsuA/RluD family; Region: PseudoU_synth_RluCD_like; cd02869 717522004349 active site 717522004350 Uncharacterized protein conserved in bacteria, putative lipoprotein [Function unknown]; Region: LprI; COG4461 717522004351 Protein of unknown function (DUF1311); Region: DUF1311; pfam07007 717522004352 Membrane-bound lysozyme-inhibitor of c-type lysozyme; Region: MliC; pfam09864 717522004353 Truncated hemoglobins (trHbs) are a family of oxygen-binding heme proteins found in cyanobacteria, eubacteria, unicellular eukaryotes, and plants. The truncated hemoglobins have a characteristic two-over-two alpha helical folding pattern that is distinct...; Region: Trunc_globin; cd00454 717522004354 apolar tunnel; other site 717522004355 heme binding site [chemical binding]; other site 717522004356 dimerization interface [polypeptide binding]; other site 717522004357 short chain dehydrogenase; Provisional; Region: PRK05866 717522004358 classical (c) SDRs; Region: SDR_c; cd05233 717522004359 NAD(P) binding site [chemical binding]; other site 717522004360 active site 717522004361 Short-chain dehydrogenases of various substrate specificities [General function prediction only]; Region: DltE; COG0300 717522004362 Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931 717522004363 NAD(P) binding site [chemical binding]; other site 717522004364 active site 717522004365 START/RHO_alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) ligand-binding domain superfamily; Region: SRPBCC; cd07812 717522004366 hydrophobic ligand binding site; other site 717522004367 DNA polymerase III subunit alpha; Validated; Region: dnaE; PRK05673 717522004368 Polymerase and Histidinol Phosphatase domain of alpha-subunit of bacterial polymerase III DnaE3; Region: PHP_PolIIIA_DnaE3; cd12113 717522004369 active site 717522004370 PHP Thumb interface [polypeptide binding]; other site 717522004371 metal binding site [ion binding]; metal-binding site 717522004372 DnaE_OBF: A subfamily of OB folds corresponding to the C-terminal OB-fold nucleic acid binding domain of Thermus aquaticus and Escherichia coli type C replicative DNA polymerase III alpha subunit (DnaE). The DNA polymerase holoenzyme of E. coli contains...; Region: DnaE_OBF; cd04485 717522004373 generic binding surface II; other site 717522004374 generic binding surface I; other site 717522004375 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522004376 PPE family; Region: PPE; pfam00823 717522004377 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522004378 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522004379 Long-chain acyl-CoA synthetases (AMP-forming) [Lipid metabolism]; Region: FAA1; COG1022 717522004380 Long-chain fatty acid CoA synthetases and Bubblegum-like very long-chain fatty acid CoA synthetases; Region: VL_LC_FACS_like; cd05907 717522004381 acyl-activating enzyme (AAE) consensus motif; other site 717522004382 putative AMP binding site [chemical binding]; other site 717522004383 putative active site [active] 717522004384 putative CoA binding site [chemical binding]; other site 717522004385 glycerol-3-phosphate acyltransferase; Reviewed; Region: PRK11915 717522004386 Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: GPAT-like; Region: LPLAT_DHAPAT-like; cd07993 717522004387 putative acyl-acceptor binding pocket; other site 717522004388 fumarate reductase, flavoprotein subunit; Region: fum_red_Fp; TIGR01176 717522004389 L-aspartate oxidase; Provisional; Region: PRK06175 717522004390 Fumarate reductase flavoprotein C-term; Region: Succ_DH_flav_C; pfam02910 717522004391 fumarate reductase iron-sulfur subunit; Provisional; Region: PRK12385 717522004392 2Fe-2S iron-sulfur cluster binding domain; Region: Fer2_3; pfam13085 717522004393 Quinol:fumarate reductase (QFR) Type D subfamily, 15kD hydrophobic subunit C; QFR couples the reduction of fumarate to succinate to the oxidation of quinol to quinone, the opposite reaction to that catalyzed by the related protein, succinate:quinine...; Region: QFR_TypeD_subunitC; cd00546 717522004394 D-subunit interface [polypeptide binding]; other site 717522004395 Iron-sulfur protein interface; other site 717522004396 proximal quinone binding site [chemical binding]; other site 717522004397 distal quinone binding site [chemical binding]; other site 717522004398 Quinol:fumarate reductase (QFR) Type D subfamily, 13kD hydrophobic subunit D; QFR couples the reduction of fumarate to succinate to the oxidation of quinol to quinone, the opposite reaction to that catalyzed by the related protein, succinate:quinine...; Region: QFR_TypeD_subunitD; cd00547 717522004399 Iron-sulfur protein interface; other site 717522004400 proximal quinone binding site [chemical binding]; other site 717522004401 C-subunit interface; other site 717522004402 distal quinone binding site; other site 717522004403 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522004404 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522004405 Mycobacterium membrane protein; Region: Mycobact_memb; pfam05423 717522004406 TbD1 Region of difference TbD1, inserted region in Mycobacterium bovis BCG Pasteur, BCG Tokyo, BCG Mexico and Mycobacterium bovis AF2122/97 compared to Mycobacterium tuberculosis H37Rv2. This deletion in Mycobacterium tuberculosis modern strains, e.g. H37Rv, merges truncated genes mmpS6 and mmpL6 in an uniq gene, mmpL6 (Rv1557) 717522004407 Predicted drug exporters of the RND superfamily [General function prediction only]; Region: COG2409 717522004408 Domain of unknown function (DUF385); Region: DUF385; pfam04075 717522004409 threonine dehydratase; Validated; Region: PRK08639 717522004410 Threonine dehydratase: The first step in amino acid degradation is the removal of nitrogen. Although the nitrogen atoms of most amino acids are transferred to alpha-ketoglutarate before removal, the alpha-amino group of threonine can be directly...; Region: Thr-dehyd; cd01562 717522004411 tetramer interface [polypeptide binding]; other site 717522004412 pyridoxal 5'-phosphate binding site [chemical binding]; other site 717522004413 catalytic residue [active] 717522004414 C-terminal regulatory domain of Threonine dehydratase; Region: Thr_dehydrat_C; pfam00585 717522004415 Transcription regulator of the Arc/MetJ class [Transcription]; Region: COG5450 717522004416 PIN domain of the Rv0301 toxin of Mycobacterium tuberculosis and other uncharacterized, annotated PilT protein domain proteins; Region: PIN_MtRv0301; cd09882 717522004417 putative active site [active] 717522004418 Alpha amylase catalytic domain family; Region: AmyAc_family; cl07893 717522004419 Domain of unknown function (DUF3459); Region: DUF3459; pfam11941 717522004420 N-terminal Early set domain associated with the catalytic domain of Maltooligosyl trehalose trehalohydrolase (also called Glycosyltrehalose trehalohydrolase) and similar proteins; Region: E_set_MTHase_like_N; cd02853 717522004421 Alpha amylase catalytic domain found in Glycosyltrehalose trehalohydrolase (also called Maltooligosyl trehalose Trehalohydrolase); Region: AmyAc_GTHase; cd11325 717522004422 catalytic site [active] 717522004423 malto-oligosyltrehalose synthase; Region: trehalose_TreY; TIGR02401 717522004424 Alpha amylase catalytic domain found in maltooligosyl trehalose synthase (MTSase); Region: AmyAc_MTSase; cd11336 717522004425 active site 717522004426 catalytic site [active] 717522004427 RD17 Region of difference RD17, deleted region in Mycobacterium bovis AF2122/97 compared to Mycobacterium tuberculosis H37Rv2 , Mycobacterium bovis BCG Pasteur, BCG Tokyo and BCG Mexico. This deletion, in Mycobacterium bovis AF2122/97, splits treY in 2 genes treYa and treYb 717522004428 glycogen debranching enzyme GlgX; Region: glgX_debranch; TIGR02100 717522004429 N-terminal Early set domain associated with the catalytic domain of Glycogen debranching enzyme and bacterial isoamylase (also called glycogen 6-glucanohydrolase); Region: E_set_GDE_Isoamylase_N; cd02856 717522004430 Alpha amylase catalytic domain found in glycogen debranching enzymes; Region: AmyAc_Glg_debranch; cd11326 717522004431 active site 717522004432 catalytic site [active] 717522004433 Predicted acyltransferases [Lipid metabolism]; Region: COG1835 717522004434 Cell wall-associated hydrolases (invasion-associated proteins) [Cell envelope biogenesis, outer membrane]; Region: Spr; COG0791 717522004435 NlpC/P60 family; Region: NLPC_P60; pfam00877 717522004436 adenosylmethionine--8-amino-7-oxononanoate transaminase; Provisional; Region: PRK05964 717522004437 Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610 717522004438 inhibitor-cofactor binding pocket; inhibition site 717522004439 pyridoxal 5'-phosphate binding site [chemical binding]; other site 717522004440 catalytic residue [active] 717522004441 8-amino-7-oxononanoate synthase; Reviewed; Region: PRK05958 717522004442 Aminotransferase class I and II; Region: Aminotran_1_2; pfam00155 717522004443 pyridoxal 5'-phosphate binding pocket [chemical binding]; other site 717522004444 catalytic residue [active] 717522004445 dithiobiotin synthetase; Reviewed; Region: bioD; PRK00090 717522004446 2'-5' RNA ligase superfamily; Region: 2_5_RNA_ligase2; pfam13563 717522004447 Domain of unknown function (DUF222); Region: DUF222; pfam02720 717522004448 HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085 717522004449 active site 717522004450 RD3 Region of difference RD3 (phiRv1), deleted region in Mycobacterium bovis BCG Pasteur, BCG Tokyo and BCG Mexico compared to Mycobacterium tuberculosis H37Rv2 and Mycobacterium bovis AF2122/97. Removes genes Rv1573c-Rv1586c and merges truncated genes Rv1587c and Rv1572c 717522004451 Domain of unknown function (DUF222); Region: DUF222; pfam02720 717522004452 biotin synthase; Validated; Region: PRK06256 717522004453 Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335 717522004454 FeS/SAM binding site; other site 717522004455 Biotin and Thiamin Synthesis associated domain; Region: BATS; pfam06968 717522004456 Protein of unknown function (DUF2567); Region: DUF2567; pfam10821 717522004457 Secretory lipase; Region: LIP; pfam03583 717522004458 ADP-ribose pyrophosphatase [Nucleotide transport and metabolism]; Region: COG1051 717522004459 nudix motif; other site 717522004460 quinolinate synthetase; Provisional; Region: PRK09375 717522004461 L-aspartate oxidase; Provisional; Region: PRK07804 717522004462 L-aspartate oxidase; Provisional; Region: PRK06175 717522004463 Fumarate reductase flavoprotein C-term; Region: Succ_DH_flav_C; pfam02910 717522004464 nicotinate-nucleotide pyrophosphorylase; Provisional; Region: PRK07896 717522004465 Quinolinate phosphoribosyl transferase (QAPRTase or QPRTase), also called nicotinate-nucleotide pyrophosphorylase, is involved in the de novo synthesis of NAD in both prokaryotes and eukaryotes. It catalyses the reaction of quinolinic acid (QA) with...; Region: QPRTase; cd01572 717522004466 dimerization interface [polypeptide binding]; other site 717522004467 active site 717522004468 Methyltransferase domain; Region: Methyltransf_11; pfam08241 717522004469 S-adenosylmethionine binding site [chemical binding]; other site 717522004470 deazaflavin-dependent oxidoreductase, nitroreductase family; Region: hi_GC_TIGR00026 717522004471 Histidinol dehydrogenase; Region: Histidinol_dh; pfam00815 717522004472 Histidinol dehydrogenase, HisD, E.C 1.1.1.23. Histidinol dehydrogenase catalyzes the last two steps in the L-histidine biosynthesis pathway, which is conserved in bacteria, archaea, fungi, and plants. These last two steps are (i) the NAD-dependent...; Region: Histidinol_dh; cd06572 717522004473 NAD binding site [chemical binding]; other site 717522004474 dimerization interface [polypeptide binding]; other site 717522004475 product binding site; other site 717522004476 substrate binding site [chemical binding]; other site 717522004477 zinc binding site [ion binding]; other site 717522004478 catalytic residues [active] 717522004479 histidinol-phosphate aminotransferase; Provisional; Region: PRK03317 717522004480 Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609 717522004481 pyridoxal 5'-phosphate binding site [chemical binding]; other site 717522004482 homodimer interface [polypeptide binding]; other site 717522004483 catalytic residue [active] 717522004484 Imidazoleglycerol-phosphate dehydratase; Region: IGPD; cd07914 717522004485 4-fold oligomerization interface [polypeptide binding]; other site 717522004486 putative active site pocket [active] 717522004487 metal binding residues [ion binding]; metal-binding site 717522004488 3-fold/trimer interface [polypeptide binding]; other site 717522004489 imidazole glycerol phosphate synthase subunit HisH; Provisional; Region: hisH; PRK13146 717522004490 Type 1 glutamine amidotransferase (GATase1) domain found in imidazole glycerol phosphate synthase (IGPS); Region: GATase1_IGP_Synthase; cd01748 717522004491 putative active site [active] 717522004492 oxyanion strand; other site 717522004493 catalytic triad [active] 717522004494 HisA. Phosphoribosylformimino-5-aminoimidazole carboxamide ribonucleotide (ProFAR) isomerase catalyzes the fourth step in histidine biosynthesis, an isomerisation of the aminoaldose moiety of ProFAR to the aminoketose of PRFAR (N-(5'-phospho-D-1...; Region: HisA; cd04732 717522004495 Histidine biosynthesis protein; Region: His_biosynth; pfam00977 717522004496 catalytic residues [active] 717522004497 Inositol-monophosphatase-like domains. This family of phosphatases is dependent on bivalent metal ions such as Mg++, and many members are inhibited by Li+ (which is thought to displace a bivalent ion in the active site). Substrates include fructose-1; Region: IMPase_like; cd01637 717522004498 Archaeal fructose-1,6-bisphosphatase and related enzymes of inositol monophosphatase family [Carbohydrate transport and metabolism]; Region: SuhB; COG0483 717522004499 active site 717522004500 The cyclase subunit of imidazoleglycerol phosphate synthase (HisF). Imidazole glycerol phosphate synthase (IGPS) catalyzes the fifth step of histidine biosynthesis, the formation of the imidazole ring. IGPS converts N1-(5'-phosphoribulosyl)...; Region: HisF; cd04731 717522004501 Histidine biosynthesis protein; Region: His_biosynth; pfam00977 717522004502 substrate binding site [chemical binding]; other site 717522004503 glutamase interaction surface [polypeptide binding]; other site 717522004504 phosphoribosyl-AMP cyclohydrolase; Reviewed; Region: hisI; PRK00051 717522004505 Ca2+/H+ antiporter [Inorganic ion transport and metabolism]; Region: ChaA; COG0387 717522004506 Sodium/calcium exchanger protein; Region: Na_Ca_ex; pfam01699 717522004507 Peroxiredoxin [Posttranslational modification, protein turnover, chaperones]; Region: AhpC; COG0450 717522004508 Peroxiredoxin (PRX) family, Bacterioferritin comigratory protein (BCP) subfamily; composed of thioredoxin-dependent thiol peroxidases, widely expressed in pathogenic bacteria, that protect cells against toxicity from reactive oxygen species by reducing...; Region: PRX_BCP; cd03017 717522004509 catalytic triad [active] 717522004510 anthranilate synthase component I; Provisional; Region: PRK13571 717522004511 Anthranilate synthase component I, N terminal region; Region: Anth_synt_I_N; pfam04715 717522004512 chorismate binding enzyme; Region: Chorismate_bind; pfam00425 717522004513 Tryptophan-associated transmembrane protein (Trp_oprn_chp); Region: Trp_oprn_chp; pfam09534 717522004514 Indole-3-glycerol phosphate synthase (IGPS); an enzyme in the tryptophan biosynthetic pathway, catalyzing the ring closure reaction of 1-(o-carboxyphenylamino)-1-deoxyribulose-5-phosphate (CdRP) to indole-3-glycerol phosphate (IGP), accompanied by the...; Region: IGPS; cd00331 717522004515 active site 717522004516 ribulose/triose binding site [chemical binding]; other site 717522004517 phosphate binding site [ion binding]; other site 717522004518 substrate (anthranilate) binding pocket [chemical binding]; other site 717522004519 product (indole) binding pocket [chemical binding]; other site 717522004520 tryptophan synthase, beta subunit; Region: trpB; TIGR00263 717522004521 Tryptophan synthase-beta: Trptophan synthase is a bifunctional enzyme that catalyses the last two steps in the biosynthesis of L-tryptophan via its alpha and beta reactions. In the alpha reaction, indole 3-glycerol phosphate is cleaved reversibly to...; Region: Trp-synth_B; cd06446 717522004522 pyridoxal 5'-phosphate binding site [chemical binding]; other site 717522004523 catalytic residue [active] 717522004524 Ttryptophan synthase (TRPS) alpha subunit (TSA). TPRS is a bifunctional tetrameric enzyme (2 alpha and 2 beta subunits) that catalyzes the last two steps of L-tryptophan biosynthesis. Alpha and beta subunit catalyze two distinct reactions which are both...; Region: Tryptophan_synthase_alpha; cd04724 717522004525 substrate binding site [chemical binding]; other site 717522004526 active site 717522004527 catalytic residues [active] 717522004528 heterodimer interface [polypeptide binding]; other site 717522004529 prolipoprotein diacylglyceryl transferase; Reviewed; Region: PRK13108 717522004530 Prolipoprotein diacylglyceryltransferase [Cell envelope biogenesis, outer membrane]; Region: Lgt; COG0682 717522004531 TM2 domain; Region: TM2; pfam05154 717522004532 Protein of unknown function (DUF2752); Region: DUF2752; pfam10825 717522004533 pyruvate kinase; Provisional; Region: PRK06247 717522004534 Pyruvate kinase (PK): Large allosteric enzyme that regulates glycolysis through binding of the substrate, phosphoenolpyruvate, and one or more allosteric effectors. Like other allosteric enzymes, PK has a high substrate affinity R state and a low...; Region: Pyruvate_Kinase; cl17342 717522004535 domain interfaces; other site 717522004536 active site 717522004537 Acyl-CoA thioesterase [Lipid metabolism]; Region: TesB; COG1946 717522004538 Thioesterase II (TEII) is thought to regenerate misprimed nonribosomal peptide synthetases (NRPSs) as well as modular polyketide synthases (PKSs) by hydrolyzing acetyl groups bound to the peptidyl carrier protein (PCP) and acyl carrier protein (ACP)...; Region: Thioesterase_II_repeat2; cd03445 717522004539 active site 717522004540 Thioesterase II (TEII) is thought to regenerate misprimed nonribosomal peptide synthetases (NRPSs) as well as modular polyketide synthases (PKSs) by hydrolyzing acetyl groups bound to the peptidyl carrier protein (PCP) and acyl carrier protein (ACP)...; Region: Thioesterase_II_repeat1; cd03444 717522004541 catalytic triad [active] 717522004542 dimer interface [polypeptide binding]; other site 717522004543 Uncharacterized conserved protein [Function unknown]; Region: COG2898 717522004544 Uncharacterized conserved protein (DUF2156); Region: DUF2156; pfam09924 717522004545 thiol reductant ABC exporter, CydC subunit; Region: CydC; TIGR02868 717522004546 ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201 717522004547 ATP-binding cassette domain of multidrug resistance protein-like transporters; Region: ABCC_MRP_Like; cd03228 717522004548 Walker A/P-loop; other site 717522004549 Walker A/P-loop; other site 717522004550 ATP binding site [chemical binding]; other site 717522004551 ATP binding site [chemical binding]; other site 717522004552 Q-loop/lid; other site 717522004553 ABC-type transport system involved in cytochrome bd biosynthesis, ATPase and permease components [Energy production and conversion / Posttranslational modification, protein turnover, chaperones]; Region: CydD; COG4988 717522004554 ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201 717522004555 Walker A/P-loop; other site 717522004556 ATP binding site [chemical binding]; other site 717522004557 Q-loop/lid; other site 717522004558 ABC transporter signature motif; other site 717522004559 Walker B; other site 717522004560 D-loop; other site 717522004561 H-loop/switch region; other site 717522004562 cytochrome d ubiquinol oxidase subunit 2; Provisional; Region: PRK15003; cl12219 717522004563 Cytochrome oxidase subunit II; Region: Cyto_ox_2; pfam02322 717522004564 cytochrome d terminal oxidase subunit 1; Provisional; Region: PRK15097 717522004565 Bacterial Cytochrome Ubiquinol Oxidase; Region: Bac_Ubq_Cox; pfam01654 717522004566 Uncharacterized conserved protein [Function unknown]; Region: HdeD; COG3247 717522004567 Adenylyl- / guanylyl cyclase, catalytic domain; Region: CYCc; smart00044 717522004568 cyclase homology domain; Region: CHD; cd07302 717522004569 nucleotidyl binding site; other site 717522004570 metal binding site [ion binding]; metal-binding site 717522004571 dimer interface [polypeptide binding]; other site 717522004572 Response regulator with putative antiterminator output domain [Signal transduction mechanisms]; Region: AmiR; COG3707 717522004573 Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156 717522004574 active site 717522004575 phosphorylation site [posttranslational modification] 717522004576 intermolecular recognition site; other site 717522004577 dimerization interface [polypeptide binding]; other site 717522004578 ANTAR domain; Region: ANTAR; pfam03861 717522004579 lipid-transfer protein; Provisional; Region: PRK06059 717522004580 Thiolase domain associated with sterol carrier protein (SCP)-x isoform and related proteins; SCP-2 has multiple roles in intracellular lipid circulation and metabolism. The N-terminal presequence in the SCP-x isoform represents a peroxisomal...; Region: SCP-x_thiolase; cd00829 717522004581 active site 717522004582 Predicted nucleic-acid-binding protein containing a Zn-ribbon [General function prediction only]; Region: COG1545 717522004583 Rubredoxin-like zinc ribbon domain (DUF35_N); Region: DUF35_N; pfam12172 717522004584 DUF35 OB-fold domain; Region: DUF35; pfam01796 717522004585 DNA polymerase I; Provisional; Region: PRK05755 717522004586 PIN domain of the 5'-3' exonuclease of Taq DNA polymerase I and homologs; Region: PIN_53EXO; cd09859 717522004587 active site 717522004588 metal binding site 1 [ion binding]; metal-binding site 717522004589 putative 5' ssDNA interaction site; other site 717522004590 metal binding site 3; metal-binding site 717522004591 metal binding site 2 [ion binding]; metal-binding site 717522004592 H3TH domain of the 5'-3' exonuclease of Taq DNA polymerase I and homologs; Region: H3TH_53EXO; cd09898 717522004593 putative DNA binding site [nucleotide binding]; other site 717522004594 putative metal binding site [ion binding]; other site 717522004595 3'-5' exonuclease; Region: 35EXOc; smart00474 717522004596 inactive DEDDy 3'-5' exonuclease domain of Bacillus stearothermophilus DNA polymerase I and similar family-A DNA polymerases; Region: DNA_polA_I_Bacillus_like_exo; cd06140 717522004597 Polymerase I functions primarily to fill DNA gaps that arise during DNA repair, recombination and replication; Region: DNA_pol_A_pol_I_C; cd08637 717522004598 active site 717522004599 DNA binding site [nucleotide binding] 717522004600 catalytic site [active] 717522004601 30S ribosomal protein S1; Reviewed; Region: rpsA; PRK07899 717522004602 S1_RPS1_repeat_ec1_hs1: Ribosomal protein S1 (RPS1) domain. RPS1 is a component of the small ribosomal subunit thought to be involved in the recognition and binding of mRNA's during translation initiation. The bacterial RPS1 domain architecture...; Region: S1_RPS1_repeat_ec1_hs1; cd05687 717522004603 RNA binding site [nucleotide binding]; other site 717522004604 S1_RPS1_repeat_ec2_hs2: Ribosomal protein S1 (RPS1) domain. RPS1 is a component of the small ribosomal subunit thought to be involved in the recognition and binding of mRNA's during translation initiation. The bacterial RPS1 domain architecture...; Region: S1_RPS1_repeat_ec2_hs2; cd04465 717522004605 RNA binding site [nucleotide binding]; other site 717522004606 S1_like: Ribosomal protein S1-like RNA-binding domain. Found in a wide variety of RNA-associated proteins. Originally identified in S1 ribosomal protein. This superfamily also contains the Cold Shock Domain (CSD), which is a homolog of the S1 domain; Region: S1_like; cl09927 717522004607 RNA binding site [nucleotide binding]; other site 717522004608 S1_RPS1_repeat_hs4: Ribosomal protein S1 (RPS1) domain. RPS1 is a component of the small ribosomal subunit thought to be involved in the recognition and binding of mRNA's during translation initiation. The bacterial RPS1 domain architecture consists...; Region: S1_RPS1_repeat_hs4; cd05692 717522004609 RNA binding site [nucleotide binding]; other site 717522004610 dephospho-CoA kinase/protein folding accessory domain-containing protein; Provisional; Region: coaE; PRK03333 717522004611 Dephospho-coenzyme A kinase (DPCK, EC 2.7.1.24) catalyzes the phosphorylation of dephosphocoenzyme A (dCoA) to yield CoA, which is the final step in CoA biosynthesis; Region: DPCK; cd02022 717522004612 CoA-binding site [chemical binding]; other site 717522004613 ATP-binding [chemical binding]; other site 717522004614 Uncharacterized conserved protein [Function unknown]; Region: GrpB; COG2320 717522004615 Predicted RNA-binding protein, associated with RNAses E/G family [General function prediction only]; Region: COG2306 717522004616 excinuclease ABC subunit B; Provisional; Region: PRK05298 717522004617 DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046 717522004618 Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079 717522004619 nucleotide binding region [chemical binding]; other site 717522004620 ATP-binding site [chemical binding]; other site 717522004621 Ultra-violet resistance protein B; Region: UvrB; pfam12344 717522004622 UvrB/uvrC motif; Region: UVR; pfam02151 717522004623 The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174 717522004624 Major Facilitator Superfamily; Region: MFS_1; pfam07690 717522004625 putative substrate translocation pore; other site 717522004626 Predicted membrane protein [Function unknown]; Region: COG5305 717522004627 Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293 717522004628 Ligand Binding Site [chemical binding]; other site 717522004629 Zn-dependent hydrolases, including glyoxylases [General function prediction only]; Region: GloB; COG0491 717522004630 excinuclease ABC subunit A; Reviewed; Region: uvrA; PRK00349 717522004631 ATP-binding cassette domain I of the excision repair protein UvrA; Region: ABC_UvrA_I; cd03270 717522004632 ATP-binding cassette domain I of the excision repair protein UvrA; Region: ABC_UvrA_I; cd03270 717522004633 ATP-binding cassette domain II of the excision repair protein UvrA; Region: ABC_UvrA_II; cd03271 717522004634 Phage shock protein A (IM30), suppresses sigma54-dependent transcription [Transcription / Signal transduction mechanisms]; Region: PspA; COG1842 717522004635 Predicted esterase [General function prediction only]; Region: COG0627 717522004636 lysyl-tRNA synthetase; Provisional; Region: lysS; PRK02983 717522004637 Uncharacterized conserved protein (DUF2156); Region: DUF2156; pfam09924 717522004638 LysRS_N: N-terminal, anticodon recognition domain of lysyl-tRNA synthetases (LysRS). These enzymes are homodimeric class 2b aminoacyl-tRNA synthetases (aaRSs). This domain is a beta-barrel domain (OB fold) involved in binding the tRNA anticodon stem-loop; Region: LysRS_N; cd04322 717522004639 dimer interface [polypeptide binding]; other site 717522004640 putative anticodon binding site; other site 717522004641 Class II tRNA amino-acyl synthetase-like catalytic core domain. Class II amino acyl-tRNA synthetases (aaRS) share a common fold and generally attach an amino acid to the 3' OH of ribose of the appropriate tRNA. PheRS is an exception in that it...; Region: class_II_aaRS-like_core; cl00268 717522004642 motif 1; other site 717522004643 dimer interface [polypeptide binding]; other site 717522004644 active site 717522004645 motif 2; other site 717522004646 motif 3; other site 717522004647 translation initiation factor IF-3; Reviewed; Region: infC; PRK00028 717522004648 Translation initiation factor IF-3, N-terminal domain; Region: IF3_N; pfam05198 717522004649 Translation initiation factor IF-3, C-terminal domain; Region: IF3_C; pfam00707 717522004650 50S ribosomal protein L35; Reviewed; Region: rpmI; PRK00172 717522004651 Ribosomal protein L20; Region: Ribosomal_L20; cd07026 717522004652 23S rRNA binding site [nucleotide binding]; other site 717522004653 L21 binding site [polypeptide binding]; other site 717522004654 L13 binding site [polypeptide binding]; other site 717522004655 rRNA methylases [Translation, ribosomal structure and biogenesis]; Region: SpoU; COG0566 717522004656 SpoU rRNA Methylase family; Region: SpoU_methylase; pfam00588 717522004657 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3662 717522004658 PE family; Region: PE; pfam00934 717522004659 Adenylate cyclase, family 3 (some proteins contain HAMP domain) [Signal transduction mechanisms]; Region: CyaA; COG2114 717522004660 cyclase homology domain; Region: CHD; cd07302 717522004661 nucleotidyl binding site; other site 717522004662 metal binding site [ion binding]; metal-binding site 717522004663 dimer interface [polypeptide binding]; other site 717522004664 phenylalanyl-tRNA synthetase subunit alpha; Validated; Region: pheS; PRK00488 717522004665 Aminoacyl tRNA synthetase class II, N-terminal domain; Region: Phe_tRNA-synt_N; pfam02912 717522004666 Phenylalanyl-tRNA synthetase (PheRS) alpha chain catalytic core domain. PheRS belongs to class II aminoacyl-tRNA synthetases (aaRS) based upon its structure and the presence of three characteristic sequence motifs. This domain is primarily responsible...; Region: PheRS_alpha_core; cd00496 717522004667 dimer interface [polypeptide binding]; other site 717522004668 motif 1; other site 717522004669 active site 717522004670 motif 2; other site 717522004671 motif 3; other site 717522004672 phenylalanyl-tRNA synthetase subunit beta; Reviewed; Region: pheT; PRK00629 717522004673 tRNA-binding-domain-containing prokaryotic phenylalanly tRNA synthetase (PheRS) beta chain. PheRS aminoacylate phenylalanine transfer RNAs (tRNAphe). PheRSs belong structurally to class II aminoacyl tRNA synthetases (aaRSs) but, as they aminoacylate...; Region: tRNA_bind_bactPheRS; cd02796 717522004674 putative tRNA-binding site [nucleotide binding]; other site 717522004675 B3/4 domain; Region: B3_4; pfam03483 717522004676 tRNA synthetase B5 domain; Region: B5; smart00874 717522004677 Phenylalanyl-tRNA synthetase (PheRS) beta chain core domain. PheRS belongs to class II aminoacyl-tRNA synthetases (aaRS) based upon its structure. While class II aaRSs generally aminoacylate the 3'-OH ribose of the appropriate tRNA, PheRS is an...; Region: PheRS_beta_core; cd00769 717522004678 dimer interface [polypeptide binding]; other site 717522004679 motif 1; other site 717522004680 motif 3; other site 717522004681 motif 2; other site 717522004682 Ferredoxin-fold anticodon binding domain; Region: FDX-ACB; pfam03147 717522004683 PE family; Region: PE; pfam00934 717522004684 N-acetyl-gamma-glutamyl-phosphate reductase, common form; Region: argC; TIGR01850 717522004685 Semialdehyde dehydrogenase, NAD binding domain; Region: Semialdhyde_dh; smart00859 717522004686 Ornithine acetyltransferase (OAT) family; also referred to as ArgJ. OAT catalyzes the first and fifth steps in arginine biosynthesis, coupling acetylation of glutamate with deacetylation of N-acetylornithine, which allows recycling of the acetyl group in...; Region: OAT; cd02152 717522004687 heterotetramer interface [polypeptide binding]; other site 717522004688 active site pocket [active] 717522004689 cleavage site 717522004690 AAK_NAGK-C: N-Acetyl-L-glutamate kinase - cyclic (NAGK-C) catalyzes the phosphorylation of the gamma-COOH group of N-acetyl-L-glutamate (NAG) by ATP in the second step of arginine biosynthesis found in some bacteria and photosynthetic organisms using the...; Region: AAK_NAGK-C; cd04250 717522004691 feedback inhibition sensing region; other site 717522004692 homohexameric interface [polypeptide binding]; other site 717522004693 nucleotide binding site [chemical binding]; other site 717522004694 N-acetyl-L-glutamate binding site [chemical binding]; other site 717522004695 acetylornithine aminotransferase; Provisional; Region: argD; PRK03244 717522004696 Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610 717522004697 inhibitor-cofactor binding pocket; inhibition site 717522004698 pyridoxal 5'-phosphate binding site [chemical binding]; other site 717522004699 catalytic residue [active] 717522004700 ornithine carbamoyltransferase; Provisional; Region: PRK00779 717522004701 Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding domain; Region: OTCace_N; pfam02729 717522004702 Aspartate/ornithine carbamoyltransferase, Asp/Orn binding domain; Region: OTCace; pfam00185 717522004703 arginine repressor; Provisional; Region: PRK03341 717522004704 Arginine repressor, DNA binding domain; Region: Arg_repressor; pfam01316 717522004705 Arginine repressor, C-terminal domain; Region: Arg_repressor_C; pfam02863 717522004706 argininosuccinate synthase; Provisional; Region: PRK13820 717522004707 Argininosuccinate synthase. The Argininosuccinate synthase is a urea cycle enzyme that catalyzes the penultimate step in arginine biosynthesis: the ATP-dependent ligation of citrulline to aspartate to form argininosuccinate, AMP and pyrophosphate . In...; Region: Argininosuccinate_Synthase; cd01999 717522004708 ANP binding site [chemical binding]; other site 717522004709 Substrate Binding Site II [chemical binding]; other site 717522004710 Substrate Binding Site I [chemical binding]; other site 717522004711 argininosuccinate lyase; Provisional; Region: PRK00855 717522004712 Argininosuccinate lyase (argininosuccinase, ASAL); Region: Argininosuccinate_lyase; cd01359 717522004713 active sites [active] 717522004714 tetramer interface [polypeptide binding]; other site 717522004715 Predicted naringenin-chalcone synthase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: BcsA; COG3424 717522004716 Chalcone and stilbene synthases; plant-specific polyketide synthases (PKS) and related enzymes, also called type III PKSs. PKS generate an array of different products, dependent on the nature of the starter molecule. They share a common chemical strategy; Region: CHS_like; cd00831 717522004717 malonyl-CoA binding site [chemical binding]; other site 717522004718 dimer interface [polypeptide binding]; other site 717522004719 active site 717522004720 product binding site; other site 717522004721 Polyketide synthase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3321 717522004722 polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833 717522004723 active site 717522004724 Acyl transferase domain in polyketide synthase (PKS) enzymes; Region: PKS_AT; smart00827 717522004725 Dehydratase domain in polyketide synthase (PKS) enzymes; Region: PKS_DH; smart00826 717522004726 Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931 717522004727 Enoylreductase; Region: PKS_ER; smart00829 717522004728 enoyl reductase of polyketide synthase; Region: enoyl_red; cd05195 717522004729 NAD(P) binding site [chemical binding]; other site 717522004730 beta-ketoacyl reductase (KR) domain of fatty acid synthase (FAS), subgroup 3, complex (x); Region: KR_3_FAS_SDR_x; cd08956 717522004731 This enzymatic domain is part of bacterial polyketide synthases; Region: PKS_KR; smart00822 717522004732 putative NADP binding site [chemical binding]; other site 717522004733 active site 717522004734 Phosphopantetheine attachment site; Region: PKS_PP; smart00823 717522004735 Polyketide synthase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3321 717522004736 polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833 717522004737 active site 717522004738 Acyl transferase domain in polyketide synthase (PKS) enzymes; Region: PKS_AT; smart00827 717522004739 Dehydratase domain in polyketide synthase (PKS) enzymes; Region: PKS_DH; smart00826 717522004740 Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931 717522004741 enoyl reductase of polyketide synthase; Region: enoyl_red; cd05195 717522004742 Enoylreductase; Region: PKS_ER; smart00829 717522004743 NAD(P) binding site [chemical binding]; other site 717522004744 Medium chain reductase/dehydrogenase (MDR)/zinc-dependent alcohol dehydrogenase-like family; Region: MDR; cl16912 717522004745 beta-ketoacyl reductase (KR) domain of fatty acid synthase (FAS), subgroup 3, complex (x); Region: KR_3_FAS_SDR_x; cd08956 717522004746 This enzymatic domain is part of bacterial polyketide synthases; Region: PKS_KR; smart00822 717522004747 putative NADP binding site [chemical binding]; other site 717522004748 active site 717522004749 Phosphopantetheine attachment site; Region: PKS_PP; smart00823 717522004750 Beta-ketoacyl synthase; Region: PKS_KS; smart00825 717522004751 polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833 717522004752 active site 717522004753 malonyl CoA-acyl carrier protein transacylase; Region: fabD; TIGR00128 717522004754 Acyl transferase domain in polyketide synthase (PKS) enzymes; Region: PKS_AT; smart00827 717522004755 Phosphopantetheine attachment site; Region: PKS_PP; smart00823 717522004756 Predicted naringenin-chalcone synthase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: BcsA; COG3424 717522004757 Chalcone and stilbene synthases; plant-specific polyketide synthases (PKS) and related enzymes, also called type III PKSs. PKS generate an array of different products, dependent on the nature of the starter molecule. They share a common chemical strategy; Region: CHS_like; cd00831 717522004758 malonyl-CoA binding site [chemical binding]; other site 717522004759 dimer interface [polypeptide binding]; other site 717522004760 active site 717522004761 product binding site; other site 717522004762 Cytochrome P450; Region: p450; cl12078 717522004763 Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124 717522004764 ATPase components of ABC transporters with duplicated ATPase domains [General function prediction only]; Region: Uup; COG0488 717522004765 ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221 717522004766 ABC transporter; Region: ABC_tran_2; pfam12848 717522004767 ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221 717522004768 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2343 717522004769 The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174 717522004770 putative substrate translocation pore; other site 717522004771 Transglutaminase-like enzymes, putative cysteine proteases [Amino acid transport and metabolism]; Region: COG1305 717522004772 Transglutaminase-like superfamily; Region: Transglut_core; pfam01841 717522004773 Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090 717522004774 dimerization interface [polypeptide binding]; other site 717522004775 putative DNA binding site [nucleotide binding]; other site 717522004776 putative Zn2+ binding site [ion binding]; other site 717522004777 Rhodanese Homology Domain (RHOD); an alpha beta fold domain found duplicated in the rhodanese protein. The cysteine containing enzymatically active version of the domain is also found in the Cdc25 class of protein phosphatases and a variety of proteins...; Region: RHOD; cl00125 717522004778 active site residue [active] 717522004779 cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases [Signal transduction mechanisms]; Region: Crp; COG0664 717522004780 effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038 717522004781 ligand binding site [chemical binding]; other site 717522004782 flexible hinge region; other site 717522004783 Crp-like helix-turn-helix domain; Region: HTH_Crp_2; pfam13545 717522004784 Peroxiredoxin (PRX)-like 2 family; hypothetical proteins that show sequence similarity to PRXs. Members of this group contain a CXXC motif, similar to TRX. The second cysteine in the motif corresponds to the peroxidatic cysteine of PRX, however, these...; Region: PRX_like2; cd02970 717522004785 putative catalytic residues [active] 717522004786 TlpA-like family, suppressor for copper sensitivity D protein (ScsD) and actinobacterial DsbE homolog subfamily; composed of ScsD, the DsbE homolog of Mycobacterium tuberculosis (MtbDsbE) and similar proteins, all containing a redox-active CXXC motif; Region: TlpA_like_ScsD_MtbDsbE; cd03011 717522004787 Thioredoxin-like; Region: Thioredoxin_8; pfam13905 717522004788 catalytic residues [active] 717522004789 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522004790 Acyl-CoA dehydrogenase; Region: ACAD; cl09933 717522004791 active site 717522004792 ABC-type phosphate/phosphonate transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: PhnD; COG3221 717522004793 Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134 717522004794 substrate binding pocket [chemical binding]; other site 717522004795 membrane-bound complex binding site; other site 717522004796 Predicted Fe-S oxidoreductases [General function prediction only]; Region: COG0535 717522004797 Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335 717522004798 FeS/SAM binding site; other site 717522004799 DivIVA protein; Region: DivIVA; pfam05103 717522004800 ATP synthase B/B' CF(0); Region: ATP-synt_B; cl17192 717522004801 acyl-CoA synthetase; Validated; Region: PRK07868 717522004802 PHB de-polymerase C-terminus; Region: PHB_depo_C; pfam06850 717522004803 Adenylate forming domain, Class I; Region: AFD_class_I; cl17068 717522004804 Adenylate forming domain, Class I; Region: AFD_class_I; cl17068 717522004805 acyl-activating enzyme (AAE) consensus motif; other site 717522004806 AMP binding site [chemical binding]; other site 717522004807 active site 717522004808 CoA binding site [chemical binding]; other site 717522004809 Uncharacterized conserved protein [Function unknown]; Region: COG2835 717522004810 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522004811 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522004812 ABC-type multidrug transport system, permease component [Defense mechanisms]; Region: COG0842 717522004813 ABC-2 type transporter; Region: ABC2_membrane; cl17235 717522004814 ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230 717522004815 ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system; Region: PQQ_ABC_ATP; TIGR03864 717522004816 Walker A/P-loop; other site 717522004817 ATP binding site [chemical binding]; other site 717522004818 Q-loop/lid; other site 717522004819 ABC transporter signature motif; other site 717522004820 Walker B; other site 717522004821 D-loop; other site 717522004822 H-loop/switch region; other site 717522004823 Alkyladenine DNA glycosylase catalyzes the first step in base excision repair; Region: AAG; cd00540 717522004824 active site 717522004825 DNA binding site [nucleotide binding] 717522004826 tyrosyl-tRNA synthetase; Validated; Region: PRK05912 717522004827 catalytic core domain of tyrosinyl-tRNA synthetase; Region: TyrRS_core; cd00805 717522004828 active site 717522004829 HIGH motif; other site 717522004830 dimer interface [polypeptide binding]; other site 717522004831 KMSKS motif; other site 717522004832 S4 RNA-binding domain; Region: S4; smart00363 717522004833 RNA binding surface [nucleotide binding]; other site 717522004834 Protein of unknown function (DUF732); Region: DUF732; pfam05305 717522004835 Tetratrico peptide repeat; Region: TPR_5; pfam12688 717522004836 Predicted sugar phosphatases of the HAD superfamily [Carbohydrate transport and metabolism]; Region: NagD; COG0647 717522004837 Haloacid dehalogenase-like hydrolase; Region: Hydrolase_6; pfam13344 717522004838 HAD-hyrolase-like; Region: Hydrolase_like; pfam13242 717522004839 Predicted rRNA methylase [Translation, ribosomal structure and biogenesis]; Region: COG1189 717522004840 S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site; Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165 717522004841 RNA binding surface [nucleotide binding]; other site 717522004842 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522004843 S-adenosylmethionine binding site [chemical binding]; other site 717522004844 inorganic polyphosphate/ATP-NAD kinase; Provisional; Region: ppnK; PRK03372 717522004845 ATP-NAD kinase; Region: NAD_kinase; pfam01513 717522004846 DNA repair protein RecN; Region: recN; TIGR00634 717522004847 ATP-binding cassette domain of RecN; Region: ABC_RecN; cd03241 717522004848 Walker A/P-loop; other site 717522004849 ATP binding site [chemical binding]; other site 717522004850 Q-loop/lid; other site 717522004851 ATP-binding cassette domain of RecN; Region: ABC_RecN; cd03241 717522004852 ABC transporter signature motif; other site 717522004853 Walker B; other site 717522004854 D-loop; other site 717522004855 H-loop/switch region; other site 717522004856 Uncharacterized membrane-anchored protein conserved in bacteria [Function unknown]; Region: COG4825 717522004857 Thiamine pyrophosphokinase; Region: TPK; cl08415 717522004858 Thiamine pyrophosphokinase C terminal; Region: TPPK_C; pfam12555 717522004859 Protein of unknown function (DUF3186); Region: DUF3186; pfam11382 717522004860 CTP synthetase; Validated; Region: pyrG; PRK05380 717522004861 CTP synthetase (CTPs) is a two-domain protein, which consists of an N-terminal synthetase domain and C-terminal glutaminase domain. The enzymes hydrolyze the amide bond of glutamine to ammonia and glutamate at the glutaminase domains and transfer nascent...; Region: CTGs; cd03113 717522004862 Catalytic site [active] 717522004863 active site 717522004864 UTP binding site [chemical binding]; other site 717522004865 Type 1 glutamine amidotransferase (GATase1) domain found in Cytidine Triphosphate Synthetase; Region: GATase1_CTP_Synthase; cd01746 717522004866 active site 717522004867 putative oxyanion hole; other site 717522004868 catalytic triad [active] 717522004869 ADP-ribose pyrophosphatase (ADPRase) catalyzes the hydrolysis of ADP-ribose and a variety of additional ADP-sugar conjugates to AMP and ribose-5-phosphate. Like other members of the Nudix hydrolase superfamily, it requires a divalent cation, such as Mg2+; Region: ADPRase_NUDT5; cd03424 717522004870 dimer interface [polypeptide binding]; other site 717522004871 ADP-ribose binding site [chemical binding]; other site 717522004872 active site 717522004873 nudix motif; other site 717522004874 metal binding site [ion binding]; metal-binding site 717522004875 site-specific tyrosine recombinase XerD; Reviewed; Region: xerD; PRK00283 717522004876 DNA breaking-rejoining enzymes, C-terminal catalytic domain. The DNA breaking-rejoining enzyme superfamily includes type IB topoisomerases and tyrosine recombinases that share the same fold in their catalytic domain containing six conserved active site...; Region: DNA_BRE_C; cl00213 717522004877 active site 717522004878 DNA binding site [nucleotide binding] 717522004879 Int/Topo IB signature motif; other site 717522004880 Domain of unknown function (DUF222); Region: DUF222; pfam02720 717522004881 HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085 717522004882 active site 717522004883 Predicted O-methyltransferase [General function prediction only]; Region: COG4122 717522004884 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522004885 S-adenosylmethionine binding site [chemical binding]; other site 717522004886 D-alanine/D-serine/glycine permease; Provisional; Region: PRK11049 717522004887 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522004888 PPE family; Region: PPE; pfam00823 717522004889 Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484 717522004890 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522004891 PPE family; Region: PPE; pfam00823 717522004892 Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484 717522004893 Sulfate permease and related transporters (MFS superfamily) [Inorganic ion transport and metabolism]; Region: SUL1; COG0659 717522004894 Sulfate transporter family; Region: Sulfate_transp; pfam00916 717522004895 Sulphate Transporter and Anti-Sigma factor antagonist domain of SulP-like sulfate transporters, plays a role in the function and regulation of the transport activity, proposed general NTP binding function; Region: STAS_SulP_like_sulfate_transporter; cd07042 717522004896 ATPases involved in chromosome partitioning [Cell division and chromosome partitioning]; Region: Soj; COG1192 717522004897 ParA and ParB of Caulobacter crescentus belong to a conserved family of bacterial proteins implicated in chromosome segregation. ParB binds to DNA sequences adjacent to the origin of replication and localizes to opposite cell poles shortly following the...; Region: ParA; cd02042 717522004898 P-loop; other site 717522004899 Magnesium ion binding site [ion binding]; other site 717522004900 ParA and ParB of Caulobacter crescentus belong to a conserved family of bacterial proteins implicated in chromosome segregation. ParB binds to DNA sequences adjacent to the origin of replication and localizes to opposite cell poles shortly following the...; Region: ParA; cd02042 717522004901 Magnesium ion binding site [ion binding]; other site 717522004902 Rec8/ScpA/Scc1-like protein (kleisin family) [Replication, recombination, and repair]; Region: scpA; COG1354 717522004903 Chromosome segregation and condensation protein B [DNA replication, recombination and repair]; Region: scpB; COG1386 717522004904 16S rRNA uridine-516 pseudouridylate synthase and related pseudouridylate synthases [Translation, ribosomal structure and biogenesis]; Region: RsuA; COG1187 717522004905 S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site; Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165 717522004906 RNA binding surface [nucleotide binding]; other site 717522004907 Pseudouridine synthases, RsuA subfamily; Region: PseudoU_synth_RsuA_like; cd02870 717522004908 active site 717522004909 cytidylate kinase; Provisional; Region: cmk; PRK00023 717522004910 Cytidine monophosphate kinase (CMPK) catalyzes the reversible phosphorylation of cytidine monophosphate (CMP) to produce cytidine diphosphate (CDP), using ATP as the preferred phosphoryl donor; Region: CMPK; cd02020 717522004911 CMP-binding site; other site 717522004912 The sites determining sugar specificity; other site 717522004913 GTP-binding protein Der; Reviewed; Region: PRK03003 717522004914 EngA1 GTPase contains the first domain of EngA; Region: EngA1; cd01894 717522004915 GTP/Mg2+ binding site [chemical binding]; other site 717522004916 Switch I region; other site 717522004917 G2 box; other site 717522004918 Switch II region; other site 717522004919 G3 box; other site 717522004920 G4 box; other site 717522004921 G5 box; other site 717522004922 EngA2 GTPase contains the second domain of EngA; Region: EngA2; cd01895 717522004923 G1 box; other site 717522004924 GTP/Mg2+ binding site [chemical binding]; other site 717522004925 Switch I region; other site 717522004926 G2 box; other site 717522004927 G3 box; other site 717522004928 Switch II region; other site 717522004929 G4 box; other site 717522004930 G5 box; other site 717522004931 short chain dehydrogenase; Provisional; Region: PRK07060 717522004932 classical (c) SDRs; Region: SDR_c; cd05233 717522004933 NAD(P) binding site [chemical binding]; other site 717522004934 active site 717522004935 3-hydroxyacyl-CoA dehydrogenase [Lipid metabolism]; Region: FadB; COG1250 717522004936 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain; Region: 3HCDH_N; pfam02737 717522004937 3-hydroxyacyl-CoA dehydrogenase, C-terminal domain; Region: 3HCDH; pfam00725 717522004938 Kynurenine formamidase [Amino acid transport and metabolism]; Region: COG1878 717522004939 Cupin domain; Region: Cupin_2; pfam07883 717522004940 Prokaryotic protein of unknown function (DUF849); Region: DUF849; pfam05853 717522004941 Transcriptional regulator [Transcription]; Region: IclR; COG1414 717522004942 helix_turn_helix, cAMP Regulatory protein C-terminus; DNA binding domain of prokaryotic regulatory proteins belonging to the catabolite activator protein family; Region: HTH_CRP; cd00092 717522004943 putative switch regulator; other site 717522004944 non-specific DNA interactions [nucleotide binding]; other site 717522004945 DNA binding site [nucleotide binding] 717522004946 sequence specific DNA binding site [nucleotide binding]; other site 717522004947 putative cAMP binding site [chemical binding]; other site 717522004948 Bacterial transcriptional regulator; Region: IclR; pfam01614 717522004949 PIN domain of the Pyrobaculum aerophilum Pae0151 and Pae2754 proteins and homologs; Region: PIN_Pae0151; cd09873 717522004950 putative active site [active] 717522004951 homotetrameric interface [polypeptide binding]; other site 717522004952 metal binding site [ion binding]; metal-binding site 717522004953 biotin carboxylase-like protein; Validated; Region: PRK06524 717522004954 ATP-grasp domain; Region: ATP-grasp_4; pfam13535 717522004955 Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680 717522004956 Beta-lactamase; Region: Beta-lactamase; pfam00144 717522004957 Predicted transcriptional regulators [Transcription]; Region: COG1733 717522004958 Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090 717522004959 dimerization interface [polypeptide binding]; other site 717522004960 putative DNA binding site [nucleotide binding]; other site 717522004961 putative Zn2+ binding site [ion binding]; other site 717522004962 Predicted transcriptional regulators [Transcription]; Region: COG1733 717522004963 FAD/FMN-containing dehydrogenases [Energy production and conversion]; Region: GlcD; COG0277 717522004964 FAD binding domain; Region: FAD_binding_4; pfam01565 717522004965 Berberine and berberine like; Region: BBE; pfam08031 717522004966 TIGR03086 family protein; Region: TIGR03086 717522004967 uncharacterized Actinobacterial protein TIGR03083; Region: TIGR03083 717522004968 O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315 717522004969 methyltransferase, TIGR00027 family; Region: mthyl_TIGR00027 717522004970 Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680 717522004971 Beta-lactamase; Region: Beta-lactamase; pfam00144 717522004972 succinic semialdehyde dehydrogenase; Reviewed; Region: gabD2; PRK09407 717522004973 Mycobacterium tuberculosis succinate-semialdehyde dehydrogenase 2-like; Region: ALDH_SSADH2_GabD2; cd07101 717522004974 NAD(P) binding site [chemical binding]; other site 717522004975 catalytic residues [active] 717522004976 Peroxiredoxin (PRX)-like 1 family; hypothetical proteins that show sequence similarity to PRXs. Members of this group contain a conserved cysteine that aligns to the first cysteine in the CXXC motif of TRX. This does not correspond to the peroxidatic...; Region: PRX_like1; cd02969 717522004977 putative catalytic residue [active] 717522004978 Pyruvate/2-oxoglutarate dehydrogenase complex, dihydrolipoamide acyltransferase (E2) component, and related enzymes [Energy production and conversion]; Region: AceF; COG0508 717522004979 2-oxoacid dehydrogenases acyltransferase (catalytic domain); Region: 2-oxoacid_dh; pfam00198 717522004980 Tellurite resistance protein and related permeases [Inorganic ion transport and metabolism]; Region: TehA; COG1275 717522004981 The Tellurite-resistance/Dicarboxylate Transporter (TDT) family; Region: TDT_like_1; cd09319 717522004982 gating phenylalanine in ion channel; other site 717522004983 Molybdopterin-Binding (MopB) domain of the MopB superfamily of proteins, a large, diverse, heterogeneous superfamily of enzymes that, in general, bind molybdopterin as a cofactor. The MopB domain is found in a wide variety of molybdenum- and...; Region: Molybdopterin-Binding; cl09928 717522004984 Nitrate reductase delta subunit [Energy production and conversion]; Region: NarJ; COG2180 717522004985 Nitrate reductase gamma subunit; Region: Nitrate_red_gam; pfam02665 717522004986 The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174 717522004987 nitrite extrusion protein (nitrite facilitator); Region: 2A0108; TIGR00886 717522004988 putative substrate translocation pore; other site 717522004989 Domain of unknown function (DUF1876); Region: DUF1876; pfam08962 717522004990 Sulfate permease and related transporters (MFS superfamily) [Inorganic ion transport and metabolism]; Region: SUL1; COG0659 717522004991 Sulfate transporter N-terminal domain with GLY motif; Region: Sulfate_tra_GLY; pfam13792 717522004992 Sulfate transporter family; Region: Sulfate_transp; pfam00916 717522004993 Sulphate Transporter and Anti-Sigma factor antagonist domain of SulP-like sulfate transporters, plays a role in the function and regulation of the transport activity, proposed general NTP binding function; Region: STAS_SulP_like_sulfate_transporter; cd07042 717522004994 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4423 717522004995 PIN (PilT N terminus) domain: Superfamily; Region: PIN_SF; cl14812 717522004996 putative active site [active] 717522004997 Protein tyrosine kinase; Region: Pkinase_Tyr; pfam07714 717522004998 Catalytic domain of Protein Kinases; Region: PKc; cd00180 717522004999 active site 717522005000 ATP binding site [chemical binding]; other site 717522005001 substrate binding site [chemical binding]; other site 717522005002 activation loop (A-loop); other site 717522005003 Protein-disulfide isomerase [Posttranslational modification, protein turnover, chaperones]; Region: DsbG; COG1651 717522005004 Thioredoxin; Region: Thioredoxin_4; cl17273 717522005005 Isopentenyldiphosphate isomerase [Lipid metabolism]; Region: Idi; COG1443 717522005006 Isopentenyl diphosphate (IPP) isomerase, a member of the Nudix hydrolase superfamily, is a key enzyme in the isoprenoid biosynthetic pathway. Isoprenoids comprise a large family of natural products including sterols, carotenoids, dolichols and prenylated...; Region: IPP_Isomerase; cd02885 717522005007 active site 717522005008 metal binding site [ion binding]; metal-binding site 717522005009 nudix motif; other site 717522005010 Serine/Threonine protein kinases, catalytic domain; Region: S_TKc; smart00220 717522005011 Catalytic domain of Protein Kinases; Region: PKc; cd00180 717522005012 active site 717522005013 ATP binding site [chemical binding]; other site 717522005014 substrate binding site [chemical binding]; other site 717522005015 activation loop (A-loop); other site 717522005016 FOG: FHA domain [Signal transduction mechanisms]; Region: COG1716 717522005017 Forkhead associated domain (FHA); found in eukaryotic and prokaryotic proteins. Putative nuclear signalling domain. FHA domains may bind phosphothreonine, phosphoserine and sometimes phosphotyrosine. In eukaryotes, many FHA domain-containing proteins...; Region: FHA; cd00060 717522005018 phosphopeptide binding site; other site 717522005019 FOG: FHA domain [Signal transduction mechanisms]; Region: COG1716 717522005020 Forkhead associated domain (FHA); found in eukaryotic and prokaryotic proteins. Putative nuclear signalling domain. FHA domains may bind phosphothreonine, phosphoserine and sometimes phosphotyrosine. In eukaryotes, many FHA domain-containing proteins...; Region: FHA; cd00060 717522005021 phosphopeptide binding site; other site 717522005022 Eye pigment and drug resistance transporter subfamily G of the ATP-binding cassette superfamily; Region: ABCG_EPDR; cd03213 717522005023 The Eye Pigment Precursor Transporter (EPP) Family protein; Region: 3a01204; TIGR00955 717522005024 Walker A/P-loop; other site 717522005025 ATP binding site [chemical binding]; other site 717522005026 Q-loop/lid; other site 717522005027 ABC transporter signature motif; other site 717522005028 Walker B; other site 717522005029 D-loop; other site 717522005030 H-loop/switch region; other site 717522005031 ABC-2 type transporter; Region: ABC2_membrane; pfam01061 717522005032 acyl-CoA synthetase; Provisional; Region: PRK13388 717522005033 Adenylate forming domain, Class I; Region: AFD_class_I; cl17068 717522005034 acyl-activating enzyme (AAE) consensus motif; other site 717522005035 AMP binding site [chemical binding]; other site 717522005036 active site 717522005037 CoA binding site [chemical binding]; other site 717522005038 hypothetical protein; Provisional; Region: PRK06185 717522005039 ubiquinone biosynthesis hydroxylase family protein; Provisional; Region: PRK07608; cl17314 717522005040 ubiquinone biosynthesis hydroxylase family protein; Provisional; Region: PRK07608; cl17314 717522005041 Predicted dehydrogenases and related proteins [General function prediction only]; Region: MviM; COG0673 717522005042 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522005043 PPE family; Region: PPE; pfam00823 717522005044 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522005045 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522005046 Domain of unknown function (DUF4185); Region: DUF4185; pfam13810 717522005047 Phospholipase C [Cell envelope biogenesis, outer membrane]; Region: PlcC; COG3511 717522005048 Phosphoesterase family; Region: Phosphoesterase; pfam04185 717522005049 RvD2 Region of difference RvD2, substituted region in Mycobacterium bovis BCG Pasteur, BCG Tokyo, BCG Mexico and Mycobacterium bovis AF2122/97 compared to Mycobacterium tuberculosis H37Rv2. In Mycobacterium bovis BCG Pasteur and Mycobacterium bovis AF2122/97, this region encodes genes Equivalent to Mycobacterium tuberculosis strain CDC1551, MT1800-MT1802 and complete gene for plcDand cut1. In Mycobacterium tuberculosis strain H37Rv, insertion of an IS6110 element (encoding genes Rv1756c and Rv1757c) removes genes MT1800-MT1802 and truncates plcD(Rv1555c) and cut1(Rv1758) 717522005050 Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438 717522005051 This family is most closely related to the GT1 family of glycosyltransferases. Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. The acceptor molecule can...; Region: GT1_like_2; cd03814 717522005052 sulfite oxidase; Provisional; Region: PLN00177 717522005053 Subgroup of sulfite oxidase (SO) family molybdopterin binding domains that contains conserved dimerization domain. This molybdopterin cofactor (Moco) binding domain is found in a variety of oxidoreductases, main members of this family are nitrate...; Region: SO_family_Moco_dimer; cd02110 717522005054 Moco binding site; other site 717522005055 metal coordination site [ion binding]; other site 717522005056 dimerization interface [polypeptide binding]; other site 717522005057 Transport protein; Region: actII; TIGR00833 717522005058 Cutinase; Region: Cutinase; pfam01083 717522005059 acyltransferase, WS/DGAT/MGAT; Region: acyl_WS_DGAT; TIGR02946 717522005060 Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007 717522005061 Uncharacterized conserved protein [Function unknown]; Region: COG0393 717522005062 Putative heavy-metal-binding; Region: YbjQ_1; cl00426 717522005063 RvD3 Region of difference RvD3, substituted region in Mycobacterium bovis BCG Pasteur, BCG Tokyo, BCG Mexico and Mycobacterium bovis AF2122/97 compared to Mycobacterium tuberculosis strain H37Rv. In Mycobacterium tuberculosis strain H37Rv, this region bears a copy of IS6110 while in Mycobacterium bovis BCG Pasteur and Mycobacterium bovis AF2122/97, this region encodes 2 genes, also found in Mycobacterium tuberculosis strain CDC1551, MT1812 and MT1813 717522005064 Domain of unknown function (DUF222); Region: DUF222; pfam02720 717522005065 HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085 717522005066 active site 717522005067 RD14 Region of difference RD14, deleted region in Mycobacterium bovis BCG Pasteur compared to Mycobacterium tuberculosis H37Rv2 and Mycobacterium bovis AF2122/97. Removes genes Rv1765A-Rv1772 and merges truncated genes Rv1773c and Rv1765c 717522005068 Integrase core domain; Region: rve; pfam00665 717522005069 Transcriptional regulators CsoR (copper-sensitive operon repressor), RcnR, and FrmR, and related domains; this domain superfamily was previously known as DUF156; Region: CsoR-like_DUF156; cd10148 717522005070 putative homotetramer interface [polypeptide binding]; other site 717522005071 putative homodimer interface [polypeptide binding]; other site 717522005072 putative allosteric switch controlling residues; other site 717522005073 putative metal binding site [ion binding]; other site 717522005074 putative homodimer-homodimer interface [polypeptide binding]; other site 717522005075 Uncharacterized homolog of gamma-carboxymuconolactone decarboxylase subunit [Function unknown]; Region: COG0599 717522005076 PE family; Region: PE; pfam00934 717522005077 Predicted amino acid aldolase or racemase [Amino acid transport and metabolism]; Region: COG3616 717522005078 Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzymes Similar to D-Serine Dehydratase and D-Threonine Aldolase, Unknown Group 2; Region: PLPDE_III_DSD_D-TA_like_2; cd06813 717522005079 dimer interface [polypeptide binding]; other site 717522005080 active site 717522005081 pyridoxal 5'-phosphate (PLP) binding site [chemical binding]; other site 717522005082 substrate binding site [chemical binding]; other site 717522005083 catalytic residue [active] 717522005084 Predicted aminopeptidases [General function prediction only]; Region: Iap; COG2234 717522005085 Zinc peptidases M18, M20, M28, and M42; Region: Zinc_peptidase_like; cl14876 717522005086 metal binding site [ion binding]; metal-binding site 717522005087 FAD-linked oxidoreductase; Region: bact_FAD_ox; TIGR01679 717522005088 FAD binding domain; Region: FAD_binding_4; pfam01565 717522005089 D-arabinono-1,4-lactone oxidase; Region: ALO; pfam04030 717522005090 ANTAR (AmiR and NasR transcription antitermination regulators) is an RNA-binding domain found in bacterial transcription antitermination regulatory proteins; Region: ANTAR; smart01012 717522005091 helix_turn_helix isocitrate lyase regulation; Region: HTH_ICLR; smart00346 717522005092 Transcriptional regulator [Transcription]; Region: IclR; COG1414 717522005093 Bacterial transcriptional regulator; Region: IclR; pfam01614 717522005094 FAD/FMN-containing dehydrogenases [Energy production and conversion]; Region: GlcD; COG0277 717522005095 FAD binding domain; Region: FAD_binding_4; pfam01565 717522005096 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522005097 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522005098 Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124 717522005099 Cytochrome P450; Region: p450; cl12078 717522005100 Domain of unknown function (DUF4407); Region: DUF4407; pfam14362 717522005101 4-alpha-glucanotransferase [Carbohydrate transport and metabolism]; Region: MalQ; COG1640 717522005102 Protein of unknown function (DUF690); Region: DUF690; pfam05108 717522005103 type VII secretion protein EccCa; Region: T7SS_EccC_a; TIGR03924 717522005104 FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580 717522005105 type VII secretion protein EccCb; Region: T7SS_EccC_b; TIGR03925 717522005106 FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580 717522005107 Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124 717522005108 Cytochrome P450; Region: p450; cl12078 717522005109 Ferredoxin [Energy production and conversion]; Region: Fer; COG1141 717522005110 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522005111 PPE family; Region: PPE; pfam00823 717522005112 Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484 717522005113 PE family; Region: PE; pfam00934 717522005114 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522005115 PPE family; Region: PPE; pfam00823 717522005116 Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484 717522005117 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522005118 PPE family; Region: PPE; pfam00823 717522005119 Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484 717522005120 PE family; Region: PE; pfam00934 717522005121 WXG100 family type VII secretion target; Region: WXG100_ESAT6; TIGR03930 717522005122 Proteins of 100 residues with WXG; Region: WXG100; pfam06013 717522005123 EspG family; Region: ESX-1_EspG; pfam14011 717522005124 type VII secretion integral membrane protein EccD; Region: T7SS_EccD; TIGR03920 717522005125 Peptidase domain in the S8 and S53 families; Region: Peptidases_S8_S53; cl10459 717522005126 catalytic residues [active] 717522005127 type VII secretion-associated serine protease mycosin; Region: T7SS_mycosin; TIGR03921 717522005128 Peptidase domain in the S8 and S53 families; Region: Peptidases_S8_S53; cd00306 717522005129 active site 717522005130 catalytic residues [active] 717522005131 type VII secretion protein EccE; Region: T7SS_EccE; TIGR03923 717522005132 type VII secretion AAA-ATPase EccA; Region: T7SS_EccA; TIGR03922 717522005133 The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009 717522005134 Walker A motif; other site 717522005135 ATP binding site [chemical binding]; other site 717522005136 Walker B motif; other site 717522005137 arginine finger; other site 717522005138 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522005139 PPE family; Region: PPE; pfam00823 717522005140 PE-PPE domain; Region: PE-PPE; pfam08237 717522005141 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522005142 PPE family; Region: PPE; pfam00823 717522005143 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522005144 PPE family; Region: PPE; pfam00823 717522005145 PE family; Region: PE; pfam00934 717522005146 Protein of unknown function (DUF732); Region: DUF732; pfam05305 717522005147 PE family; Region: PE; pfam00934 717522005148 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522005149 PPE family; Region: PPE; pfam00823 717522005150 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522005151 PPE family; Region: PPE; pfam00823 717522005152 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522005153 PPE family; Region: PPE; pfam00823 717522005155 Protein of unknown function (DUF732); Region: DUF732; pfam05305 717522005156 Uncharacterized membrane protein [Function unknown]; Region: SapB; COG1285 717522005157 MgtC family; Region: MgtC; pfam02308 717522005158 NADH dehydrogenase, FAD-containing subunit [Energy production and conversion]; Region: Ndh; COG1252 717522005159 NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500 717522005160 Domain of unknown function (DUF4189); Region: DUF4189; pfam13827 717522005161 Sterol desaturase [Lipid metabolism]; Region: ERG3; COG3000 717522005162 Fatty acid hydroxylase superfamily; Region: FA_hydroxylase; pfam04116 717522005163 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522005164 hypothetical protein; Validated; Region: PRK07121 717522005165 PE family; Region: PE; pfam00934 717522005166 ABC-type uncharacterized transport system, permease and ATPase components [General function prediction only]; Region: COG4178 717522005167 ABC transporter transmembrane region 2; Region: ABC_membrane_2; pfam06472 717522005168 ATP-binding cassette domain of peroxisomal transporter, subfamily D; Region: ABCD_peroxisomal_ALDP; cd03223 717522005169 hypothetical protein; Provisional; Region: PRK05858 717522005170 Pyrimidine (PYR) binding domain of POX and related proteins; Region: TPP_PYR_POX_like; cd07035 717522005171 PYR/PP interface [polypeptide binding]; other site 717522005172 dimer interface [polypeptide binding]; other site 717522005173 TPP binding site [chemical binding]; other site 717522005174 Thiamine pyrophosphate enzyme, central domain; Region: TPP_enzyme_M; pfam00205 717522005175 Thiamine pyrophosphate (TPP) family, BZL_OCoD_HPCL subfamily, TPP-binding module; composed of proteins similar to benzaldehyde lyase (BZL), oxalyl-CoA decarboxylase (OCoD) and 2-hydroxyphytanoyl-CoA lyase (2-HPCL). Pseudomonas fluorescens biovar I BZL...; Region: TPP_BZL_OCoD_HPCL; cd02004 717522005176 TPP-binding site; other site 717522005177 dimer interface [polypeptide binding]; other site 717522005178 preprotein translocase subunit SecA; Reviewed; Region: PRK12326 717522005179 SecA preprotein cross-linking domain; Region: SecA_PP_bind; pfam01043 717522005180 Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cl17351 717522005181 nucleotide binding region [chemical binding]; other site 717522005182 ATP-binding site [chemical binding]; other site 717522005183 Phosphatidylglycerophosphate synthase [Lipid metabolism]; Region: PgsA; COG0558 717522005184 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3879 717522005185 Bacterial protein of unknown function (DUF881); Region: DUF881; pfam05949 717522005186 Uncharacterized conserved protein (small basic protein) [Function unknown]; Region: Sbp; COG3856 717522005187 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3879 717522005188 Bacterial protein of unknown function (DUF881); Region: DUF881; pfam05949 717522005189 Glycine cleavage H-protein. Glycine cleavage H-proteins are part of the glycine cleavage system (GCS) found in bacteria, archea and the mitochondria of eukaryotes. GCS is a multienzyme complex consisting of 4 different components (P-, H-, T- and...; Region: GCS_H; cd06848 717522005190 lipoyl attachment site [posttranslational modification]; other site 717522005191 FOG: FHA domain [Signal transduction mechanisms]; Region: COG1716 717522005192 Forkhead associated domain (FHA); found in eukaryotic and prokaryotic proteins. Putative nuclear signalling domain. FHA domains may bind phosphothreonine, phosphoserine and sometimes phosphotyrosine. In eukaryotes, many FHA domain-containing proteins...; Region: FHA; cd00060 717522005193 phosphopeptide binding site; other site 717522005194 Helix-Turn-Helix DNA binding domain of MerR-like transcription regulators; Region: HTH_MerR-like; cd00592 717522005195 MerR HTH family regulatory protein; Region: MerR_1; pfam13411 717522005196 DNA binding residues [nucleotide binding] 717522005197 Bifunctional nuclease; Region: DNase-RNase; pfam02577 717522005198 Helix-Turn-Helix DNA binding domain of GlnR-like transcription regulators; Region: HTH_GlnR-like; cd01105 717522005199 DNA binding residues [nucleotide binding] 717522005200 MerR HTH family regulatory protein; Region: MerR_1; pfam13411 717522005201 putative dimer interface [polypeptide binding]; other site 717522005202 glycine dehydrogenase; Provisional; Region: PRK05367 717522005203 Glycine cleavage system P-protein, alpha- and beta-subunits. This family consists of Glycine cleavage system P-proteins EC:1.4.4.2 from bacterial, mammalian and plant sources. The P protein is part of the glycine decarboxylase multienzyme complex EC:2.1; Region: GDC-P; cd00613 717522005204 pyridoxal 5'-phosphate binding site [chemical binding]; other site 717522005205 tetramer interface [polypeptide binding]; other site 717522005206 catalytic residue [active] 717522005207 Glycine cleavage system P-protein, alpha- and beta-subunits. This family consists of Glycine cleavage system P-proteins EC:1.4.4.2 from bacterial, mammalian and plant sources. The P protein is part of the glycine decarboxylase multienzyme complex EC:2.1; Region: GDC-P; cd00613 717522005208 tetramer interface [polypeptide binding]; other site 717522005209 pyridoxal 5'-phosphate binding site [chemical binding]; other site 717522005210 catalytic residue [active] 717522005211 haloalkane dehalogenase; Provisional; Region: PRK03204 717522005212 Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697 717522005213 putative hydrolase, CocE/NonD family; Region: /NonD; TIGR00976 717522005214 X-Pro dipeptidyl-peptidase C-terminal non-catalytic domain; Region: PepX_C; pfam08530 717522005215 Von Willebrand factor type A (vWA) domain was originally found in the blood coagulation protein von Willebrand factor (vWF). Typically, the vWA domain is made up of approximately 200 amino acid residues folded into a classic a/b para-rossmann type of...; Region: vWFA; cl00057 717522005216 metal ion-dependent adhesion site (MIDAS); other site 717522005217 Malate synthase G (MSG), monomeric enzyme present in some bacteria. In general, malate synthase catalyzes the Claisen condensation of glyoxylate and acetyl-CoA to malyl-CoA , which hydrolyzes to malate and CoA. This reaction is part of the glyoxylate...; Region: malate_synt_G; cd00728 717522005218 active site 717522005219 PIN domain of ribonucleases (toxins), VapC, FitB, and PAE0151 of bacterial and archaeal toxin/antitoxin-like operons, and other similar homologs; Region: PIN_VapC-like; cd09861 717522005220 putative active site [active] 717522005222 Domain of unknown function DUF21; Region: DUF21; pfam01595 717522005223 This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains associated with the CorC_HlyC domain. CorC_HlyC is a transporter associated domain. This small domain is found in Na+/H+ antiporters, in proteins involved in...; Region: CBS_pair_CorC_HlyC_assoc; cd04590 717522005224 FOG: CBS domain [General function prediction only]; Region: COG0517 717522005225 Hemolysins and related proteins containing CBS domains [General function prediction only]; Region: TlyC; COG1253 717522005226 Domain of unknown function DUF21; Region: DUF21; pfam01595 717522005227 This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains associated with the CorC_HlyC domain. CorC_HlyC is a transporter associated domain. This small domain is found in Na+/H+ antiporters, in proteins involved in...; Region: CBS_pair_CorC_HlyC_assoc; cd04590 717522005228 Transporter associated domain; Region: CorC_HlyC; smart01091 717522005229 inosine 5-monophosphate dehydrogenase; Validated; Region: PRK07807 717522005230 TIM barrel proteins share a structurally conserved phosphate binding motif and in general share an eight beta/alpha closed barrel structure. Specific for this family is the conserved phosphate binding site at the edges of strands 7 and 8. The phosphate...; Region: TIM_phosphate_binding; cl17186 717522005231 The CBS domain, named after human CBS, is a small domain originally identified in cystathionine beta-synthase and is subsequently found in a wide range of different proteins. CBS domains usually occur in tandem repeats. They associate to form a so-called...; Region: CBS_pair; cd02205 717522005232 IMPDH: The catalytic domain of the inosine monophosphate dehydrogenase. IMPDH catalyzes the NAD-dependent oxidation of inosine 5'-monophosphate (IMP) to xanthosine 5' monophosphate (XMP). It is a rate-limiting step in the de novo synthesis of...; Region: IMPDH; cd00381 717522005233 active site 717522005234 6-phosphogluconate dehydrogenase-like protein; Reviewed; Region: PRK09599 717522005235 NAD binding domain of 6-phosphogluconate dehydrogenase; Region: NAD_binding_2; pfam03446 717522005236 6-phosphogluconate dehydrogenase, C-terminal domain; Region: 6PGD; pfam00393 717522005237 Zn-dependent protease with chaperone function [Posttranslational modification, protein turnover, chaperones]; Region: HtpX; COG0501 717522005238 Predicted transcriptional regulator [Transcription]; Region: COG3682 717522005239 PaaI_thioesterase is a tetrameric acyl-CoA thioesterase with a hot dog fold and one of several proteins responsible for phenylacetic acid (PA) degradation in bacteria. Although orthologs of PaaI exist in archaea and eukaryotes, their function has not...; Region: PaaI_thioesterase; cd03443 717522005240 CoenzymeA binding site [chemical binding]; other site 717522005241 subunit interaction site [polypeptide binding]; other site 717522005242 PHB binding site; other site 717522005243 Urease gamma-subunit; Urease is a nickel-dependent metalloenzyme that catalyzes the hydrolysis of urea to form ammonia and carbon dioxide. Nickel-dependent ureases are found in bacteria, archaea, fungi and plants. Their primary role is to allow the use...; Region: Urease_gamma; cd00390 717522005244 alpha-gamma subunit interface [polypeptide binding]; other site 717522005245 beta-gamma subunit interface [polypeptide binding]; other site 717522005246 Urease beta-subunit; Urease is a nickel-dependent metalloenzyme that catalyzes the hydrolysis of urea to form ammonia and carbon dioxide. Nickel-dependent ureases are found in bacteria, archaea, fungi and plants. Their primary role is to allow the use of...; Region: Urease_beta; cd00407 717522005247 gamma-beta subunit interface [polypeptide binding]; other site 717522005248 alpha-beta subunit interface [polypeptide binding]; other site 717522005249 urease subunit alpha; Reviewed; Region: ureC; PRK13206 717522005250 Urease alpha-subunit; Urease is a nickel-dependent metalloenzyme that catalyzes the hydrolysis of urea to form ammonia and carbon dioxide. Nickel-dependent ureases are found in bacteria, fungi and plants. Their primary role is to allow the use of...; Region: Urease_alpha; cd00375 717522005251 subunit interactions [polypeptide binding]; other site 717522005252 active site 717522005253 flap region; other site 717522005254 Urease accessory protein UreF [Posttranslational modification, protein turnover, chaperones]; Region: UreF; COG0830 717522005255 UreF; Region: UreF; pfam01730 717522005256 The Fer4_NifH superfamily contains a variety of proteins which share a common ATP-binding domain. Functionally, proteins in this superfamily use the energy from hydrolysis of NTP to transfer electron or ion; Region: Fer4_NifH; cl17203 717522005257 UreD urease accessory protein; Region: UreD; cl00530 717522005258 NADH dehydrogenase, FAD-containing subunit [Energy production and conversion]; Region: Ndh; COG1252 717522005259 Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070 717522005260 probable F420-dependent oxidoreductase, Rv1855c family; Region: F420_Rv1855c; TIGR03560 717522005261 Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cl07892 717522005262 N5,N10-methylenetetrahydromethanopterin reductase (Mer) catalyzes the reduction of N5,N10-methylenetetrahydromethanopterin with reduced coenzyme F420 to N5-methyltetrahydromethanopterin and oxidized coenzyme F420; Region: Tetrahydromethanopterin_reductase; cd01097 717522005263 classical (c) SDRs; Region: SDR_c; cd05233 717522005264 gluconate 5-dehydrogenase; Provisional; Region: PRK08213 717522005265 NAD(P) binding site [chemical binding]; other site 717522005266 active site 717522005267 ABC-type molybdate transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: ModA; COG0725 717522005268 Bacterial extracellular solute-binding protein; Region: SBP_bac_1; cl17199 717522005269 sulfate transport protein; Provisional; Region: cysT; CHL00187 717522005270 Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261 717522005271 dimer interface [polypeptide binding]; other site 717522005272 conserved gate region; other site 717522005273 putative PBP binding loops; other site 717522005274 ABC-ATPase subunit interface; other site 717522005275 ABC-type sulfate/molybdate transport systems, ATPase component [Inorganic ion transport and metabolism]; Region: CysA; COG1118 717522005276 ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201 717522005277 Walker A/P-loop; other site 717522005278 ATP binding site [chemical binding]; other site 717522005279 Q-loop/lid; other site 717522005280 ABC transporter signature motif; other site 717522005281 Walker B; other site 717522005282 D-loop; other site 717522005283 H-loop/switch region; other site 717522005284 TOBE domain; Region: TOBE; pfam03459 717522005285 Fibronectin-attachment protein (FAP); Region: FAP; pfam07174 717522005286 Predicted membrane protein [Function unknown]; Region: COG2261 717522005287 Cinnamyl alcohol dehydrogenases (CAD); Region: CAD2; cd08298 717522005288 zinc-binding alcohol dehydrogenase family protein; Region: adh_fam_2; TIGR02822 717522005289 putative NAD(P) binding site [chemical binding]; other site 717522005290 putative substrate binding site [chemical binding]; other site 717522005291 catalytic Zn binding site [ion binding]; other site 717522005292 structural Zn binding site [ion binding]; other site 717522005293 CAAX protease self-immunity; Region: Abi; pfam02517 717522005294 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2258 717522005295 MOSC domain; Region: MOSC; pfam03473 717522005296 short chain dehydrogenase; Provisional; Region: PRK07825 717522005297 classical (c) SDRs; Region: SDR_c; cd05233 717522005298 NAD(P) binding site [chemical binding]; other site 717522005299 active site 717522005300 Predicted acyl-CoA transferases/carnitine dehydratase [Energy production and conversion]; Region: CaiB; COG1804 717522005301 CoA-transferase family III; Region: CoA_transf_3; pfam02515 717522005302 Predicted acyl-CoA transferases/carnitine dehydratase [Energy production and conversion]; Region: CaiB; COG1804 717522005303 CoA-transferase family III; Region: CoA_transf_3; pfam02515 717522005304 acetyl-CoA acetyltransferase; Validated; Region: PRK08257 717522005305 Thiolase domain associated with sterol carrier protein (SCP)-x isoform and related proteins; SCP-2 has multiple roles in intracellular lipid circulation and metabolism. The N-terminal presequence in the SCP-x isoform represents a peroxisomal...; Region: SCP-x_thiolase; cd00829 717522005306 active site 717522005307 hypothetical protein; Provisional; Region: PRK12320 717522005308 Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931 717522005309 phenylpropionate dioxygenase ferredoxin reductase subunit; Provisional; Region: PRK09754 717522005310 NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500 717522005311 Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070 717522005312 Domain of unknown function (DUF385); Region: DUF385; pfam04075 717522005313 Isopentenyl diphosphate isomerase (BS_ypgA, MTH48 and related proteins) [Coenzyme transport and metabolism]; Region: idi; COG1304 717522005314 Family of homologous FMN-dependent alpha-hydroxyacid oxidizing enzymes. This family occurs in both prokaryotes and eukaryotes. Members of this family include flavocytochrome b2 (FCB2), glycolate oxidase (GOX), lactate monooxygenase (LMO), mandelate...; Region: alpha_hydroxyacid_oxid_FMN; cd02809 717522005315 active site 717522005316 substrate binding site [chemical binding]; other site 717522005317 FMN binding site [chemical binding]; other site 717522005318 putative catalytic residues [active] 717522005319 Uncharacterized conserved protein [Function unknown]; Region: COG5579 717522005320 PPOX class probable F420-dependent enzyme; Region: Rv1155_F420; TIGR03618 717522005321 Bacterioferritin (cytochrome b1) [Inorganic ion transport and metabolism]; Region: Bfr; COG2193 717522005322 Bacterioferritin, ferritin-like diiron-binding domain; Region: Bacterioferritin; cd00907 717522005323 heme binding site [chemical binding]; other site 717522005324 ferroxidase pore; other site 717522005325 ferroxidase diiron center [ion binding]; other site 717522005326 The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174 717522005327 putative substrate translocation pore; other site 717522005328 The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174 717522005329 Ribosomal protein L13. Protein L13, a large ribosomal subunit protein, is one of five proteins required for an early folding intermediate of 23S rRNA in the assembly of the large subunit. L13 is situated on the bottom of the large subunit, near the...; Region: Ribosomal_L13; cl00333 717522005330 23S rRNA interface [nucleotide binding]; other site 717522005331 L3 interface [polypeptide binding]; other site 717522005332 helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347 717522005333 Glutamine synthetase [Amino acid transport and metabolism]; Region: GlnA; COG0174 717522005334 Glutamine synthetase, catalytic domain; Region: Gln-synt_C; pfam00120 717522005335 Predicted metal-dependent hydrolase of the TIM-barrel fold [General function prediction only]; Region: COG2159 717522005336 Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124 717522005337 Cytochrome P450; Region: p450; cl12078 717522005338 Mycobacterium 19 kDa lipoprotein antigen; Region: Myco_19_kDa; pfam05481 717522005339 short chain dehydrogenase; Provisional; Region: PRK08267 717522005340 classical (c) SDR, subgroup 9; Region: SDR_c9; cd08931 717522005341 putative NAD(P) binding site [chemical binding]; other site 717522005342 active site 717522005343 START/RHO_alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) ligand-binding domain superfamily; Region: SRPBCC; cd07812 717522005344 hydrophobic ligand binding site; other site 717522005345 Transglycosylase-like domain; Region: Transglycosylas; pfam06737 717522005346 chorismate mutase; Provisional; Region: PRK09269 717522005347 chorismate mutase, putative; Region: CM_mono2; TIGR01806 717522005348 Putative esterase; Region: Esterase; pfam00756 717522005349 Leucine carboxyl methyltransferase; Region: LCM; cl01306 717522005350 O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315 717522005351 Leucine carboxyl methyltransferase; Region: LCM; cl01306 717522005352 Uncharacterized conserved protein [Function unknown]; Region: COG2353 717522005353 Nitronate monooxygenase; Region: NMO; pfam03060 717522005354 2-Nitropropane dioxygenase (NPD), one of the nitroalkane oxidizing enzyme families, catalyzes oxidative denitrification of nitroalkanes to their corresponding carbonyl compounds and nitrites. NDP is a member of the NAD(P)H-dependent flavin oxidoreductase...; Region: NPD_like; cd04730 717522005355 FMN binding site [chemical binding]; other site 717522005356 substrate binding site [chemical binding]; other site 717522005357 putative catalytic residue [active] 717522005358 Medium chain reductase/dehydrogenase (MDR)/zinc-dependent alcohol dehydrogenase-like family; Region: MDR; cl16912 717522005359 Threonine dehydrogenase and related Zn-dependent dehydrogenases [Amino acid transport and metabolism / General function prediction only]; Region: Tdh; COG1063 717522005360 Medium chain reductase/dehydrogenase (MDR)/zinc-dependent alcohol dehydrogenase-like family; Region: MDR; cl16912 717522005361 Threonine dehydrogenase and related Zn-dependent dehydrogenases [Amino acid transport and metabolism / General function prediction only]; Region: Tdh; COG1063 717522005362 NAD(P) binding site [chemical binding]; other site 717522005363 O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315 717522005364 methyltransferase, TIGR00027 family; Region: mthyl_TIGR00027 717522005365 D-tyrosyl-tRNA(Tyr) deacylase; Provisional; Region: PRK05273 717522005366 putative active site [active] 717522005367 dimerization interface [polypeptide binding]; other site 717522005368 putative tRNAtyr binding site [nucleotide binding]; other site 717522005369 Domain of unknown function DUF77; Region: DUF77; pfam01910 717522005370 Macro domain, Unknown family 2. The macro domain is a high-affinity ADP-ribose binding module found in a variety of proteins as a stand-alone domain or in combination with other domains like in histone macroH2A and some PARPs (poly ADP-ribose polymerases)...; Region: Macro_2; cd03330 717522005371 putative ADP-ribose binding site [chemical binding]; other site 717522005372 Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596 717522005373 Adenylate cyclase, family 3 (some proteins contain HAMP domain) [Signal transduction mechanisms]; Region: CyaA; COG2114 717522005374 cyclase homology domain; Region: CHD; cd07302 717522005375 nucleotidyl binding site; other site 717522005376 metal binding site [ion binding]; metal-binding site 717522005377 dimer interface [polypeptide binding]; other site 717522005378 competence damage-inducible protein A; Provisional; Region: PRK00549 717522005379 Competence-damaged protein. CinA is the first gene in the competence- inducible (cin) operon and is thought to be specifically required at some stage in the process of transformation. This domain is closely related to a domain, found in a variety of...; Region: cinA; cd00885 717522005380 putative MPT binding site; other site 717522005381 Uncharacterized protein (competence- and mitomycin-induced) [General function prediction only]; Region: CinA; COG1546 717522005382 putative sialic acid transporter; Region: 2A0112; TIGR00891 717522005383 The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174 717522005384 putative substrate translocation pore; other site 717522005385 Predicted membrane protein [Function unknown]; Region: COG1950 717522005386 Sulphate Transporter and Anti-Sigma factor antagonist) domain of anti-anti-sigma factors, key regulators of anti-sigma factors by phosphorylation; Region: STAS_anti-anti-sigma_factors; cd07043 717522005387 anti sigma factor interaction site; other site 717522005388 regulatory phosphorylation site [posttranslational modification]; other site 717522005389 Glycine/D-amino acid oxidases (deaminating) [Amino acid transport and metabolism]; Region: DadA; COG0665 717522005390 Domain of unknown function (DUF4262); Region: DUF4262; pfam14081 717522005391 catalase/hydroperoxidase HPI(I); Provisional; Region: PRK15061 717522005392 N-terminal catalytic domain of catalase-peroxidases; Region: catalase_peroxidase_1; cd00649 717522005393 dimer interface [polypeptide binding]; other site 717522005394 active site 717522005395 heme binding site [chemical binding]; other site 717522005396 C-terminal non-catalytic domain of catalase-peroxidases; Region: catalase_peroxidase_2; cd08200 717522005397 Ferric uptake regulator(Fur) and related metalloregulatory proteins; typically iron-dependent, DNA-binding repressors and activators; Region: Fur_like; cd07153 717522005398 metal binding site 2 [ion binding]; metal-binding site 717522005399 putative DNA binding helix; other site 717522005400 metal binding site 1 [ion binding]; metal-binding site 717522005401 dimer interface [polypeptide binding]; other site 717522005402 structural Zn2+ binding site [ion binding]; other site 717522005403 PhosphatidylEthanolamine-Binding Protein (PEBP) domain present in bacteria and archaea; Region: PEBP_bact_arch; cd00865 717522005404 substrate binding site [chemical binding]; other site 717522005405 PhosphatidylEthanolamine-Binding Protein (PEBP) domain present in bacteria and archaea; Region: PEBP_bact_arch; cd00865 717522005406 substrate binding site [chemical binding]; other site 717522005407 NADPH:quinone reductase and related Zn-dependent oxidoreductases [Energy production and conversion / General function prediction only]; Region: Qor; COG0604 717522005408 Medium chain dehydrogenases/reductase (MDR)/zinc-dependent alcohol dehydrogenase-like family; Region: MDR3; cd08275 717522005409 putative NAD(P) binding site [chemical binding]; other site 717522005410 Zn-dependent hydrolases, including glyoxylases [General function prediction only]; Region: GloB; COG0491 717522005411 Members of the ICL/PEPM enzyme family catalyze either P-C or C-C bond formation/cleavage. Known members are phosphoenolpyruvate mutase (PEPM), phosphonopyruvate hydrolase (PPH), carboxyPEP mutase (CPEP mutase), oxaloacetate hydrolase (OAH), isocitrate...; Region: ICL_PEPM; cd00377 717522005412 tetramer interface [polypeptide binding]; other site 717522005413 active site 717522005414 Mg2+/Mn2+ binding site [ion binding]; other site 717522005415 Members of the ICL/PEPM_KPHMT enzyme superfamily catalyze the formation and cleavage of either P-C or C-C bonds. Typical members are phosphoenolpyruvate mutase (PEPM), phosphonopyruvate hydrolase (PPH), carboxyPEP mutase (CPEP mutase), oxaloacetate...; Region: ICL_KPHMT; cl00435 717522005416 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522005417 PPE family; Region: PPE; pfam00823 717522005418 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522005419 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522005420 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522005421 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522005422 I-RD03 Region of difference I-RD03, inserted region in Mycobacterium bovis BCG Pasteur, BCG Tokyo, BCG Mexico and Mycobacterium bovis AF2122/97 compared to Mycobacterium tuberculosis H37Rv. In-frame insertion in PPE34 gene 717522005423 S-RD04 Region of difference S-RD04, inserted region in Mycobacterium bovis BCG Pasteur, BCG Tokyo, BCG Mexico and Mycobacterium bovis AF2122/97 compared to Mycobacterium tuberculosis H37Rv. In-frame insertion in PPE34 gene 717522005424 In Mycobacterium tuberculosis strain H37Rv, PPE35 exists as a single gene. In Mycobacterium bovis and in Mycobacterium bovis BCG Pasteur, BCG Tokyo and BCG Mexico, a frameshift due to a single base insertion splits PPE35 into 2 parts, PPE35a and PPE35b. Differs from Mb1952c by 1aa, T112I 717522005425 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522005426 PPE family; Region: PPE; pfam00823 717522005427 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522005428 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522005429 Pyrabactin resistance 1 (PYR1), PYR1-like (PYL), regulatory component of abscisic acid receptors (RCARs), and related proteins; Region: PYR_PYL_RCAR_like; cd07821 717522005430 putative hydrophobic ligand binding site [chemical binding]; other site 717522005431 protein interface [polypeptide binding]; other site 717522005432 gate; other site 717522005433 1-acyl-sn-glycerol-3-phosphate acyltransferase [Lipid metabolism]; Region: PlsC; COG0204 717522005434 Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: MGAT-like; Region: LPLAT_MGAT-like; cd07987 717522005435 putative acyl-acceptor binding pocket; other site 717522005436 haloacid dehalogenase-like hydrolase; Region: HAD; cl17202 717522005437 Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680 717522005438 Beta-lactamase; Region: Beta-lactamase; pfam00144 717522005439 Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680 717522005440 Beta-lactamase; Region: Beta-lactamase; pfam00144 717522005441 putative fatty-acid--CoA ligase; Provisional; Region: PRK12476 717522005442 Fatty acyl-AMP ligase (FAAL); Region: FAAL; cd05931 717522005443 acyl-activating enzyme (AAE) consensus motif; other site 717522005444 active site 717522005445 Domain of unknown function (DUF1942); Region: DUF1942; pfam09167 717522005446 Uncharacterized conserved protein [Function unknown]; Region: COG3361 717522005447 short chain dehydrogenase; Provisional; Region: PRK05867 717522005448 Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931 717522005449 NAD(P) binding site [chemical binding]; other site 717522005450 active site 717522005451 TIGR03085 family protein; Region: TIGR03085 717522005452 Putative intracellular protease/amidase [General function prediction only]; Region: ThiJ; COG0693 717522005453 Type 1 glutamine amidotransferase (GATase1)-like domain; Region: GAT_1; cl00020 717522005454 Type 1 glutamine amidotransferase (GATase1)-like domain found in a subgroup of proteins similar to PfpI from Pyrococcus furiosus; Region: GATase1_PfpI_2; cd03139 717522005455 Type 1 glutamine amidotransferase (GATase1)-like domain; Region: GAT_1; cl00020 717522005456 conserved cys residue [active] 717522005457 helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342 717522005458 Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165 717522005459 Peroxiredoxin (PRX) family, Atypical 2-cys PRX subfamily; composed of PRXs containing peroxidatic and resolving cysteines, similar to the homodimeric thiol specific antioxidant (TSA) protein also known as TRX-dependent thiol peroxidase (Tpx). Tpx is a...; Region: PRX_Atyp2cys; cd03014 717522005460 dimer interface [polypeptide binding]; other site 717522005461 catalytic triad [active] 717522005462 peroxidatic and resolving cysteines [active] 717522005463 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522005464 Acyl-CoA dehydrogenase, N-terminal domain; Region: Acyl-CoA_dh_N; pfam02771 717522005465 Acyl-CoA dehydrogenase; Region: ACAD; cd00567 717522005466 active site 717522005467 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522005468 Putative acyl-CoA dehydrogenases similar to fadE6, fadE17, and fadE26; Region: ACAD_fadE6_17_26; cd01152 717522005469 FAD binding site [chemical binding]; other site 717522005470 substrate binding site [chemical binding]; other site 717522005471 catalytic base [active] 717522005472 enoyl-CoA hydratase; Provisional; Region: PRK08290 717522005473 Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558 717522005474 substrate binding site [chemical binding]; other site 717522005475 oxyanion hole (OAH) forming residues; other site 717522005476 trimer interface [polypeptide binding]; other site 717522005477 Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cl07892 717522005478 Coenzyme F420-dependent N5,N10-methylene tetrahydromethanopterin reductase and related flavin-dependent oxidoreductases [Energy production and conversion]; Region: COG2141 717522005479 anthranilate dioxygenase reductase; Provisional; Region: antC; PRK11872 717522005480 2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207 717522005481 catalytic loop [active] 717522005482 iron binding site [ion binding]; other site 717522005483 Benzoate dioxygenase reductase (BenDO) FAD/NAD binding domain. Oxygenases oxidize hydrocarbons using dioxygen as the oxidant. As a Class I bacterial dioxygenases, benzoate dioxygenase like proteins combine an [2Fe-2S] cluster containing N-terminal...; Region: BenDO_FAD_NAD; cd06209 717522005484 FAD binding pocket [chemical binding]; other site 717522005485 FAD binding motif [chemical binding]; other site 717522005486 phosphate binding motif [ion binding]; other site 717522005487 beta-alpha-beta structure motif; other site 717522005488 NAD binding pocket [chemical binding]; other site 717522005489 Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596 717522005490 Putative lysophospholipase; Region: Hydrolase_4; pfam12146 717522005491 Flavin reductase like domain; Region: Flavin_Reduct; smart00903 717522005492 3,4-dihydroxy-2-butanone 4-phosphate synthase [Coenzyme metabolism]; Region: RibB; COG0108 717522005493 3,4-dihydroxy-2-butanone 4-phosphate synthase; Region: DHBP_synthase; pfam00926 717522005494 GTP cyclohydrolase II [Coenzyme metabolism]; Region: RibA; COG0807 717522005495 dimerization interface [polypeptide binding]; other site 717522005496 active site 717522005497 classical (c) SDR, subgroup 12; Region: SDR_c12; cd08944 717522005498 putative NAD(P) binding site [chemical binding]; other site 717522005499 active site 717522005500 homodimer interface [polypeptide binding]; other site 717522005501 Growth inhibitor [Signal transduction mechanisms]; Region: MazF; COG2337 717522005502 SEC-C motif; Region: SEC-C; pfam02810 717522005503 Domain of unknown function (DUF222); Region: DUF222; pfam02720 717522005504 HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085 717522005505 active site 717522005506 Plasmid stability protein [General function prediction only]; Region: StbC; COG4691 717522005507 Predicted nucleic acid-binding protein, contains PIN domain [General function prediction only]; Region: VapC; COG1487 717522005508 Phage derived protein Gp49-like (DUF891); Region: Gp49; pfam05973 717522005509 Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093 717522005510 non-specific DNA binding site [nucleotide binding]; other site 717522005511 salt bridge; other site 717522005512 sequence-specific DNA binding site [nucleotide binding]; other site 717522005513 Plasmid stabilization system protein [General function prediction only]; Region: ParE; COG3668 717522005514 Uncharacterized protein family (UPF0156); Region: RHH_2; pfam03693 717522005515 PIN domain of the hypothetical protein MT3492 of Mycobacterium tuberculosis CDC1551 and other uncharacterized, annotated PilT protein domain proteins; Region: PIN_MT3492; cd09874 717522005516 putative active site [active] 717522005517 Antitoxin of toxin-antitoxin stability system [Cell division and chromosome partitioning]; Region: Phd; COG4118 717522005518 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522005519 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522005520 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522005521 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522005522 Permease; Region: Permease; cl00510 717522005523 RD7 Region of difference RD7, deleted region in Mycobacterium bovis BCG Pasteur, BCG Tokyo, BCG Mexico and Mycobacterium bovis AF2122/97 compared to Mycobacterium tuberculosis H37Rv. Removes genes Rv1965-Rv1977 and truncates genes Rv1964 and Rv1978 717522005524 Ribosomal RNA adenine dimethylases; Region: rADc; smart00650 717522005525 RD2 Region of Difference RD2, deleted region in Mycobacterium bovis BCG Pasteur and BCG Mexico compared to Mycobacterium tuberculosis H37Rv2 and Mycobacterium bovis AF2122/97. Removes genes Rv1979-Rv1987, and merges truncated part of Rv1978 and Rv1988 717522005526 Uncharacterized conserved protein [Function unknown]; Region: COG5654 717522005527 putative toxin-antitoxin system antitoxin component, TIGR02293 family; Region: TAS_TIGR02293 717522005528 Protein of unknown function (DUF2384); Region: DUF2384; pfam09722 717522005529 Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931 717522005530 Growth inhibitor [Signal transduction mechanisms]; Region: MazF; COG2337 717522005531 heavy metal-(Cd/Co/Hg/Pb/Zn)-translocating P-type ATPase; Region: ATPase-IB2_Cd; TIGR01512 717522005532 E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122 717522005533 Protein of unknown function (DUF1490); Region: DUF1490; pfam07371 717522005534 Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090 717522005535 dimerization interface [polypeptide binding]; other site 717522005536 putative DNA binding site [nucleotide binding]; other site 717522005537 putative Zn2+ binding site [ion binding]; other site 717522005538 Hemerythrin-like domain; Region: Hr-like; cd12108 717522005539 Fe binding site [ion binding]; other site 717522005540 Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293 717522005541 Ligand Binding Site [chemical binding]; other site 717522005542 Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293 717522005543 Ligand Binding Site [chemical binding]; other site 717522005544 Cation transport ATPase [Inorganic ion transport and metabolism]; Region: MgtA; COG0474 717522005545 Cation transporter/ATPase, N-terminus; Region: Cation_ATPase_N; smart00831 717522005546 E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122 717522005547 Putative hydrolase of sodium-potassium ATPase alpha subunit; Region: Hydrolase_like2; pfam13246 717522005548 Soluble P-type ATPase [General function prediction only]; Region: COG4087 717522005549 Cation transporting ATPase, C-terminus; Region: Cation_ATPase_C; pfam00689 717522005550 Members of the ICL/PEPM enzyme family catalyze either P-C or C-C bond formation/cleavage. Known members are phosphoenolpyruvate mutase (PEPM), phosphonopyruvate hydrolase (PPH), carboxyPEP mutase (CPEP mutase), oxaloacetate hydrolase (OAH), isocitrate...; Region: ICL_PEPM; cd00377 717522005551 Phosphoenolpyruvate phosphomutase; Region: PEP_mutase; pfam13714 717522005552 tetramer interface [polypeptide binding]; other site 717522005553 active site 717522005554 Mg2+/Mn2+ binding site [ion binding]; other site 717522005555 Amino acid transporters [Amino acid transport and metabolism]; Region: PotE; COG0531 717522005556 Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox_3; pfam13738 717522005557 Acyl-ACP thioesterase [Lipid metabolism]; Region: FatA; COG3884 717522005558 3beta17beta hydroxysteroid dehydrogenase-like, classical (c) SDRs; Region: 3beta-17beta-HSD_like_SDR_c; cd05341 717522005559 homotetramer interface [polypeptide binding]; other site 717522005560 3-ketoacyl-(acyl-carrier-protein) reductase; Validated; Region: fabG; PRK05653 717522005561 NAD binding site [chemical binding]; other site 717522005562 homodimer interface [polypeptide binding]; other site 717522005563 active site 717522005564 Methyltransferase domain; Region: Methyltransf_23; pfam13489 717522005565 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522005566 S-adenosylmethionine binding site [chemical binding]; other site 717522005567 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2187 717522005568 Predicted kinase [General function prediction only]; Region: COG0645 717522005569 AAA domain; Region: AAA_17; pfam13207 717522005570 Universal stress protein family; Region: Usp; pfam00582 717522005571 Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293 717522005572 Ligand Binding Site [chemical binding]; other site 717522005573 beta-phosphoglucomutase family hydrolase; Region: PGMB-YQAB-SF; TIGR02009 717522005574 Trehalose-6-phosphatase [Carbohydrate transport and metabolism]; Region: OtsB; COG1877 717522005575 trehalose-6-phosphate phosphatase; Provisional; Region: PRK10187; cl17105 717522005576 Trehalose and maltose hydrolases (possible phosphorylases) [Carbohydrate transport and metabolism]; Region: ATH1; COG1554 717522005577 Glycosyl hydrolase family 65, N-terminal domain; Region: Glyco_hydro_65N; pfam03636 717522005578 Glycosyl hydrolase family 65 central catalytic domain; Region: Glyco_hydro_65m; pfam03632 717522005579 Glycosyl hydrolase family 65, C-terminal domain; Region: Glyco_hydro_65C; pfam03633 717522005580 Ferredoxin [Energy production and conversion]; Region: COG1146 717522005581 Rat sarcoma (Ras)-like superfamily of small guanosine triphosphatases (GTPases); Region: Ras_like_GTPase; cl17170 717522005582 Predicted ATPase (AAA+ superfamily) [General function prediction only]; Region: COG1373 717522005583 The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009 717522005584 Walker A motif; other site 717522005585 ATP binding site [chemical binding]; other site 717522005586 Walker B motif; other site 717522005587 arginine finger; other site 717522005588 Transcription regulator of the Arc/MetJ class [Transcription]; Region: COG5450 717522005589 PIN domain of the Rv0301 toxin of Mycobacterium tuberculosis and other uncharacterized, annotated PilT protein domain proteins; Region: PIN_MtRv0301; cd09882 717522005590 putative active site [active] 717522005591 Transcriptional regulators [Transcription]; Region: MarR; COG1846 717522005592 MarR family; Region: MarR_2; pfam12802 717522005593 Phage envelope protein [General function prediction only]; Region: COG5562 717522005594 Transposase; Region: DEDD_Tnp_IS110; pfam01548 717522005595 Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3547 717522005596 Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3547 717522005597 Transposase IS116/IS110/IS902 family; Region: Transposase_20; pfam02371 717522005598 Domain of unknown function (DUF222); Region: DUF222; pfam02720 717522005599 HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085 717522005600 active site 717522005601 Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396 717522005602 Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093 717522005603 non-specific DNA binding site [nucleotide binding]; other site 717522005604 salt bridge; other site 717522005605 sequence-specific DNA binding site [nucleotide binding]; other site 717522005606 Predicted Zn peptidase [Amino acid transport and metabolism]; Region: COG2856 717522005607 Uncharacterized conserved protein [Function unknown]; Region: COG2442 717522005608 Predicted helicase [General function prediction only]; Region: COG4889 717522005609 Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093 717522005610 Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396 717522005611 non-specific DNA binding site [nucleotide binding]; other site 717522005612 salt bridge; other site 717522005613 sequence-specific DNA binding site [nucleotide binding]; other site 717522005614 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4683 717522005615 RvD1 Region of difference RvD1, inserted region in Mycobacterium bovis BCG Pasteur, BCG Tokyo, BCG Mexico and Mycobacterium bovis AF2122/97 compared to Mycobacterium tuberculosis H37Rv. Leads to 2 extra genes, Mb2046c and Mb2047c and a longer one, Rv2024c 717522005616 Predicted helicase [General function prediction only]; Region: COG4889 717522005617 Restriction endonuclease; Region: Mrr_cat_2; pfam13156 717522005618 Type III restriction enzyme, res subunit; Region: ResIII; pfam04851 717522005619 DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046 717522005620 ATP binding site [chemical binding]; other site 717522005621 putative Mg++ binding site [ion binding]; other site 717522005622 Helicase conserved C-terminal domain; Region: Helicase_C; pfam00271 717522005623 ATP-binding site [chemical binding]; other site 717522005624 Methyltransferase domain; Region: Methyltransf_26; pfam13659 717522005625 Predicted Co/Zn/Cd cation transporters [Inorganic ion transport and metabolism]; Region: MMT1; COG0053 717522005626 cation diffusion facilitator family transporter; Region: CDF; TIGR01297 717522005627 Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293 717522005628 Ligand Binding Site [chemical binding]; other site 717522005629 Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293 717522005630 Ligand Binding Site [chemical binding]; other site 717522005631 FOG: GAF domain [Signal transduction mechanisms]; Region: FhlA; COG2203 717522005632 Domain present in phytochromes and cGMP-specific phosphodiesterases; Region: GAF; smart00065 717522005633 Signal transduction histidine kinase [Signal transduction mechanisms]; Region: COG4585 717522005634 Histidine kinase; Region: HisKA_3; pfam07730 717522005635 Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293 717522005636 Ligand Binding Site [chemical binding]; other site 717522005637 Fructose-1-phosphate kinase and related fructose-6-phosphate kinase (PfkB) [Carbohydrate transport and metabolism]; Region: FruK; COG1105 717522005638 1-phosphofructokinase (FruK), minor 6-phosphofructokinase (pfkB) and related sugar kinases. FruK plays an important role in the predominant pathway for fructose utilisation.This group also contains tagatose-6-phophate kinase, an enzyme of the tagatose...; Region: FruK_PfkB_like; cd01164 717522005639 putative substrate binding site [chemical binding]; other site 717522005640 putative ATP binding site [chemical binding]; other site 717522005641 Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223 717522005642 active site 717522005643 Erythromycin esterase homolog [General function prediction only]; Region: COG2312 717522005644 Molecular chaperone (small heat shock protein) [Posttranslational modification, protein turnover, chaperones]; Region: IbpA; COG0071 717522005645 Alpha-crystallin domain (ACD) of alpha-crystallin-type small(s) heat shock proteins (Hsps). sHsps are small stress induced proteins with monomeric masses between 12 -43 kDa, whose common feature is the Alpha-crystallin domain (ACD). sHsps are generally...; Region: ACD_sHsps-like; cd06464 717522005646 putative dimer interface [polypeptide binding]; other site 717522005647 Proteins of this family catalyze the reduction of flavin or nitrocompounds using NAD(P)H as electron donor in a obligatory two-electron transfer, utilizing FMN or FAD as cofactor. They are often found to be homodimers. Enzymes of this family are...; Region: Nitro_FMN_reductase; cl00514 717522005648 dimer interface [polypeptide binding]; other site 717522005649 Protein of unknown function (DUF3097); Region: DUF3097; pfam11296 717522005650 Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090 717522005651 putative DNA binding site [nucleotide binding]; other site 717522005652 dimerization interface [polypeptide binding]; other site 717522005653 putative Zn2+ binding site [ion binding]; other site 717522005654 Ligand-binding SRPBCC domain of Micromonospora echinospora CalC and related proteins; Region: SRPBCC_CalC; cd08891 717522005655 putative hydrophobic ligand binding site [chemical binding]; other site 717522005656 CLM binding site; other site 717522005657 L1 loop; other site 717522005658 DNA binding site [nucleotide binding] 717522005659 uncharacterized Actinobacterial protein TIGR03083; Region: TIGR03083 717522005660 Mycothiol maleylpyruvate isomerase N-terminal domain; Region: MDMPI_N; pfam11716 717522005661 MDMPI C-terminal domain; Region: MDMPI_C; pfam07398 717522005662 Predicted esterase of the alpha-beta hydrolase superfamily [General function prediction only]; Region: RssA; COG1752 717522005663 ExoU and VipD-like proteins; homologus to patatin, cPLA2, and iPLA2; Region: Pat_ExoU_VipD_like; cd07207 717522005664 nucleophile elbow; other site 717522005665 Patatins and Phospholipases; Region: Patatin_and_cPLA2; cl11396 717522005666 glycerol-3-phosphate transporter ATP-binding subunit; Provisional; Region: ugpC; PRK11650 717522005667 The N-terminal ATPase domain of the maltose transporter, MalK; Region: ABC_MalK_N; cd03301 717522005668 Walker A/P-loop; other site 717522005669 ATP binding site [chemical binding]; other site 717522005670 Q-loop/lid; other site 717522005671 ABC transporter signature motif; other site 717522005672 Walker B; other site 717522005673 D-loop; other site 717522005674 H-loop/switch region; other site 717522005675 TOBE domain; Region: TOBE_2; pfam08402 717522005676 ABC-type sugar transport system, permease component [Carbohydrate transport and metabolism]; Region: UgpE; COG0395 717522005677 Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261 717522005678 dimer interface [polypeptide binding]; other site 717522005679 conserved gate region; other site 717522005680 putative PBP binding loops; other site 717522005681 ABC-ATPase subunit interface; other site 717522005682 ABC-type spermidine/putrescine transport system, permease component II [Amino acid transport and metabolism]; Region: PotC; COG1177 717522005683 Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261 717522005684 dimer interface [polypeptide binding]; other site 717522005685 conserved gate region; other site 717522005686 putative PBP binding loops; other site 717522005687 ABC-ATPase subunit interface; other site 717522005688 Bacterial extracellular solute-binding protein; Region: SBP_bac_8; pfam13416 717522005689 Bacterial extracellular solute-binding protein; Region: SBP_bac_1; pfam01547 717522005690 Nuclear transport factor 2 (NTF2) domain; Region: NTF2; pfam02136 717522005691 Nicotinamidase/pyrazinamidase (PZase). Nicotinamidase, a ubiquitous enzyme in prokaryotes, converts nicotinamide to nicotinic acid (niacin) and ammonia, which in turn can be recycled to make nicotinamide adenine dinucleotide (NAD). The same enzyme is...; Region: nicotinamidase; cd01011 717522005692 Isochorismatase family; Region: Isochorismatase; pfam00857 717522005693 catalytic triad [active] 717522005694 metal binding site [ion binding]; metal-binding site 717522005695 conserved cis-peptide bond; other site 717522005696 Protein of Unknown function (DUF2784); Region: DUF2784; pfam10861 717522005697 Carboxylesterase type B [Lipid metabolism]; Region: PnbA; COG2272 717522005698 Esterases and lipases (includes fungal lipases, cholinesterases, etc.) These enzymes act on carboxylic esters (EC: 3.1.1.-). The catalytic apparatus involves three residues (catalytic triad): a serine, a glutamate or aspartate and a histidine.These...; Region: Esterase_lipase; cd00312 717522005699 substrate binding pocket [chemical binding]; other site 717522005700 catalytic triad [active] 717522005701 hypothetical protein; Provisional; Region: PRK05865 717522005702 Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931 717522005703 NAD(P) binding site [chemical binding]; other site 717522005704 active site 717522005705 PEP-utilising enzyme, mobile domain; Region: PEP-utilizers; pfam00391 717522005706 Polyketide synthase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3321 717522005707 polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833 717522005708 active site 717522005709 Acyl transferase domain in polyketide synthase (PKS) enzymes; Region: PKS_AT; smart00827 717522005710 Dehydratase domain in polyketide synthase (PKS) enzymes; Region: PKS_DH; smart00826 717522005711 Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931 717522005712 enoyl reductase of polyketide synthase; Region: enoyl_red; cd05195 717522005713 Enoylreductase; Region: PKS_ER; smart00829 717522005714 NAD(P) binding site [chemical binding]; other site 717522005715 beta-ketoacyl reductase (KR) domain of fatty acid synthase (FAS), subgroup 3, complex (x); Region: KR_3_FAS_SDR_x; cd08956 717522005716 This enzymatic domain is part of bacterial polyketide synthases; Region: PKS_KR; smart00822 717522005717 putative NADP binding site [chemical binding]; other site 717522005718 active site 717522005719 Phosphopantetheine attachment site; Region: PKS_PP; smart00823 717522005720 Polyketide synthase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3321 717522005721 polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833 717522005722 active site 717522005723 Acyl transferase domain in polyketide synthase (PKS) enzymes; Region: PKS_AT; smart00827 717522005724 Dehydratase domain in polyketide synthase (PKS) enzymes; Region: PKS_DH; smart00826 717522005725 Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931 717522005726 enoyl reductase of polyketide synthase; Region: enoyl_red; cd05195 717522005727 Enoylreductase; Region: PKS_ER; smart00829 717522005728 NAD(P) binding site [chemical binding]; other site 717522005729 beta-ketoacyl reductase (KR) domain of fatty acid synthase (FAS), subgroup 3, complex (x); Region: KR_3_FAS_SDR_x; cd08956 717522005730 This enzymatic domain is part of bacterial polyketide synthases; Region: PKS_KR; smart00822 717522005731 putative NADP binding site [chemical binding]; other site 717522005732 active site 717522005733 Phosphopantetheine attachment site; Region: PKS_PP; smart00823 717522005734 Domain of unknown function (DUF4109); Region: DUF4109; pfam13397 717522005735 Apolipoprotein N-acyltransferase [Cell envelope biogenesis, outer membrane]; Region: Lnt; COG0815 717522005736 Apolipoprotein N-acyl transferase (class 9 nitrilases); Region: ALP_N-acyl_transferase; cd07571 717522005737 putative active site [active] 717522005738 catalytic triad [active] 717522005739 putative dimer interface [polypeptide binding]; other site 717522005740 dolichyl-phosphate beta-D-mannosyltransferase; Region: PLN02726 717522005741 DPM1_like represents putative enzymes similar to eukaryotic DPM1; Region: DPM1_like; cd06442 717522005742 Ligand binding site; other site 717522005743 Putative Catalytic site; other site 717522005744 DXD motif; other site 717522005745 Predicted metal-dependent hydrolase with the TIM-barrel fold [General function prediction only]; Region: COG1574 717522005746 YtcJ_like metal dependent amidohydrolases. YtcJ is a Bacillus subtilis ORF of unknown function. The Arabidopsis homolog LAF3 has been identified as a factor required for photochrome A signalling; Region: YtcJ_like; cd01300 717522005747 active site 717522005748 phage T7 F exclusion suppressor FxsA; Reviewed; Region: fxsA; PRK11463 717522005749 Dienelactone hydrolase and related enzymes [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG0412 717522005750 BAAT / Acyl-CoA thioester hydrolase C terminal; Region: BAAT_C; pfam08840 717522005751 30S ribosomal protein S18; Provisional; Region: PRK13401 717522005752 30S ribosomal protein S14; Reviewed; Region: rpsN; PRK08881 717522005753 50S ribosomal protein L33; Validated; Region: rpmG; PRK00595 717522005754 50S ribosomal protein L28; Reviewed; Region: rpmB; PRK00359 717522005755 ABC-type metal ion transport system, periplasmic component/surface adhesin [Inorganic ion transport and metabolism]; Region: LraI; COG0803 717522005756 Helical backbone metal receptor (TroA-like domain). These proteins have been shown to function in the ABC transport of ferric siderophores and metal ions such as Mn2+, Fe3+, Cu2+ and/or Zn2+. Their ligand binding site is formed in the interface between...; Region: TroA-like; cl00262 717522005757 intersubunit interface [polypeptide binding]; other site 717522005758 PPOX class probable F420-dependent enzyme, Rv2061 family; Region: Rv2061_F420; TIGR03666 717522005759 cobaltochelatase subunit CobN; Reviewed; Region: cobN; PRK05989 717522005760 CobN subunit of cobaltochelatase, bchH and chlH subunits of magnesium chelatases, and similar proteins; Region: CobN_like; cd10150 717522005761 CobN subunit of cobaltochelatase, bchH and chlH subunits of magnesium chelatases, and similar proteins; Region: CobN_like; cd10150 717522005762 PemK-like protein; Region: PemK; pfam02452 717522005763 precorrin-3B synthase; Region: CobG; TIGR02435 717522005764 Nitrite/Sulfite reductase ferredoxin-like half domain; Region: NIR_SIR_ferr; pfam03460 717522005765 precorrin-8X methylmutase; Reviewed; Region: cobH; PRK08285 717522005766 Precorrin-8X methylmutase; Region: CbiC; pfam02570 717522005767 Precorrin-2 C20-methyltransferase, also named CobI or CbiL; Region: Precorrin_2_C20_MT; cd11645 717522005768 active site 717522005769 SAM binding site [chemical binding]; other site 717522005770 homodimer interface [polypeptide binding]; other site 717522005771 Precorrin-3B C(17)-methyltransferase (CobJ/CbiH); Region: Precorrin_3B_C17_MT; cd11646 717522005772 active site 717522005773 SAM binding site [chemical binding]; other site 717522005774 homodimer interface [polypeptide binding]; other site 717522005775 Methyltransferase domain; Region: Methyltransf_31; pfam13847 717522005776 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522005777 S-adenosylmethionine binding site [chemical binding]; other site 717522005778 Beta-lactamase class A [Defense mechanisms]; Region: PenP; COG2367 717522005779 Beta-lactamase enzyme family; Region: Beta-lactamase2; pfam13354 717522005780 RNA polymerase sigma factor SigC; Reviewed; Region: PRK09649 717522005781 Sigma-70 region 2; Region: Sigma70_r2; pfam04542 717522005782 Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171 717522005783 DNA binding residues [nucleotide binding] 717522005784 Precorrin-6x reductase [Coenzyme metabolism]; Region: CobK; COG2099 717522005785 Precorrin-6x reductase CbiJ/CobK; Region: CbiJ; cl00922 717522005786 Precorrin-4 C11-methyltransferase (CbiF/CobM); Region: Precorrin-4_C11-MT; cd11641 717522005787 active site 717522005788 SAM binding site [chemical binding]; other site 717522005789 homodimer interface [polypeptide binding]; other site 717522005790 Precorrin-6Y methyltransferase, the cobalamin biosynthesis enzyme CbiE; Region: Precorrin-6Y-methylase; cd11644 717522005791 active site 717522005792 SAM binding site [chemical binding]; other site 717522005793 Precorrin-6B methylase 2 [Coenzyme metabolism]; Region: CobL; COG2242 717522005794 precorrin-6Y C5,15-methyltransferase (decarboxylating), CbiT subunit; Region: CbiT; TIGR02469 717522005795 S-AdoMet dependent tetrapyrrole methylases; Region: TP_methylase; cl00304 717522005796 Catalytic domain of phosphoinositide-specific phospholipase C-like phosphodiesterases superfamily; Region: PI-PLCc_GDPD_SF; cl14615 717522005797 active site 717522005798 catalytic site [active] 717522005799 RD9 Region of Difference RD9, deleted region in Mycobacterium bovis BCG Pasteur, BCG Tokyo, BCG Mexico and Mycobacterium bovis AF2122/97 compared to Mycobacterium tuberculosis H37Rv2. Removes genes Rv2073-Rv2074 and truncates Rv2075c 717522005800 Protein of unknown function (DUF2563); Region: DUF2563; pfam10817 717522005801 Alpha/beta hydrolase; Region: Abhydrolase_8; pfam06259 717522005803 putative transposase OrfB; Reviewed; Region: PHA02517 717522005804 Serine/Threonine protein kinases, catalytic domain; Region: S_TKc; smart00220 717522005805 Catalytic domain of Protein Kinases; Region: PKc; cd00180 717522005806 active site 717522005807 ATP binding site [chemical binding]; other site 717522005808 substrate binding site [chemical binding]; other site 717522005809 activation loop (A-loop); other site 717522005810 PknH-like extracellular domain; Region: PknH_C; pfam14032 717522005811 Xaa-Pro aminopeptidase [Amino acid transport and metabolism]; Region: PepP; COG0006 717522005812 Similar to Prolidase and Aminopeptidase P. The members of this subfamily presumably catalyse hydrolysis of Xaa-Pro dipeptides and/or release of any N-terminal amino acid, including proline, that is linked with proline; Region: APP-like; cd01092 717522005813 active site 717522005814 5'-3' exonuclease, N-terminal resolvase-like domain; Region: 5_3_exonuc_N; pfam02739 717522005815 PIN domain of the 5'-3' exonuclease of Taq DNA polymerase I and homologs; Region: PIN_53EXO; cd09859 717522005816 active site 717522005817 metal binding site 1 [ion binding]; metal-binding site 717522005818 putative 5' ssDNA interaction site; other site 717522005819 metal binding site 3; metal-binding site 717522005820 metal binding site 2 [ion binding]; metal-binding site 717522005821 H3TH domain of the 5'-3' exonuclease of Taq DNA polymerase I and homologs; Region: H3TH_53EXO; cd09898 717522005822 putative DNA binding site [nucleotide binding]; other site 717522005823 putative metal binding site [ion binding]; other site 717522005824 Domain of unknown function (DUF4333); Region: DUF4333; pfam14230 717522005825 Superfamily II RNA helicase [DNA replication, recombination, and repair]; Region: COG4581 717522005826 DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046 717522005827 ATP binding site [chemical binding]; other site 717522005828 putative Mg++ binding site [ion binding]; other site 717522005829 Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079 717522005830 nucleotide binding region [chemical binding]; other site 717522005831 ATP-binding site [chemical binding]; other site 717522005832 DSHCT (NUC185) domain; Region: DSHCT; pfam08148 717522005833 Sec-independent protein secretion pathway component TatC [Intracellular trafficking and secretion]; Region: TatC; COG0805 717522005834 twin arginine translocase protein A; Provisional; Region: tatA; PRK00575 717522005835 mttA/Hcf106 family; Region: MttA_Hcf106; pfam02416 717522005836 Predicted transcriptional regulator [Transcription]; Region: COG2378 717522005837 WYL domain; Region: WYL; pfam13280 717522005838 Predicted transcriptional regulator [Transcription]; Region: COG2378 717522005839 WYL domain; Region: WYL; pfam13280 717522005840 proteasome accessory factor PafA; Region: pupylate_PafA; TIGR03686 717522005841 PE family; Region: PE; pfam00934 717522005842 Domain of unknown function (DUF222); Region: DUF222; pfam02720 717522005843 HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085 717522005844 active site 717522005845 Superfamily II DNA/RNA helicases, SNF2 family [Transcription / DNA replication, recombination, and repair]; Region: HepA; COG0553 717522005846 SNF2 Helicase protein; Region: DUF3670; pfam12419 717522005847 DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046 717522005848 ATP binding site [chemical binding]; other site 717522005849 putative Mg++ binding site [ion binding]; other site 717522005850 Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079 717522005851 nucleotide binding region [chemical binding]; other site 717522005852 ATP-binding site [chemical binding]; other site 717522005853 Uncharacterized conserved protein [Function unknown]; Region: COG4279 717522005854 PIN domain of ribonucleases (toxins), VapC, FitB, and PAE0151 of bacterial and archaeal toxin/antitoxin-like operons, and other similar homologs; Region: PIN_VapC-like; cd09861 717522005855 putative active site [active] 717522005856 PE family; Region: PE; pfam00934 717522005857 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522005858 PPE family; Region: PPE; pfam00823 717522005859 proteasome, alpha subunit, bacterial type; Region: 20S_bact_alpha; TIGR03691 717522005860 proteasome_protease_HslV. This group contains the eukaryotic proteosome alpha and beta subunits and the prokaryotic protease hslV subunit. Proteasomes are large multimeric self-compartmentalizing proteases, involved in the clearance of misfolded proteins; Region: proteasome_protease_HslV; cd01906 717522005861 active site 717522005862 proteasome, beta subunit, bacterial type; Region: 20S_bact_beta; TIGR03690 717522005863 proteasome_protease_HslV. This group contains the eukaryotic proteosome alpha and beta subunits and the prokaryotic protease hslV subunit. Proteasomes are large multimeric self-compartmentalizing proteases, involved in the clearance of misfolded proteins; Region: proteasome_protease_HslV; cd01906 717522005864 active site 717522005865 Pup-like protein; Region: Pup; pfam05639 717522005866 proteasome accessory factor PafA2; Region: pupylate_PafA2; TIGR03688 717522005867 proteasome ATPase; Region: pup_AAA; TIGR03689 717522005868 The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009 717522005869 Walker A motif; other site 717522005870 ATP binding site [chemical binding]; other site 717522005871 Walker B motif; other site 717522005872 arginine finger; other site 717522005873 Type 1 periplasmic binding fold superfamily; Region: Periplasmic_Binding_Protein_Type_1; cl10011 717522005874 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG1550 717522005875 tRNA(1-methyladenosine) methyltransferase and related methyltransferases [Translation, ribosomal structure and biogenesis]; Region: GCD14; COG2519 717522005876 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522005877 RecB family exonuclease [DNA replication, recombination, and repair]; Region: COG2887 717522005878 Predicted membrane protein [Function unknown]; Region: COG3918 717522005879 ATP phosphoribosyltransferase; Reviewed; Region: hisG; PRK00489 717522005880 ATP phosphoribosyltransferase; Region: hisG; TIGR00070 717522005881 ATP phosphoribosyltransferase, C-terminal domain; Region: HisG_C-term; TIGR03455 717522005882 Nucleoside Triphosphate Pyrophosphohydrolase (EC 3.6.1.8) MazG-like domain found in Mycobacterium tuberculosis phosphoribosyl-ATP pyrophosphohydrolase (HisE or PRATP-PH) and its bacterial homologs; Region: NTP-PPase_HisE; cd11547 717522005883 homodimer interface [polypeptide binding]; other site 717522005884 putative metal binding site [ion binding]; other site 717522005885 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522005886 PPE family; Region: PPE; pfam00823 717522005887 Methionine synthase I (cobalamin-dependent), methyltransferase domain [Amino acid transport and metabolism]; Region: MetH; COG0646 717522005888 5-methyltetrahydrofolate--homocysteine methyltransferase; Region: metH; TIGR02082 717522005889 MeTr subgroup of pterin binding enzymes. This family includes cobalamin-dependent methyltransferases such as methyltetrahydrofolate, corrinoid iron-sulfur protein methyltransferase (MeTr) and methionine synthase (MetH). Cobalamin-dependent...; Region: MeTr; cd00740 717522005890 substrate binding pocket [chemical binding]; other site 717522005891 B12 binding domain of methionine synthase. This domain binds methylcobalamin, which it uses as an intermediate methyl carrier from methyltetrahydrofolate (CH3H4folate) to homocysteine (Hcy); Region: methionine_synthase_B12_BD; cd02069 717522005892 B12 binding site [chemical binding]; other site 717522005893 cobalt ligand [ion binding]; other site 717522005894 Vitamin B12 dependent methionine synthase, activation domain; Region: Met_synt_B12; pfam02965 717522005895 PAC2 family; Region: PAC2; pfam09754 717522005896 Gamma-aminobutyrate permease and related permeases [Amino acid transport and metabolism]; Region: AnsP; COG1113 717522005897 short chain dehydrogenase; Provisional; Region: PRK05872 717522005898 classical (c) SDRs; Region: SDR_c; cd05233 717522005899 NAD(P) binding site [chemical binding]; other site 717522005900 active site 717522005901 catalytic core domain of cysteinyl tRNA synthetase; Region: CysRS_core; cd00672 717522005902 cysteinyl-tRNA synthetase; Provisional; Region: PRK12418 717522005903 active site 717522005904 HIGH motif; other site 717522005905 nucleotidyl transferase superfamily; Region: nt_trans; cl00015 717522005906 active site 717522005907 KMSKS motif; other site 717522005908 Anticodon-binding domain of cysteinyl tRNA synthetases and domain found in MshC; Region: Anticodon_Ia_Cys_like; cd07955 717522005909 putative tRNA binding surface [nucleotide binding]; other site 717522005910 CysQ, a 3'-Phosphoadenosine-5'-phosphosulfate (PAPS) 3'-phosphatase, is a bacterial member of the inositol monophosphatase family. It has been proposed that CysQ helps control intracellular levels of PAPS, which is an intermediate in...; Region: CysQ; cd01638 717522005911 active site 717522005912 Ribbon-helix-helix protein, copG family; Region: RHH_1; pfam01402 717522005913 conserved hypothetical protein; Region: TIGR03843 717522005914 conserved hypothetical protein; Region: TIGR03847 717522005915 Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067 717522005916 catalytic core [active] 717522005917 undecaprenyl-diphosphatase UppP; Region: undec_PP_bacA; TIGR00753 717522005918 dihydroorotate dehydrogenase, subfamily 2; Region: pyrD_sub2; TIGR01036 717522005919 Dihydroorotate dehydrogenase (DHOD) class 2. DHOD catalyzes the oxidation of (S)-dihydroorotate to orotate. This is the fourth step and the only redox reaction in the de novo biosynthesis of UMP, the precursor of all pyrimidine nucleotides. DHOD requires...; Region: DHOD_2_like; cd04738 717522005920 quinone interaction residues [chemical binding]; other site 717522005921 active site 717522005922 catalytic residues [active] 717522005923 FMN binding site [chemical binding]; other site 717522005924 substrate binding site [chemical binding]; other site 717522005925 PhosphatidylEthanolamine-Binding Protein (PEBP) domain present in bacteria and archaea; Region: PEBP_bact_arch; cd00865 717522005926 substrate binding site [chemical binding]; other site 717522005927 hypothetical protein; Provisional; Region: PRK07906 717522005928 M20 Peptidase, carboxypeptidase yscS-like; Region: M20_yscS_like; cd05675 717522005929 putative metal binding site [ion binding]; other site 717522005930 Plasmid stabilisation system protein; Region: Plasmid_stabil; cl17483 717522005931 putative addiction module component, TIGR02574 family; Region: stabl_TIGR02574 717522005932 Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223 717522005933 active site 717522005934 DivIVA domain; Region: DivI1A_domain; TIGR03544 717522005935 Cell division initiation protein [Cell division and chromosome partitioning]; Region: DivIVA; COG3599 717522005936 ATP synthase B/B' CF(0); Region: ATP-synt_B; cl17192 717522005937 Predicted integral membrane protein [Function unknown]; Region: COG0762 717522005938 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG1799 717522005939 Predicted enzyme with a TIM-barrel fold [General function prediction only]; Region: COG0325 717522005940 pyridoxal 5'-phosphate (PLP) binding site [chemical binding]; other site 717522005941 catalytic residue [active] 717522005942 Multicopper polyphenol oxidase (laccase) [Secondary metabolites biosynthesis, transport and catabolism]; Region: yfiH; COG1496 717522005943 uncharacterized protein, YfiH family; Region: TIGR00726 717522005944 cell division protein FtsZ; Validated; Region: PRK09330 717522005945 FtsZ is a GTPase that is similar to the eukaryotic tubulins and is essential for cell division in prokaryotes. FtsZ is capable of polymerizing in a GTP-driven process into structures similar to those formed by tubulin. FtsZ forms a ring-shaped septum at...; Region: FtsZ_type1; cd02201 717522005946 nucleotide binding site [chemical binding]; other site 717522005947 SulA interaction site; other site 717522005948 Cell division septal protein [Cell envelope biogenesis, outer membrane]; Region: FtsQ; COG1589 717522005949 POTRA domain, FtsQ-type; Region: POTRA_1; pfam08478 717522005950 Cell division protein FtsQ; Region: FtsQ; pfam03799 717522005951 UDP-N-acetylmuramate--L-alanine ligase; Provisional; Region: murC; PRK00421 717522005952 Mur ligase family, catalytic domain; Region: Mur_ligase; pfam01225 717522005953 Mur ligase middle domain; Region: Mur_ligase_M; pfam08245 717522005954 Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875 717522005955 MurG is an N-acetylglucosaminyltransferase, the last enzyme involved in the intracellular phase of peptidoglycan biosynthesis. It transfers N-acetyl-D-glucosamine (GlcNAc) from UDP-GlcNAc to the C4 hydroxyl of a lipid-linked N-acetylmuramoyl pentapeptide...; Region: GT1_MurG; cd03785 717522005956 undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase; Region: murG; TIGR01133 717522005957 active site 717522005958 homodimer interface [polypeptide binding]; other site 717522005959 cell division protein FtsW; Region: ftsW; TIGR02614 717522005960 UDP-N-acetylmuramoyl-L-alanyl-D-glutamate synthetase; Provisional; Region: murD; PRK03369 717522005961 Mur ligase middle domain; Region: Mur_ligase_M; pfam08245 717522005962 Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875 717522005963 phospho-N-acetylmuramoyl-pentapeptide-transferase; Provisional; Region: mraY; PRK00108 717522005964 Phospho-N-acetylmuramoyl-pentapeptide-transferase (mraY) is an enzyme responsible for the formation of the first lipid intermediate in the synthesis of bacterial cell wall peptidoglycan. It catalyzes the formation of...; Region: GT_MraY; cd06852 717522005965 Mg++ binding site [ion binding]; other site 717522005966 putative catalytic motif [active] 717522005967 putative substrate binding site [chemical binding]; other site 717522005968 UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase; Region: murF; TIGR01143 717522005969 Mur ligase middle domain; Region: Mur_ligase_M; pfam08245 717522005970 Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875 717522005971 UDP-N-acetylmuramoylalanyl-D-glutamate--2, 6-diaminopimelate ligase; Provisional; Region: murE; PRK00139 717522005972 Mur ligase family, catalytic domain; Region: Mur_ligase; pfam01225 717522005973 Mur ligase middle domain; Region: Mur_ligase_M; pfam08245 717522005974 Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875 717522005975 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522005976 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522005977 probable F420-dependent oxidoreductase, Rv2161c family; Region: F420_Rv2161c; TIGR03619 717522005978 Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cl07892 717522005979 N5,N10-methylenetetrahydromethanopterin reductase (Mer) catalyzes the reduction of N5,N10-methylenetetrahydromethanopterin with reduced coenzyme F420 to N5-methyltetrahydromethanopterin and oxidized coenzyme F420; Region: Tetrahydromethanopterin_reductase; cd01097 717522005980 PE family; Region: PE; pfam00934 717522005981 Cell division protein FtsI/penicillin-binding protein 2 [Cell envelope biogenesis, outer membrane]; Region: FtsI; COG0768 717522005982 Penicillin-binding Protein dimerisation domain; Region: PBP_dimer; pfam03717 717522005983 Penicillin binding protein transpeptidase domain; Region: Transpeptidase; pfam00905 717522005984 Predicted S-adenosylmethionine-dependent methyltransferase involved in cell envelope biogenesis [Cell envelope biogenesis, outer membrane]; Region: COG0275 717522005985 MraW methylase family; Region: Methyltransf_5; pfam01795 717522005986 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2001 717522005987 MraZ protein; Region: MraZ; pfam02381 717522005988 MraZ protein; Region: MraZ; pfam02381 717522005989 Protein of unknown function (DUF3040); Region: DUF3040; pfam11239 717522005990 Protein of unknown function (DUF3153); Region: DUF3153; pfam11353 717522005991 Geranylgeranyl pyrophosphate synthase [Coenzyme metabolism]; Region: IspA; COG0142 717522005992 Trans-Isoprenyl Diphosphate Synthases, head-to-tail; Region: Trans_IPPS_HT; cd00685 717522005993 substrate binding pocket [chemical binding]; other site 717522005994 chain length determination region; other site 717522005995 substrate-Mg2+ binding site; other site 717522005996 catalytic residues [active] 717522005997 aspartate-rich region 1; other site 717522005998 active site lid residues [active] 717522005999 aspartate-rich region 2; other site 717522006000 carotene biosynthesis associated membrane protein; Region: crt_membr; TIGR03459 717522006001 Serine/Threonine protein kinases, catalytic domain; Region: S_TKc; smart00220 717522006002 Catalytic domain of Protein Kinases; Region: PKc; cd00180 717522006003 active site 717522006004 ATP binding site [chemical binding]; other site 717522006005 substrate binding site [chemical binding]; other site 717522006006 Protein Kinases, catalytic domain; Region: PKc_like; cl09925 717522006007 substrate binding site [chemical binding]; other site 717522006008 activation loop (A-loop); other site 717522006009 activation loop (A-loop); other site 717522006010 Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3547 717522006011 Transposase IS116/IS110/IS902 family; Region: Transposase_20; pfam02371 717522006012 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) synthase [Amino acid transport and metabolism]; Region: AroG; COG3200 717522006013 Protein of unknown function (DUF2029); Region: DUF2029; cl09812 717522006014 1-acyl-sn-glycerol-3-phosphate acyltransferase [Lipid metabolism]; Region: PlsC; COG0204 717522006015 Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: AGPAT-like; Region: LPLAT_AGPAT-like; cd07989 717522006016 putative acyl-acceptor binding pocket; other site 717522006017 Predicted ATPase involved in chromosome partitioning [Cell division and chromosome partitioning]; Region: ArsA; COG0003 717522006018 ArsA ATPase functionas as an efflux pump located on the inner membrane of the cell. This ATP-driven oxyanion pump catalyzes the extrusion of arsenite, antimonite and arsenate. Maintenance of a low intracellular concentration of oxyanion produces...; Region: ArsA; cd02035 717522006019 DTAP/Switch II; other site 717522006020 Switch I; other site 717522006021 Ligand-binding SRPBCC domain of an uncharacterized subfamily of proteins; Region: SRPBCC_2; cd07819 717522006022 putative hydrophobic ligand binding site [chemical binding]; other site 717522006023 Adenylate forming domain, Class I; Region: AFD_class_I; cl17068 717522006024 Long-chain acyl-CoA synthetases (AMP-forming) [Lipid metabolism]; Region: FAA1; COG1022 717522006025 Long-chain fatty acid CoA synthetases and Bubblegum-like very long-chain fatty acid CoA synthetases; Region: VL_LC_FACS_like; cd05907 717522006026 acyl-activating enzyme (AAE) consensus motif; other site 717522006027 putative AMP binding site [chemical binding]; other site 717522006028 putative active site [active] 717522006029 putative CoA binding site [chemical binding]; other site 717522006030 This family is most closely related to the GT1 family of glycosyltransferases and named after YqgM in Bacillus licheniformis about which little is known. Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to...; Region: GT1_YqgM_like; cd03801 717522006031 Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438 717522006032 Peptidase MA superfamily; Region: Peptidase_MA_2; pfam13485 717522006033 Cell wall-associated hydrolases (invasion-associated proteins) [Cell envelope biogenesis, outer membrane]; Region: Spr; COG0791 717522006034 NlpC/P60 family; Region: NLPC_P60; pfam00877 717522006035 hypothetical protein; Validated; Region: PRK07883 717522006036 DEDDh 3'-5' exonuclease domain family; Region: DEDDh; cd06127 717522006037 active site 717522006038 catalytic site [active] 717522006039 substrate binding site [chemical binding]; other site 717522006040 Catalytic GIY-YIG domain of nucleotide excision repair endonucleases UvrC, Cho, and similar proteins; Region: GIY-YIG_UvrC_Cho; cd10434 717522006041 GIY-YIG motif/motif A; other site 717522006042 active site 717522006043 catalytic site [active] 717522006044 putative DNA binding site [nucleotide binding]; other site 717522006045 metal binding site [ion binding]; metal-binding site 717522006046 anthranilate phosphoribosyltransferase; Provisional; Region: trpD; PRK00188 717522006047 Glycosyl transferase family, helical bundle domain; Region: Glycos_trans_3N; pfam02885 717522006048 Glycosyl transferase family, a/b domain; Region: Glycos_transf_3; pfam00591 717522006049 Heme-copper oxidase subunit III. Heme-copper oxidases are transmembrane protein complexes in the respiratory chains of prokaryotes and mitochondria which couple the reduction of molecular oxygen to water to, proton pumping across the membrane. The...; Region: Heme_Cu_Oxidase_III_like; cd00386 717522006050 Subunit I/III interface [polypeptide binding]; other site 717522006051 Cytochrome c, mono- and diheme variants [Energy production and conversion]; Region: CccA; COG2010 717522006052 Cytochrome c; Region: Cytochrom_C; pfam00034 717522006053 Cytochrome C oxidase, cbb3-type, subunit III; Region: Cytochrome_CBB3; pfam13442 717522006054 Rieske Fe-S protein [Energy production and conversion]; Region: QcrA; COG0723 717522006055 Rieske domain; a [2Fe-2S] cluster binding domain commonly found in Rieske non-heme iron oxygenase (RO) systems such as naphthalene and biphenyl dioxygenases, as well as in plant/cyanobacterial chloroplast b6f and mitochondrial cytochrome bc(1) complexes; Region: Rieske; cd03467 717522006056 iron-sulfur cluster [ion binding]; other site 717522006057 [2Fe-2S] cluster binding site [ion binding]; other site 717522006058 Cytochrome b subunit of the bc complex [Energy production and conversion]; Region: QcrB; COG1290 717522006059 Cytochrome b (N-terminus)/b6/petB: Cytochrome b is a subunit of cytochrome bc1, an 11-subunit mitochondrial respiratory enzyme. Cytochrome b spans the mitochondrial membrane with 8 transmembrane helices (A-H) in eukaryotes. In plants and cyanobacteria; Region: Cytochrome_b_N; cl00859 717522006060 heme bH binding site [chemical binding]; other site 717522006061 intrachain domain interface; other site 717522006062 heme bL binding site [chemical binding]; other site 717522006063 interchain domain interface [polypeptide binding]; other site 717522006064 Cytochrome b(N-terminal)/b6/petB; Region: Cytochrom_B_N_2; pfam13631 717522006065 Qo binding site; other site 717522006066 Protein of unknown function (DUF2561); Region: DUF2561; pfam10812 717522006067 Mycobacterium membrane protein; Region: Mycobact_memb; pfam05423 717522006068 Cytochrome c oxidase subunit IV; Region: Cyt_c_ox_IV; pfam12270 717522006069 Heme/copper-type cytochrome/quinol oxidases, subunit 2 [Energy production and conversion]; Region: CyoA; COG1622 717522006070 Cytochrome C oxidase subunit II, periplasmic domain; Region: COX2; pfam00116 717522006071 Asparagine synthase (glutamine-hydrolyzing) [Amino acid transport and metabolism]; Region: AsnB; COG0367 717522006072 Glutamine amidotransferases class-II (GATase) asparagine synthase_B type. Asparagine synthetase B catalyses the ATP-dependent conversion of aspartate to asparagine. This enzyme is a homodimer, with each monomer composed of a glutaminase domain and a...; Region: AsnB; cd00712 717522006073 dimer interface [polypeptide binding]; other site 717522006074 active site 717522006075 The C-terminal domain of Asparagine Synthase B. This domain is always found associated n-terminal amidotransferase domain. Family members that contain this domain catalyse the conversion of aspartate to asparagine. Asparagine synthetase B catalyzes the...; Region: Asn_Synthase_B_C; cd01991 717522006076 Ligand Binding Site [chemical binding]; other site 717522006077 Molecular Tunnel; other site 717522006078 Ribokinase-like subgroup A. Found in bacteria and archaea, this subgroup is part of the ribokinase/pfkB superfamily. Its oligomerization state is unknown at this time; Region: ribokinase_group_A; cd01942 717522006079 Sugar kinases, ribokinase family [Carbohydrate transport and metabolism]; Region: RbsK; COG0524 717522006080 substrate binding site [chemical binding]; other site 717522006081 ATP binding site [chemical binding]; other site 717522006082 Fe-S cluster assembly scaffold protein [Posttranslational modification, protein turnover, chaperones]; Region: sufA; COG0316 717522006083 Glycerate kinase family; Region: Gly_kinase; pfam02595 717522006084 Protein of unknown function (DUF3043); Region: DUF3043; pfam11241 717522006085 Phosphoribosyltransferase; Region: DBI_PRT; pfam02277 717522006086 Nicotinate-nucleotide-dimethylbenzimidazole phosphoribosyltransferase (DMB-PRT), also called CobT; Region: DMB-PRT_CobT; cd02439 717522006087 putative dimer interface [polypeptide binding]; other site 717522006088 active site pocket [active] 717522006089 putative cataytic base [active] 717522006090 Cobalamin-5-phosphate synthase; Region: CobS; pfam02654 717522006091 branched-chain amino acid aminotransferase; Provisional; Region: PRK13357 717522006092 BCAT_beta_family: Branched-chain aminotransferase catalyses the transamination of the branched-chain amino acids leusine, isoleucine and valine to their respective alpha-keto acids, alpha-ketoisocaproate, alpha-keto-beta-methylvalerate and...; Region: BCAT_beta_family; cd01557 717522006093 homodimer interface [polypeptide binding]; other site 717522006094 substrate-cofactor binding pocket; other site 717522006095 catalytic residue [active] 717522006096 glycine cleavage system aminomethyltransferase T; Reviewed; Region: gcvT; PRK00389 717522006097 Glycine cleavage T-protein C-terminal barrel domain; Region: GCV_T_C; pfam08669 717522006098 cyclase homology domain; Region: CHD; cd07302 717522006099 Adenylate cyclase, family 3 (some proteins contain HAMP domain) [Signal transduction mechanisms]; Region: CyaA; COG2114 717522006100 nucleotidyl binding site; other site 717522006101 metal binding site [ion binding]; metal-binding site 717522006102 dimer interface [polypeptide binding]; other site 717522006103 multifunctional aminopeptidase A; Provisional; Region: PRK00913 717522006104 Cytosol aminopeptidase family, N-terminal and catalytic domains. Family M17 contains zinc- and manganese-dependent exopeptidases ( EC 3.4.11.1), including leucine aminopeptidase. They catalyze removal of amino acids from the N-terminus of a protein and...; Region: Peptidase_M17; cd00433 717522006105 interface (dimer of trimers) [polypeptide binding]; other site 717522006106 Substrate-binding/catalytic site; other site 717522006107 Zn-binding sites [ion binding]; other site 717522006108 short chain dehydrogenase; Validated; Region: PRK05855 717522006109 Putative lysophospholipase; Region: Hydrolase_4; pfam12146 717522006110 classical (c) SDRs; Region: SDR_c; cd05233 717522006111 NAD(P) binding site [chemical binding]; other site 717522006112 active site 717522006113 dihydrolipoamide acetyltransferase; Reviewed; Region: PRK11855 717522006114 Lipoyl domain of the dihydrolipoyl acyltransferase component (E2) of 2-oxo acid dehydrogenases. 2-oxo acid dehydrogenase multienzyme complexes, like pyruvate dehydrogenase (PDH), 2-oxoglutarate dehydrogenase (OGDH) and branched-chain 2-oxo acid...; Region: lipoyl_domain; cd06849 717522006115 E3 interaction surface; other site 717522006116 lipoyl attachment site [posttranslational modification]; other site 717522006117 Lipoyl domain of the dihydrolipoyl acyltransferase component (E2) of 2-oxo acid dehydrogenases. 2-oxo acid dehydrogenase multienzyme complexes, like pyruvate dehydrogenase (PDH), 2-oxoglutarate dehydrogenase (OGDH) and branched-chain 2-oxo acid...; Region: lipoyl_domain; cd06849 717522006118 E3 interaction surface; other site 717522006119 lipoyl attachment site [posttranslational modification]; other site 717522006120 e3 binding domain; Region: E3_binding; pfam02817 717522006121 2-oxoacid dehydrogenases acyltransferase (catalytic domain); Region: 2-oxoacid_dh; pfam00198 717522006122 atypical (a) SDRs, subgroup 8; Region: SDR_a8; cd05242 717522006123 Predicted nucleoside-diphosphate sugar epimerase [General function prediction only]; Region: COG1090 717522006124 putative NAD(P) binding site [chemical binding]; other site 717522006125 putative active site [active] 717522006126 lipoate-protein ligase B; Provisional; Region: PRK14345 717522006127 lipoyl synthase; Provisional; Region: PRK05481 717522006128 Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335 717522006129 FeS/SAM binding site; other site 717522006130 Domain of unknown function (DUF4191); Region: DUF4191; pfam13829 717522006131 RDD family; Region: RDD; pfam06271 717522006132 glutamine synthetase, type I; Region: GlnA; TIGR00653 717522006133 Glutamine synthetase, beta-Grasp domain; Region: Gln-synt_N; pfam03951 717522006134 Glutamine synthetase, catalytic domain; Region: Gln-synt_C; pfam00120 717522006135 bifunctional glutamine-synthetase adenylyltransferase/deadenyltransferase; Provisional; Region: PRK14109 717522006136 Nucleotidyltransferase (NT) domain of Escherichia coli adenylyltransferase (GlnE), Escherichia coli uridylyl transferase (GlnD), and similar proteins; Region: NT_GlnE_GlnD_like; cd05401 717522006137 metal binding triad; other site 717522006138 GlnD PII-uridylyltransferase; Region: GlnD_UR_UTase; pfam08335 717522006139 Nucleotidyltransferase (NT) domain of Escherichia coli adenylyltransferase (GlnE), Escherichia coli uridylyl transferase (GlnD), and similar proteins; Region: NT_GlnE_GlnD_like; cd05401 717522006140 metal binding triad; other site 717522006141 GlnD PII-uridylyltransferase; Region: GlnD_UR_UTase; pfam08335 717522006142 Glutamine synthetase [Amino acid transport and metabolism]; Region: GlnA; COG0174 717522006143 Glutamine synthetase, beta-Grasp domain; Region: Gln-synt_N; pfam03951 717522006144 Glutamine synthetase, catalytic domain; Region: Gln-synt_C; pfam00120 717522006145 alpha/beta hydrolase fold; Region: Abhydrolase_1; pfam00561 717522006146 TAP-like protein; Region: Abhydrolase_4; pfam08386 717522006147 alpha/beta hydrolase fold; Region: Abhydrolase_1; pfam00561 717522006148 TAP-like protein; Region: Abhydrolase_4; pfam08386 717522006149 Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007 717522006150 Ketopantoate hydroxymethyltransferase (KPHMT) is the first enzyme in the pantothenate biosynthesis pathway. Ketopantoate hydroxymethyltransferase (KPHMT) catalyzes the first committed step in the biosynthesis of pantothenate (vitamin B5), which is a...; Region: KPHMT-like; cd06557 717522006151 oligomerization interface [polypeptide binding]; other site 717522006152 active site 717522006153 metal binding site [ion binding]; metal-binding site 717522006154 CYTH-like (also known as triphosphate tunnel metalloenzyme (TTM)-like) Phosphatases; Region: CYTH-like_Pase; cd07374 717522006155 putative active site; other site 717522006156 putative metal binding residues [ion binding]; other site 717522006157 signature motif; other site 717522006158 putative triphosphate binding site [ion binding]; other site 717522006159 The CHAD domain is an alpha-helical domain functionally associated with some members of the adenylate cyclase family; Region: CHAD; smart00880 717522006160 Uncharacterized protein conserved in bacteria (DUF2086); Region: DUF2086; cl17606 717522006161 Uncharacterized protein conserved in bacteria (DUF2086); Region: DUF2086; pfam09859 717522006162 bifunctional RNase H/acid phosphatase; Provisional; Region: PRK07238 717522006163 RNAse HI family that includes Archaeal RNase HI; Region: RNase_HI_archaeal_like; cd09279 717522006164 RNA/DNA hybrid binding site [nucleotide binding]; other site 717522006165 active site 717522006166 Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067 717522006167 catalytic core [active] 717522006168 Zn-ribbon protein, possibly nucleic acid-binding [General function prediction only]; Region: COG1579 717522006169 Putative zinc ribbon domain; Region: DUF164; pfam02591 717522006170 NIF3 (NGG1p interacting factor 3); Region: NIF3; cl15371 717522006171 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3323 717522006172 Uncharacterized conserved protein [Function unknown]; Region: COG0327 717522006173 NIF3 (NGG1p interacting factor 3); Region: NIF3; pfam01784 717522006174 hypothetical protein; Provisional; Region: PRK07908 717522006175 Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609 717522006176 pyridoxal 5'-phosphate binding site [chemical binding]; other site 717522006177 homodimer interface [polypeptide binding]; other site 717522006178 catalytic residue [active] 717522006179 Predicted phosphatases [General function prediction only]; Region: Gph; COG0546 717522006180 Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427 717522006181 active site 717522006182 motif I; other site 717522006183 motif II; other site 717522006184 Low molecular weight phosphatase family; Region: LMWPc; cd00115 717522006185 Low molecular weight phosphotyrosine protein phosphatase; Region: LMWPc; pfam01451 717522006186 active site 717522006187 SURF1 superfamily. Surf1/Shy1 has been implicated in the posttranslational steps of the biogenesis of the mitochondrially-encoded Cox1 subunit of cytochrome c oxidase (complex IV). Cytochrome c oxidase (complex IV), the terminal electron-transferring...; Region: SURF1; cd06662 717522006188 cobalamin biosynthesis protein; Provisional; Region: cobD; PRK01209 717522006189 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3662 717522006190 Peroxiredoxin [Posttranslational modification, protein turnover, chaperones]; Region: AhpC; COG0450 717522006191 Peroxiredoxin (PRX) family, AhpE-like subfamily; composed of proteins similar to Mycobacterium tuberculosis AhpE. AhpE is described as a 1-cys PRX because of the absence of a resolving cysteine. The structure and sequence of AhpE, however, show greater...; Region: PRX_AhpE_like; cd03018 717522006192 dimer interface [polypeptide binding]; other site 717522006193 catalytic triad [active] 717522006194 Protein of unknown function (DUF3052); Region: DUF3052; pfam11253 717522006195 pyruvate dehydrogenase subunit E1; Reviewed; Region: aceE; PRK09405 717522006196 Thiamine pyrophosphate (TPP) family, E1 of E. coli PDC-like subfamily, TPP-binding module; composed of proteins similar to the E1 component of the Escherichia coli pyruvate dehydrogenase multienzyme complex (PDC). PDC catalyzes the oxidative...; Region: TPP_E1_EcPDC_like; cd02017 717522006197 dimer interface [polypeptide binding]; other site 717522006198 TPP-binding site [chemical binding]; other site 717522006199 Regulator of polyketide synthase expression [Signal transduction mechanisms / Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG2508 717522006200 PucR C-terminal helix-turn-helix domain; Region: HTH_30; pfam13556 717522006201 (acyl-carrier-protein) S-malonyltransferase [Lipid metabolism]; Region: FabD; COG0331 717522006202 malonyl CoA-acyl carrier protein transacylase; Region: fabD; TIGR00128 717522006203 acyl carrier protein; Provisional; Region: acpP; PRK00982 717522006204 3-oxoacyl-(acyl carrier protein) synthase II; Reviewed; Region: PRK07910 717522006205 Beta-ketoacyl-acyl carrier protein (ACP) synthase (KAS), type I and II. KASs are responsible for the elongation steps in fatty acid biosynthesis. KASIII catalyses the initial condensation and KAS I and II catalyze further elongation steps by Claisen...; Region: KAS_I_II; cd00834 717522006206 dimer interface [polypeptide binding]; other site 717522006207 active site 717522006208 3-oxoacyl-(acyl carrier protein) synthase II; Reviewed; Region: PRK07910 717522006209 Beta-ketoacyl-acyl carrier protein (ACP) synthase (KAS), type I and II. KASs are responsible for the elongation steps in fatty acid biosynthesis. KASIII catalyses the initial condensation and KAS I and II catalyze further elongation steps by Claisen...; Region: KAS_I_II; cd00834 717522006210 dimer interface [polypeptide binding]; other site 717522006211 active site 717522006212 Acetyl-CoA carboxylase, carboxyltransferase component (subunits alpha and beta) [Lipid metabolism]; Region: COG4799 717522006213 malonate decarboxylase subunit beta; Reviewed; Region: PRK07189; cl17682 717522006214 Acetyl-CoA carboxylase alpha subunit [Lipid metabolism]; Region: AccA; cl17345 717522006215 Superfamily of nucleases including Short Patch Repair (Vsr) Endonucleases, archaeal Holliday junction resolvases, MutH methy-directed DNA mismatch-repair endonucleases, and catalytic domains of many restriction endonucleases, such as EcoRI, BamHI, and...; Region: Restriction_endonuclease_like; cl00277 717522006216 Glycerol-3-phosphate dehydrogenase [Energy production and conversion]; Region: GlpA; COG0578 717522006217 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522006218 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522006219 FAD/FMN-containing dehydrogenases [Energy production and conversion]; Region: GlcD; COG0277 717522006220 FAD binding domain; Region: FAD_binding_4; pfam01565 717522006221 diacylglycerol kinase; Reviewed; Region: PRK11914 717522006222 Diacylglycerol kinase catalytic domain; Region: DAGK_cat; pfam00781 717522006223 Protein of unknown function (DUF3145); Region: DUF3145; pfam11343 717522006224 Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680 717522006225 Beta-lactamase; Region: Beta-lactamase; pfam00144 717522006226 Methyltransferase domain; Region: Methyltransf_31; pfam13847 717522006227 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522006228 S-adenosylmethionine binding site [chemical binding]; other site 717522006229 S-(hydroxymethyl)mycothiol dehydrogenase; Region: mycoS_dep_FDH; TIGR03451 717522006230 Class III alcohol dehydrogenase; Region: Zn_ADH_class_III; cd08279 717522006231 NAD binding site [chemical binding]; other site 717522006232 catalytic Zn binding site [ion binding]; other site 717522006233 substrate binding site [chemical binding]; other site 717522006234 structural Zn binding site [ion binding]; other site 717522006235 Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849 717522006236 Apolipoprotein N-acyltransferase [Cell envelope biogenesis, outer membrane]; Region: Lnt; COG0815 717522006237 Apolipoprotein N-acyl transferase (class 9 nitrilases); Region: ALP_N-acyl_transferase; cd07571 717522006238 putative active site [active] 717522006239 catalytic triad [active] 717522006240 putative dimer interface [polypeptide binding]; other site 717522006241 short chain dehydrogenase; Provisional; Region: PRK05854 717522006242 retinol dehydrogenase (retinol-DH), Light dependent Protochlorophyllide (Pchlide) OxidoReductase (LPOR) and related proteins, classical (c) SDRs; Region: retinol-DH_like_SDR_c_like; cd05327 717522006243 putative NAD(P) binding site [chemical binding]; other site 717522006244 active site 717522006245 Molecular chaperone [Posttranslational modification, protein turnover, chaperones]; Region: DnaK; COG0443 717522006246 Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cl17037 717522006247 nucleotide binding site [chemical binding]; other site 717522006248 Major Facilitator Superfamily; Region: MFS_1; pfam07690 717522006249 Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124 717522006250 Cytochrome P450; Region: p450; cl12078 717522006251 Sulfotransferase domain; Region: Sulfotransfer_1; pfam00685 717522006252 Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124 717522006253 Cytochrome P450; Region: p450; cl12078 717522006254 Septum formation; Region: Septum_form; pfam13845 717522006255 Protein of unknown function (DUF2695); Region: DUF2695; pfam10905 717522006256 Predicted membrane protein [Function unknown]; Region: COG2149 717522006257 Domain of unknown function (DUF202); Region: DUF202; pfam02656 717522006258 Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124 717522006259 Cytochrome P450; Region: p450; cl12078 717522006260 Glycerophosphodiester phosphodiesterase domain of uncharacterized bacterial protein Rv2277c and similar proteins; Region: GDPD_Rv2277c_like; cd08580 717522006261 Glycerophosphoryl diester phosphodiesterase family; Region: GDPD; pfam03009 717522006262 putative active site [active] 717522006263 catalytic site [active] 717522006264 putative metal binding site [ion binding]; other site 717522006265 glycolate oxidase, subunit GlcD; Region: glcD; TIGR00387 717522006266 FAD binding domain; Region: FAD_binding_4; pfam01565 717522006267 Phosphate/sulphate permeases [Inorganic ion transport and metabolism]; Region: PitA; COG0306 717522006268 Phosphate/sulphate permeases [Inorganic ion transport and metabolism]; Region: PitA; COG0306 717522006269 Transcriptional regulator [Transcription]; Region: LysR; COG0583 717522006270 Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126 717522006271 The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398 717522006272 dimerization interface [polypeptide binding]; other site 717522006273 Esterases and lipases (includes fungal lipases, cholinesterases, etc.) These enzymes act on carboxylic esters (EC: 3.1.1.-). The catalytic apparatus involves three residues (catalytic triad): a serine, a glutamate or aspartate and a histidine.These...; Region: Esterase_lipase; cd00312 717522006274 alpha/beta hydrolase fold; Region: Abhydrolase_3; pfam07859 717522006275 Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326 717522006276 acyltransferase, WS/DGAT/MGAT; Region: acyl_WS_DGAT; TIGR02946 717522006277 Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007 717522006278 Protein Disulfide Oxidoreductases and Other Proteins with a Thioredoxin fold; Region: Thioredoxin_like; cl00388 717522006279 Na+/H+ antiporter, bacterial form; Region: a_cpa1; TIGR00831 717522006280 CDP-diacylglycerol pyrophosphatase [Lipid metabolism]; Region: Cdh; COG2134 717522006281 Rhodanese-related sulfurtransferase [Inorganic ion transport and metabolism]; Region: SseA; COG2897 717522006282 Thiosulfate sulfurtransferase (TST), N-terminal, inactive domain. TST contains 2 copies of the Rhodanese Homology Domain; this is the 1st repeat, which does not contain the catalytically active Cys residue. The role of the 1st repeat is uncertain, but it...; Region: TST_Repeat_1; cd01448 717522006283 active site residue [active] 717522006284 Thiosulfate sulfurtransferase (TST), C-terminal, catalytic domain. TST contains 2 copies of the Rhodanese Homology Domain; this is the second repeat. Only the second repeat contains the catalytically active Cys residue; Region: TST_Repeat_2; cd01449 717522006285 active site residue [active] 717522006286 Nucleoside phosphorylase [Nucleotide transport and metabolism]; Region: Pfs; COG0775 717522006287 Bifunctional PLP-dependent enzyme with beta-cystathionase and maltose regulon repressor activities [Amino acid transport and metabolism]; Region: MalY; COG1168 717522006288 Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609 717522006289 pyridoxal 5'-phosphate binding site [chemical binding]; other site 717522006290 homodimer interface [polypeptide binding]; other site 717522006291 catalytic residue [active] 717522006292 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3196 717522006293 haloalkane dehalogenase; Provisional; Region: PRK00870 717522006294 Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660 717522006295 Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248 717522006296 active site 717522006297 catalytic tetrad [active] 717522006298 heat shock protein 90; Provisional; Region: PRK05218 717522006299 Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075 717522006300 ATP binding site [chemical binding]; other site 717522006301 Mg2+ binding site [ion binding]; other site 717522006302 G-X-G motif; other site 717522006303 Zn-dependent hydrolases, including glyoxylases [General function prediction only]; Region: GloB; COG0491 717522006304 Cutinase; Region: Cutinase; pfam01083 717522006305 Domain of unknown function (DUF1918); Region: DUF1918; pfam08940 717522006306 Predicted metal-dependent hydrolase of the TIM-barrel fold [General function prediction only]; Region: COG2159 717522006307 Uncharacterized protein containing a NRPS condensation (elongation) domain [General function prediction only]; Region: COG4908 717522006308 Uncharacterized conserved protein [Function unknown]; Region: COG0398 717522006309 SNARE associated Golgi protein; Region: SNARE_assoc; pfam09335 717522006310 Alpha/beta hydrolase family; Region: Abhydrolase_5; pfam12695 717522006311 Uncharacterized conserved protein [Function unknown]; Region: COG2442 717522006312 DNA breaking-rejoining enzymes, C-terminal catalytic domain. The DNA breaking-rejoining enzyme superfamily includes type IB topoisomerases and tyrosine recombinases that share the same fold in their catalytic domain containing six conserved active site...; Region: DNA_BRE_C; cl00213 717522006313 DNA binding site [nucleotide binding] 717522006314 active site 717522006315 Int/Topo IB signature motif; other site 717522006316 Helix-Turn-Helix DNA binding domain of truncated MerR-like proteins; Region: HTH_MerR-trunc; cd04762 717522006317 DNA binding residues [nucleotide binding] 717522006318 ATP-dependent exoDNAse (exonuclease V), alpha subunit - helicase superfamily I member [DNA replication, recombination, and repair]; Region: RecD; COG0507 717522006319 Uncharacterized conserved protein [Function unknown]; Region: COG2128 717522006320 Predicted Zn-dependent proteases and their inactivated homologs [General function prediction only]; Region: TldD; COG0312 717522006321 Predicted Zn-dependent proteases and their inactivated homologs [General function prediction only]; Region: TldD; COG0312 717522006322 Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261 717522006323 putative PBP binding loops; other site 717522006324 ABC-ATPase subunit interface; other site 717522006325 ABC-type sugar transport system, permease component [Carbohydrate transport and metabolism]; Region: UgpE; COG0395 717522006326 Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261 717522006327 dimer interface [polypeptide binding]; other site 717522006328 conserved gate region; other site 717522006329 putative PBP binding loops; other site 717522006330 ABC-ATPase subunit interface; other site 717522006331 ABC-type sugar transport system, periplasmic component [Carbohydrate transport and metabolism]; Region: UgpB; COG1653 717522006332 Bacterial extracellular solute-binding protein; Region: SBP_bac_1; pfam01547 717522006333 Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293 717522006334 Ligand Binding Site [chemical binding]; other site 717522006335 Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293 717522006336 Ligand Binding Site [chemical binding]; other site 717522006337 amino acid transporter; Region: 2A0306; TIGR00909 717522006338 C-terminus of AA_permease; Region: AA_permease_C; pfam13906 717522006339 Ornithine/acetylornithine aminotransferase [Amino acid transport and metabolism]; Region: ArgD; COG4992 717522006340 Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes. PLP combines with an alpha-amino acid to form a compound called a Schiff base or aldimine intermediate, which depending on the reaction, is the...; Region: AAT_I; cl00321 717522006341 pyridoxal 5'-phosphate binding pocket [chemical binding]; other site 717522006342 catalytic residue [active] 717522006343 Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes. PLP combines with an alpha-amino acid to form a compound called a Schiff base or aldimine intermediate, which depending on the reaction, is the...; Region: AAT_I; cl00321 717522006344 pyridoxal 5'-phosphate binding pocket [chemical binding]; other site 717522006345 Amidinotransferase; Region: Amidinotransf; pfam02274 717522006346 N-Dimethylarginine dimethylaminohydrolase [Amino acid transport and metabolism]; Region: COG1834 717522006347 helix_turn_helix ASNC type; Region: HTH_ASNC; smart00344 717522006348 Winged helix-turn-helix DNA-binding; Region: HTH_24; pfam13412 717522006349 putative DNA binding site [nucleotide binding]; other site 717522006350 putative Zn2+ binding site [ion binding]; other site 717522006351 AsnC family; Region: AsnC_trans_reg; pfam01037 717522006352 ABC-type cobalt transport system, permease component CbiQ and related transporters [Inorganic ion transport and metabolism]; Region: CbiQ; COG0619 717522006353 First domain of the ATP-binding cassette component of cobalt transport system; Region: ABC_cobalt_CbiO_domain1; cd03225 717522006354 cobalt transport protein ATP-binding subunit; Region: cbiO; TIGR01166 717522006355 Walker A/P-loop; other site 717522006356 ATP binding site [chemical binding]; other site 717522006357 Q-loop/lid; other site 717522006358 ABC transporter signature motif; other site 717522006359 Walker B; other site 717522006360 D-loop; other site 717522006361 H-loop/switch region; other site 717522006362 ABC-type cobalt transport system, ATPase component [Inorganic ion transport and metabolism]; Region: CbiO; COG1122 717522006363 First domain of the ATP-binding cassette component of cobalt transport system; Region: ABC_cobalt_CbiO_domain1; cd03225 717522006364 Walker A/P-loop; other site 717522006365 ATP binding site [chemical binding]; other site 717522006366 Q-loop/lid; other site 717522006367 ABC transporter signature motif; other site 717522006368 Walker B; other site 717522006369 D-loop; other site 717522006370 H-loop/switch region; other site 717522006371 MarR family; Region: MarR; pfam01047 717522006372 helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347 717522006373 PE family; Region: PE; pfam00934 717522006374 Nitrate/nitrite transporter [Inorganic ion transport and metabolism]; Region: NarK; COG2223 717522006375 The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174 717522006376 putative substrate translocation pore; other site 717522006377 LppP/LprE lipoprotein; Region: Lipoprotein_21; pfam14041 717522006378 Molybdopterin-Binding (MopB) domain of the MopB superfamily of proteins, a large, diverse, heterogeneous superfamily of enzymes that, in general, bind molybdopterin as a cofactor. The MopB domain is found in a wide variety of molybdenum- and...; Region: Molybdopterin-Binding; cl09928 717522006379 Ferredoxin reductase (FNR), an FAD and NAD(P) binding protein, was intially identified as a chloroplast reductase activity, catalyzing the electron transfer from reduced iron-sulfur protein ferredoxin to NADP+ as the final step in the electron transport...; Region: FNR_like; cl06868 717522006380 malate dehydrogenase; Provisional; Region: PRK13529 717522006381 Malic enzyme, N-terminal domain; Region: malic; pfam00390 717522006382 NAD(P) binding domain of malic enzyme (ME), subgroup 1; Region: NAD_bind_1_malic_enz; cd05312 717522006383 NAD(P) binding site [chemical binding]; other site 717522006384 The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174 717522006385 Major Facilitator Superfamily; Region: MFS_1; pfam07690 717522006386 putative substrate translocation pore; other site 717522006387 The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174 717522006388 putative substrate translocation pore; other site 717522006389 Cysteine synthase [Amino acid transport and metabolism]; Region: CysK; COG0031 717522006390 CBS_like: This subgroup includes Cystathionine beta-synthase (CBS) and Cysteine synthase. CBS is a unique heme-containing enzyme that catalyzes a pyridoxal 5'-phosphate (PLP)-dependent condensation of serine and homocysteine to give cystathionine; Region: CBS_like; cd01561 717522006391 dimer interface [polypeptide binding]; other site 717522006392 pyridoxal 5'-phosphate binding site [chemical binding]; other site 717522006393 catalytic residue [active] 717522006394 Serine acetyltransferase, N-terminal; Region: SATase_N; cl05762 717522006395 serine O-acetyltransferase; Region: cysE; TIGR01172 717522006396 Serine acetyltransferase (SAT): SAT catalyzes the CoA-dependent acetylation of the side chain hydroxyl group of L-serine to form O-acetylserine, as the first step of a two-step biosynthetic pathway in bacteria and plants leading to the formation of...; Region: LbH_SAT; cd03354 717522006397 trimer interface [polypeptide binding]; other site 717522006398 active site 717522006399 substrate binding site [chemical binding]; other site 717522006400 CoA binding site [chemical binding]; other site 717522006401 hypothetical protein; Provisional; Region: PRK14851 717522006402 hypothetical protein; Validated; Region: PRK08223 717522006403 Superfamily of activating enzymes (E1) of the ubiquitin-like proteins. This family includes classical ubiquitin-activating enzymes E1, ubiquitin-like (ubl) activating enzymes and other mechanistic homologes, like MoeB, Thif1 and others. The common...; Region: E1_enzyme_family; cd01483 717522006404 ATP binding site [chemical binding]; other site 717522006405 substrate interface [chemical binding]; other site 717522006406 MMPL family; Region: MMPL; pfam03176 717522006407 MMPL family; Region: MMPL; pfam03176 717522006408 Transport protein; Region: actII; TIGR00833 717522006409 PE family; Region: PE; pfam00934 717522006410 DNA primase; Validated; Region: dnaG; PRK05667 717522006411 CHC2 zinc finger; Region: zf-CHC2; pfam01807 717522006412 DNA primase catalytic core, N-terminal domain; Region: Toprim_N; pfam08275 717522006413 TOPRIM_DnaG_primases: The topoisomerase-primase (TORPIM) nucleotidyl transferase/hydrolase domain found in the active site regions of proteins similar to Escherichia coli DnaG. Primases synthesize RNA primers for the initiation of DNA replication. DnaG...; Region: TOPRIM_DnaG_primases; cd03364 717522006414 active site 717522006415 metal binding site [ion binding]; metal-binding site 717522006416 interdomain interaction site; other site 717522006417 DnaB-helicase binding domain of primase; Region: DnaB_bind; pfam10410 717522006418 DNA primase DnaG DnaB-binding; Region: DnaG_DnaB_bind; smart00766 717522006419 deoxyguanosinetriphosphate triphosphohydrolase-like protein; Provisional; Region: PRK03007 717522006420 Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077 717522006421 Zn2+ binding site [ion binding]; other site 717522006422 Mg2+ binding site [ion binding]; other site 717522006423 Phosphohydrolase-associated domain; Region: HD_assoc; pfam13286 717522006424 Repair protein; Region: Repair_PSII; pfam04536 717522006425 Proteins of 100 residues with WXG; Region: WXG100; cl02005 717522006426 PPE family; Region: PPE; pfam00823 717522006427 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522006428 PPE family; Region: PPE; pfam00823 717522006429 RD5 Region of difference RD5, deleted region in Mycobacterium bovis BCG Pasteur, BCG Tokyo, BCG Mexico and Mycobacterium bovis AF2122/97 compared to Mycobacterium tuberculosis H37Rv. Removes genes Rv2347c-Rv2352c and truncates genes Rv2346c and Rv2353c. In Mycobacterium bovis, Mycobacterium bovis BCG Pasteur, BCG Tokyo and BCG Mexico, additional recombination events occurred: -1- the loss of a copy of IS6110 which leads to the loss of Rv2354 and Rv2355. -2- Recombination between PPE39(Rv2353c) and PPE40(Rv2356c) resulting, for Mycobacterium bovis AF2122/97, in two genes, PPE71 and PPE40, and for Mycobacterium bovis BCG Pasteur, BCG Tokyo and BCG Mexico in one gene, PPE71 717522006430 N-RD5 Region of difference N-RD5, deleted region in Mycobacterium bovis BCG Pasteur, BCG Tokyo, BCG Mexico and Mycobacterium bovis AF2122/97 compared to Mycobacterium tuberculosis H37Rv. In Mycobacterium bovis, Mycobacterium bovis BCG Pasteur, BCG Tokyo and BCG Mexico, additional recombination events occurred: -1- the loss of a copy of IS6110 which lead to the loss of Rv2354 and Rv2355. -2- Recombination between PPE39 and PPE40 resulting, in Mycobacterium bovis AF2122/97, in two genes, PPE71 and PPE40. In Mycobacterium bovis BCG Pasteur, BCG Tokyo and BCG Mexico, there have been a 2579bp deletion, these have resulted in an in-frame fusion of the 5'-end of PPE40 with the 3'-end of PPE71 probably due to a homologous recombination event between codons 68 and 174 of PPE40 as the PPE40 and PPE71 genes have identical 5'-ends (first 535 bp) 717522006431 NN-RD5 Region of difference NN-RD5. Compared to Mycobacterium bovis, there has been a 2579bp deletion, this has resulted in anin-frame fusion of the 5'-end of PPE40 with the 3'-end ofPPE71 probably due to a homologous recombination event between codons 68 and 174 of PPE40 as the PPE40 and PPE71 genes have identical 5'-ends (first 535 bp). Differs from Mb2376c (PPE71) by extra 11aa, insertion of A at position 68 due to 3bp insertion (present in PPE40) and STNVGSGNIG at position 307 due to 30 bp insertion. M. bovis BCG Pasteur, BCG Tokyo and BCG Mexico, thus has three copies of tandem repeat STNVGSGNIG compared to two in Mb2376c. The 3'-end of PPE71 of M. bovis BCG Pasteur, BCG Tokyo and BCG Mexico have also been truncated as a result of the same deletion described in Mycobacterium bovis, 8963bp deletion (RD5) 717522006432 glycyl-tRNA synthetase; Provisional; Region: PRK04173 717522006433 Class II tRNA amino-acyl synthetase-like catalytic core domain. Class II amino acyl-tRNA synthetases (aaRS) share a common fold and generally attach an amino acid to the 3' OH of ribose of the appropriate tRNA. PheRS is an exception in that it...; Region: class_II_aaRS-like_core; cl00268 717522006434 motif 1; other site 717522006435 Glycyl-tRNA synthetase (GlyRS)-like class II core catalytic domain. GlyRS functions as a homodimer in eukaryotes, archaea and some bacteria and as a heterotetramer in the remainder of prokaryotes. It is responsible for the attachment of glycine to the 3...; Region: GlyRS-like_core; cd00774 717522006436 active site 717522006437 motif 2; other site 717522006438 motif 3; other site 717522006439 GlyRS Glycyl-anticodon binding domain. GlyRS belongs to class II aminoacyl-tRNA synthetases (aaRS). This alignment contains the anticodon binding domain, which is responsible for specificity in tRNA-binding, so that the activated amino acid is...; Region: GlyRS_anticodon; cd00858 717522006440 anticodon binding site; other site 717522006441 Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090 717522006442 dimerization interface [polypeptide binding]; other site 717522006443 putative DNA binding site [nucleotide binding]; other site 717522006444 putative Zn2+ binding site [ion binding]; other site 717522006445 Ferric uptake regulator(Fur) and related metalloregulatory proteins; typically iron-dependent, DNA-binding repressors and activators; Region: Fur_like; cd07153 717522006446 metal binding site 2 [ion binding]; metal-binding site 717522006447 putative DNA binding helix; other site 717522006448 metal binding site 1 [ion binding]; metal-binding site 717522006449 dimer interface [polypeptide binding]; other site 717522006450 structural Zn2+ binding site [ion binding]; other site 717522006451 Undecaprenyl pyrophosphate synthase [Lipid metabolism]; Region: UppS; COG0020 717522006452 Cis (Z)-Isoprenyl Diphosphate Synthases (cis-IPPS); homodimers which catalyze the successive 1'-4 condensation of the isopentenyl diphosphate (IPP) molecule to trans,trans-farnesyl diphosphate (FPP) or to cis,trans-FPP to form long-chain polyprenyl...; Region: CIS_IPPS; cd00475 717522006453 catalytic residue [active] 717522006454 putative FPP diphosphate binding site; other site 717522006455 putative FPP binding hydrophobic cleft; other site 717522006456 dimer interface [polypeptide binding]; other site 717522006457 putative IPP diphosphate binding site; other site 717522006458 DNA repair protein RecO; Reviewed; Region: recO; PRK00085 717522006459 Recombination protein O N terminal; Region: RecO_N; pfam11967 717522006460 Recombination protein O C terminal; Region: RecO_C; pfam02565 717522006461 amidase; Provisional; Region: PRK06061 717522006462 Amidase; Region: Amidase; pfam01425 717522006463 GTPase Era; Reviewed; Region: era; PRK00089 717522006464 E. coli Ras-like protein (Era) is a multifunctional GTPase; Region: Era; cd04163 717522006465 G1 box; other site 717522006466 GTP/Mg2+ binding site [chemical binding]; other site 717522006467 Switch I region; other site 717522006468 G2 box; other site 717522006469 Switch II region; other site 717522006470 G3 box; other site 717522006471 G4 box; other site 717522006472 G5 box; other site 717522006473 KH domain; Region: KH_2; pfam07650 717522006474 Hemolysins and related proteins containing CBS domains [General function prediction only]; Region: TlyC; COG1253 717522006475 Domain of unknown function DUF21; Region: DUF21; pfam01595 717522006476 This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains associated with the CorC_HlyC domain. CorC_HlyC is a transporter associated domain. This small domain is found in Na+/H+ antiporters, in proteins involved in...; Region: CBS_pair_CorC_HlyC_assoc; cd04590 717522006477 Transporter associated domain; Region: CorC_HlyC; smart01091 717522006478 metal-binding heat shock protein; Provisional; Region: PRK00016 717522006479 K homology RNA-binding domain; Region: KH; smart00322 717522006480 Phosphate starvation-inducible protein PhoH, predicted ATPase [Signal transduction mechanisms]; Region: PhoH; COG1702 717522006481 PhoH-like protein; Region: PhoH; pfam02562 717522006482 Regulator of polyketide synthase expression [Signal transduction mechanisms / Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG2508 717522006483 PE family; Region: PE; pfam00934 717522006484 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG1385 717522006485 RNA methyltransferase, RsmE family; Region: TIGR00046 717522006486 chaperone protein DnaJ; Provisional; Region: PRK14278 717522006487 DnaJ domain or J-domain. DnaJ/Hsp40 (heat shock protein 40) proteins are highly conserved and play crucial roles in protein translation, folding, unfolding, translocation, and degradation. They act primarily by stimulating the ATPase activity of Hsp70s; Region: DnaJ; cd06257 717522006488 HSP70 interaction site [polypeptide binding]; other site 717522006489 Zinc finger domain of DnaJ and HSP40; Region: DnaJ_zf; cd10719 717522006490 Zn binding sites [ion binding]; other site 717522006491 C-terminal substrate binding domain of DnaJ and HSP40; Region: DnaJ_C; cd10747 717522006492 dimer interface [polypeptide binding]; other site 717522006493 heat-inducible transcription repressor; Provisional; Region: hrcA; PRK00082 717522006494 Transcription regulator of the Arc/MetJ class [Transcription]; Region: COG5450 717522006495 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3251 717522006496 NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500 717522006497 Condensation domain; Region: Condensation; pfam00668 717522006498 Non-ribosomal peptide synthetase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: EntF; COG1020 717522006499 The adenylation domain of nonribosomal peptide synthetases (NRPS); Region: A_NRPS; cd05930 717522006500 acyl-activating enzyme (AAE) consensus motif; other site 717522006501 AMP binding site [chemical binding]; other site 717522006502 Condensation domain; Region: Condensation; pfam00668 717522006503 non-ribosomal peptide synthase domain TIGR01720; Region: NRPS-para261 717522006504 Condensation domain; Region: Condensation; pfam00668 717522006505 Non-ribosomal peptide synthetase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: EntF; COG1020 717522006506 HxxPF-repeated domain; Region: HxxPF_rpt; pfam13745 717522006507 The adenylation domain of nonribosomal peptide synthetases (NRPS); Region: A_NRPS; cd05930 717522006508 acyl-activating enzyme (AAE) consensus motif; other site 717522006509 AMP binding site [chemical binding]; other site 717522006510 Phosphopantetheine attachment site; Region: PP-binding; pfam00550 717522006511 Condensation domain; Region: Condensation; pfam00668 717522006512 Non-ribosomal peptide synthetase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: EntF; COG1020 717522006513 HxxPF-repeated domain; Region: HxxPF_rpt; pfam13745 717522006514 Adenylate forming domain, Class I; Region: AFD_class_I; cl17068 717522006515 Phosphopantetheine attachment site; Region: PP-binding; pfam00550 717522006516 malonyl CoA-acyl carrier protein transacylase; Region: fabD; TIGR00128 717522006517 Acyl transferase domain in polyketide synthase (PKS) enzymes; Region: PKS_AT; smart00827 717522006518 ketoreductase (KR) and fatty acid synthase (FAS), complex (x) SDRs; Region: KR_FAS_SDR_x; cd05274 717522006519 NADP binding site [chemical binding]; other site 717522006520 This enzymatic domain is part of bacterial polyketide synthases; Region: PKS_KR; smart00822 717522006521 active site 717522006522 Phosphopantetheine attachment site; Region: PKS_PP; smart00823 717522006523 polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833 717522006524 Beta-ketoacyl synthase; Region: PKS_KS; smart00825 717522006525 active site 717522006526 Aryl carrier domain [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3433 717522006527 Condensation domain; Region: Condensation; pfam00668 717522006528 Non-ribosomal peptide synthetase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: EntF; COG1020 717522006529 Nonribosomal peptide synthase; Region: NRPS; pfam08415 717522006530 The adenylation domain of nonribosomal peptide synthetases (NRPS), including Streptoalloteichus tallysomycin biosynthesis genes; Region: A_NRPS_TlmIV_like; cd12114 717522006531 acyl-activating enzyme (AAE) consensus motif; other site 717522006532 AMP binding site [chemical binding]; other site 717522006533 Phosphopantetheine attachment site; Region: PP-binding; pfam00550 717522006534 Predicted thioesterase involved in non-ribosomal peptide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: GrsT; COG3208 717522006535 Peptide arylation enzymes [Secondary metabolites biosynthesis, transport, and catabolism]; Region: EntE; COG1021 717522006536 2,3-dihydroxybenzoate-AMP ligase; Region: 23DHB-AMP_lg; cd05920 717522006537 acyl-activating enzyme (AAE) consensus motif; other site 717522006538 active site 717522006539 AMP binding site [chemical binding]; other site 717522006540 substrate binding site [chemical binding]; other site 717522006541 Esterase/lipase [Lipid metabolism]; Region: Aes; COG0657 717522006542 salicylate synthase MbtI; Reviewed; Region: PRK07912 717522006543 chorismate binding enzyme; Region: Chorismate_bind; pfam00425 717522006544 Predicted permease [General function prediction only]; Region: COG3329 717522006545 coproporphyrinogen III oxidase; Validated; Region: PRK05628 717522006546 Transglycosylase-like domain; Region: Transglycosylas; pfam06737 717522006547 Sulfite reductase, beta subunit (hemoprotein) [Inorganic ion transport and metabolism]; Region: CysI; COG0155 717522006548 Nitrite/Sulfite reductase ferredoxin-like half domain; Region: NIR_SIR_ferr; pfam03460 717522006549 Nitrite/Sulfite reductase ferredoxin-like half domain; Region: NIR_SIR_ferr; pfam03460 717522006550 3'-phosphoadenosine 5'-phosphosulfate sulfotransferase (PAPS reductase)/FAD synthetase and related enzymes [Amino acid transport and metabolism / Coenzyme metabolism]; Region: CysH; COG0175 717522006551 This domain is found in phosphoadenosine phosphosulphate (PAPS) reductase enzymes or PAPS sulphotransferase. PAPS reductase is part of the adenine nucleotide alpha hydrolases superfamily also including N type ATP PPases and ATP sulphurylases. A highly...; Region: PAPS_reductase; cd01713 717522006552 Active Sites [active] 717522006553 Sirohydrochlorin ferrochelatase [Inorganic ion transport and metabolism]; Region: COG2138 717522006554 Sirohydrochlorin cobalt chelatase (CbiX) and sirohydrochlorin iron chelatase (SirB), N-terminal domain. SirB catalyzes the ferro-chelation of sirohydrochlorin to siroheme, the prosthetic group of sulfite and nitrite reductases. CbiX is a cobaltochelatase; Region: CbiX_SirB_N; cd03416 717522006555 putative active site [active] 717522006556 Sirohydrochlorin cobalt chelatase (CbiX) and sirohydrochlorin iron chelatase (SirB), C-terminal domain. SirB catalyzes the ferro-chelation of sirohydrochlorin to siroheme, the prosthetic group of sulfite and nitrite reductases. CbiX is a cobaltochelatase; Region: CbiX_SirB_C; cd03414 717522006557 putative active site [active] 717522006558 Gamma-glutamyltransferase [Amino acid transport and metabolism]; Region: Ggt; COG0405 717522006559 Gamma-glutamyltranspeptidase; Region: G_glu_transpept; pfam01019 717522006560 OPT oligopeptide transporter protein; Region: OPT; cl14607 717522006561 OPT oligopeptide transporter protein; Region: OPT; cl14607 717522006562 PE family; Region: PE; pfam00934 717522006563 ATP-binding cassette domain of the sulfate transporter; Region: ABC_CysA_sulfate_importer; cd03296 717522006564 sulfate ABC transporter, ATP-binding protein; Region: 3a0106s01; TIGR00968 717522006565 Walker A/P-loop; other site 717522006566 ATP binding site [chemical binding]; other site 717522006567 Q-loop/lid; other site 717522006568 ABC transporter signature motif; other site 717522006569 Walker B; other site 717522006570 D-loop; other site 717522006571 H-loop/switch region; other site 717522006572 sulfate transport protein; Provisional; Region: cysT; CHL00187 717522006573 Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261 717522006574 dimer interface [polypeptide binding]; other site 717522006575 conserved gate region; other site 717522006576 putative PBP binding loops; other site 717522006577 ABC-ATPase subunit interface; other site 717522006578 sulfate transport protein; Provisional; Region: cysT; CHL00187 717522006579 Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261 717522006580 dimer interface [polypeptide binding]; other site 717522006581 conserved gate region; other site 717522006582 putative PBP binding loops; other site 717522006583 ABC-ATPase subunit interface; other site 717522006584 ABC-type sulfate transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: Sbp; COG1613 717522006585 Bacterial extracellular solute-binding protein; Region: SBP_bac_11; pfam13531 717522006586 Glucoamylase and related glycosyl hydrolases [Carbohydrate transport and metabolism]; Region: SGA1; COG3387 717522006587 Glycosyl hydrolases family 15; Region: Glyco_hydro_15; pfam00723 717522006588 PknH-like extracellular domain; Region: PknH_C; pfam14032 717522006589 GTP-binding protein LepA; Provisional; Region: PRK05433 717522006590 LepA also known as Elongation Factor 4 (EF4); Region: LepA; cd01890 717522006591 G1 box; other site 717522006592 putative GEF interaction site [polypeptide binding]; other site 717522006593 GTP/Mg2+ binding site [chemical binding]; other site 717522006594 Switch I region; other site 717522006595 G2 box; other site 717522006596 G3 box; other site 717522006597 Switch II region; other site 717522006598 G4 box; other site 717522006599 G5 box; other site 717522006600 lepA_II: This subfamily represents the domain II of LepA, a GTP-binding protein localized in the cytoplasmic membrane. The N-terminal domain of LepA shares regions of homology to translation factors. In terms of interaction with the ribosome, EF-G, EF-Tu...; Region: lepA_II; cd03699 717522006601 lepA_C: This family represents the C-terminal region of LepA, a GTP-binding protein localized in the cytoplasmic membrane. LepA is ubiquitous in Bacteria and Eukaryota (e.g. Saccharomyces cerevisiae GUF1p), but is missing from Archaea. LepA exhibits...; Region: lepA_C; cd03709 717522006602 GTP-binding protein LepA C-terminus; Region: LepA_C; pfam06421 717522006603 PemK-like protein; Region: PemK; pfam02452 717522006604 The CBS domain, named after human CBS, is a small domain originally identified in cystathionine beta-synthase and is subsequently found in a wide range of different proteins. CBS domains usually occur in tandem repeats. They associate to form a so-called...; Region: CBS_pair_10; cd04623 717522006605 FOG: CBS domain [General function prediction only]; Region: COG0517 717522006606 ribonuclease Z; Reviewed; Region: PRK00055 717522006607 PE family; Region: PE; pfam00934 717522006608 Transglutaminase-like enzymes, putative cysteine proteases [Amino acid transport and metabolism]; Region: COG1305 717522006609 Bacterial transglutaminase-like N-terminal region; Region: Bact_transglu_N; pfam08379 717522006610 Transglutaminase-like superfamily; Region: Transglut_core; pfam01841 717522006611 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2307 717522006612 A predicted alpha-helical domain with a conserved ER motif; Region: Alpha-E; pfam04168 717522006613 Uncharacterized conserved protein [Function unknown]; Region: COG2308 717522006614 30S ribosomal protein S20; Reviewed; Region: rpsT; PRK00239 717522006615 hypothetical protein; Reviewed; Region: PRK07914 717522006616 DNA polymerase III, delta subunit; Region: DNA_pol3_delta; pfam06144 717522006617 Predicted membrane metal-binding protein [General function prediction only]; Region: ComEC; COG0658 717522006618 Competence protein; Region: Competence; pfam03772 717522006619 Helix-hairpin-helix motif; Region: HHH_3; pfam12836 717522006620 Helix-hairpin-helix motif; Region: HHH; pfam00633 717522006621 Predicted acetyltransferase involved in intracellular survival and related acetyltransferases [General function prediction only]; Region: Eis; COG4552 717522006622 N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301 717522006623 Coenzyme A binding pocket [chemical binding]; other site 717522006624 Uncharacterized protein conserved in bacteria [Function unknown]; Region: DegV; COG1307 717522006625 Uncharacterized protein, DegV family COG1307; Region: DegV; pfam02645 717522006626 SGNH_hydrolase, or GDSL_hydrolase, is a diverse family of lipases and esterases. The tertiary fold of the enzyme is substantially different from that of the alpha/beta hydrolase family and unique among all known hydrolases; its active site closely...; Region: SGNH_hydrolase; cd00229 717522006627 active site 717522006628 catalytic triad [active] 717522006629 oxyanion hole [active] 717522006630 Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067 717522006631 catalytic core [active] 717522006632 Uncharacterized homolog of plant Iojap protein [Function unknown]; Region: COG0799 717522006633 Nicotinamide/nicotinate mononucleotide adenylyltransferase; Region: NMNAT; cd02165 717522006634 nicotinic acid mononucleotide adenylyltransferase; Provisional; Region: nadD; PRK00071 717522006635 active site 717522006636 (T/H)XGH motif; other site 717522006637 Methyltransferase domain; Region: Methyltransf_23; pfam13489 717522006638 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522006639 S-adenosylmethionine binding site [chemical binding]; other site 717522006640 Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3547 717522006641 Transposase IS116/IS110/IS902 family; Region: Transposase_20; pfam02371 717522006642 Transposase; Region: DEDD_Tnp_IS110; pfam01548 717522006643 Protein containing von Willebrand factor type A (vWA) domain [General function prediction only]; Region: CoxE; COG3552 717522006644 Von Willebrand factor type A (vWA) domain was originally found in the blood coagulation protein von Willebrand factor (vWF). Typically, the vWA domain is made up of approximately 200 amino acid residues folded into a classic a/b para-rossmann type of...; Region: vWFA; cl00057 717522006645 metal ion-dependent adhesion site (MIDAS); other site 717522006646 ATPases associated with a variety of cellular activities; Region: AAA; smart00382 717522006647 The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009 717522006648 Walker A motif; other site 717522006649 ATP binding site [chemical binding]; other site 717522006650 Walker B motif; other site 717522006651 arginine finger; other site 717522006652 Gamma-glutamyl phosphate reductase (GPR), aldehyde dehydrogenase families 18 and 19; Region: ALDH_F18-19_ProA-GPR; cd07079 717522006653 gamma-glutamyl phosphate reductase; Region: proA; TIGR00407 717522006654 putative catalytic cysteine [active] 717522006657 Peroxiredoxin [Posttranslational modification, protein turnover, chaperones]; Region: AhpC; COG0450 717522006658 Peroxiredoxin (PRX) family, Typical 2-Cys PRX subfamily; PRXs are thiol-specific antioxidant (TSA) proteins, which confer a protective role in cells through its peroxidase activity by reducing hydrogen peroxide, peroxynitrite, and organic hydroperoxides; Region: PRX_Typ2cys; cd03015 717522006659 dimer interface [polypeptide binding]; other site 717522006660 decamer (pentamer of dimers) interface [polypeptide binding]; other site 717522006661 catalytic triad [active] 717522006662 peroxidatic and resolving cysteines [active] 717522006663 alkylhydroperoxidase, AhpD family; Region: ahpD; TIGR00777 717522006664 alkylhydroperoxidase AhpD family core domain; Region: ahpD_dom; TIGR00778 717522006665 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522006666 PPE family; Region: PPE; pfam00823 717522006667 PE family; Region: PE; pfam00934 717522006668 Small-conductance mechanosensitive channel [Cell envelope biogenesis, outer membrane]; Region: MscS; COG0668 717522006669 Mechanosensitive ion channel; Region: MS_channel; pfam00924 717522006670 effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038 717522006671 cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases [Signal transduction mechanisms]; Region: Crp; COG0664 717522006672 ligand binding site [chemical binding]; other site 717522006673 flexible hinge region; other site 717522006674 Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225 717522006675 dimerization interface [polypeptide binding]; other site 717522006676 Adenylyl- / guanylyl cyclase, catalytic domain; Region: CYCc; smart00044 717522006677 cyclase homology domain; Region: CHD; cd07302 717522006678 nucleotidyl binding site; other site 717522006679 metal binding site [ion binding]; metal-binding site 717522006680 dimer interface [polypeptide binding]; other site 717522006681 Sugar kinases, ribokinase family [Carbohydrate transport and metabolism]; Region: RbsK; COG0524 717522006682 Ribokinase catalyses the phosphorylation of ribose to ribose-5-phosphate using ATP. This reaction is the first step in the ribose metabolism. It traps ribose within the cell after uptake and also prepares the sugar for use in the synthesis of nucleotides...; Region: ribokinase; cd01174 717522006683 substrate binding site [chemical binding]; other site 717522006684 dimer interface [polypeptide binding]; other site 717522006685 ATP binding site [chemical binding]; other site 717522006686 Putative protein-S-isoprenylcysteine methyltransferase [Posttranslational modification, protein turnover, chaperones]; Region: STE14; COG2020 717522006687 NAD synthetase; Reviewed; Region: nadE; PRK02628 717522006688 Glutamine aminotransferase (GAT, glutaminase) domain of glutamine-dependent NAD synthetases (class 7 and 8 nitrilases); Region: GAT_Gln-NAD-synth; cd07570 717522006689 multimer interface [polypeptide binding]; other site 717522006690 active site 717522006691 catalytic triad [active] 717522006692 protein interface 1 [polypeptide binding]; other site 717522006693 NAD+ synthase is a homodimer, which catalyzes the final step in de novo nicotinamide adenine dinucleotide (NAD+) biosynthesis, an amide transfer from either ammonia or glutamine to nicotinic acid adenine dinucleotide (NaAD). The conversion of NaAD to NAD...; Region: NAD_synthase; cd00553 717522006694 homodimer interface [polypeptide binding]; other site 717522006695 NAD binding pocket [chemical binding]; other site 717522006696 ATP binding pocket [chemical binding]; other site 717522006697 Mg binding site [ion binding]; other site 717522006698 active-site loop [active] 717522006699 gamma-glutamyl kinase; Provisional; Region: PRK05429 717522006700 AAK_G5K_ProB: Glutamate-5-kinase (G5K) catalyzes glutamate-dependent ATP cleavage; G5K transfers the terminal phosphoryl group of ATP to the gamma-carboxyl group of glutamate, in the first and controlling step of proline (and, in mammals, ornithine)...; Region: AAK_G5K_ProB; cd04242 717522006701 nucleotide binding site [chemical binding]; other site 717522006702 homotetrameric interface [polypeptide binding]; other site 717522006703 putative phosphate binding site [ion binding]; other site 717522006704 putative allosteric binding site; other site 717522006705 PUA domain; Region: PUA; pfam01472 717522006706 GTPase CgtA; Reviewed; Region: obgE; PRK12296 717522006707 GTP1/OBG; Region: GTP1_OBG; pfam01018 717522006708 Obg GTPase; Region: Obg; cd01898 717522006709 G1 box; other site 717522006710 GTP/Mg2+ binding site [chemical binding]; other site 717522006711 Switch I region; other site 717522006712 G2 box; other site 717522006713 G3 box; other site 717522006714 Switch II region; other site 717522006715 G4 box; other site 717522006716 G5 box; other site 717522006717 Domain of unknown function (DUF1967); Region: DUF1967; pfam09269 717522006718 50S ribosomal protein L27; Validated; Region: rpmA; PRK05435 717522006719 50S ribosomal protein L21; Validated; Region: rplU; PRK05573 717522006720 Na+/H+-dicarboxylate symporters [Energy production and conversion]; Region: GltP; COG1301 717522006721 Sodium:dicarboxylate symporter family; Region: SDF; cl00573 717522006722 ribonuclease, Rne/Rng family; Region: RNaseEG; TIGR00757 717522006723 S1_RNase_E: RNase E and RNase G, S1-like RNA-binding domain. RNase E is an essential endoribonuclease in the processing and degradation of RNA. In addition to its role in mRNA degradation, RNase E has also been implicated in the processing of rRNA, and...; Region: S1_RNase_E; cd04453 717522006724 homodimer interface [polypeptide binding]; other site 717522006725 oligonucleotide binding site [chemical binding]; other site 717522006726 Nucleoside diphosphate kinase Group I (NDPk_I)-like: NDP kinase domains are present in a large family of structurally and functionally conserved proteins from bacteria to humans that generally catalyze the transfer of gamma-phosphates of a nucleoside...; Region: NDPk_I; cd04413 717522006727 active site 717522006728 multimer interface [polypeptide binding]; other site 717522006729 Protein of unknown function (DUF4233); Region: DUF4233; pfam14017 717522006730 Folylpolyglutamate synthase [Coenzyme metabolism]; Region: FolC; COG0285 717522006731 Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875 717522006732 valyl-tRNA synthetase; Reviewed; Region: valS; PRK05729 717522006733 nucleotidyl transferase superfamily; Region: nt_trans; cl00015 717522006734 active site 717522006735 HIGH motif; other site 717522006736 nucleotide binding site [chemical binding]; other site 717522006737 Leucyl-tRNA synthetase, Domain 2; Region: tRNA-synt_1_2; pfam13603 717522006738 catalytic core domain of valyl-tRNA synthetases; Region: ValRS_core; cd00817 717522006739 active site 717522006740 KMSKS motif; other site 717522006741 Anticodon-binding domain of valyl tRNA synthetases; Region: Anticodon_Ia_Val; cd07962 717522006742 tRNA binding surface [nucleotide binding]; other site 717522006743 anticodon binding site; other site 717522006744 Valyl tRNA synthetase tRNA binding arm; Region: Val_tRNA-synt_C; pfam10458 717522006745 Uncharacterized conserved protein [Function unknown]; Region: COG3268 717522006746 NAD(P) binding domain of amino acid dehydrogenase-like proteins; Region: NAD_bind_amino_acid_DH; cl17226 717522006747 NAD(P) binding pocket [chemical binding]; other site 717522006748 Transglycosylase-like domain; Region: Transglycosylas; pfam06737 717522006749 molybdopterin-guanine dinucleotide biosynthesis protein MobA; Reviewed; Region: mobA; PRK00317 717522006750 MobA catalyzes the formation of molybdopterin guanine dinucleotide; Region: MobA; cd02503 717522006751 GTP binding site; other site 717522006752 2-oxoglutarate ferredoxin oxidoreductase subunit beta; Reviewed; Region: PRK11867 717522006753 Thiamine pyrophosphate (TPP family), 2-oxoglutarate ferredoxin oxidoreductase (OGFOR) subfamily, TPP-binding module; OGFOR catalyzes the oxidative decarboxylation of 2-oxo-acids, with ferredoxin acting as an electron acceptor. In the TCA cycle, OGFOR...; Region: TPP_OGFOR; cd03375 717522006754 TPP-binding site [chemical binding]; other site 717522006755 Pyruvate:ferredoxin oxidoreductase and related 2-oxoacid:ferredoxin oxidoreductases, gamma subunit [Energy production and conversion]; Region: PorG; COG1014 717522006756 2-oxoacid:acceptor oxidoreductase, alpha subunit; Region: OAFO_sf; TIGR03710 717522006757 Pyrimidine (PYR) binding domain of pyruvate ferredoxin oxidoreductase (PFOR), indolepyruvate ferredoxin oxidoreductase alpha subunit (IOR-alpha), and related proteins; Region: TPP_PYR_PFOR_IOR-alpha_like; cd07034 717522006758 dimer interface [polypeptide binding]; other site 717522006759 PYR/PP interface [polypeptide binding]; other site 717522006760 TPP binding site [chemical binding]; other site 717522006761 substrate binding site [chemical binding]; other site 717522006762 ATP-dependent protease ATP-binding subunit ClpX; Provisional; Region: clpX; PRK05342 717522006763 ClpX C4-type zinc finger; Region: zf-C4_ClpX; pfam06689 717522006764 The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009 717522006765 Walker A motif; other site 717522006766 ATP binding site [chemical binding]; other site 717522006767 Walker B motif; other site 717522006768 C-terminal, D2-small domain, of ClpB protein; Region: ClpB_D2-small; smart01086 717522006769 homocysteine methyltransferase; Provisional; Region: mmuM; PRK09485 717522006770 Homocysteine S-methyltransferase; Region: S-methyl_trans; pfam02574 717522006771 The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174 717522006772 Major Facilitator Superfamily; Region: MFS_1; pfam07690 717522006773 putative substrate translocation pore; other site 717522006774 The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174 717522006775 ATP-dependent Clp protease proteolytic subunit; Reviewed; Region: PRK12553 717522006776 Caseinolytic protease (ClpP) is an ATP-dependent, highly conserved serine protease; Region: S14_ClpP_2; cd07017 717522006777 oligomer interface [polypeptide binding]; other site 717522006778 active site residues [active] 717522006779 Clp protease; Region: CLP_protease; pfam00574 717522006780 Caseinolytic protease (ClpP) is an ATP-dependent, highly conserved serine protease; Region: S14_ClpP_2; cd07017 717522006781 oligomer interface [polypeptide binding]; other site 717522006782 active site residues [active] 717522006783 trigger factor; Provisional; Region: tig; PRK01490 717522006784 FKBP-type peptidyl-prolyl cis-trans isomerase; Region: FKBP_C; pfam00254 717522006785 Bacterial trigger factor protein (TF) C-terminus; Region: Trigger_C; pfam05698 717522006786 Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680 717522006787 Beta-lactamase; Region: Beta-lactamase; pfam00144 717522006788 Formamidopyrimidine-DNA glycosylase [DNA replication, recombination, and repair]; Region: Nei; COG0266 717522006789 N-terminal domain of the actinomycetal Nei1 and related DNA glycosylases; Region: AcNei1_N; cd08970 717522006790 putative DNA binding site [nucleotide binding]; other site 717522006791 catalytic residue [active] 717522006792 putative H2TH interface [polypeptide binding]; other site 717522006793 putative catalytic residues [active] 717522006794 Formamidopyrimidine-DNA glycosylase H2TH domain; Region: H2TH; pfam06831 717522006795 Zinc finger found in FPG and IleRS; Region: zf-FPG_IleRS; pfam06827 717522006796 ribose-5-phosphate isomerase B; Provisional; Region: PRK05571 717522006797 DSBA-like thioredoxin domain; Region: DSBA; pfam01323 717522006798 Protein Disulfide Oxidoreductases and Other Proteins with a Thioredoxin fold; Region: Thioredoxin_like; cl00388 717522006799 aminopeptidase N, Streptomyces lividans type; Region: pepN_strep_liv; TIGR02412 717522006800 Peptidase M1 family containing Aminopeptidase N; Region: M1_APN_3; cd09602 717522006801 Zn binding site [ion binding]; other site 717522006802 Restriction endonuclease [Defense mechanisms]; Region: McrA; COG1403 717522006803 HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085 717522006804 active site 717522006805 Truncated hemoglobins (trHbs) are a family of oxygen-binding heme proteins found in cyanobacteria, eubacteria, unicellular eukaryotes, and plants. The truncated hemoglobins have a characteristic two-over-two alpha helical folding pattern that is distinct...; Region: Trunc_globin; cd00454 717522006806 apolar tunnel; other site 717522006807 heme binding site [chemical binding]; other site 717522006808 dimerization interface [polypeptide binding]; other site 717522006809 Alpha amylase catalytic domain found in oligo-1,6-glucosidase (also called isomaltase; sucrase-isomaltase; alpha-limit dextrinase), trehalose synthase (also called maltose alpha-D-glucosyltransferase), and related proteins; Region: AmyAc_OligoGlu_TS; cd11332 717522006810 alpha,alpha-phosphotrehalase; Region: trehalose_treC; TIGR02403 717522006811 active site 717522006812 catalytic site [active] 717522006813 Domain of unknown function (DUF3459); Region: DUF3459; pfam11941 717522006814 4-hydroxybenzoyl-CoA thioesterase (4HBT). Catalyzes the final step in the 4-chlorobenzoate degradation pathway in which 4-chlorobenzoate is converted to 4-hydroxybenzoate in certain soil-dwelling bacteria. 4HBT forms a homotetramer with four active sites; Region: 4HBT; cd00586 717522006815 active site 717522006816 NAD-specific glutamate dehydrogenase [Amino acid transport and metabolism]; Region: COG2902 717522006817 putative ABC transporter ATP-binding protein; Reviewed; Region: PRK11819 717522006818 ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221 717522006819 ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221 717522006820 ABC transporter; Region: ABC_tran_2; pfam12848 717522006821 ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221 717522006822 SSB_OBF: A subfamily of OB folds similar to the OB fold of ssDNA-binding protein (SSB). SSBs bind with high affinity to ssDNA. They bind to and protect ssDNA intermediates during DNA metabolic pathways. All bacterial and eukaryotic SSBs studied to date...; Region: SSB_OBF; cd04496 717522006823 dimer interface [polypeptide binding]; other site 717522006824 Single-stranded DNA-binding protein [DNA replication, recombination, and repair]; Region: Ssb; COG0629 717522006825 ssDNA binding site [nucleotide binding]; other site 717522006826 tetramer (dimer of dimers) interface [polypeptide binding]; other site 717522006827 glycerol-3-phosphate acyltransferase; Validated; Region: PRK03355 717522006828 Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: GPAT-like; Region: LPLAT_DHAPAT-like; cd07993 717522006829 putative acyl-acceptor binding pocket; other site 717522006830 Phosphoserine phosphatase [Amino acid transport and metabolism]; Region: SerB; COG0560 717522006831 HAD-superfamily subfamily IB hydrolase, TIGR01490; Region: HAD-SF-IB-hyp1 717522006832 1-acyl-sn-glycerol-3-phosphate acyltransferase [Lipid metabolism]; Region: PlsC; COG0204 717522006833 Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: AGPAT-like; Region: LPLAT_AGPAT-like; cd07989 717522006834 putative acyl-acceptor binding pocket; other site 717522006835 Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007 717522006836 acyltransferase, WS/DGAT/MGAT; Region: acyl_WS_DGAT; TIGR02946 717522006837 Esterase/lipase [Lipid metabolism]; Region: Aes; COG0657 717522006838 Esterases and lipases (includes fungal lipases, cholinesterases, etc.) These enzymes act on carboxylic esters (EC: 3.1.1.-). The catalytic apparatus involves three residues (catalytic triad): a serine, a glutamate or aspartate and a histidine.These...; Region: Esterase_lipase; cd00312 717522006839 Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326 717522006840 enoyl-CoA hydratase; Provisional; Region: PRK05870 717522006841 Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558 717522006842 substrate binding site [chemical binding]; other site 717522006843 oxyanion hole (OAH) forming residues; other site 717522006844 trimer interface [polypeptide binding]; other site 717522006846 PE family; Region: PE; pfam00934 717522006847 Adenylate cyclase, family 3 (some proteins contain HAMP domain) [Signal transduction mechanisms]; Region: CyaA; COG2114 717522006848 cyclase homology domain; Region: CHD; cd07302 717522006849 nucleotidyl binding site; other site 717522006850 metal binding site [ion binding]; metal-binding site 717522006851 dimer interface [polypeptide binding]; other site 717522006852 Predicted ATPase [General function prediction only]; Region: COG3903 717522006853 Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197 717522006854 C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170 717522006855 DNA binding residues [nucleotide binding] 717522006856 dimerization interface [polypeptide binding]; other site 717522006857 PE family; Region: PE; pfam00934 717522006858 TIGR00725 family protein; Region: TIGR00725 717522006859 thymidylate synthase; Provisional; Region: thyA; PRK00956 717522006860 Mycobacterium tuberculosis PIN domain family; Region: Mtu_PIN_fam; TIGR00028 717522006861 branched-chain alpha-keto acid dehydrogenase subunit E2; Reviewed; Region: PRK11856 717522006862 Lipoyl domain of the dihydrolipoyl acyltransferase component (E2) of 2-oxo acid dehydrogenases. 2-oxo acid dehydrogenase multienzyme complexes, like pyruvate dehydrogenase (PDH), 2-oxoglutarate dehydrogenase (OGDH) and branched-chain 2-oxo acid...; Region: lipoyl_domain; cd06849 717522006863 E3 interaction surface; other site 717522006864 lipoyl attachment site [posttranslational modification]; other site 717522006865 e3 binding domain; Region: E3_binding; pfam02817 717522006866 2-oxoacid dehydrogenases acyltransferase (catalytic domain); Region: 2-oxoacid_dh; pfam00198 717522006867 Pyruvate/2-oxoglutarate dehydrogenase complex, dehydrogenase (E1) component, eukaryotic type, beta subunit [Energy production and conversion]; Region: AcoB; COG0022 717522006868 Pyrimidine (PYR) binding domain of the beta subunits of the E1 components of human pyruvate dehydrogenase complex (E1- PDHc) and related proteins; Region: TPP_PYR_E1-PDHc-beta_like; cd07036 717522006869 alpha subunit interface [polypeptide binding]; other site 717522006870 TPP binding site [chemical binding]; other site 717522006871 heterodimer interface [polypeptide binding]; other site 717522006872 Transketolase, C-terminal domain; Region: Transketolase_C; pfam02780 717522006873 pyruvate dehydrogenase E1 component, alpha subunit; Region: PDH_E1_alph_x; TIGR03181 717522006874 Thiamine pyrophosphate (TPP) family, E1 of PDC_ADC_BCADC subfamily, TPP-binding module; composed of proteins similar to the E1 components of the human pyruvate dehydrogenase complex (PDC), the acetoin dehydrogenase complex (ADC) and the branched chain...; Region: TPP_E1_PDC_ADC_BCADC; cd02000 717522006875 tetramer interface [polypeptide binding]; other site 717522006876 TPP-binding site [chemical binding]; other site 717522006877 heterodimer interface [polypeptide binding]; other site 717522006878 phosphorylation loop region [posttranslational modification] 717522006879 Citrate lyase beta subunit [Carbohydrate transport and metabolism]; Region: CitE; COG2301 717522006880 FkbR2 is a Streptomyces hygroscopicus protein with a hot dog fold that belongs to a conserved family of proteins found in prokaryotes and archaea but not in eukaryotes. FkbR2 has sequence similarity to (R)-specific enoyl-CoA hydratase, the peroxisomal...; Region: FkbR2; cd03451 717522006881 putative active site [active] 717522006882 putative catalytic site [active] 717522006883 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522006884 Acyl-CoA dehydrogenase; Region: ACAD; cl09933 717522006885 active site 717522006886 Acetyl/propionyl-CoA carboxylase, alpha subunit [Lipid metabolism]; Region: COG4770 717522006887 Carbamoyl-phosphate synthase L chain, N-terminal domain; Region: CPSase_L_chain; pfam00289 717522006888 Carbamoyl-phosphate synthase L chain, ATP binding domain; Region: CPSase_L_D2; pfam02786 717522006889 Biotin carboxylase C-terminal domain; Region: Biotin_carb_C; smart00878 717522006890 The biotinyl-domain or biotin carboxyl carrier protein (BCCP) domain is present in all biotin-dependent enzymes, such as acetyl-CoA carboxylase, pyruvate carboxylase, propionyl-CoA carboxylase, methylcrotonyl-CoA carboxylase, geranyl-CoA carboxylase; Region: biotinyl_domain; cd06850 717522006891 carboxyltransferase (CT) interaction site; other site 717522006892 biotinylation site [posttranslational modification]; other site 717522006893 Acetyl-CoA carboxylase, carboxyltransferase component (subunits alpha and beta) [Lipid metabolism]; Region: COG4799 717522006894 malonate decarboxylase subunit beta; Reviewed; Region: PRK07189; cl17682 717522006895 Acetyl-CoA carboxylase alpha subunit [Lipid metabolism]; Region: AccA; cl17345 717522006896 3-oxoacid CoA-transferase, B subunit; Region: pcaJ_scoB_fam; TIGR02428 717522006897 Acyl CoA:acetate/3-ketoacid CoA transferase, alpha subunit [Lipid metabolism]; Region: AtoD; COG1788 717522006898 AMP-binding domain protein; Validated; Region: PRK08315 717522006899 Adenylate forming domain, Class I; Region: AFD_class_I; cl17068 717522006900 Uncharacterized subfamily of fatty acid CoA ligase (FACL); Region: FACL_like_2; cd05917 717522006901 acyl-activating enzyme (AAE) consensus motif; other site 717522006902 acyl-activating enzyme (AAE) consensus motif; other site 717522006903 putative AMP binding site [chemical binding]; other site 717522006904 putative active site [active] 717522006905 putative CoA binding site [chemical binding]; other site 717522006906 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522006907 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522006908 Permeases of the major facilitator superfamily [General function prediction only]; Region: COG2270 717522006909 Short-chain dehydrogenases of various substrate specificities [General function prediction only]; Region: DltE; COG0300 717522006910 classical (c) SDRs; Region: SDR_c; cd05233 717522006911 NAD(P) binding site [chemical binding]; other site 717522006912 active site 717522006913 Bacterial protein of unknown function (DUF853); Region: DUF853; pfam05872 717522006914 DEDDh 3'-5' exonuclease domain of oligoribonuclease and similar proteins; Region: Orn; cd06135 717522006915 catalytic site [active] 717522006916 putative active site [active] 717522006917 putative substrate binding site [chemical binding]; other site 717522006918 dimer interface [polypeptide binding]; other site 717522006919 Transposase, Mutator family; Region: Transposase_mut; pfam00872 717522006920 MULE transposase domain; Region: MULE; pfam10551 717522006921 Domain of unknown function (DUF4411); Region: DUF4411; pfam14367 717522006922 Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093 717522006923 non-specific DNA binding site [nucleotide binding]; other site 717522006924 salt bridge; other site 717522006925 sequence-specific DNA binding site [nucleotide binding]; other site 717522006926 Predicted Zn peptidase [Amino acid transport and metabolism]; Region: COG2856 717522006927 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2739; cl17893 717522006928 IgD-like repeat domain of mycobacterial L,D-transpeptidases; Region: LDT_IgD_like_1; cd13431 717522006929 IgD-like repeat domain of mycobacterial L,D-transpeptidases; Region: LDT_IgD_like_2; cd13432 717522006930 Uncharacterized protein conserved in bacteria [Function unknown]; Region: ErfK; COG1376 717522006931 L,D-transpeptidase catalytic domain; Region: YkuD; pfam03734 717522006932 PE family; Region: PE; pfam00934 717522006933 Protein of unknown function (DUF3618); Region: DUF3618; pfam12277 717522006934 Peroxiredoxin (PRX) family, Bacterioferritin comigratory protein (BCP) subfamily; composed of thioredoxin-dependent thiol peroxidases, widely expressed in pathogenic bacteria, that protect cells against toxicity from reactive oxygen species by reducing...; Region: PRX_BCP; cd03017 717522006935 Thioredoxin-like; Region: Thioredoxin_8; pfam13905 717522006936 catalytic triad [active] 717522006937 hypothetical protein; Provisional; Region: PRK07907 717522006938 M20 Dipeptidases; Region: M20_Dipept_like; cd03893 717522006939 active site 717522006940 metal binding site [ion binding]; metal-binding site 717522006941 dimer interface [polypeptide binding]; other site 717522006942 4'-phosphopantetheinyl transferase; Provisional; Region: acpS; PRK00070 717522006943 (acyl-carrier-protein) S-malonyltransferase [Lipid metabolism]; Region: FabD; COG0331 717522006944 Enoyl reductase domain of yeast-type FAS1 [Lipid metabolism]; Region: COG4981 717522006945 TIM barrel proteins share a structurally conserved phosphate binding motif and in general share an eight beta/alpha closed barrel structure. Specific for this family is the conserved phosphate binding site at the edges of strands 7 and 8. The phosphate...; Region: TIM_phosphate_binding; cl17186 717522006946 phosphate binding site [ion binding]; other site 717522006947 Domain of unknown function (DUF1729); Region: DUF1729; pfam08354 717522006948 FAS_MaoC, the MaoC-like hot dog fold of the fatty acid synthase, beta subunit. Other enzymes with this fold include MaoC dehydratase, Hydratase-Dehydrogenase-Epimerase protein (HDE), and 17-beta-hydroxysteriod dehydrogenase (HSD); Region: FAS_MaoC; cd03447 717522006949 putative active site [active] 717522006950 putative catalytic site [active] 717522006951 (acyl-carrier-protein) S-malonyltransferase [Lipid metabolism]; Region: FabD; COG0331 717522006952 malonyl CoA-acyl carrier protein transacylase; Region: fabD; TIGR00128 717522006953 3-oxoacyl-[acyl-carrier protein]; Region: COG4982 717522006954 ketoacyl reductase (KR) domain of fungal-type fatty acid synthase (fFAS), classical (c)-like SDRs; Region: KR_fFAS_SDR_c_like; cd08950 717522006955 putative NAD(P) binding site [chemical binding]; other site 717522006956 active site 717522006957 "elongating" condensing enzymes are a subclass of decarboxylating condensing enzymes, including beta-ketoacyl [ACP] synthase, type I and II and polyketide synthases.They are characterized by the utlization of acyl carrier protein (ACP)...; Region: elong_cond_enzymes; cd00828 717522006958 3-oxoacyl-(acyl-carrier-protein) synthase [Lipid metabolism / Secondary metabolites biosynthesis, transport, and catabolism]; Region: FabB; COG0304 717522006959 active site 717522006960 Domain of unknown function (DUF1906); Region: DUF1906; pfam08924 717522006961 PIN domain of the Rv0301 toxin of Mycobacterium tuberculosis and other uncharacterized, annotated PilT protein domain proteins; Region: PIN_MtRv0301; cd09882 717522006962 putative active site [active] 717522006963 Restriction endonuclease [Defense mechanisms]; Region: Mrr; COG1715 717522006964 Mrr N-terminal domain; Region: Mrr_N; pfam14338 717522006965 Restriction endonuclease; Region: Mrr_cat; pfam04471 717522006966 ERCC4 domain; Region: ERCC4; pfam02732 717522006967 Lsr2; Region: Lsr2; pfam11774 717522006968 PIN domain of ribonucleases (toxins), VapC, FitB, and PAE0151 of bacterial and archaeal toxin/antitoxin-like operons, and other similar homologs; Region: PIN_VapC-like; cd09861 717522006969 putative active site [active] 717522006970 Arginine/lysine/ornithine decarboxylases [Amino acid transport and metabolism]; Region: LdcC; COG1982 717522006971 Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes. PLP combines with an alpha-amino acid to form a compound called a Schiff base or aldimine intermediate, which depending on the reaction, is the...; Region: AAT_I; cl00321 717522006972 pyridoxal 5'-phosphate binding pocket [chemical binding]; other site 717522006973 catalytic residue [active] 717522006974 Orn/Lys/Arg decarboxylase, C-terminal domain; Region: OKR_DC_1_C; pfam03711 717522006975 Transcription termination factor NusB (N protein-Utilization Substance B). NusB plays a key role in the regulation of ribosomal RNA biosynthesis in eubacteria by modulating the efficiency of transcriptional antitermination. NusB along with other Nus...; Region: Terminator_NusB; cd00619 717522006976 putative RNA binding site [nucleotide binding]; other site 717522006977 elongation factor P; Validated; Region: PRK00529 717522006978 Elongation factor P (EF-P) KOW-like domain; Region: EFP_N; pfam08207 717522006979 S1_EF-P_repeat_1: Translation elongation factor P (EF-P), S1-like RNA-binding domain, repeat 1. EF-P stimulates the peptidyltransferase activity in the prokaryotic 70S ribosome. EF-P enhances the synthesis of certain dipeptides with...; Region: S1_EF-P_repeat_1; cd04470 717522006980 RNA binding site [nucleotide binding]; other site 717522006981 S1_EF-P_repeat_2: Translation elongation factor P (EF-P), S1-like RNA-binding domain, repeat 1. EF-P stimulates the peptidyltransferase activity in the prokaryotic 70S ribosome. EF-P enhances the synthesis of certain dipeptides with...; Region: S1_EF-P_repeat_2; cd05794 717522006982 RNA binding site [nucleotide binding]; other site 717522006983 Xaa-Pro aminopeptidase [Amino acid transport and metabolism]; Region: PepP; COG0006 717522006984 Creatinase/Prolidase N-terminal domain; Region: Creatinase_N; pfam01321 717522006985 Similar to Prolidase and Aminopeptidase P. The members of this subfamily presumably catalyse hydrolysis of Xaa-Pro dipeptides and/or release of any N-terminal amino acid, including proline, that is linked with proline; Region: APP-like; cd01092 717522006986 active site 717522006987 Dehydroquinase (DHQase), type II. Dehydroquinase (or 3-dehydroquinate dehydratase) catalyzes the reversible dehydration of 3-dehydroquinate to form 3-dehydroshikimate. This reaction is part of two metabolic pathways: the biosynthetic shikimate pathway...; Region: DHQase_II; cd00466 717522006988 Dehydroquinase class II; Region: DHquinase_II; pfam01220 717522006989 trimer interface [polypeptide binding]; other site 717522006990 active site 717522006991 dimer interface [polypeptide binding]; other site 717522006992 Dehydroquinate synthase (DHQS) catalyzes the conversion of DAHP to DHQ in shikimate pathway for aromatic compounds synthesis; Region: DHQS; cd08195 717522006993 active site 717522006994 dimer interface [polypeptide binding]; other site 717522006995 metal binding site [ion binding]; metal-binding site 717522006996 shikimate kinase; Reviewed; Region: aroK; PRK00131 717522006997 Shikimate kinase (SK) is the fifth enzyme in the shikimate pathway, a seven-step biosynthetic pathway which converts erythrose-4-phosphate to chorismic acid, found in bacteria, fungi and plants. Chorismic acid is a important intermediate in the synthesis...; Region: SK; cd00464 717522006998 ADP binding site [chemical binding]; other site 717522006999 magnesium binding site [ion binding]; other site 717522007000 putative shikimate binding site; other site 717522007001 Chorismate synthase [Amino acid transport and metabolism]; Region: AroC; COG0082 717522007002 Chorismase synthase, the enzyme catalyzing the final step of the shikimate pathway; Region: Chorismate_synthase; cd07304 717522007003 Tetramer interface [polypeptide binding]; other site 717522007004 active site 717522007005 FMN-binding site [chemical binding]; other site 717522007006 Alpha/beta hydrolase; Region: Abhydrolase_8; pfam06259 717522007007 I-RD05 Region of difference I-RD05, inserted region in Mycobacterium bovis BCG Pasteur, BCG Tokyo, BCG Mexico and Mycobacterium bovis AF2122/97 compared to Mycobacterium tuberculosis H37Rv. Leads to extra gene, lprR, similar to adjacent lppA and lppB 717522007008 digalactosyldiacylglycerol synthase; Region: PLN02846 717522007009 Transcription regulator of the Arc/MetJ class [Transcription]; Region: COG5450 717522007010 PIN domain of the Rv0301 toxin of Mycobacterium tuberculosis and other uncharacterized, annotated PilT protein domain proteins; Region: PIN_MtRv0301; cd09882 717522007011 putative active site [active] 717522007012 Ribbon-helix-helix protein, copG family; Region: RHH_1; pfam01402 717522007013 PIN domain of ribonucleases (toxins), VapC and FitB, of prokaryotic toxin/antitoxin operons, Pyrococcus horikoshii protein PH0500, and other similar bacterial and archaeal homologs; Region: PIN_VapC-FitB; cd09881 717522007014 oligomeric interface; other site 717522007015 putative active site [active] 717522007016 homodimer interface [polypeptide binding]; other site 717522007017 Predicted nucleic acid-binding protein, contains PIN domain [General function prediction only]; Region: COG2402 717522007018 putative active site [active] 717522007019 Ribbon-helix-helix protein, copG family; Region: RHH_1; pfam01402 717522007020 Type II secretory pathway, prepilin signal peptidase PulO and related peptidases [Cell motility and secretion / Posttranslational modification, protein turnover, chaperones / Intracellular trafficking and secretion]; Region: PulO; COG1989 717522007021 Type IV leader peptidase family; Region: Peptidase_A24; pfam01478 717522007022 shikimate-5-dehydrogenase, fungal AROM-type; Region: Shik-DH-AROM; TIGR01809 717522007023 Shikimate dehydrogenase substrate binding domain; Region: Shikimate_dh_N; pfam08501 717522007024 NAD(P) binding domain of Shikimate dehydrogenase; Region: NAD_bind_Shikimate_DH; cd01065 717522007025 NAD(P) binding site [chemical binding]; other site 717522007026 shikimate binding site; other site 717522007027 Aminodeoxychorismate lyase [Coenzyme transport and metabolism]; Region: COG1559 717522007028 proteins similar to Escherichia coli yceG; Region: yceG_like; cd08010 717522007029 dimerization interface [polypeptide binding]; other site 717522007030 Holliday junction resolvase-like protein; Reviewed; Region: PRK00109 717522007031 alanyl-tRNA synthetase; Reviewed; Region: alaS; PRK00252 717522007032 Alanyl-tRNA synthetase (AlaRS) class II core catalytic domain. AlaRS is a homodimer. It is responsible for the attachment of alanine to the 3' OH group of ribose of the appropriate tRNA. This domain is primarily responsible for ATP-dependent...; Region: AlaRS_core; cd00673 717522007033 motif 1; other site 717522007034 active site 717522007035 motif 2; other site 717522007036 motif 3; other site 717522007037 Threonyl and Alanyl tRNA synthetase second additional domain; Region: tRNA_SAD; smart00863 717522007038 DHHA1 domain; Region: DHHA1; pfam02272 717522007039 Uncharacterized conserved protein [Function unknown]; Region: COG0432 717522007040 recombination factor protein RarA; Reviewed; Region: PRK13342 717522007041 The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009 717522007042 Walker A motif; other site 717522007043 ATP binding site [chemical binding]; other site 717522007044 Walker B motif; other site 717522007045 arginine finger; other site 717522007046 MgsA AAA+ ATPase C terminal; Region: MgsA_C; pfam12002 717522007047 Predicted integral membrane protein [Function unknown]; Region: COG5473 717522007048 Protein of unknown function (DUF2652); Region: DUF2652; pfam10851 717522007049 MacB-like periplasmic core domain; Region: MacB_PCD; pfam12704 717522007050 ATP-binding cassette domain of the transporters involved in export of lipoprotein and macrolide, and cell division protein; Region: ABC_MJ0796_LolCDE_FtsE; cd03255 717522007051 ABC-type antimicrobial peptide transport system, ATPase component [Defense mechanisms]; Region: SalX; COG1136 717522007052 Walker A/P-loop; other site 717522007053 ATP binding site [chemical binding]; other site 717522007054 Q-loop/lid; other site 717522007055 ABC transporter signature motif; other site 717522007056 Walker B; other site 717522007057 D-loop; other site 717522007058 H-loop/switch region; other site 717522007059 effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038 717522007060 cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases [Signal transduction mechanisms]; Region: Crp; COG0664 717522007061 ligand binding site [chemical binding]; other site 717522007062 flexible hinge region; other site 717522007063 cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases [Signal transduction mechanisms]; Region: Crp; COG0664 717522007064 effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038 717522007065 ligand binding site [chemical binding]; other site 717522007066 flexible hinge region; other site 717522007067 Predicted esterase of the alpha-beta hydrolase superfamily [General function prediction only]; Region: RssA; COG1752 717522007068 Patatin-like phospholipase domain containing protein 6, protein 7, and fungal NTE1; Region: Pat_PNPLA6_PNPLA7_NTE1_like; cd07205 717522007069 active site 717522007070 nucleophile elbow; other site 717522007071 Transglutaminase-like enzymes, putative cysteine proteases [Amino acid transport and metabolism]; Region: COG1305 717522007072 Bacterial transglutaminase-like N-terminal region; Region: Bact_transglu_N; pfam08379 717522007073 Transglutaminase-like superfamily; Region: Transglut_core; pfam01841 717522007074 Putative amidoligase enzyme (DUF2126); Region: DUF2126; pfam09899 717522007075 Putative amidoligase enzyme (DUF2126); Region: DUF2126; pfam09899 717522007076 Uncharacterized conserved protein [Function unknown]; Region: COG2308 717522007077 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2307 717522007078 A predicted alpha-helical domain with a conserved ER motif; Region: Alpha-E; pfam04168 717522007079 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4307 717522007080 Uncharacterized protein conserved in bacteria (DUF2248); Region: DUF2248; pfam10005 717522007081 Transglutaminase-like enzymes, putative cysteine proteases [Amino acid transport and metabolism]; Region: COG1305 717522007082 Bacterial transglutaminase-like N-terminal region; Region: Bact_transglu_N; pfam08379 717522007083 Transglutaminase/protease-like homologues; Region: TGc; smart00460 717522007084 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3801 717522007085 Predicted membrane protein [Function unknown]; Region: COG4129 717522007086 Fusaric acid resistance protein-like; Region: FUSC_2; pfam13515 717522007087 aspartyl-tRNA synthetase; Validated; Region: aspS; PRK00476 717522007088 EcAspRS_like_N: N-terminal, anticodon recognition domain of the type found in Escherichia coli aspartyl-tRNA synthetase (AspRS), the human mitochondrial (mt) AspRS-2, the discriminating (D) Thermus thermophilus AspRS-1, and the nondiscriminating (ND)...; Region: EcAspRS_like_N; cd04317 717522007089 dimer interface [polypeptide binding]; other site 717522007090 anticodon binding site; other site 717522007091 Asp tRNA synthetase (aspRS) class II core domain. Class II assignment is based upon its structure and the presence of three characteristic sequence motifs. AspRS is a homodimer, which attaches a specific amino acid to the 3' OH group of ribose of...; Region: AspRS_core; cd00777 717522007092 homodimer interface [polypeptide binding]; other site 717522007093 motif 1; other site 717522007094 active site 717522007095 motif 2; other site 717522007096 GAD domain; Region: GAD; pfam02938 717522007097 Class II tRNA amino-acyl synthetase-like catalytic core domain. Class II amino acyl-tRNA synthetases (aaRS) share a common fold and generally attach an amino acid to the 3' OH of ribose of the appropriate tRNA. PheRS is an exception in that it...; Region: class_II_aaRS-like_core; cl00268 717522007098 active site 717522007099 motif 3; other site 717522007100 2-dehydropantoate 2-reductase; Provisional; Region: PRK12921 717522007101 Ketopantoate reductase PanE/ApbA; Region: ApbA; pfam02558 717522007102 Ketopantoate reductase PanE/ApbA C terminal; Region: ApbA_C; pfam08546 717522007103 Pyrabactin resistance 1 (PYR1), PYR1-like (PYL), regulatory component of abscisic acid receptors (RCARs), and related proteins; Region: PYR_PYL_RCAR_like; cd07821 717522007104 putative hydrophobic ligand binding site [chemical binding]; other site 717522007105 protein interface [polypeptide binding]; other site 717522007106 gate; other site 717522007107 Predicted metalloprotease [General function prediction only]; Region: COG2321 717522007108 Putative neutral zinc metallopeptidase; Region: Zn_peptidase; pfam04228 717522007109 Predicted phosphohydrolases [General function prediction only]; Region: Icc; COG1409 717522007110 metallophosphatase superfamily, metallophosphatase domain; Region: MPP_superfamily; cl13995 717522007111 active site 717522007112 metal binding site [ion binding]; metal-binding site 717522007113 DNA repair photolyase [DNA replication, recombination, and repair]; Region: SplB; COG1533 717522007114 haloalkane dehalogenase; Provisional; Region: PRK03592 717522007115 histidyl-tRNA synthetase; Reviewed; Region: hisS; PRK00037 717522007116 Class II Histidinyl-tRNA synthetase (HisRS)-like catalytic core domain. HisRS is a homodimer. It is responsible for the attachment of histidine to the 3' OH group of ribose of the appropriate tRNA. This domain is primarily responsible for...; Region: HisRS-like_core; cd00773 717522007117 dimer interface [polypeptide binding]; other site 717522007118 motif 1; other site 717522007119 active site 717522007120 motif 2; other site 717522007121 motif 3; other site 717522007122 HisRS Histidyl-anticodon binding domain. HisRS belongs to class II aminoacyl-tRNA synthetases (aaRS). This alignment contains the anticodon binding domain, which is responsible for specificity in tRNA-binding, so that the activated amino acid is...; Region: HisRS_anticodon; cd00859 717522007123 anticodon binding site; other site 717522007124 Zn-dependent hydrolases, including glyoxylases [General function prediction only]; Region: GloB; COG0491 717522007125 cyclophilin: cyclophilin-type peptidylprolyl cis- trans isomerases. This family contains eukaryotic, bacterial and archeal proteins which exhibit a peptidylprolyl cis- trans isomerases activity (PPIase, Rotamase) and in addition bind the...; Region: cyclophilin; cd00317 717522007126 active site 717522007127 (p)ppGpp synthetase, RelA/SpoT family; Region: spoT_relA; TIGR00691 717522007128 Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077 717522007129 Zn2+ binding site [ion binding]; other site 717522007130 Mg2+ binding site [ion binding]; other site 717522007131 Nucleotidyltransferase (NT) domain of RelA- and SpoT-like ppGpp synthetases and hydrolases; Region: NT_Rel-Spo_like; cd05399 717522007132 synthetase active site [active] 717522007133 NTP binding site [chemical binding]; other site 717522007134 metal binding site [ion binding]; metal-binding site 717522007135 TGS_RelA_SpoT: The RelA (SpoT) protein, also referred to as ppGpp hydrolase/synthetase, is a ribosome-associated protein that is activated during amino acid starvation and thought to mediate the stringent response. RelA contains a TGS domain, named after...; Region: TGS_RelA_SpoT; cd01668 717522007136 ACT domain found C-terminal of the RelA/SpoT domains; Region: ACT_RelA-SpoT; cd04876 717522007137 Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223 717522007138 active site 717522007139 The substrate-binding domain of an ABC-type nickel/oligopeptide-like import system contains the type 2 periplasmic binding fold; Region: PBP2_NikA_DppA_OppA_like; cl01709 717522007140 ABC-type dipeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: DdpA; COG0747 717522007141 preprotein translocase subunit SecF; Reviewed; Region: secF; PRK13022 717522007142 Protein export membrane protein; Region: SecD_SecF; pfam02355 717522007143 preprotein translocase subunit SecD; Reviewed; Region: secD; PRK05812 717522007144 protein-export membrane protein, SecD/SecF family; Region: 2A0604s01; TIGR00916 717522007145 preprotein translocase subunit YajC; Validated; Region: yajC; PRK05886 717522007146 4-aminobutyrate aminotransferase; Provisional; Region: PRK06058 717522007147 Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610 717522007148 inhibitor-cofactor binding pocket; inhibition site 717522007149 pyridoxal 5'-phosphate binding site [chemical binding]; other site 717522007150 catalytic residue [active] 717522007151 Long-chain acyl-CoA synthetases (AMP-forming) [Lipid metabolism]; Region: FAA1; COG1022 717522007152 Adenylate forming domain, Class I; Region: AFD_class_I; cl17068 717522007153 acyl-activating enzyme (AAE) consensus motif; other site 717522007154 AMP binding site [chemical binding]; other site 717522007155 active site 717522007156 CoA binding site [chemical binding]; other site 717522007157 Putative dehydrogenase domain of multifunctional non-ribosomal peptide synthetases and related enzymes [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3320 717522007158 extended (e) SDRs, subgroup 1; Region: SDR_e1; cd05235 717522007159 putative NAD(P) binding site [chemical binding]; other site 717522007160 active site 717522007161 putative substrate binding site [chemical binding]; other site 717522007162 PE family; Region: PE; pfam00934 717522007163 Holliday junction DNA helicase RuvB; Reviewed; Region: ruvB; PRK00080 717522007164 The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009 717522007165 Walker A motif; other site 717522007166 ATP binding site [chemical binding]; other site 717522007167 Walker B motif; other site 717522007168 arginine finger; other site 717522007169 Holliday junction DNA helicase ruvB C-terminus; Region: RuvB_C; pfam05491 717522007170 Holliday junction DNA helicase RuvA; Reviewed; Region: ruvA; PRK00116 717522007171 RuvA N terminal domain; Region: RuvA_N; pfam01330 717522007172 Holliday junction resolvases (HJRs) are endonucleases that specifically resolve Holliday junction DNA intermediates during homologous recombination. HJR's occur in archaea, bacteria, and in the mitochondria of certain fungi, however this CD...; Region: RuvC_resolvase; cd00529 717522007173 active site 717522007174 putative DNA-binding cleft [nucleotide binding]; other site 717522007175 dimer interface [polypeptide binding]; other site 717522007176 Regulators of stationary/sporulation gene expression [Transcription]; Region: AbrB; COG2002 717522007177 looped-hinge helix DNA binding domain, AbrB family; Region: lp_hng_hel_AbrB; TIGR01439 717522007178 PIN domain of ribonucleases (toxins), VapC, FitB, and PAE0151 of bacterial and archaeal toxin/antitoxin-like operons, and other similar homologs; Region: PIN_VapC-like; cd09861 717522007179 putative active site [active] 717522007180 Domain of unknown function (DUF4178); Region: DUF4178; pfam13785 717522007181 Protein of unknown function DUF2617; Region: DUF2617; pfam10936 717522007182 Domain of unknown function (DUF4247); Region: DUF4247; pfam14042 717522007183 Domain of Unknown Function (DUF350); Region: DUF350; pfam03994 717522007184 Predicted spermidine synthase with an N-terminal membrane domain [General function prediction only]; Region: COG4262 717522007185 Spermine/spermidine synthase; Region: Spermine_synth; pfam01564 717522007186 Plasmid stability protein [General function prediction only]; Region: StbC; COG4691 717522007187 Mycobacterium tuberculosis PIN domain family; Region: Mtu_PIN_fam; TIGR00028 717522007188 hypothetical protein; Validated; Region: PRK00110 717522007189 Glutamine Amidotransferase (GATase_I) involved in pyridoxine biosynthesis; Region: GATase1_PB; cd01749 717522007190 predicted active site [active] 717522007191 catalytic triad [active] 717522007192 acyl-CoA thioesterase II; Region: tesB; TIGR00189 717522007193 Thioesterase II (TEII) is thought to regenerate misprimed nonribosomal peptide synthetases (NRPSs) as well as modular polyketide synthases (PKSs) by hydrolyzing acetyl groups bound to the peptidyl carrier protein (PCP) and acyl carrier protein (ACP)...; Region: Thioesterase_II_repeat2; cd03445 717522007194 active site 717522007195 Thioesterase II (TEII) is thought to regenerate misprimed nonribosomal peptide synthetases (NRPSs) as well as modular polyketide synthases (PKSs) by hydrolyzing acetyl groups bound to the peptidyl carrier protein (PCP) and acyl carrier protein (ACP)...; Region: Thioesterase_II_repeat1; cd03444 717522007196 catalytic triad [active] 717522007197 dimer interface [polypeptide binding]; other site 717522007198 pyridoxal 5'-phosphate synthase, synthase subunit Pdx1; Region: TIGR00343 717522007199 PdxS is a subunit of the pyridoxal 5'-phosphate (PLP) synthase, an important enzyme in deoxyxylulose 5-phosphate (DXP)-independent pathway for de novo biosynthesis of PLP, present in some eubacteria, in archaea, fungi, plants, plasmodia, and some...; Region: pdxS; cd04727 717522007200 active site 717522007201 multimer interface [polypeptide binding]; other site 717522007202 Pyridoxamine-phosphate oxidase [Coenzyme metabolism]; Region: PdxH; COG0259 717522007203 Pyridoxamine 5'-phosphate oxidase; Region: Pyridox_oxidase; pfam01243 717522007204 Pyridoxine 5'-phosphate oxidase C-terminal dimerisation region; Region: PNPOx_C; pfam10590 717522007205 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522007206 PPE family; Region: PPE; pfam00823 717522007207 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522007208 PE-PPE domain; Region: PE-PPE; pfam08237 717522007209 Members of the Nudix hydrolase superfamily catalyze the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily requires a divalent cation, such as Mg2+ or Mn2+, for their activity and contain a highly...; Region: Nudix_Hydrolase_26; cd04685 717522007210 nudix motif; other site 717522007211 Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438 717522007212 This family is most closely related to the GT1 family of glycosyltransferases and named after YqgM in Bacillus licheniformis about which little is known. Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to...; Region: GT1_YqgM_like; cd03801 717522007213 Bacterial lipid A biosynthesis acyltransferase; Region: Lip_A_acyltrans; pfam03279 717522007214 Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: LABLAT-like; Region: LPLAT_LABLAT-like; cd07984 717522007215 putative acyl-acceptor binding pocket; other site 717522007216 Phosphatidylglycerophosphate synthase [Lipid metabolism]; Region: PgsA; COG0558 717522007217 FHIT (fragile histidine family): FHIT proteins, related to the HIT family carry a motif HxHxH/Qxx (x, is a hydrophobic amino acid), On the basis of sequence, substrate specificity, structure, evolution and mechanism, HIT proteins are classified into...; Region: FHIT; cd01275 717522007218 nucleotide binding site/active site [active] 717522007219 HIT family signature motif; other site 717522007220 catalytic residue [active] 717522007221 threonyl-tRNA synthetase; Reviewed; Region: thrS; PRK12305 717522007222 Threonyl and Alanyl tRNA synthetase second additional domain; Region: tRNA_SAD; pfam07973 717522007223 Threonyl-tRNA synthetase (ThrRS) class II core catalytic domain. ThrRS is a homodimer. It is responsible for the attachment of threonine to the 3' OH group of ribose of the appropriate tRNA. This domain is primarily responsible for ATP-dependent...; Region: ThrRS_core; cd00771 717522007224 active site 717522007225 dimer interface [polypeptide binding]; other site 717522007226 motif 1; other site 717522007227 motif 2; other site 717522007228 motif 3; other site 717522007229 ThrRS Threonyl-anticodon binding domain. ThrRS belongs to class II aminoacyl-tRNA synthetases (aaRS). This alignment contains the anticodon binding domain, which is responsible for specificity in tRNA-binding, so that the activated amino acid is...; Region: ThrRS_anticodon; cd00860 717522007230 anticodon binding site; other site 717522007231 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4762 717522007232 Predicted transcriptional regulator [Transcription]; Region: COG2345 717522007233 Helix-turn-helix domain; Region: HTH_20; pfam12840 717522007234 Uncharacterized conserved protein, contains double-stranded beta-helix domain [Function unknown]; Region: COG1917 717522007235 Predicted transcriptional regulator [Transcription]; Region: COG2345 717522007236 Helix-turn-helix domain; Region: HTH_20; pfam12840 717522007237 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522007238 S-adenosylmethionine binding site [chemical binding]; other site 717522007239 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cl17173 717522007240 Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293 717522007241 Ligand Binding Site [chemical binding]; other site 717522007242 Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293 717522007243 Ligand Binding Site [chemical binding]; other site 717522007244 Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293 717522007245 Ligand Binding Site [chemical binding]; other site 717522007246 Universal stress protein family; Region: Usp; pfam00582 717522007247 Ligand Binding Site [chemical binding]; other site 717522007248 SpoIVFB Site-2 protease (S2P), a zinc metalloprotease (MEROPS family M50B), regulates intramembrane proteolysis (RIP), and is involved in the pro-sigmaK pathway of bacterial spore formation. In this subgroup, SpoIVFB (sporulation protein, stage IV cell...; Region: S2P-M50_SpoIVFB_CBS; cd06164 717522007249 active site 717522007250 Peptidase family M50; Region: Peptidase_M50; pfam02163 717522007251 putative substrate binding region [chemical binding]; other site 717522007252 FOG: CBS domain [General function prediction only]; Region: COG0517 717522007253 This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains in association with either the SpoIVFB domain (sporulation protein, stage IV cell wall formation, F locus, promoter-distal B) or the chloride channel protein EriC; Region: CBS_pair_SpoIVFB_EriC_assoc; cd04612 717522007254 FOG: CBS domain [General function prediction only]; Region: COG0517 717522007255 The CBS domain, named after human CBS, is a small domain originally identified in cystathionine beta-synthase and is subsequently found in a wide range of different proteins. CBS domains usually occur in tandem repeats. They associate to form a so-called...; Region: CBS_pair_9; cd04622 717522007256 peptide chain release factor 1; Provisional; Region: PRK04011 717522007257 SHS2 domain protein implicated in nucleic acid metabolism [General function prediction only]; Region: COG1371 717522007258 Uncharacterized conserved protein [Function unknown]; Region: RtcB; COG1690 717522007259 hypothetical protein; Reviewed; Region: PRK09588 717522007260 Domain of unknown function (DUF1876); Region: DUF1876; pfam08962 717522007261 Hemerythrin-like domain; Region: Hr-like; cd12108 717522007262 Fe binding site [ion binding]; other site 717522007263 PE family; Region: PE; pfam00934 717522007264 Chloramphenicol (Cm) phosphotransferase (CPT). Cm-inactivating enzyme; modifies the primary (C-3) hydroxyl of the antibiotic. Related structurally to shikimate kinase II; Region: CPT; cd00227 717522007265 P-loop motif; other site 717522007266 ATP binding site [chemical binding]; other site 717522007267 Chloramphenicol (Cm) binding site [chemical binding]; other site 717522007268 catalytic residue [active] 717522007269 Uncharacterized membrane-associated protein [Function unknown]; Region: DedA; COG0586 717522007270 SNARE associated Golgi protein; Region: SNARE_assoc; cl00429 717522007271 Sulphate Transporter and Anti-Sigma factor antagonist) domain of anti-anti-sigma factors, key regulators of anti-sigma factors by phosphorylation; Region: STAS_anti-anti-sigma_factors; cd07043 717522007272 anti sigma factor interaction site; other site 717522007273 regulatory phosphorylation site [posttranslational modification]; other site 717522007274 hypothetical protein; Provisional; Region: PRK02237 717522007275 Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090 717522007276 Transcriptional regulators [Transcription]; Region: MarR; COG1846 717522007277 putative DNA binding site [nucleotide binding]; other site 717522007278 putative Zn2+ binding site [ion binding]; other site 717522007279 This conserved domain belongs to a superfamily including the bleomycin resistance protein, glyoxalase I, and type I ring-cleaving dioxygenases; Region: Glo_EDI_BRP_like_20; cd07254 717522007280 Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903 717522007281 putative metal binding site [ion binding]; other site 717522007282 Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090 717522007283 dimerization interface [polypeptide binding]; other site 717522007284 putative DNA binding site [nucleotide binding]; other site 717522007285 putative Zn2+ binding site [ion binding]; other site 717522007286 Arsenite efflux pump ACR3 and related permeases [Inorganic ion transport and metabolism]; Region: ACR3; COG0798 717522007287 arsenical-resistance protein; Region: acr3; TIGR00832 717522007288 Protein-tyrosine-phosphatase [Signal transduction mechanisms]; Region: Wzb; COG0394 717522007289 Low molecular weight phosphatase family; Region: LMWPc; cd00115 717522007290 active site 717522007291 RD11 Region of difference RD11, phiRv2, deleted region in Mycobacterium bovis BCG Pasteur, BCG Tokyo, BCG Mexico and Mycobacterium bovis AF2122/97 compared to Mycobacterium tuberculosis H37Rv2. Removes genes Rv2645-Rv2659c. The region comprises a copy of IS6110 and the phiRv2 prophage 717522007292 Transposase, Mutator family; Region: Transposase_mut; pfam00872 717522007293 MULE transposase domain; Region: MULE; pfam10551 717522007294 ATP-binding subunits of Clp protease and DnaK/DnaJ chaperones [Posttranslational modification, protein turnover, chaperones]; Region: clpA; COG0542 717522007295 Acetyltransferase (GNAT) domain; Region: Acetyltransf_10; pfam13673 717522007296 N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301 717522007297 Coenzyme A binding pocket [chemical binding]; other site 717522007298 AFG1-like ATPase; Region: AFG1_ATPase; pfam03969 717522007299 hypothetical protein; Provisional; Region: PRK14059 717522007300 Pyrimidine reductase, riboflavin biosynthesis [Coenzyme metabolism]; Region: RibD; COG1985 717522007301 Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596 717522007302 TAP-like protein; Region: Abhydrolase_4; pfam08386 717522007303 Protein of unknown function (DUF2029); Region: DUF2029; pfam09594 717522007304 Conserved domain frequently associated with peptide methionine sulfoxide reductase [Posttranslational modification, protein turnover, chaperones]; Region: COG0229 717522007305 SelR domain; Region: SelR; pfam01641 717522007306 Methyltransferase domain; Region: Methyltransf_31; pfam13847 717522007307 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522007308 S-adenosylmethionine binding site [chemical binding]; other site 717522007309 Predicted heme peroxidase involved in anaerobic stress response [General function prediction only]; Region: ywfI; COG3253 717522007310 protoporphyrinogen oxidase; Reviewed; Region: PRK11883 717522007311 NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450 717522007312 NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500 717522007313 Uroporphyrinogen decarboxylase (URO-D) is a dimeric cytosolic enzyme that decarboxylates the four acetate side chains of uroporphyrinogen III (uro-III) to create coproporphyrinogen III, without requiring any prosthetic groups or cofactors. This reaction...; Region: URO-D; cd00717 717522007314 substrate binding site [chemical binding]; other site 717522007315 active site 717522007316 Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558 717522007317 Enoyl-CoA hydratase/carnithine racemase [Lipid metabolism]; Region: CaiD; COG1024 717522007318 substrate binding site [chemical binding]; other site 717522007319 oxyanion hole (OAH) forming residues; other site 717522007320 trimer interface [polypeptide binding]; other site 717522007321 Protein of unknown function (DUF3000); Region: DUF3000; pfam11452 717522007322 Ribonuclease D [Translation, ribosomal structure and biogenesis]; Region: Rnd; COG0349 717522007323 DEDDy 3'-5' exonuclease domain of Ribonuclease D and similar proteins; Region: RNaseD_exo; cd06142 717522007324 catalytic site [active] 717522007325 putative active site [active] 717522007326 putative substrate binding site [chemical binding]; other site 717522007327 Deoxyxylulose-5-phosphate synthase [Coenzyme metabolism / Lipid metabolism]; Region: Dxs; COG1154 717522007328 Thiamine pyrophosphate (TPP) family, DXS subfamily, TPP-binding module; 1-Deoxy-D-xylulose-5-phosphate synthase (DXS) is a regulatory enzyme of the mevalonate-independent pathway involved in terpenoid biosynthesis. Terpeniods are plant natural products...; Region: TPP_DXS; cd02007 717522007329 TPP-binding site; other site 717522007330 Pyrimidine (PYR) binding domain of 1-deoxy-D-xylulose-5-phosphate synthase (DXS), transketolase (TK), and related proteins; Region: TPP_PYR_DXS_TK_like; cd07033 717522007331 PYR/PP interface [polypeptide binding]; other site 717522007332 dimer interface [polypeptide binding]; other site 717522007333 TPP binding site [chemical binding]; other site 717522007334 Transketolase, C-terminal domain; Region: Transketolase_C; pfam02780 717522007335 The CBS domain, named after human CBS, is a small domain originally identified in cystathionine beta-synthase and is subsequently found in a wide range of different proteins. CBS domains usually occur in tandem repeats. They associate to form a so-called...; Region: CBS_pair; cd02205 717522007336 Na+/H+ antiporter NhaD and related arsenite permeases [Inorganic ion transport and metabolism]; Region: ArsB; COG1055 717522007337 Permease P (pink-eyed dilution). Mutations in the human melanosomal P gene were responsible for classic phenotype of oculocutaneous albinism type 2 (OCA2). Although the precise function of the P protein is unknown, it was predicted to regulate the...; Region: P_permease; cd01116 717522007338 transmembrane helices; other site 717522007339 Na+/H+ antiporter NhaD and related arsenite permeases [Inorganic ion transport and metabolism]; Region: ArsB; COG1055 717522007340 Permease P (pink-eyed dilution). Mutations in the human melanosomal P gene were responsible for classic phenotype of oculocutaneous albinism type 2 (OCA2). Although the precise function of the P protein is unknown, it was predicted to regulate the...; Region: P_permease; cd01116 717522007341 transmembrane helices; other site 717522007342 ABC-type multidrug transport system, ATPase component [Defense mechanisms]; Region: CcmA; COG1131 717522007343 ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230 717522007344 Walker A/P-loop; other site 717522007345 ATP binding site [chemical binding]; other site 717522007346 Q-loop/lid; other site 717522007347 ABC transporter signature motif; other site 717522007348 Walker B; other site 717522007349 D-loop; other site 717522007350 H-loop/switch region; other site 717522007351 TRAM domain; Region: TRAM; cl01282 717522007352 SAM-dependent methyltransferases related to tRNA (uracil-5-)-methyltransferase [Translation, ribosomal structure and biogenesis]; Region: TrmA; COG2265 717522007353 Amino acid transporters [Amino acid transport and metabolism]; Region: PotE; COG0531 717522007354 K+ transport systems, NAD-binding component [Inorganic ion transport and metabolism]; Region: TrkA; COG0569 717522007355 TrkA-N domain; Region: TrkA_N; pfam02254 717522007356 TrkA-C domain; Region: TrkA_C; pfam02080 717522007357 K+ transport systems, NAD-binding component [Inorganic ion transport and metabolism]; Region: TrkA; COG0569 717522007358 TrkA-N domain; Region: TrkA_N; pfam02254 717522007359 TrkA-C domain; Region: TrkA_C; pfam02080 717522007360 Protein of unknown function (DUF3159); Region: DUF3159; pfam11361 717522007361 RecG_wedge_OBF: A subfamily of OB folds corresponding to the OB fold found in the N-terminal (wedge) domain of Escherichia coli RecG. RecG is a branched-DNA-specific helicase, which catalyzes the interconversion of a DNA replication fork to a...; Region: RecG_wedge_OBF; cd04488 717522007362 generic binding surface II; other site 717522007363 ssDNA binding site; other site 717522007364 Protein of unknown function (DUF3710); Region: DUF3710; pfam12502 717522007365 Trimeric dUTP diphosphatases; Region: trimeric_dUTPase; cd07557 717522007366 trimer interface [polypeptide binding]; other site 717522007367 active site 717522007368 Protein of unknown function (DUF3093); Region: DUF3093; pfam11292 717522007369 Domain of unknown function (DUF4193); Region: DUF4193; pfam13834 717522007370 LytR cell envelope-related transcriptional attenuator; Region: LytR_C; pfam13399 717522007371 Archaeal fructose-1,6-bisphosphatase and related enzymes of inositol monophosphatase family [Carbohydrate transport and metabolism]; Region: SuhB; COG0483 717522007372 IMPase, inositol monophosphatase and related domains. A family of Mg++ dependent phosphatases, inhibited by lithium, many of which may act on inositol monophosphate substrate. They dephosphorylate inositol phosphate to generate inositol, which may be...; Region: IMPase; cd01639 717522007373 active site 717522007374 dimerization interface [polypeptide binding]; other site 717522007375 Transcriptional regulator/sugar kinase [Transcription / Carbohydrate transport and metabolism]; Region: NagC; COG1940 717522007376 Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cl17037 717522007377 RNA polymerase sigma factor SigB; Reviewed; Region: PRK07921 717522007378 Sigma-70 region 2; Region: Sigma70_r2; pfam04542 717522007379 Sigma-70 region 3; Region: Sigma70_r3; pfam04539 717522007380 Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171 717522007381 DNA binding residues [nucleotide binding] 717522007382 This group of proteins belong to a large family of YjgF/YER057c/UK114-like proteins present in bacteria, archaea, and eukaryotes with no definitive function. The conserved domain is similar in structure to chorismate mutase but there is no sequence...; Region: YjgF_YER057c_UK114_like_6; cd06154 717522007383 homotrimer interaction site [polypeptide binding]; other site 717522007384 putative active site [active] 717522007385 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3502 717522007386 Ribonuclease BN family enzyme [Replication, recombination, and repair]; Region: Rbn; COG1295 717522007387 Protein of unknown function (DUF3039); Region: DUF3039; pfam11238 717522007388 Protein of unknown function (DUF3099); Region: DUF3099; pfam11298 717522007389 RNA polymerase sigma factor SigB; Reviewed; Region: PRK07921 717522007390 Sigma-70 factor, region 1.2; Region: Sigma70_r1_2; pfam00140 717522007391 Sigma-70 region 2; Region: Sigma70_r2; pfam04542 717522007392 Sigma-70 region 3; Region: Sigma70_r3; pfam04539 717522007393 Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171 717522007394 DNA binding residues [nucleotide binding] 717522007395 Mn-dependent transcriptional regulator [Transcription]; Region: TroR; COG1321 717522007396 Iron dependent repressor, N-terminal DNA binding domain; Region: Fe_dep_repress; pfam01325 717522007397 Iron dependent repressor, metal binding and dimerisation domain; Region: Fe_dep_repr_C; pfam02742 717522007398 This entry represents the core domain of the ferrous iron (Fe2+) transport protein FeoA found in bacteria; Region: FeoA; smart00899 717522007399 Domain of unknown function (DUF4192); Region: DUF4192; pfam13830 717522007400 soluble pyridine nucleotide transhydrogenase; Provisional; Region: PRK05249 717522007401 NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500 717522007402 Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070 717522007403 Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852 717522007404 PAC2 family; Region: PAC2; pfam09754 717522007405 Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596 717522007406 methyl indole-3-acetate methyltransferase; Region: PLN02211; cl17657 717522007407 Predicted epimerase, PhzC/PhzF homolog [General function prediction only]; Region: COG0384 717522007408 nitrobindin heme-binding domain; Region: nitrobindin; cd07828 717522007409 heme-binding site [chemical binding]; other site 717522007410 transcriptional regulator NrdR; Validated; Region: nrdR; PRK00464 717522007411 ATP cone domain; Region: ATP-cone; pfam03477 717522007412 LysM domain; Region: LysM; pfam01476 717522007413 LexA repressor; Validated; Region: PRK00215 717522007414 LexA DNA binding domain; Region: LexA_DNA_bind; pfam01726 717522007415 Peptidase S24 LexA-like proteins are involved in the SOS response leading to the repair of single-stranded DNA within the bacterial cell. This family includes: the lambda repressor CI/C2 family and related bacterial prophage repressor proteins; LexA (EC...; Region: S24_LexA-like; cd06529 717522007416 Catalytic site [active] 717522007417 Uncharacterized protein potentially involved in peptidoglycan biosynthesis [Cell envelope biogenesis, outer membrane]; Region: COG5479 717522007418 LGFP repeat; Region: LGFP; pfam08310 717522007419 LGFP repeat; Region: LGFP; pfam08310 717522007420 LGFP repeat; Region: LGFP; pfam08310 717522007421 LGFP repeat; Region: LGFP; pfam08310 717522007422 LGFP repeat; Region: LGFP; pfam08310 717522007423 Integral membrane protein TerC family; Region: TerC; cl10468 717522007424 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522007425 Acyl-CoA dehydrogenase; Region: ACAD; cl09933 717522007426 active site 717522007427 GTPases [General function prediction only]; Region: HflX; COG2262 717522007428 GTP-binding GTPase N-terminal; Region: GTP-bdg_N; pfam13167 717522007429 HflX GTPase family; Region: HflX; cd01878 717522007430 G1 box; other site 717522007431 GTP/Mg2+ binding site [chemical binding]; other site 717522007432 Switch I region; other site 717522007433 G2 box; other site 717522007434 G3 box; other site 717522007435 Switch II region; other site 717522007436 G4 box; other site 717522007437 G5 box; other site 717522007438 diaminopimelate epimerase; Region: DapF; TIGR00652 717522007439 Diaminopimelate epimerase; Region: DAP_epimerase; pfam01678 717522007440 Diaminopimelate epimerase; Region: DAP_epimerase; pfam01678 717522007441 tRNA delta(2)-isopentenylpyrophosphate transferase [Translation, ribosomal structure and biogenesis]; Region: MiaA; COG0324 717522007442 tRNA delta(2)-isopentenylpyrophosphate transferase; Reviewed; Region: miaA; PRK00091 717522007443 Subunit B of Class III Extradiol ring-cleavage dioxygenases; Region: Extradiol_Dioxygenase_3B_like; cl00599 717522007444 active site 717522007445 metal binding site [ion binding]; metal-binding site 717522007446 Domain of Unknown Function (DUF349); Region: DUF349; pfam03993 717522007447 Domain of Unknown Function (DUF349); Region: DUF349; pfam03993 717522007448 Domain of Unknown Function (DUF349); Region: DUF349; pfam03993 717522007449 (dimethylallyl)adenosine tRNA methylthiotransferase; Provisional; Region: PRK14326 717522007450 Uncharacterized protein family UPF0004; Region: UPF0004; pfam00919 717522007451 Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335 717522007452 FeS/SAM binding site; other site 717522007453 TRAM domain; Region: TRAM; cl01282 717522007454 Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335 717522007455 FeS/SAM binding site; other site 717522007456 Uncharacterized protein conserved in bacteria [General function prediction only]; Region: OraA; COG2137 717522007457 DNA recombination protein RecA; Reviewed; Region: recA; PRK09519 717522007458 RecA is a bacterial enzyme which has roles in homologous recombination, DNA repair, and the induction of the SOS response. RecA couples ATP hydrolysis to DNA strand exchange; Region: recA; cd00983 717522007459 hexamer interface [polypeptide binding]; other site 717522007460 Walker A motif; other site 717522007461 ATP binding site [chemical binding]; other site 717522007462 Walker B motif; other site 717522007463 Hedgehog/Intein domain, found in Hedgehog proteins as well as proteins which contain inteins and undergo protein splicing (e.g. DnaB, RIR1-2, GyrA and Pol). In protein splicing an intervening polypeptide sequence - the intein - is excised from a protein; Region: Hint; cd00081 717522007464 protein-splicing catalytic site; other site 717522007465 thioester formation/cholesterol transfer; other site 717522007466 Hint (Hedgehog/Intein) domain C-terminal region; Region: HintC; smart00305 717522007467 recA bacterial DNA recombination protein; Region: RecA; cl17211 717522007468 FhuF 2Fe-2S C-terminal domain; Region: FhuF_C; pfam11575 717522007469 Protein of unknown function (DUF3046); Region: DUF3046; pfam11248 717522007470 Glycosyl transferases, related to UDP-glucuronosyltransferase [Carbohydrate transport and metabolism / Signal transduction mechanisms]; Region: COG1819 717522007471 Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. The acceptor molecule can be a lipid, a protein, a heterocyclic compound, or another carbohydrate...; Region: Glycosyltransferase_GTB_type; cl10013 717522007472 Limonene-1,2-epoxide hydrolase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: LimA; COG4308 717522007473 PE family; Region: PE; pfam00934 717522007474 Protein of unknown function (DUF3046); Region: DUF3046; pfam11248 717522007475 Phage shock protein A (IM30), suppresses sigma54-dependent transcription [Transcription / Signal transduction mechanisms]; Region: PspA; COG1842 717522007476 Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093 717522007477 non-specific DNA binding site [nucleotide binding]; other site 717522007478 salt bridge; other site 717522007479 sequence-specific DNA binding site [nucleotide binding]; other site 717522007480 Phosphatidylglycerophosphate synthase [Lipid metabolism]; Region: PgsA; COG0558 717522007481 N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301 717522007482 Coenzyme A binding pocket [chemical binding]; other site 717522007483 DNA segregation ATPase FtsK/SpoIIIE and related proteins [Cell division and chromosome partitioning]; Region: FtsK; COG1674 717522007484 FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580 717522007485 This domain directs oriented DNA translocation and forms a winged helix structure; Region: Ftsk_gamma; smart00843 717522007486 Uncharacterized conserved protein [Function unknown]; Region: COG1359 717522007487 3-ketoacyl-(acyl-carrier-protein) reductase; Reviewed; Region: PRK12826 717522007488 classical (c) SDRs; Region: SDR_c; cd05233 717522007489 NAD(P) binding site [chemical binding]; other site 717522007490 active site 717522007491 O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315 717522007492 methyltransferase, TIGR00027 family; Region: mthyl_TIGR00027 717522007493 mRNA degradation ribonucleases J1/J2 (metallo-beta-lactamase superfamily) [Translation, ribosomal structure and biogenesis; Replication, recombination and repair]; Region: COG0595 717522007494 Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849 717522007495 RNA-metabolising metallo-beta-lactamase; Region: RMMBL; pfam07521 717522007496 Dihydrodipicolinate synthase/N-acetylneuraminate lyase [Amino acid transport and metabolism / Cell envelope biogenesis, outer membrane]; Region: DapA; COG0329 717522007497 Dihydrodipicolinate synthase (DHDPS); Region: DHDPS; cd00950 717522007498 dimer interface [polypeptide binding]; other site 717522007499 active site 717522007500 catalytic residue [active] 717522007501 FAD-dependent thymidylate synthase; Reviewed; Region: thyX; PRK00847 717522007502 Type I restriction modification DNA specificity domain; Region: Methylase_S; pfam01420 717522007503 HsdM N-terminal domain; Region: HsdM_N; pfam12161 717522007504 N-6 DNA Methylase; Region: N6_Mtase; pfam02384 717522007505 Methyltransferase domain; Region: Methyltransf_26; pfam13659 717522007506 PIN domain of the Rv0301 toxin of Mycobacterium tuberculosis and other uncharacterized, annotated PilT protein domain proteins; Region: PIN_MtRv0301; cd09882 717522007507 putative active site [active] 717522007508 Transcription regulator of the Arc/MetJ class [Transcription]; Region: COG5450 717522007509 PIN domain of the VapC-like UPF0110 protein Mb0640 and homologs; Region: PIN_UPF0110; cd09871 717522007510 putative active site [active] 717522007511 Rv0623-like transcription factor; Region: PSK_trans_fac; pfam07704 717522007512 Type I restriction modification DNA specificity domain; Region: Methylase_S; pfam01420 717522007513 Restriction endonuclease S subunits [Defense mechanisms]; Region: HsdS; COG0732 717522007514 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3214 717522007515 Dihydrofolate reductase [Coenzyme metabolism]; Region: FolA; COG0262 717522007516 Dihydrofolate reductase (DHFR). Reduces 7,8-dihydrofolate to 5,6,7,8-tetrahydrofolate with NADPH as a cofactor. This is an essential step in the biosynthesis of deoxythymidine phosphate since 5,6,7,8-tetrahydrofolate is required to regenerate 5; Region: DHFR; cd00209 717522007517 folate binding site [chemical binding]; other site 717522007518 NADP+ binding site [chemical binding]; other site 717522007519 thymidylate synthase; Reviewed; Region: thyA; PRK01827 717522007520 Thymidylate synthase and pyrimidine hydroxymethylase: Thymidylate synthase (TS) and deoxycytidylate hydroxymethylase (dCMP-HMase) are homologs that catalyze analogous alkylation of C5 of pyrimidine nucleotides. Both enzymes are involved in the...; Region: TS_Pyrimidine_HMase; cd00351 717522007521 dimerization interface [polypeptide binding]; other site 717522007522 active site 717522007523 Dienelactone hydrolase family; Region: DLH; pfam01738 717522007524 BAAT / Acyl-CoA thioester hydrolase C terminal; Region: BAAT_C; pfam08840 717522007525 3-ketoacyl-(acyl-carrier-protein) reductase; Provisional; Region: fabG; PRK07231 717522007526 classical (c) SDRs; Region: SDR_c; cd05233 717522007527 NAD(P) binding site [chemical binding]; other site 717522007528 active site 717522007529 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522007530 PPE family; Region: PPE; pfam00823 717522007531 Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484 717522007532 PE family; Region: PE; pfam00934 717522007533 Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484 717522007534 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522007535 PPE family; Region: PPE; pfam00823 717522007536 Multimeric flavodoxin WrbA [General function prediction only]; Region: WrbA; COG0655 717522007537 dihydrodipicolinate reductase; Provisional; Region: PRK00048 717522007538 Dihydrodipicolinate reductase, N-terminus; Region: DapB_N; pfam01113 717522007539 Dihydrodipicolinate reductase, C-terminus; Region: DapB_C; pfam05173 717522007540 Acetyltransferase (GNAT) domain; Region: Acetyltransf_10; pfam13673 717522007541 N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301 717522007542 N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182 717522007543 Coenzyme A binding pocket [chemical binding]; other site 717522007544 Flavodoxin reductases (ferredoxin-NADPH reductases) family 1 [Energy production and conversion]; Region: Hmp; COG1018 717522007545 Phthalate dioxygenase reductase (PDR) is an FMN-dependent reductase that mediates electron transfer from NADH to FMN to an iron sulfur cluster. PDR has an an N-terminal ferrredoxin reductase (FNR)-like NAD(H) binding domain and a C-terminal iron-sulfur; Region: PDR_like; cd06185 717522007546 FMN-binding pocket [chemical binding]; other site 717522007547 flavin binding motif; other site 717522007548 phosphate binding motif [ion binding]; other site 717522007549 beta-alpha-beta structure motif; other site 717522007550 NAD binding pocket [chemical binding]; other site 717522007551 2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207 717522007552 catalytic loop [active] 717522007553 iron binding site [ion binding]; other site 717522007554 Predicted metal-dependent hydrolase [General function prediction only]; Region: COG3687 717522007555 Predicted metal-dependent hydrolase; Region: Metal_hydrol; pfam10118 717522007556 START/RHO_alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) ligand-binding domain superfamily; Region: SRPBCC; cd07812 717522007557 hydrophobic ligand binding site; other site 717522007558 helix_turn_helix ASNC type; Region: HTH_ASNC; smart00344 717522007559 Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090 717522007560 putative DNA binding site [nucleotide binding]; other site 717522007561 putative Zn2+ binding site [ion binding]; other site 717522007562 AsnC family; Region: AsnC_trans_reg; pfam01037 717522007563 Formate/glycerate dehydrogenases, D-specific 2-hydroxy acid dehydrogenases and related dehydrogenases; Region: FDH_GDH_like; cl17240 717522007564 Formate/glycerate dehydrogenases, D-specific 2-hydroxy acid dehydrogenases and related dehydrogenases; Region: FDH_GDH_like; cl17240 717522007565 NAD binding site [chemical binding]; other site 717522007566 Nitronate monooxygenase; Region: NMO; pfam03060 717522007567 2-Nitropropane dioxygenase (NPD), one of the nitroalkane oxidizing enzyme families, catalyzes oxidative denitrification of nitroalkanes to their corresponding carbonyl compounds and nitrites. NDP is a member of the NAD(P)H-dependent flavin oxidoreductase...; Region: NPD_like; cd04730 717522007568 FMN binding site [chemical binding]; other site 717522007569 substrate binding site [chemical binding]; other site 717522007570 putative catalytic residue [active] 717522007571 Predicted Zn-dependent peptidases [General function prediction only]; Region: PqqL; COG0612 717522007572 Insulinase (Peptidase family M16); Region: Peptidase_M16; pfam00675 717522007573 Peptidase M16 inactive domain; Region: Peptidase_M16_C; pfam05193 717522007574 guanosine pentaphosphate synthetase I/polynucleotide phosphorylase; Region: pppGpp_PNP; TIGR02696 717522007575 RNase PH-like 3'-5' exoribonucleases; Region: RNase_PH; cl03114 717522007576 oligomer interface [polypeptide binding]; other site 717522007577 RNA binding site [nucleotide binding]; other site 717522007578 Polyribonucleotide nucleotidyltransferase, RNA binding domain; Region: PNPase; pfam03726 717522007579 Polyribonucleotide nucleotidyltransferase, repeat 2; Region: RNase_PH_PNPase_2; cd11364 717522007580 RNase E interface [polypeptide binding]; other site 717522007581 trimer interface [polypeptide binding]; other site 717522007582 active site 717522007583 Polynucleotide phosphorylase (PNPase) K homology RNA-binding domain (KH). PNPase is a polyribonucleotide nucleotidyl transferase that degrades mRNA in prokaryotes and plant chloroplasts. The C-terminal region of PNPase contains domains homologous to...; Region: PNPase_KH; cd02393 717522007584 putative nucleic acid binding region [nucleotide binding]; other site 717522007585 G-X-X-G motif; other site 717522007586 S1_PNPase: Polynucleotide phosphorylase (PNPase), ), S1-like RNA-binding domain. PNPase is a polyribonucleotide nucleotidyl transferase that degrades mRNA. It is a trimeric multidomain protein. The C-terminus contains the S1 domain which binds ssRNA; Region: S1_PNPase; cd04472 717522007587 RNA binding site [nucleotide binding]; other site 717522007588 domain interface; other site 717522007589 Ribosomal protein S15 (prokaryotic)_S13 (eukaryotic) binds the central domain of 16S rRNA and is required for assembly of the small ribosomal subunit and for intersubunit association, thus representing a key element in the assembly of the whole ribosome; Region: Ribosomal_S15p_S13e; cd00353 717522007590 16S/18S rRNA binding site [nucleotide binding]; other site 717522007591 S13e-L30e interaction site [polypeptide binding]; other site 717522007592 25S rRNA binding site [nucleotide binding]; other site 717522007593 bifunctional riboflavin kinase/FMN adenylyltransferase; Reviewed; Region: PRK05627 717522007594 FAD synthetase, N-terminal domain of the bifunctional enzyme; Region: FAD_synthetase_N; cd02064 717522007595 active site 717522007596 Riboflavin kinase; Region: Flavokinase; pfam01687 717522007597 Antiactivator of flagellar biosynthesis FleN, an ATPase [Cell motility]; Region: flhG; COG0455 717522007598 This protein family consists of proteins similar to the cpaE protein of the Caulobacter pilus assembly and the orf4 protein of Actinobacillus pilus formation gene cluster. The function of these proteins are unkown. The Caulobacter pilus assembly contains...; Region: CpaE_like; cd03111 717522007599 Mn-dependent transcriptional regulator [Transcription]; Region: TroR; COG1321 717522007600 Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090 717522007601 putative DNA binding site [nucleotide binding]; other site 717522007602 Iron dependent repressor, metal binding and dimerisation domain; Region: Fe_dep_repr_C; pfam02742 717522007603 FeoA domain; Region: FeoA; pfam04023 717522007604 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522007605 Acyl-CoA dehydrogenase; Region: ACAD; cl09933 717522007606 active site 717522007607 lipid-transfer protein; Provisional; Region: PRK08256 717522007608 Thiolase domain associated with sterol carrier protein (SCP)-x isoform and related proteins; SCP-2 has multiple roles in intracellular lipid circulation and metabolism. The N-terminal presequence in the SCP-x isoform represents a peroxisomal...; Region: SCP-x_thiolase; cd00829 717522007609 active site 717522007610 Helix-turn-helix domain; Region: HTH_OrfB_IS605; pfam12323 717522007611 Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG0675 717522007612 Probable transposase; Region: OrfB_IS605; pfam01385 717522007613 Predicted site-specific integrase-resolvase [DNA replication, recombination, and repair]; Region: COG2452 717522007614 Serine Recombinase (SR) family, IS607-like transposase subfamily, catalytic domain; members contain a DNA binding domain with homology to MerR/SoxR located N-terminal to the catalytic domain. Serine recombinases catalyze site-specific recombination of...; Region: SR_IS607_transposase_like; cd03769 717522007615 catalytic residues [active] 717522007616 catalytic nucleophile [active] 717522007617 tRNA pseudouridine synthase B; Provisional; Region: truB; PRK03287 717522007618 Pseudouridine synthase, Escherichia coli TruB like; Region: PseudoU_synth_EcTruB; cd02573 717522007619 RNA binding site [nucleotide binding]; other site 717522007620 active site 717522007621 tRNA Pseudouridine synthase II, C terminal; Region: TruB_C; pfam09142 717522007622 Phosphopantetheinyl transferase component of siderophore synthetase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: EntD; COG2977 717522007623 4'-phosphopantetheinyl transferase superfamily; Region: ACPS; pfam01648 717522007624 Predicted phosphohydrolases [General function prediction only]; Region: Icc; COG1409 717522007625 metallophosphatase superfamily, metallophosphatase domain; Region: MPP_superfamily; cl13995 717522007626 active site 717522007627 metal binding site [ion binding]; metal-binding site 717522007628 Uncharacterized conserved protein [Function unknown]; Region: COG4717 717522007629 Alpha/beta hydrolase; Region: Abhydrolase_8; pfam06259 717522007630 Protein of unknown function (DUF3558); Region: DUF3558; pfam12079 717522007631 Predicted acyl esterases [General function prediction only]; Region: COG2936 717522007632 X-Pro dipeptidyl-peptidase C-terminal non-catalytic domain; Region: PepX_C; smart00939 717522007633 Growth inhibitor [Signal transduction mechanisms]; Region: MazF; COG2337 717522007634 Uncharacterized conserved protein [Function unknown]; Region: COG5586 717522007635 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4453 717522007636 Integrase core domain; Region: rve; pfam00665 717522007638 Helix-turn-helix domain; Region: HTH_28; pfam13518 717522007639 Winged helix-turn helix; Region: HTH_29; pfam13551 717522007640 Integrase core domain; Region: rve; pfam00665 717522007641 Integrase core domain; Region: rve_3; pfam13683 717522007642 Mu transposase, C-terminal; Region: Mu-transpos_C; pfam09299 717522007643 Type II secretory pathway, component ExeA (predicted ATPase) [Intracellular trafficking and secretion]; Region: ExeA; COG3267 717522007644 S-RD06, 4921 bp, Region of difference S-RD06. The DR region is composed of near-perfect tandem direct repeats of 36 bases pairs, separated in 2 stretches by the insertion of an IS6110 element inside one copy. In Mycobacterium bovis BCG Pasteur, BCG Tokyo and BCG Mexico, it is composed of 49 copies (19.5 and 29.5), compared to 42 copies (17.5 and 24.5) in Mycobacterium bovis AF and 42 copies (18.5 and 23.5) in Mycobacterium tuberculosis strain H37Rv. 717522007645 putative transposase OrfB; Reviewed; Region: PHA02517 717522007646 HTH-like domain; Region: HTH_21; pfam13276 717522007647 Integrase core domain; Region: rve; pfam00665 717522007648 Integrase core domain; Region: rve_3; pfam13683 717522007649 Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963 717522007650 Transposase; Region: HTH_Tnp_1; cl17663 717522007651 CRISPR/Cas system-associated protein Cas2; Region: Cas2_I_II_III; cd09638 717522007652 CRISPR/Cas system-associated protein Cas1; Region: Cas1_I-II-III; cd09636 717522007654 CRISPR/Cas system-associated protein Csm6; Region: Csm6_III-A; cl09873 717522007655 CRISPR/Cas system-associated RAMP superfamily protein Csm5; Region: Csm5_III-A; cd09662 717522007656 CRISPR/Cas system-associated RAMP superfamily protein Csm4; Region: Csm4_III-A; cd09663 717522007657 CRISPR/Cas system-associated RAMP superfamily protein Csm3; Region: Csm3_III-A; cd09684 717522007658 CRISPR/Cas system-associated protein Csm2; Region: Csm2_III-A; cd09647 717522007659 Predicted CRISPR-associated polymerase [Defense mechanisms]; Region: COG1353 717522007660 CRISPR/Cas system-associated protein Cas10; Region: Cas10_III; cd09680 717522007661 CRISPR/Cas system-associated RAMP superfamily protein Cas6; Region: Cas6-I-III; cd09652 717522007662 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4293 717522007663 Uncharacterized conserved protein [Function unknown]; Region: COG2253 717522007664 Protein of unknown function (DUF2005); Region: DUF2005; pfam09407 717522007665 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4293 717522007666 Uncharacterized conserved protein (DUF2277); Region: DUF2277; pfam10041 717522007667 PIN domain of the VapC-like Sll0205 protein and homologs; Region: PIN_Sll0205; cd09872 717522007668 putative active site [active] 717522007669 Antitoxin of toxin-antitoxin stability system [Cell division and chromosome partitioning]; Region: Phd; COG4118 717522007670 enoyl-CoA hydratase; Provisional; Region: PRK06190 717522007671 Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558 717522007672 substrate binding site [chemical binding]; other site 717522007673 oxyanion hole (OAH) forming residues; other site 717522007674 trimer interface [polypeptide binding]; other site 717522007675 glycerol-3-phosphate transporter ATP-binding subunit; Provisional; Region: ugpC; PRK11650 717522007676 The N-terminal ATPase domain of the maltose transporter, MalK; Region: ABC_MalK_N; cd03301 717522007677 Walker A/P-loop; other site 717522007678 ATP binding site [chemical binding]; other site 717522007679 Q-loop/lid; other site 717522007680 ABC transporter signature motif; other site 717522007681 Walker B; other site 717522007682 D-loop; other site 717522007683 H-loop/switch region; other site 717522007685 ABC-type sugar transport system, periplasmic component [Carbohydrate transport and metabolism]; Region: UgpB; COG1653 717522007686 Bacterial extracellular solute-binding protein; Region: SBP_bac_1; pfam01547 717522007687 ABC-type sugar transport system, permease component [Carbohydrate transport and metabolism]; Region: UgpE; COG0395 717522007688 Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261 717522007689 dimer interface [polypeptide binding]; other site 717522007690 conserved gate region; other site 717522007691 putative PBP binding loops; other site 717522007692 ABC-ATPase subunit interface; other site 717522007693 ABC-type polysaccharide transport system, permease component [Carbohydrate transport and metabolism]; Region: LplB; COG4209 717522007694 Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261 717522007695 dimer interface [polypeptide binding]; other site 717522007696 conserved gate region; other site 717522007697 putative PBP binding loops; other site 717522007698 ABC-ATPase subunit interface; other site 717522007699 Na+-driven multidrug efflux pump [Defense mechanisms]; Region: NorM; COG0534 717522007700 DinF and similar proteins, a subfamily of the multidrug and toxic compound extrusion (MATE)-like proteins; Region: MATE_DinF_like; cd13136 717522007701 Exopolyphosphatase-related proteins [General function prediction only]; Region: COG0618 717522007702 DHH family; Region: DHH; pfam01368 717522007703 ribosome-binding factor A; Validated; Region: rbfA; PRK00521 717522007704 Translation initiation factor IF-2, N-terminal region; Region: IF2_N; pfam04760 717522007705 Translation initiation factor IF-2, N-terminal region; Region: IF2_N; pfam04760 717522007706 Translation initiation factor 2 (IF-2; GTPase) [Translation, ribosomal structure and biogenesis]; Region: InfB; COG0532 717522007707 Initiation Factor 2 (IF2)/ eukaryotic Initiation Factor 5B (eIF5B) family; Region: IF2_eIF5B; cd01887 717522007708 G1 box; other site 717522007709 putative GEF interaction site [polypeptide binding]; other site 717522007710 GTP/Mg2+ binding site [chemical binding]; other site 717522007711 Switch I region; other site 717522007712 G2 box; other site 717522007713 G3 box; other site 717522007714 Switch II region; other site 717522007715 G4 box; other site 717522007716 G5 box; other site 717522007717 This family represents the domain II of bacterial Initiation Factor 2 (IF2) and its eukaryotic mitochondrial homologue mtIF2. IF2, the largest initiation factor is an essential GTP binding protein. In E. coli three natural forms of IF2 exist in the cell; Region: IF2_mtIF2_II; cd03702 717522007718 Translation-initiation factor 2; Region: IF-2; pfam11987 717522007719 mtIF2_IVc: this family represents the C2 subdomain of domain IV of mitochondrial translation initiation factor 2 (mtIF2) which adopts a beta-barrel fold displaying a high degree of structural similarity with domain II of the translation elongation factor...; Region: mtIF2_IVc; cd03692 717522007720 Predicted nucleic-acid-binding protein implicated in transcription termination [Transcription]; Region: COG2740 717522007721 putative RNA binding cleft [nucleotide binding]; other site 717522007722 transcription elongation factor NusA; Provisional; Region: nusA; PRK12327 717522007723 NusA N-terminal domain; Region: NusA_N; pfam08529 717522007724 S1_NusA: N-utilizing substance A protein (NusA), S1-like RNA-binding domain. S1-like RNA-binding domains are found in a wide variety of RNA-associated proteins. NusA is a transcription elongation factor containing an N-terminal catalytic domain and three...; Region: S1_NusA; cd04455 717522007725 RNA binding site [nucleotide binding]; other site 717522007726 homodimer interface [polypeptide binding]; other site 717522007727 NusA_K homology RNA-binding domain (KH). NusA is an essential multifunctional transcription elongation factor that is universally conserved among prokaryotes and archaea. NusA anti-termination function plays an important role in the expression of...; Region: NusA_KH; cd02134 717522007728 G-X-X-G motif; other site 717522007729 NusA_K homology RNA-binding domain (KH). NusA is an essential multifunctional transcription elongation factor that is universally conserved among prokaryotes and archaea. NusA anti-termination function plays an important role in the expression of...; Region: NusA_KH; cd02134 717522007730 G-X-X-G motif; other site 717522007731 ribosome maturation protein RimP; Reviewed; Region: PRK00092 717522007732 Sm and related proteins; Region: Sm_like; cl00259 717522007733 Bacillus subtilis YxlS-like, C-terminal domain; Region: YlxS_C; cd01734 717522007734 putative oligomer interface [polypeptide binding]; other site 717522007735 putative RNA binding site [nucleotide binding]; other site 717522007736 Mitochondrial ATP synthase g subunit; Region: ATP-synt_G; pfam04718 717522007737 Ferritin-like superfamily of diiron-containing four-helix-bundle proteins; Region: Ferritin_like; cd00657 717522007738 dinuclear metal binding motif [ion binding]; other site 717522007739 prolyl-tRNA synthetase; Provisional; Region: PRK09194 717522007740 Prolyl-tRNA synthetase (ProRS) class II core catalytic domain. ProRS is a homodimer. It is responsible for the attachment of proline to the 3' OH group of ribose of the appropriate tRNA. This domain is primarily responsible for ATP-dependent...; Region: ProRS_core_prok; cd00779 717522007741 dimer interface [polypeptide binding]; other site 717522007742 motif 1; other site 717522007743 active site 717522007744 motif 2; other site 717522007745 YbaK-like. The YbaK family of deacylase domains includes the INS amino acid-editing domain of the bacterial class II prolyl tRNA synthetase (ProRS), and it's trans-acting homologs, YbaK, ProX, and PrdX. The primary function of INS is to hydrolyze...; Region: YbaK_like; cl00022 717522007746 putative deacylase active site [active] 717522007747 Class II tRNA amino-acyl synthetase-like catalytic core domain. Class II amino acyl-tRNA synthetases (aaRS) share a common fold and generally attach an amino acid to the 3' OH of ribose of the appropriate tRNA. PheRS is an exception in that it...; Region: class_II_aaRS-like_core; cl00268 717522007748 active site 717522007749 motif 3; other site 717522007750 ProRS Prolyl-anticodon binding domain, short version found predominantly in bacteria. ProRS belongs to class II aminoacyl-tRNA synthetases (aaRS). This alignment contains the anticodon binding domain, which is responsible for specificity in tRNA-binding; Region: ProRS_anticodon_short; cd00861 717522007751 anticodon binding site; other site 717522007752 The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174 717522007753 drug resistance transporter, EmrB/QacA subfamily; Region: efflux_EmrB; TIGR00711 717522007754 putative substrate translocation pore; other site 717522007755 Siroheme synthase (precorrin-2 oxidase/ferrochelatase domain) [Coenzyme metabolism]; Region: CysG; COG1648 717522007756 Putative NAD(P)-binding; Region: NAD_binding_7; pfam13241 717522007757 Uroporphyrin-III C-methyltransferase (S-Adenosyl-L-methionine:uroporphyrinogen III methyltransferase, SUMT); Region: SUMT; cd11642 717522007758 homodimer interface [polypeptide binding]; other site 717522007759 active site 717522007760 SAM binding site [chemical binding]; other site 717522007761 cobyrinic acid a,c-diamide synthase; Validated; Region: PRK01077 717522007762 The Fer4_NifH superfamily contains a variety of proteins which share a common ATP-binding domain. Functionally, proteins in this superfamily use the energy from hydrolysis of NTP to transfer electron or ion; Region: Fer4_NifH; cl17203 717522007763 Type 1 glutamine amidotransferase (GATase1) domain found in Cobyrinic Acid a,c-Diamide Synthase; Region: GATase1_CobB; cd03130 717522007764 catalytic triad [active] 717522007765 ATP:corrinoid adenosyltransferase [Coenzyme metabolism]; Region: BtuR; COG2109 717522007766 ATP:corrinoid adenosyltransferase BtuR/CobO/CobP. This family consists of the BtuR, CobO, CobP proteins all of which are Cob(I)alamin (vitamin B12) adenosyltransferase, which is involved in cobalamin (vitamin B12) biosynthesis. This enzyme is a homodimer; Region: CobA_CobO_BtuR; cd00561 717522007767 homodimer interface [polypeptide binding]; other site 717522007768 Walker A motif; other site 717522007769 ATP binding site [chemical binding]; other site 717522007770 hydroxycobalamin binding site [chemical binding]; other site 717522007771 Walker B motif; other site 717522007772 cobaltochelatase subunit; Region: Cob-chelat-sub; TIGR02442 717522007773 The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009 717522007774 Walker A motif; other site 717522007775 ATP binding site [chemical binding]; other site 717522007776 Walker B motif; other site 717522007777 arginine finger; other site 717522007778 Magnesium chelatase: Mg-chelatase catalyses the insertion of Mg into protoporphyrin IX (Proto). In chlorophyll biosynthesis, insertion of Mg2+ into protoporphyrin IX is catalysed by magnesium chelatase in an ATP-dependent reaction. Magnesium chelatase is...; Region: vWA_Magnesium_chelatase; cd01451 717522007779 metal ion-dependent adhesion site (MIDAS); other site 717522007780 Predicted acyltransferase [General function prediction only]; Region: ElaA; COG2153 717522007781 malate:quinone oxidoreductase; Validated; Region: PRK05257 717522007782 malate:quinone-oxidoreductase; Region: mal_quin_oxido; TIGR01320 717522007783 PE family; Region: PE; pfam00934 717522007784 Lysophospholipase [Lipid metabolism]; Region: PldB; COG2267 717522007785 Putative lysophospholipase; Region: Hydrolase_4; pfam12146 717522007786 mycothione reductase; Reviewed; Region: PRK07846 717522007787 NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500 717522007788 Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070 717522007789 Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852 717522007790 High-affinity nickel permease [Inorganic ion transport and metabolism]; Region: HoxN; COG3376 717522007791 The Fer4_NifH superfamily contains a variety of proteins which share a common ATP-binding domain. Functionally, proteins in this superfamily use the energy from hydrolysis of NTP to transfer electron or ion; Region: Fer4_NifH; cl17203 717522007792 The Fer4_NifH superfamily contains a variety of proteins which share a common ATP-binding domain. Functionally, proteins in this superfamily use the energy from hydrolysis of NTP to transfer electron or ion; Region: Fer4_NifH; cl17203 717522007793 short chain dehydrogenase; Provisional; Region: PRK06057 717522007794 classical (c) SDRs; Region: SDR_c; cd05233 717522007795 NAD(P) binding site [chemical binding]; other site 717522007796 active site 717522007797 Aldehyde dehydrogenase family; Region: Aldedh; pfam00171 717522007798 NAD(P)+ dependent aldehyde dehydrogenase family; Region: ALDH; cd07078 717522007799 NAD(P) binding site [chemical binding]; other site 717522007800 catalytic residues [active] 717522007801 Predicted glutamine amidotransferases [General function prediction only]; Region: COG2071 717522007802 Subgroup of proteins having the Type 1 glutamine amidotransferase (GATase1) domain; Region: GATase1_2; cd01745 717522007803 catalytic triad [active] 717522007804 Glutamine synthetase [Amino acid transport and metabolism]; Region: GlnA; COG0174 717522007805 Glutamine synthetase, beta-Grasp domain; Region: Gln-synt_N; pfam03951 717522007806 Glutamine synthetase, catalytic domain; Region: Gln-synt_C; pfam00120 717522007807 Methionine Aminopeptidase 1. E.C. 3.4.11.18. Also known as methionyl aminopeptidase and Peptidase M. Catalyzes release of N-terminal amino acids, preferentially methionine, from peptides and arylamides; Region: MetAP1; cd01086 717522007808 active site 717522007809 Domain of unknown function (DUF1707); Region: DUF1707; pfam08044 717522007810 PIN domain of ribonucleases (toxins), VapC, FitB, and PAE0151 of bacterial and archaeal toxin/antitoxin-like operons, and other similar homologs; Region: PIN_VapC-like; cd09861 717522007811 putative active site [active] 717522007812 NTF2-like N-terminal transpeptidase domain; Region: MecA_N; pfam05223 717522007813 Cell division protein FtsI/penicillin-binding protein 2 [Cell envelope biogenesis, outer membrane]; Region: FtsI; COG0768 717522007814 Penicillin binding protein transpeptidase domain; Region: Transpeptidase; pfam00905 717522007815 Antitoxin of toxin-antitoxin stability system [Cell division and chromosome partitioning]; Region: StbD; COG2161 717522007816 Cytotoxic translational repressor of toxin-antitoxin stability system [Translation, ribosomal structure and biogenesis / Cell division and chromosome partitioning]; Region: RelE; COG2026 717522007817 Predicted acetyltransferase [General function prediction only]; Region: COG3393 717522007818 Domain of unknown function (DUF4081); Region: DUF4081; pfam13312 717522007819 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase; Reviewed; Region: ispG; PRK00366 717522007820 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase; Validated; Region: PRK00694 717522007821 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase; Validated; Region: PRK00694 717522007822 Predicted membrane-associated Zn-dependent proteases 1 [Cell envelope biogenesis, outer membrane]; Region: COG0750 717522007823 RseP-like Site-2 proteases (S2P), zinc metalloproteases (MEROPS family M50A), cleave transmembrane domains of substrate proteins, regulating intramembrane proteolysis (RIP) of diverse signal transduction mechanisms. In Escherichia coli, the S2P homolog...; Region: S2P-M50_PDZ_RseP-like; cd06163 717522007824 active site 717522007825 PDZ domain of bacterial and plant zinc metalloprotases, presumably membrane-associated or integral membrane proteases, which may be involved in signalling and regulatory mechanisms. May be responsible for substrate recognition and/or binding, as most PDZ...; Region: PDZ_metalloprotease; cd00989 717522007826 protein binding site [polypeptide binding]; other site 717522007827 1-deoxy-D-xylulose 5-phosphate reductoisomerase; Provisional; Region: PRK05447 717522007828 1-deoxy-D-xylulose 5-phosphate reductoisomerase; Region: DXP_reductoisom; pfam02670 717522007829 1-deoxy-D-xylulose 5-phosphate reductoisomerase C-terminal; Region: DXP_redisom_C; pfam08436 717522007830 DXP reductoisomerase C-terminal domain; Region: DXPR_C; pfam13288 717522007831 Ribbon-helix-helix protein, copG family; Region: RHH_1; pfam01402 717522007832 Mycobacterium tuberculosis PIN domain family; Region: Mtu_PIN_fam; TIGR00028 717522007833 Secreted and surface protein containing fasciclin-like repeats [Cell envelope biogenesis, outer membrane]; Region: COG2335 717522007834 Fasciclin domain; Region: Fasciclin; pfam02469 717522007835 Antitoxin of toxin-antitoxin stability system [Cell division and chromosome partitioning]; Region: Phd; COG4118 717522007836 Cytochrome c biogenesis protein [Posttranslational modification, protein turnover, chaperones]; Region: CcdA; COG0785 717522007837 Cytochrome C biogenesis protein transmembrane region; Region: DsbD; cl15788 717522007838 TlpA-like family, DipZ-like subfamily; composed uncharacterized proteins containing a TlpA-like TRX domain. Some members show domain architectures similar to that of E. coli DipZ protein (also known as DsbD). The only eukaryotic members of the TlpA...; Region: TlpA_like_DipZ_like; cd03012 717522007839 Thioredoxin-like; Region: Thioredoxin_8; pfam13905 717522007840 catalytic residues [active] 717522007841 Secreted and surface protein containing fasciclin-like repeats [Cell envelope biogenesis, outer membrane]; Region: COG2335 717522007842 Fasciclin domain; Region: Fasciclin; pfam02469 717522007843 Protein of unknown function (DUF2631); Region: DUF2631; pfam10939 717522007844 Cytochrome c biogenesis protein [Posttranslational modification, protein turnover, chaperones]; Region: CcdA; COG0785 717522007845 TlpA-like family, suppressor for copper sensitivity D protein (ScsD) and actinobacterial DsbE homolog subfamily; composed of ScsD, the DsbE homolog of Mycobacterium tuberculosis (MtbDsbE) and similar proteins, all containing a redox-active CXXC motif; Region: TlpA_like_ScsD_MtbDsbE; cd03011 717522007846 Thioredoxin-like; Region: Thioredoxin_8; pfam13905 717522007847 catalytic residues [active] 717522007848 ribosomal RNA large subunit methyltransferase N; Provisional; Region: PRK14459 717522007849 Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335 717522007850 FeS/SAM binding site; other site 717522007851 CDP-diglyceride synthetase [Lipid metabolism]; Region: CdsA; COG0575 717522007852 Cytidylyltransferase family; Region: CTP_transf_1; pfam01148 717522007853 ribosome recycling factor; Reviewed; Region: frr; PRK00083 717522007854 Ribosome recycling factor (RRF). Ribosome recycling factor dissociates the posttermination complex, composed of the ribosome, deacylated tRNA, and mRNA, after termination of translation. Thus ribosomes are "recycled" and ready for another...; Region: RRF; cd00520 717522007855 hinge region; other site 717522007856 UMP kinase (UMPK)-Ec, the microbial/chloroplast uridine monophosphate kinase (uridylate kinase) enzyme that catalyzes UMP phosphorylation and plays a key role in pyrimidine nucleotide biosynthesis; regulation of this process is via feed-back control and...; Region: AAK_UMPK-PyrH-Ec; cd04254 717522007857 putative nucleotide binding site [chemical binding]; other site 717522007858 uridine monophosphate binding site [chemical binding]; other site 717522007859 homohexameric interface [polypeptide binding]; other site 717522007860 Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745 717522007861 Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383 717522007862 DNA binding site [nucleotide binding] 717522007863 Helix-turn-helix domain; Region: HTH_OrfB_IS605; pfam12323 717522007864 Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG0675 717522007865 Probable transposase; Region: OrfB_IS605; pfam01385 717522007866 Predicted site-specific integrase-resolvase [DNA replication, recombination, and repair]; Region: COG2452 717522007867 Serine Recombinase family, catalytic domain; a DNA binding domain may be present either N- or C-terminal to the catalytic domain. These enzymes perform site-specific recombination of DNA molecules by a concerted, four-strand cleavage and rejoining...; Region: Ser_Recombinase; cl02788 717522007868 catalytic residues [active] 717522007869 catalytic nucleophile [active] 717522007870 helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347 717522007871 MarR family; Region: MarR; pfam01047 717522007872 amidase; Provisional; Region: PRK07869 717522007873 Amidase; Region: Amidase; pfam01425 717522007874 elongation factor Ts; Provisional; Region: tsf; PRK09377 717522007875 UBA/TS-N domain; Region: UBA; pfam00627 717522007876 Elongation factor TS; Region: EF_TS; pfam00889 717522007877 Elongation factor TS; Region: EF_TS; pfam00889 717522007878 Ribosomal protein S2 (RPS2), involved in formation of the translation initiation complex, where it might contact the messenger RNA and several components of the ribosome. It has been shown that in Escherichia coli RPS2 is essential for the binding of...; Region: RPS2; cd01425 717522007879 rRNA interaction site [nucleotide binding]; other site 717522007880 S8 interaction site; other site 717522007881 putative laminin-1 binding site; other site 717522007882 Membrane proteins related to metalloendopeptidases [Cell envelope biogenesis, outer membrane]; Region: NlpD; COG0739 717522007883 Peptidase family M23; Region: Peptidase_M23; pfam01551 717522007884 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522007885 PPE family; Region: PPE; pfam00823 717522007886 Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484 717522007887 probable F420-dependent oxidoreductase, MSMEG_2516 family; Region: F420_MSMEG_2516; TIGR03621 717522007888 Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cl07892 717522007889 site-specific tyrosine recombinase XerC; Reviewed; Region: xerC; PRK00236 717522007890 DNA breaking-rejoining enzymes, C-terminal catalytic domain. The DNA breaking-rejoining enzyme superfamily includes type IB topoisomerases and tyrosine recombinases that share the same fold in their catalytic domain containing six conserved active site...; Region: DNA_BRE_C; cl00213 717522007891 active site 717522007892 DNA binding site [nucleotide binding] 717522007893 Int/Topo IB signature motif; other site 717522007894 Siderophore-interacting protein [Inorganic ion transport and metabolism]; Region: ViuB; COG2375 717522007895 Siderophore interacting proteins share the domain structure of the ferredoxin reductase like family. Siderophores are produced in various bacteria (and some plants) to extract iron from hosts. Binding constants are high, so iron can be pilfered from...; Region: siderophore_interacting; cd06193 717522007896 FAD binding pocket [chemical binding]; other site 717522007897 FAD binding motif [chemical binding]; other site 717522007898 phosphate binding motif [ion binding]; other site 717522007899 NAD binding pocket [chemical binding]; other site 717522007900 Predicted Rossmann fold nucleotide-binding protein involved in DNA uptake [DNA replication, recombination, and repair / Intracellular trafficking and secretion]; Region: Smf; COG0758 717522007901 DNA protecting protein DprA; Region: dprA; TIGR00732 717522007902 Predicted ATPase with chaperone activity [Posttranslational modification, protein turnover, chaperones]; Region: COG0606 717522007903 Subunit ChlI of Mg-chelatase; Region: ChlI; pfam13541 717522007904 The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009 717522007905 Walker A motif; other site 717522007906 ATP binding site [chemical binding]; other site 717522007907 Walker B motif; other site 717522007908 Magnesium chelatase, subunit ChlI; Region: Mg_chelatase_2; pfam13335 717522007909 hypothetical protein; Reviewed; Region: PRK12497 717522007910 formate dehydrogenase accessory protein; Reviewed; Region: PRK00724 717522007911 oxidoreductase alpha (molybdopterin) subunit; Region: Fdhalpha-like; TIGR01701 717522007912 The MopB_ydeP CD includes a group of related uncharacterized bacterial molybdopterin-binding oxidoreductase-like domains with a putative molybdopterin cofactor binding site. These members belong to the molybdopterin_binding (MopB) superfamily of proteins; Region: MopB_ydeP; cd02767 717522007913 putative molybdopterin cofactor binding site [chemical binding]; other site 717522007914 The MopB_CT_ydeP CD includes a group of related uncharacterized bacterial molybdopterin-binding oxidoreductase-like domains with a putative molybdopterin cofactor binding site. This CD is of the conserved molybdopterin_binding C-terminal (MopB_CT) region...; Region: MopB_CT_ydeP; cd02787 717522007915 putative molybdopterin cofactor binding site; other site 717522007916 Protein of unknown function (DUF2469); Region: DUF2469; pfam10611 717522007917 bacterial Ribonuclease HII-like; Region: RNase_HII_bacteria_HII_like; cd07182 717522007918 RNA/DNA hybrid binding site [nucleotide binding]; other site 717522007919 active site 717522007920 signal peptidase I, bacterial type; Region: sigpep_I_bact; TIGR02227 717522007921 The S26 Type I signal peptidase (SPase; LepB; leader peptidase B; leader peptidase I; EC 3.4.21.89) family members are essential membrane-bound serine proteases that function to cleave the amino-terminal signal peptide extension from proteins that are...; Region: S26_SPase_I; cd06530 717522007922 Catalytic site [active] 717522007923 The S26 Type I signal peptidase (SPase; LepB; leader peptidase B; leader peptidase I; EC 3.4.21.89) family members are essential membrane-bound serine proteases that function to cleave the amino-terminal signal peptide extension from proteins that are...; Region: S26_SPase_I; cd06530 717522007924 50S ribosomal protein L19; Provisional; Region: rplS; PRK05338 717522007925 Beta-lactamase enzyme family; Region: Beta-lactamase2; cl17872 717522007926 tRNA (guanine-N(1)-)-methyltransferase; Reviewed; Region: trmD; PRK00026 717522007927 16S rRNA-processing protein RimM; Provisional; Region: rimM; PRK00122 717522007928 RimM N-terminal domain; Region: RimM; pfam01782 717522007929 hypothetical protein; Provisional; Region: PRK02821 717522007930 Predicted RNA-binding protein (contains KH domain) [General function prediction only]; Region: COG1837 717522007931 G-X-X-G motif; other site 717522007932 30S ribosomal protein S16; Provisional; Region: rpsP; PRK14520 717522007933 Nuclear transport factor 2 (NTF2-like) superfamily. This family includes members of the NTF2 family, Delta-5-3-ketosteroid isomerases, Scytalone Dehydratases, and the beta subunit of Ring hydroxylating dioxygenases. This family is a classic example of...; Region: NTF2_like; cd00531 717522007934 D-alanyl-D-alanine carboxypeptidase; Region: Peptidase_S11; pfam00768 717522007935 Beta-lactamase enzyme family; Region: Beta-lactamase2; cl17872 717522007936 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522007937 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522007938 N-acyl-D-aspartate/D-glutamate deacylase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3653 717522007939 D-aminoacylases (N-acyl-D-Amino acid amidohydrolases) catalyze the hydrolysis of N-acyl-D-amino acids to produce the corresponding D-amino acids, which are used as intermediates in the synthesis of pesticides, bioactive peptides, and antibiotics; Region: D-aminoacylase; cd01297 717522007940 active site 717522007941 putative substrate binding pocket [chemical binding]; other site 717522007942 Superfamily of metallo-dependent hydrolases (also called amidohydrolase superfamily) is a large group of proteins that show conservation in their 3-dimensional fold (TIM barrel) and in details of their active site. The vast majority of the members have a...; Region: metallo-dependent_hydrolases; cl00281 717522007943 Serine/Threonine protein kinases, catalytic domain; Region: S_TKc; smart00220 717522007944 Catalytic domain of Protein Kinases; Region: PKc; cd00180 717522007945 active site 717522007946 ATP binding site [chemical binding]; other site 717522007947 substrate binding site [chemical binding]; other site 717522007948 activation loop (A-loop); other site 717522007949 Imidazolonepropionase and related amidohydrolases [Secondary metabolites biosynthesis, transport, and catabolism]; Region: HutI; COG1228 717522007950 Metallo-dependent hydrolases, subgroup A is part of the superfamily of metallo-dependent hydrolases, a large group of proteins that show conservation in their 3-dimensional fold (TIM barrel) and in details of their active site. The vast majority of the...; Region: Met_dep_hydrolase_A; cd01299 717522007951 active site 717522007952 signal recognition particle protein; Provisional; Region: PRK10867 717522007953 SRP54-type protein, helical bundle domain; Region: SRP54_N; smart00963 717522007954 The signal recognition particle (SRP) mediates the transport to or across the plasma membrane in bacteria and the endoplasmic reticulum in eukaryotes. SRP recognizes N-terminal sighnal sequences of newly synthesized polypeptides at the ribosome. The...; Region: SRP; cd03115 717522007955 P loop; other site 717522007956 GTP binding site [chemical binding]; other site 717522007957 Signal peptide binding domain; Region: SRP_SPB; pfam02978 717522007958 DNA or RNA helicases of superfamily II [Transcription / DNA replication, recombination, and repair]; Region: SSL2; COG1061 717522007959 DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cl17251 717522007960 ATP binding site [chemical binding]; other site 717522007961 putative Mg++ binding site [ion binding]; other site 717522007962 PII uridylyl-transferase; Provisional; Region: PRK03381 717522007963 Nucleotidyltransferase (NT) domain of Escherichia coli adenylyltransferase (GlnE), Escherichia coli uridylyl transferase (GlnD), and similar proteins; Region: NT_GlnE_GlnD_like; cd05401 717522007964 metal binding triad; other site 717522007965 GlnD PII-uridylyltransferase; Region: GlnD_UR_UTase; pfam08335 717522007966 Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077 717522007967 Zn2+ binding site [ion binding]; other site 717522007968 Mg2+ binding site [ion binding]; other site 717522007969 Nitrogen regulatory protein PII [Amino acid transport and metabolism]; Region: GlnK; COG0347 717522007970 Nitrogen regulatory protein P-II; Region: P-II; smart00938 717522007971 Ammonia permease [Inorganic ion transport and metabolism]; Region: AmtB; COG0004 717522007972 signal recognition particle-docking protein FtsY; Region: ftsY; TIGR00064 717522007973 SRP54-type protein, helical bundle domain; Region: SRP54_N; pfam02881 717522007974 The Fer4_NifH superfamily contains a variety of proteins which share a common ATP-binding domain. Functionally, proteins in this superfamily use the energy from hydrolysis of NTP to transfer electron or ion; Region: Fer4_NifH; cl17203 717522007975 chromosome segregation protein SMC, common bacterial type; Region: SMC_prok_B; TIGR02168 717522007976 ATP-binding cassette domain of barmotin, a member of the SMC protein family; Region: ABC_SMC_barmotin; cd03278 717522007977 Walker A/P-loop; other site 717522007978 ATP binding site [chemical binding]; other site 717522007979 SMC proteins Flexible Hinge Domain; Region: SMC_hinge; smart00968 717522007980 ATP-binding cassette domain of barmotin, a member of the SMC protein family; Region: ABC_SMC_barmotin; cd03278 717522007981 ABC transporter signature motif; other site 717522007982 Walker B; other site 717522007983 D-loop; other site 717522007984 H-loop/switch region; other site 717522007985 acylphosphatase; Provisional; Region: PRK14422 717522007986 Predicted redox protein, regulator of disulfide bond formation [Posttranslational modification, protein turnover, chaperones]; Region: COG1765 717522007987 formamidopyrimidine/5-formyluracil/ 5-hydroxymethyluracil DNA glycosylase; Validated; Region: PRK01103 717522007988 N-terminal domain of Escherichia coli Fpg1/MutM and related bacterial DNA glycosylases; Region: EcFpg-like_N; cd08966 717522007989 DNA binding site [nucleotide binding] 717522007990 catalytic residue [active] 717522007991 H2TH interface [polypeptide binding]; other site 717522007992 putative catalytic residues [active] 717522007993 turnover-facilitating residue; other site 717522007994 intercalation triad [nucleotide binding]; other site 717522007995 8OG recognition residue [nucleotide binding]; other site 717522007996 putative reading head residues; other site 717522007997 Formamidopyrimidine-DNA glycosylase H2TH domain; Region: H2TH; pfam06831 717522007998 Zinc finger found in FPG and IleRS; Region: zf-FPG_IleRS; pfam06827 717522007999 ribonuclease III; Reviewed; Region: rnc; PRK00102 717522008000 RIBOc. Ribonuclease III C terminal domain. This group consists of eukaryotic, bacterial and archeal ribonuclease III (RNAse III) proteins. RNAse III is a double stranded RNA-specific endonuclease. Prokaryotic RNAse III is important in...; Region: RIBOc; cd00593 717522008001 dimerization interface [polypeptide binding]; other site 717522008002 active site 717522008003 metal binding site [ion binding]; metal-binding site 717522008004 Double-stranded RNA binding motif. Binding is not sequence specific but is highly specific for double stranded RNA. Found in a variety of proteins including dsRNA dependent protein kinase PKR, RNA helicases, Drosophila staufen protein, E. coli RNase III; Region: DSRM; cd00048 717522008005 dsRNA binding site [nucleotide binding]; other site 717522008006 Predicted metal-binding, possibly nucleic acid-binding protein [General function prediction only]; Region: COG1399 717522008007 Cell division initiation protein [Cell division and chromosome partitioning]; Region: DivIVA; COG3599 717522008008 The band 7 domain of flotillin (reggie) like proteins. This group contains proteins similar to stomatin, prohibitin, flotillin, HlfK/C and podicin. Many of these band 7 domain-containing proteins are lipid raft-associated. Individual proteins of this...; Region: Band_7; cl02525 717522008009 Predicted thioesterase involved in non-ribosomal peptide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: GrsT; COG3208 717522008010 acyl-CoA synthetase; Validated; Region: PRK05850 717522008011 Fatty acyl-AMP ligase (FAAL); Region: FAAL; cd05931 717522008012 acyl-activating enzyme (AAE) consensus motif; other site 717522008013 active site 717522008014 Phosphopantetheine attachment site; Region: PP-binding; pfam00550 717522008015 Polyketide synthase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3321 717522008016 polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833 717522008017 active site 717522008018 Acyl transferase domain; Region: Acyl_transf_1; pfam00698 717522008019 Dehydratase domain in polyketide synthase (PKS) enzymes; Region: PKS_DH; smart00826 717522008020 ketoreductase (KR) and fatty acid synthase (FAS), complex (x) SDRs; Region: KR_FAS_SDR_x; cd05274 717522008021 NADP binding site [chemical binding]; other site 717522008022 KR domain; Region: KR; pfam08659 717522008023 active site 717522008024 Phosphopantetheine attachment site; Region: PKS_PP; smart00823 717522008025 polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833 717522008026 Beta-ketoacyl synthase; Region: PKS_KS; smart00825 717522008027 active site 717522008028 malonyl CoA-acyl carrier protein transacylase; Region: fabD; TIGR00128 717522008029 Acyl transferase domain; Region: Acyl_transf_1; cl08282 717522008030 ketoreductase (KR) and fatty acid synthase (FAS), complex (x) SDRs; Region: KR_FAS_SDR_x; cd05274 717522008031 KR domain; Region: KR; pfam08659 717522008032 NADP binding site [chemical binding]; other site 717522008033 active site 717522008034 Phosphopantetheine attachment site; Region: PKS_PP; smart00823 717522008035 Polyketide synthase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3321 717522008036 polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833 717522008037 active site 717522008038 Acyl transferase domain; Region: Acyl_transf_1; cl08282 717522008039 Dehydratase domain in polyketide synthase (PKS) enzymes; Region: PKS_DH; smart00826 717522008040 Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931 717522008041 enoyl reductase of polyketide synthase; Region: enoyl_red; cd05195 717522008042 Enoylreductase; Region: PKS_ER; smart00829 717522008043 NAD(P) binding site [chemical binding]; other site 717522008044 beta-ketoacyl reductase (KR) domain of fatty acid synthase (FAS), subgroup 2, complex (x); Region: KR_2_FAS_SDR_x; cd08955 717522008045 KR domain; Region: KR; pfam08659 717522008046 putative NADP binding site [chemical binding]; other site 717522008047 active site 717522008048 Phosphopantetheine attachment site; Region: PKS_PP; smart00823 717522008049 Polyketide synthase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3321 717522008050 polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833 717522008051 active site 717522008052 Acyl transferase domain in polyketide synthase (PKS) enzymes; Region: PKS_AT; smart00827 717522008053 Dehydratase domain in polyketide synthase (PKS) enzymes; Region: PKS_DH; smart00826 717522008054 beta-ketoacyl reductase (KR) domain of fatty acid synthase (FAS), subgroup 2, complex (x); Region: KR_2_FAS_SDR_x; cd08955 717522008055 KR domain; Region: KR; pfam08659 717522008056 putative NADP binding site [chemical binding]; other site 717522008057 active site 717522008058 Phosphopantetheine attachment site; Region: PKS_PP; smart00823 717522008059 Polyketide synthase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3321 717522008060 polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833 717522008061 active site 717522008062 Acyl transferase domain in polyketide synthase (PKS) enzymes; Region: PKS_AT; smart00827 717522008063 Phosphopantetheine attachment site; Region: PP-binding; pfam00550 717522008064 Condensation domain; Region: Condensation; pfam00668 717522008065 non-ribosomal peptide synthase domain TIGR01720; Region: NRPS-para261 717522008066 ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201 717522008067 daunorubicin resistance ABC transporter ATP-binding subunit; Region: drrA; TIGR01188 717522008068 Walker A/P-loop; other site 717522008069 ATP binding site [chemical binding]; other site 717522008070 Q-loop/lid; other site 717522008071 ABC transporter signature motif; other site 717522008072 Walker B; other site 717522008073 D-loop; other site 717522008074 H-loop/switch region; other site 717522008075 ABC-type multidrug transport system, permease component [Defense mechanisms]; Region: COG0842 717522008076 ABC transporter efflux protein, DrrB family; Region: Mtu_efflux; TIGR00025 717522008077 ABC transporter efflux protein, DrrB family; Region: Mtu_efflux; TIGR00025 717522008078 ABC-type multidrug transport system, permease component [Defense mechanisms]; Region: COG0842 717522008079 acyltransferase PapA5; Provisional; Region: PRK09294 717522008080 Polyketide synthase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3321 717522008081 polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833 717522008082 active site 717522008083 Acyl transferase domain; Region: Acyl_transf_1; pfam00698 717522008084 Dehydratase domain in polyketide synthase (PKS) enzymes; Region: PKS_DH; smart00826 717522008085 Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931 717522008086 enoyl reductase of polyketide synthase; Region: enoyl_red; cd05195 717522008087 Enoylreductase; Region: PKS_ER; smart00829 717522008088 NAD(P) binding site [chemical binding]; other site 717522008089 beta-ketoacyl reductase (KR) domain of fatty acid synthase (FAS), subgroup 2, complex (x); Region: KR_2_FAS_SDR_x; cd08955 717522008090 KR domain; Region: KR; pfam08659 717522008091 putative NADP binding site [chemical binding]; other site 717522008092 active site 717522008093 Phosphopantetheine attachment site; Region: PKS_PP; smart00823 717522008094 acyl-CoA synthetase; Validated; Region: PRK05850 717522008095 Fatty acyl-AMP ligase (FAAL); Region: FAAL; cd05931 717522008096 acyl-activating enzyme (AAE) consensus motif; other site 717522008097 active site 717522008098 MMPL family; Region: MMPL; pfam03176 717522008099 Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG4584 717522008100 Helix-turn-helix domain of Hin and related proteins, a family of DNA-binding domains unique to bacteria and represented by the Hin protein of Salmonella. The basic HTH domain is a simple fold comprised of three core helices that form a right-handed...; Region: HTH_Hin_like; cd00569 717522008101 Integrase core domain; Region: rve; pfam00665 717522008102 The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cl17189 717522008103 Protein of unknown function (DUF1396); Region: DUF1396; pfam07161 717522008104 Erythronolide synthase docking; Region: Docking; pfam08990 717522008105 Polyketide synthase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3321 717522008106 polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833 717522008107 active site 717522008108 Acyl transferase domain in polyketide synthase (PKS) enzymes; Region: PKS_AT; smart00827 717522008109 Dehydratase domain in polyketide synthase (PKS) enzymes; Region: PKS_DH; smart00826 717522008110 Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931 717522008111 Enoylreductase; Region: PKS_ER; smart00829 717522008112 enoyl reductase of polyketide synthase; Region: enoyl_red; cd05195 717522008113 NAD(P) binding site [chemical binding]; other site 717522008114 beta-ketoacyl reductase (KR) domain of fatty acid synthase (FAS), subgroup 3, complex (x); Region: KR_3_FAS_SDR_x; cd08956 717522008115 This enzymatic domain is part of bacterial polyketide synthases; Region: PKS_KR; smart00822 717522008116 putative NADP binding site [chemical binding]; other site 717522008117 active site 717522008118 Phosphopantetheine attachment site; Region: PKS_PP; smart00823 717522008119 acyl-CoA synthetase; Validated; Region: PRK06060 717522008120 Benzoate CoA ligase (BCL) and similar adenylate forming enzymes; Region: BCL_like; cd05919 717522008121 dimer interface [polypeptide binding]; other site 717522008122 acyl-activating enzyme (AAE) consensus motif; other site 717522008123 putative active site [active] 717522008124 putative AMP binding site [chemical binding]; other site 717522008125 putative CoA binding site [chemical binding]; other site 717522008126 chemical substrate binding site [chemical binding]; other site 717522008127 Phosphopantetheine attachment site; Region: PKS_PP; smart00823 717522008128 4-hydroxybenzoate synthetase (chorismate lyase) [Coenzyme metabolism]; Region: UbiC; COG3161 717522008129 acyl-CoA synthetase; Validated; Region: PRK05850 717522008130 Fatty acyl-AMP ligase (FAAL); Region: FAAL; cd05931 717522008131 acyl-activating enzyme (AAE) consensus motif; other site 717522008132 active site 717522008133 Coenzyme F420-dependent N5,N10-methylene tetrahydromethanopterin reductase and related flavin-dependent oxidoreductases [Energy production and conversion]; Region: COG2141 717522008134 N5,N10-methylenetetrahydromethanopterin reductase (Mer) catalyzes the reduction of N5,N10-methylenetetrahydromethanopterin with reduced coenzyme F420 to N5-methyltetrahydromethanopterin and oxidized coenzyme F420; Region: Tetrahydromethanopterin_reductase; cd01097 717522008135 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522008136 S-adenosylmethionine binding site [chemical binding]; other site 717522008137 Uncharacterized conserved protein [Function unknown]; Region: COG3268 717522008138 Methyltransferase domain; Region: Methyltransf_23; pfam13489 717522008139 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522008140 S-adenosylmethionine binding site [chemical binding]; other site 717522008141 methyltransferase, FkbM family; Region: fkbM_fam; TIGR01444 717522008142 methyltransferase, FkbM family; Region: fkbM_fam; TIGR01444 717522008143 WfgS and WfeV are involved in O-antigen biosynthesis; Region: GT_2_WfgS_like; cd06433 717522008144 metal-binding site 717522008145 Glycosyl transferases, related to UDP-glucuronosyltransferase [Carbohydrate transport and metabolism / Signal transduction mechanisms]; Region: COG1819 717522008146 Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. The acceptor molecule can be a lipid, a protein, a heterocyclic compound, or another carbohydrate...; Region: Glycosyltransferase_GTB_type; cl10013 717522008147 Cephalosporin hydroxylase [Defense mechanisms]; Region: CmcI; COG3510 717522008148 Transposase and inactivated derivatives, IS5 family [DNA replication, recombination, and repair]; Region: COG3039 717522008149 Glycosyl transferases, related to UDP-glucuronosyltransferase [Carbohydrate transport and metabolism / Signal transduction mechanisms]; Region: COG1819 717522008150 This family includes the Gtfs, a group of homologous glycosyltransferases involved in the final stages of the biosynthesis of antibiotics vancomycin and related chloroeremomycin. Gtfs transfer sugar moieties from an activated NDP-sugar donor to the...; Region: GT1_Gtf_like; cd03784 717522008151 active site 717522008152 TDP-binding site; other site 717522008153 acceptor substrate-binding pocket; other site 717522008154 Predicted permease; Region: DUF318; pfam03773 717522008155 formyltetrahydrofolate deformylase; Region: PurU; TIGR00655 717522008156 N-terminal ACT domain of formyltetrahydrofolate deformylase (F4HF-DF; formyltetrahydrofolate hydrolase); Region: ACT_F4HF-DF; cd04875 717522008157 Formyltetrahydrofolate deformylase (Formyl-FH4 hydrolase), C-terminal hydrolase domain; Region: FMT_core_Formyl-FH4-Hydrolase_C; cd08648 717522008158 putative active site [active] 717522008159 putative substrate binding site [chemical binding]; other site 717522008160 putative cosubstrate binding site; other site 717522008161 catalytic site [active] 717522008162 phosphopantetheine adenylyltransferase; Provisional; Region: coaD; PRK00168 717522008163 Phosphopantetheine adenylyltransferase; Region: PPAT; cd02163 717522008164 active site 717522008165 (T/H)XGH motif; other site 717522008166 Conserved hypothetical protein 95; Region: Cons_hypoth95; pfam03602 717522008167 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522008168 S-adenosylmethionine binding site [chemical binding]; other site 717522008169 pyruvate carboxylase; Reviewed; Region: PRK12999 717522008170 Carbamoyl-phosphate synthase L chain, N-terminal domain; Region: CPSase_L_chain; pfam00289 717522008171 ATP-grasp domain; Region: ATP-grasp_4; cl17255 717522008172 Biotin carboxylase C-terminal domain; Region: Biotin_carb_C; smart00878 717522008173 Pyruvate carboxylase and Transcarboxylase 5S, carboxyltransferase domain; Region: DRE_TIM_PC_TC_5S; cd07937 717522008174 active site 717522008175 catalytic residues [active] 717522008176 metal binding site [ion binding]; metal-binding site 717522008177 homodimer binding site [polypeptide binding]; other site 717522008178 The biotinyl-domain or biotin carboxyl carrier protein (BCCP) domain is present in all biotin-dependent enzymes, such as acetyl-CoA carboxylase, pyruvate carboxylase, propionyl-CoA carboxylase, methylcrotonyl-CoA carboxylase, geranyl-CoA carboxylase; Region: biotinyl_domain; cd06850 717522008179 carboxyltransferase (CT) interaction site; other site 717522008180 biotinylation site [posttranslational modification]; other site 717522008181 Vitamin K epoxide reductase family in bacteria; Region: VKOR_5; cd12922 717522008182 putative active site [active] 717522008183 redox center [active] 717522008184 DSBA-like thioredoxin domain; Region: DSBA; pfam01323 717522008185 DsbA family; consists of DsbA and DsbA-like proteins, including DsbC, DsbG, glutathione (GSH) S-transferase kappa (GSTK), 2-hydroxychromene-2-carboxylate (HCCA) isomerase, an oxidoreductase (FrnE) presumed to be involved in frenolicin biosynthesis, a...; Region: DsbA_family; cd02972 717522008186 catalytic residues [active] 717522008187 Esterases and lipases (includes fungal lipases, cholinesterases, etc.) These enzymes act on carboxylic esters (EC: 3.1.1.-). The catalytic apparatus involves three residues (catalytic triad): a serine, a glutamate or aspartate and a histidine.These...; Region: Esterase_lipase; cd00312 717522008188 alpha/beta hydrolase fold; Region: Abhydrolase_3; pfam07859 717522008189 substrate binding pocket [chemical binding]; other site 717522008190 Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cl00470 717522008191 Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660 717522008192 Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248 717522008193 active site 717522008194 catalytic tetrad [active] 717522008195 Protein of unknown function (DUF1524); Region: DUF1524; pfam07510 717522008196 RecG-like helicase [DNA replication, recombination, and repair / Transcription]; Region: RecG; COG1200 717522008197 RecG_wedge_OBF: A subfamily of OB folds corresponding to the OB fold found in the N-terminal (wedge) domain of Escherichia coli RecG. RecG is a branched-DNA-specific helicase, which catalyzes the interconversion of a DNA replication fork to a...; Region: RecG_wedge_OBF; cd04488 717522008198 generic binding surface II; other site 717522008199 ssDNA binding site; other site 717522008200 DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046 717522008201 ATP binding site [chemical binding]; other site 717522008202 putative Mg++ binding site [ion binding]; other site 717522008203 Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079 717522008204 nucleotide binding region [chemical binding]; other site 717522008205 ATP-binding site [chemical binding]; other site 717522008206 DAK2 domain fusion protein YloV; Region: YloV; TIGR03599 717522008207 DAK2 domain; Region: Dak2; cl03685 717522008208 50S ribosomal protein L28; Reviewed; Region: rpmB; PRK00359 717522008209 Family 1 of Uracil-DNA glycosylase (UDG) enzymes; Region: UDG_F1; cd10027 717522008210 ligand binding site [chemical binding]; other site 717522008211 active site 717522008212 UGI interface [polypeptide binding]; other site 717522008213 catalytic site [active] 717522008214 thiamine monophosphate kinase; Provisional; Region: PRK05731 717522008215 ThiL (Thiamine-monophosphate kinase) plays a dual role in de novo biosynthesis and in salvage of exogenous thiamine. Thiamine salvage occurs in two steps, with thiamine kinase catalyzing the formation of thiamine phosphate, and ThiL catalyzing the...; Region: ThiL; cd02194 717522008216 ATP binding site [chemical binding]; other site 717522008217 dimerization interface [polypeptide binding]; other site 717522008218 Helix-turn-helix domain; Region: HTH_OrfB_IS605; pfam12323 717522008219 Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG0675 717522008220 Probable transposase; Region: OrfB_IS605; pfam01385 717522008221 Predicted site-specific integrase-resolvase [DNA replication, recombination, and repair]; Region: COG2452 717522008222 Serine Recombinase (SR) family, IS607-like transposase subfamily, catalytic domain; members contain a DNA binding domain with homology to MerR/SoxR located N-terminal to the catalytic domain. Serine recombinases catalyze site-specific recombination of...; Region: SR_IS607_transposase_like; cd03769 717522008223 catalytic residues [active] 717522008224 catalytic nucleophile [active] 717522008225 Protein of unknown function (DUF3515); Region: DUF3515; pfam12028 717522008226 Difference I-RD07, inserted region of 354bp in Mycobacterium bovis BCG Pasteur and BCG Mexico, compared to Mycobacterium tuberculosis H37Rv2 and of 472bp compared to Mycobacterium bovis AF2122/97. Intergenic region 717522008227 D-alanyl-alanine synthetase A; Reviewed; Region: ddl; PRK01966 717522008228 D-ala D-ala ligase N-terminus; Region: Dala_Dala_lig_N; pfam01820 717522008229 D-ala D-ala ligase C-terminus; Region: Dala_Dala_lig_C; pfam07478 717522008230 NAD(P)H-dependent glycerol-3-phosphate dehydrogenase; Validated; Region: gpsA; PRK00094 717522008231 NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus; Region: NAD_Gly3P_dh_N; pfam01210 717522008232 NAD-dependent glycerol-3-phosphate dehydrogenase C-terminus; Region: NAD_Gly3P_dh_C; pfam07479 717522008233 Predicted nucleotidyltransferase, CobY/MobA/RfbA family [General function prediction only]; Region: COG1920 717522008234 polyphosphate kinase; Provisional; Region: PRK05443 717522008235 Polyphosphate kinase N-terminal domain; Region: PP_kinase_N; pfam13089 717522008236 Polyphosphate kinase middle domain; Region: PP_kinase; pfam02503 717522008237 Catalytic C-terminal domain, first repeat, of Pseudomonas aeruginosa polyphosphate kinase 1 and similar proteins; Region: PLDc_PaPPK1_C1_like; cd09165 717522008238 putative domain interface [polypeptide binding]; other site 717522008239 putative active site [active] 717522008240 catalytic site [active] 717522008241 Catalytic C-terminal domain, second repeat, of Pseudomonas aeruginosa polyphosphate kinase 1 and similar proteins; Region: PLDc_PaPPK1_C2_like; cd09168 717522008242 putative domain interface [polypeptide binding]; other site 717522008243 putative active site [active] 717522008244 catalytic site [active] 717522008245 Diadenosine hexaphosphate (Ap6A) hydrolase is a member of the Nudix hydrolase superfamily. Ap6A hydrolase specifically hydrolyzes diadenosine polyphosphates, but not ATP or diadenosine triphosphate, and it generates ATP as the product. Ap6A, the most...; Region: Ap6A_hydrolase; cd03673 717522008246 active site 717522008247 Ap6A binding site [chemical binding]; other site 717522008248 nudix motif; other site 717522008249 metal binding site [ion binding]; metal-binding site 717522008250 Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067 717522008251 catalytic core [active] 717522008252 Integration host factor (IHF) and HU are small heterodimeric members of the DNABII protein family that bind and bend DNA, functioning as architectural factors in many cellular processes including transcription, site-specific recombination, and...; Region: HU_IHF; cd00591 717522008253 IHF - DNA interface [nucleotide binding]; other site 717522008254 IHF dimer interface [polypeptide binding]; other site 717522008255 isopropylmalate isomerase small subunit; Provisional; Region: leuD; PRK01641 717522008256 Aconatase-like swivel domain of 3-isopropylmalate dehydratase and related uncharacterized proteins. 3-isopropylmalate dehydratase catalyzes the isomerization between 2-isopropylmalate and 3-isopropylmalate, via the formation of 2-isopropylmaleate...; Region: IPMI_Swivel; cd01577 717522008257 substrate binding site [chemical binding]; other site 717522008258 3-isopropylmalate dehydratase large subunit; Reviewed; Region: PRK00402 717522008259 3-isopropylmalate dehydratase catalyzes the isomerization between 2-isopropylmalate and 3-isopropylmalate; Region: IPMI; cd01583 717522008260 substrate binding site [chemical binding]; other site 717522008261 ligand binding site [chemical binding]; other site 717522008262 helix_turn_helix isocitrate lyase regulation; Region: HTH_ICLR; smart00346 717522008263 Transcriptional regulator [Transcription]; Region: IclR; COG1414 717522008264 Bacterial transcriptional regulator; Region: IclR; pfam01614 717522008265 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522008266 S-adenosylmethionine binding site [chemical binding]; other site 717522008267 Uncharacterized stress protein (general stress protein 26) [General function prediction only]; Region: COG3871 717522008268 PPOX class probable F420-dependent enzyme; Region: Rv1155_F420; TIGR03618 717522008269 glutamyl-tRNA synthetase; Reviewed; Region: gltX; PRK01406 717522008270 nucleotidyl transferase superfamily; Region: nt_trans; cl00015 717522008271 active site 717522008272 HIGH motif; other site 717522008273 nucleotide binding site [chemical binding]; other site 717522008274 catalytic core domain of discriminating glutamyl-tRNA synthetase; Region: GluRS_core; cd00808 717522008275 active site 717522008276 KMSKS motif; other site 717522008277 2-keto-4-pentenoate hydratase/2-oxohepta-3-ene-1,7-dioic acid hydratase (catechol pathway) [Secondary metabolites biosynthesis, transport, and catabolism]; Region: MhpD; COG0179 717522008278 Domain of unknown function (DUF2437); Region: DUF2437; pfam10370 717522008279 Fumarylacetoacetate (FAA) hydrolase family; Region: FAA_hydrolase; pfam01557 717522008280 The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174 717522008281 Major Facilitator Superfamily; Region: MFS_1; pfam07690 717522008282 putative substrate translocation pore; other site 717522008283 3-isopropylmalate dehydrogenase; Provisional; Region: PRK03437 717522008284 D-3-phosphoglycerate dehydrogenase; Provisional; Region: PRK13581 717522008285 Phosphoglycerate dehydrogenases, NAD-binding and catalytic domains; Region: PGDH_4; cd12173 717522008286 ligand binding site [chemical binding]; other site 717522008287 NAD binding site [chemical binding]; other site 717522008288 dimerization interface [polypeptide binding]; other site 717522008289 catalytic site [active] 717522008290 C-terminal ACT (regulatory) domain of D-3-phosphoglycerate dehydrogenase (3PGDH); Region: ACT_3PGDH-xct; cd04902 717522008291 putative L-serine binding site [chemical binding]; other site 717522008292 Phytoene dehydrogenase and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG1233 717522008293 NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450 717522008294 Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cl01054 717522008295 Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cl00080 717522008296 phosphorylation site [posttranslational modification] 717522008297 Domain of Unknown Function (DUF1259); Region: DUF1529; pfam07485 717522008298 Domain of Unknown Function (DUF1259); Region: DUF1529; pfam07485 717522008299 ABC-type uncharacterized transport system, permease component [General function prediction only]; Region: COG0390 717522008300 ketol-acid reductoisomerase; Provisional; Region: PRK05479 717522008301 Acetohydroxy acid isomeroreductase, catalytic domain; Region: IlvN; pfam07991 717522008302 Acetohydroxy acid isomeroreductase, catalytic domain; Region: IlvC; pfam01450 717522008303 acetolactate synthase 3 regulatory subunit; Reviewed; Region: ilvH; PRK11895 717522008304 N-terminal ACT domain of the Escherichia coli IlvH-like regulatory subunit of acetohydroxyacid synthase (AHAS); Region: ACT_AHAS; cd04878 717522008305 putative valine binding site [chemical binding]; other site 717522008306 dimer interface [polypeptide binding]; other site 717522008307 Small subunit of acetolactate synthase; Region: ALS_ss_C; pfam10369 717522008308 acetolactate synthase 1 catalytic subunit; Validated; Region: PRK07789 717522008309 Pyrimidine (PYR) binding domain of POX and related proteins; Region: TPP_PYR_POX_like; cd07035 717522008310 PYR/PP interface [polypeptide binding]; other site 717522008311 dimer interface [polypeptide binding]; other site 717522008312 TPP binding site [chemical binding]; other site 717522008313 Thiamine pyrophosphate enzyme, central domain; Region: TPP_enzyme_M; pfam00205 717522008314 Thiamine pyrophosphate (TPP) family, Acetohydroxyacid synthase (AHAS) subfamily, TPP-binding module; composed of proteins similar to the large catalytic subunit of AHAS. AHAS catalyzes the condensation of two molecules of pyruvate to give the...; Region: TPP_AHAS; cd02015 717522008315 TPP-binding site [chemical binding]; other site 717522008316 dimer interface [polypeptide binding]; other site 717522008317 Protein of unknown function (DUF2581); Region: DUF2581; pfam10756 717522008318 Predicted membrane protein [Function unknown]; Region: COG2259 717522008319 Glucose/sorbosone dehydrogenases [Carbohydrate transport and metabolism]; Region: COG2133 717522008320 Conserved protein/domain typically associated with flavoprotein oxygenases, DIM6/NTAB family [General function prediction only]; Region: COG1853 717522008321 Uncharacterized membrane protein [Function unknown]; Region: SapB; COG1285 717522008322 aspartyl/glutamyl-tRNA amidotransferase subunit B; Validated; Region: gatB; PRK05477 717522008323 GatB/GatE catalytic domain; Region: GatB_N; pfam02934 717522008324 GatB domain; Region: GatB_Yqey; smart00845 717522008325 6-phosphofructokinase; Provisional; Region: PRK03202 717522008326 6-phosphofructokinase; Region: PFKA_ATP; TIGR02482 717522008327 active site 717522008328 ADP/pyrophosphate binding site [chemical binding]; other site 717522008329 dimerization interface [polypeptide binding]; other site 717522008330 allosteric effector site; other site 717522008331 fructose-1,6-bisphosphate binding site; other site 717522008332 Asp-tRNAAsn/Glu-tRNAGln amidotransferase A subunit and related amidases [Translation, ribosomal structure and biogenesis]; Region: GatA; COG0154 717522008333 aspartyl/glutamyl-tRNA amidotransferase subunit A; Reviewed; Region: gatA; PRK00012 717522008334 aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase, C subunit; Region: gatC; TIGR00135 717522008335 ACT_MalLac-Enz CD includes the N-terminal ACT domain of putative NAD-dependent malic enzyme 1, Bacillus subtilis YqkI and related domains; Region: ACT_MalLac-Enz; cd04887 717522008336 NAD-dependent DNA ligase LigA; Validated; Region: ligA; PRK07956 717522008337 NAD+ dependent DNA ligase adenylation domain. DNA ligases catalyze the crucial step of joining the breaks in duplex DNA during DNA replication, repair and recombination, utilizing either ATP or NAD(+) as a cofactor, but using the same basic reaction...; Region: LIGANc; cd00114 717522008338 nucleotide binding pocket [chemical binding]; other site 717522008339 K-X-D-G motif; other site 717522008340 catalytic site [active] 717522008341 NAD-dependent DNA ligase OB-fold domain; Region: DNA_ligase_OB; pfam03120 717522008342 NAD-dependent DNA ligase C4 zinc finger domain; Region: DNA_ligase_ZBD; pfam03119 717522008343 endonuclease III; includes endonuclease III (DNA-(apurinic or apyrimidinic site) lyase), alkylbase DNA glycosidases (Alka-family) and other DNA glycosidases; Region: ENDO3c; cl14786 717522008344 Breast Cancer Suppressor Protein (BRCA1), carboxy-terminal domain. The BRCT domain is found within many DNA damage repair and cell cycle checkpoint proteins. The unique diversity of this domain superfamily allows BRCT modules to interact forming homo...; Region: BRCT; cd00027 717522008345 Dimer interface [polypeptide binding]; other site 717522008346 CIMS - Cobalamine-independent methonine synthase, or MetE. Many members have been characterized as 5-methyltetrahydropteroyltriglutamate-homocysteine methyltransferases, EC:2.1.1.14, mostly from bacteria and plants. This enzyme catalyses the last step in...; Region: CIMS_like; cd03310 717522008347 PknH-like extracellular domain; Region: PknH_C; pfam14032 717522008348 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4842 717522008349 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522008350 PPE family; Region: PPE; pfam00823 717522008351 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4842 717522008352 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522008353 PPE family; Region: PPE; pfam00823 717522008354 Transposase, Mutator family; Region: Transposase_mut; pfam00872 717522008355 MULE transposase domain; Region: MULE; pfam10551 717522008356 tRNA methyl transferase; Region: tRNA_Me_trans; pfam03054 717522008357 tRNA methyl transferase. This family represents tRNA(5-methylaminomethyl-2-thiouridine)-methyltransferase which is involved in the biosynthesis of the modified nucleoside 5-methylaminomethyl-2-thiouridine present in the wobble position of some tRNAs; Region: tRNA_Me_trans; cd01998 717522008358 Ligand Binding Site [chemical binding]; other site 717522008359 Cysteine sulfinate desulfinase/cysteine desulfurase and related enzymes [Amino acid transport and metabolism]; Region: NifS; COG1104 717522008360 cysteine desulfurase NifS; Region: FeS_nifS; TIGR03402 717522008361 pyridoxal 5'-phosphate binding pocket [chemical binding]; other site 717522008362 catalytic residue [active] 717522008363 1-acyl-sn-glycerol-3-phosphate acyltransferase [Lipid metabolism]; Region: PlsC; COG0204 717522008364 Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: AGPAT-like; Region: LPLAT_AGPAT-like; cd07989 717522008365 putative acyl-acceptor binding pocket; other site 717522008366 Putative hemolysin [General function prediction only]; Region: COG3176 717522008367 Electron transfer flavoprotein, alpha subunit [Energy production and conversion]; Region: FixB; COG2025 717522008368 The electron transfer flavoprotein (ETF) serves as a specific electron acceptor for various mitochondrial dehydrogenases. ETF transfers electrons to the main respiratory chain via ETF-ubiquinone oxidoreductase. ETF is an heterodimer that consists of an...; Region: ETF_alpha; cd01715 717522008369 Electron transfer flavoprotein FAD-binding domain; Region: ETF_alpha; pfam00766 717522008370 The electron transfer flavoprotein (ETF) serves as a specific electron acceptor for various mitochondrial dehydrogenases. ETF transfers electrons to the main respiratory chain via ETF-ubiquinone oxidoreductase. ETF is an heterodimer that consists of an...; Region: ETF_beta; cd01714 717522008371 Ligand binding site [chemical binding]; other site 717522008372 Electron transfer flavoprotein domain; Region: ETF; pfam01012 717522008373 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522008374 S-adenosylmethionine binding site [chemical binding]; other site 717522008375 Uncharacterized conserved protein [Function unknown]; Region: COG1543 717522008376 Catalytic domain of glycoside hydrolase (GH) families 38 and 57, lactam utilization protein LamB/YcsF family proteins, YdjC-family proteins, and similar proteins; Region: GH38-57_N_LamB_YdjC_SF; cl17191 717522008377 Domain of unknown function (DUF1957); Region: DUF1957; pfam09210 717522008378 Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438 717522008379 This family is most closely related to the GT1 family of glycosyltransferases and named after YqgM in Bacillus licheniformis about which little is known. Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to...; Region: GT1_YqgM_like; cd03801 717522008380 Domain of unknown function (DUF4333); Region: DUF4333; pfam14230 717522008381 Domain of unknown function (DUF4333); Region: DUF4333; pfam14230 717522008382 Acetyltransferase (isoleucine patch superfamily) [General function prediction only]; Region: WbbJ; COG0110 717522008383 Maltose O-acyltransferase (MAT)-like: This family is composed of maltose O-acetyltransferase, galactoside O-acetyltransferase (GAT), xenobiotic acyltransferase (XAT) and similar proteins. MAT and GAT catalyze the CoA-dependent acetylation of the...; Region: LbH_MAT_like; cd04647 717522008384 trimer interface [polypeptide binding]; other site 717522008385 active site 717522008386 substrate binding site [chemical binding]; other site 717522008387 CoA binding site [chemical binding]; other site 717522008388 FOG: WD40-like repeat [Function unknown]; Region: COG1520 717522008389 Protein of unknown function (DUF3298); Region: DUF3298; pfam11738 717522008390 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522008391 S-adenosylmethionine binding site [chemical binding]; other site 717522008392 Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558 717522008393 Enoyl-CoA hydratase/carnithine racemase [Lipid metabolism]; Region: CaiD; COG1024 717522008394 substrate binding site [chemical binding]; other site 717522008395 oxyanion hole (OAH) forming residues; other site 717522008396 trimer interface [polypeptide binding]; other site 717522008397 ABC-type molybdenum transport system, ATPase component/photorepair protein PhrA [Inorganic ion transport and metabolism]; Region: ModF; COG1119 717522008398 ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201 717522008399 Walker A/P-loop; other site 717522008400 ATP binding site [chemical binding]; other site 717522008401 Q-loop/lid; other site 717522008402 ABC transporter signature motif; other site 717522008403 Walker B; other site 717522008404 D-loop; other site 717522008405 H-loop/switch region; other site 717522008406 CT domains found N-terminal of phosphoserine phosphatase (PSP, SerB); Region: ACT_PSP_1; cd04870 717522008407 ACT domains found N-terminal of phosphoserine phosphatase (PSP, SerB); Region: ACT_PSP_2; cd04871 717522008408 Phosphoserine phosphatase [Amino acid transport and metabolism]; Region: SerB; COG0560 717522008409 Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427 717522008410 motif II; other site 717522008411 Heme/copper-type cytochrome/quinol oxidases, subunit 1 [Energy production and conversion]; Region: CyoB; COG0843 717522008412 Ubiquinol oxidase subunit I. Ubiquinol oxidase, the terminal oxidase in the respiratory chains of aerobic bacteria, is a multi-chain transmembrane protein located in the cell membrane. It catalyzes the reduction of O2 and simultaneously pumps protons...; Region: Ubiquinol_Oxidase_I; cd01662 717522008413 D-pathway; other site 717522008414 Putative ubiquinol binding site [chemical binding]; other site 717522008415 Low-spin heme (heme b) binding site [chemical binding]; other site 717522008416 Putative water exit pathway; other site 717522008417 Binuclear center (heme o3/CuB) [ion binding]; other site 717522008418 K-pathway; other site 717522008419 Putative proton exit pathway; other site 717522008420 Fe3+-siderophore binding domain FhuD. These proteins have been shown to function as initial receptors in ABC transport of Fe3+-siderophores in many eubacterial species. They belong to the TroA-like superfamily of helical backbone metal receptor proteins...; Region: FhuD; cd01146 717522008421 Periplasmic binding protein; Region: Peripla_BP_2; pfam01497 717522008422 siderophore binding site; other site 717522008423 Zn-dependent alcohol dehydrogenases [General function prediction only]; Region: AdhP; COG1064 717522008424 Cinnamyl alcohol dehydrogenases (CAD); Region: CAD1; cd05283 717522008425 putative NAD(P) binding site [chemical binding]; other site 717522008426 putative substrate binding site [chemical binding]; other site 717522008427 catalytic Zn binding site [ion binding]; other site 717522008428 structural Zn binding site [ion binding]; other site 717522008429 dimer interface [polypeptide binding]; other site 717522008430 Protein of unknown function (DUF3349); Region: DUF3349; pfam11829 717522008431 ribonucleotide-diphosphate reductase subunit beta; Provisional; Region: nrdF2; PRK13966 717522008432 Ribonucleotide Reductase, R2/beta subunit, ferritin-like diiron-binding domain; Region: RNRR2; cd01049 717522008433 dimer interface [polypeptide binding]; other site 717522008434 putative radical transfer pathway; other site 717522008435 diiron center [ion binding]; other site 717522008436 tyrosyl radical; other site 717522008437 Predicted flavoprotein involved in K+ transport [Inorganic ion transport and metabolism]; Region: TrkA; COG2072 717522008438 Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox_3; pfam13738 717522008439 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522008440 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522008441 ribonucleotide-diphosphate reductase subunit alpha; Validated; Region: PRK08188 717522008442 Ribonucleotide reductase N-terminal; Region: RNR_N; pfam08343 717522008443 Class I ribonucleotide reductase; Region: RNR_I; cd01679 717522008444 active site 717522008445 dimer interface [polypeptide binding]; other site 717522008446 catalytic residues [active] 717522008447 effector binding site; other site 717522008448 R2 peptide binding site; other site 717522008449 ribonucleotide reductase stimulatory protein; Reviewed; Region: nrdI; PRK03600 717522008450 NrdH-redoxin (NrdH) family; NrdH is a small monomeric protein with a conserved redox active CXXC motif within a TRX fold, characterized by a glutaredoxin (GRX)-like sequence and TRX-like activity profile. In vitro, it displays protein disulfide reductase...; Region: NrdH; cd02976 717522008451 catalytic residues [active] 717522008452 NADPH-dependent FMN reductase; Region: FMN_red; pfam03358 717522008453 Predicted flavoprotein [General function prediction only]; Region: COG0431 717522008454 DNA polymerase IV; Validated; Region: PRK03352 717522008455 DNA Polymerase IV/Kappa; Region: PolY_Pol_IV_kappa; cd03586 717522008456 active site 717522008457 DNA binding site [nucleotide binding] 717522008458 short chain dehydrogenase; Provisional; Region: PRK07832 717522008459 classical (c) SDRs; Region: SDR_c; cd05233 717522008460 NAD(P) binding site [chemical binding]; other site 717522008461 active site 717522008462 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522008463 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522008464 Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124 717522008465 Cytochrome P450; Region: p450; cl12078 717522008466 Transcriptional regulators [Transcription]; Region: FadR; COG2186 717522008467 Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377 717522008468 DNA-binding site [nucleotide binding]; DNA binding site 717522008469 This entry represents the C-terminal ligand binding domain of many members of the GntR family; Region: FCD; smart00895 717522008470 Transcriptional regulators [Transcription]; Region: FadR; COG2186 717522008471 Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377 717522008472 DNA-binding site [nucleotide binding]; DNA binding site 717522008473 FCD domain; Region: FCD; pfam07729 717522008474 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522008475 Acyl-CoA dehydrogenase, N-terminal domain; Region: Acyl-CoA_dh_N; pfam02771 717522008476 Acyl-CoA dehydrogenase; Region: ACAD; cl09933 717522008477 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522008478 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522008479 Acyl-CoA dehydrogenase; Region: ACAD; cl09933 717522008480 active site 717522008481 ATP-dependent DNA ligase; Reviewed; Region: ligB; PRK03180 717522008482 Adenylation domain of archaeal and bacterial LigB-like DNA ligases; Region: Adenylation_DNA_ligase_Arch_LigB; cd07901 717522008483 active site 717522008484 DNA binding site [nucleotide binding] 717522008485 The Oligonucleotide/oligosaccharide binding (OB)-fold domain of archaeal and bacterial ATP-dependent DNA ligases is a DNA-binding module that is part of the catalytic core unit; Region: OBF_DNA_ligase_Arch_LigB; cd07972 717522008486 DNA binding site [nucleotide binding] 717522008487 Carbon starvation protein, predicted membrane protein [Signal transduction mechanisms]; Region: CstA; COG1966 717522008488 Carbon starvation protein CstA; Region: CstA; pfam02554 717522008489 C-terminal domain on CstA (DUF4161); Region: DUF4161; pfam13722 717522008490 Predicted membrane protein [Function unknown]; Region: COG2259 717522008491 Small Multidrug Resistance protein; Region: Multi_Drug_Res; pfam00893 717522008492 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3226 717522008493 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522008494 Protein of unknown function (DUF732); Region: DUF732; pfam05305 717522008495 phosphoglucomutase, alpha-D-glucose phosphate-specific; Region: pgm; TIGR01132 717522008496 This bacterial PGM-like (phosphoglucomutase-like) protein of unknown function belongs to the alpha-D-phosphohexomutase superfamily. The alpha-D-phosphohexomutases include several related enzymes that catalyze a reversible intramolecular phosphoryl...; Region: PGM_like3; cd05801 717522008497 active site 717522008498 substrate binding site [chemical binding]; other site 717522008499 metal binding site [ion binding]; metal-binding site 717522008500 camphor resistance protein CrcB; Provisional; Region: PRK14216 717522008501 camphor resistance protein CrcB; Provisional; Region: PRK14228 717522008502 Uncharacterized ACR, COG1993; Region: DUF190; cl00872 717522008503 Uncharacterized ACR, COG1993; Region: DUF190; cl00872 717522008504 Uncharacterized ACR, COG1993; Region: DUF190; pfam02641 717522008505 Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cl07892 717522008506 Uncharacterized conserved protein [Function unknown]; Region: COG3189 717522008507 Domain of unknown function (DUF222); Region: DUF222; pfam02720 717522008508 HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085 717522008509 active site 717522008510 Citrate lyase beta subunit [Carbohydrate transport and metabolism]; Region: CitE; COG2301 717522008511 Pyrabactin resistance 1 (PYR1), PYR1-like (PYL), regulatory component of abscisic acid receptors (RCARs), and related proteins; Region: PYR_PYL_RCAR_like; cd07821 717522008512 putative hydrophobic ligand binding site [chemical binding]; other site 717522008513 protein interface [polypeptide binding]; other site 717522008514 gate; other site 717522008515 Arylsulfatase A and related enzymes [Inorganic ion transport and metabolism]; Region: AslA; COG3119 717522008516 Sulfatase; Region: Sulfatase; pfam00884 717522008517 probable F420-dependent oxidoreductase, Rv2161c family; Region: F420_Rv2161c; TIGR03619 717522008518 Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cl07892 717522008519 Serine/Threonine protein kinases, catalytic domain; Region: S_TKc; smart00220 717522008520 Catalytic domain of Protein Kinases; Region: PKc; cd00180 717522008521 active site 717522008522 ATP binding site [chemical binding]; other site 717522008523 substrate binding site [chemical binding]; other site 717522008524 activation loop (A-loop); other site 717522008525 ATP-dependent transcriptional regulator [Transcription]; Region: MalT; COG2909 717522008526 AAA ATPase domain; Region: AAA_16; pfam13191 717522008527 Nucleotidyl transferase of unknown function (DUF2204); Region: DUF2204; pfam09970 717522008528 Arabinose-binding domain of AraC transcription regulator, N-term; Region: Arabinose_bd; pfam12625 717522008529 helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342 717522008530 Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165 717522008531 Predicted flavoprotein involved in K+ transport [Inorganic ion transport and metabolism]; Region: TrkA; COG2072 717522008532 Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox_3; pfam13738 717522008533 Esterase/lipase [Lipid metabolism]; Region: Aes; COG0657 717522008534 short chain dehydrogenase; Provisional; Region: PRK07832 717522008535 Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931 717522008536 NAD(P) binding site [chemical binding]; other site 717522008537 active site 717522008538 oxidoreductase, Rxyl_3153 family; Region: Rxyl_3153; TIGR03989 717522008539 Class III alcohol dehydrogenase; Region: Zn_ADH_class_III; cd08279 717522008540 NAD binding site [chemical binding]; other site 717522008541 catalytic Zn binding site [ion binding]; other site 717522008542 substrate binding site [chemical binding]; other site 717522008543 structural Zn binding site [ion binding]; other site 717522008544 acyltransferase, WS/DGAT/MGAT; Region: acyl_WS_DGAT; TIGR02946 717522008545 Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007 717522008546 acyltransferase, WS/DGAT/MGAT; Region: acyl_WS_DGAT; TIGR02946 717522008547 Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007 717522008548 Protein of unknown function (DUF1298); Region: DUF1298; pfam06974 717522008549 long-chain-fatty-acid--CoA ligase; Validated; Region: PRK06187 717522008550 Adenylate forming domain, Class I; Region: AFD_class_I; cl17068 717522008551 acyl-activating enzyme (AAE) consensus motif; other site 717522008552 AMP binding site [chemical binding]; other site 717522008553 active site 717522008554 CoA binding site [chemical binding]; other site 717522008555 SPFH domain / Band 7 family; Region: Band_7; pfam01145 717522008556 Membrane protease subunits, stomatin/prohibitin homologs [Posttranslational modification, protein turnover, chaperones]; Region: HflC; COG0330 717522008557 Patatin-like phospholipase; Region: Patatin; pfam01734 717522008558 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2354 717522008559 probable F420-dependent oxidoreductase, Rv3093c family; Region: F420_Rv3093c; TIGR03841 717522008560 N5,N10-methylenetetrahydromethanopterin reductase (Mer) catalyzes the reduction of N5,N10-methylenetetrahydromethanopterin with reduced coenzyme F420 to N5-methyltetrahydromethanopterin and oxidized coenzyme F420; Region: Tetrahydromethanopterin_reductase; cd01097 717522008561 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522008562 Acyl-CoA dehydrogenase; Region: ACAD; cl09933 717522008563 active site 717522008564 Predicted transcriptional regulators [Transcription]; Region: COG1733 717522008565 Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090 717522008566 dimerization interface [polypeptide binding]; other site 717522008567 putative DNA binding site [nucleotide binding]; other site 717522008568 putative Zn2+ binding site [ion binding]; other site 717522008569 Sugar-binding cellulase-like; Region: Cellulase-like; pfam12876 717522008570 PE family; Region: PE; pfam00934 717522008571 alpha/beta hydrolase fold; Region: Abhydrolase_3; pfam07859 717522008572 Protein of unknown function (DUF2424); Region: DUF2424; pfam10340 717522008573 uncharacterized Actinobacterial protein TIGR03083; Region: TIGR03083 717522008574 Mycothiol maleylpyruvate isomerase N-terminal domain; Region: MDMPI_N; pfam11716 717522008575 Medium chain reductase/dehydrogenase (MDR)/zinc-dependent alcohol dehydrogenase-like family; Region: MDR; cl16912 717522008576 Small protein B (SmpB) is a component of the trans-translation system in prokaryotes for releasing stalled ribosome from damaged messenger RNAs; Region: SmpB; cd09294 717522008577 SmpB-tmRNA interface; other site 717522008578 Cell division protein [Cell division and chromosome partitioning]; Region: FtsX; COG2177 717522008579 FtsX-like permease family; Region: FtsX; pfam02687 717522008580 Predicted ATPase involved in cell division [Cell division and chromosome partitioning]; Region: FtsE; COG2884 717522008581 ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201 717522008582 Walker A/P-loop; other site 717522008583 ATP binding site [chemical binding]; other site 717522008584 Q-loop/lid; other site 717522008585 ABC transporter signature motif; other site 717522008586 Walker B; other site 717522008587 D-loop; other site 717522008588 H-loop/switch region; other site 717522008589 Mechanosensitive ion channel; Region: MS_channel; pfam00924 717522008590 Small-conductance mechanosensitive channel [Cell envelope biogenesis, outer membrane]; Region: MscS; COG0668 717522008591 peptide chain release factor 2; Validated; Region: prfB; PRK00578 717522008592 This domain is found in peptide chain release factors; Region: PCRF; smart00937 717522008593 RF-1 domain; Region: RF-1; pfam00472 717522008594 ferredoxin-NADP+ reductase; Region: PLN02852 717522008595 FAD/FMN-containing dehydrogenases [Energy production and conversion]; Region: GlcD; COG0277 717522008596 FAD binding domain; Region: FAD_binding_4; pfam01565 717522008597 Molybdenum cofactor biosynthesis enzyme [Coenzyme metabolism]; Region: MoaA; COG2896 717522008598 Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335 717522008599 FeS/SAM binding site; other site 717522008600 Molybdenum Cofactor Synthesis C; Region: Mob_synth_C; pfam06463 717522008601 PCD_DCoH: The bifunctional protein pterin-4alpha-carbinolamine dehydratase (PCD), also known as DCoH (dimerization cofactor of hepatocyte nuclear factor-1), is both a transcription activator and a metabolic enzyme. DCoH stimulates gene expression by...; Region: PCD_DCoH; cd00488 717522008602 aromatic arch; other site 717522008603 DCoH dimer interaction site [polypeptide binding]; other site 717522008604 DCoH /HNF-1 dimer interaction site [polypeptide binding]; other site 717522008605 DCoH tetramer interaction site [polypeptide binding]; other site 717522008606 substrate binding site [chemical binding]; other site 717522008607 MoaC family, prokaryotic and eukaryotic. Members of this family are involved in molybdenum cofactor (Moco) biosynthesis, an essential cofactor of a diverse group of redox enzymes. MoaC, a small hexameric protein, converts, together with MoaA, a guanosine...; Region: MoaC_PE; cd01420 717522008608 trimer interface [polypeptide binding]; other site 717522008609 dimer interface [polypeptide binding]; other site 717522008610 putative active site [active] 717522008611 Ubiquitin domain of MoaD-like proteins; Region: MoaD; cd00754 717522008612 MoaE interaction surface [polypeptide binding]; other site 717522008613 MoeB interaction surface [polypeptide binding]; other site 717522008614 thiocarboxylated glycine; other site 717522008615 Predicted phosphatases [General function prediction only]; Region: Gph; COG0546 717522008616 HAD-hyrolase-like; Region: Hydrolase_like; pfam13242 717522008617 Nucleoside deaminases include adenosine, guanine and cytosine deaminases. These enzymes are Zn dependent and catalyze the deamination of nucleosides. The zinc ion in the active site plays a central role in the proposed catalytic mechanism, activating a...; Region: nucleoside_deaminase; cd01285 717522008618 nucleoside/Zn binding site; other site 717522008619 dimer interface [polypeptide binding]; other site 717522008620 catalytic motif [active] 717522008621 Transposase, Mutator family; Region: Transposase_mut; pfam00872 717522008622 MULE transposase domain; Region: MULE; pfam10551 717522008623 molybdopterin biosynthesis-like protein MoeZ; Validated; Region: PRK07878 717522008624 ThiF_MoeB_HesA. Family of E1-like enzymes involved in molybdopterin and thiamine biosynthesis family. The common reaction mechanism catalyzed by MoeB and ThiF, like other E1 enzymes, begins with a nucleophilic attack of the C-terminal carboxylate of MoaD...; Region: ThiF_MoeB_HesA_family; cd00757 717522008625 ATP binding site [chemical binding]; other site 717522008626 substrate interface [chemical binding]; other site 717522008627 Rhodanese Homology Domain (RHOD); an alpha beta fold domain found duplicated in the rhodanese protein. The cysteine containing enzymatically active version of the domain is also found in the Cdc25 class of protein phosphatases and a variety of proteins...; Region: RHOD; cd00158 717522008628 active site residue [active] 717522008629 Rhodanese-related sulfurtransferase [Inorganic ion transport and metabolism]; Region: SseA; COG2897 717522008630 Thiosulfate sulfurtransferase (TST), N-terminal, inactive domain. TST contains 2 copies of the Rhodanese Homology Domain; this is the 1st repeat, which does not contain the catalytically active Cys residue. The role of the 1st repeat is uncertain, but it...; Region: TST_Repeat_1; cd01448 717522008631 active site residue [active] 717522008632 Thiosulfate sulfurtransferase (TST), C-terminal, catalytic domain. TST contains 2 copies of the Rhodanese Homology Domain; this is the second repeat. Only the second repeat contains the catalytically active Cys residue; Region: TST_Repeat_2; cd01449 717522008633 active site residue [active] 717522008634 RD12 Region of difference RD12, deleted region in Mycobacterium bovis BCG Pasteur, BCG Tokyo, BCG Mexico and Mycobacterium bovis AF2122/97 compared to Mycobacterium tuberculosis H37Rv. Removes genes Rv3118-Rv3120 and merges truncated genes Rv3117 and Rv3121 717522008635 DNA-binding transcriptional activator of the SARP family [Signal transduction mechanisms]; Region: DnrI; COG3629 717522008636 Transcriptional regulatory protein, C terminal; Region: Trans_reg_C; pfam00486 717522008637 DNA binding site [nucleotide binding] 717522008638 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522008639 PPE family; Region: PPE; pfam00823 717522008640 Proteins of this family catalyze the reduction of flavin or nitrocompounds using NAD(P)H as electron donor in a obligatory two-electron transfer, utilizing FMN or FAD as cofactor. They are often found to be homodimers. Enzymes of this family are...; Region: Nitro_FMN_reductase; cl00514 717522008641 Pyridoxamine 5'-phosphate oxidase; Region: Pyridox_ox_2; pfam12900 717522008642 acyltransferase, WS/DGAT/MGAT; Region: acyl_WS_DGAT; TIGR02946 717522008643 Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007 717522008644 Proteins of this family catalyze the reduction of flavin or nitrocompounds using NAD(P)H as electron donor in a obligatory two-electron transfer, utilizing FMN or FAD as cofactor. They are often found to be homodimers. Enzymes of this family are...; Region: Nitro_FMN_reductase; cl00514 717522008645 dimer interface [polypeptide binding]; other site 717522008646 Proteins of this family catalyze the reduction of flavin or nitrocompounds using NAD(P)H as electron donor in a obligatory two-electron transfer, utilizing FMN or FAD as cofactor. They are often found to be homodimers. Enzymes of this family are...; Region: Nitro_FMN_reductase; cl00514 717522008647 FOG: GAF domain [Signal transduction mechanisms]; Region: FhlA; COG2203 717522008648 Domain present in phytochromes and cGMP-specific phosphodiesterases; Region: GAF; smart00065 717522008649 Signal transduction histidine kinase [Signal transduction mechanisms]; Region: COG4585 717522008650 Histidine kinase; Region: HisKA_3; pfam07730 717522008651 Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075 717522008652 ATP binding site [chemical binding]; other site 717522008653 Mg2+ binding site [ion binding]; other site 717522008654 G-X-G motif; other site 717522008655 Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197 717522008656 Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156 717522008657 active site 717522008658 phosphorylation site [posttranslational modification] 717522008659 intermolecular recognition site; other site 717522008660 dimerization interface [polypeptide binding]; other site 717522008661 C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170 717522008662 DNA binding residues [nucleotide binding] 717522008663 dimerization interface [polypeptide binding]; other site 717522008664 Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293 717522008665 Ligand Binding Site [chemical binding]; other site 717522008666 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522008667 PPE family; Region: PPE; pfam00823 717522008668 Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484 717522008669 I-RD08 Region of difference I-RD08, inserted region in Mycobacterium bovis BCG Pasteur, BCG Tokyo, BCG Mexico and Mycobacterium bovis AF2122/97 compared to Mycobacterium tuberculosis H37Rv. Leads to a longer PPE50 gene 717522008670 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522008671 PPE family; Region: PPE; pfam00823 717522008672 Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484 717522008673 Archaeal fructose-1,6-bisphosphatase and related enzymes of inositol monophosphatase family [Carbohydrate transport and metabolism]; Region: SuhB; COG0483 717522008674 Predominantly bacterial family of Mg++ dependend phosphatases, related to inositol monophosphatases. These enzymes may dephosphorylate fructose-1,6-bisphosphate, inositol monophospate, 3'-phosphoadenosine-5'-phosphate, or similar substrates; Region: Bacterial_IMPase_like_1; cd01641 717522008675 active site 717522008676 AmmeMemoRadiSam system radical SAM enzyme; Region: AmmeMemoSam_rS; TIGR04337 717522008677 Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335 717522008678 FeS/SAM binding site; other site 717522008679 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522008680 Acyl-CoA dehydrogenase; Region: ACAD; cl09933 717522008681 active site 717522008682 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522008683 Acyl-CoA dehydrogenase; Region: ACAD; cl09933 717522008684 active site 717522008685 NADPH:quinone reductase and related Zn-dependent oxidoreductases [Energy production and conversion / General function prediction only]; Region: Qor; COG0604 717522008686 Quinone oxidoreductase (QOR); Region: QOR1; cd08241 717522008687 NAD(P) binding site [chemical binding]; other site 717522008688 Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156 717522008689 active site 717522008690 phosphorylation site [posttranslational modification] 717522008691 intermolecular recognition site; other site 717522008692 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522008693 PPE family; Region: PPE; pfam00823 717522008694 NADH dehydrogenase subunit A; Validated; Region: PRK07928 717522008695 NADH dehydrogenase subunit B; Validated; Region: PRK06411 717522008696 NADH dehydrogenase subunit C; Provisional; Region: PRK07785 717522008697 NADH (or F420H2) dehydrogenase, subunit C; Region: NuoC_fam; TIGR01961 717522008698 NADH dehydrogenase I, D subunit; Region: NuoD; TIGR01962 717522008699 NADH dehydrogenase subunit D; Validated; Region: PRK06075 717522008700 NADH dehydrogenase subunit E; Validated; Region: PRK07539 717522008701 TRX-like [2Fe-2S] Ferredoxin (Fd) family, NADH:ubiquinone oxidoreductase (Nuo) subunit E subfamily; Nuo, also called respiratory chain Complex 1, is the entry point for electrons into the respiratory chains of bacteria and the mitochondria of eukaryotes; Region: TRX_Fd_NuoE; cd03064 717522008702 putative dimer interface [polypeptide binding]; other site 717522008703 [2Fe-2S] cluster binding site [ion binding]; other site 717522008704 NADH-quinone oxidoreductase, F subunit; Region: nuoF_fam; TIGR01959 717522008705 SLBB domain; Region: SLBB; pfam10531 717522008706 NADH-ubiquinone oxidoreductase-F iron-sulfur binding region; Region: NADH_4Fe-4S; pfam10589 717522008707 NADH dehydrogenase subunit G; Validated; Region: PRK07860 717522008708 2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207 717522008709 catalytic loop [active] 717522008710 iron binding site [ion binding]; other site 717522008711 NADH-ubiquinone oxidoreductase-G iron-sulfur binding region; Region: NADH-G_4Fe-4S_3; pfam10588 717522008712 MopB_NDH-1_NuoG2-N7: The second domain of the NuoG subunit (with a [4Fe-4S] cluster, N7) of the NADH-quinone oxidoreductase/NADH dehydrogenase-1 (NDH-1) found in various bacteria. The NDH-1 is the first energy-transducting complex in the respiratory...; Region: MopB_NDH-1_NuoG2-N7; cd02771 717522008713 [4Fe-4S] binding site [ion binding]; other site 717522008714 MopB_CT_NDH-1_NuoG2-N7: C-terminal region of the NuoG-like subunit (of the variant with a [4Fe-4S] cluster, N7) of the NADH-quinone oxidoreductase/NADH dehydrogenase-1 (NDH-1) found in various bacteria. The NDH-1 is the first energy-transducting complex...; Region: MopB_CT_NDH-1_NuoG2-N7; cd02788 717522008715 NADH:ubiquinone oxidoreductase subunit H; Provisional; Region: PRK06076 717522008716 Formate hydrogenlyase subunit 4 [Energy production and conversion]; Region: HyfC; COG0650 717522008717 NADH dehydrogenase subunit I; Provisional; Region: PRK05888 717522008718 4Fe-4S binding domain; Region: Fer4; pfam00037 717522008719 4Fe-4S binding domain; Region: Fer4; pfam00037 717522008720 NADH:ubiquinone oxidoreductase subunit J; Provisional; Region: PRK06638 717522008721 NADH:ubiquinone oxidoreductase subunit K; Validated; Region: PRK05715 717522008722 NADH:ubiquinone oxidoreductase subunit L; Reviewed; Region: PRK06590 717522008723 NADH-Ubiquinone oxidoreductase (complex I), chain 5 N-terminus; Region: Oxidored_q1_N; pfam00662 717522008724 NADH-Ubiquinone/plastoquinone (complex I), various chains; Region: Oxidored_q1; pfam00361 717522008725 NADH:ubiquinone oxidoreductase subunit M; Reviewed; Region: PRK05846 717522008726 NADH-Ubiquinone/plastoquinone (complex I), various chains; Region: Oxidored_q1; pfam00361 717522008727 NADH:ubiquinone oxidoreductase subunit N; Provisional; Region: PRK05777 717522008728 NADH-Ubiquinone/plastoquinone (complex I), various chains; Region: Oxidored_q1; pfam00361 717522008729 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522008730 PPE family; Region: PPE; pfam00823 717522008731 I-RD09 Region of difference I-RD09, inserted region in Mycobacterium bovis BCG Pasteur, BCG Tokyo, BCG Mexico and Mycobacterium bovis AF2122/97 compared to Mycobacterium tuberculosis H37Rv2. Leads to an additional gene, PPE70 717522008732 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522008733 PPE family; Region: PPE; pfam00823 717522008734 pyrimidine utilization regulatory protein R; Region: RutR; TIGR03613 717522008735 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522008736 Phenylpropionate dioxygenase and related ring-hydroxylating dioxygenases, large terminal subunit [Inorganic ion transport and metabolism / General function prediction only]; Region: HcaE; COG4638 717522008737 Rieske non-heme iron oxygenase (RO) family, N-terminal Rieske domain of the oxygenase alpha subunit; The RO family comprise a large class of aromatic ring-hydroxylating dioxygenases found predominantly in microorganisms. These enzymes enable...; Region: Rieske_RO_Alpha_N; cd03469 717522008738 [2Fe-2S] cluster binding site [ion binding]; other site 717522008739 C-terminal catalytic domain of the oxygenase alpha subunit of an uncharacterized subgroup of Rieske-type non-heme iron aromatic ring-hydroxylating oxygenases; Region: RHO_alpha_C_1; cd08885 717522008740 putative alpha subunit interface [polypeptide binding]; other site 717522008741 putative active site [active] 717522008742 putative substrate binding site [chemical binding]; other site 717522008743 Fe binding site [ion binding]; other site 717522008744 Uncharacterized conserved protein (some members contain a von Willebrand factor type A (vWA) domain) [General function prediction only]; Region: COG1721 717522008745 Protein of unknown function DUF58; Region: DUF58; pfam01882 717522008746 MoxR-like ATPases [General function prediction only]; Region: COG0714 717522008747 The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009 717522008748 Walker A motif; other site 717522008749 ATP binding site [chemical binding]; other site 717522008750 Walker B motif; other site 717522008751 arginine finger; other site 717522008752 Domain of unknown function (DUF4129); Region: DUF4129; pfam13559 717522008753 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522008754 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522008755 Acyl-CoA dehydrogenase (ACAD) 10 and 11, N-terminal domain, and similar proteins. This subfamily is part of a larger superfamily that includes the catalytic domains of other kinases, such as the typical serine/threonine/tyrosine protein kinases (PKs); Region: ACAD10_11_like; cd05154 717522008756 putative active site [active] 717522008757 putative substrate binding site [chemical binding]; other site 717522008758 ATP binding site [chemical binding]; other site 717522008759 Phosphotransferase enzyme family; Region: APH; pfam01636 717522008760 Monoamine oxidase [Amino acid transport and metabolism]; Region: COG1231 717522008761 NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450 717522008762 hydroxyglutarate oxidase; Provisional; Region: PRK11728 717522008763 Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596 717522008764 Putative lysophospholipase; Region: Hydrolase_4; pfam12146 717522008765 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522008766 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522008767 short chain dehydrogenase; Validated; Region: PRK08264 717522008768 Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931 717522008769 NAD(P) binding site [chemical binding]; other site 717522008770 active site 717522008771 amidase; Provisional; Region: PRK06170 717522008772 Amidase; Region: Amidase; pfam01425 717522008773 Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697 717522008774 Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596 717522008775 TAP-like protein; Region: Abhydrolase_4; pfam08386 717522008776 Domain of unknown function (DUF385); Region: DUF385; pfam04075 717522008777 Predicted ATPase (AAA+ superfamily) [General function prediction only]; Region: COG1373 717522008778 AAA domain; Region: AAA_14; pfam13173 717522008779 PIN (PilT N terminus) domain: Superfamily; Region: PIN_SF; cl14812 717522008780 putative active site [active] 717522008781 Antitoxin of toxin-antitoxin stability system [Cell division and chromosome partitioning]; Region: Phd; COG4118 717522008782 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4683 717522008783 Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093 717522008784 non-specific DNA binding site [nucleotide binding]; other site 717522008785 salt bridge; other site 717522008786 sequence-specific DNA binding site [nucleotide binding]; other site 717522008787 RES domain; Region: RES; pfam08808 717522008788 Transposase and inactivated derivatives, IS30 family [DNA replication, recombination, and repair]; Region: Tra8; COG2826 717522008789 Helix-turn-helix domain; Region: HTH_38; pfam13936 717522008790 Integrase core domain; Region: rve; pfam00665 717522008791 Luciferase-like monooxygenase; Region: Bac_luciferase; pfam00296 717522008792 Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cl07892 717522008793 hypothetical protein; Validated; Region: PRK00068 717522008794 Uncharacterized conserved protein [Function unknown]; Region: COG1615 717522008795 Uncharacterized conserved protein [Function unknown]; Region: COG1615; cl09133 717522008796 Predicted secreted protein containing a PDZ domain [Signal transduction mechanisms]; Region: SdrC; COG3480 717522008797 PDZ domain, also called DHR (Dlg homologous region) or GLGF (after a conserved sequence motif). Many PDZ domains bind C-terminal polypeptides, though binding to internal (non-C-terminal) polypeptides and even to lipids has been demonstrated; Region: PDZ; cl00117 717522008798 Lon protease (S16) C-terminal proteolytic domain; Region: Lon_C; pfam05362 717522008799 Uncharacterized conserved protein [Function unknown]; Region: COG5282 717522008800 uncharacterized protein, coenzyme F420 biosynthesis associated; Region: DUF2342_F420; TIGR03883 717522008801 bacteriocin biosynthesis cyclodehydratase domain; Region: cyclo_dehyd_2; TIGR03882 717522008802 ABC1 family; Region: ABC1; pfam03109 717522008803 Phosphotransferase enzyme family; Region: APH; pfam01636 717522008804 Aminoglycoside 3'-phosphotransferase (APH) and Choline Kinase (ChoK) family. The APH/ChoK family is part of a larger superfamily that includes the catalytic domains of other kinases, such as the typical serine/threonine/tyrosine protein kinases (PKs)...; Region: APH_ChoK_like; cd05120 717522008805 active site 717522008806 ATP binding site [chemical binding]; other site 717522008807 Transcription factor WhiB; Region: Whib; pfam02467 717522008808 Superfamily I DNA and RNA helicases [DNA replication, recombination, and repair]; Region: UvrD; COG0210 717522008809 Part of AAA domain; Region: AAA_19; pfam13245 717522008810 Family description; Region: UvrD_C_2; pfam13538 717522008811 HRDC domain; Region: HRDC; pfam00570 717522008812 NrdH-redoxin (NrdH) family; NrdH is a small monomeric protein with a conserved redox active CXXC motif within a TRX fold, characterized by a glutaredoxin (GRX)-like sequence and TRX-like activity profile. In vitro, it displays protein disulfide reductase...; Region: NrdH; cd02976 717522008813 catalytic residues [active] 717522008814 NADH pyrophosphatase; Reviewed; Region: nudC; PRK00241 717522008815 NADH pyrophosphatase-like rudimentary NUDIX domain; Region: NUDIX-like; pfam09296 717522008816 NADH pyrophosphatase zinc ribbon domain; Region: zf-NADH-PPase; pfam09297 717522008817 NADH pyrophosphatase, a member of the Nudix hydrolase superfamily, catalyzes the cleavage of NADH into reduced nicotinamide mononucleotide (NMNH) and AMP. Like other members of the Nudix family, it requires a divalent cation, such as Mg2+ or Mn2+, for...; Region: NADH_pyrophosphatase; cd03429 717522008818 putative NADH binding site [chemical binding]; other site 717522008819 putative active site [active] 717522008820 nudix motif; other site 717522008821 putative metal binding site [ion binding]; other site 717522008822 Ion channel; Region: Ion_trans_2; pfam07885 717522008823 K+ transport systems, NAD-binding component [Inorganic ion transport and metabolism]; Region: TrkA; COG0569 717522008824 TrkA-N domain; Region: TrkA_N; pfam02254 717522008825 UvrD/REP helicase N-terminal domain; Region: UvrD-helicase; pfam00580 717522008826 Part of AAA domain; Region: AAA_19; pfam13245 717522008827 RecB family exonuclease [DNA replication, recombination, and repair]; Region: COG2887 717522008828 UvrD/REP helicase N-terminal domain; Region: UvrD-helicase; pfam00580 717522008829 Superfamily I DNA and RNA helicases [DNA replication, recombination, and repair]; Region: UvrD; COG0210 717522008830 RecB family exonuclease [DNA replication, recombination, and repair]; Region: COG2887 717522008831 alpha/beta hydrolase fold; Region: Abhydrolase_1; pfam00561 717522008832 Novel bacterial esterase that cleaves esters on halogenated cyclic compounds; Region: Esterase_713_like; cl17303 717522008833 The DNA repair protein O6-alkylguanine-DNA alkyltransferase (ATase; also known as AGT, AGAT and MGMT) reverses O6-alkylation DNA damage by transferring O6-alkyl adducts to an active site cysteine irreversibly, without inducing DNA strand breaks. ATases...; Region: ATase; cd06445 717522008834 active site 717522008835 DNA binding site [nucleotide binding] 717522008836 TIGR02569 family protein; Region: TIGR02569_actnb 717522008837 molybdopterin biosynthesis-like protein MoeZ; Validated; Region: PRK07878 717522008838 ThiF_MoeB_HesA. Family of E1-like enzymes involved in molybdopterin and thiamine biosynthesis family. The common reaction mechanism catalyzed by MoeB and ThiF, like other E1 enzymes, begins with a nucleophilic attack of the C-terminal carboxylate of MoaD...; Region: ThiF_MoeB_HesA_family; cd00757 717522008839 ATP binding site [chemical binding]; other site 717522008840 substrate interface [chemical binding]; other site 717522008841 Rhodanese Homology Domain (RHOD); an alpha beta fold domain found duplicated in the rhodanese protein. The cysteine containing enzymatically active version of the domain is also found in the Cdc25 class of protein phosphatases and a variety of proteins...; Region: RHOD; cd00158 717522008842 active site residue [active] 717522008843 Protein of unknown function (DUF3152); Region: DUF3152; pfam11350 717522008844 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522008845 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522008846 Protein of unknown function (DUF3107); Region: DUF3107; pfam11305 717522008847 tRNA-(MS[2]IO[6]A)-hydroxylase (MiaE)-like; Region: MiaE_2; pfam13794 717522008848 DEAD-box helicases. A diverse family of proteins involved in ATP-dependent RNA unwinding, needed in a variety of cellular processes including splicing, ribosome biogenesis and RNA degradation. The name derives from the sequence of the Walker B motif; Region: DEADc; cd00268 717522008849 DEAD-like helicases superfamily; Region: DEXDc; smart00487 717522008850 ATP binding site [chemical binding]; other site 717522008851 Mg++ binding site [ion binding]; other site 717522008852 motif III; other site 717522008853 Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079 717522008854 nucleotide binding region [chemical binding]; other site 717522008855 ATP-binding site [chemical binding]; other site 717522008856 ATPases involved in chromosome partitioning [Cell division and chromosome partitioning]; Region: Soj; COG1192 717522008857 ParA and ParB of Caulobacter crescentus belong to a conserved family of bacterial proteins implicated in chromosome segregation. ParB binds to DNA sequences adjacent to the origin of replication and localizes to opposite cell poles shortly following the...; Region: ParA; cd02042 717522008858 P-loop; other site 717522008859 Magnesium ion binding site [ion binding]; other site 717522008860 ParA and ParB of Caulobacter crescentus belong to a conserved family of bacterial proteins implicated in chromosome segregation. ParB binds to DNA sequences adjacent to the origin of replication and localizes to opposite cell poles shortly following the...; Region: ParA; cd02042 717522008861 Magnesium ion binding site [ion binding]; other site 717522008862 Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067 717522008863 catalytic core [active] 717522008864 Isochorismate synthase [Coenzyme metabolism / Secondary metabolites biosynthesis, transport, and catabolism]; Region: MenF; COG1169 717522008865 chorismate binding enzyme; Region: Chorismate_bind; pfam00425 717522008866 Sphingosine kinase and enzymes related to eukaryotic diacylglycerol kinase [Lipid metabolism / General function prediction only]; Region: LCB5; COG1597 717522008867 Diacylglycerol kinase catalytic domain; Region: DAGK_cat; pfam00781 717522008868 Transcription factor WhiB; Region: Whib; pfam02467 717522008869 Signal transduction histidine kinase; Region: H_kinase_N; pfam12282 717522008870 PAS domain S-box; Region: sensory_box; TIGR00229 717522008871 Signal transduction histidine kinase [Signal transduction mechanisms]; Region: COG3920 717522008872 Histidine kinase; Region: HisKA_2; pfam07568 717522008873 Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075 717522008874 ATP binding site [chemical binding]; other site 717522008875 Mg2+ binding site [ion binding]; other site 717522008876 G-X-G motif; other site 717522008877 The biotinyl-domain or biotin carboxyl carrier protein (BCCP) domain is present in all biotin-dependent enzymes, such as acetyl-CoA carboxylase, pyruvate carboxylase, propionyl-CoA carboxylase, methylcrotonyl-CoA carboxylase, geranyl-CoA carboxylase; Region: biotinyl_domain; cd06850 717522008878 carboxyltransferase (CT) interaction site; other site 717522008879 biotinylation site [posttranslational modification]; other site 717522008880 mycothiol system anti-sigma-R factor; Region: antisig_RsrA; TIGR03988 717522008881 RNA polymerase sigma-70 factor, TIGR02947 family; Region: SigH_actino 717522008882 Sigma-70 region 2; Region: Sigma70_r2; pfam04542 717522008883 Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171 717522008884 DNA binding residues [nucleotide binding] 717522008885 short chain dehydrogenase; Provisional; Region: PRK08278 717522008886 human hydroxysteroid dehydrogenase-like protein 2 (HSDL2), classical (c) SDRs; Region: HSDL2_SDR_c; cd09762 717522008887 NAD(P) binding site [chemical binding]; other site 717522008888 homodimer interface [polypeptide binding]; other site 717522008889 active site 717522008890 YbaK-like. The YbaK family of deacylase domains includes the INS amino acid-editing domain of the bacterial class II prolyl tRNA synthetase (ProRS), and it's trans-acting homologs, YbaK, ProX, and PrdX. The primary function of INS is to hydrolyze...; Region: YbaK_like; cl00022 717522008891 YbaK-like. The YbaK family of deacylase domains includes the INS amino acid-editing domain of the bacterial class II prolyl tRNA synthetase (ProRS), and it's trans-acting homologs, YbaK, ProX, and PrdX. The primary function of INS is to hydrolyze...; Region: YbaK_like; cl00022 717522008892 putative deacylase active site [active] 717522008893 Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302 717522008894 N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301 717522008895 Coenzyme A binding pocket [chemical binding]; other site 717522008896 Uncharacterized bacterial proteins with similarity to Aminoglycoside 3'-phosphotransferase (APH) and Choline kinase (ChoK) family members. The APH/ChoK subfamily is part of a larger superfamily that includes the catalytic domains of other kinases; Region: APH_ChoK_like_1; cd05155 717522008897 Phosphotransferase enzyme family; Region: APH; pfam01636 717522008898 putative active site [active] 717522008899 putative substrate binding site [chemical binding]; other site 717522008900 ATP binding site [chemical binding]; other site 717522008901 Uncharacterized conserved protein [Function unknown]; Region: COG2135 717522008902 3-phosphoshikimate 1-carboxyvinyltransferase; Provisional; Region: PRK02427 717522008903 EPSP synthase domain. 3-phosphoshikimate 1-carboxyvinyltransferase (5-enolpyruvylshikimate-3-phosphate synthase) (EC 2.5.1.19) catalyses the reaction between shikimate-3-phosphate (S3P) and phosphoenolpyruvate (PEP) to form...; Region: EPSP_synthase; cd01556 717522008904 hinge; other site 717522008905 active site 717522008906 Predicted GTPases [General function prediction only]; Region: COG1162 717522008907 Ribosomal interacting GTPase YjeQ/EngC, a circularly permuted subfamily of the Ras GTPases; Region: YjeQ_EngC; cd01854 717522008908 GTPase/Zn-binding domain interface [polypeptide binding]; other site 717522008909 GTP/Mg2+ binding site [chemical binding]; other site 717522008910 G4 box; other site 717522008911 G5 box; other site 717522008912 G1 box; other site 717522008913 Switch I region; other site 717522008914 G2 box; other site 717522008915 G3 box; other site 717522008916 Switch II region; other site 717522008917 Fatty acid desaturase [Lipid metabolism]; Region: DesA; COG3239 717522008918 The Delta6 Fatty Acid Desaturase (Delta6-FADS)-like CD includes the integral-membrane enzymes: delta-4, delta-5, delta-6, delta-8, delta-8-sphingolipid, and delta-11 desaturases found in vertebrates, higher plants, fungi, and bacteria. These desaturases...; Region: Delta6-FADS-like; cd03506 717522008919 putative di-iron ligands [ion binding]; other site 717522008920 Iron-sulfur binding ferredoxin reductase (FNR) proteins combine the FAD and NAD(P) binding regions of FNR with an iron-sulfur binding cluster domain. Ferredoxin-NADP+ (oxido)reductase is an FAD-containing enzyme that catalyzes the reversible electron...; Region: FNR_iron_sulfur_binding_2; cd06216 717522008921 Flavodoxin reductases (ferredoxin-NADPH reductases) family 1 [Energy production and conversion]; Region: Hmp; COG1018 717522008922 FAD binding pocket [chemical binding]; other site 717522008923 FAD binding motif [chemical binding]; other site 717522008924 phosphate binding motif [ion binding]; other site 717522008925 beta-alpha-beta structure motif; other site 717522008926 NAD binding pocket [chemical binding]; other site 717522008927 2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207 717522008928 Ferredoxin [Energy production and conversion]; Region: Fdx; COG0633 717522008929 catalytic loop [active] 717522008930 iron binding site [ion binding]; other site 717522008931 polyphosphate kinase 2, PA0141 family; Region: PPK2_P_aer; TIGR03707 717522008932 acyltransferase, WS/DGAT/MGAT; Region: acyl_WS_DGAT; TIGR02946 717522008933 Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007 717522008934 Kef-type K+ transport systems, membrane components [Inorganic ion transport and metabolism]; Region: KefB; COG0475 717522008935 Sodium/hydrogen exchanger family; Region: Na_H_Exchanger; pfam00999 717522008936 Putative regulatory, ligand-binding protein related to C-terminal domains of K+ channels [Inorganic ion transport and metabolism]; Region: COG0490 717522008937 TrkA-C domain; Region: TrkA_C; pfam02080 717522008938 Putative protein-S-isoprenylcysteine methyltransferase [Posttranslational modification, protein turnover, chaperones]; Region: STE14; COG2020 717522008939 The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174 717522008940 drug resistance transporter, EmrB/QacA subfamily; Region: efflux_EmrB; TIGR00711 717522008941 putative substrate translocation pore; other site 717522008942 cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases [Signal transduction mechanisms]; Region: Crp; COG0664 717522008943 effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038 717522008944 ligand binding site [chemical binding]; other site 717522008945 flexible hinge region; other site 717522008946 Predicted esterase of the alpha-beta hydrolase superfamily [General function prediction only]; Region: RssA; COG1752 717522008947 Patatins and Phospholipases; Region: Patatin_and_cPLA2; cl11396 717522008948 nucleophile elbow; other site 717522008949 preprotein translocase subunit SecA; Reviewed; Region: PRK12904 717522008950 SecA preprotein cross-linking domain; Region: SecA_PP_bind; smart00958 717522008951 RaiA ("ribosome-associated inhibitor A", also known as Protein Y (PY), YfiA, and SpotY, is a stress-response protein that binds the ribosomal subunit interface and arrests translation by interfering with aminoacyl-tRNA binding to the ribosomal...; Region: RaiA; cd00552 717522008952 30S subunit binding site; other site 717522008953 Predicted amidophosphoribosyltransferases [General function prediction only]; Region: ComFC; COG1040 717522008954 active site 717522008955 Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cl00309 717522008956 Protein of unknown function (DUF2993); Region: DUF2993; pfam11209 717522008957 lipoprotein LpqB; Provisional; Region: PRK13616 717522008958 Sporulation and spore germination; Region: Germane; pfam10646 717522008959 heavy metal sensor kinase; Region: cztS_silS_copS; TIGR01386 717522008960 Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225 717522008961 dimerization interface [polypeptide binding]; other site 717522008962 Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082 717522008963 dimer interface [polypeptide binding]; other site 717522008964 phosphorylation site [posttranslational modification] 717522008965 Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075 717522008966 ATP binding site [chemical binding]; other site 717522008967 Mg2+ binding site [ion binding]; other site 717522008968 G-X-G motif; other site 717522008969 Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745 717522008970 Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156 717522008971 active site 717522008972 phosphorylation site [posttranslational modification] 717522008973 intermolecular recognition site; other site 717522008974 dimerization interface [polypeptide binding]; other site 717522008975 Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383 717522008976 DNA binding site [nucleotide binding] 717522008977 Thymidylate kinase [Nucleotide transport and metabolism]; Region: Tmk; COG0125 717522008978 Thymidine monophosphate kinase (TMPK), also known as thymidylate kinase, catalyzes the phosphorylation of thymidine monophosphate (TMP) to thymidine diphosphate (TDP) utilizing ATP as its preferred phophoryl donor. TMPK represents the rate-limiting step...; Region: TMPK; cd01672 717522008979 TMP-binding site; other site 717522008980 ATP-binding site [chemical binding]; other site 717522008981 Adenosylhomocysteinase; Provisional; Region: PTZ00075 717522008982 S-Adenosylhomocysteine Hydrolase, NAD-binding and catalytic domains; Region: SAHH; cd00401 717522008983 homotetramer interface [polypeptide binding]; other site 717522008984 ligand binding site [chemical binding]; other site 717522008985 catalytic site [active] 717522008986 NAD binding site [chemical binding]; other site 717522008987 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522008988 probable dihydroxyacetone kinase regulator; Region: DHAK_reg; TIGR02366 717522008989 Rubredoxin [Energy production and conversion]; Region: COG1773 717522008990 Rubredoxin; nonheme iron binding domains containing a [Fe(SCys)4] center. Rubredoxins are small nonheme iron proteins. The iron atom is coordinated by four cysteine residues (Fe(S-Cys)4), but iron can also be replaced by cobalt, nickel or zinc. They are...; Region: rubredoxin; cd00730 717522008991 iron binding site [ion binding]; other site 717522008992 Rubredoxin [Energy production and conversion]; Region: COG1773 717522008993 Rubredoxin; nonheme iron binding domains containing a [Fe(SCys)4] center. Rubredoxins are small nonheme iron proteins. The iron atom is coordinated by four cysteine residues (Fe(S-Cys)4), but iron can also be replaced by cobalt, nickel or zinc. They are...; Region: rubredoxin; cd00730 717522008994 iron binding site [ion binding]; other site 717522008995 Alkane hydroxylase is a bacterial, integral-membrane di-iron enzyme that shares a requirement for iron and oxygen for activity similar to that of the non-heme integral-membrane acyl coenzyme A (CoA) desaturases and acyl lipid desaturases. The alk genes...; Region: Alkane-hydroxylase; cd03512 717522008996 Fatty acid desaturase; Region: FA_desaturase; pfam00487 717522008997 Di-iron ligands [ion binding]; other site 717522008998 amino acid transporter; Region: 2A0306; TIGR00909 717522008999 C-terminus of AA_permease; Region: AA_permease_C; pfam13906 717522009000 2-polyprenyl-6-methoxyphenol hydroxylase and related FAD-dependent oxidoreductases [Coenzyme metabolism / Energy production and conversion]; Region: UbiH; COG0654 717522009001 Phosphomannose isomerase [Carbohydrate transport and metabolism]; Region: ManA; COG1482 717522009002 Alpha-Mannosidase Binding Domain of Atg19/34; Region: ABD; cl15429 717522009003 Alpha-Mannosidase Binding Domain of Atg19/34; Region: ABD; cl15429 717522009004 The phosphomannomutase/phosphoglucomutase (PMM/PGM) bifunctional enzyme catalyzes the reversible conversion of 1-phospho to 6-phospho-sugars (e.g. between mannose-1-phosphate and mannose-6-phosphate or glucose-1-phosphate and glucose-6-phosphate) via a...; Region: PMM_PGM; cd03089 717522009005 phosphomannomutase/phosphoglucomutase; Reviewed; Region: manB; PRK09542 717522009006 active site 717522009007 substrate binding site [chemical binding]; other site 717522009008 metal binding site [ion binding]; metal-binding site 717522009009 Protein of unknown function (DUF3499); Region: DUF3499; pfam12005 717522009010 Minimal MMP-like domain found in a group of hypothetical proteins from alphaproteobacteria and actinobacteria; Region: MMP_TTHA0227_like_1; cd12954 717522009011 Transcription factor WhiB; Region: Whib; pfam02467 717522009012 Uncharacterized protein family UPF0052; Region: UPF0052; pfam01933 717522009013 LPPG:FO 2-phospho-L-lactate transferase; important in F420 biosynthesis; Region: CofD_like; cd07186 717522009014 phosphate binding site [ion binding]; other site 717522009015 dimer interface [polypeptide binding]; other site 717522009016 substrate binding site [chemical binding]; other site 717522009017 F420-0--gamma-glutamyl ligase; Provisional; Region: PRK13294 717522009018 F420-0:Gamma-glutamyl ligase; Region: F420_ligase; cl00644 717522009019 NAD(P)H:flavin oxidoreductase-like family 1. A subfamily of the nitroreductase family containing uncharacterized proteins that are similar to nitroreductase. Nitroreductase catalyzes the reduction of nitroaromatic compounds such as nitrotoluenes; Region: NADPH_oxidoreductase_1; cd02150 717522009020 putative FMN binding site [chemical binding]; other site 717522009021 Adenine-specific DNA methylase [DNA replication, recombination, and repair]; Region: COG0827 717522009022 Methyltransferase domain; Region: Methyltransf_26; pfam13659 717522009023 Nucleoside-diphosphate-sugar pyrophosphorylase involved in lipopolysaccharide biosynthesis/translation initiation factor 2B, gamma/epsilon subunits (eIF-2Bgamma/eIF-2Bepsilon) [Cell envelope biogenesis, outer membrane / Translation, ribosomal structure...; Region: GCD1; COG1208 717522009024 NTP_transferases catalyze the transfer of nucleotides onto phosphosugars; Region: NTP_transferase; cd04181 717522009025 active site 717522009026 Substrate binding site; other site 717522009027 Mg++ binding site; other site 717522009028 Left-handed parallel beta-Helix (LbetaH or LbH) domain: The alignment contains 5 turns, each containing three imperfect tandem repeats of a hexapeptide repeat motif (X-[STAV]-X-[LIV]-[GAED]-X). Proteins containing hexapeptide repeats are often enzymes...; Region: LbetaH; cl00160 717522009029 Subfamily of Glycosyltransferase Family GT2 of unknown function; Region: GT_2_like_c; cd04186 717522009030 Glycosyltransferase like family 2; Region: Glyco_tranf_2_3; pfam13641 717522009031 Probable Catalytic site; other site 717522009032 metal-binding site 717522009033 dTDP-4-dehydrorhamnose reductase; Region: rmlD; TIGR01214 717522009034 dTDP-6-deoxy-L-lyxo-4-hexulose reductase and related proteins, extended (e) SDRs; Region: dTDP_HR_like_SDR_e; cd05254 717522009035 NADP binding site [chemical binding]; other site 717522009036 active site 717522009037 putative substrate binding site [chemical binding]; other site 717522009038 Transcriptional regulator [Transcription]; Region: LytR; COG1316 717522009039 LytR cell envelope-related transcriptional attenuator; Region: LytR_C; pfam13399 717522009040 TIGR03089 family protein; Region: TIGR03089 717522009041 Protein of unknown function (DUF1490); Region: DUF1490; pfam07371 717522009042 Cation transport ATPase [Inorganic ion transport and metabolism]; Region: ZntA; COG2217 717522009043 E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122 717522009044 Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cl17915 717522009045 active site 717522009046 motif I; other site 717522009047 motif II; other site 717522009048 Predicted Co/Zn/Cd cation transporters [Inorganic ion transport and metabolism]; Region: MMT1; COG0053 717522009049 Predicted acyl-CoA transferases/carnitine dehydratase [Energy production and conversion]; Region: CaiB; COG1804 717522009050 CoA-transferase family III; Region: CoA_transf_3; pfam02515 717522009051 Sulfate permease and related transporters (MFS superfamily) [Inorganic ion transport and metabolism]; Region: SUL1; COG0659 717522009052 Sulfate transporter family; Region: Sulfate_transp; pfam00916 717522009053 Carbonic anhydrase [Inorganic ion transport and metabolism]; Region: CynT; COG0288 717522009054 active site clefts [active] 717522009055 zinc binding site [ion binding]; other site 717522009056 dimer interface [polypeptide binding]; other site 717522009057 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522009058 Short chain acyl-CoA dehydrogenases and eukaryotic short/branched chain acyl-CoA dehydrogenases; Region: SCAD_SBCAD; cd01158 717522009059 FAD binding site [chemical binding]; other site 717522009060 homotetramer interface [polypeptide binding]; other site 717522009061 substrate binding pocket [chemical binding]; other site 717522009062 catalytic base [active] 717522009063 Phosphoribosylcarboxyaminoimidazole (NCAIR) mutase [Nucleotide transport and metabolism]; Region: PurE; COG0041 717522009064 Phosphoribosylaminoimidazole carboxylase (NCAIR synthetase) [Nucleotide transport and metabolism]; Region: PurK; COG0026 717522009065 ATP-grasp domain; Region: ATP-grasp; pfam02222 717522009066 Predicted membrane protein [Function unknown]; Region: COG2246 717522009067 GtrA-like protein; Region: GtrA; pfam04138 717522009068 Bacterial PH domain; Region: DUF304; pfam03703 717522009069 Biotin-(acetyl-CoA carboxylase) ligase [Coenzyme metabolism]; Region: BirA; COG0340 717522009070 Biotin/lipoate A/B protein ligase family; Region: BPL_LplA_LipB; cl14057 717522009071 Biotin protein ligase C terminal domain; Region: BPL_C; pfam02237 717522009072 Acetyl-CoA carboxylase, carboxyltransferase component (subunits alpha and beta) [Lipid metabolism]; Region: COG4799 717522009073 malonate decarboxylase subunit beta; Reviewed; Region: PRK07189; cl17682 717522009074 Acetyl-CoA carboxylase alpha subunit [Lipid metabolism]; Region: AccA; cl17345 717522009075 Acyl-CoA carboxylase epsilon subunit; Region: ACC_epsilon; pfam13822 717522009076 Maf-like protein; Region: Maf; pfam02545 717522009077 Nucleotide binding protein Maf. Maf has been implicated in inhibition of septum formation in eukaryotes, bacteria and archaea, but homologs in B.subtilis and S.cerevisiae are nonessential for cell division. Maf has been predicted to be a nucleotide- or...; Region: Maf; cd00555 717522009078 active site 717522009079 dimer interface [polypeptide binding]; other site 717522009080 Rhodanese-related sulfurtransferase [Inorganic ion transport and metabolism]; Region: SseA; COG2897 717522009081 Thiosulfate sulfurtransferase (TST), N-terminal, inactive domain. TST contains 2 copies of the Rhodanese Homology Domain; this is the 1st repeat, which does not contain the catalytically active Cys residue. The role of the 1st repeat is uncertain, but it...; Region: TST_Repeat_1; cd01448 717522009082 active site residue [active] 717522009083 Thiosulfate sulfurtransferase (TST), C-terminal, catalytic domain. TST contains 2 copies of the Rhodanese Homology Domain; this is the second repeat. Only the second repeat contains the catalytically active Cys residue; Region: TST_Repeat_2; cd01449 717522009084 active site residue [active] 717522009085 Fe-S metabolism associated domain; Region: SufE; pfam02657 717522009086 Acetyl/propionyl-CoA carboxylase, alpha subunit [Lipid metabolism]; Region: COG4770 717522009087 Carbamoyl-phosphate synthase L chain, N-terminal domain; Region: CPSase_L_chain; pfam00289 717522009088 Carbamoyl-phosphate synthase L chain, ATP binding domain; Region: CPSase_L_D2; pfam02786 717522009089 Biotin carboxylase C-terminal domain; Region: Biotin_carb_C; smart00878 717522009090 The biotinyl-domain or biotin carboxyl carrier protein (BCCP) domain is present in all biotin-dependent enzymes, such as acetyl-CoA carboxylase, pyruvate carboxylase, propionyl-CoA carboxylase, methylcrotonyl-CoA carboxylase, geranyl-CoA carboxylase; Region: biotinyl_domain; cd06850 717522009091 carboxyltransferase (CT) interaction site; other site 717522009092 biotinylation site [posttranslational modification]; other site 717522009093 RNA polymerase sigma factor SigF; Reviewed; Region: PRK07122 717522009094 Sigma-70 region 2; Region: Sigma70_r2; pfam04542 717522009095 Sigma-70 region 3; Region: Sigma70_r3; pfam04539 717522009096 Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cl17257 717522009097 Anti-sigma regulatory factor (Ser/Thr protein kinase) [Signal transduction mechanisms]; Region: RsbW; COG2172 717522009098 L-lysine aminotransferase; Provisional; Region: PRK08297 717522009099 Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610 717522009100 inhibitor-cofactor binding pocket; inhibition site 717522009101 pyridoxal 5'-phosphate binding site [chemical binding]; other site 717522009102 catalytic residue [active] 717522009103 putative DNA binding site [nucleotide binding]; other site 717522009104 dimerization interface [polypeptide binding]; other site 717522009105 helix_turn_helix ASNC type; Region: HTH_ASNC; smart00344 717522009106 AsnC-type helix-turn-helix domain; Region: HTH_AsnC-type; pfam13404 717522009107 putative Zn2+ binding site [ion binding]; other site 717522009108 AsnC family; Region: AsnC_trans_reg; pfam01037 717522009109 Domain of unknown function (DUF1338); Region: DUF1338; pfam07063 717522009110 NAD+-dependent alpha-aminoadipic semialdehyde dehydrogenase, ALDH family members 7A1 and 7B; Region: ALDH_F7_AASADH; cd07130 717522009111 Aldehyde dehydrogenase family; Region: Aldedh; pfam00171 717522009112 tetrameric interface [polypeptide binding]; other site 717522009113 NAD binding site [chemical binding]; other site 717522009114 catalytic residues [active] 717522009115 Domain of unknown function (DUF4143); Region: DUF4143; pfam13635 717522009116 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522009117 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522009118 DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046 717522009119 putative ATP-dependent helicase Lhr; Provisional; Region: PRK09751 717522009120 ATP binding site [chemical binding]; other site 717522009121 putative Mg++ binding site [ion binding]; other site 717522009122 Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079 717522009123 nucleotide binding region [chemical binding]; other site 717522009124 ATP-binding site [chemical binding]; other site 717522009125 DEAD/H associated; Region: DEAD_assoc; pfam08494 717522009126 Formamidopyrimidine-DNA glycosylase [DNA replication, recombination, and repair]; Region: Nei; COG0266 717522009127 N-terminal domain of the actinomycetal Nei2 and related DNA glycosylases; Region: AcNei2_N; cd08971 717522009128 putative DNA binding site [nucleotide binding]; other site 717522009129 catalytic residue [active] 717522009130 putative H2TH interface [polypeptide binding]; other site 717522009131 putative catalytic residues [active] 717522009132 Formamidopyrimidine-DNA glycosylase H2TH domain; Region: H2TH; pfam06831 717522009133 Poly(3-hydroxybutyrate) depolymerase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: LpqC; COG3509 717522009134 Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326 717522009135 Arylsulfatase A and related enzymes [Inorganic ion transport and metabolism]; Region: AslA; COG3119 717522009136 Sulfatase; Region: Sulfatase; pfam00884 717522009137 Pseudouridine synthase, a subgroup of the RluA family; Region: PSRA_1; cd02558 717522009138 Pseudouridylate synthases, 23S RNA-specific [Translation, ribosomal structure and biogenesis]; Region: RluA; COG0564 717522009139 probable active site [active] 717522009140 phosphate transport system regulatory protein PhoU; Region: phoU_full; TIGR02135 717522009141 PhoU domain; Region: PhoU; pfam01895 717522009142 PhoU domain; Region: PhoU; pfam01895 717522009143 Glycerol-3-phosphate dehydrogenase [Energy production and conversion]; Region: GlpA; COG0578 717522009144 Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852 717522009145 AAA domain; Region: AAA_31; pfam13614 717522009146 ParA and ParB of Caulobacter crescentus belong to a conserved family of bacterial proteins implicated in chromosome segregation. ParB binds to DNA sequences adjacent to the origin of replication and localizes to opposite cell poles shortly following the...; Region: ParA; cd02042 717522009147 P-loop; other site 717522009148 Magnesium ion binding site [ion binding]; other site 717522009149 transport-energizing ATPase, TRC40/GET3/ArsA family; Region: GET3_arsA_TRC40; TIGR00345 717522009150 ParA and ParB of Caulobacter crescentus belong to a conserved family of bacterial proteins implicated in chromosome segregation. ParB binds to DNA sequences adjacent to the origin of replication and localizes to opposite cell poles shortly following the...; Region: ParA; cd02042 717522009151 Magnesium ion binding site [ion binding]; other site 717522009152 Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067 717522009153 catalytic core [active] 717522009154 Isochorismate synthase [Coenzyme metabolism / Secondary metabolites biosynthesis, transport, and catabolism]; Region: MenF; COG1169 717522009155 chorismate binding enzyme; Region: Chorismate_bind; pfam00425 717522009156 Sphingosine kinase and enzymes related to eukaryotic diacylglycerol kinase [Lipid metabolism / General function prediction only]; Region: LCB5; COG1597 717522009157 Diacylglycerol kinase catalytic domain; Region: DAGK_cat; pfam00781 717522009158 Transcription factor WhiB; Region: Whib; pfam02467 717522009159 Signal transduction histidine kinase; Region: H_kinase_N; pfam12282 717522009160 PAS domain S-box; Region: sensory_box; TIGR00229 717522009161 Signal transduction histidine kinase [Signal transduction mechanisms]; Region: COG3920 717522009162 Histidine kinase; Region: HisKA_2; pfam07568 717522009163 Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075 717522009164 ATP binding site [chemical binding]; other site 717522009165 Mg2+ binding site [ion binding]; other site 717522009166 G-X-G motif; other site 717522009167 The biotinyl-domain or biotin carboxyl carrier protein (BCCP) domain is present in all biotin-dependent enzymes, such as acetyl-CoA carboxylase, pyruvate carboxylase, propionyl-CoA carboxylase, methylcrotonyl-CoA carboxylase, geranyl-CoA carboxylase; Region: biotinyl_domain; cd06850 717522009168 carboxyltransferase (CT) interaction site; other site 717522009169 biotinylation site [posttranslational modification]; other site 717522009170 mycothiol system anti-sigma-R factor; Region: antisig_RsrA; TIGR03988 717522009171 RNA polymerase sigma-70 factor, TIGR02947 family; Region: SigH_actino 717522009172 Sigma-70 region 2; Region: Sigma70_r2; pfam04542 717522009173 Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171 717522009174 DNA binding residues [nucleotide binding] 717522009175 short chain dehydrogenase; Provisional; Region: PRK08278 717522009176 human hydroxysteroid dehydrogenase-like protein 2 (HSDL2), classical (c) SDRs; Region: HSDL2_SDR_c; cd09762 717522009177 NAD(P) binding site [chemical binding]; other site 717522009178 homodimer interface [polypeptide binding]; other site 717522009179 active site 717522009180 YbaK-like. The YbaK family of deacylase domains includes the INS amino acid-editing domain of the bacterial class II prolyl tRNA synthetase (ProRS), and it's trans-acting homologs, YbaK, ProX, and PrdX. The primary function of INS is to hydrolyze...; Region: YbaK_like; cl00022 717522009181 YbaK-like. The YbaK family of deacylase domains includes the INS amino acid-editing domain of the bacterial class II prolyl tRNA synthetase (ProRS), and it's trans-acting homologs, YbaK, ProX, and PrdX. The primary function of INS is to hydrolyze...; Region: YbaK_like; cl00022 717522009182 putative deacylase active site [active] 717522009183 Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302 717522009184 N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301 717522009185 Coenzyme A binding pocket [chemical binding]; other site 717522009186 Uncharacterized bacterial proteins with similarity to Aminoglycoside 3'-phosphotransferase (APH) and Choline kinase (ChoK) family members. The APH/ChoK subfamily is part of a larger superfamily that includes the catalytic domains of other kinases; Region: APH_ChoK_like_1; cd05155 717522009187 Phosphotransferase enzyme family; Region: APH; pfam01636 717522009188 putative active site [active] 717522009189 putative substrate binding site [chemical binding]; other site 717522009190 ATP binding site [chemical binding]; other site 717522009191 Uncharacterized conserved protein [Function unknown]; Region: COG2135 717522009192 3-phosphoshikimate 1-carboxyvinyltransferase; Provisional; Region: PRK02427 717522009193 EPSP synthase domain. 3-phosphoshikimate 1-carboxyvinyltransferase (5-enolpyruvylshikimate-3-phosphate synthase) (EC 2.5.1.19) catalyses the reaction between shikimate-3-phosphate (S3P) and phosphoenolpyruvate (PEP) to form...; Region: EPSP_synthase; cd01556 717522009194 hinge; other site 717522009195 active site 717522009196 Predicted GTPases [General function prediction only]; Region: COG1162 717522009197 Ribosomal interacting GTPase YjeQ/EngC, a circularly permuted subfamily of the Ras GTPases; Region: YjeQ_EngC; cd01854 717522009198 GTPase/Zn-binding domain interface [polypeptide binding]; other site 717522009199 GTP/Mg2+ binding site [chemical binding]; other site 717522009200 G4 box; other site 717522009201 G5 box; other site 717522009202 G1 box; other site 717522009203 Switch I region; other site 717522009204 G2 box; other site 717522009205 G3 box; other site 717522009206 Switch II region; other site 717522009207 Fatty acid desaturase [Lipid metabolism]; Region: DesA; COG3239 717522009208 The Delta6 Fatty Acid Desaturase (Delta6-FADS)-like CD includes the integral-membrane enzymes: delta-4, delta-5, delta-6, delta-8, delta-8-sphingolipid, and delta-11 desaturases found in vertebrates, higher plants, fungi, and bacteria. These desaturases...; Region: Delta6-FADS-like; cd03506 717522009209 putative di-iron ligands [ion binding]; other site 717522009210 Iron-sulfur binding ferredoxin reductase (FNR) proteins combine the FAD and NAD(P) binding regions of FNR with an iron-sulfur binding cluster domain. Ferredoxin-NADP+ (oxido)reductase is an FAD-containing enzyme that catalyzes the reversible electron...; Region: FNR_iron_sulfur_binding_2; cd06216 717522009211 Flavodoxin reductases (ferredoxin-NADPH reductases) family 1 [Energy production and conversion]; Region: Hmp; COG1018 717522009212 FAD binding pocket [chemical binding]; other site 717522009213 FAD binding motif [chemical binding]; other site 717522009214 phosphate binding motif [ion binding]; other site 717522009215 beta-alpha-beta structure motif; other site 717522009216 NAD binding pocket [chemical binding]; other site 717522009217 2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207 717522009218 Ferredoxin [Energy production and conversion]; Region: Fdx; COG0633 717522009219 catalytic loop [active] 717522009220 iron binding site [ion binding]; other site 717522009221 Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes. PLP combines with an alpha-amino acid to form a compound called a Schiff base or aldimine intermediate, which depending on the reaction, is the...; Region: AAT_I; cl00321 717522009222 putative DNA binding site [nucleotide binding]; other site 717522009223 dimerization interface [polypeptide binding]; other site 717522009224 helix_turn_helix ASNC type; Region: HTH_ASNC; smart00344 717522009225 AsnC-type helix-turn-helix domain; Region: HTH_AsnC-type; pfam13404 717522009226 putative Zn2+ binding site [ion binding]; other site 717522009227 AsnC family; Region: AsnC_trans_reg; pfam01037 717522009228 Domain of unknown function (DUF1338); Region: DUF1338; pfam07063 717522009229 NAD+-dependent alpha-aminoadipic semialdehyde dehydrogenase, ALDH family members 7A1 and 7B; Region: ALDH_F7_AASADH; cd07130 717522009230 Aldehyde dehydrogenase family; Region: Aldedh; pfam00171 717522009231 tetrameric interface [polypeptide binding]; other site 717522009232 NAD binding site [chemical binding]; other site 717522009233 catalytic residues [active] 717522009234 Domain of unknown function (DUF4143); Region: DUF4143; pfam13635 717522009235 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522009236 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522009237 DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046 717522009238 putative ATP-dependent helicase Lhr; Provisional; Region: PRK09751 717522009239 ATP binding site [chemical binding]; other site 717522009240 putative Mg++ binding site [ion binding]; other site 717522009241 Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079 717522009242 nucleotide binding region [chemical binding]; other site 717522009243 ATP-binding site [chemical binding]; other site 717522009244 DEAD/H associated; Region: DEAD_assoc; pfam08494 717522009245 Formamidopyrimidine-DNA glycosylase [DNA replication, recombination, and repair]; Region: Nei; COG0266 717522009246 N-terminal domain of the actinomycetal Nei2 and related DNA glycosylases; Region: AcNei2_N; cd08971 717522009247 putative DNA binding site [nucleotide binding]; other site 717522009248 catalytic residue [active] 717522009249 putative H2TH interface [polypeptide binding]; other site 717522009250 putative catalytic residues [active] 717522009251 Formamidopyrimidine-DNA glycosylase H2TH domain; Region: H2TH; pfam06831 717522009252 Poly(3-hydroxybutyrate) depolymerase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: LpqC; COG3509 717522009253 Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326 717522009254 Arylsulfatase A and related enzymes [Inorganic ion transport and metabolism]; Region: AslA; COG3119 717522009255 Sulfatase; Region: Sulfatase; pfam00884 717522009256 Pseudouridine synthase, a subgroup of the RluA family; Region: PSRA_1; cd02558 717522009257 Pseudouridylate synthases, 23S RNA-specific [Translation, ribosomal structure and biogenesis]; Region: RluA; COG0564 717522009258 probable active site [active] 717522009259 phosphate transport system regulatory protein PhoU; Region: phoU_full; TIGR02135 717522009260 PhoU domain; Region: PhoU; pfam01895 717522009261 PhoU domain; Region: PhoU; pfam01895 717522009262 Glycerol-3-phosphate dehydrogenase [Energy production and conversion]; Region: GlpA; COG0578 717522009263 flavoprotein disulfide reductase; Reviewed; Region: PRK07845 717522009264 Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070 717522009265 Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852 717522009266 GGCT-like domains, also called AIG2-like family. Gamma-glutamyl cyclotransferase (GGCT) catalyzes the formation of pyroglutamic acid (5-oxoproline) from dipeptides containing gamma-glutamyl, and is a dimeric protein. In Homo sapiens, the protein is...; Region: GGCT_like; cd06661 717522009267 putative active site pocket [active] 717522009268 dimerization interface [polypeptide binding]; other site 717522009269 putative catalytic residue [active] 717522009270 Metal-dependent amidase/aminoacylase/carboxypeptidase [General function prediction only]; Region: AbgB; COG1473 717522009271 M20 Peptidase Aminoacylase 1 subfamily; Region: M20_Acy1_like4; cd08014 717522009272 metal binding site [ion binding]; metal-binding site 717522009273 putative dimer interface [polypeptide binding]; other site 717522009274 M20 Peptidase Aminoacylase 1-like protein 2-like, amidohydrolase subfamily; Region: M20_ACY1L2_like; cd05672 717522009275 amidohydrolase; Region: amidohydrolases; TIGR01891 717522009276 metal binding site [ion binding]; metal-binding site 717522009277 purine nucleoside phosphorylase; Provisional; Region: PRK08202 717522009278 phosphoglucomutase-2-like protein; Provisional; Region: PTZ00150 717522009279 This CD includes PGM2 (phosphoglucomutase 2) and PGM2L1 (phosphoglucomutase 2-like 1). The mammalian PGM2 is thought to be a phosphopentomutase that catalyzes the conversion of the nucleoside breakdown products, ribose-1-phosphate and...; Region: PGM2; cd05799 717522009280 active site 717522009281 substrate binding site [chemical binding]; other site 717522009282 metal binding site [ion binding]; metal-binding site 717522009283 Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223 717522009284 active site 717522009285 Phosphoesterase family; Region: Phosphoesterase; pfam04185 717522009286 Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596 717522009287 Adenosine deaminase [Nucleotide transport and metabolism]; Region: Add; COG1816 717522009288 adenosine deaminase; Provisional; Region: PRK09358 717522009289 active site 717522009290 thymidine phosphorylase; Reviewed; Region: deoA; PRK05820 717522009291 Glycosyl transferase family, helical bundle domain; Region: Glycos_trans_3N; pfam02885 717522009292 Glycosyl transferase family, a/b domain; Region: Glycos_transf_3; pfam00591 717522009293 Pyrimidine nucleoside phosphorylase C-terminal domain; Region: PYNP_C; pfam07831 717522009294 Cytidine deaminase zinc-binding domain. These enzymes are Zn dependent. The zinc ion in the active site plays a central role in the proposed catalytic mechanism, activating a water molecule to form a hydroxide ion that performs a nucleophilic attack on...; Region: cytidine_deaminase; cd01283 717522009295 active site 717522009296 catalytic motif [active] 717522009297 Zn binding site [ion binding]; other site 717522009298 Succinate:quinone oxidoreductase (SQR) Type A subfamily, Succinate dehydrogenase C (SdhC)-like subunit; SQR catalyzes the oxidation of succinate to fumarate coupled to the reduction of quinone to quinol. Members of this subfamily reduce low potential...; Region: SQR_TypeA_SdhC_like; cd03501 717522009299 putative Iron-sulfur protein interface [polypeptide binding]; other site 717522009300 putative proximal heme binding site [chemical binding]; other site 717522009301 putative SdhD-like interface [polypeptide binding]; other site 717522009302 putative distal heme binding site [chemical binding]; other site 717522009303 Succinate:quinone oxidoreductase (SQR) Type A subfamily, Succinate dehydrogenase D (SdhD)-like subunit; SQR catalyzes the oxidation of succinate to fumarate coupled to the reduction of quinone to quinol. Members of this subfamily reduce low potential...; Region: SQR_TypeA_SdhD_like; cd03500 717522009304 putative Iron-sulfur protein interface [polypeptide binding]; other site 717522009305 putative proximal heme binding site [chemical binding]; other site 717522009306 putative SdhC-like subunit interface [polypeptide binding]; other site 717522009307 putative distal heme binding site [chemical binding]; other site 717522009308 succinate dehydrogenase flavoprotein subunit; Reviewed; Region: sdhA; PRK08205 717522009309 L-aspartate oxidase; Provisional; Region: PRK06175 717522009310 Fumarate reductase flavoprotein C-term; Region: Succ_DH_flav_C; pfam02910 717522009311 succinate dehydrogenase iron-sulfur subunit; Reviewed; Region: sdhB; PRK05950 717522009312 2Fe-2S iron-sulfur cluster binding domain; Region: Fer2_3; pfam13085 717522009313 Mycobacterium tuberculosis PIN domain family; Region: Mtu_PIN_fam; TIGR00028 717522009314 Ribbon-helix-helix protein, copG family; Region: RHH_1; pfam01402 717522009315 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522009316 S-adenosylmethionine binding site [chemical binding]; other site 717522009317 Ubiquitin domain of MoaD-like proteins; Region: MoaD; cd00754 717522009318 MoaE interaction surface [polypeptide binding]; other site 717522009319 MoeB interaction surface [polypeptide binding]; other site 717522009320 thiocarboxylated glycine; other site 717522009321 MoaE family. Members of this family are involved in biosynthesis of the molybdenum cofactor (Moco), an essential cofactor for a diverse group of redox enzymes. Moco biosynthesis is an evolutionarily conserved pathway present in eubacteria, archaea and...; Region: MoaE; cd00756 717522009322 MoaE homodimer interface [polypeptide binding]; other site 717522009323 MoaD interaction [polypeptide binding]; other site 717522009324 active site residues [active] 717522009325 MoaC family, prokaryotic and eukaryotic. Members of this family are involved in molybdenum cofactor (Moco) biosynthesis, an essential cofactor of a diverse group of redox enzymes. MoaC, a small hexameric protein, converts, together with MoaA, a guanosine...; Region: MoaC_PE; cd01420 717522009326 trimer interface [polypeptide binding]; other site 717522009327 dimer interface [polypeptide binding]; other site 717522009328 putative active site [active] 717522009329 PCD_DCoH: The bifunctional protein pterin-4alpha-carbinolamine dehydratase (PCD), also known as DCoH (dimerization cofactor of hepatocyte nuclear factor-1), is both a transcription activator and a metabolic enzyme. DCoH stimulates gene expression by...; Region: PCD_DCoH; cd00488 717522009330 aromatic arch; other site 717522009331 DCoH dimer interaction site [polypeptide binding]; other site 717522009332 DCoH /HNF-1 dimer interaction site [polypeptide binding]; other site 717522009333 DCoH tetramer interaction site [polypeptide binding]; other site 717522009334 substrate binding site [chemical binding]; other site 717522009335 RvD5 Region of difference RvD5, substituted region in Mycobacterium bovis BCG Pasteur, BCG Tokyo, BCG Mexico and Mycobacterium bovis AF2122/97 compared to Mycobacterium tuberculosis H37Rv2. In Mycobacterium bovis BCG Pasteur, BCG Tokyo, BCG Mexico and Mycobacterium bovis AF2122/97, this region encodes genes Equivalent to Mycobacterium tuberculosis strain CDC1551, MT3426-MT3429. In Mycobacterium tuberculosis strain H37Rv, insertion of an IS6110 element (encoding genes Rv3325 and Rv3326) removes genes MT3426-MT3429 717522009336 Molybdenum cofactor biosynthesis enzyme [Coenzyme metabolism]; Region: MoaA; COG2896 717522009337 Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335 717522009338 FeS/SAM binding site; other site 717522009339 Molybdenum Cofactor Synthesis C; Region: Mob_synth_C; pfam06463 717522009340 DNA-binding transcriptional activator of the SARP family [Signal transduction mechanisms]; Region: DnrI; COG3629 717522009341 Transcriptional regulatory protein, C terminal; Region: Trans_reg_C; pfam00486 717522009342 DNA binding site [nucleotide binding] 717522009343 Forkhead associated domain (FHA); found in eukaryotic and prokaryotic proteins. Putative nuclear signalling domain. FHA domains may bind phosphothreonine, phosphoserine and sometimes phosphotyrosine. In eukaryotes, many FHA domain-containing proteins...; Region: FHA; cd00060 717522009344 FOG: FHA domain [Signal transduction mechanisms]; Region: COG1716 717522009345 phosphopeptide binding site; other site 717522009346 Condensation domain; Region: Condensation; pfam00668 717522009347 Transposase; Region: DEDD_Tnp_IS110; pfam01548 717522009348 Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3547 717522009349 Transposase IS116/IS110/IS902 family; Region: Transposase_20; pfam02371 717522009350 Uncharacterized conserved protein [Function unknown]; Region: COG2128 717522009351 RNA polymerase sigma factor SigJ; Provisional; Region: PRK09636 717522009352 Sigma-70 region 2; Region: Sigma70_r2; pfam04542 717522009353 Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171 717522009354 DNA binding residues [nucleotide binding] 717522009355 SnoaL-like domain; Region: SnoaL_2; pfam12680 717522009356 hypothetical protein; Provisional; Region: PRK06541 717522009357 Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610 717522009358 inhibitor-cofactor binding pocket; inhibition site 717522009359 pyridoxal 5'-phosphate binding site [chemical binding]; other site 717522009360 catalytic residue [active] 717522009361 Beta-lactamase enzyme family; Region: Beta-lactamase2; cl17872 717522009362 D-alanyl-D-alanine carboxypeptidase; Region: Peptidase_S11; pfam00768 717522009363 Sugar (and other) transporter; Region: Sugar_tr; pfam00083 717522009364 The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174 717522009365 N-acetylglucosamine-6-phosphate deacetylase [Carbohydrate transport and metabolism]; Region: NagA; COG1820 717522009366 N-acetylglucosamine-6-phosphate deacetylase, NagA, catalyzes the hydrolysis of the N-acetyl group of N-acetyl-glucosamine-6-phosphate (GlcNAc-6-P) to glucosamine 6-phosphate and acetate. This is the first committed step in the biosynthetic pathway to...; Region: NagA; cd00854 717522009367 active site 717522009368 dimer interface [polypeptide binding]; other site 717522009369 Protein of unknown function (DUF732); Region: DUF732; pfam05305 717522009370 Helix-Turn-Helix DNA binding domain of Heavy Metal Resistance transcription regulators; Region: HTH_HMRTR; cd04770 717522009371 Predicted transcriptional regulators [Transcription]; Region: SoxR; COG0789 717522009372 DNA binding residues [nucleotide binding] 717522009373 dimer interface [polypeptide binding]; other site 717522009374 metal binding site [ion binding]; metal-binding site 717522009375 Virulence factor BrkB; Region: Virul_fac_BrkB; cl07918 717522009376 tryptophanyl-tRNA synthetase II; Reviewed; Region: PRK12282 717522009377 catalytic core domain of tryptophanyl-tRNA synthetase; Region: TrpRS_core; cd00806 717522009378 active site 717522009379 HIGH motif; other site 717522009380 dimer interface [polypeptide binding]; other site 717522009381 KMSKS motif; other site 717522009382 Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596 717522009383 isocitrate dehydrogenase; Validated; Region: PRK08299 717522009384 O-acetylhomoserine aminocarboxypropyltransferase; Validated; Region: PRK07812 717522009385 CGS_like: Cystathionine gamma-synthase is a PLP dependent enzyme and catalyzes the committed step of methionine biosynthesis. This pathway is unique to microorganisms and plants, rendering the enzyme an attractive target for the development of...; Region: CGS_like; cd00614 717522009386 homodimer interface [polypeptide binding]; other site 717522009387 substrate-cofactor binding pocket; other site 717522009388 pyridoxal 5'-phosphate binding site [chemical binding]; other site 717522009389 catalytic residue [active] 717522009390 homoserine O-acetyltransferase; Provisional; Region: metX; PRK00175 717522009391 homoserine O-acetyltransferase; Region: homoserO_Ac_trn; TIGR01392 717522009392 Methyltransferase domain; Region: Methyltransf_23; pfam13489 717522009393 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522009394 S-adenosylmethionine binding site [chemical binding]; other site 717522009395 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522009396 PPE family; Region: PPE; pfam00823 717522009397 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522009398 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522009399 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522009400 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522009401 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522009402 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522009403 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522009404 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522009405 RD19 Region of difference RD19, deleted region in Mycobacterium bovis BCG Pasteur, BCG Tokyo, BCG Mexico and Mycobacterium bovis AF2122/97 compared to Mycobacterium tuberculosis H37Rv. Internal in-frame deletion of PPE54, Rv3343c 717522009406 PE family; Region: PE; pfam00934 717522009407 Protein of unknown function (DUF3017); Region: DUF3017; pfam11222 717522009409 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522009410 PPE family; Region: PPE; pfam00823 717522009411 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522009412 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522009413 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522009414 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522009415 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522009416 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522009417 Transposase; Region: DEDD_Tnp_IS110; pfam01548 717522009418 Transposase; Region: DDE_Tnp_ISL3; pfam01610 717522009421 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522009422 PPE family; Region: PPE; pfam00823 717522009423 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522009424 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522009425 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522009426 Berberine and berberine like; Region: BBE; pfam08031 717522009427 FAD/FMN-containing dehydrogenases [Energy production and conversion]; Region: GlcD; COG0277 717522009428 Protein of unknown function (DUF732); Region: DUF732; pfam05305 717522009429 Protein of unknown function (DUF3017); Region: DUF3017; pfam11222 717522009430 bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase; Provisional; Region: PRK14193 717522009431 Tetrahydrofolate dehydrogenase/cyclohydrolase, catalytic domain; Region: THF_DHG_CYH; pfam00763 717522009432 NADP binding domain of methylene-tetrahydrofolate dehydrogenase/cyclohydrolase; Region: NAD_bind_m-THF_DH_Cyclohyd; cd01080 717522009433 homodimer interface [polypeptide binding]; other site 717522009434 NADP binding site [chemical binding]; other site 717522009435 substrate binding site [chemical binding]; other site 717522009436 Antitoxin of toxin-antitoxin stability system [Cell division and chromosome partitioning]; Region: StbD; COG2161 717522009437 Plasmid encoded toxin Txe; Region: Plasmid_Txe; pfam06769 717522009438 NADH:flavin oxidoreductases, Old Yellow Enzyme family [Energy production and conversion]; Region: NemA; COG1902 717522009439 Old yellow enzyme (OYE)-like FMN binding domain. OYE was the first flavin-dependent enzyme identified, however its true physiological role remains elusive to this day. Each monomer of OYE contains FMN as a non-covalently bound cofactor, uses NADPH as a...; Region: OYE_like_FMN_family; cd02803 717522009440 active site 717522009441 FMN binding site [chemical binding]; other site 717522009442 substrate binding site [chemical binding]; other site 717522009443 putative catalytic residue [active] 717522009444 TIM barrel proteins share a structurally conserved phosphate binding motif and in general share an eight beta/alpha closed barrel structure. Specific for this family is the conserved phosphate binding site at the edges of strands 7 and 8. The phosphate...; Region: TIM_phosphate_binding; cl17186 717522009445 phosphate binding site [ion binding]; other site 717522009446 FOG: FHA domain [Signal transduction mechanisms]; Region: COG1716 717522009447 Forkhead associated domain (FHA); found in eukaryotic and prokaryotic proteins. Putative nuclear signalling domain. FHA domains may bind phosphothreonine, phosphoserine and sometimes phosphotyrosine. In eukaryotes, many FHA domain-containing proteins...; Region: FHA; cd00060 717522009448 phosphopeptide binding site; other site 717522009449 Pentapeptide repeats (9 copies); Region: Pentapeptide_4; pfam13599 717522009450 Pentapeptide repeats (8 copies); Region: Pentapeptide; pfam00805 717522009451 Pentapeptide repeats (9 copies); Region: Pentapeptide_4; pfam13599 717522009452 Pentapeptide repeats (8 copies); Region: Pentapeptide; pfam00805 717522009453 Rat sarcoma (Ras)-like superfamily of small guanosine triphosphatases (GTPases); Region: Ras_like_GTPase; cd00882 717522009454 Conserved hypothetical ATP binding protein; Region: ATP_bind_1; pfam03029 717522009455 G1 box; other site 717522009456 GTP/Mg2+ binding site [chemical binding]; other site 717522009457 G2 box; other site 717522009458 Switch I region; other site 717522009459 G3 box; other site 717522009460 Switch II region; other site 717522009461 G4 box; other site 717522009462 G5 box; other site 717522009463 Protein of unknown function (DUF742); Region: DUF742; pfam05331 717522009464 Uncharacterized distant relative of homeotic protein bithoraxoid [General function prediction only]; Region: COG2018 717522009465 Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642 717522009466 Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075 717522009467 ATP binding site [chemical binding]; other site 717522009468 Mg2+ binding site [ion binding]; other site 717522009469 G-X-G motif; other site 717522009470 Predicted rRNA methylase (SpoU class) [Translation, ribosomal structure and biogenesis]; Region: CspR; COG0219 717522009471 PE family; Region: PE; pfam00934 717522009472 Proteins of this family catalyze the reduction of flavin or nitrocompounds using NAD(P)H as electron donor in a obligatory two-electron transfer, utilizing FMN or FAD as cofactor. They are often found to be homodimers. Enzymes of this family are...; Region: Nitro_FMN_reductase; cd02062 717522009473 FMN binding site [chemical binding]; other site 717522009474 dimer interface [polypeptide binding]; other site 717522009475 Pyridoxine 5'-phosphate (PNP) oxidase-like proteins; Region: PNPOx_like; cl00381 717522009476 error-prone DNA polymerase; Validated; Region: dnaE2; PRK05672 717522009477 Polymerase and Histidinol Phosphatase domain; Region: PHP; cl17102 717522009478 active site 717522009479 DnaE_OBF: A subfamily of OB folds corresponding to the C-terminal OB-fold nucleic acid binding domain of Thermus aquaticus and Escherichia coli type C replicative DNA polymerase III alpha subunit (DnaE). The DNA polymerase holoenzyme of E. coli contains...; Region: DnaE_OBF; cd04485 717522009480 generic binding surface II; other site 717522009481 generic binding surface I; other site 717522009482 acyltransferase, WS/DGAT/MGAT; Region: acyl_WS_DGAT; TIGR02946 717522009483 Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007 717522009484 Predicted phosphatase/phosphohexomutase [General function prediction only]; Region: COG0637 717522009485 Trehalose-6-phosphatase [Carbohydrate transport and metabolism]; Region: OtsB; COG1877 717522009486 Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427 717522009487 active site 717522009488 motif I; other site 717522009489 motif II; other site 717522009490 3-hydroxybutyryl-CoA dehydratase; Validated; Region: PRK05809 717522009491 Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558 717522009492 substrate binding site [chemical binding]; other site 717522009493 oxyanion hole (OAH) forming residues; other site 717522009494 trimer interface [polypeptide binding]; other site 717522009495 Asp-tRNAAsn/Glu-tRNAGln amidotransferase A subunit and related amidases [Translation, ribosomal structure and biogenesis]; Region: GatA; COG0154 717522009496 Amidase; Region: Amidase; pfam01425 717522009497 Predicted hydrolase (HAD superfamily) [General function prediction only]; Region: COG1011 717522009498 Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427 717522009499 motif II; other site 717522009500 This group contains class II terpene cyclases, protein prenyltransferases beta subunit, two broadly specific proteinase inhibitors alpha2-macroglobulin (alpha (2)-M) and pregnancy zone protein (PZP) and, the C3 C4 and C5 components of vertebrate...; Region: ISOPREN_C2_like; cl08267 717522009501 This group contains class II terpene cyclases, protein prenyltransferases beta subunit, two broadly specific proteinase inhibitors alpha2-macroglobulin (alpha (2)-M) and pregnancy zone protein (PZP) and, the C3 C4 and C5 components of vertebrate...; Region: ISOPREN_C2_like; cd00688 717522009502 Thiamine pyrophosphate (TPP) enzyme family, TPP-binding module; found in many key metabolic enzymes which use TPP (also known as thiamine diphosphate) as a cofactor. These enzymes include, among others, the E1 components of the pyruvate, the acetoin and...; Region: TPP_enzymes; cl01629 717522009503 TPP-binding site [chemical binding]; other site 717522009504 Transketolase, C-terminal subunit [Carbohydrate transport and metabolism]; Region: COG3958 717522009505 Pyrimidine (PYR) binding domain of 1-deoxy-D-xylulose-5-phosphate synthase (DXS), transketolase (TK), and related proteins; Region: TPP_PYR_DXS_TK_like; cd07033 717522009506 PYR/PP interface [polypeptide binding]; other site 717522009507 dimer interface [polypeptide binding]; other site 717522009508 TPP binding site [chemical binding]; other site 717522009509 Transketolase, C-terminal domain; Region: Transketolase_C; pfam02780 717522009510 4-Hydroxy-3-methylbut-2-enyl diphosphate reductase IspH [Lipid metabolism]; Region: lytB; COG0761 717522009511 4-hydroxy-3-methylbut-2-enyl diphosphate reductase; Reviewed; Region: ispH; PRK01045 717522009512 Geranylgeranyl pyrophosphate synthase [Coenzyme metabolism]; Region: IspA; COG0142 717522009513 Trans-Isoprenyl Diphosphate Synthases, head-to-tail; Region: Trans_IPPS_HT; cd00685 717522009514 substrate binding pocket [chemical binding]; other site 717522009515 chain length determination region; other site 717522009516 substrate-Mg2+ binding site; other site 717522009517 catalytic residues [active] 717522009518 aspartate-rich region 1; other site 717522009519 active site lid residues [active] 717522009520 aspartate-rich region 2; other site 717522009521 PIN domain of the hypothetical protein MT3492 of Mycobacterium tuberculosis CDC1551 and other uncharacterized, annotated PilT protein domain proteins; Region: PIN_MT3492; cd09874 717522009522 putative active site [active] 717522009523 Antitoxin of toxin-antitoxin stability system [Cell division and chromosome partitioning]; Region: Phd; COG4118 717522009524 Transposase and inactivated derivatives, IS5 family [DNA replication, recombination, and repair]; Region: COG3039 717522009525 Transposase domain (DUF772); Region: DUF772; pfam05598 717522009526 Transposase and inactivated derivatives, IS5 family [DNA replication, recombination, and repair]; Region: COG3039 717522009527 Transposase DDE domain; Region: DDE_Tnp_1_6; pfam13751 717522009528 PE family; Region: PE; pfam00934 717522009529 enoyl-CoA hydratase; Region: PLN02864 717522009530 The hotdog fold was initially identified in the E. coli FabA (beta-hydroxydecanoyl-acyl carrier protein (ACP)-dehydratase) structure and subsequently in 4HBT (4-hydroxybenzoyl-CoA thioesterase) from Pseudomonas. A number of other seemingly unrelated...; Region: hot_dog; cl00509 717522009531 HDE_HSD The R-hydratase-like hot dog fold of the 17-beta-hydroxysteriod dehydrogenase (HSD), and Hydratase-Dehydrogenase-Epimerase (HDE) proteins. Other enzymes with this fold include MaoC dehydratase, and the fatty acid synthase beta subunit; Region: HDE_HSD; cd03448 717522009532 dimer interaction site [polypeptide binding]; other site 717522009533 substrate-binding tunnel; other site 717522009534 active site 717522009535 catalytic site [active] 717522009536 substrate binding site [chemical binding]; other site 717522009537 Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067 717522009538 short chain dehydrogenase; Provisional; Region: PRK07201 717522009539 Pseudomonas fluorescens MupV-like, extended (e) SDRs; Region: MupV_like_SDR_e; cd05263 717522009540 putative NAD(P) binding site [chemical binding]; other site 717522009541 active site 717522009542 putative substrate binding site [chemical binding]; other site 717522009543 classical (c) SDRs; Region: SDR_c; cd05233 717522009544 NAD(P) binding site [chemical binding]; other site 717522009545 active site 717522009546 Mycolic acid cyclopropane synthetase; Region: CMAS; pfam02353 717522009547 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522009548 S-adenosylmethionine binding site [chemical binding]; other site 717522009549 NH_3: A subgroup of nucleoside hydrolases. This group contains eukaryotic and bacterial proteins similar to nucleoside hydrolases. Nucleoside hydrolases cleave the N-glycosidic bond in nucleosides generating ribose and the respective base. These enzymes...; Region: nuc_hydro_3; cd02653 717522009550 active site 717522009551 DNA Polymerase Y-family; Region: PolY_like; cd03468 717522009552 DNA binding site [nucleotide binding] 717522009553 GMP synthase; Reviewed; Region: guaA; PRK00074 717522009554 Type 1 glutamine amidotransferase (GATase1) domain found in GMP synthetase; Region: GATase1_GMP_Synthase; cd01742 717522009555 AMP/PPi binding site [chemical binding]; other site 717522009556 candidate oxyanion hole; other site 717522009557 catalytic triad [active] 717522009558 potential glutamine specificity residues [chemical binding]; other site 717522009559 The C-terminal domain of GMP synthetase. It contains two subdomains; the ATP pyrophosphatase domain which closes to the N-termial and the dimerization domain at C-terminal end. The ATP-PPase is a twisted, five-stranded parallel beta-sheet sandwiched...; Region: GMP_synthase_C; cd01997 717522009560 ATP Binding subdomain [chemical binding]; other site 717522009561 Ligand Binding sites [chemical binding]; other site 717522009562 Dimerization subdomain; other site 717522009563 Trans-Isoprenyl Diphosphate Synthases, head-to-head; Region: Trans_IPPS_HH; cd00683 717522009564 active site lid residues [active] 717522009565 substrate binding pocket [chemical binding]; other site 717522009566 catalytic residues [active] 717522009567 substrate-Mg2+ binding site; other site 717522009568 aspartate-rich region 1; other site 717522009569 aspartate-rich region 2; other site 717522009570 Geranylgeranyl pyrophosphate synthase [Coenzyme metabolism]; Region: IspA; COG0142 717522009571 Trans-Isoprenyl Diphosphate Synthases, head-to-tail; Region: Trans_IPPS_HT; cd00685 717522009572 substrate binding pocket [chemical binding]; other site 717522009573 chain length determination region; other site 717522009574 substrate-Mg2+ binding site; other site 717522009575 catalytic residues [active] 717522009576 aspartate-rich region 1; other site 717522009577 active site lid residues [active] 717522009578 aspartate-rich region 2; other site 717522009579 O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315 717522009580 methyltransferase, TIGR00027 family; Region: mthyl_TIGR00027 717522009581 beta-phosphoglucomutase family hydrolase; Region: PGMB-YQAB-SF; TIGR02009 717522009582 HAD-hyrolase-like; Region: Hydrolase_like; pfam13242 717522009583 Trehalose and maltose hydrolases (possible phosphorylases) [Carbohydrate transport and metabolism]; Region: ATH1; COG1554 717522009584 Glycosyl hydrolase family 65, N-terminal domain; Region: Glyco_hydro_65N; pfam03636 717522009585 Glycosyl hydrolase family 65 central catalytic domain; Region: Glyco_hydro_65m; pfam03632 717522009586 Glycosyl hydrolase family 65, C-terminal domain; Region: Glyco_hydro_65C; pfam03633 717522009587 Predicted pyridoxal phosphate-dependent enzyme apparently involved in regulation of cell wall biogenesis [Cell envelope biogenesis, outer membrane]; Region: WecE; COG0399 717522009588 Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes. PLP combines with an alpha-amino acid to form a compound called a Schiff base or aldimine intermediate, which depending on the reaction, is the...; Region: AAT_I; cl00321 717522009589 pyridoxal 5'-phosphate binding pocket [chemical binding]; other site 717522009590 catalytic residue [active] 717522009591 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4529 717522009592 NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500 717522009593 hypothetical protein; Provisional; Region: PRK07579 717522009594 Formyltransferase, catalytic core domain; Region: FMT_core; cd08369 717522009595 active site 717522009596 cosubstrate binding site; other site 717522009597 substrate binding site [chemical binding]; other site 717522009598 catalytic site [active] 717522009599 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522009600 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522009601 Probable taurine catabolism dioxygenase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: TauD; COG2175 717522009602 Clavaminic acid synthetase (CAS) -like; CAS is a trifunctional Fe(II)/ 2-oxoglutarate (2OG) oxygenase carrying out three reactions in the biosynthesis of clavulanic acid, an inhibitor of class A serine beta-lactamases. In general, Fe(II)-2OG oxygenases...; Region: CAS_like; cl00184 717522009603 Antitoxin of toxin-antitoxin stability system [Cell division and chromosome partitioning]; Region: Phd; COG4118 717522009604 PIN domain of the hypothetical protein MT3492 of Mycobacterium tuberculosis CDC1551 and other uncharacterized, annotated PilT protein domain proteins; Region: PIN_MT3492; cd09874 717522009605 putative active site [active] 717522009606 Choline dehydrogenase and related flavoproteins [Amino acid transport and metabolism]; Region: BetA; COG2303 717522009607 NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450 717522009608 GMC oxidoreductase; Region: GMC_oxred_C; pfam05199 717522009609 inosine 5-monophosphate dehydrogenase; Validated; Region: PRK08649 717522009610 TIM barrel proteins share a structurally conserved phosphate binding motif and in general share an eight beta/alpha closed barrel structure. Specific for this family is the conserved phosphate binding site at the edges of strands 7 and 8. The phosphate...; Region: TIM_phosphate_binding; cl17186 717522009611 phosphate binding site [ion binding]; other site 717522009612 inosine 5'-monophosphate dehydrogenase; Reviewed; Region: PRK05567 717522009613 TIM barrel proteins share a structurally conserved phosphate binding motif and in general share an eight beta/alpha closed barrel structure. Specific for this family is the conserved phosphate binding site at the edges of strands 7 and 8. The phosphate...; Region: TIM_phosphate_binding; cl17186 717522009614 This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains in the inosine 5' monophosphate dehydrogenase (IMPDH) protein. IMPDH is an essential enzyme that catalyzes the first step unique to GTP synthesis, playing a...; Region: CBS_pair_IMPDH; cd04601 717522009615 IMPDH: The catalytic domain of the inosine monophosphate dehydrogenase. IMPDH catalyzes the NAD-dependent oxidation of inosine 5'-monophosphate (IMP) to xanthosine 5' monophosphate (XMP). It is a rate-limiting step in the de novo synthesis of...; Region: IMPDH; cd00381 717522009616 active site 717522009617 RNA polymerase sigma factor SigD; Reviewed; Region: PRK09648 717522009618 Sigma-70 region 2; Region: Sigma70_r2; pfam04542 717522009619 Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171 717522009620 DNA binding residues [nucleotide binding] 717522009621 Transcription factor WhiB; Region: Whib; pfam02467 717522009622 chaperonin GroEL; Reviewed; Region: groEL; PRK12849 717522009623 GroEL_like type I chaperonin. Chaperonins are involved in productive folding of proteins. They share a common general morphology, a double toroid of 2 stacked rings, each composed of 7-9 subunits. The symmetry of type I is seven-fold and they are found...; Region: GroEL; cd03344 717522009624 ring oligomerisation interface [polypeptide binding]; other site 717522009625 ATP/Mg binding site [chemical binding]; other site 717522009626 stacking interactions; other site 717522009627 hinge regions; other site 717522009628 Chaperonin 10 Kd subunit (cpn10 or GroES); Cpn10 cooperates with chaperonin 60 (cpn60 or GroEL), an ATPase, to assist the folding and assembly of proteins and is found in eubacterial cytosol, as well as in the matrix of mitochondria and chloroplasts. It...; Region: cpn10; cd00320 717522009629 oligomerisation interface [polypeptide binding]; other site 717522009630 mobile loop; other site 717522009631 roof hairpin; other site 717522009632 UGMP family protein; Validated; Region: PRK09604 717522009633 ribosomal-protein-alanine acetyltransferase; Region: rimI; TIGR01575 717522009634 Acetyltransferase (GNAT) family; Region: Acetyltransf_1; pfam00583 717522009635 Coenzyme A binding pocket [chemical binding]; other site 717522009636 Inactive homolog of metal-dependent proteases, putative molecular chaperone [Posttranslational modification, protein turnover, chaperones]; Region: COG1214 717522009637 Uncharacterized P-loop hydrolase UPF0079; Region: UPF0079; pfam02367 717522009638 alanine racemase; Reviewed; Region: alr; PRK00053 717522009639 Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzyme Alanine Racemase; Region: PLPDE_III_AR; cd00430 717522009640 active site 717522009641 pyridoxal 5'-phosphate (PLP) binding site [chemical binding]; other site 717522009642 dimer interface [polypeptide binding]; other site 717522009643 substrate binding site [chemical binding]; other site 717522009644 catalytic residues [active] 717522009645 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522009646 PPE family; Region: PPE; pfam00823 717522009647 In Mycobacterium bovis BCG Pasteur, BCG Tokyo, BCG Mexico and Mycobacterium bovis, a large deletion of 4926 bp (RD6) leads to the loss of the COOH part of PPE57, and the following CDSs, PPE58, Rv3427c, Rv3428c and the NH2-part of PPE59 compared to Mycobacterium tuberculosis strain H37Rv 717522009648 Integrase core domain; Region: rve; pfam00665 717522009649 Integrase core domain; Region: rve_3; pfam13683 717522009650 Transposase, Mutator family; Region: Transposase_mut; pfam00872 717522009651 MULE transposase domain; Region: MULE; pfam10551 717522009652 DOPA decarboxylase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to DOPA/tyrosine decarboxylase (DDC), histidine decarboxylase (HDC), and...; Region: DOPA_deC_like; cd06450 717522009653 pyridoxal 5'-phosphate binding site [chemical binding]; other site 717522009654 catalytic residue [active] 717522009655 Uncharacterized conserved protein [Function unknown]; Region: COG0062 717522009656 B.subtilis YXKO protein of unknown function and related proteins. Based on the conservation of the ATP binding site, the substrate binding site and the Mg2+binding site and structural homology this group is a member of the ribokinase-like superfamily; Region: YXKO-related; cd01171 717522009657 putative substrate binding site [chemical binding]; other site 717522009658 putative ATP binding site [chemical binding]; other site 717522009659 glucosamine--fructose-6-phosphate aminotransferase; Reviewed; Region: PRK00331 717522009660 Glutamine amidotransferases class-II (Gn-AT)_GFAT-type. This domain is found at the N-terminus of glucosamine-6P synthase (GlmS, or GFAT in humans). The glutaminase domain catalyzes amide nitrogen transfer from glutamine to the appropriate substrate. In...; Region: GFAT; cd00714 717522009661 glutaminase active site [active] 717522009662 SIS (Sugar ISomerase) domain repeat 1 found in Glucosamine 6-phosphate synthase (GlmS) and Glucosamine-6-phosphate deaminase (GlmD). The SIS domain is found in many phosphosugar isomerases and phosphosugar binding proteins. GlmS contains a N-terminal...; Region: SIS_GlmS_GlmD_1; cd05008 717522009663 dimer interface [polypeptide binding]; other site 717522009664 active site 717522009665 SIS (Sugar ISomerase) domain repeat 2 found in Glucosamine 6-phosphate synthase (GlmS) and Glucosamine-6-phosphate deaminase (GlmD). The SIS domain is found in many phosphosugar isomerases and phosphosugar binding proteins. GlmS contains a N-terminal...; Region: SIS_GlmS_GlmD_2; cd05009 717522009666 dimer interface [polypeptide binding]; other site 717522009667 active site 717522009668 Protein of unknown function (DUF2510); Region: DUF2510; pfam10708 717522009669 phosphoglucosamine mutase; Provisional; Region: glmM; PRK14318 717522009670 GlmM is a bacterial phosphoglucosamine mutase (PNGM) that belongs to the alpha-D-phosphohexomutase superfamily. It is required for the interconversion of glucosamine-6-phosphate and glucosamine-1-phosphate in the biosynthetic pathway of...; Region: GlmM; cd05802 717522009671 active site 717522009672 substrate binding site [chemical binding]; other site 717522009673 metal binding site [ion binding]; metal-binding site 717522009674 30S ribosomal protein S9; Reviewed; Region: rpsI; PRK00132 717522009675 Ribosomal protein L13. Protein L13, a large ribosomal subunit protein, is one of five proteins required for an early folding intermediate of 23S rRNA in the assembly of the large subunit. L13 is situated on the bottom of the large subunit, near the...; Region: Ribosomal_L13; cd00392 717522009676 23S rRNA interface [nucleotide binding]; other site 717522009677 L3 interface [polypeptide binding]; other site 717522009678 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4842 717522009679 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4842 717522009680 type VII secretion-associated protein, Rv3446c family, C-terminal domain; Region: T7SS_Rv3446c; TIGR03931 717522009681 type VII secretion protein EccCa; Region: T7SS_EccC_a; TIGR03924 717522009682 FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580 717522009683 type VII secretion protein EccCb; Region: T7SS_EccC_b; TIGR03925 717522009684 FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580 717522009685 FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580 717522009686 type VII secretion integral membrane protein EccD; Region: T7SS_EccD; TIGR03920 717522009687 type VII secretion-associated serine protease mycosin; Region: T7SS_mycosin; TIGR03921 717522009688 Peptidase domain in the S8 and S53 families; Region: Peptidases_S8_S53; cl10459 717522009689 active site 717522009690 catalytic residues [active] 717522009691 Protein of unknown function (DUF690); Region: DUF690; pfam05108 717522009692 Cutinase; Region: Cutinase; pfam01083 717522009693 Cutinase; Region: Cutinase; pfam01083 717522009694 Solute carrier families 5 and 6-like; solute binding domain; Region: SLC5-6-like_sbd; cl00456 717522009695 Eukaryotic and bacterial pseudouridine synthases similar to E. coli TruA; Region: PseudoU_synth_EcTruA; cd02570 717522009696 tRNA pseudouridine synthase A; Validated; Region: truA; PRK00021 717522009697 active site 717522009698 dimerization interface 3.5A [polypeptide binding]; other site 717522009699 50S ribosomal protein L17; Validated; Region: rplQ; PRK05591 717522009700 DNA-directed RNA polymerase subunit alpha; Provisional; Region: PRK05182 717522009701 N-terminal domain of the Alpha subunit of Bacterial RNA polymerase; Region: RNAP_alpha_NTD; cd06928 717522009702 alphaNTD - beta interaction site [polypeptide binding]; other site 717522009703 alphaNTD homodimer interface [polypeptide binding]; other site 717522009704 alphaNTD - beta' interaction site [polypeptide binding]; other site 717522009705 Bacterial RNA polymerase, alpha chain C terminal domain; Region: RNA_pol_A_CTD; pfam03118 717522009706 30S ribosomal protein S4; Validated; Region: rpsD; PRK05327 717522009707 Ribosomal protein S4/S9 N-terminal domain; Region: Ribosomal_S4; pfam00163 717522009708 S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site; Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165 717522009709 RNA binding surface [nucleotide binding]; other site 717522009710 30S ribosomal protein S11; Validated; Region: PRK05309 717522009711 30S ribosomal protein S13; Validated; Region: rpsM; PRK05179 717522009712 30S ribosomal protein S13; Region: bact_S13; TIGR03631 717522009713 50S ribosomal protein L36; Reviewed; Region: rpmJ; PRK00465 717522009714 S1_IF1: Translation Initiation Factor IF1, S1-like RNA-binding domain. IF1 contains an S1-like RNA-binding domain, which is found in a wide variety of RNA-associated proteins. Translation initiation includes a number of interrelated steps preceding the...; Region: S1_IF1; cd04451 717522009715 rRNA binding site [nucleotide binding]; other site 717522009716 predicted 30S ribosome binding site; other site 717522009717 probable F420-dependent oxidoreductase, MSMEG_4141 family; Region: F420_MSMEG_4141; TIGR03620 717522009718 F420-dependent oxidoreductase, MSMEG_4879 family; Region: F420_MSMEG_4879; TIGR03564 717522009719 dTDP-D-glucose 4,6-dehydratase [Cell envelope biogenesis, outer membrane]; Region: RfbB; COG1088 717522009720 dTDP-D-glucose 4,6-dehydratase, extended (e) SDRs; Region: dTDP_GD_SDR_e; cd05246 717522009721 NAD binding site [chemical binding]; other site 717522009722 substrate binding site [chemical binding]; other site 717522009723 homodimer interface [polypeptide binding]; other site 717522009724 active site 717522009725 dTDP-4-dehydrorhamnose 3,5-epimerase; Region: dTDP_sugar_isom; pfam00908 717522009726 Domain of unknown function (DUF222); Region: DUF222; pfam02720 717522009727 Domain of unknown function (DUF222); Region: DUF222; pfam02720 717522009728 HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085 717522009729 active site 717522009730 Nucleoside-diphosphate-sugar epimerases [Cell envelope biogenesis, outer membrane / Carbohydrate transport and metabolism]; Region: WcaG; COG0451 717522009731 extended (e) SDRs; Region: SDR_e; cd08946 717522009732 NAD(P) binding site [chemical binding]; other site 717522009733 active site 717522009734 4-hyroxy-2-oxovalerate/4-hydroxy-2-oxopentanoic acid aldolase,; Validated; Region: PRK08195 717522009735 DRE-TIM metallolyase superfamily; Region: DRE_TIM_metallolyase; cl07974 717522009736 active site 717522009737 catalytic residues [active] 717522009738 metal binding site [ion binding]; metal-binding site 717522009739 Thiamine pyrophosphate-requiring enzymes [acetolactate synthase, pyruvate dehydrogenase (cytochrome), glyoxylate carboligase, phosphonopyruvate decarboxylase] [Amino acid transport and metabolism / Coenzyme metabolism]; Region: IlvB; COG0028 717522009740 Pyrimidine (PYR) binding domain of POX and related proteins; Region: TPP_PYR_POX_like; cd07035 717522009741 PYR/PP interface [polypeptide binding]; other site 717522009742 dimer interface [polypeptide binding]; other site 717522009743 TPP binding site [chemical binding]; other site 717522009744 Thiamine pyrophosphate enzyme, central domain; Region: TPP_enzyme_M; pfam00205 717522009745 Thiamine pyrophosphate (TPP) enzyme family, TPP-binding module; found in many key metabolic enzymes which use TPP (also known as thiamine diphosphate) as a cofactor. These enzymes include, among others, the E1 components of the pyruvate, the acetoin and...; Region: TPP_enzymes; cd00568 717522009746 TPP-binding site [chemical binding]; other site 717522009747 Mannose-6-phosphate isomerase [Carbohydrate transport and metabolism]; Region: {ManC}; COG0662 717522009748 Nuclear transport factor 2 (NTF2-like) superfamily. This family includes members of the NTF2 family, Delta-5-3-ketosteroid isomerases, Scytalone Dehydratases, and the beta subunit of Ring hydroxylating dioxygenases. This family is a classic example of...; Region: NTF2_like; cd00531 717522009749 Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596 717522009750 Novel bacterial esterase that cleaves esters on halogenated cyclic compounds; Region: Esterase_713_like; cl17303 717522009751 The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174 717522009752 metabolite-proton symporter; Region: 2A0106; TIGR00883 717522009753 putative substrate translocation pore; other site 717522009754 PE family; Region: PE; pfam00934 717522009755 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522009756 PPE family; Region: PPE; pfam00823 717522009757 Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484 717522009758 patatin-related protein; Region: TIGR03607 717522009759 In Mycobacterium tuberculosis strain H37Rv, Rv3479 exists as a single gene. In Mycobacterium bovis BCG Pasteur, BCG Tokyo, BCG Mexico and Mycobacterium bovis, a 713 bp deletion (RD18) splits Rv3479 into 2 parts, Mb3507 and Mb3508. Differs from Rv3479 by 1aa, R174L in Mycobacterium bovis, BCG Pasteur, BCG Tokyo and BCG Mexico 717522009760 Protein of unknown function (DUF3376); Region: DUF3376; pfam11856 717522009761 acyltransferase, WS/DGAT/MGAT; Region: acyl_WS_DGAT; TIGR02946 717522009762 Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007 717522009763 Protein of unknown function (DUF1298); Region: DUF1298; pfam06974 717522009764 Protein of unknown function (DUF2910); Region: DUF2910; pfam11139 717522009765 Protein of unknown function (DUF2510); Region: DUF2510; pfam10708 717522009766 LppP/LprE lipoprotein; Region: Lipoprotein_21; pfam14041 717522009767 Transcriptional regulator [Transcription]; Region: LytR; COG1316 717522009768 LytR cell envelope-related transcriptional attenuator; Region: LytR_C; pfam13399 717522009769 short chain dehydrogenase; Provisional; Region: PRK05875 717522009770 classical (c) SDRs; Region: SDR_c; cd05233 717522009771 NAD(P) binding site [chemical binding]; other site 717522009772 active site 717522009773 Predicted membrane protein [Function unknown]; Region: COG2259 717522009774 Protein of unknown function (DUF2424); Region: DUF2424; pfam10340 717522009775 alpha/beta hydrolase fold; Region: Abhydrolase_3; pfam07859 717522009776 Predicted transcriptional regulators [Transcription]; Region: COG1695 717522009777 Transcriptional regulator PadR-like family; Region: PadR; pfam03551 717522009778 Trehalose-6-phosphate synthase [Carbohydrate transport and metabolism]; Region: OtsA; COG0380 717522009779 Trehalose-6-Phosphate Synthase (TPS) is a glycosyltransferase that catalyses the synthesis of alpha,alpha-1,1-trehalose-6-phosphate from glucose-6-phosphate using a UDP-glucose donor. It is a key enzyme in the trehalose synthesis pathway. Trehalose is a...; Region: GT1_TPS; cd03788 717522009780 active site 717522009781 homotetramer interface [polypeptide binding]; other site 717522009782 virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996 717522009783 mce related protein; Region: MCE; pfam02470 717522009784 virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996 717522009785 mce related protein; Region: MCE; pfam02470 717522009786 mce related protein; Region: MCE; pfam02470 717522009787 virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996 717522009788 Protein of unknown function (DUF3407); Region: DUF3407; pfam11887 717522009789 virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996 717522009790 mce related protein; Region: MCE; pfam02470 717522009791 virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996 717522009792 mce related protein; Region: MCE; pfam02470 717522009793 virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996 717522009794 mce related protein; Region: MCE; pfam02470 717522009795 Protein of unknown function (DUF3407); Region: DUF3407; pfam11887 717522009796 ABC-type transport system involved in resistance to organic solvents, permease component [Secondary metabolites biosynthesis, transport, and catabolism]; Region: Ttg2B; COG0767 717522009797 Permease; Region: Permease; pfam02405 717522009798 ABC-type transport system involved in resistance to organic solvents, permease component [Secondary metabolites biosynthesis, transport, and catabolism]; Region: Ttg2B; COG0767 717522009799 Permease; Region: Permease; pfam02405 717522009800 3-ketoacyl-(acyl-carrier-protein) reductase; Provisional; Region: fabG; PRK07792 717522009801 Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931 717522009802 NAD(P) binding site [chemical binding]; other site 717522009803 active site 717522009804 Ferredoxin [Energy production and conversion]; Region: Fer; COG1141 717522009805 Protein of unknown function (DUF1271); Region: DUF1271; cl01443 717522009806 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522009807 Putative acyl-CoA dehydrogenases similar to fadE6, fadE17, and fadE26; Region: ACAD_fadE6_17_26; cd01152 717522009808 FAD binding site [chemical binding]; other site 717522009809 substrate binding site [chemical binding]; other site 717522009810 catalytic base [active] 717522009811 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522009812 Acyl-CoA dehydrogenase; Region: ACAD; cl09933 717522009813 active site 717522009814 acyl-CoA synthetase; Validated; Region: PRK07867 717522009815 Fatty acid transport proteins (FATP) play dual roles as fatty acid transporters and its activation enzymes; Region: FATP_FACS; cd05940 717522009816 acyl-activating enzyme (AAE) consensus motif; other site 717522009817 putative AMP binding site [chemical binding]; other site 717522009818 putative active site [active] 717522009819 putative CoA binding site [chemical binding]; other site 717522009820 PE family; Region: PE; pfam00934 717522009821 PE family; Region: PE; pfam00934 717522009822 RD20 Region of difference RD20, deleted region in Mycobacterium bovis BCG Pasteur, BCG Tokyo, BCG Mexico and Mycobacterium bovis AF2122/97 compared to Mycobacterium tuberculosis H37Rv. In-frame deletion in PE_PGRS54 gene. 717522009823 I-RD10 Region of difference I-RD10, inserted region in Mycobacterium bovis BCG Pasteur, BCG Tokyo and BCG Mexico, compared to Mycobacterium tuberculosis H37Rv and of 1827bp compared to Mycobacterium bovis AF2122/97. In-frame insertion in PE_PGRS54 gene. 717522009824 hypothetical protein; Validated; Region: PRK07586 717522009825 Pyrimidine (PYR) binding domain of POX and related proteins; Region: TPP_PYR_POX_like; cd07035 717522009826 PYR/PP interface [polypeptide binding]; other site 717522009827 dimer interface [polypeptide binding]; other site 717522009828 TPP binding site [chemical binding]; other site 717522009829 Thiamine pyrophosphate (TPP) family, BFDC subfamily, TPP-binding module; composed of proteins similar to Pseudomonas putida benzoylformate decarboxylase (BFDC). P. putida BFDC plays a role in the mandelate pathway, catalyzing the conversion of...; Region: TPP_BFDC; cd02002 717522009830 TPP-binding site [chemical binding]; other site 717522009831 dimer interface [polypeptide binding]; other site 717522009832 Predicted metal-dependent hydrolase of the TIM-barrel fold [General function prediction only]; Region: COG2159 717522009833 PE family; Region: PE; pfam00934 717522009834 I-RD11 Region of difference I-RD11, inserted region in Mycobacterium bovis BCG Pasteur, BCG Mexico and Mycobacterium bovis AF2122/97 compared to Mycobacterium tuberculosis H37Rv and BCG Tokyo. Merges PE_PGRS55(Rv3511) and PE_PGRS56(Rv3512) in a single gene, PE_PGRS55. The PE_PGRS55 gene of BCG Tokyo (5088bp) is 345bp shorter than that of BCG Pasteur (5433bp). As 345bp is the length of a repeat in the gene, the difference reflected the copy number of the BCG strains. 717522009835 Adenylate forming domain, Class I; Region: AFD_class_I; cl17068 717522009836 CoA binding site [chemical binding]; other site 717522009837 PE family; Region: PE; pfam00934 717522009838 S-RD12 Region of difference S-RD12, substituted region in Mycobacterium bovis BCG Pasteur, BCG Tokyo, BCG Mexico and Mycobacterium bovis AF2122/97 compared to Mycobacterium tuberculosis H37Rv. In Mycobacterium bovis BCG Pasteur and BCG Mexico, an in-frame insertion of 360bp in PE_PGRS57 gene leads to a longer product compared to Mycobacterium bovis AF2122/97 ones. 717522009839 acyl-CoA synthetase; Validated; Region: PRK07798 717522009840 Adenylate forming domain, Class I; Region: AFD_class_I; cl17068 717522009841 Uncharacterized subfamily of fatty acid CoA ligase (FACL); Region: FACL_like_5; cd05924 717522009842 acyl-activating enzyme (AAE) consensus motif; other site 717522009843 acyl-activating enzyme (AAE) consensus motif; other site 717522009844 putative AMP binding site [chemical binding]; other site 717522009845 putative active site [active] 717522009846 putative CoA binding site [chemical binding]; other site 717522009847 enoyl-CoA hydratase; Provisional; Region: PRK07799 717522009848 Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558 717522009849 substrate binding site [chemical binding]; other site 717522009850 oxyanion hole (OAH) forming residues; other site 717522009851 trimer interface [polypeptide binding]; other site 717522009852 Domain of unknown function (DUF4095); Region: DUF4095; pfam13338 717522009853 Cytochrome P450; Region: p450; cl12078 717522009854 Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124 717522009855 Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124 717522009856 Acetoacetate decarboxylase (ADC); Region: ADC; pfam06314 717522009857 N5,N10-methylenetetrahydromethanopterin reductase (Mer) catalyzes the reduction of N5,N10-methylenetetrahydromethanopterin with reduced coenzyme F420 to N5-methyltetrahydromethanopterin and oxidized coenzyme F420; Region: Tetrahydromethanopterin_reductase; cd01097 717522009858 probable F420-dependent oxidoreductase, Rv3520c family; Region: F420_Rv3520c; TIGR03559 717522009859 DUF35 OB-fold domain; Region: DUF35; pfam01796 717522009860 Predicted nucleic-acid-binding protein containing a Zn-ribbon [General function prediction only]; Region: COG1545 717522009861 DUF35 OB-fold domain; Region: DUF35; pfam01796 717522009862 lipid-transfer protein; Provisional; Region: PRK07937 717522009863 Thiolase domain associated with sterol carrier protein (SCP)-x isoform and related proteins; SCP-2 has multiple roles in intracellular lipid circulation and metabolism. The N-terminal presequence in the SCP-x isoform represents a peroxisomal...; Region: SCP-x_thiolase; cd00829 717522009864 active site 717522009865 acetyl-CoA acetyltransferase; Provisional; Region: PRK08313 717522009866 Thiolase domain associated with sterol carrier protein (SCP)-x isoform and related proteins; SCP-2 has multiple roles in intracellular lipid circulation and metabolism. The N-terminal presequence in the SCP-x isoform represents a peroxisomal...; Region: SCP-x_thiolase; cd00829 717522009867 active site 717522009868 NHL repeat; Region: NHL; pfam01436 717522009869 Uncharacterized conserved protein [Function unknown]; Region: COG3391 717522009870 NHL repeat; Region: NHL; pfam01436 717522009871 NHL repeat; Region: NHL; pfam01436 717522009872 NHL repeat; Region: NHL; pfam01436 717522009873 NHL repeat; Region: NHL; pfam01436 717522009874 Carbonic anhydrases/acetyltransferases, isoleucine patch superfamily [General function prediction only]; Region: PaaY; COG0663 717522009875 Gamma carbonic anhydrase-like: This family is composed of gamma carbonic anhydrase (CA), Ferripyochelin Binding Protein (FBP), E. coli paaY protein, and similar proteins. CAs are zinc-containing enzymes that catalyze the reversible hydration of carbon...; Region: LbH_gamma_CA_like; cd04645 717522009876 trimer interface [polypeptide binding]; other site 717522009877 putative metal binding site [ion binding]; other site 717522009878 Phenylpropionate dioxygenase and related ring-hydroxylating dioxygenases, large terminal subunit [Inorganic ion transport and metabolism / General function prediction only]; Region: HcaE; COG4638 717522009879 The alignment model represents the N-terminal rieske iron-sulfur domain of KshA, the oxygenase component of 3-ketosteroid 9-alpha-hydroxylase (KSH). The terminal oxygenase component of KSH is a key enzyme in the microbial steroid degradation pathway; Region: Rieske_RO_Alpha_KSH; cd03531 717522009880 Sulfotransferase family; Region: Sulfotransfer_3; pfam13469 717522009881 short chain dehydrogenase; Provisional; Region: PRK07890 717522009882 Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931 717522009883 NAD(P) binding site [chemical binding]; other site 717522009884 active site 717522009885 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522009886 PPE family; Region: PPE; pfam00823 717522009887 Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484 717522009888 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522009889 PPE family; Region: PPE; pfam00823 717522009890 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522009891 Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469 717522009892 4-hyroxy-2-oxovalerate/4-hydroxy-2-oxopentanoic acid aldolase,; Validated; Region: PRK08195 717522009893 4-hydroxy-2-oxovalerate aldolase, N-terminal catalytic TIM barrel domain; Region: DRE_TIM_HOA; cd07943 717522009894 active site 717522009895 catalytic residues [active] 717522009896 metal binding site [ion binding]; metal-binding site 717522009897 DmpG-like communication domain; Region: DmpG_comm; pfam07836 717522009898 acetaldehyde dehydrogenase; Validated; Region: PRK08300 717522009899 Semialdehyde dehydrogenase, NAD binding domain; Region: Semialdhyde_dh; smart00859 717522009900 Prokaryotic acetaldehyde dehydrogenase, dimerisation; Region: AcetDehyd-dimer; pfam09290 717522009901 2-keto-4-pentenoate hydratase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3971 717522009902 3-ketosteroid-delta-1-dehydrogenase; Reviewed; Region: PRK07843 717522009903 putative FAD-binding dehydrogenase; Reviewed; Region: PRK12834 717522009904 enoyl-CoA hydratase; Region: PLN02864 717522009905 The hotdog fold was initially identified in the E. coli FabA (beta-hydroxydecanoyl-acyl carrier protein (ACP)-dehydratase) structure and subsequently in 4HBT (4-hydroxybenzoyl-CoA thioesterase) from Pseudomonas. A number of other seemingly unrelated...; Region: hot_dog; cl00509 717522009906 HDE_HSD The R-hydratase-like hot dog fold of the 17-beta-hydroxysteriod dehydrogenase (HSD), and Hydratase-Dehydrogenase-Epimerase (HDE) proteins. Other enzymes with this fold include MaoC dehydratase, and the fatty acid synthase beta subunit; Region: HDE_HSD; cd03448 717522009907 dimer interaction site [polypeptide binding]; other site 717522009908 substrate-binding tunnel; other site 717522009909 active site 717522009910 catalytic site [active] 717522009911 substrate binding site [chemical binding]; other site 717522009912 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522009913 PPE family; Region: PPE; pfam00823 717522009914 PE-PPE domain; Region: PE-PPE; pfam08237 717522009915 lipid-transfer protein; Provisional; Region: PRK07855 717522009916 Thiolase domain associated with sterol carrier protein (SCP)-x isoform and related proteins; SCP-2 has multiple roles in intracellular lipid circulation and metabolism. The N-terminal presequence in the SCP-x isoform represents a peroxisomal...; Region: SCP-x_thiolase; cd00829 717522009917 active site 717522009918 SAV4209 is a Streptomyces avermitilis protein with a hot dog fold that is similar to those of (R)-specific enoyl-CoA hydratase, the peroxisomal Hydratase-Dehydrogenase-Epimerase (HDE) protein, and the fatty acid synthase beta subunit. The alpha- and...; Region: SAV4209; cd03455 717522009919 putative active site [active] 717522009920 putative catalytic site [active] 717522009921 (R)-hydratase [(R)-specific enoyl-CoA hydratase]. Catalyzes the hydration of trans-2-enoyl CoA to (R)-3-hydroxyacyl-CoA as part of the PHA (polyhydroxyalkanoate) biosynthetic pathway. The structure of the monomer includes a five-strand antiparallel...; Region: R_hydratase_like; cd03441 717522009922 active site 717522009923 catalytic site [active] 717522009924 Predicted nucleic-acid-binding protein containing a Zn-ribbon [General function prediction only]; Region: COG1545 717522009925 DUF35 OB-fold domain; Region: DUF35; pfam01796 717522009926 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522009927 Acyl-CoA dehydrogenase; Region: ACAD; cl09933 717522009928 active site 717522009929 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522009930 Acyl-CoA dehydrogenase, N-terminal domain; Region: Acyl-CoA_dh_N; pfam02771 717522009931 Acyl-CoA dehydrogenase; Region: ACAD; cl09933 717522009932 active site 717522009933 Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124 717522009934 Cytochrome P450; Region: p450; cl12078 717522009935 acetyl-CoA acetyltransferase; Provisional; Region: PRK07850 717522009936 Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751 717522009937 dimer interface [polypeptide binding]; other site 717522009938 active site 717522009939 Domain of unknown function (DUF385); Region: DUF385; pfam04075 717522009940 short chain dehydrogenase; Provisional; Region: PRK07791 717522009941 (3R)-hydroxyacyl-CoA dehydrogenase-like, classical(c)-like SDRs; Region: hydroxyacyl-CoA-like_DH_SDR_c-like; cd05353 717522009942 homodimer interface [polypeptide binding]; other site 717522009943 NAD binding site [chemical binding]; other site 717522009944 active site 717522009945 short chain dehydrogenase; Provisional; Region: PRK07856 717522009946 classical (c) SDRs; Region: SDR_c; cd05233 717522009947 NAD(P) binding site [chemical binding]; other site 717522009948 active site 717522009949 enoyl-CoA hydratase; Provisional; Region: PRK06495 717522009950 Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558 717522009951 substrate binding site [chemical binding]; other site 717522009952 oxyanion hole (OAH) forming residues; other site 717522009953 trimer interface [polypeptide binding]; other site 717522009954 Acyl CoA:acetate/3-ketoacid CoA transferase, alpha subunit [Lipid metabolism]; Region: AtoD; COG1788 717522009955 Acyl CoA:acetate/3-ketoacid CoA transferase, beta subunit [Lipid metabolism]; Region: AtoA; COG2057 717522009956 Nitronate monooxygenase; Region: NMO; pfam03060 717522009957 2-Nitropropane dioxygenase (NPD), one of the nitroalkane oxidizing enzyme families, catalyzes oxidative denitrification of nitroalkanes to their corresponding carbonyl compounds and nitrites. NDP is a member of the NAD(P)H-dependent flavin oxidoreductase...; Region: NPD_like; cd04730 717522009958 FMN binding site [chemical binding]; other site 717522009959 substrate binding site [chemical binding]; other site 717522009960 putative catalytic residue [active] 717522009961 Fatty acid desaturase [Lipid metabolism]; Region: DesA; COG3239 717522009962 Beta-carotene hydroxylase (CrtR), the carotenoid zeaxanthin biosynthetic enzyme catalyzes the addition of hydroxyl groups to the beta-ionone rings of beta-carotene to form zeaxanthin and is found in bacteria and red algae. Carotenoids are important...; Region: CrtR_beta-carotene-hydroxylase; cd03514 717522009963 putative di-iron ligands [ion binding]; other site 717522009964 phenylacetate-CoA oxygenase/reductase, PaaK subunit; Region: PA_CoA_Oxy5; TIGR02160 717522009965 NAD(P) binding domain of ferredoxin reductase like phenylacetic acid (PA) degradation oxidoreductase. PA oxidoreductases of E. coli hydroxylate PA-CoA in the second step of PA degradation. Members of this group typically fuse a ferredoxin reductase-like...; Region: PA_degradation_oxidoreductase_like; cd06214 717522009966 FAD binding pocket [chemical binding]; other site 717522009967 FAD binding motif [chemical binding]; other site 717522009968 phosphate binding motif [ion binding]; other site 717522009969 beta-alpha-beta structure motif; other site 717522009970 NAD(p) ribose binding residues [chemical binding]; other site 717522009971 NAD binding pocket [chemical binding]; other site 717522009972 NAD(P)-pyrophosphate-nicotinamide binding residues [chemical binding]; other site 717522009973 2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207 717522009974 catalytic loop [active] 717522009975 iron binding site [ion binding]; other site 717522009976 Domain of unknown function (DUF4095); Region: DUF4095; pfam13338 717522009977 Superfamily of nucleases including Short Patch Repair (Vsr) Endonucleases, archaeal Holliday junction resolvases, MutH methy-directed DNA mismatch-repair endonucleases, and catalytic domains of many restriction endonucleases, such as EcoRI, BamHI, and...; Region: Restriction_endonuclease_like; cl00277 717522009978 putative active site [active] 717522009979 acetyl-CoA acetyltransferase; Provisional; Region: PRK07801 717522009980 Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751 717522009981 dimer interface [polypeptide binding]; other site 717522009982 active site 717522009983 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522009984 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522009985 PPE-repeat proteins [Cell motility and secretion]; Region: COG5651 717522009986 PPE family; Region: PPE; pfam00823 717522009987 short chain dehydrogenase; Provisional; Region: PRK07831 717522009988 classical (c) SDRs; Region: SDR_c; cd05233 717522009989 NAD(P) binding site [chemical binding]; other site 717522009990 active site 717522009991 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522009992 Acyl-CoA dehydrogenase; Region: ACAD; cl09933 717522009993 active site 717522009994 long-chain-fatty-acid--CoA ligase; Validated; Region: PRK07656 717522009995 Adenylate forming domain, Class I; Region: AFD_class_I; cl17068 717522009996 Uncharacterized subfamily of fatty acid CoA ligase (FACL); Region: FACL_like_2; cd05917 717522009997 acyl-activating enzyme (AAE) consensus motif; other site 717522009998 putative AMP binding site [chemical binding]; other site 717522009999 putative active site [active] 717522010000 putative CoA binding site [chemical binding]; other site 717522010001 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522010002 Acyl-CoA dehydrogenase; Region: ACAD; cl09933 717522010003 active site 717522010004 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522010005 Acyl-CoA dehydrogenase, N-terminal domain; Region: Acyl-CoA_dh_N; pfam02771 717522010006 Acyl-CoA dehydrogenase; Region: ACAD; cl09933 717522010007 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522010008 active site 717522010009 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522010010 Acyl-CoA dehydrogenase, N-terminal domain; Region: Acyl-CoA_dh_N; pfam02771 717522010011 Acyl-CoA dehydrogenase; Region: ACAD; cl09933 717522010012 active site 717522010013 aspartate aminotransferase; Provisional; Region: PRK05764 717522010014 Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609 717522010015 pyridoxal 5'-phosphate binding site [chemical binding]; other site 717522010016 homodimer interface [polypeptide binding]; other site 717522010017 catalytic residue [active] 717522010018 Arylamine N-acetyltransferase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: NhoA; COG2162 717522010019 Flavin reductase like domain; Region: Flavin_Reduct; smart00903 717522010020 2,3-dihydroxybiphenyl 1,2-dioxygenase; Region: 23dbph12diox; TIGR03213 717522010021 N-terminal domain of 2,3-dihydroxybiphenyl 1,2-dioxygenase (BphC, EC 1.13.11.39) 1 from Rhodococcus globerulus P6 (BphC1-RGP6) and similar proteins; Region: BphC1-RGP6_N_like; cd07252 717522010022 C-terminal domain of 2,3-dihydroxybiphenyl 1,2-dioxygenase (BphC, EC 1.13.11.39) 1 from Rhodococcus globerulus P6 (BphC1-RGP6) and similar proteins; Region: BphC1-RGP6_C_like; cd07237 717522010023 active site 717522010024 Fe binding site [ion binding]; other site 717522010025 2-hydroxy-6-oxo-6-phenylhexa-2,4-dienoate hydrolase; Region: biphenyl_bphD; TIGR03343 717522010026 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522010027 Naphthocyclinone hydroxylase; Region: NcnH; cd01159 717522010028 Flavin binding site [chemical binding]; other site 717522010029 Flavodoxin reductases (ferredoxin-NADPH reductases) family 1 [Energy production and conversion]; Region: Hmp; COG1018 717522010030 NAD(P) binding domain of ferredoxin reductase like phenylacetic acid (PA) degradation oxidoreductase. PA oxidoreductases of E. coli hydroxylate PA-CoA in the second step of PA degradation. Members of this group typically fuse a ferredoxin reductase-like...; Region: PA_degradation_oxidoreductase_like; cd06214 717522010031 FAD binding pocket [chemical binding]; other site 717522010032 FAD binding motif [chemical binding]; other site 717522010033 phosphate binding motif [ion binding]; other site 717522010034 beta-alpha-beta structure motif; other site 717522010035 NAD(p) ribose binding residues [chemical binding]; other site 717522010036 NAD binding pocket [chemical binding]; other site 717522010037 NAD(P)-pyrophosphate-nicotinamide binding residues [chemical binding]; other site 717522010038 Ferredoxin [Energy production and conversion]; Region: Fdx; COG0633 717522010039 2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207 717522010040 catalytic loop [active] 717522010041 iron binding site [ion binding]; other site 717522010042 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522010043 Acyl-CoA dehydrogenase; Region: ACAD; cl09933 717522010044 Acyl-CoA dehydrogenase; Region: ACAD; cl09933 717522010045 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522010046 active site 717522010047 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522010048 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522010049 Transcriptional regulators [Transcription]; Region: PurR; COG1609 717522010050 Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392 717522010051 DNA binding site [nucleotide binding] 717522010052 domain linker motif; other site 717522010053 Ligand-binding domain of uncharacterized DNA-binding regulatory proteins that are members of the LacI-GalR family of bacterial transcription repressors; Region: PBP1_LacI_like_3; cd06279 717522010054 putative dimerization interface [polypeptide binding]; other site 717522010055 putative ligand binding site [chemical binding]; other site 717522010056 PknH-like extracellular domain; Region: PknH_C; pfam14032 717522010057 Predicted Zn-dependent hydrolases of the beta-lactamase fold [General function prediction only]; Region: COG2220 717522010058 Metallo-beta-lactamase superfamily; Region: Lactamase_B; cl00446 717522010059 Na+/H+ antiporter NhaD and related arsenite permeases [Inorganic ion transport and metabolism]; Region: ArsB; COG1055 717522010060 Anion permease ArsB/NhaD. These permeases have been shown to translocate sodium, arsenate, antimonite, sulfate and organic anions across biological membranes in all three kingdoms of life. A typical anion permease contains 8-13 transmembrane helices...; Region: ArsB_NhaD_permease; cl17221 717522010061 transmembrane helices; other site 717522010062 Anion permease ArsB/NhaD. These permeases have been shown to translocate sodium, arsenate, antimonite, sulfate and organic anions across biological membranes in all three kingdoms of life. A typical anion permease contains 8-13 transmembrane helices...; Region: ArsB_NhaD_permease; cl17221 717522010063 rRNA methylases [Translation, ribosomal structure and biogenesis]; Region: SpoU; COG0566 717522010064 RNA 2'-O ribose methyltransferase substrate binding; Region: SpoU_sub_bind; smart00967 717522010065 SpoU rRNA Methylase family; Region: SpoU_methylase; pfam00588 717522010066 cysteinyl-tRNA synthetase; Validated; Region: cysS; PRK00260 717522010067 nucleotidyl transferase superfamily; Region: nt_trans; cl00015 717522010068 active site 717522010069 HIGH motif; other site 717522010070 nucleotide binding site [chemical binding]; other site 717522010071 catalytic core domain of cysteinyl tRNA synthetase; Region: CysRS_core; cd00672 717522010072 KMSKS motif; other site 717522010073 Anticodon-binding domain of class Ia aminoacyl tRNA synthetases and similar domains; Region: Anticodon_Ia_like; cl12020 717522010074 MECDP_synthase (2-C-methyl-D-erythritol-2,4-cyclodiphosphate synthase), encoded by the ispF gene, catalyzes the formation of 2-C-methyl-D-erythritol 2,4-cyclodiphosphate (MEC) in the non-mevalonate deoxyxylulose (DOXP) pathway for isoprenoid biosynthesis; Region: MECDP_synthase; cd00554 717522010075 homotrimer interaction site [polypeptide binding]; other site 717522010076 zinc binding site [ion binding]; other site 717522010077 CDP-binding sites; other site 717522010078 CDP-ME synthetase is involved in mevalonate-independent isoprenoid production; Region: CDP-ME_synthetase; cd02516 717522010079 substrate binding site; other site 717522010080 dimer interface; other site 717522010081 Transcriptional regulators, similar to M. xanthus CarD [Transcription]; Region: COG1329 717522010082 DNA repair protein RadA; Provisional; Region: PRK11823 717522010083 Sms (bacterial radA) DNA repair protein. This protein is not related to archael radA any more than is to other RecA-like NTPases. Sms has a role in recombination and recombinational repair and is responsible for the stabilization or processing of...; Region: Sms; cd01121 717522010084 Walker A motif/ATP binding site; other site 717522010085 ATP binding site [chemical binding]; other site 717522010086 Walker B motif; other site 717522010087 Subunit ChlI of Mg-chelatase; Region: ChlI; pfam13541 717522010088 DNA integrity scanning protein DisA; Provisional; Region: PRK13482 717522010089 DisA bacterial checkpoint controller nucleotide-binding; Region: DisA_N; pfam02457 717522010090 DisA bacterial checkpoint controller linker region; Region: DisA-linker; pfam10635 717522010091 Carbonic anhydrases (CA) are zinc-containing enzymes that catalyze the reversible hydration of carbon dioxide in a two-step mechanism in which the nucleophilic attack of a zinc-bound hydroxide ion on carbon dioxide is followed by the regeneration of an...; Region: beta_CA_cladeC; cd03378 717522010092 active site clefts [active] 717522010093 zinc binding site [ion binding]; other site 717522010094 dimer interface [polypeptide binding]; other site 717522010095 endonuclease III; includes endonuclease III (DNA-(apurinic or apyrimidinic site) lyase), alkylbase DNA glycosidases (Alka-family) and other DNA glycosidases; Region: ENDO3c; cd00056 717522010096 endonuclease III; Region: ENDO3c; smart00478 717522010097 minor groove reading motif; other site 717522010098 helix-hairpin-helix signature motif; other site 717522010099 substrate binding pocket [chemical binding]; other site 717522010100 active site 717522010101 iron-sulpphur binding domain in DNA-(apurinic or apyrimidinic site) lyase (subfamily of ENDO3); Region: FES; smart00525 717522010102 PE family; Region: PE; pfam00934 717522010103 Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596 717522010104 Novel bacterial esterase that cleaves esters on halogenated cyclic compounds; Region: Esterase_713_like; cl17303 717522010105 catalytic site [active] 717522010106 Uncharacterized enzyme involved in biosynthesis of extracellular polysaccharides [General function prediction only]; Region: COG2329 717522010107 Beta-lactamase class A [Defense mechanisms]; Region: PenP; COG2367 717522010108 Beta-lactamase enzyme family; Region: Beta-lactamase2; pfam13354 717522010109 Ami_2 domain; Region: Ami_2; smart00644 717522010110 amidase catalytic site [active] 717522010111 Zn binding residues [ion binding]; other site 717522010112 substrate binding site [chemical binding]; other site 717522010113 PE family; Region: PE; pfam00934 717522010114 ATP-binding subunits of Clp protease and DnaK/DnaJ chaperones [Posttranslational modification, protein turnover, chaperones]; Region: clpA; COG0542 717522010115 Clp amino terminal domain; Region: Clp_N; pfam02861 717522010116 Clp amino terminal domain; Region: Clp_N; pfam02861 717522010117 The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009 717522010118 Walker A motif; other site 717522010119 ATP binding site [chemical binding]; other site 717522010120 Walker B motif; other site 717522010121 arginine finger; other site 717522010122 UvrB/uvrC motif; Region: UVR; pfam02151 717522010123 The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009 717522010124 Walker A motif; other site 717522010125 ATP binding site [chemical binding]; other site 717522010126 Walker B motif; other site 717522010127 C-terminal, D2-small domain, of ClpB protein; Region: ClpB_D2-small; pfam10431 717522010128 Lsr2; Region: Lsr2; pfam11774 717522010129 lysyl-tRNA synthetase; Reviewed; Region: lysS; PRK00484 717522010130 LysRS_N: N-terminal, anticodon recognition domain of lysyl-tRNA synthetases (LysRS). These enzymes are homodimeric class 2b aminoacyl-tRNA synthetases (aaRSs). This domain is a beta-barrel domain (OB fold) involved in binding the tRNA anticodon stem-loop; Region: LysRS_N; cd04322 717522010131 dimer interface [polypeptide binding]; other site 717522010132 putative anticodon binding site; other site 717522010133 Class II tRNA amino-acyl synthetase-like catalytic core domain. Class II amino acyl-tRNA synthetases (aaRS) share a common fold and generally attach an amino acid to the 3' OH of ribose of the appropriate tRNA. PheRS is an exception in that it...; Region: class_II_aaRS-like_core; cl00268 717522010134 motif 1; other site 717522010135 dimer interface [polypeptide binding]; other site 717522010136 active site 717522010137 motif 2; other site 717522010138 motif 3; other site 717522010139 pantothenate kinase; Reviewed; Region: PRK13318 717522010140 Aspartate alpha-decarboxylase or L-aspartate 1-decarboxylase, a pyruvoyl group-dependent decarboxylase in beta-alanine production; Region: Asp_decarbox; cd06919 717522010141 tetramerization interface [polypeptide binding]; other site 717522010142 active site 717522010143 Pantoate-beta-alanine ligase; Region: PanC; cd00560 717522010144 pantoate--beta-alanine ligase; Region: panC; TIGR00018 717522010145 active site 717522010146 ATP-binding site [chemical binding]; other site 717522010147 pantoate-binding site; other site 717522010148 HXXH motif; other site 717522010149 Rossmann-like domain; Region: Rossmann-like; pfam10727 717522010150 Uncharacterized conserved protein [Function unknown]; Region: COG5495 717522010151 Domain of unknown function (DUF2520); Region: DUF2520; pfam10728 717522010152 Protein of unknown function (DUF3180); Region: DUF3180; pfam11377 717522010153 7,8-dihydro-6-hydroxymethylpterin-pyrophosphokinase (HPPK). Folate derivatives are essential cofactors in the biosynthesis of purines, pyrimidines, and amino acids as well as formyl-tRNA. Mammalian cells are able to utilize pre-formed folates after...; Region: HPPK; cd00483 717522010154 catalytic center binding site [active] 717522010155 ATP binding site [chemical binding]; other site 717522010156 Dihydroneopterin aldolase (DHNA) and 7,8-dihydroneopterin triphosphate epimerase domain (DHNTPE); these enzymes have been designated folB and folX, respectively. Folate derivatives are essential cofactors in the biosynthesis of purines, pyrimidines, and...; Region: DHNA_DHNTPE; cd00534 717522010157 homooctamer interface [polypeptide binding]; other site 717522010158 active site 717522010159 DHPS subgroup of Pterin binding enzymes. DHPS (dihydropteroate synthase), a functional homodimer, catalyzes the condensation of p-aminobenzoic acid (pABA) in the de novo biosynthesis of folate, which is an essential cofactor in both nucleic acid and...; Region: DHPS; cd00739 717522010160 dihydropteroate synthase; Region: DHPS; TIGR01496 717522010161 substrate binding pocket [chemical binding]; other site 717522010162 dimer interface [polypeptide binding]; other site 717522010163 inhibitor binding site; inhibition site 717522010164 GTP cyclohydrolase I (GTP-CH-I) catalyzes the conversion of GTP into dihydroneopterin triphosphate. The enzyme product is the precursor of tetrahydrofolate in eubacteria, fungi, and plants and of the folate analogs in methanogenic bacteria. In...; Region: GTP_cyclohydro1; cd00642 717522010165 homodecamer interface [polypeptide binding]; other site 717522010166 GTP cyclohydrolase I; Provisional; Region: PLN03044 717522010167 active site 717522010168 putative catalytic site residues [active] 717522010169 zinc binding site [ion binding]; other site 717522010170 GTP-CH-I/GFRP interaction surface; other site 717522010171 FtsH Extracellular; Region: FtsH_ext; pfam06480 717522010172 ATP-dependent metalloprotease FtsH; Region: FtsH_fam; TIGR01241 717522010173 The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009 717522010174 Walker A motif; other site 717522010175 ATP binding site [chemical binding]; other site 717522010176 Walker B motif; other site 717522010177 arginine finger; other site 717522010178 Peptidase family M41; Region: Peptidase_M41; pfam01434 717522010179 chromosomal replication initiation protein; Provisional; Region: dnaA; PRK14086 717522010180 Protein of unknown function (DUF2580); Region: DUF2580; pfam10824 717522010181 RD8 Region of difference RD8, deleted region in Mycobacterium bovis BCG Pasteur, BCG Tokyo, BCG Mexico and Mycobacterium bovis AF2122/97 compared to Mycobacterium tuberculosis H37Rv. Removes genes Rv3617-Rv3622c and truncates Rv3623 717522010182 Uncharacterized conserved protein [Function unknown]; Region: COG2968 717522010183 Protein of unknown function (DUF541); Region: SIMPL; pfam04402 717522010184 Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223 717522010185 active site 717522010186 tRNA(Ile)-lysidine synthase MesJ [Cell cycle control, cell division, chromosome partitioning]; Region: MesJ; COG0037 717522010187 N-terminal domain of predicted ATPase of the PP-loop faimly implicated in cell cycle control [Cell division and chromosome partitioning]. This is a subfamily of Adenine nucleotide alpha hydrolases superfamily.Adeninosine nucleotide alpha hydrolases...; Region: PP-ATPase; cd01992 717522010188 Ligand Binding Site [chemical binding]; other site 717522010189 Uncharacterized conserved protein [Function unknown]; Region: COG5282 717522010190 uncharacterized protein, coenzyme F420 biosynthesis associated; Region: DUF2342_F420; TIGR03883 717522010191 D-Ala-D-Ala carboxypeptidase 3 (S13) family; Region: Peptidase_S13; pfam02113 717522010192 D-alanyl-D-alanine carboxypeptidase, serine-type, PBP4 family; Region: PBP4; TIGR00666 717522010193 Inorganic pyrophosphatase. These enzymes hydrolyze inorganic pyrophosphate (PPi) to two molecules of orthophosphates (Pi). The reaction requires bivalent cations. The enzymes in general exist as homooligomers; Region: pyrophosphatase; cd00412 717522010194 dimer interface [polypeptide binding]; other site 717522010195 substrate binding site [chemical binding]; other site 717522010196 metal binding sites [ion binding]; metal-binding site 717522010197 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2899 717522010198 DPM_DPG-synthase_like is a member of the Glycosyltransferase 2 superfamily; Region: DPM_DPG-synthase_like; cd04179 717522010199 Ligand binding site; other site 717522010200 Putative Catalytic site; other site 717522010201 DXD motif; other site 717522010202 Uncharacterized conserved protein (DUF2304); Region: DUF2304; cl01034 717522010203 Protein involved in biosynthesis of mitomycin antibiotics/polyketide fumonisin [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG5285 717522010204 Nucleoside-diphosphate-sugar epimerases [Cell envelope biogenesis, outer membrane / Carbohydrate transport and metabolism]; Region: WcaG; COG0451 717522010205 Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931 717522010206 NAD(P) binding site [chemical binding]; other site 717522010207 active site 717522010208 Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG4584 717522010209 Helix-turn-helix domain of Hin and related proteins, a family of DNA-binding domains unique to bacteria and represented by the Hin protein of Salmonella. The basic HTH domain is a simple fold comprised of three core helices that form a right-handed...; Region: HTH_Hin_like; cl17393 717522010210 Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG4584 717522010211 transposase; Provisional; Region: PRK06526 717522010212 IstB-like ATP binding protein; Region: IstB_IS21; pfam01695 717522010213 Walker B motif; other site 717522010214 Transposase, Mutator family; Region: Transposase_mut; pfam00872 717522010215 MULE transposase domain; Region: MULE; pfam10551 717522010216 Protein involved in cell division [Cell division and chromosome partitioning]; Region: Fic; COG2184 717522010217 Fic/DOC family; Region: Fic; cl00960 717522010218 VbhA antitoxin and related proteins; Region: VbhA_like; cd11586 717522010219 DNA polymerase III subunit delta'; Validated; Region: PRK07940 717522010220 DNA polymerase III subunit delta'; Validated; Region: PRK08485 717522010221 Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225 717522010222 dimerization interface [polypeptide binding]; other site 717522010223 Adenylate cyclase, family 3 (some proteins contain HAMP domain) [Signal transduction mechanisms]; Region: CyaA; COG2114 717522010224 cyclase homology domain; Region: CHD; cd07302 717522010225 nucleotidyl binding site; other site 717522010226 metal binding site [ion binding]; metal-binding site 717522010227 dimer interface [polypeptide binding]; other site 717522010228 DNA topoisomerase I subunit omega; Validated; Region: PRK07561 717522010229 TOPRIM_TopoIA_TopoI: The topoisomerase-primase (TORPIM) domain found in members of the type IA family of DNA topoisomerases (Topo IA) similar to Escherichia coli DNA topoisomerase I. Type IA DNA topoisomerases remove (relax) negative supercoils in the...; Region: TOPRIM_TopoIA_TopoI; cd03363 717522010230 active site 717522010231 interdomain interaction site; other site 717522010232 putative metal-binding site [ion binding]; other site 717522010233 nucleotide binding site [chemical binding]; other site 717522010234 Bacterial DNA topoisomeraes I ATP-binding domain; Region: TOP1Bc; smart00436 717522010235 domain I; other site 717522010236 phosphate binding site [ion binding]; other site 717522010237 DNA Topoisomerase, subtype IA; DNA-binding, ATP-binding and catalytic domain of bacterial DNA topoisomerases I and III, and eukaryotic DNA topoisomerase III and eubacterial and archael reverse gyrases. Topoisomerases clevage single or double stranded DNA...; Region: TOP1Ac; cd00186 717522010238 domain II; other site 717522010239 domain III; other site 717522010240 nucleotide binding site [chemical binding]; other site 717522010241 DNA binding groove [nucleotide binding] 717522010242 catalytic site [active] 717522010243 domain IV; other site 717522010244 Topoisomerase C-terminal repeat; Region: Toprim_C_rpt; pfam13368 717522010245 Topoisomerase C-terminal repeat; Region: Toprim_C_rpt; pfam13368 717522010246 Topoisomerase C-terminal repeat; Region: Toprim_C_rpt; pfam13368 717522010247 Cold-Shock Protein (CSP) contains an S1-like cold-shock domain (CSD) that is found in eukaryotes, prokaryotes, and archaea. CSP's include the major cold-shock proteins CspA and CspB in bacteria and the eukaryotic gene regulatory factor Y-box...; Region: CSP_CDS; cd04458 717522010248 DNA-binding site [nucleotide binding]; DNA binding site 717522010249 RNA-binding motif; other site 717522010250 helicase/secretion neighborhood putative DEAH-box helicase; Region: DECH_helic; TIGR03817 717522010251 DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046 717522010252 ATP binding site [chemical binding]; other site 717522010253 putative Mg++ binding site [ion binding]; other site 717522010254 Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079 717522010255 nucleotide binding region [chemical binding]; other site 717522010256 Domain of unknown function (DUF1998); Region: DUF1998; pfam09369 717522010257 PE family; Region: PE; pfam00934 717522010258 Protein of unknown function (DUF4244); Region: DUF4244; pfam14029 717522010259 Flp pilus assembly protein TadB [Intracellular trafficking and secretion]; Region: TadB; COG4965 717522010260 Flp pilus assembly protein, ATPase CpaF [Intracellular trafficking and secretion]; Region: CpaF; COG4962 717522010261 Type IV secretory pathway component VirB11, and related ATPases. The homohexamer, VirB11 is one of eleven Vir proteins, which are required for T-pilus biogenesis and virulence in the transfer of T-DNA from the Ti (tumor-inducing) plasmid of bacterial to...; Region: VirB11-like_ATPase; cd01130 717522010262 Walker A motif; other site 717522010263 hexamer interface [polypeptide binding]; other site 717522010264 ATP binding site [chemical binding]; other site 717522010265 Walker B motif; other site 717522010266 helicase/secretion neighborhood CpaE-like protein; Region: CpaE_hom_Actino; TIGR03815 717522010267 Phosphoserine phosphatase [Amino acid transport and metabolism]; Region: SerB; COG0560 717522010268 Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427 717522010269 motif II; other site 717522010270 ATPase components of various ABC-type transport systems, contain duplicated ATPase [General function prediction only]; Region: COG1123 717522010271 ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257 717522010272 Walker A/P-loop; other site 717522010273 ATP binding site [chemical binding]; other site 717522010274 Q-loop/lid; other site 717522010275 ABC transporter signature motif; other site 717522010276 Walker B; other site 717522010277 D-loop; other site 717522010278 H-loop/switch region; other site 717522010279 ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257 717522010280 Walker A/P-loop; other site 717522010281 ATP binding site [chemical binding]; other site 717522010282 Q-loop/lid; other site 717522010283 ABC transporter signature motif; other site 717522010284 Walker B; other site 717522010285 D-loop; other site 717522010286 H-loop/switch region; other site 717522010287 Oligopeptide/dipeptide transporter, C-terminal region; Region: oligo_HPY; cl07097 717522010288 nickel ABC transporter, permease subunit NikC; Region: nickel_nikC; TIGR02790 717522010289 Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261 717522010290 ABC-ATPase subunit interface; other site 717522010291 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppB; COG0601 717522010292 Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261 717522010293 dimer interface [polypeptide binding]; other site 717522010294 conserved gate region; other site 717522010295 ABC-ATPase subunit interface; other site 717522010296 ABC-type oligopeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: OppA; COG4166 717522010297 The substrate-binding domain of an ABC-type nickel/oligopeptide-like import system contains the type 2 periplasmic binding fold; Region: PBP2_NikA_DppA_OppA_like; cd00995 717522010298 acetyl-CoA synthetase; Provisional; Region: PRK00174 717522010299 Acetyl-CoA synthetase (also known as acetate-CoA ligase and acetyl-activating enzyme); Region: ACS; cd05966 717522010300 active site 717522010301 CoA binding site [chemical binding]; other site 717522010302 acyl-activating enzyme (AAE) consensus motif; other site 717522010303 AMP binding site [chemical binding]; other site 717522010304 acetate binding site [chemical binding]; other site 717522010305 Protein of unknown function (DUF1469); Region: DUF1469; pfam07332 717522010306 Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596 717522010307 Trypsin-like peptidase domain; Region: Trypsin_2; pfam13365 717522010308 Coenzyme A pyrophosphatase (CoAse), a member of the Nudix hydrolase superfamily, functions to catalyze the elimination of oxidized inactive CoA, which can inhibit CoA-utilizing enzymes. The need of CoAses mainly arises under conditions of oxidative...; Region: CoAse; cd03426 717522010309 putative active site [active] 717522010310 putative CoA binding site [chemical binding]; other site 717522010311 nudix motif; other site 717522010312 metal binding site [ion binding]; metal-binding site 717522010313 TlpA-like family; composed of TlpA, ResA, DsbE and similar proteins. TlpA, ResA and DsbE are bacterial protein disulfide reductases with important roles in cytochrome maturation. They are membrane-anchored proteins with a soluble TRX domain containing a...; Region: TlpA_like_family; cd02966 717522010314 Thioredoxin-like; Region: Thioredoxin_8; pfam13905 717522010315 catalytic residues [active] 717522010316 Predicted EndoIII-related endonuclease [DNA replication, recombination, and repair]; Region: Nth; COG0177 717522010317 endonuclease III; includes endonuclease III (DNA-(apurinic or apyrimidinic site) lyase), alkylbase DNA glycosidases (Alka-family) and other DNA glycosidases; Region: ENDO3c; cd00056 717522010318 minor groove reading motif; other site 717522010319 helix-hairpin-helix signature motif; other site 717522010320 substrate binding pocket [chemical binding]; other site 717522010321 active site 717522010322 iron-sulpphur binding domain in DNA-(apurinic or apyrimidinic site) lyase (subfamily of ENDO3); Region: FES; smart00525 717522010323 cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases [Signal transduction mechanisms]; Region: Crp; COG0664 717522010324 effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038 717522010325 ligand binding site [chemical binding]; other site 717522010326 flexible hinge region; other site 717522010327 helix_turn_helix, cAMP Regulatory protein C-terminus; DNA binding domain of prokaryotic regulatory proteins belonging to the catabolite activator protein family; Region: HTH_CRP; cd00092 717522010328 putative switch regulator; other site 717522010329 non-specific DNA interactions [nucleotide binding]; other site 717522010330 DNA binding site [nucleotide binding] 717522010331 sequence specific DNA binding site [nucleotide binding]; other site 717522010332 putative cAMP binding site [chemical binding]; other site 717522010333 Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849 717522010334 This group of proteins belong to a large family of YjgF/YER057c/UK114-like proteins present in bacteria, archaea, and eukaryotes with no definitive function. The conserved domain is similar in structure to chorismate mutase but there is no sequence...; Region: YjgF_YER057c_UK114_like_1; cd02199 717522010335 homotrimer interaction site [polypeptide binding]; other site 717522010336 putative active site [active] 717522010337 Domain of unknown function (DUF4177); Region: DUF4177; pfam13783 717522010338 Predicted ATPase involved in chromosome partitioning [Cell division and chromosome partitioning]; Region: ArsA; COG0003 717522010339 ArsA ATPase functionas as an efflux pump located on the inner membrane of the cell. This ATP-driven oxyanion pump catalyzes the extrusion of arsenite, antimonite and arsenate. Maintenance of a low intracellular concentration of oxyanion produces...; Region: ArsA; cd02035 717522010340 P loop; other site 717522010341 Nucleotide binding site [chemical binding]; other site 717522010342 DTAP/Switch II; other site 717522010343 Predicted ATPase involved in chromosome partitioning [Cell division and chromosome partitioning]; Region: ArsA; COG0003 717522010344 ArsA ATPase functionas as an efflux pump located on the inner membrane of the cell. This ATP-driven oxyanion pump catalyzes the extrusion of arsenite, antimonite and arsenate. Maintenance of a low intracellular concentration of oxyanion produces...; Region: ArsA; cd02035 717522010345 DTAP/Switch II; other site 717522010346 Switch I; other site 717522010347 ArsA ATPase functionas as an efflux pump located on the inner membrane of the cell. This ATP-driven oxyanion pump catalyzes the extrusion of arsenite, antimonite and arsenate. Maintenance of a low intracellular concentration of oxyanion produces...; Region: ArsA; cd02035 717522010348 Transcription factor WhiB; Region: Whib; pfam02467 717522010349 Membrane carboxypeptidase (penicillin-binding protein) [Cell envelope biogenesis, outer membrane]; Region: MrcB; COG0744 717522010350 Transglycosylase; Region: Transgly; pfam00912 717522010351 Penicillin binding protein transpeptidase domain; Region: Transpeptidase; cl17760 717522010352 PASTA domain of bacterial serine/threonine kinase pknB-like proteins. PknB is a member of a group of related transmembrane sensor kinases present in many gram positive bacteria, which has been shown to regulate cell shape in Mycobacterium tubercolosis; Region: PASTA_pknB; cd06577 717522010353 phosphodiesterase YaeI; Provisional; Region: PRK11340 717522010354 Bacillus subtilis YkuE and related proteins, C-terminal metallophosphatase domain; Region: MPP_YkuE_C; cd07385 717522010355 putative active site [active] 717522010356 putative metal binding site [ion binding]; other site 717522010357 Cysteine synthase [Amino acid transport and metabolism]; Region: CysK; COG0031 717522010358 Tryptophan synthase beta superfamily (fold type II); this family of pyridoxal phosphate (PLP)-dependent enzymes catalyzes beta-replacement and beta-elimination reactions. This CD corresponds to aminocyclopropane-1-carboxylate deaminase (ACCD), tryptophan...; Region: Trp-synth-beta_II; cl00342 717522010359 pyridoxal 5'-phosphate binding pocket [chemical binding]; other site 717522010360 catalytic residue [active] 717522010361 Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124 717522010362 Cytochrome P450; Region: p450; cl12078 717522010363 Sulphate Transporter and Anti-Sigma factor antagonist) domain of anti-anti-sigma factors, key regulators of anti-sigma factors by phosphorylation; Region: STAS_anti-anti-sigma_factors; cd07043 717522010364 anti sigma factor interaction site; other site 717522010365 regulatory phosphorylation site [posttranslational modification]; other site 717522010366 Uncharacterized conserved protein [Function unknown]; Region: COG1610 717522010367 Domain of unknown function (DUF4129); Region: DUF4129; pfam13559 717522010368 Domain of unknown function (DUF4350); Region: DUF4350; pfam14258 717522010369 MoxR-like ATPases [General function prediction only]; Region: COG0714 717522010370 The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009 717522010371 Walker A motif; other site 717522010372 ATP binding site [chemical binding]; other site 717522010373 Walker B motif; other site 717522010374 arginine finger; other site 717522010375 Uncharacterized conserved protein (some members contain a von Willebrand factor type A (vWA) domain) [General function prediction only]; Region: COG1721 717522010376 Protein of unknown function DUF58; Region: DUF58; pfam01882 717522010377 Uncharacterized membrane protein [Function unknown]; Region: SpoIIM; COG1300 717522010378 Predicted membrane protein/domain [Function unknown]; Region: COG1714 717522010379 glycerol kinase; Provisional; Region: glpK; PRK00047 717522010380 Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cl17037 717522010381 nucleotide binding site [chemical binding]; other site 717522010382 Mycobacterium tuberculosis PIN domain family; Region: Mtu_PIN_fam; TIGR00028 717522010383 Glutamate-cysteine ligase family 2(GCS2); Region: GCS2; cl00954 717522010384 Methyltransferase domain; Region: Methyltransf_23; pfam13489 717522010385 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522010386 S-adenosylmethionine binding site [chemical binding]; other site 717522010387 Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes. PLP combines with an alpha-amino acid to form a compound called a Schiff base or aldimine intermediate, which depending on the reaction, is the...; Region: AAT_I; cl00321 717522010388 Selenocysteine lyase/Cysteine desulfurase [Posttranslational modification, protein turnover, chaperones]; Region: csdA; COG0520 717522010389 pyridoxal 5'-phosphate binding pocket [chemical binding]; other site 717522010390 catalytic residue [active] 717522010391 Uncharacterized conserved protein [Function unknown]; Region: COG4301 717522010392 Uncharacterized conserved protein (DUF2260); Region: DUF2260; pfam10017 717522010393 ergothioneine biosynthesis protein EgtC; Region: TIGR03442 717522010394 Glutamine amidotransferases class-II (Gn-AT)_YafJ-type. YafJ is a glutamine amidotransferase-like protein of unknown function found in prokaryotes, eukaryotes and archaea. YafJ has a conserved structural fold similar to those of other class II...; Region: YafJ; cd01908 717522010395 putative active site [active] 717522010396 putative dimer interface [polypeptide binding]; other site 717522010397 ergothioneine biosynthesis protein EgtB; Region: egtB_TIGR03440 717522010398 Formylglycine-generating sulfatase enzyme; Region: FGE-sulfatase; pfam03781 717522010399 Gamma-glutamylcysteine synthetase [Coenzyme metabolism]; Region: GshA; COG3572 717522010400 PknH-like extracellular domain; Region: PknH_C; pfam14032 717522010401 Domain of unknown function (DUF4185); Region: DUF4185; pfam13810 717522010402 aspartate-semialdehyde dehydrogenase; Provisional; Region: PRK14874 717522010403 Semialdehyde dehydrogenase, NAD binding domain; Region: Semialdhyde_dh; smart00859 717522010404 aspartate kinase; Reviewed; Region: PRK06635 717522010405 AAK_AKii-LysC-BS: Amino Acid Kinase Superfamily (AAK), AKii; this CD includes the N-terminal catalytic aspartokinase (AK) domain of the lysine-sensitive aspartokinase isoenzyme AKII of Bacillus subtilis 168, and the lysine plus threonine-sensitive...; Region: AAK_AKii-LysC-BS; cd04261 717522010406 putative nucleotide binding site [chemical binding]; other site 717522010407 putative catalytic residues [active] 717522010408 putative Mg ion binding site [ion binding]; other site 717522010409 putative aspartate binding site [chemical binding]; other site 717522010410 ACT domains of the lysine-sensitive aspartokinase isoenzyme AKII of Bacillus subtilis (BS) strain 168 and related proteins; Region: ACT_AKii-LysC-BS-like_1; cd04913 717522010411 putative allosteric regulatory site; other site 717522010412 ACT domains of the lysine-sensitive, aspartokinase (AK) isoenzyme AKII of Bacillus subtilis (BS) strain 168 and related domains; Region: ACT_AKii-LysC-BS-like_2; cd04936 717522010413 putative allosteric regulatory residue; other site 717522010414 2-isopropylmalate synthase; Validated; Region: PRK03739 717522010415 Mycobacterium tuberculosis LeuA3 and related proteins, N-terminal catalytic TIM barrel domain; Region: DRE_TIM_LeuA; cd07942 717522010416 active site 717522010417 catalytic residues [active] 717522010418 metal binding site [ion binding]; metal-binding site 717522010419 LeuA allosteric (dimerisation) domain; Region: LeuA_dimer; smart00917 717522010420 S-RD13 (VNTR4155) Region of difference S-RD13, repeated region in leuA composed of tandem repeat of 57bp (tcgcgagcccggcgcagccgggcgaagcgggtcggcacgcatcggaccc cgtgacga). 12 copies have been found in Mycobacterium bovis BCG Pasteur and BCG Mexico, and 11 copies have been found in BCG Tokyo compared to 2 copies in Mycobacterium tuberculosis strain H37Rv and 5 copies in Mycobacterium bovis AF2122/97 717522010421 DNA polymerase III subunit epsilon; Provisional; Region: PRK06063 717522010422 DEDDh 3'-5' exonuclease domain family; Region: DEDDh; cd06127 717522010423 active site 717522010424 catalytic site [active] 717522010425 substrate binding site [chemical binding]; other site 717522010426 UDP-N-acetylmuramyl tripeptide synthase [Cell envelope biogenesis, outer membrane]; Region: MurE; COG0769 717522010427 Domain of unknown function (DUF1727); Region: DUF1727; pfam08353 717522010428 Type 1 glutamine amidotransferase (GATase1) domain found in Cobyric Acid Synthase (CobQ); Region: GATase1_CobQ; cd01750 717522010429 catalytic triad [active] 717522010430 Superfamily of nucleases including Short Patch Repair (Vsr) Endonucleases, archaeal Holliday junction resolvases, MutH methy-directed DNA mismatch-repair endonucleases, and catalytic domains of many restriction endonucleases, such as EcoRI, BamHI, and...; Region: Restriction_endonuclease_like; cl00277 717522010431 putative active site [active] 717522010432 recombination protein RecR; Reviewed; Region: recR; PRK00076 717522010433 RecR protein; Region: RecR; pfam02132 717522010434 TOPRIM_recR: topoisomerase-primase (TOPRIM) nucleotidyl transferase/hydrolase domain of the type found in Escherichia coli RecR. RecR participates in the RecFOR pathway of homologous recombinational repair in prokaryotes. This pathway provides a...; Region: TOPRIM_recR; cd01025 717522010435 putative active site [active] 717522010436 putative metal-binding site [ion binding]; other site 717522010437 tetramer interface [polypeptide binding]; other site 717522010438 hypothetical protein; Validated; Region: PRK00153 717522010439 N-acetylmuramoyl-L-alanine amidase [Cell envelope biogenesis, outer membrane]; Region: AmiC; COG0860 717522010440 N-acetylmuramoyl-L-alanine amidase or MurNAc-LAA (also known as peptidoglycan aminohydrolase, NAMLA amidase, NAMLAA, Amidase 3, and peptidoglycan amidase; EC 3.5.1.28) is an autolysin that hydrolyzes the amide bond between N-acetylmuramoyl and L-amino...; Region: MurNAc-LAA; cd02696 717522010441 active site 717522010442 metal binding site [ion binding]; metal-binding site 717522010443 Polyketide cyclase / dehydrase and lipid transport; Region: Polyketide_cyc2; pfam10604 717522010444 hydrophobic ligand binding site; other site 717522010445 FAD/FMN-containing dehydrogenases [Energy production and conversion]; Region: GlcD; COG0277 717522010446 FAD binding domain; Region: FAD_binding_4; pfam01565 717522010447 Mycolic acid cyclopropane synthetase; Region: CMAS; pfam02353 717522010448 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522010449 S-adenosylmethionine binding site [chemical binding]; other site 717522010450 DNA polymerase III subunits gamma and tau; Provisional; Region: PRK14952 717522010451 The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009 717522010452 Walker A motif; other site 717522010453 ATP binding site [chemical binding]; other site 717522010454 Walker B motif; other site 717522010455 arginine finger; other site 717522010456 DNA polymerase III subunits gamma and tau domain III; Region: DNA_pol3_gamma3; pfam12169 717522010457 Alanine-glyoxylate amino-transferase; Region: Aminotran_MocR; pfam12897 717522010458 Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes. PLP combines with an alpha-amino acid to form a compound called a Schiff base or aldimine intermediate, which depending on the reaction, is the...; Region: AAT_I; cl00321 717522010459 pyridoxal 5'-phosphate binding pocket [chemical binding]; other site 717522010460 catalytic residue [active] 717522010461 Cutinase; Region: Cutinase; pfam01083 717522010462 hopanoid-associated sugar epimerase; Region: HpnA; TIGR03466 717522010463 Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931 717522010464 NAD(P) binding site [chemical binding]; other site 717522010465 active site 717522010466 Threonine dehydrogenase and related Zn-dependent dehydrogenases [Amino acid transport and metabolism / General function prediction only]; Region: Tdh; COG1063 717522010467 Alcohol dehydrogenases of the MDR family; Region: Zn_ADH8; cd08262 717522010468 putative NAD(P) binding site [chemical binding]; other site 717522010469 catalytic Zn binding site [ion binding]; other site 717522010470 Uncharacterized conserved protein [Function unknown]; Region: COG3349 717522010471 Streptococcal 67 kDa myosin-cross-reactive antigen like family; Region: Strep_67kDa_ant; cl17487 717522010472 drug resistance transporter, EmrB/QacA subfamily; Region: efflux_EmrB; TIGR00711 717522010473 The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174 717522010474 putative substrate translocation pore; other site 717522010475 cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases [Signal transduction mechanisms]; Region: Crp; COG0664 717522010476 effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038 717522010477 ligand binding site [chemical binding]; other site 717522010478 Predicted esterase of the alpha-beta hydrolase superfamily [General function prediction only]; Region: RssA; COG1752 717522010479 Patatin-like phospholipase domain containing protein 6, protein 7, and fungal NTE1; Region: Pat_PNPLA6_PNPLA7_NTE1_like; cd07205 717522010480 active site 717522010481 nucleophile elbow; other site 717522010482 Predicted Fe-S oxidoreductases [General function prediction only]; Region: COG1964 717522010483 Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335 717522010484 FeS/SAM binding site; other site 717522010485 Methyltransferase domain; Region: Methyltransf_31; pfam13847 717522010486 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522010487 S-adenosylmethionine binding site [chemical binding]; other site 717522010488 LigD_Pol_like_2: Polymerase (Pol) domain of bacterial LigD proteins similar to Pseudomonas aeruginosa (Pae) LigD, subgroup 2. The LigD Pol domain belongs to the archaeal/eukaryal primase (AEP) superfamily. In prokaryotes, LigD along with Ku is required...; Region: LigD_Pol_like_2; cd04865 717522010489 nucleotide binding site [chemical binding]; other site 717522010490 ATP-dependent DNA ligase; Reviewed; Region: ligC; PRK08224 717522010491 Adenylation domain of Mycobacterium tuberculosis LigC-like ATP-dependent DNA ligases; Region: Adenylation_DNA_ligase_LigC; cd07905 717522010492 active site 717522010493 DNA binding site [nucleotide binding] 717522010494 The Oligonucleotide/oligosaccharide binding (OB)-fold domain of ATP-dependent DNA ligase LigC is a DNA-binding module that is part of the catalytic core unit; Region: OBF_DNA_ligase_LigC; cd07970 717522010495 DNA binding site [nucleotide binding] 717522010496 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4402 717522010497 Members of the Nudix hydrolase superfamily catalyze the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+, for their activity and contain a highly...; Region: Nudix_Hydrolase_5; cd04662 717522010498 nudix motif; other site 717522010499 acyltransferase, WS/DGAT/MGAT; Region: acyl_WS_DGAT; TIGR02946 717522010500 Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007 717522010501 Uncharacterized conserved protein [Function unknown]; Region: COG1839 717522010502 Arabinose-binding domain of AraC transcription regulator, N-term; Region: Arabinose_bd; pfam12625 717522010503 helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342 717522010504 Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165 717522010505 Uncharacterized conserved protein [Function unknown]; Region: COG2966 717522010506 Protein of unknown function (DUF1212); Region: DUF1212; pfam06738 717522010507 Uncharacterized conserved protein [Function unknown]; Region: COG3610 717522010509 N-RD25 Region of difference N-RD25, deleted region in Mycobacterium bovis BCG Pasteur, Mycobacterium bovis AF2122/97, BCG Tokyo, and BCG Mexico,compared to Mycobacterium tuberculosis H37Rv. Removes gene Rv3739c(PPE67) and truncates Rv3738c(PPE66) 717522010510 acyltransferase, WS/DGAT/MGAT; Region: acyl_WS_DGAT; TIGR02946 717522010511 Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007 717522010512 Predicted flavoprotein involved in K+ transport [Inorganic ion transport and metabolism]; Region: TrkA; COG2072 717522010513 Predicted flavoprotein involved in K+ transport [Inorganic ion transport and metabolism]; Region: TrkA; COG2072 717522010514 Malate:quinone oxidoreductase (Mqo); Region: Mqo; cl17341 717522010515 heavy metal translocating P-type ATPase; Region: ATPase-IB_hvy; TIGR01525 717522010516 E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122 717522010517 Soluble P-type ATPase [General function prediction only]; Region: COG4087 717522010518 Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090 717522010519 dimerization interface [polypeptide binding]; other site 717522010520 putative DNA binding site [nucleotide binding]; other site 717522010521 putative Zn2+ binding site [ion binding]; other site 717522010522 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3651 717522010523 DNA binding domain, excisionase family; Region: excise; TIGR01764 717522010524 DNA breaking-rejoining enzymes, C-terminal catalytic domain. The DNA breaking-rejoining enzyme superfamily includes type IB topoisomerases and tyrosine recombinases that share the same fold in their catalytic domain containing six conserved active site...; Region: DNA_BRE_C; cl00213 717522010525 active site 717522010526 Int/Topo IB signature motif; other site 717522010527 Nucleoside deaminases include adenosine, guanine and cytosine deaminases. These enzymes are Zn dependent and catalyze the deamination of nucleosides. The zinc ion in the active site plays a central role in the proposed catalytic mechanism, activating a...; Region: nucleoside_deaminase; cd01285 717522010528 nucleoside/Zn binding site; other site 717522010529 dimer interface [polypeptide binding]; other site 717522010530 catalytic motif [active] 717522010531 putative tRNA adenosine deaminase-associated protein; Region: tRNA_deam_assoc; TIGR03941 717522010532 prephenate dehydrogenase; Validated; Region: PRK06545 717522010533 prephenate dehydrogenase; Validated; Region: PRK08507 717522010534 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3554 717522010535 Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261 717522010536 ABC-ATPase subunit interface; other site 717522010537 ABC-type proline/glycine betaine transport systems, permease component [Amino acid transport and metabolism]; Region: OpuBB; COG1174 717522010538 ABC-type proline/glycine betaine transport systems, ATPase components [Amino acid transport and metabolism]; Region: OpuBA; COG1125 717522010539 ATP-binding cassette domain of the osmoprotectant transporter; Region: ABC_OpuCA_Osmoprotection; cd03295 717522010540 Walker A/P-loop; other site 717522010541 ATP binding site [chemical binding]; other site 717522010542 Q-loop/lid; other site 717522010543 ABC transporter signature motif; other site 717522010544 Walker B; other site 717522010545 D-loop; other site 717522010546 H-loop/switch region; other site 717522010547 Periplasmic glycine betaine/choline-binding (lipo)protein of an ABC-type transport system (osmoprotectant binding protein) [Cell envelope biogenesis, outer membrane]; Region: OpuBC; COG1732 717522010548 Uncharacterized integral membrane protein [Function unknown]; Region: COG5416 717522010549 Acyl-CoA dehydrogenase (ACAD) 10 and 11, N-terminal domain, and similar proteins. This subfamily is part of a larger superfamily that includes the catalytic domains of other kinases, such as the typical serine/threonine/tyrosine protein kinases (PKs); Region: ACAD10_11_like; cd05154 717522010550 putative active site [active] 717522010551 putative substrate binding site [chemical binding]; other site 717522010552 ATP binding site [chemical binding]; other site 717522010553 Alkyl sulfatase and related hydrolases [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG2015 717522010554 Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849 717522010555 Mycobacterium 19 kDa lipoprotein antigen; Region: Myco_19_kDa; pfam05481 717522010556 Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642 717522010557 HAMP (Histidine kinases, Adenylyl cyclases, Methyl binding proteins, Phosphatases) domain; Region: HAMP; smart00304 717522010558 dimerization interface [polypeptide binding]; other site 717522010559 Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082 717522010560 dimer interface [polypeptide binding]; other site 717522010561 phosphorylation site [posttranslational modification] 717522010562 Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075 717522010563 ATP binding site [chemical binding]; other site 717522010564 Mg2+ binding site [ion binding]; other site 717522010565 G-X-G motif; other site 717522010566 Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745 717522010567 Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156 717522010568 active site 717522010569 phosphorylation site [posttranslational modification] 717522010570 intermolecular recognition site; other site 717522010571 dimerization interface [polypeptide binding]; other site 717522010572 Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383 717522010573 DNA binding site [nucleotide binding] 717522010574 Photosystem II reaction centre W protein (PsbW); Region: PsbW; cl06243 717522010575 O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315 717522010576 methyltransferase, TIGR00027 family; Region: mthyl_TIGR00027 717522010577 SnoaL-like domain; Region: SnoaL_2; pfam12680 717522010578 Histidinol-phosphate/aromatic aminotransferase and cobyric acid decarboxylase [Amino acid transport and metabolism]; Region: HisC; COG0079 717522010579 Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609 717522010580 pyridoxal 5'-phosphate binding site [chemical binding]; other site 717522010581 homodimer interface [polypeptide binding]; other site 717522010582 catalytic residue [active] 717522010583 uncharacterized Actinobacterial protein TIGR03083; Region: TIGR03083 717522010584 TIGR03086 family protein; Region: TIGR03086 717522010585 uncharacterized Actinobacterial protein TIGR03083; Region: TIGR03083 717522010586 enoyl-CoA hydratase; Provisional; Region: PRK06142 717522010587 Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558 717522010588 substrate binding site [chemical binding]; other site 717522010589 oxyanion hole (OAH) forming residues; other site 717522010590 trimer interface [polypeptide binding]; other site 717522010591 Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680 717522010592 Beta-lactamase; Region: Beta-lactamase; pfam00144 717522010593 Domain of unknown function (DUF222); Region: DUF222; pfam02720 717522010594 HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085 717522010595 active site 717522010596 putative NAD(P)H quinone oxidoreductase, PIG3 family; Region: quinone_pig3; TIGR02824 717522010597 PIG3 p53-inducible quinone oxidoreductase; Region: p53_inducible_oxidoreductase; cd05276 717522010598 NAD(P) binding site [chemical binding]; other site 717522010599 Selenocysteine lyase/Cysteine desulfurase [Posttranslational modification, protein turnover, chaperones]; Region: csdA; COG0520 717522010600 cysteine desulfurase family protein, VC1184 subfamily; Region: am_tr_V_VC1184; TIGR01976 717522010601 pyridoxal 5'-phosphate binding pocket [chemical binding]; other site 717522010602 catalytic residue [active] 717522010603 Protein of unknown function (DUF2587); Region: DUF2587; pfam10759 717522010604 ABC-type polysaccharide/polyol phosphate transport system, ATPase component [Carbohydrate transport and metabolism / Cell envelope biogenesis, outer membrane]; Region: TagH; COG1134 717522010605 ATP-binding cassette component of polysaccharide transport system; Region: ABC_KpsT_Wzt; cd03220 717522010606 Walker A/P-loop; other site 717522010607 ATP binding site [chemical binding]; other site 717522010608 Q-loop/lid; other site 717522010609 ABC transporter signature motif; other site 717522010610 Walker B; other site 717522010611 D-loop; other site 717522010612 H-loop/switch region; other site 717522010613 Predicted glycosyltransferases [General function prediction only]; Region: COG1216 717522010614 Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394 717522010615 active site 717522010616 ABC-type polysaccharide/polyol phosphate export systems, permease component [Carbohydrate transport and metabolism / Cell envelope biogenesis, outer membrane]; Region: TagG; COG1682 717522010617 ABC-2 type transporter; Region: ABC2_membrane; pfam01061 717522010618 Nucleoside-diphosphate-sugar epimerases [Cell envelope biogenesis, outer membrane / Carbohydrate transport and metabolism]; Region: WcaG; COG0451 717522010619 Arna decarboxylase_like, extended (e) SDRs; Region: Arna_like_SDR_e; cd05257 717522010620 NAD binding site [chemical binding]; other site 717522010621 substrate binding site [chemical binding]; other site 717522010622 active site 717522010623 Glycosyltransferases involved in cell wall biogenesis [Cell envelope biogenesis, outer membrane]; Region: WcaA; COG0463 717522010624 Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394 717522010625 active site 717522010626 Membrane proteins related to metalloendopeptidases [Cell envelope biogenesis, outer membrane]; Region: NlpD; COG0739 717522010627 Peptidase family M23; Region: Peptidase_M23; pfam01551 717522010628 O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315 717522010629 methyltransferase, TIGR00027 family; Region: mthyl_TIGR00027 717522010630 nucleoside diphosphate kinase regulator; Provisional; Region: PRK05892 717522010631 Transcription elongation factor, GreA/GreB, C-term; Region: GreA_GreB; pfam01272 717522010632 Predicted membrane protein [Function unknown]; Region: COG2246 717522010633 GtrA-like protein; Region: GtrA; pfam04138 717522010634 FAD/FMN-containing dehydrogenases [Energy production and conversion]; Region: GlcD; COG0277 717522010635 FAD binding domain; Region: FAD_binding_4; pfam01565 717522010636 D-arabinono-1,4-lactone oxidase; Region: ALO; pfam04030 717522010637 short chain dehydrogenase; Provisional; Region: PRK07904 717522010638 Short-chain dehydrogenases of various substrate specificities [General function prediction only]; Region: DltE; COG0300 717522010639 NAD(P) binding site [chemical binding]; other site 717522010640 active site 717522010641 Arabinofuranosyltransferase N terminal; Region: AftA_N; pfam12250 717522010642 Arabinofuranosyltransferase A C terminal; Region: AftA_C; pfam12249 717522010643 Mycobacterial cell wall arabinan synthesis protein; Region: Arabinose_trans; pfam04602 717522010644 Mycobacterial cell wall arabinan synthesis protein; Region: Arabinose_trans; pfam04602 717522010645 Mycobacterial cell wall arabinan synthesis protein; Region: Arabinose_trans; pfam04602 717522010646 Metal-dependent hydrolases of the beta-lactamase superfamily III [General function prediction only]; Region: ElaC; COG1234 717522010647 Proteins involved in DNA damage response, similar to the AidB gene product; Region: AidB; cd01154 717522010648 Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960 717522010649 FAD binding site [chemical binding]; other site 717522010650 substrate binding site [chemical binding]; other site 717522010651 catalytic residues [active] 717522010652 Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3464 717522010653 Transposase; Region: DDE_Tnp_ISL3; pfam01610 717522010654 Acetyl-CoA carboxylase, carboxyltransferase component (subunits alpha and beta) [Lipid metabolism]; Region: COG4799 717522010655 malonate decarboxylase subunit beta; Reviewed; Region: PRK07189; cl17682 717522010656 Acetyl-CoA carboxylase alpha subunit [Lipid metabolism]; Region: AccA; cl17345 717522010657 Phosphopantetheine attachment site; Region: PKS_PP; smart00823 717522010658 polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833 717522010659 Beta-ketoacyl synthase; Region: PKS_KS; smart00825 717522010660 active site 717522010661 malonyl CoA-acyl carrier protein transacylase; Region: fabD; TIGR00128 717522010662 Acyl transferase domain in polyketide synthase (PKS) enzymes; Region: PKS_AT; smart00827 717522010663 Phosphopantetheine attachment site; Region: PKS_PP; smart00823 717522010664 Thioesterase domains of type I polyketide synthases or non-ribosomal peptide synthetases [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3319 717522010665 long-chain-fatty-acid--CoA ligase; Validated; Region: PRK07769 717522010666 Fatty acyl-AMP ligase (FAAL); Region: FAAL; cd05931 717522010667 acyl-activating enzyme (AAE) consensus motif; other site 717522010668 active site 717522010669 Cutinase; Region: Cutinase; pfam01083 717522010670 Predicted esterase [General function prediction only]; Region: COG0627 717522010671 Putative esterase; Region: Esterase; pfam00756 717522010672 phosphoribose diphosphate:decaprenyl-phosphate phosphoribosyltransferase; Provisional; Region: PRK12324 717522010673 PAP2_like proteins, a super-family of histidine phosphatases and vanadium haloperoxidases, includes type 2 phosphatidic acid phosphatase or lipid phosphate phosphatase (LPP), Glucose-6-phosphatase, Phosphatidylglycerophosphatase B and bacterial acid...; Region: PAP2_like; cd01610 717522010674 active site 717522010675 Predicted glycosyltransferases [General function prediction only]; Region: COG1216 717522010676 Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394 717522010677 active site 717522010678 UDP-galactopyranose mutase [Cell envelope biogenesis, outer membrane]; Region: Glf; COG0562 717522010679 NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450 717522010680 UDP-galactopyranose mutase; Region: GLF; pfam03275 717522010681 Uncharacterized protein potentially involved in peptidoglycan biosynthesis [Cell envelope biogenesis, outer membrane]; Region: COG5479 717522010682 Peptidoglycan recognition proteins (PGRPs) are pattern recognition receptors that bind, and in certain cases, hydrolyze peptidoglycans (PGNs) of bacterial cell walls. PGRPs have been divided into three classes: short PGRPs (PGRP-S), that are small (20...; Region: PGRP; cd06583 717522010683 amidase catalytic site [active] 717522010684 Zn binding residues [ion binding]; other site 717522010685 substrate binding site [chemical binding]; other site 717522010686 LGFP repeat; Region: LGFP; pfam08310 717522010687 PE family; Region: PE; pfam00934 717522010688 Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427 717522010689 haloacid dehalogenase-like hydrolase; Region: Hydrolase_3; pfam08282 717522010690 active site 717522010691 motif I; other site 717522010692 motif II; other site 717522010693 haloacid dehalogenase-like hydrolase; Region: HAD; cl17202 717522010694 1-acyl-sn-glycerol-3-phosphate acyltransferase [Lipid metabolism]; Region: PlsC; COG0204 717522010695 Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: AGPAT-like; Region: LPLAT_AGPAT-like; cd07989 717522010696 putative acyl-acceptor binding pocket; other site 717522010697 1-acyl-sn-glycerol-3-phosphate acyltransferase [Lipid metabolism]; Region: PlsC; COG0204 717522010698 Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: AGPAT-like; Region: LPLAT_AGPAT-like; cd07989 717522010699 putative acyl-acceptor binding pocket; other site 717522010700 1-acyl-sn-glycerol-3-phosphate acyltransferase [Lipid metabolism]; Region: PlsC; COG0204 717522010701 Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: AGPAT-like; Region: LPLAT_AGPAT-like; cd07989 717522010702 putative acyl-acceptor binding pocket; other site 717522010703 Aminoglycoside 3'-phosphotransferase (APH). The APH subfamily is part of a larger superfamily that includes the catalytic domains of other kinases, such as the typical serine/threonine/tyrosine protein kinases (PKs), RIO kinases, actin-fragmin...; Region: APH; cd05150 717522010704 Phosphotransferase enzyme family; Region: APH; pfam01636 717522010705 active site 717522010706 ATP binding site [chemical binding]; other site 717522010707 antibiotic binding site [chemical binding]; other site 717522010708 Predicted Zn-dependent hydrolases of the beta-lactamase fold [General function prediction only]; Region: COG2220 717522010709 Metallo-beta-lactamase superfamily; Region: Lactamase_B; cl00446 717522010710 Rieske domain; a [2Fe-2S] cluster binding domain commonly found in Rieske non-heme iron oxygenase (RO) systems such as naphthalene and biphenyl dioxygenases, as well as in plant/cyanobacterial chloroplast b6f and mitochondrial cytochrome bc(1) complexes; Region: Rieske; cl00938 717522010711 iron-sulfur cluster [ion binding]; other site 717522010712 [2Fe-2S] cluster binding site [ion binding]; other site 717522010713 Condensation domain; Region: Condensation; pfam00668 717522010714 Protein of unknown function (DUF2910); Region: DUF2910; pfam11139 717522010715 PE-PPE domain; Region: PE-PPE; pfam08237 717522010716 Predicted drug exporters of the RND superfamily [General function prediction only]; Region: COG2409 717522010717 Condensation domain; Region: Condensation; pfam00668 717522010718 Polyketide synthase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3321 717522010719 polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833 717522010720 active site 717522010721 Acyl transferase domain; Region: Acyl_transf_1; cl08282 717522010722 Dehydratase domain in polyketide synthase (PKS) enzymes; Region: PKS_DH; smart00826 717522010723 Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931 717522010724 enoyl reductase of polyketide synthase; Region: enoyl_red; cd05195 717522010725 Enoylreductase; Region: PKS_ER; smart00829 717522010726 NAD(P) binding site [chemical binding]; other site 717522010727 beta-ketoacyl reductase (KR) domain of fatty acid synthase (FAS), subgroup 2, complex (x); Region: KR_2_FAS_SDR_x; cd08955 717522010728 KR domain; Region: KR; pfam08659 717522010729 putative NADP binding site [chemical binding]; other site 717522010730 active site 717522010731 Phosphopantetheine attachment site; Region: PKS_PP; smart00823 717522010733 RDMex02 Deleted region in Mycobacterium bovis BCG Mexico compared to Mycobacterium bovis BCG Pasteur. Truncates gene BCG_3889 717522010734 Helix-turn-helix domain; Region: HTH_OrfB_IS605; pfam12323 717522010735 Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG0675 717522010736 Probable transposase; Region: OrfB_IS605; pfam01385 717522010737 Predicted site-specific integrase-resolvase [DNA replication, recombination, and repair]; Region: COG2452 717522010738 Serine Recombinase family, catalytic domain; a DNA binding domain may be present either N- or C-terminal to the catalytic domain. These enzymes perform site-specific recombination of DNA molecules by a concerted, four-strand cleavage and rejoining...; Region: Ser_Recombinase; cl02788 717522010739 catalytic residues [active] 717522010740 catalytic nucleophile [active] 717522010741 Phytoene dehydrogenase and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG1233 717522010742 NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450 717522010743 mycofactocin system transcriptional regulator; Region: mycofact_TetR; TIGR03968 717522010744 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522010745 Protein of unknown function (DUF2834); Region: DUF2834; pfam11196 717522010746 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440 717522010747 S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I; AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cl17173 717522010748 Cupin domain; Region: Cupin_2; cl17218 717522010749 Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165 717522010750 helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342 717522010751 seryl-tRNA synthetase; Provisional; Region: PRK05431 717522010752 Seryl-tRNA synthetase N-terminal domain; Region: Seryl_tRNA_N; pfam02403 717522010753 Seryl-tRNA synthetase (SerRS) class II core catalytic domain. SerRS is responsible for the attachment of serine to the 3' OH group of ribose of the appropriate tRNA. This domain It is primarily responsible for ATP-dependent formation of the enzyme...; Region: SerRS_core; cd00770 717522010754 dimer interface [polypeptide binding]; other site 717522010755 active site 717522010756 motif 1; other site 717522010757 motif 2; other site 717522010758 motif 3; other site 717522010759 Septum formation; Region: Septum_form; pfam13845 717522010760 Septum formation; Region: Septum_form; pfam13845 717522010761 Minimal MMP-like domain found in Acidothermus cellulolyticus hypothetical protein ACEL2062 and similar protein; Region: MMP_ACEL2062; cd12952 717522010762 Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067 717522010763 catalytic core [active] 717522010764 prephenate dehydratase; Provisional; Region: PRK11898 717522010765 Prephenate dehydratase; Region: PDT; pfam00800 717522010766 C-terminal ACT domain of the bifunctional chorismate mutase-prephenate dehydratase (CM-PDT) enzyme and the prephenate dehydratase (PDT) enzyme; Region: ACT_CM-PDT; cd04905 717522010767 putative L-Phe binding site [chemical binding]; other site 717522010768 Transcriptional regulator [Transcription]; Region: LytR; COG1316 717522010769 nonheme-containing ferritins; Region: Nonheme_Ferritin; cd01055 717522010770 Ferritin-like domain; Region: Ferritin; pfam00210 717522010771 ferroxidase diiron center [ion binding]; other site 717522010772 Glycerophosphodiester phosphodiesterase domain of uncharacterized bacterial glycerophosphodiester phosphodiesterases; Region: GDPD_like_2; cd08582 717522010773 Glycerophosphoryl diester phosphodiesterase family; Region: GDPD; pfam03009 717522010774 putative active site [active] 717522010775 catalytic site [active] 717522010776 putative metal binding site [ion binding]; other site 717522010777 Domain of unknown function (DUF4328); Region: DUF4328; pfam14219 717522010778 Transposase; Region: DEDD_Tnp_IS110; pfam01548 717522010779 Superoxide dismutase [Inorganic ion transport and metabolism]; Region: SodA; COG0605 717522010780 Iron/manganese superoxide dismutases, alpha-hairpin domain; Region: Sod_Fe_N; pfam00081 717522010781 Iron/manganese superoxide dismutases, C-terminal domain; Region: Sod_Fe_C; pfam02777 717522010782 Predicted membrane protein [Function unknown]; Region: COG2119 717522010783 Uncharacterized protein family UPF0016; Region: UPF0016; pfam01169 717522010784 Uncharacterized protein family UPF0016; Region: UPF0016; pfam01169 717522010785 Fimbrial protein; Region: Fimbrial; cl01416 717522010786 ribonuclease activity regulator protein RraA; Provisional; Region: PRK09372 717522010787 Predicted flavoprotein involved in K+ transport [Inorganic ion transport and metabolism]; Region: TrkA; COG2072 717522010788 Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox_3; pfam13738 717522010789 Transcriptional regulator [Transcription]; Region: AcrR; COG1309 717522010790 Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440 717522010791 hypothetical protein; Provisional; Region: PRK07945 717522010792 RelA- and SpoT-like ppGpp Synthetases and Hydrolases, catalytic domain; Region: Rel-Spo_like; cl11966 717522010793 Polymerase and Histidinol Phosphatase domain of bacterial polymerase X; Region: PHP_PolX; cd07436 717522010794 active site 717522010795 glutamate synthase subunit beta; Reviewed; Region: gltD; PRK12810 717522010796 NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450 717522010797 glutamate synthase subunit alpha; Provisional; Region: gltB; PRK11750 717522010798 Glutamine amidotransferases class-II (Gn-AT), glutamate synthase (GltS)-type. GltS is a homodimer that synthesizes L-glutamate from 2-oxoglutarate and L-glutamine, an important step in ammonia assimilation in bacteria, cyanobacteria and plants. The...; Region: GltS; cd00713 717522010799 active site 717522010800 dimer interface [polypeptide binding]; other site 717522010801 Glutamate synthase central domain; Region: Glu_syn_central; pfam04898 717522010802 Glutamate synthase (GltS) FMN-binding domain. GltS is a complex iron-sulfur flavoprotein that catalyzes the reductive synthesis of L-glutamate from 2-oxoglutarate and L-glutamine via intramolecular channelling of ammonia, a reaction in the plant, yeast...; Region: GltS_FMN; cd02808 717522010803 active site 717522010804 FMN binding site [chemical binding]; other site 717522010805 substrate binding site [chemical binding]; other site 717522010806 3Fe-4S cluster binding site [ion binding]; other site 717522010807 gltb_C. This domain is found at the C-terminus of the large subunit (gltB) of glutamate synthase (GltS). GltS encodes a complex iron-sulfur flavoprotein that catalyzes the synthesis of L-glutamate from L-glutamine and 2-oxoglutarate. It requires the...; Region: gltB_C; cd00982 717522010808 domain interface; other site 717522010809 RDMex03 Deleted region in Mycobacterium bovis BCG Mexico compared to Mycobacterium bovis BCG Pasteur. Removes genes BCG_3923, BCG_3924 and BCG_3925c, and truncates genes BCG_3926 717522010810 FOG: FHA domain [Signal transduction mechanisms]; Region: COG1716 717522010811 Protein of unknown function (DUF2580); Region: DUF2580; pfam10824 717522010812 EspG family; Region: ESX-1_EspG; pfam14011 717522010813 type VII secretion AAA-ATPase EccA; Region: T7SS_EccA; TIGR03922 717522010814 The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009 717522010815 Walker A motif; other site 717522010816 ATP binding site [chemical binding]; other site 717522010817 Walker B motif; other site 717522010818 arginine finger; other site 717522010819 Protein of unknown function (DUF690); Region: DUF690; pfam05108 717522010820 type VII secretion protein EccCa; Region: T7SS_EccC_a; TIGR03924 717522010821 FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580 717522010822 FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580 717522010823 FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580 717522010824 RD1 Region of difference RD1, deleted region in Mycobacterium bovis BCG Pasteur, BCG Tokyo and BCG Mexico compared to Mycobacterium tuberculosis H37Rv and Mycobacterium bovis AF2122/97. Removes genes Rv3872-Rv3879c 717522010825 YbaB/EbfC DNA-binding family; Region: YbaB_DNA_bd; pfam02575 717522010826 type VII secretion protein EccE; Region: T7SS_EccE; TIGR03923 717522010827 Peptidase domain in the S8 and S53 families; Region: Peptidases_S8_S53; cl10459 717522010828 type VII secretion-associated serine protease mycosin; Region: T7SS_mycosin; TIGR03921 717522010829 active site 717522010830 catalytic residues [active] 717522010831 type VII secretion AAA-ATPase EccA; Region: T7SS_EccA; TIGR03922 717522010832 The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009 717522010833 Walker A motif; other site 717522010834 ATP binding site [chemical binding]; other site 717522010835 Walker B motif; other site 717522010836 arginine finger; other site 717522010837 type VII secretion protein EccE; Region: T7SS_EccE; TIGR03923 717522010838 Peptidase domain in the S8 and S53 families; Region: Peptidases_S8_S53; cl10459 717522010839 catalytic residues [active] 717522010840 Peptidase domain in the S8 and S53 families; Region: Peptidases_S8_S53; cl10459 717522010841 active site 717522010842 catalytic residues [active] 717522010843 type VII secretion integral membrane protein EccD; Region: T7SS_EccD; TIGR03920 717522010844 In Mycobacterium bovis, a deletion of 2406 bp (RDpan) leads to the loss of the NH2 part of Rv3887c, the entire Rv3888c and the COOH part of Rv3889c compared to Mycobacterium tuberculosis strain H37Rv, Mycobacterium bovis BCG Pasteur, BCG Tokyo and BCG Mexico. Differs from Mb3917c by 1aa D346G in BCG Pasteur, BCG Tokyo and BCG Mexico 717522010845 Antiactivator of flagellar biosynthesis FleN, an ATPase [Cell motility]; Region: flhG; COG0455 717522010846 EspG family; Region: ESX-1_EspG; pfam14011 717522010847 Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4842 717522010848 Proteins of 100 residues with WXG; Region: WXG100; pfam06013 717522010849 PPE family; Region: PPE; pfam00823 717522010850 type VII secretion protein EccCb; Region: T7SS_EccC_b; TIGR03925 717522010851 FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580 717522010852 FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580 717522010853 type VII secretion protein EccCa; Region: T7SS_EccC_a; TIGR03924 717522010854 FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580 717522010855 Protein of unknown function (DUF690); Region: DUF690; pfam05108 717522010856 lysozyme_like domain. This contains several members including Soluble Lytic Transglycosylases (SLT), Goose Egg-White Lysozymes (GEWL), Hen Egg-White Lysozymes (HEWL), chitinases, bacteriophage lambda lysozymes, endolysins, autolysins, and chitosanases; Region: lysozyme_like; cl00222 717522010857 catalytic residue [active] 717522010859 Protein of unknown function (DUF4237); Region: DUF4237; pfam14021 717522010860 Proteins of 100 residues with WXG; Region: WXG100; cl02005 717522010861 tRNA adenylyltransferase; Region: tRNA_CCA_actino; TIGR02692 717522010862 Nucleotidyltransferase (NT) domain of ClassII CCA-adding enzymes; Region: NT_ClassII-CCAase; cd05398 717522010863 active site 717522010864 NTP binding site [chemical binding]; other site 717522010865 metal binding triad [ion binding]; metal-binding site 717522010866 Probable RNA and SrmB- binding site of polymerase A; Region: PolyA_pol_RNAbd; pfam12627 717522010867 Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077 717522010868 Zn2+ binding site [ion binding]; other site 717522010869 Mg2+ binding site [ion binding]; other site 717522010870 tRNA nucleotidyltransferase domain 2 putative; Region: tRNA_NucTran2_2; pfam13735 717522010871 Diadenosine hexaphosphate (Ap6A) hydrolase is a member of the Nudix hydrolase superfamily. Ap6A hydrolase specifically hydrolyzes diadenosine polyphosphates, but not ATP or diadenosine triphosphate, and it generates ATP as the product. Ap6A, the most...; Region: Ap6A_hydrolase; cd03673 717522010872 active site 717522010873 Ap6A binding site [chemical binding]; other site 717522010874 nudix motif; other site 717522010875 metal binding site [ion binding]; metal-binding site 717522010876 Uncharacterized membrane protein, putative virulence factor [General function prediction only]; Region: MviN; COG0728 717522010877 MurJ/MviN, a subfamily of the multidrug and toxic compound extrusion (MATE)-like proteins; Region: MATE_MurJ_like; cd13123 717522010878 RNA polymerase sigma factor SigM; Reviewed; Region: PRK09643 717522010879 Sigma-70 region 2; Region: Sigma70_r2; pfam04542 717522010880 Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171 717522010881 DNA binding residues [nucleotide binding] 717522010883 thioredoxin-disulfide reductase; Region: TRX_reduct; TIGR01292 717522010884 NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500 717522010885 Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070 717522010886 TRX family; composed of two groups: Group I, which includes proteins that exclusively encode a TRX domain; and Group II, which are composed of fusion proteins of TRX and additional domains. Group I TRX is a small ancient protein that alter the redox...; Region: TRX_family; cd02947 717522010887 Thioredoxin-like; Region: Thioredoxin_8; pfam13905 717522010888 catalytic residues [active] 717522010889 Putative peptidoglycan-binding domain-containing protein [Cell envelope biogenesis, outer membrane]; Region: COG3409 717522010890 Putative peptidoglycan binding domain; Region: PG_binding_1; pfam01471 717522010891 Putative peptidoglycan binding domain; Region: PG_binding_1; pfam01471 717522010892 N-acetylmuramoyl-L-alanine amidase [Cell envelope biogenesis, outer membrane]; Region: AmiC; COG0860 717522010893 N-acetylmuramoyl-L-alanine amidase or MurNAc-LAA (also known as peptidoglycan aminohydrolase, NAMLA amidase, NAMLAA, Amidase 3, and peptidoglycan amidase; EC 3.5.1.28) is an autolysin that hydrolyzes the amide bond between N-acetylmuramoyl and L-amino...; Region: MurNAc-LAA; cd02696 717522010894 active site 717522010895 metal binding site [ion binding]; metal-binding site 717522010896 ParB/RepB/Spo0J family partition protein; Region: parB_part; TIGR00180 717522010897 ParB-like nuclease domain; Region: ParB; smart00470 717522010898 ATPases involved in chromosome partitioning [Cell division and chromosome partitioning]; Region: Soj; COG1192 717522010899 ParA and ParB of Caulobacter crescentus belong to a conserved family of bacterial proteins implicated in chromosome segregation. ParB binds to DNA sequences adjacent to the origin of replication and localizes to opposite cell poles shortly following the...; Region: ParA; cd02042 717522010900 P-loop; other site 717522010901 Magnesium ion binding site [ion binding]; other site 717522010902 ParA and ParB of Caulobacter crescentus belong to a conserved family of bacterial proteins implicated in chromosome segregation. ParB binds to DNA sequences adjacent to the origin of replication and localizes to opposite cell poles shortly following the...; Region: ParA; cd02042 717522010903 Magnesium ion binding site [ion binding]; other site 717522010904 rRNA small subunit methyltransferase G; Region: GidB; pfam02527 717522010905 16S rRNA methyltransferase GidB; Reviewed; Region: gidB; PRK00107 717522010906 Predicted RNA-binding protein [General function prediction only]; Region: Jag; COG1847 717522010907 jag_K homology RNA-binding domain. The KH domain is found in proteins homologous to the Bacillus subtilis protein Jag, which is associated with SpoIIIJ and is necessary for the third stage of sporulation. The KH motif is a beta-alpha-alpha-beta-beta...; Region: jag_KH; cd02414 717522010908 G-X-X-G motif; other site 717522010909 R3H domain found in proteins homologous to Bacillus subtilus Jag, which is associated with SpoIIIJ. SpoIIIJ is necessary for the third stage of sporulation. The name of the R3H domain comes from the characteristic spacing of the most conserved arginine...; Region: R3H_jag; cd02644 717522010910 RxxxH motif; other site 717522010911 putative inner membrane protein translocase component YidC; Provisional; Region: PRK03449 717522010912 Uncharacterized conserved protein [Function unknown]; Region: COG0759 717522010913 ribonuclease P; Reviewed; Region: rnpA; PRK00588 717522010914 50S ribosomal protein L34; Reviewed; Region: rpmH; PRK00399