-- dump date   	20140619_151606
-- class       	Genbank::misc_feature
-- table       	misc_feature_note
-- id	note
561275000001	chromosomal replication initiator protein DnaA; Region: DnaA; TIGR00362
561275000002	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
561275000003	Walker A motif; other site
561275000004	ATP binding site [chemical binding]; other site
561275000005	Walker B motif; other site
561275000006	arginine finger; other site
561275000007	C-terminal domain of bacterial DnaA proteins. The DNA-binding C-terminal domain of DnaA contains a helix-turn-helix motif that specifically interacts with the DnaA box, a 9-mer motif that occurs repetitively in the replication origin oriC. Multiple...; Region: Bac_DnaA_C; cd06571
561275000008	DnaA box-binding interface [nucleotide binding]; other site
561275000009	DNA polymerase III subunit beta; Validated; Region: PRK07761
561275000010	Beta clamp domain.  The beta subunit (processivity factor) of DNA polymerase III holoenzyme, refered to as the beta clamp, forms a ring shaped dimer that encircles dsDNA (sliding clamp) in bacteria.  The beta-clamp is structurally similar to the trimeric...; Region: beta_clamp; cd00140
561275000011	putative DNA binding surface [nucleotide binding]; other site
561275000012	dimer interface [polypeptide binding]; other site
561275000013	beta-clamp/clamp loader binding surface; other site
561275000014	beta-clamp/translesion DNA polymerase binding surface; other site
561275000015	recF protein; Region: recf; TIGR00611
561275000016	ATP-binding cassette domain of RecF; Region: ABC_RecF; cd03242
561275000017	Walker A/P-loop; other site
561275000018	ATP binding site [chemical binding]; other site
561275000019	Q-loop/lid; other site
561275000020	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
561275000021	ABC transporter signature motif; other site
561275000022	Walker B; other site
561275000023	D-loop; other site
561275000024	H-loop/switch region; other site
561275000025	hypothetical protein; Provisional; Region: PRK03195
561275000026	DNA gyrase subunit B; Validated; Region: gyrB; PRK05644
561275000027	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
561275000028	Mg2+ binding site [ion binding]; other site
561275000029	G-X-G motif; other site
561275000030	TopoIIA_Trans_DNA_gyrase: Transducer domain, having a ribosomal S5 domain 2-like fold, of the type found in proteins of the type IIA family of DNA topoisomerases similar to the B subunits of E. coli DNA gyrase and E. coli Topoisomerase IV which are; Region: TopoII_Trans_DNA_gyrase; cd00822
561275000031	anchoring element; other site
561275000032	dimer interface [polypeptide binding]; other site
561275000033	ATP binding site [chemical binding]; other site
561275000034	TOPRIM_TopoIIA_GyrB: topoisomerase-primase (TOPRIM) nucleotidyl transferase/hydrolase domain of the type found in proteins of the type IIA family of DNA topoisomerases similar to the Escherichia coli GyrB subunit. TopoIIA enzymes cut both strands of the...; Region: TOPRIM_TopoIIA_GyrB; cd03366
561275000035	active site
561275000036	putative metal-binding site [ion binding]; other site
561275000037	DNA gyrase B subunit, carboxyl terminus; Region: DNA_gyraseB_C; pfam00986
561275000038	DNA gyrase subunit A; Validated; Region: PRK05560
561275000039	DNA Topoisomerase, subtype IIA; domain A'; bacterial DNA topoisomerase IV (C subunit, ParC), bacterial DNA gyrases (A subunit, GyrA),mammalian DNA toposiomerases II. DNA topoisomerases are essential enzymes that regulate the conformational changes...; Region: TOP4c; cd00187
561275000040	CAP-like domain; other site
561275000041	active site
561275000042	primary dimer interface [polypeptide binding]; other site
561275000043	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
561275000044	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
561275000045	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
561275000046	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
561275000047	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
561275000048	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
561275000049	Transmembrane domain of unknown function (DUF3566); Region: DUF3566; pfam12089
561275000050	Protein of unknown function (DUF2562); Region: DUF2562; pfam10814
561275000051	cyclophilin: cyclophilin-type peptidylprolyl cis- trans isomerases. This family contains eukaryotic, bacterial and archeal proteins which exhibit a peptidylprolyl cis- trans isomerases activity (PPIase, Rotamase) and in addition bind the...; Region: cyclophilin; cd00317
561275000052	active site
561275000053	Protein of unknown function (DUF2581); Region: DUF2581; pfam10756
561275000054	putative septation inhibitor protein; Reviewed; Region: PRK00159
561275000055	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3879
561275000056	Bacterial protein of unknown function (DUF881); Region: DUF881; pfam05949
561275000057	Type 1 glutamine amidotransferase (GATase1) domain found in Anthranilate synthase; Region: GATase1_Anthranilate_Synthase; cd01743
561275000058	Glutamine amidotransferase class-I; Region: GATase; pfam00117
561275000059	glutamine binding [chemical binding]; other site
561275000060	catalytic triad [active]
561275000061	Serine/Threonine protein kinases, catalytic domain; Region: S_TKc; smart00220
561275000062	Catalytic domain of Protein Kinases; Region: PKc; cd00180
561275000063	active site
561275000064	ATP binding site [chemical binding]; other site
561275000065	substrate binding site [chemical binding]; other site
561275000066	activation loop (A-loop); other site
561275000067	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2815
561275000068	PASTA domain of bacterial serine/threonine kinase pknB-like proteins. PknB is a member of a group of related transmembrane sensor kinases present in many gram positive bacteria, which has been shown to regulate cell shape in Mycobacterium tubercolosis; Region: PASTA_pknB; cd06577
561275000069	PASTA domain of bacterial serine/threonine kinase pknB-like proteins. PknB is a member of a group of related transmembrane sensor kinases present in many gram positive bacteria, which has been shown to regulate cell shape in Mycobacterium tubercolosis; Region: PASTA_pknB; cd06577
561275000070	PASTA domain of bacterial serine/threonine kinase pknB-like proteins. PknB is a member of a group of related transmembrane sensor kinases present in many gram positive bacteria, which has been shown to regulate cell shape in Mycobacterium tubercolosis; Region: PASTA_pknB; cd06577
561275000071	PASTA domain of bacterial serine/threonine kinase pknB-like proteins. PknB is a member of a group of related transmembrane sensor kinases present in many gram positive bacteria, which has been shown to regulate cell shape in Mycobacterium tubercolosis; Region: PASTA_pknB; cd06577
561275000072	There is no tandem duplication of DU1 in BCG Tokyo like that present in BCG Pasteur.
561275000073	Serine/Threonine protein kinases, catalytic domain; Region: S_TKc; smart00220
561275000074	Catalytic domain of Protein Kinases; Region: PKc; cd00180
561275000075	active site
561275000076	ATP binding site [chemical binding]; other site
561275000077	substrate binding site [chemical binding]; other site
561275000078	activation loop (A-loop); other site
561275000079	Cell division protein FtsI/penicillin-binding protein 2 [Cell envelope biogenesis, outer membrane]; Region: FtsI; COG0768
561275000080	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; pfam00905
561275000081	Bacterial cell division membrane protein [Cell division and chromosome partitioning]; Region: FtsW; COG0772
561275000082	Serine/threonine phosphatases, family 2C, catalytic domain; The protein architecture and deduced catalytic mechanism of PP2C phosphatases are similar to the PP1, PP2A, PP2B family of protein Ser/Thr phosphatases, with which PP2C shares no sequence...; Region: PP2Cc; cd00143
561275000083	active site
561275000084	FOG: FHA domain [Signal transduction mechanisms]; Region: COG1716
561275000085	Forkhead associated domain (FHA); found in eukaryotic and prokaryotic proteins. Putative nuclear signalling domain. FHA domains may bind phosphothreonine, phosphoserine and sometimes phosphotyrosine. In eukaryotes, many FHA domain-containing proteins...; Region: FHA; cd00060
561275000086	phosphopeptide binding site; other site
561275000087	Protein of unknown function (DUF2662); Region: DUF3662; pfam12401
561275000088	Forkhead associated domain (FHA); found in eukaryotic and prokaryotic proteins. Putative nuclear signalling domain. FHA domains may bind phosphothreonine, phosphoserine and sometimes phosphotyrosine. In eukaryotes, many FHA domain-containing proteins...; Region: FHA; cd00060
561275000089	FOG: FHA domain [Signal transduction mechanisms]; Region: COG1716
561275000090	phosphopeptide binding site; other site
561275000091	Nitronate monooxygenase; Region: NMO; pfam03060
561275000092	2-Nitropropane dioxygenase (NPD), one of the nitroalkane oxidizing enzyme families, catalyzes oxidative denitrification of nitroalkanes to their corresponding carbonyl compounds and nitrites. NDP is a member of the NAD(P)H-dependent flavin oxidoreductase...; Region: NPD_like; cd04730
561275000093	FMN binding site [chemical binding]; other site
561275000094	substrate binding site [chemical binding]; other site
561275000095	putative catalytic residue [active]
561275000096	Transcription factor WhiB; Region: Whib; pfam02467
561275000097	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
561275000098	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
561275000099	non-specific DNA binding site [nucleotide binding]; other site
561275000100	salt bridge; other site
561275000101	sequence-specific DNA binding site [nucleotide binding]; other site
561275000103	Domain of unknown function (DUF4226); Region: DUF4226; pfam10774
561275000104	Domain of unknown function (DUF4226); Region: DUF4226; pfam10774
561275000105	Protein of unknown function (DUF2580); Region: DUF2580; pfam10824
561275000106	Protein of unknown function (DUF2694); Region: DUF2694; pfam10904
561275000107	Protein of unknown function (DUF2710); Region: DUF2710; pfam10921
561275000108	Acetyltransferase (GNAT) domain; Region: Acetyltransf_6; pfam13480
561275000109	7-keto-8-aminopelargonate synthetase and related enzymes [Coenzyme metabolism]; Region: BioF; COG0156
561275000110	pyridoxal phosphate-dependent acyltransferase, putative; Region: gly_Cac_T_rel; TIGR01825
561275000111	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
561275000112	catalytic residue [active]
561275000113	Acyl carrier protein [Lipid metabolism / Secondary metabolites biosynthesis, transport, and catabolism]; Region: AcpP; COG0236
561275000114	Ketosteroid isomerase-related protein [General function prediction only]; Region: COG3631
561275000115	Acyl-CoA synthetases (AMP-forming)/AMP-acid ligases II [Lipid metabolism / Secondary metabolites biosynthesis, transport, and catabolism]; Region: CaiC; COG0318
561275000116	Fatty acyl-AMP ligase (FAAL); Region: FAAL; cd05931
561275000117	acyl-activating enzyme (AAE) consensus motif; other site
561275000118	active site
561275000119	Mycothiol maleylpyruvate isomerase N-terminal domain; Region: MDMPI_N; pfam11716
561275000120	H+ Antiporter protein; Region: 2A0121; TIGR00900
561275000121	hypothetical protein; Validated; Region: PRK00228
561275000122	Probable lipoprotein LpqN; Region: Lpp-LpqN; pfam10738
561275000123	leucyl-tRNA synthetase; Validated; Region: leuS; PRK00390
561275000124	nucleotidyl transferase superfamily; Region: nt_trans; cl00015
561275000125	active site
561275000126	HIGH motif; other site
561275000127	nucleotide binding site [chemical binding]; other site
561275000128	Leucyl-tRNA synthetase, Domain 2; Region: tRNA-synt_1_2; pfam13603
561275000129	nucleotidyl transferase superfamily; Region: nt_trans; cl00015
561275000130	nucleotidyl transferase superfamily; Region: nt_trans; cl00015
561275000131	active site
561275000132	KMSKS motif; other site
561275000133	Anticodon-binding domain of bacterial and eukaryotic mitochondrial leucyl tRNA synthetases; Region: Anticodon_Ia_Leu_BEm; cd07958
561275000134	tRNA binding surface [nucleotide binding]; other site
561275000135	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
561275000136	MarR family; Region: MarR; pfam01047
561275000137	Transcriptional regulators [Transcription]; Region: FadR; COG2186
561275000138	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
561275000139	DNA-binding site [nucleotide binding]; DNA binding site
561275000140	probable F420-dependent oxidoreductase, MSMEG_2906 family; Region: F420_MSMEG_2906; TIGR03856
561275000141	Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cl07892
561275000142	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
561275000143	Myo-inositol-1-phosphate synthase [Lipid metabolism]; Region: INO1; COG1260
561275000144	Myo-inositol-1-phosphate synthase; Region: NAD_binding_5; cl00554
561275000145	Predicted transcriptional regulators [Transcription]; Region: COG1695
561275000146	Transcriptional regulator PadR-like family; Region: PadR; pfam03551
561275000147	Domain of unknown function (DUF1707); Region: DUF1707; pfam08044
561275000148	Transglycosylase; Region: Transgly; pfam00912
561275000149	penicillin-binding protein, 1A family; Region: PBP_1a_fam; TIGR02074
561275000150	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; pfam00905
561275000151	Predicted integral membrane protein [Function unknown]; Region: COG5650
561275000152	Type 1 glutamine amidotransferase (GATase1)-like domain found in a subgroup of proteins similar to PfpI from Pyrococcus furiosus; Region: GATase1_PfpI_2; cd03139
561275000153	conserved cys residue [active]
561275000154	30S ribosomal protein S6; Reviewed; Region: rpsF; PRK00453
561275000155	Single-stranded DNA-binding protein [DNA replication, recombination, and repair]; Region: Ssb; COG0629
561275000156	SSB_OBF: A subfamily of OB folds similar to the OB fold of ssDNA-binding protein (SSB). SSBs bind with high affinity to ssDNA. They bind to and protect ssDNA intermediates during DNA metabolic pathways. All bacterial and eukaryotic SSBs studied to date...; Region: SSB_OBF; cd04496
561275000157	dimer interface [polypeptide binding]; other site
561275000158	ssDNA binding site [nucleotide binding]; other site
561275000159	tetramer (dimer of dimers) interface [polypeptide binding]; other site
561275000160	30S ribosomal protein S18; Reviewed; Region: rpsR; PRK00391
561275000161	50S ribosomal protein L9; Reviewed; Region: rplI; PRK00137
561275000162	Ribosomal protein L9, N-terminal domain; Region: Ribosomal_L9_N; pfam01281
561275000163	Ribosomal protein L9, C-terminal domain; Region: Ribosomal_L9_C; pfam03948
561275000164	replicative DNA helicase; Validated; Region: PRK07773
561275000165	DnaB-like helicase N terminal domain; Region: DnaB; pfam00772
561275000166	DnaB helicase C terminal domain. The hexameric helicase DnaB unwinds the DNA duplex at the  chromosome replication fork. Although the mechanism by which DnaB both couples ATP hydrolysis to translocation along DNA and denatures the duplex is unknown, a...; Region: DnaB_C; cd00984
561275000167	Walker A motif; other site
561275000168	ATP binding site [chemical binding]; other site
561275000169	Walker B motif; other site
561275000170	DNA binding loops [nucleotide binding]
561275000171	Hedgehog/Intein domain, found in Hedgehog proteins as well as proteins which contain inteins and undergo protein splicing (e.g. DnaB, RIR1-2, GyrA and Pol). In protein splicing an intervening polypeptide sequence - the intein - is excised from a protein; Region: Hint; cd00081
561275000172	protein-splicing catalytic site; other site
561275000173	thioester formation/cholesterol transfer; other site
561275000174	Hedgehog/Intein domain, found in Hedgehog proteins as well as proteins which contain inteins and undergo protein splicing (e.g. DnaB, RIR1-2, GyrA and Pol). In protein splicing an intervening polypeptide sequence - the intein - is excised from a protein; Region: Hint; cd00081
561275000175	protein-splicing catalytic site; other site
561275000176	RecA-like NTPases. This family includes the NTP binding domain of F1 and V1 H+ATPases, DnaB and related helicases as well as bacterial RecA and related eukaryotic and archaeal recombinases. This group also includes bacterial conjugation proteins and...; Region: RecA-like_NTPases; cl17233
561275000177	Macro domain, Poa1p_like family. The macro domain is a high-affinity ADP-ribose binding module found in a variety of proteins as a stand-alone domain or in combination with other domains like in histone macroH2A and some PARPs (poly ADP-ribose...; Region: Macro_Poa1p_like; cd02901
561275000178	ADP-ribose binding site [chemical binding]; other site
561275000179	Predicted phosphatase homologous to the C-terminal domain of histone macroH2A1 [General function prediction only]; Region: COG2110
561275000180	Glycosyl hydrolases family 6; Region: Glyco_hydro_6; pfam01341
561275000181	FAD/FMN-containing dehydrogenases [Energy production and conversion]; Region: GlcD; COG0277
561275000182	FAD binding domain; Region: FAD_binding_4; pfam01565
561275000183	Berberine and berberine like; Region: BBE; pfam08031
561275000184	hypothetical protein; Provisional; Region: PRK12438
561275000185	hypothetical protein; Validated; Region: PRK00068
561275000186	PIN domain of the Pyrobaculum aerophilum Pae0151 and Pae2754 proteins and homologs; Region: PIN_Pae0151; cd09873
561275000187	homotetrameric interface [polypeptide binding]; other site
561275000188	putative active site [active]
561275000189	metal binding site [ion binding]; metal-binding site
561275000190	Monomeric isocitrate dehydrogenase [Energy production and conversion]; Region: Icd; COG2838
561275000191	Monomeric isocitrate dehydrogenase; Region: IDH; pfam03971
561275000192	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275000193	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275000194	short chain dehydrogenase; Provisional; Region: PRK06197
561275000195	retinol dehydrogenase (retinol-DH), Light dependent Protochlorophyllide (Pchlide) OxidoReductase (LPOR) and related proteins, classical (c) SDRs; Region: retinol-DH_like_SDR_c_like; cd05327
561275000196	putative NAD(P) binding site [chemical binding]; other site
561275000197	active site
561275000198	L-serine dehydratase, iron-sulfur-dependent, single chain form; Region: sda_mono; TIGR00720
561275000199	Serine dehydratase beta chain; Region: SDH_beta; pfam03315
561275000200	Serine dehydratase alpha chain; Region: SDH_alpha; pfam03313
561275000201	serine hydroxymethyltransferase; Reviewed; Region: glyA; PRK00011
561275000202	Serine-glycine hydroxymethyltransferase (SHMT). This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). SHMT carries out interconversion of serine and glycine; it catalyzes the transfer of hydroxymethyl...; Region: SHMT; cd00378
561275000203	dimer interface [polypeptide binding]; other site
561275000204	active site
561275000205	glycine-pyridoxal phosphate binding site [chemical binding]; other site
561275000206	folate binding site [chemical binding]; other site
561275000207	Retron-type reverse transcriptase [DNA replication, recombination, and repair]; Region: COG3344
561275000208	RT_G2_intron: Reverse transcriptases (RTs) with group II intron origin. RT transcribes DNA using RNA as template. Proteins in this subfamily are found in bacterial and mitochondrial group II introns. Their most probable ancestor was a retrotransposable...; Region: RT_G2_intron; cd01651
561275000209	putative NTP binding site [chemical binding]; other site
561275000210	MacB-like periplasmic core domain; Region: MacB_PCD; pfam12704
561275000211	ATP-binding cassette domain of the transporters involved in export of lipoprotein and macrolide, and cell division protein; Region: ABC_MJ0796_LolCDE_FtsE; cd03255
561275000212	ABC-type antimicrobial peptide transport system, ATPase component [Defense mechanisms]; Region: SalX; COG1136
561275000213	Walker A/P-loop; other site
561275000214	ATP binding site [chemical binding]; other site
561275000215	Q-loop/lid; other site
561275000216	ABC transporter signature motif; other site
561275000217	Walker B; other site
561275000218	D-loop; other site
561275000219	H-loop/switch region; other site
561275000220	cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases [Signal transduction mechanisms]; Region: Crp; COG0664
561275000221	effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038
561275000222	ligand binding site [chemical binding]; other site
561275000223	flexible hinge region; other site
561275000224	Imidazolonepropionase and related amidohydrolases [Secondary metabolites biosynthesis, transport, and catabolism]; Region: HutI; COG1228
561275000225	Superfamily of metallo-dependent hydrolases (also called amidohydrolase superfamily) is a large group of proteins that show conservation in their 3-dimensional fold (TIM barrel) and in details of their active site. The vast majority of the members have a...; Region: metallo-dependent_hydrolases; cl00281
561275000226	Metallo-dependent hydrolases, subgroup A is part of the superfamily of metallo-dependent hydrolases, a large group of proteins that show conservation in their 3-dimensional fold (TIM barrel) and in details of their active site. The vast majority of the...; Region: Met_dep_hydrolase_A; cd01299
561275000227	active site
561275000228	Bifunctional PLP-dependent enzyme with beta-cystathionase and maltose regulon repressor activities [Amino acid transport and metabolism]; Region: MalY; COG1168
561275000229	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
561275000230	pyridoxal 5'-phosphate binding site [chemical binding]; other site
561275000231	homodimer interface [polypeptide binding]; other site
561275000232	catalytic residue [active]
561275000233	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
561275000234	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275000235	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275000236	Pyridoxamine 5'-phosphate oxidase; Region: Pyridox_ox_2; pfam12900
561275000237	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
561275000238	dimerization interface [polypeptide binding]; other site
561275000239	putative DNA binding site [nucleotide binding]; other site
561275000240	putative Zn2+ binding site [ion binding]; other site
561275000241	Ni,Fe-hydrogenase III small subunit [Energy production and conversion]; Region: COG3260
561275000242	hydrogenase 4 subunit B; Validated; Region: PRK06521
561275000243	NADH-Ubiquinone/plastoquinone (complex I), various chains; Region: Oxidored_q1; pfam00361
561275000244	Formate hydrogenlyase subunit 4 [Energy production and conversion]; Region: HyfC; COG0650
561275000245	NADH dehydrogenase; Region: NADHdh; cl00469
561275000246	Hydrogenase 4 membrane component (E) [Energy production and conversion]; Region: HyfE; COG4237
561275000247	NADH-Ubiquinone/plastoquinone (complex I), various chains; Region: Oxidored_q1; pfam00361
561275000248	Ni,Fe-hydrogenase III component G [Energy production and conversion]; Region: HycE; COG3262
561275000249	Ni,Fe-hydrogenase III large subunit [Energy production and conversion]; Region: HycE; COG3261
561275000250	NADH dehydrogenase subunit D; Validated; Region: PRK06075; cl17338
561275000251	Coenzyme F420-reducing hydrogenase, alpha subunit [Energy production and conversion]; Region: FrhA; COG3259
561275000252	Ligand-binding SRPBCC domain of an uncharacterized subfamily of proteins; Region: SRPBCC_7; cd07825
561275000253	putative hydrophobic ligand binding site [chemical binding]; other site
561275000254	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275000255	S-adenosylmethionine binding site [chemical binding]; other site
561275000256	Predicted membrane protein [Function unknown]; Region: COG3305
561275000257	Phosphorylase superfamily; Region: PNP_UDP_1; cl00303
561275000258	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase; Region: MTA/SAH-Nsdase; TIGR01704
561275000259	Cation transport ATPase [Inorganic ion transport and metabolism]; Region: ZntA; COG2217
561275000260	Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371
561275000261	metal-binding site [ion binding]
561275000262	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
561275000263	Soluble P-type ATPase [General function prediction only]; Region: COG4087
561275000264	Predicted integral membrane protein [Function unknown]; Region: COG5660
561275000265	Putative zinc-finger; Region: zf-HC2; pfam13490
561275000266	Domain of unknown function (DUF222); Region: DUF222; pfam02720
561275000267	HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085
561275000268	active site
561275000269	Domain of unknown function (DUF222); Region: DUF222; pfam02720
561275000270	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275000271	PPE family; Region: PPE; pfam00823
561275000272	Probable taurine catabolism dioxygenase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: TauD; COG2175
561275000273	Taurine catabolism dioxygenase TauD, TfdA family; Region: TauD; pfam02668
561275000274	FcoT-like thioesterase domain; Region: FcoT; pfam10862
561275000275	acyl-CoA synthetase; Validated; Region: PRK05857
561275000276	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
561275000277	Adenylate forming domain, Class I; Region: AFD_class_I; cd04433
561275000278	acyl-activating enzyme (AAE) consensus motif; other site
561275000279	acyl-activating enzyme (AAE) consensus motif; other site
561275000280	AMP binding site [chemical binding]; other site
561275000281	active site
561275000282	CoA binding site [chemical binding]; other site
561275000283	Phosphopantetheine attachment site; Region: PP-binding; pfam00550
561275000284	AMP-binding enzyme; Region: AMP-binding; pfam00501
561275000285	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
561275000286	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
561275000287	acyl-activating enzyme (AAE) consensus motif; other site
561275000288	acyl-activating enzyme (AAE) consensus motif; other site
561275000289	active site
561275000290	AMP binding site [chemical binding]; other site
561275000291	CoA binding site [chemical binding]; other site
561275000292	Phosphopantetheine attachment site; Region: PP-binding; pfam00550
561275000293	Condensation domain; Region: Condensation; pfam00668
561275000294	Non-ribosomal peptide synthetase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: EntF; COG1020
561275000295	HxxPF-repeated domain; Region: HxxPF_rpt; pfam13745
561275000296	The adenylation domain of nonribosomal peptide synthetases (NRPS); Region: A_NRPS; cd05930
561275000297	acyl-activating enzyme (AAE) consensus motif; other site
561275000298	AMP binding site [chemical binding]; other site
561275000299	Phosphopantetheine attachment site; Region: PP-binding; pfam00550
561275000300	Putative dehydrogenase domain of multifunctional non-ribosomal peptide synthetases and related enzymes [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3320
561275000301	extended (e) SDRs, subgroup 1; Region: SDR_e1; cd05235
561275000302	putative NAD(P) binding site [chemical binding]; other site
561275000303	active site
561275000304	putative substrate binding site [chemical binding]; other site
561275000305	Predicted membrane protein [Function unknown]; Region: COG3336
561275000306	Cation transport ATPase [Inorganic ion transport and metabolism]; Region: ZntA; COG2217
561275000307	Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371
561275000308	metal-binding site [ion binding]
561275000309	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
561275000310	Soluble P-type ATPase [General function prediction only]; Region: COG4087
561275000311	cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases [Signal transduction mechanisms]; Region: Crp; COG0664
561275000312	effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038
561275000313	ligand binding site [chemical binding]; other site
561275000314	flexible hinge region; other site
561275000315	50S ribosomal protein L28; Reviewed; Region: rpmB; PRK00359
561275000316	Putative GTPases (G3E family) [General function prediction only]; Region: COG0523
561275000317	Cobalamin synthesis protein cobW C-terminal domain; Region: CobW_C; smart00833
561275000318	Cation transport ATPase [Inorganic ion transport and metabolism]; Region: MgtA; COG0474
561275000319	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
561275000320	Putative hydrolase of sodium-potassium ATPase alpha subunit; Region: Hydrolase_like2; pfam13246
561275000321	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
561275000322	motif II; other site
561275000323	Cation transporting ATPase, C-terminus; Region: Cation_ATPase_C; pfam00689
561275000324	PE family; Region: PE; pfam00934
561275000325	Rhomboid family; Region: Rhomboid; pfam01694
561275000326	Predicted acyltransferases [Lipid metabolism]; Region: COG1835
561275000327	SGNH_hydrolase, or GDSL_hydrolase, is a diverse family of lipases and esterases. The tertiary fold of the enzyme is substantially different from that of the alpha/beta hydrolase family and unique among all known hydrolases; its active site closely...; Region: SGNH_hydrolase; cl01053
561275000328	active site
561275000329	catalytic triad [active]
561275000330	Nucleoside-diphosphate-sugar epimerases [Cell envelope biogenesis, outer membrane / Carbohydrate transport and metabolism]; Region: WcaG; COG0451
561275000331	GDP-mannose 4,6 dehydratase, extended (e) SDRs; Region: GDP_MD_SDR_e; cd05260
561275000332	NADP-binding site; other site
561275000333	homotetramer interface [polypeptide binding]; other site
561275000334	substrate binding site [chemical binding]; other site
561275000335	homodimer interface [polypeptide binding]; other site
561275000336	active site
561275000337	Phosphoheptose isomerase is a member of the SIS (Sugar ISomerase) superfamily. Phosphoheptose isomerase catalyzes the isomerization of sedoheptulose 7-phosphate into D-glycero-D-mannoheptose 7-phosphate. This is the first step of the biosynthesis of...; Region: SIS_GmhA; cd05006
561275000338	dimer interface [polypeptide binding]; other site
561275000339	active site
561275000340	histidinol-phosphate phosphatase family domain; Region: Histidinol-ppas; TIGR01656
561275000341	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
561275000342	active site
561275000343	motif I; other site
561275000344	motif II; other site
561275000345	Predicted kinase related to galactokinase and mevalonate kinase [General function prediction only]; Region: COG2605
561275000346	Uncharacterized protein conserved in bacteria [Function unknown]; Region: ErfK; COG1376
561275000347	IgD-like repeat domain of mycobacterial L,D-transpeptidases; Region: LDT_IgD_like_1; cd13431
561275000348	L,D-transpeptidase catalytic domain; Region: YkuD; pfam03734
561275000349	Transcriptional regulator [Transcription]; Region: LysR; COG0583
561275000350	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
561275000351	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
561275000352	dimerization interface [polypeptide binding]; other site
561275000353	putative oxalyl-CoA decarboxylase; Validated; Region: PRK09259
561275000354	Pyrimidine (PYR) binding domain of POX and related proteins; Region: TPP_PYR_POX_like; cd07035
561275000355	PYR/PP interface [polypeptide binding]; other site
561275000356	dimer interface [polypeptide binding]; other site
561275000357	TPP binding site [chemical binding]; other site
561275000358	Thiamine pyrophosphate enzyme, central domain; Region: TPP_enzyme_M; pfam00205
561275000359	Thiamine pyrophosphate (TPP) family, BZL_OCoD_HPCL subfamily, TPP-binding module; composed of proteins similar to benzaldehyde lyase (BZL), oxalyl-CoA decarboxylase (OCoD) and 2-hydroxyphytanoyl-CoA lyase (2-HPCL). Pseudomonas fluorescens biovar I BZL...; Region: TPP_BZL_OCoD_HPCL; cd02004
561275000360	TPP-binding site; other site
561275000361	dimer interface [polypeptide binding]; other site
561275000362	acyl-CoA synthetase; Validated; Region: PRK05852
561275000363	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
561275000364	Subfamily of fatty acid CoA ligase (FACL) similar to Fum10p of Gibberella moniliformis; Region: FACL_fum10p_like; cd05926
561275000365	acyl-activating enzyme (AAE) consensus motif; other site
561275000366	acyl-activating enzyme (AAE) consensus motif; other site
561275000367	putative AMP binding site [chemical binding]; other site
561275000368	putative active site [active]
561275000369	putative CoA binding site [chemical binding]; other site
561275000370	Elongation factor G (EF-G) family; Region: EF-G_bact; cd04170
561275000371	elongation factor G; Reviewed; Region: PRK12740
561275000372	G1 box; other site
561275000373	putative GEF interaction site [polypeptide binding]; other site
561275000374	GTP/Mg2+ binding site [chemical binding]; other site
561275000375	Switch I region; other site
561275000376	G2 box; other site
561275000377	G3 box; other site
561275000378	Switch II region; other site
561275000379	G4 box; other site
561275000380	G5 box; other site
561275000381	EFG_mtEFG_II: this subfamily represents the domain II of elongation factor G (EF-G) in bacteria and, the C-terminus of mitochondrial Elongation factor G1 (mtEFG1) and G2 (mtEFG2)_like proteins found in eukaryotes. During the process of peptide synthesis...; Region: EFG_mtEFG_II; cd04088
561275000382	EFG_mtEFG1_IV: domains similar to domain IV of the bacterial translational elongation factor (EF) EF-G. Included in this group is a domain of mitochondrial Elongation factor G1 (mtEFG1) proteins homologous to domain IV of EF-G. Eukaryotic cells harbor 2...; Region: EFG_mtEFG1_IV; cd01434
561275000383	EFG_mtEFG_C: domains similar to the C-terminal domain of the bacterial translational elongation factor (EF) EF-G.  Included in this group is the C-terminus of mitochondrial Elongation factor G1 (mtEFG1) and G2 (mtEFG2) proteins. Eukaryotic cells harbor 2...; Region: EFG_mtEFG_C; cd03713
561275000384	PPOX class probable F420-dependent enzyme, Rv0121 family; Region: Rv0121_F420; TIGR03668
561275000385	PE family; Region: PE; pfam00934
561275000386	Trypsin-like serine proteases, typically periplasmic, contain C-terminal PDZ domain [Posttranslational modification, protein turnover, chaperones]; Region: DegQ; COG0265
561275000387	Trypsin-like peptidase domain; Region: Trypsin_2; pfam13365
561275000388	PDZ domain of tryspin-like serine proteases, such as DegP/HtrA, which are oligomeric proteins involved in heat-shock response, chaperone function, and apoptosis. May be responsible for substrate recognition and/or binding, as most PDZ domains bind...; Region: PDZ_serine_protease; cd00987
561275000389	trehalose synthase; Region: treS_nterm; TIGR02456
561275000390	Alpha amylase catalytic domain found in Trehalose synthetase; Region: AmyAc_TreS; cd11334
561275000391	active site
561275000392	catalytic site [active]
561275000393	trehalose synthase-fused probable maltokinase; Region: TreS_Cterm; TIGR02457
561275000394	Uncharacterized protein, probably involved in trehalose biosynthesis [Carbohydrate transport and metabolism]; Region: Ble; COG3281
561275000395	Predicted membrane protein [Function unknown]; Region: COG3619
561275000396	Predicted esterase [General function prediction only]; Region: COG0627
561275000397	NodN (nodulation factor N) contains a single hot dog fold similar to those of the peroxisomal Hydratase-Dehydrogenase-Epimerase (HDE) protein, and the fatty acid synthase beta subunit.  Rhizobium and related species form nodules on the roots of their...; Region: NodN; cd03450
561275000398	putative active site [active]
561275000399	putative catalytic site [active]
561275000400	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275000401	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
561275000402	active site
561275000403	F420-dependent oxidoreductase, G6PDH family; Region: F420_G6P_family; TIGR03557
561275000404	N5,N10-methylenetetrahydromethanopterin reductase (Mer) catalyzes the reduction of N5,N10-methylenetetrahydromethanopterin with reduced coenzyme F420 to N5-methyltetrahydromethanopterin and oxidized coenzyme F420; Region: Tetrahydromethanopterin_reductase; cd01097
561275000405	Acetyltransferase (GNAT) domain; Region: Acetyltransf_7; pfam13508
561275000406	Coenzyme A binding pocket [chemical binding]; other site
561275000410	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275000411	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275000412	Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124
561275000413	Cytochrome P450; Region: p450; cl12078
561275000414	methionine sulfoxide reductase A; Provisional; Region: PRK14054
561275000415	SnoaL-like domain; Region: SnoaL_2; pfam12680
561275000416	hopanoid-associated sugar epimerase; Region: HpnA; TIGR03466
561275000417	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
561275000418	NAD(P) binding site [chemical binding]; other site
561275000419	active site
561275000420	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2343
561275000421	Ketosteroid isomerase-related protein [General function prediction only]; Region: COG3631
561275000422	3-methyladenine DNA glycosylase/8-oxoguanine DNA glycosylase [DNA replication, recombination, and repair]; Region: AlkA; COG0122
561275000423	endonuclease III; includes endonuclease III (DNA-(apurinic or apyrimidinic site) lyase), alkylbase DNA glycosidases (Alka-family) and other DNA glycosidases; Region: ENDO3c; cd00056
561275000424	minor groove reading motif; other site
561275000425	helix-hairpin-helix signature motif; other site
561275000426	active site
561275000427	Chloride channel protein EriC [Inorganic ion transport and metabolism]; Region: EriC; COG0038
561275000428	CLC voltage-gated chloride channel. The ClC chloride channels catalyse the selective flow of Cl- ions across cell membranes, thereby regulating electrical excitation in skeletal muscle and the flow of salt and water across epithelial barriers. This...; Region: Voltage_gated_ClC; cd00400
561275000429	Cl- selectivity filter; other site
561275000430	Cl- binding residues [ion binding]; other site
561275000431	pore gating glutamate residue; other site
561275000432	dimer interface [polypeptide binding]; other site
561275000433	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275000434	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275000435	O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315
561275000436	methyltransferase, TIGR00027 family; Region: mthyl_TIGR00027
561275000437	O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315
561275000438	methyltransferase, TIGR00027 family; Region: mthyl_TIGR00027
561275000439	aldehyde dehydrogenase family protein; Provisional; Region: PTZ00381
561275000440	ALDH subfamily: Coniferyl aldehyde dehydrogenase, ALDH families 3, 13, and 14, and other related proteins; Region: ALDH_F3-13-14_CALDH-like; cd07087
561275000441	NAD(P) binding site [chemical binding]; other site
561275000442	catalytic residues [active]
561275000443	short chain dehydrogenase; Provisional; Region: PRK07791
561275000444	(3R)-hydroxyacyl-CoA dehydrogenase-like, classical(c)-like SDRs; Region: hydroxyacyl-CoA-like_DH_SDR_c-like; cd05353
561275000445	NAD binding site [chemical binding]; other site
561275000446	homodimer interface [polypeptide binding]; other site
561275000447	active site
561275000448	NADPH:quinone reductase and related Zn-dependent oxidoreductases [Energy production and conversion / General function prediction only]; Region: Qor; COG0604
561275000449	Quinone oxidoreductase (QOR); Region: QOR1; cd08241
561275000450	NAD(P) binding site [chemical binding]; other site
561275000451	PE family; Region: PE; pfam00934
561275000452	PE-PPE domain; Region: PE-PPE; pfam08237
561275000453	PE-PPE domain; Region: PE-PPE; pfam08237
561275000454	Protein tyrosine/serine phosphatase [Signal transduction mechanisms]; Region: COG2365
561275000455	Protein tyrosine phosphatases (PTP) catalyze the dephosphorylation of phosphotyrosine peptides; they regulate phosphotyrosine levels in signal transduction pathways. The depth of the active site cleft renders the enzyme specific for phosphorylated Tyr; Region: PTPc; cl00053
561275000456	Tyrosine phosphatase family C-terminal region; Region: Y_phosphatase3C; pfam13348
561275000457	Acyl-CoA dehydrogenases similar to fadE2; Region: ACAD_FadE2; cd01155
561275000458	FAD binding site [chemical binding]; other site
561275000459	substrate binding site [chemical binding]; other site
561275000460	catalytic base [active]
561275000461	NAD/NADP transhydrogenase alpha subunit [Energy production and conversion]; Region: PntA; COG3288
561275000462	Rubrum transdehydrogenase NAD-binding and catalytic domains; Region: Rubrum_tdh; cd05304
561275000463	ligand binding site [chemical binding]; other site
561275000464	homodimer interface [polypeptide binding]; other site
561275000465	NAD(P) binding site [chemical binding]; other site
561275000466	trimer interface B [polypeptide binding]; other site
561275000467	trimer interface A [polypeptide binding]; other site
561275000468	NAD/NADP transhydrogenase alpha subunit [Energy production and conversion]; Region: PntA; COG3288
561275000469	Domain of unknown function (DUF3814); Region: DUF3814; pfam12769
561275000470	NAD/NADP transhydrogenase beta subunit [Energy production and conversion]; Region: PntB; COG1282
561275000471	NAD(P) transhydrogenase beta subunit; Region: PNTB; pfam02233
561275000472	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275000473	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275000474	QacR-like protein, C-terminal region; Region: TetR_C_5; pfam08360
561275000475	PE family; Region: PE; pfam00934
561275000476	PE-PPE domain; Region: PE-PPE; pfam08237
561275000477	PE family; Region: PE; pfam00934
561275000478	PE-PPE domain; Region: PE-PPE; pfam08237
561275000479	FAD/FMN-containing dehydrogenases [Energy production and conversion]; Region: GlcD; COG0277
561275000480	FAD binding domain; Region: FAD_binding_4; pfam01565
561275000481	Zn-dependent alcohol dehydrogenases, class III [Energy production and conversion]; Region: AdhC; COG1062
561275000482	Medium chain reductase/dehydrogenase (MDR)/zinc-dependent alcohol dehydrogenase-like family; Region: MDR; cl16912
561275000483	NAD(P) binding site [chemical binding]; other site
561275000484	4-hydroxybenzoyl-CoA thioesterase (4HBT). Catalyzes the final step in the 4-chlorobenzoate degradation pathway in which 4-chlorobenzoate is converted to 4-hydroxybenzoate in certain soil-dwelling bacteria. 4HBT forms a homotetramer with four active sites; Region: 4HBT; cd00586
561275000485	active site
561275000486	Ligand-binding SRPBCC domain of an uncharacterized subfamily of proteins; Region: SRPBCC_2; cd07819
561275000487	putative hydrophobic ligand binding site [chemical binding]; other site
561275000488	Transcriptional regulators [Transcription]; Region: GntR; COG1802
561275000489	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
561275000490	DNA-binding site [nucleotide binding]; DNA binding site
561275000491	FCD domain; Region: FCD; pfam07729
561275000492	long-chain-fatty-acid--CoA ligase; Validated; Region: PRK07786
561275000493	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
561275000494	Bacterial Bile acid CoA ligases and similar proteins; Region: BACL_like; cd05929
561275000495	acyl-activating enzyme (AAE) consensus motif; other site
561275000496	acyl-activating enzyme (AAE) consensus motif; other site
561275000497	putative AMP binding site [chemical binding]; other site
561275000498	putative active site [active]
561275000499	putative CoA binding site [chemical binding]; other site
561275000500	ABC-type transport system involved in resistance to organic solvents, permease component [Secondary metabolites biosynthesis, transport, and catabolism]; Region: Ttg2B; COG0767
561275000501	Permease; Region: Permease; pfam02405
561275000502	ABC-type transport system involved in resistance to organic solvents, permease component [Secondary metabolites biosynthesis, transport, and catabolism]; Region: Ttg2B; COG0767
561275000503	Permease; Region: Permease; pfam02405
561275000504	virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996
561275000505	mce related protein; Region: MCE; pfam02470
561275000506	Protein of unknown function (DUF3407); Region: DUF3407; pfam11887
561275000507	virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996
561275000508	mce related protein; Region: MCE; pfam02470
561275000509	Protein of unknown function (DUF3407); Region: DUF3407; pfam11887
561275000510	virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996
561275000511	mce related protein; Region: MCE; pfam02470
561275000512	virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996
561275000513	mce related protein; Region: MCE; pfam02470
561275000514	virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996
561275000515	mce related protein; Region: MCE; pfam02470
561275000516	virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996
561275000517	mce related protein; Region: MCE; pfam02470
561275000518	RDD family; Region: RDD; pfam06271
561275000519	indolepyruvate ferredoxin oxidoreductase; Validated; Region: PRK09193
561275000520	Predicted periplasmic protein (DUF2233); Region: DUF2233; pfam09992
561275000521	Predicted membrane protein [Function unknown]; Region: COG1511
561275000522	YhgE/Pip N-terminal domain; Region: pip_yhgE_Nterm; TIGR03061
561275000523	YhgE/Pip C-terminal domain; Region: pip_yhgE_Cterm; TIGR03062
561275000524	Pirin-related protein [General function prediction only]; Region: COG1741
561275000525	Pirin; Region: Pirin; pfam02678
561275000526	RNA polymerase factor sigma-70; Validated; Region: PRK08241
561275000527	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
561275000528	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
561275000529	DNA binding residues [nucleotide binding]
561275000530	SnoaL-like domain; Region: SnoaL_2; pfam12680
561275000531	Lysophospholipase [Lipid metabolism]; Region: PldB; COG2267
561275000532	Putative lysophospholipase; Region: Hydrolase_4; pfam12146
561275000533	Protein of unknown function (DUF2786); Region: DUF2786; pfam10979
561275000534	putative metallohydrolase, TIGR04338 family; Region: HEXXH_Rv0185
561275000535	Glycosyl hydrolase family 3 N terminal domain; Region: Glyco_hydro_3; pfam00933
561275000536	Beta-glucosidase-related glycosidases [Carbohydrate transport and metabolism]; Region: BglX; COG1472
561275000537	Glycosyl hydrolase family 3 C-terminal domain; Region: Glyco_hydro_3_C; pfam01915
561275000538	Fibronectin type III-like domain; Region: Fn3-like; pfam14310
561275000539	Predicted O-methyltransferase [General function prediction only]; Region: COG4122
561275000540	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275000541	S-adenosylmethionine binding site [chemical binding]; other site
561275000542	SPW repeat; Region: SPW; pfam03779
561275000543	SPW repeat; Region: SPW; pfam03779
561275000544	dihydroxy-acid dehydratase; Provisional; Region: PRK00911
561275000545	6-phosphogluconate dehydratase; Region: edd; TIGR01196
561275000546	Transcriptional regulators CsoR (copper-sensitive operon repressor), RcnR, and FrmR, and related domains; this domain superfamily was previously known as DUF156; Region: CsoR-like_DUF156; cd10148
561275000547	putative homodimer interface [polypeptide binding]; other site
561275000548	putative homotetramer interface [polypeptide binding]; other site
561275000549	putative allosteric switch controlling residues; other site
561275000550	putative metal binding site [ion binding]; other site
561275000551	putative homodimer-homodimer interface [polypeptide binding]; other site
561275000552	Arabinose efflux permease [Carbohydrate transport and metabolism]; Region: AraJ; COG2814
561275000553	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
561275000554	putative substrate translocation pore; other site
561275000555	Uncharacterized protein conserved in bacteria [Function unknown]; Region: ErfK; COG1376
561275000556	IgD-like repeat domain of mycobacterial L,D-transpeptidases; Region: LDT_IgD_like_1; cd13431
561275000557	L,D-transpeptidase catalytic domain; Region: YkuD; pfam03734
561275000558	ABC-type multidrug transport system, ATPase and permease components [Defense mechanisms]; Region: MdlB; COG1132
561275000559	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
561275000560	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
561275000561	Walker A/P-loop; other site
561275000562	ATP binding site [chemical binding]; other site
561275000563	Q-loop/lid; other site
561275000564	ABC transporter signature motif; other site
561275000565	Walker B; other site
561275000566	D-loop; other site
561275000567	H-loop/switch region; other site
561275000568	ABC-type multidrug transport system, ATPase and permease components [Defense mechanisms]; Region: MdlB; COG1132
561275000569	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
561275000570	Walker A/P-loop; other site
561275000571	ATP binding site [chemical binding]; other site
561275000572	Q-loop/lid; other site
561275000573	ABC transporter signature motif; other site
561275000574	Walker B; other site
561275000575	D-loop; other site
561275000576	H-loop/switch region; other site
561275000577	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
561275000578	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
561275000579	dimerization interface [polypeptide binding]; other site
561275000580	DNA binding residues [nucleotide binding]
561275000581	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275000582	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275000583	Anaerobic dehydrogenases, typically selenocysteine-containing [Energy production and conversion]; Region: BisC; COG0243
561275000584	The MopB_1 CD includes a group of related uncharacterized bacterial molybdopterin-binding oxidoreductase-like domains with a putative N-terminal iron-sulfur [4Fe-4S] cluster binding site and molybdopterin cofactor binding site. These members belong to...; Region: MopB_1; cd02762
561275000585	putative [Fe4-S4] binding site [ion binding]; other site
561275000586	putative molybdopterin cofactor binding site [chemical binding]; other site
561275000587	Molybdopterin-Binding (MopB) domain of the MopB superfamily of proteins, a  large, diverse, heterogeneous superfamily of enzymes that, in general, bind molybdopterin as a cofactor. The MopB domain is found in a wide variety of molybdenum- and...; Region: Molybdopterin-Binding; cl09928
561275000588	The MopB_CT_1 CD includes a group of related uncharacterized bacterial molybdopterin-binding oxidoreductase-like domains with a putative N-terminal iron-sulfur [4Fe-4S] cluster binding site and molybdopterin cofactor binding site. This CD is of the...; Region: MopB_CT_1; cd02782
561275000589	putative molybdopterin cofactor binding site; other site
561275000590	Predicted metalloendopeptidase [Posttranslational modification, protein turnover, chaperones]; Region: PepO; COG3590
561275000591	Peptidase family M13 includes neprilysin, endothelin-converting enzyme I; Region: M13; cd08662
561275000592	active site
561275000593	Zn binding site [ion binding]; other site
561275000594	Predicted drug exporters of the RND superfamily [General function prediction only]; Region: COG2409
561275000595	Sterol-sensing domain of SREBP cleavage-activation; Region: Sterol-sensing; pfam12349
561275000596	Predicted integral membrane protein [Function unknown]; Region: COG0392
561275000597	Predicted permease, member of the PurR regulon [General function prediction only]; Region: yhhT; COG0628
561275000598	Domain of unknown function DUF20; Region: UPF0118; pfam01594
561275000599	MMPL family; Region: MMPL; pfam03176
561275000600	MMPL family; Region: MMPL; pfam03176
561275000601	LabA_like proteins; Region: LabA_like; cd06167
561275000602	putative metal binding site [ion binding]; other site
561275000603	Putative methyltransferase; Region: Methyltransf_4; pfam02390
561275000604	Phosphoenolpyruvate carboxykinase (PEPCK), a critical gluconeogenic enzyme, catalyzes the first committed step in the diversion of tricarboxylic acid cycle intermediates toward gluconeogenesis. It catalyzes the reversible decarboxylation and...; Region: PEPCK_GTP; cd00819
561275000605	active site
561275000606	substrate-binding site [chemical binding]; other site
561275000607	metal-binding site [ion binding]
561275000608	GTP binding site [chemical binding]; other site
561275000609	nicotinamide-nucleotide adenylyltransferase, NadR type; Region: nadR_NMN_Atrans; TIGR01526
561275000610	Nicotinamide/nicotinate mononucleotide adenylyltransferase of bifunctional NadR-like proteins; Region: NMNAT_NadR; cd02167
561275000611	active site
561275000612	(T/H)XGH motif; other site
561275000613	Predicted ATPase/kinase involved in NAD metabolism [Coenzyme metabolism]; Region: NadR; COG3172
561275000614	B12 binding domain_like associated with radical SAM domain. This domain shows similarity with B12 (adenosylcobamide) binding domains found in several enzymes, such as glutamate mutase, methionine synthase and methylmalonyl-CoA mutase, but it lacks the...; Region: radical_SAM_B12_BD; cd02068
561275000615	Elongator protein 3, MiaB family, Radical SAM; Region: Elp3; smart00729
561275000616	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
561275000617	FeS/SAM binding site; other site
561275000618	long-chain-fatty-acid--CoA ligase; Validated; Region: PRK08276
561275000619	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
561275000620	Bacterial Bile acid CoA ligases and similar proteins; Region: BACL_like; cd05929
561275000621	acyl-activating enzyme (AAE) consensus motif; other site
561275000622	acyl-activating enzyme (AAE) consensus motif; other site
561275000623	putative AMP binding site [chemical binding]; other site
561275000624	putative active site [active]
561275000625	putative CoA binding site [chemical binding]; other site
561275000626	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275000627	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
561275000628	active site
561275000629	FkbR2 is a Streptomyces hygroscopicus protein with a hot dog fold that belongs to a conserved family of proteins found in prokaryotes and archaea but not in eukaryotes. FkbR2  has sequence similarity to (R)-specific enoyl-CoA hydratase, the peroxisomal...; Region: FkbR2; cd03451
561275000630	putative active site [active]
561275000631	putative catalytic site [active]
561275000632	The hotdog fold was initially identified in the E. coli FabA (beta-hydroxydecanoyl-acyl carrier protein (ACP)-dehydratase) structure and subsequently in 4HBT (4-hydroxybenzoyl-CoA thioesterase) from Pseudomonas. A number of other seemingly unrelated...; Region: hot_dog; cl00509
561275000633	active site 2 [active]
561275000634	active site 1 [active]
561275000635	Esterases and lipases (includes fungal lipases, cholinesterases, etc.)  These enzymes act on carboxylic esters (EC: 3.1.1.-). The catalytic apparatus involves three residues (catalytic triad): a serine, a glutamate or aspartate and a histidine.These...; Region: Esterase_lipase; cd00312
561275000636	alpha/beta hydrolase fold; Region: Abhydrolase_3; pfam07859
561275000637	Sulfite oxidase and related enzymes [General function prediction only]; Region: COG2041
561275000638	Sulfite oxidase (SO) family, molybdopterin binding domain. This molybdopterin cofactor (Moco) binding domain is found in a variety of oxidoreductases, main members of this family are nitrate reductase (NR) and sulfite oxidase (SO). SO catalyzes the...; Region: SO_family_Moco; cd00321
561275000639	Moco binding site; other site
561275000640	metal coordination site [ion binding]; other site
561275000641	alpha/beta hydrolase fold; Region: Abhydrolase_3; pfam07859
561275000642	Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326
561275000643	Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007
561275000644	NAD(P)+-dependent aldehyde dehydrogenase superfamily; Region: ALDH-SF; cl11961
561275000645	NAD(P) binding site [chemical binding]; other site
561275000646	catalytic residues [active]
561275000647	RD10, 1902 bp. Region of difference RD10, deleted region in Mycobacterium bovis BCG Pasteur (position 294686..294687), BCG Tokyo (position 265019..265020), and Mycobacterium bovis AF2122/97 (position 264979..264980) compared to Mycobacterium tuberculosis H37Rv (position: 264755..266656, 1902bp). Removes gene Rv0222 and truncates genes Rv0221 and Rv0223
561275000648	NAD(P)+-dependent aldehyde dehydrogenase superfamily; Region: ALDH-SF; cl11961
561275000649	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275000650	S-adenosylmethionine binding site [chemical binding]; other site
561275000651	This family is most closely related to the GT1 family of glycosyltransferases and named after YqgM in Bacillus licheniformis about which little is known. Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to...; Region: GT1_YqgM_like; cd03801
561275000652	Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438
561275000653	Protein of unknown function (DUF3068); Region: DUF3068; pfam11271
561275000654	Predicted acyltransferases [Lipid metabolism]; Region: COG1835
561275000655	PIN domain of the Rv0301 toxin of Mycobacterium tuberculosis and other uncharacterized, annotated PilT protein domain proteins; Region: PIN_MtRv0301; cd09882
561275000656	putative active site [active]
561275000657	Phosphotriesterase (PTE) catalyzes the hydrolysis of organophosphate nerve agents, including the chemical warfare agents VX, soman, and sarin as well as the insecticide paraoxon. PTE exists as a homodimer with one active site per monomer. The active site...; Region: PTE; cd00530
561275000658	active site
561275000659	substrate binding pocket [chemical binding]; other site
561275000660	homodimer interaction site [polypeptide binding]; other site
561275000661	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275000662	Acyl-CoA dehydrogenase; Region: ACAD; cd00567
561275000663	active site
561275000664	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275000665	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275000666	Ribonucleotide Reductase R2-like protein, Mn/Fe-binding domain; Region: RNRR2_Rv0233_like; cd07911
561275000667	active site
561275000668	diiron metal binding site [ion binding]; other site
561275000669	NAD(P)+-dependent aldehyde dehydrogenase superfamily; Region: ALDH-SF; cl11961
561275000670	NAD-dependent aldehyde dehydrogenases [Energy production and conversion]; Region: PutA; COG1012
561275000671	Mycobacterium tuberculosis succinate-semialdehyde dehydrogenase 1-like; Region: ALDH_SSADH1_GabD1; cd07100
561275000672	NAD(P) binding site [chemical binding]; other site
561275000673	catalytic residues [active]
561275000674	Lipase maturation factor; Region: LMF1; pfam06762
561275000675	Domain of unknown function (DUF3367); Region: DUF3367; pfam11847
561275000676	Protein of unknown function (DUF2613); Region: DUF2613; pfam11021
561275000677	Beta-glucosidase-related glycosidases [Carbohydrate transport and metabolism]; Region: BglX; COG1472
561275000678	Glycosyl hydrolase family 3 N terminal domain; Region: Glyco_hydro_3; cl07971
561275000679	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275000680	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275000681	Mycobacterium tuberculosis PIN domain family; Region: Mtu_PIN_fam; TIGR00028
561275000682	The hotdog fold was initially identified in the E. coli FabA (beta-hydroxydecanoyl-acyl carrier protein (ACP)-dehydratase) structure and subsequently in 4HBT (4-hydroxybenzoyl-CoA thioesterase) from Pseudomonas. A number of other seemingly unrelated...; Region: hot_dog; cl00509
561275000683	MaoC like domain; Region: MaoC_dehydratas; pfam01575
561275000684	active site 2 [active]
561275000685	active site 1 [active]
561275000686	3-ketoacyl-(acyl-carrier-protein) reductase; Provisional; Region: fabG; PRK08261
561275000687	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
561275000688	NAD(P) binding site [chemical binding]; other site
561275000689	active site
561275000690	acetyl-CoA acetyltransferase; Provisional; Region: PRK09268
561275000691	Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751
561275000692	dimer interface [polypeptide binding]; other site
561275000693	active site
561275000694	Acyl-CoA dehydrogenase N terminal; Region: AcylCoA_DH_N; pfam12418
561275000695	acyl-CoA dehydrogenase; Provisional; Region: PTZ00456
561275000696	Putative acyl-CoA dehydrogenases similar to fadE5; Region: ACAD_fadE5; cd01153
561275000697	FAD binding site [chemical binding]; other site
561275000698	substrate binding site [chemical binding]; other site
561275000699	catalytic residues [active]
561275000700	Acetyl-CoA dehydrogenase C-terminal like; Region: Acyl-CoA_dh_C; pfam12806
561275000701	Flavin reductase like domain; Region: Flavin_Reduct; smart00903
561275000702	fumarate reductase iron-sulfur subunit; Provisional; Region: PRK12386
561275000703	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
561275000704	catalytic loop [active]
561275000705	iron binding site [ion binding]; other site
561275000706	succinate dehydrogenase flavoprotein subunit; Reviewed; Region: sdhA; PRK07803
561275000707	L-aspartate oxidase; Provisional; Region: PRK06175
561275000708	Fumarate reductase flavoprotein C-term; Region: Succ_DH_flav_C; pfam02910
561275000709	Molecular chaperone (small heat shock protein) [Posttranslational modification, protein turnover, chaperones]; Region: IbpA; COG0071
561275000710	Alpha-crystallin domain (ACD) of alpha-crystallin-type small(s) heat shock proteins (Hsps). sHsps are small stress induced proteins with monomeric masses between 12 -43 kDa, whose common feature is the Alpha-crystallin domain  (ACD). sHsps are generally...; Region: ACD_sHsps-like; cd06464
561275000711	putative dimer interface [polypeptide binding]; other site
561275000712	nitrite reductase [NAD(P)H], large subunit; Region: nitri_red_nirB; TIGR02374
561275000713	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
561275000714	BFD-like [2Fe-2S] binding domain; Region: Fer2_BFD; pfam04324
561275000715	Nitrite/Sulfite reductase ferredoxin-like half domain; Region: NIR_SIR_ferr; pfam03460
561275000716	Assimilatory nitrite reductase (NirD) family, Rieske domain; Assimilatory nitrate and nitrite reductases convert nitrate through nitrite to ammonium. Members include bacterial and fungal proteins. The bacterial NirD contains a single Rieske domain while...; Region: Rieske_NirD; cd03529
561275000717	Adenosylcobinamide kinase / adenosylcobinamide phosphate guanyltransferase (CobU). CobU is bifunctional cobalbumin biosynthesis enzymes which display adenosylcobinamide kinase and adenosylcobinamide phosphate guanyltransferase activity. This enzyme is a...; Region: CobU; cd00544
561275000718	homotrimer interface [polypeptide binding]; other site
561275000719	Walker A motif; other site
561275000720	GTP binding site [chemical binding]; other site
561275000721	Walker B motif; other site
561275000722	cobyric acid synthase; Provisional; Region: PRK00784
561275000723	Dethiobiotin synthetase [Coenzyme metabolism]; Region: BioD; COG0132
561275000724	Type 1 glutamine amidotransferase (GATase1) domain found in Cobyric Acid Synthase (CobQ); Region: GATase1_CobQ; cd01750
561275000725	catalytic triad [active]
561275000726	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275000727	PPE family; Region: PPE; pfam00823
561275000728	Sirohydrochlorin ferrochelatase [Inorganic ion transport and metabolism]; Region: COG2138
561275000729	Sirohydrochlorin cobalt chelatase (CbiX) and sirohydrochlorin iron chelatase (SirB), N-terminal domain. SirB catalyzes the ferro-chelation of sirohydrochlorin to siroheme, the prosthetic group of sulfite and nitrite reductases. CbiX is a cobaltochelatase; Region: CbiX_SirB_N; cd03416
561275000730	putative active site [active]
561275000731	Sirohydrochlorin cobalt chelatase (CbiX) and sirohydrochlorin iron chelatase (SirB), C-terminal domain. SirB catalyzes the ferro-chelation of sirohydrochlorin to siroheme, the prosthetic group of sulfite and nitrite reductases. CbiX is a cobaltochelatase; Region: CbiX_SirB_C; cd03414
561275000732	putative active site [active]
561275000733	bifunctional uroporphyrinogen-III synthetase/response regulator domain protein; Validated; Region: PRK07239
561275000734	Uroporphyrinogen-III synthase (HemD) catalyzes the asymmetrical cyclization of tetrapyrrole (linear) to uroporphyrinogen-III, the fourth step in the biosynthesis of heme. This ubiquitous enzyme is present in eukaryotes, bacteria and archaea. Mutations in...; Region: HemD; cd06578
561275000735	active site
561275000736	DNA-binding winged-HTH domains [Transcription]; Region: CadC; COG3710
561275000737	DNA binding site [nucleotide binding]
561275000738	Nitrate/nitrite transporter [Inorganic ion transport and metabolism]; Region: NarK; COG2223
561275000739	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
561275000740	Coenzyme A binding pocket [chemical binding]; other site
561275000741	Allophanate hydrolase subunit 2; Region: AHS2; cl00865
561275000742	Allophanate hydrolase subunit 1 [Amino acid transport and metabolism]; Region: DUR1; COG2049
561275000743	Allophanate hydrolase subunit 1; Region: AHS1; smart00796
561275000744	ABC-type Fe3+-hydroxamate transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: FepB; COG0614
561275000745	Helical backbone metal receptor (TroA-like domain). These proteins have been shown to function in the ABC transport of ferric siderophores and metal ions such as Mn2+, Fe3+, Cu2+ and/or Zn2+.  Their ligand binding site is formed in the interface between...; Region: TroA-like; cl00262
561275000746	intersubunit interface [polypeptide binding]; other site
561275000747	5-oxoprolinase; Region: PLN02666
561275000748	Hydantoinase/oxoprolinase N-terminal region; Region: Hydant_A_N; pfam05378
561275000749	Hydantoinase/oxoprolinase; Region: Hydantoinase_A; pfam01968
561275000750	N-methylhydantoinase B/acetone carboxylase, alpha subunit [Amino acid transport and metabolism / Secondary metabolites biosynthesis, transport, and catabolism]; Region: HyuB; COG0146
561275000751	Nitrate/nitrite transporter [Inorganic ion transport and metabolism]; Region: NarK; COG2223
561275000752	Antitoxin of toxin-antitoxin stability system [Cell division and chromosome partitioning]; Region: StbD; COG2161
561275000753	LigD_Pol_like_2: Polymerase (Pol) domain of bacterial LigD proteins similar to Pseudomonas aeruginosa (Pae) LigD, subgroup 2. The LigD Pol domain belongs to the archaeal/eukaryal primase (AEP) superfamily. In prokaryotes, LigD along with Ku is required...; Region: LigD_Pol_like_2; cd04865
561275000754	nucleotide binding site [chemical binding]; other site
561275000755	acyl-CoA synthetase; Validated; Region: PRK07788
561275000756	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
561275000757	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
561275000758	active site
561275000759	CoA binding site [chemical binding]; other site
561275000760	AMP binding site [chemical binding]; other site
561275000761	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275000762	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
561275000763	Putative acyl-CoA dehydrogenases similar to fadE6, fadE17, and fadE26; Region: ACAD_fadE6_17_26; cd01152
561275000764	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275000765	FAD binding site [chemical binding]; other site
561275000766	substrate binding site [chemical binding]; other site
561275000767	catalytic base [active]
561275000768	Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697
561275000769	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275000770	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275000771	N-terminal domain of Sphingobium chlorophenolicum 2,6-dichloro-p-hydroquinone 1,2-dioxygenase (PcpA), and similar proteins; Region: PcpA_N_like; cd08346
561275000772	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
561275000773	Zn binding site [ion binding]; other site
561275000774	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3662
561275000775	Mycobacterium tuberculosis PIN domain family; Region: Mtu_PIN_fam; TIGR00028
561275000776	putative active site [active]
561275000778	PE family; Region: PE; pfam00934
561275000779	I-RD01, 2924 bp. Region of difference I-RD01, inserted region in Mycobacterium bovis BCG Pasteur (position 362672..365595, 2924bp), BCG Tokyo (position 333005..335928, 2924bp) and Mycobacterium bovis AF2122/97 (position 332966..335745, 2780 bp) compared to Mycobacterium tuberculosis H37Rv2 (position: 334641..334642). Duplicates PE_PGRS3
561275000780	PE family; Region: PE; pfam00934
561275000781	PE family; Region: PE; pfam00934
561275000782	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275000783	PPE family; Region: PPE; pfam00823
561275000784	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275000785	O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315
561275000786	methyltransferase, TIGR00027 family; Region: mthyl_TIGR00027
561275000787	type VII secretion AAA-ATPase EccA; Region: T7SS_EccA; TIGR03922
561275000788	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
561275000789	Walker A motif; other site
561275000790	ATP binding site [chemical binding]; other site
561275000791	Walker B motif; other site
561275000792	arginine finger; other site
561275000793	Protein of unknown function (DUF690); Region: DUF690; pfam05108
561275000794	type VII secretion protein EccCa; Region: T7SS_EccC_a; TIGR03924
561275000795	FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580
561275000796	type VII secretion protein EccCb; Region: T7SS_EccC_b; TIGR03925
561275000797	FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580
561275000798	FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580
561275000799	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275000800	PPE family; Region: PPE; pfam00823
561275000801	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4842
561275000802	EspG family; Region: ESX-1_EspG; pfam14011
561275000803	type VII secretion integral membrane protein EccD; Region: T7SS_EccD; TIGR03920
561275000804	Peptidase domain in the S8 and S53 families; Region: Peptidases_S8_S53; cl10459
561275000805	type VII secretion-associated serine protease mycosin; Region: T7SS_mycosin; TIGR03921
561275000806	active site
561275000807	catalytic residues [active]
561275000808	type VII secretion protein EccE; Region: T7SS_EccE; TIGR03923
561275000809	Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697
561275000810	Uncharacterized conserved protein (DUF2048); Region: DUF2048; pfam09752
561275000811	Trans-aconitate methyltransferase [General function prediction only]; Region: Tam; COG4106
561275000812	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275000813	S-adenosylmethionine binding site [chemical binding]; other site
561275000814	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4424
561275000815	Arylsulfatase A and related enzymes [Inorganic ion transport and metabolism]; Region: AslA; COG3119
561275000816	Sulfatase; Region: Sulfatase; cl17466
561275000817	hypothetical protein; Region: PHA01748
561275000818	PIN domain of the Rv0301 toxin of Mycobacterium tuberculosis and other uncharacterized, annotated PilT protein domain proteins; Region: PIN_MtRv0301; cd09882
561275000819	putative active site [active]
561275000820	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275000821	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275000822	light-dependent protochlorophyllide reductase (LPOR)-like, classical (c)-like SDRs; Region: LPOR_like_SDR_c_like; cd09810
561275000823	protochlorophyllide reductase; Region: PLN00015
561275000824	putative NAD(P) binding site [chemical binding]; other site
561275000825	active site
561275000826	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275000827	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275000828	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275000829	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275000830	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275000831	PPE family; Region: PPE; pfam00823
561275000832	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275000833	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275000834	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275000835	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275000836	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275000837	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275000838	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275000839	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275000840	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275000841	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275000842	Subfamily of the nitroreductase family that includes BluB protein in Rhodobacter capsulatus is involved in the conversion of cobinamide to cobalamin in Cobalamin (vitamin B12) biosynthesis. Nitroreductases typically reduce their substrates by using NAD(P)...; Region: BluB; cd02145
561275000843	putative FMN binding site [chemical binding]; other site
561275000844	PAP2_like_2 proteins. PAP2 is a super-family of phosphatases and haloperoxidases. This subgroup, which is specific to bacteria, lacks functional characterization and may act as a membrane-associated lipid phosphatase; Region: PAP2_like_2; cd03392
561275000845	Membrane-associated phospholipid phosphatase [Lipid metabolism]; Region: PgpB; COG0671
561275000846	active site
561275000847	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3786
561275000848	SnoaL-like domain; Region: SnoaL_4; pfam13577
561275000849	SnoaL-like domain; Region: SnoaL_3; pfam13474
561275000850	Molecular chaperone [Posttranslational modification, protein turnover, chaperones]; Region: DnaK; COG0443
561275000851	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cl17037
561275000852	nucleotide binding site [chemical binding]; other site
561275000853	Molecular chaperone, HSP90 family [Posttranslational modification, protein turnover, chaperones]; Region: HtpG; COG0326
561275000854	Protein of unknown function (DUF3060); Region: DUF3060; pfam11259
561275000855	Beta-glucanase/Beta-glucan synthetase [Carbohydrate transport and metabolism]; Region: SKN1; COG2273
561275000856	Laminarinase, member of the glycosyl hydrolase family 16; Region: GH16_laminarinase_like; cd08023
561275000857	active site
561275000858	catalytic residues [active]
561275000859	Muconolactone delta-isomerase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CatC1; COG4829
561275000860	Muconolactone delta-isomerase; Region: MIase; cl01992
561275000861	Glycerophosphodiester phosphodiesterase domain of Streptomyces coelicolor cytoplasmic phosphodiesterases UgpQ2 and similar proteins; Region: GDPD_cytoplasmic_ScUgpQ2_like; cd08561
561275000862	Glycerophosphoryl diester phosphodiesterase family; Region: GDPD; pfam03009
561275000863	putative active site [active]
561275000864	catalytic site [active]
561275000865	putative metal binding site [ion binding]; other site
561275000866	Predicted divalent heavy-metal cations transporter [Inorganic ion transport and metabolism]; Region: COG0428
561275000867	Pyroglutamyl peptidase (PGP) type I, also known as pyrrolidone carboxyl peptidase (pcp) type I:  Enzymes responsible for cleaving pyroglutamate (pGlu) from the N-terminal end of specialized proteins. The N-terminal pGlu protects these proteins from...; Region: Peptidase_C15; cd00501
561275000868	putative substrate binding pocket [chemical binding]; other site
561275000869	AC domain interface; other site
561275000870	catalytic triad [active]
561275000871	AB domain interface; other site
561275000872	interchain disulfide; other site
561275000873	Trimeric dUTP diphosphatases; Region: trimeric_dUTPase; cd07557
561275000874	trimer interface [polypeptide binding]; other site
561275000875	active site
561275000876	Predicted UDP-glucose 6-dehydrogenase [Cell envelope biogenesis, outer membrane]; Region: Ugd; COG1004
561275000877	3-hydroxyacyl-CoA dehydrogenase, NAD binding domain; Region: 3HCDH_N; pfam02737
561275000878	UDP-glucose/GDP-mannose dehydrogenase family, central domain; Region: UDPG_MGDP_dh; pfam00984
561275000879	UDP binding domain; Region: UDPG_MGDP_dh_C; smart00984
561275000880	Uncharacterized proteins, LmbE homologs [Function unknown]; Region: COG2120
561275000881	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
561275000882	dimerization interface [polypeptide binding]; other site
561275000883	putative DNA binding site [nucleotide binding]; other site
561275000884	putative Zn2+ binding site [ion binding]; other site
561275000885	Rhodanese Homology Domain (RHOD); an alpha beta fold domain found duplicated in the rhodanese protein. The cysteine containing enzymatically active version of the domain is also found in the Cdc25 class of protein phosphatases and a variety of proteins...; Region: RHOD; cd00158
561275000886	active site residue [active]
561275000887	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275000888	S-adenosylmethionine binding site [chemical binding]; other site
561275000889	Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124
561275000890	Cytochrome P450; Region: p450; cl12078
561275000891	transcriptional repressor BetI; Region: betaine_BetI; TIGR03384
561275000892	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275000893	Bacterial transcriptional repressor; Region: TetR_C_6; pfam13977
561275000894	Methyltransferase domain; Region: Methyltransf_23; pfam13489
561275000895	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275000896	S-adenosylmethionine binding site [chemical binding]; other site
561275000897	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275000898	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275000899	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox_2; pfam07992
561275000900	uncharacterized Actinobacterial protein TIGR03083; Region: TIGR03083
561275000901	Mycothiol maleylpyruvate isomerase N-terminal domain; Region: MDMPI_N; pfam11716
561275000902	SnoaL-like domain; Region: SnoaL_2; pfam12680
561275000903	G1P_TT_short is the short form of glucose-1-phosphate thymidylyltransferase; Region: G1P_TT_short; cd02538
561275000904	glucose-1-phosphate thymidylyltransferase, short form; Region: rmlA; TIGR01207
561275000905	substrate binding site; other site
561275000906	tetramer interface; other site
561275000907	PE family; Region: PE; pfam00934
561275000908	nonfunctional due to frameshift
561275000909	aminotransferase AlaT; Validated; Region: PRK09265
561275000910	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
561275000911	pyridoxal 5'-phosphate binding site [chemical binding]; other site
561275000912	homodimer interface [polypeptide binding]; other site
561275000913	catalytic residue [active]
561275000914	Fe-S oxidoreductase [Energy production and conversion]; Region: GlpC; COG0247
561275000915	4Fe-4S binding domain; Region: Fer4; pfam00037
561275000916	Cysteine-rich domain; Region: CCG; pfam02754
561275000917	Cysteine-rich domain; Region: CCG; pfam02754
561275000918	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
561275000919	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
561275000920	DNA binding residues [nucleotide binding]
561275000921	dimerization interface [polypeptide binding]; other site
561275000922	Predicted GTPases (dynamin-related) [General function prediction only]; Region: COG0699
561275000923	Rat sarcoma (Ras)-like superfamily of small guanosine triphosphatases (GTPases); Region: Ras_like_GTPase; cl17170
561275000924	G3 box; other site
561275000925	Switch II region; other site
561275000926	GTP/Mg2+ binding site [chemical binding]; other site
561275000927	G4 box; other site
561275000928	G5 box; other site
561275000929	Predicted GTPases (dynamin-related) [General function prediction only]; Region: COG0699
561275000930	Rat sarcoma (Ras)-like superfamily of small guanosine triphosphatases (GTPases); Region: Ras_like_GTPase; cl17170
561275000931	G1 box; other site
561275000932	GTP/Mg2+ binding site [chemical binding]; other site
561275000933	G2 box; other site
561275000934	Switch I region; other site
561275000935	G3 box; other site
561275000936	Switch II region; other site
561275000937	Uncharacterized MobA-related protein [General function prediction only]; Region: COG2068
561275000938	active site
561275000939	Gamma-aminobutyrate permease and related permeases [Amino acid transport and metabolism]; Region: AnsP; COG1113
561275000940	TIGR04255 family protein; Region: sporadTIGR04255
561275000941	molecular chaperone DnaK; Provisional; Region: dnaK; PRK00290
561275000942	Nucleotide-binding domain of human HSPA9 and similar proteins; Region: HSPA9-Ssq1-like_NBD; cd10234
561275000943	nucleotide binding site [chemical binding]; other site
561275000944	NEF interaction site [polypeptide binding]; other site
561275000945	SBD interface [polypeptide binding]; other site
561275000946	Molecular chaperone GrpE (heat shock protein) [Posttranslational modification, protein turnover, chaperones]; Region: GrpE; COG0576
561275000947	GrpE is the adenine nucleotide exchange factor of DnaK (Hsp70)-type ATPases. The GrpE dimer binds to the ATPase domain of Hsp70 catalyzing the dissociation of ADP, which enables rebinding of ATP, one step in the Hsp70 reaction cycle in protein folding; Region: GrpE; cd00446
561275000948	dimer interface [polypeptide binding]; other site
561275000949	hsp70 (ATPase domain) interactions [polypeptide binding]; other site
561275000950	chaperone protein DnaJ; Provisional; Region: PRK14279
561275000951	DnaJ domain or J-domain.  DnaJ/Hsp40 (heat shock protein 40) proteins are highly conserved and play crucial roles in protein translation, folding, unfolding, translocation, and degradation. They act primarily by stimulating the ATPase activity of Hsp70s; Region: DnaJ; cd06257
561275000952	HSP70 interaction site [polypeptide binding]; other site
561275000953	Zinc finger domain of DnaJ and HSP40; Region: DnaJ_zf; cd10719
561275000954	Zn binding sites [ion binding]; other site
561275000955	C-terminal substrate binding domain of DnaJ and HSP40; Region: DnaJ_C; cd10747
561275000956	dimer interface [polypeptide binding]; other site
561275000957	Helix-Turn-Helix DNA binding domain of HspR-like transcription regulators; Region: HTH_HspR-like; cd01279
561275000958	DNA binding residues [nucleotide binding]
561275000959	MerR HTH family regulatory protein; Region: MerR_1; pfam13411
561275000960	putative dimer interface [polypeptide binding]; other site
561275000961	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275000962	PPE family; Region: PPE; pfam00823
561275000963	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275000964	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275000965	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275000966	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275000967	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275000968	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275000969	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275000970	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275000971	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275000972	PaaI_thioesterase is a tetrameric acyl-CoA thioesterase with a hot dog fold and one of several proteins responsible for phenylacetic acid (PA) degradation in bacteria.  Although orthologs of PaaI exist in archaea and eukaryotes, their function has not...; Region: PaaI_thioesterase; cd03443
561275000973	CoenzymeA binding site [chemical binding]; other site
561275000974	subunit interaction site [polypeptide binding]; other site
561275000975	PHB binding site; other site
561275000976	Adenylosuccinate synthetase; Region: Adenylsucc_synt; smart00788
561275000977	Adenylosuccinate synthetase (AdSS) catalyzes the first step in the de novo biosynthesis of AMP. IMP and L-aspartate are conjugated in a two-step reaction accompanied by the hydrolysis of GTP to GDP in the presence of Mg2+. In the first step, the...; Region: AdSS; cd03108
561275000978	GDP-binding site [chemical binding]; other site
561275000979	ACT binding site; other site
561275000980	IMP binding site; other site
561275000981	Uncharacterized homologs of Site-2 protease (S2P), zinc metalloproteases (MEROPS family M50) which cleave transmembrane domains of substrate proteins, regulating intramembrane proteolysis (RIP) of diverse signal transduction mechanisms. Members of the...; Region: S2P-M50_like_1; cd06158
561275000982	Peptidase family M50; Region: Peptidase_M50; pfam02163
561275000983	active site
561275000984	putative substrate binding region [chemical binding]; other site
561275000985	Protein of unknown function (DUF3151); Region: DUF3151; pfam11349
561275000986	Mg/Co/Ni transporter MgtE (contains CBS domain) [Inorganic ion transport and metabolism]; Region: MgtE; COG2239
561275000987	MgtE intracellular N domain; Region: MgtE_N; pfam03448
561275000988	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domain in the magnesium transporter, MgtE.  MgtE and its homologs are found in eubacteria, archaebacteria, and eukaryota. Members of this family transport Mg2+ or other...; Region: CBS_pair_Mg_transporter; cd04606
561275000989	Divalent cation transporter; Region: MgtE; pfam01769
561275000990	fructose-bisphosphate aldolase; Provisional; Region: PRK09197
561275000991	fructose-bisphosphate aldolase, class II, yeast/E. coli subtype; Region: FruBisAldo_II_A; TIGR01520
561275000992	active site
561275000993	intersubunit interface [polypeptide binding]; other site
561275000994	zinc binding site [ion binding]; other site
561275000995	Na+ binding site [ion binding]; other site
561275000996	Uncharacterized membrane-associated protein [Function unknown]; Region: DedA; COG0586
561275000997	SNARE associated Golgi protein; Region: SNARE_assoc; cl00429
561275000998	Predicted glycosyl hydrolase [Carbohydrate transport and metabolism]; Region: COG4833
561275000999	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4185
561275001000	AAA domain; Region: AAA_33; pfam13671
561275001001	Protein of unknown function (DUF3423); Region: DUF3423; pfam11903
561275001002	VWA domain containing CoxE-like protein; Region: VWA_CoxE; pfam05762
561275001003	von Willebrand factor (vWF) type A domain; Region: VWA; smart00327
561275001004	metal ion-dependent adhesion site (MIDAS); other site
561275001005	Ligand-binding SRPBCC domain of an uncharacterized subfamily of proteins; Region: SRPBCC_5; cd07823
561275001006	putative hydrophobic ligand binding site [chemical binding]; other site
561275001007	MoxR-like ATPases [General function prediction only]; Region: COG0714
561275001008	GT_2_like_f is a subfamily of the glycosyltransferase family 2 (GT-2) with unknown function; Region: GT_2_like_f; cd04182
561275001009	Ligand binding site; other site
561275001010	metal-binding site
561275001011	Xanthine and CO dehydrogenases maturation factor, XdhC/CoxF family [Posttranslational modification, protein turnover, chaperones]; Region: XdhC; COG1975
561275001012	XdhC and CoxI family; Region: XdhC_CoxI; pfam02625
561275001013	XdhC Rossmann domain; Region: XdhC_C; pfam13478
561275001014	carbon-monoxide dehydrogenase, large subunit; Region: CO_dehy_Mo_lg; TIGR02416
561275001015	Aldehyde oxidase and xanthine dehydrogenase, a/b hammerhead domain; Region: Ald_Xan_dh_C; pfam01315
561275001016	Molybdopterin-binding domain of aldehyde dehydrogenase; Region: Ald_Xan_dh_C2; pfam02738
561275001017	Aerobic-type carbon monoxide dehydrogenase, small subunit CoxS/CutS homologs [Energy production and conversion]; Region: CoxS; COG2080
561275001018	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
561275001019	catalytic loop [active]
561275001020	iron binding site [ion binding]; other site
561275001021	[2Fe-2S] binding domain; Region: Fer2_2; pfam01799
561275001022	Aerobic-type carbon monoxide dehydrogenase, middle subunit CoxM/CutM homologs [Energy production and conversion]; Region: CoxM; COG1319
561275001023	CO dehydrogenase flavoprotein C-terminal domain; Region: CO_deh_flav_C; pfam03450
561275001024	XdhC and CoxI family; Region: XdhC_CoxI; pfam02625
561275001025	Xanthine and CO dehydrogenases maturation factor, XdhC/CoxF family [Posttranslational modification, protein turnover, chaperones]; Region: XdhC; COG1975
561275001026	XdhC and CoxI family; Region: XdhC_CoxI; pfam02625
561275001027	XdhC Rossmann domain; Region: XdhC_C; pfam13478
561275001028	Transcriptional regulator [Transcription]; Region: LysR; COG0583
561275001029	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
561275001030	LysR substrate binding domain; Region: LysR_substrate; pfam03466
561275001031	dimerization interface [polypeptide binding]; other site
561275001032	Uncharacterized conserved protein [Function unknown]; Region: COG3360
561275001033	rRNA methylases [Translation, ribosomal structure and biogenesis]; Region: SpoU; COG0566
561275001034	SpoU rRNA Methylase family; Region: SpoU_methylase; pfam00588
561275001035	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
561275001036	active site
561275001037	ATP-dependent chaperone ClpB; Region: chaperone_ClpB; TIGR03346
561275001038	Clp amino terminal domain; Region: Clp_N; pfam02861
561275001039	Clp amino terminal domain; Region: Clp_N; pfam02861
561275001040	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
561275001041	Walker A motif; other site
561275001042	ATP binding site [chemical binding]; other site
561275001043	Walker B motif; other site
561275001044	arginine finger; other site
561275001045	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
561275001046	Walker A motif; other site
561275001047	ATP binding site [chemical binding]; other site
561275001048	Walker B motif; other site
561275001049	arginine finger; other site
561275001050	C-terminal, D2-small domain, of ClpB protein; Region: ClpB_D2-small; pfam10431
561275001051	Globins are heme proteins, which bind and transport oxygen. This family summarizes a diverse set of homologous protein domains, including: (1) tetrameric vertebrate hemoglobins, which are the major protein component of erythrocytes and transport oxygen...; Region: globin; cd01040
561275001052	bifunctional nitric oxide dioxygenase/dihydropteridine reductase 2; Provisional; Region: PRK13289
561275001053	heme-binding site [chemical binding]; other site
561275001054	The oxygenase reductase FAD/NADH binding domain acts as part of the multi-component bacterial oxygenases which oxidize hydrocarbons using oxygen as the oxidant. Electron transfer is from NADH via FAD (in the oxygenase reductase) and an [2FE-2S]...; Region: O2ase_reductase_like; cd06187
561275001055	FAD binding pocket [chemical binding]; other site
561275001056	FAD binding motif [chemical binding]; other site
561275001057	phosphate binding motif [ion binding]; other site
561275001058	beta-alpha-beta structure motif; other site
561275001059	NAD binding pocket [chemical binding]; other site
561275001060	Adenylate cyclase, family 3 (some proteins contain HAMP domain) [Signal transduction mechanisms]; Region: CyaA; COG2114
561275001061	cyclase homology domain; Region: CHD; cd07302
561275001062	nucleotidyl binding site; other site
561275001063	metal binding site [ion binding]; metal-binding site
561275001064	dimer interface [polypeptide binding]; other site
561275001065	Predicted ATPase [General function prediction only]; Region: COG3903
561275001066	RecA-like NTPases. This family includes the NTP binding domain of F1 and V1 H+ATPases, DnaB and related helicases as well as bacterial RecA and related eukaryotic and archaeal recombinases. This group also includes bacterial conjugation proteins and...; Region: RecA-like_NTPases; cl17233
561275001067	Walker A motif; other site
561275001068	ATP binding site [chemical binding]; other site
561275001069	Walker B motif; other site
561275001070	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
561275001071	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
561275001072	DNA binding residues [nucleotide binding]
561275001073	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275001074	PPE family; Region: PPE; pfam00823
561275001075	Formate-dependent phosphoribosylglycinamide formyltransferase (GAR transformylase) [Nucleotide transport and metabolism]; Region: PurT; COG0027
561275001076	Orn/Lys/Arg decarboxylase, N-terminal domain; Region: OKR_DC_1_N; pfam03709
561275001077	ATP-grasp domain; Region: ATP-grasp_4; cl17255
561275001078	Member of the Rhodanese Homology Domain superfamily, subgroup 1. This CD includes the putative rhodanese-related sulfurtransferases of several uncharacterized proteins; Region: RHOD_1; cd01522
561275001079	active site residue [active]
561275001080	O-succinylhomoserine sulfhydrylase; Provisional; Region: PRK07810
561275001081	CGS_like: Cystathionine gamma-synthase is a PLP dependent enzyme and catalyzes the committed step of methionine biosynthesis. This pathway is unique to microorganisms and plants, rendering the enzyme an attractive target for the development of...; Region: CGS_like; cd00614
561275001082	homodimer interface [polypeptide binding]; other site
561275001083	substrate-cofactor binding pocket; other site
561275001084	pyridoxal 5'-phosphate binding site [chemical binding]; other site
561275001085	catalytic residue [active]
561275001086	NADH dehydrogenase, FAD-containing subunit [Energy production and conversion]; Region: Ndh; COG1252
561275001087	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
561275001088	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
561275001089	Domain of unknown function (DUF222); Region: DUF222; pfam02720
561275001090	HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085
561275001091	active site
561275001092	PLD-like domain; Region: PLDc_2; pfam13091
561275001093	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
561275001094	Beta-lactamase; Region: Beta-lactamase; pfam00144
561275001095	Glutaryl-CoA dehydrogenase; Region: GCD; cd01151
561275001096	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275001097	FAD binding site [chemical binding]; other site
561275001098	substrate binding pocket [chemical binding]; other site
561275001099	catalytic base [active]
561275001100	Protein of unknown function (DUF3054); Region: DUF3054; pfam11255
561275001101	MMPL family; Region: MMPL; pfam03176
561275001102	MMPL family; Region: MMPL; pfam03176
561275001103	Mycobacterium membrane protein; Region: Mycobact_memb; pfam05423
561275001104	acyl-CoA synthetase; Validated; Region: PRK05850
561275001105	Fatty acyl-AMP ligase (FAAL); Region: FAAL; cd05931
561275001106	acyl-activating enzyme (AAE) consensus motif; other site
561275001107	active site
561275001108	Acyl carrier protein [Lipid metabolism / Secondary metabolites biosynthesis, transport, and catabolism]; Region: AcpP; COG0236
561275001109	Polyketide synthase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3321
561275001110	polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833
561275001111	active site
561275001112	Condensing enzymes; Family of enzymes that catalyze a (decarboxylating or non-decarboxylating) Claisen-like condensation reaction. Members are share strong structural similarity, and are involved in the synthesis and degradation of fatty acids, and the...; Region: cond_enzymes; cl09938
561275001113	malonyl CoA-acyl carrier protein transacylase; Region: fabD; TIGR00128
561275001114	Acyl transferase domain in polyketide synthase (PKS) enzymes; Region: PKS_AT; smart00827
561275001115	Phosphopantetheine attachment site; Region: PKS_PP; smart00823
561275001116	Thioesterase; Region: PKS_TE; smart00824
561275001117	Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849
561275001118	glucose-6-phosphate dehydrogenase (coenzyme-F420); Region: F420_G6P_DH; TIGR03554
561275001119	probable F420-dependent oxidoreductase, MSMEG_4141 family; Region: F420_MSMEG_4141; TIGR03620
561275001120	N5,N10-methylenetetrahydromethanopterin reductase (Mer) catalyzes the reduction of N5,N10-methylenetetrahydromethanopterin with reduced coenzyme F420 to N5-methyltetrahydromethanopterin and oxidized coenzyme F420; Region: Tetrahydromethanopterin_reductase; cd01097
561275001121	phosphate acetyltransferase; Reviewed; Region: PRK05632
561275001122	DRTGG domain; Region: DRTGG; pfam07085
561275001123	phosphotransacetylase; Reviewed; Region: eutD; PRK09653
561275001124	propionate/acetate kinase; Provisional; Region: PRK12379
561275001125	acetate kinase A/propionate kinase 2; Reviewed; Region: PRK00180
561275001126	Serine/Threonine protein kinases, catalytic domain; Region: S_TKc; smart00220
561275001127	Catalytic domain of Protein Kinases; Region: PKc; cd00180
561275001128	active site
561275001129	ATP binding site [chemical binding]; other site
561275001130	substrate binding site [chemical binding]; other site
561275001131	activation loop (A-loop); other site
561275001132	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
561275001133	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
561275001134	substrate binding pocket [chemical binding]; other site
561275001135	membrane-bound complex binding site; other site
561275001136	hinge residues; other site
561275001137	NUDIX domain; Region: NUDIX; pfam00293
561275001138	nudix motif; other site
561275001139	Thiamine monophosphate synthase (TMP synthase)/TenI. TMP synthase catalyzes an important step in the thiamine biosynthesis pathway, the substitution of the pyrophosphate of 2-methyl-4-amino-5- hydroxymethylpyrimidine pyrophosphate by 4-methyl-5-; Region: TMP_TenI; cd00564
561275001140	thiamine phosphate binding site [chemical binding]; other site
561275001141	active site
561275001142	pyrophosphate binding site [ion binding]; other site
561275001143	NADP oxidoreductase coenzyme F420-dependent; Region: F420_oxidored; cl17232
561275001144	glycine oxidase ThiO; Region: thiamin_ThiO; TIGR02352
561275001145	ThiaminS ubiquitin-like sulfur carrier protein; Region: ThiS; cd00565
561275001146	thiS-thiF/thiG interaction site; other site
561275001147	Thiazole synthase (ThiG) is the tetrameric enzyme that is involved in the formation of the thiazole moiety of thiamin pyrophosphate, an essential ubiquitous cofactor that plays an important role in carbohydrate and amino acid metabolism. ThiG catalyzes...; Region: ThiG; cd04728
561275001148	ThiS interaction site; other site
561275001149	putative active site [active]
561275001150	tetramer interface [polypeptide binding]; other site
561275001151	Predicted aminopeptidases [General function prediction only]; Region: Iap; COG2234
561275001152	Zinc peptidases M18, M20, M28, and M42; Region: Zinc_peptidase_like; cl14876
561275001153	PA_SaNapH_like: Protease-associated domain containing proteins like Streptomyces anulatus N-acetylpuromycin N-acetylhydrolase (SaNapH).This group contains various PA domain-containing proteins similar SaNapH.  Proteins in this group belong to the...; Region: PA_SaNapH_like; cd04816
561275001154	PA/protease or protease-like domain interface [polypeptide binding]; other site
561275001155	M28 Zn-peptidase Streptomyces griseus Aminopeptidase and similar proteins; Region: M28_SGAP_like; cd03876
561275001156	active site
561275001157	metal binding site [ion binding]; metal-binding site
561275001158	Predicted metalloprotease [General function prediction only]; Region: COG2321
561275001159	Peptidase Gluzincin family (thermolysin-like proteinases, TLPs) includes peptidases M1, M2, M3, M4, M13, M32 and M36 (fungalysins); Region: GluZincin; cl14813
561275001160	Zn binding site [ion binding]; other site
561275001161	Alpha/beta hydrolase family; Region: Abhydrolase_5; pfam12695
561275001162	4-amino-5-hydroxymethyl-2-methyl-pyrimidine phosphate kinase (HMPP-kinase) catalyzes two consecutive phosphorylation steps in the thiamine phosphate biosynthesis pathway, leading to the synthesis of vitamin B1. The first step is the phosphorylation of...; Region: HMPP_kinase; cd01169
561275001163	dimer interface [polypeptide binding]; other site
561275001164	substrate binding site [chemical binding]; other site
561275001165	ATP binding site [chemical binding]; other site
561275001166	thiamine biosynthesis protein ThiC; Provisional; Region: PRK09284
561275001167	ThiC-associated domain; Region: ThiC-associated; pfam13667
561275001168	ThiC family; Region: ThiC; pfam01964
561275001169	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
561275001170	ATPase, P-type (transporting), HAD superfamily, subfamily IC; Region: ATPase_P-type; TIGR01494
561275001171	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
561275001172	motif II; other site
561275001173	Cation transporting ATPase, C-terminus; Region: Cation_ATPase_C; pfam00689
561275001174	Escherichia coli exonuclease III (ExoIII) and Neisseria meningitides NExo-like subfamily of the ExoIII family purinic/apyrimidinic (AP) endonucleases; Region: ExoIII-like_AP-endo; cd09086
561275001175	putative catalytic site [active]
561275001176	putative phosphate binding site [ion binding]; other site
561275001177	active site
561275001178	metal binding site A [ion binding]; metal-binding site
561275001179	DNA binding site [nucleotide binding]
561275001180	putative AP binding site [nucleotide binding]; other site
561275001181	putative metal binding site B [ion binding]; other site
561275001182	Polypeptide or peptide deformylase; a family of metalloenzymes that catalyzes the removal of the N-terminal formyl group in a growing polypeptide chain following translation initiation during protein synthesis in prokaryotes. These enzymes utilize Fe(II)...; Region: Pep_deformylase; cd00487
561275001183	active site
561275001184	catalytic residues [active]
561275001185	metal binding site [ion binding]; metal-binding site
561275001186	Protein of unknown function (DUF3263); Region: DUF3263; pfam11662
561275001187	LytR cell envelope-related transcriptional attenuator; Region: LytR_C; pfam13399
561275001188	Cu/Zn superoxide dismutase [Inorganic ion transport and metabolism]; Region: SodC; COG2032
561275001189	Copper/zinc superoxide dismutase (SOD). superoxide dismutases catalyse the conversion of superoxide radicals to molecular oxygen. Three evolutionarily distinct families of SODs are known, of which the copper/zinc-binding family is one. Defects in the...; Region: Cu-Zn_Superoxide_Dismutase; cd00305
561275001190	E-class dimer interface [polypeptide binding]; other site
561275001191	P-class dimer interface [polypeptide binding]; other site
561275001192	active site
561275001193	Cu2+ binding site [ion binding]; other site
561275001194	Zn2+ binding site [ion binding]; other site
561275001195	carboxylate-amine ligase; Provisional; Region: PRK13517
561275001196	carboxylate-amine ligase, YbdK family; Region: gshA_cyan_rel; TIGR02050
561275001197	Uncharacterized protein, similar to the N-terminal domain of Lon protease [General function prediction only]; Region: COG2802
561275001198	AAA family ATPase, CDC48 subfamily; Region: CDC48; TIGR01243
561275001199	Cell division protein 48 (CDC48), N-terminal domain; Region: CDC48_N; pfam02359
561275001200	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
561275001201	Walker A motif; other site
561275001202	ATP binding site [chemical binding]; other site
561275001203	Walker B motif; other site
561275001204	arginine finger; other site
561275001205	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
561275001206	Walker A motif; other site
561275001207	ATP binding site [chemical binding]; other site
561275001208	Walker B motif; other site
561275001209	arginine finger; other site
561275001210	Phosphatidylserine synthase [Lipid metabolism]; Region: PssA; COG1183
561275001211	CDP-alcohol phosphatidyltransferase; Region: CDP-OH_P_transf; pfam01066
561275001212	phosphatidylserine decarboxylase; Provisional; Region: PRK05305
561275001213	Molybdopterin biosynthesis enzyme [Coenzyme metabolism]; Region: MoeA; COG0303
561275001214	MoeA family. Members of this family are involved in biosynthesis of the molybdenum cofactor (MoCF), an essential cofactor of a diverse group of redox enzymes. MoCF biosynthesis is an evolutionarily conserved pathway present in eubacteria, archaea and...; Region: MoeA; cd00887
561275001215	dimer interface [polypeptide binding]; other site
561275001216	putative functional site; other site
561275001217	putative MPT binding site; other site
561275001218	short chain dehydrogenase; Provisional; Region: PRK06197
561275001219	retinol dehydrogenase (retinol-DH), Light dependent Protochlorophyllide (Pchlide) OxidoReductase (LPOR) and related proteins, classical (c) SDRs; Region: retinol-DH_like_SDR_c_like; cd05327
561275001220	putative NAD(P) binding site [chemical binding]; other site
561275001221	active site
561275001222	chaperonin GroEL; Reviewed; Region: groEL; PRK12849
561275001223	GroEL_like type I chaperonin. Chaperonins are involved in productive folding of proteins. They share a common general morphology, a double toroid of 2 stacked rings, each composed of 7-9 subunits. The symmetry of type I is seven-fold and they are found...; Region: GroEL; cd03344
561275001224	ring oligomerisation interface [polypeptide binding]; other site
561275001225	ATP/Mg binding site [chemical binding]; other site
561275001226	stacking interactions; other site
561275001227	hinge regions; other site
561275001228	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275001229	PPE family; Region: PPE; pfam00823
561275001230	Protein of unknown function (DUF664); Region: DUF664; pfam04978
561275001231	DinB superfamily; Region: DinB_2; pfam12867
561275001232	putative anti-sigmaE protein; Provisional; Region: PRK13920
561275001233	Anti-sigma-K factor rskA; Region: RskA; pfam10099
561275001234	RNA polymerase sigma factor SigK; Reviewed; Region: PRK09646
561275001235	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
561275001236	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
561275001237	DNA binding residues [nucleotide binding]
561275001238	Steroid 5-alpha reductase family enzyme [General function prediction only]; Region: COG3752
561275001239	Mycolic acid cyclopropane synthetase; Region: CMAS; pfam02353
561275001240	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275001241	S-adenosylmethionine binding site [chemical binding]; other site
561275001242	Uncharacterized conserved protein [Function unknown]; Region: COG3496
561275001243	Predicted NAD/FAD-binding protein [General function prediction only]; Region: COG2907
561275001244	Subunit A of Class III extradiol dioxygenases; Region: Extradiol_Dioxygenase_3A_like; cl06673
561275001245	dimer interface [polypeptide binding]; other site
561275001246	Transport protein; Region: actII; TIGR00833
561275001247	Mycobacterium membrane protein; Region: Mycobact_memb; pfam05423
561275001248	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275001249	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275001250	PPE family; Region: PPE; pfam00823
561275001251	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275001252	Protein of unknown function (DUF2782); Region: DUF2782; pfam11191
561275001253	enoyl-CoA hydratase; Provisional; Region: PRK12478
561275001254	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
561275001255	substrate binding site [chemical binding]; other site
561275001256	oxyanion hole (OAH) forming residues; other site
561275001257	trimer interface [polypeptide binding]; other site
561275001258	PemK-like protein; Region: PemK; pfam02452
561275001259	Serine proteases of the peptidase family S9A [Amino acid transport and metabolism]; Region: COG1505
561275001260	Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326
561275001261	Ralstonia eutrophus NAD+-dependent acetaldehyde dehydrogenase II-like; Region: ALDH_ACDHII-AcoD; cd07116
561275001262	Aldehyde dehydrogenase family; Region: Aldedh; pfam00171
561275001263	NAD(P) binding site [chemical binding]; other site
561275001264	catalytic residues [active]
561275001265	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3564
561275001266	dihydrolipoamide dehydrogenase; Reviewed; Region: PRK07818
561275001267	Anaerobic glycerol-3-phosphate dehydrogenase [Amino acid transport and metabolism]; Region: GlpB; cl17730
561275001268	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
561275001269	Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852
561275001270	Uncharacterized conserved protein [Function unknown]; Region: COG2128
561275001271	Carboxymuconolactone decarboxylase family; Region: CMD; pfam02627
561275001272	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
561275001273	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
561275001274	non-specific DNA binding site [nucleotide binding]; other site
561275001275	salt bridge; other site
561275001276	sequence-specific DNA binding site [nucleotide binding]; other site
561275001277	Predicted transcriptional regulator [General function prediction only]; Region: COG3800
561275001278	Domain of unknown function (DUF955); Region: DUF955; pfam06114
561275001279	Predicted transcriptional regulator (DUF2083); Region: DUF2083; pfam09856
561275001280	Acyl-ACP thioesterase [Lipid metabolism]; Region: FatA; COG3884
561275001281	4-hydroxybenzoyl-CoA thioesterase (4HBT). Catalyzes the final step in the 4-chlorobenzoate degradation pathway in which 4-chlorobenzoate is converted to 4-hydroxybenzoate in certain soil-dwelling bacteria. 4HBT forms a homotetramer with four active sites; Region: 4HBT; cd00586
561275001282	active site
561275001283	The hotdog fold was initially identified in the E. coli FabA (beta-hydroxydecanoyl-acyl carrier protein (ACP)-dehydratase) structure and subsequently in 4HBT (4-hydroxybenzoyl-CoA thioesterase) from Pseudomonas. A number of other seemingly unrelated...; Region: hot_dog; cl00509
561275001284	active site 2 [active]
561275001285	isocitrate lyase; Provisional; Region: PRK15063
561275001286	Members of the ICL/PEPM_KPHMT enzyme superfamily catalyze the formation and cleavage of either P-C or C-C bonds. Typical members are phosphoenolpyruvate mutase (PEPM), phosphonopyruvate hydrolase (PPH), carboxyPEP mutase (CPEP mutase), oxaloacetate...; Region: ICL_KPHMT; cd06556
561275001287	oligomerization interface [polypeptide binding]; other site
561275001288	active site
561275001289	metal binding site [ion binding]; metal-binding site
561275001290	3-hydroxybutyryl-CoA dehydrogenase; Validated; Region: PRK07819
561275001291	3-hydroxyacyl-CoA dehydrogenase, NAD binding domain; Region: 3HCDH_N; pfam02737
561275001292	3-hydroxyacyl-CoA dehydrogenase, C-terminal domain; Region: 3HCDH; pfam00725
561275001293	Mycolic acid cyclopropane synthetase; Region: CMAS; pfam02353
561275001294	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275001295	S-adenosylmethionine binding site [chemical binding]; other site
561275001296	Mycolic acid cyclopropane synthetase; Region: CMAS; pfam02353
561275001297	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cl17173
561275001298	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275001299	S-adenosylmethionine binding site [chemical binding]; other site
561275001300	1,4-dihydroxy-2-naphthoate octaprenyltransferase [Coenzyme metabolism]; Region: MenA; cl17224
561275001301	UbiA prenyltransferase family; Region: UbiA; pfam01040
561275001302	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275001303	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275001304	Predicted membrane protein [Function unknown]; Region: COG2733
561275001305	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
561275001306	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
561275001307	non-specific DNA binding site [nucleotide binding]; other site
561275001308	salt bridge; other site
561275001309	sequence-specific DNA binding site [nucleotide binding]; other site
561275001310	Protein of unknown function (DUF2516); Region: DUF2516; pfam10724
561275001311	Protein of unknown function (DUF2599); Region: DUF2599; pfam10783
561275001312	2-deoxyribose-5-phosphate aldolase (DERA) of the DeoC family; Region: DeoC; cd00959
561275001313	intersubunit interface [polypeptide binding]; other site
561275001314	active site
561275001315	catalytic residue [active]
561275001316	Protein of unknown function (DUF2993); Region: DUF2993; pfam11209
561275001317	Predicted amidohydrolase [General function prediction only]; Region: COG0388
561275001318	Uncharacterized subgroup of the nitrilase superfamily (putative class 13 nitrilases); Region: nitrilase_3; cd07581
561275001319	putative active site [active]
561275001320	catalytic triad [active]
561275001321	putative dimer interface [polypeptide binding]; other site
561275001322	Protein of unknown function (DUF2505); Region: DUF2505; pfam10698
561275001323	UDP-N-acetylenolpyruvoylglucosamine reductase; Provisional; Region: murB; PRK13903
561275001324	FAD binding domain; Region: FAD_binding_4; pfam01565
561275001325	UDP-N-acetylenolpyruvoylglucosamine reductase, C-terminal domain; Region: MurB_C; pfam02873
561275001326	IgD-like repeat domain of mycobacterial L,D-transpeptidases; Region: LDT_IgD_like_1; cd13431
561275001327	Uncharacterized protein conserved in bacteria [Function unknown]; Region: ErfK; COG1376
561275001328	IgD-like repeat domain of mycobacterial L,D-transpeptidases; Region: LDT_IgD_like_2; cd13432
561275001329	L,D-transpeptidase catalytic domain; Region: YkuD; pfam03734
561275001330	Short-chain alcohol dehydrogenase of unknown specificity [General function prediction only]; Region: COG4221
561275001331	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
561275001332	NAD(P) binding site [chemical binding]; other site
561275001333	active site
561275001334	Transcriptional regulator/sugar kinase [Transcription / Carbohydrate transport and metabolism]; Region: NagC; COG1940
561275001335	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cl17037
561275001336	This family is most closely related to the GT1 family of glycosyltransferases. The sucrose-phosphate synthases in this family may be unique to plants and photosynthetic bacteria. This enzyme catalyzes the synthesis of sucrose 6-phosphate from fructose...; Region: GT1_Sucrose_synthase; cd03800
561275001337	D-inositol-3-phosphate glycosyltransferase; Region: mycothiol_MshA; TIGR03449
561275001338	putative ADP-binding pocket [chemical binding]; other site
561275001339	Putative bacterial sensory transduction regulator; Region: YbjN; pfam10722
561275001340	VNTR0577 is located between Rv0487 and Rv0488. Differs from BCG Pasteur by a 58-bp in VNTR0577 locus of BCG Tokyo. The copy number of the 58-bp unit is 3 in BCG Tokyo and 4 in BCG Pasteur.
561275001341	L-lysine exporter; Region: 2a75; TIGR00948
561275001342	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
561275001343	catalytic core [active]
561275001344	Histidine phosphatase domain found in a functionally diverse set of proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP; cd07040
561275001345	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
561275001346	dimer interface [polypeptide binding]; other site
561275001347	phosphorylation site [posttranslational modification]
561275001348	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
561275001349	ATP binding site [chemical binding]; other site
561275001350	Mg2+ binding site [ion binding]; other site
561275001351	G-X-G motif; other site
561275001352	VNTR0580 (alternatively, senX3-regX3) is located between senX3 and regX3. Differs from BCG Pasteur by a 77-bp in VNTR0580 locus of BCG Tokyo. The copy number of the 77-bp unit is 3 in BCG Tokyo and 2 in BCG Pasteur.
561275001353	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
561275001354	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
561275001355	active site
561275001356	phosphorylation site [posttranslational modification]
561275001357	intermolecular recognition site; other site
561275001358	dimerization interface [polypeptide binding]; other site
561275001359	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
561275001360	DNA binding site [nucleotide binding]
561275001361	GMC oxidoreductase; Region: GMC_oxred_N; pfam00732
561275001362	GMC oxidoreductase; Region: GMC_oxred_C; pfam05199
561275001363	Transcriptional regulators [Transcription]; Region: FadR; COG2186
561275001364	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
561275001365	DNA-binding site [nucleotide binding]; DNA binding site
561275001366	FCD domain; Region: FCD; pfam07729
561275001367	Ppx/GppA phosphatase family; Region: Ppx-GppA; pfam02541
561275001368	exopolyphosphatase; Region: exo_poly_only; TIGR03706
561275001369	Sugar phosphate isomerases/epimerases [Carbohydrate transport and metabolism]; Region: IolE; COG1082
561275001370	AP endonuclease family 2; These endonucleases play a role in DNA repair. Cleave phosphodiester bonds at apurinic or apyrimidinic sites; the alignment also contains hexulose-6-phosphate isomerases, enzymes that catalyze the epimerization of...; Region: AP2Ec; cl12060
561275001371	Thioesterase-like superfamily; Region: 4HBT_3; pfam13622
561275001372	Diacylglycerol kinase catalytic domain (presumed); Region: DAGKc; smart00046
561275001373	pyrroline-5-carboxylate reductase; Reviewed; Region: PRK11880
561275001374	NADP oxidoreductase coenzyme F420-dependent; Region: F420_oxidored; pfam03807
561275001375	NADP oxidoreductase coenzyme F420-dependent; Region: F420_oxidored; cl17232
561275001376	DNA binding domain, excisionase family; Region: excise; TIGR01764
561275001377	Nucleoside-diphosphate-sugar epimerases [Cell envelope biogenesis, outer membrane / Carbohydrate transport and metabolism]; Region: WcaG; COG0451
561275001378	UDP-glucose 4 epimerase (G4E), subgroup 3, extended (e) SDRs; Region: UDP_G4E_3_SDR_e; cd05240
561275001379	putative NAD(P) binding site [chemical binding]; other site
561275001380	active site
561275001381	putative substrate binding site [chemical binding]; other site
561275001382	1-acyl-sn-glycerol-3-phosphate acyltransferase [Lipid metabolism]; Region: PlsC; COG0204
561275001383	Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: MGAT-like; Region: LPLAT_MGAT-like; cd07987
561275001384	putative acyl-acceptor binding pocket; other site
561275001385	Mycolic acid cyclopropane synthetase; Region: CMAS; pfam02353
561275001386	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cl17173
561275001387	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275001388	S-adenosylmethionine binding site [chemical binding]; other site
561275001389	(R)-hydratase [(R)-specific enoyl-CoA hydratase]. Catalyzes the hydration of trans-2-enoyl CoA to (R)-3-hydroxyacyl-CoA as part of the PHA (polyhydroxyalkanoate) biosynthetic pathway.  The structure of the monomer includes a five-strand antiparallel...; Region: R_hydratase_like; cd03441
561275001390	active site
561275001391	catalytic site [active]
561275001392	Phosphoserine phosphatase [Amino acid transport and metabolism]; Region: SerB; COG0560
561275001393	HAD-superfamily subfamily IB hydrolase, TIGR01490; Region: HAD-SF-IB-hyp1
561275001394	Mycobacterium membrane protein; Region: Mycobact_memb; pfam05423
561275001395	Predicted drug exporters of the RND superfamily [General function prediction only]; Region: COG2409
561275001396	Glutaredoxin-like domain (DUF836); Region: DUF836; pfam05768
561275001397	glutamyl-tRNA reductase; Region: hemA; TIGR01035
561275001398	NADP-binding domain of glutamyl-tRNA reductase; Region: NAD_bind_Glutamyl_tRNA_reduct; cd05213
561275001399	tRNA; other site
561275001400	putative tRNA binding site [nucleotide binding]; other site
561275001401	putative NADP binding site [chemical binding]; other site
561275001402	Glutamyl-tRNAGlu reductase, dimerisation domain; Region: GlutR_dimer; pfam00745
561275001403	porphobilinogen deaminase; Reviewed; Region: hemC; PRK00072
561275001404	Hydroxymethylbilane synthase (HMBS), also known as porphobilinogen deaminase (PBGD), is an intermediate enzyme in the biosynthetic pathway of tetrapyrrolic ring systems, such as heme, chlorophylls, and vitamin B12. HMBS catalyzes the conversion of...; Region: HMBS; cd00494
561275001405	domain interfaces; other site
561275001406	active site
561275001407	S-AdoMet dependent tetrapyrrole methylases; Region: TP_methylase; cd09815
561275001408	active site
561275001409	homodimer interface [polypeptide binding]; other site
561275001410	SAM binding site [chemical binding]; other site
561275001411	Uroporphyrinogen-III synthase [Coenzyme metabolism]; Region: HemD; COG1587
561275001412	Uroporphyrinogen-III synthase (HemD) catalyzes the asymmetrical cyclization of tetrapyrrole (linear) to uroporphyrinogen-III, the fourth step in the biosynthesis of heme. This ubiquitous enzyme is present in eukaryotes, bacteria and archaea. Mutations in...; Region: HemD; cd06578
561275001413	active site
561275001414	Porphobilinogen synthase (PBGS), which is also called delta-aminolevulinic acid dehydratase (ALAD), catalyzes the condensation of two 5-aminolevulinic acid (ALA) molecules to form the pyrrole porphobilinogen (PBG), which is the second step in the...; Region: ALAD_PBGS; cd00384
561275001415	dimer interface [polypeptide binding]; other site
561275001416	active site
561275001417	Schiff base residues; other site
561275001418	Domain of unknown function (DUF222); Region: DUF222; pfam02720
561275001419	HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085
561275001420	active site
561275001421	Sulphate Transporter and Anti-Sigma factor antagonist) domain of anti-anti-sigma factors, key regulators of anti-sigma factors by phosphorylation; Region: STAS_anti-anti-sigma_factors; cd07043
561275001422	anti sigma factor interaction site; other site
561275001423	regulatory phosphorylation site [posttranslational modification]; other site
561275001424	Predicted acyltransferases [Lipid metabolism]; Region: COG1835
561275001425	SGNH_hydrolase, or GDSL_hydrolase, is a diverse family of lipases and esterases. The tertiary fold of the enzyme is substantially different from that of the alpha/beta hydrolase family and unique among all known hydrolases; its active site closely...; Region: SGNH_hydrolase; cd00229
561275001426	active site
561275001427	catalytic triad [active]
561275001428	oxyanion hole [active]
561275001429	Enterochelin esterase and related enzymes [Inorganic ion transport and metabolism]; Region: Fes; COG2382
561275001430	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275001431	Methyltransferase domain; Region: Methyltransf_31; pfam13847
561275001432	Gamma-aminobutyrate permease and related permeases [Amino acid transport and metabolism]; Region: AnsP; COG1113
561275001433	Domain of unknown function (DUF385); Region: DUF385; pfam04075
561275001434	glutamate-1-semialdehyde aminotransferase; Provisional; Region: PRK00062
561275001435	Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes. PLP combines with an alpha-amino acid to form a compound called a Schiff base or aldimine intermediate, which depending on the reaction, is the...; Region: AAT_I; cl00321
561275001436	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
561275001437	catalytic residue [active]
561275001438	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
561275001439	catalytic core [active]
561275001440	TlpA-like family; composed of  TlpA, ResA, DsbE and similar proteins. TlpA, ResA and DsbE are bacterial protein disulfide reductases with important roles in cytochrome maturation. They are membrane-anchored proteins with a soluble TRX domain containing a...; Region: TlpA_like_family; cd02966
561275001441	Thioredoxin-like; Region: Thioredoxin_8; pfam13905
561275001442	catalytic residues [active]
561275001443	Cytochrome c biogenesis protein [Posttranslational modification, protein turnover, chaperones]; Region: CcdA; COG0785
561275001444	Cytochrome C biogenesis protein transmembrane region; Region: DsbD; cl15788
561275001445	ResB protein required for cytochrome c biosynthesis [Posttranslational modification, protein turnover, chaperones]; Region: ResB; COG1333
561275001446	ResB-like family; Region: ResB; pfam05140
561275001447	cytochrome c-type biogenesis protein CcsB; Region: cytochr_II_ccsB; TIGR03144
561275001448	ParA and ParB of Caulobacter crescentus belong to a conserved family of bacterial proteins implicated in chromosome segregation. ParB binds to DNA sequences adjacent to the origin of replication and localizes to opposite cell poles shortly following the...; Region: ParA; cd02042
561275001449	AAA domain; Region: AAA_31; pfam13614
561275001450	P-loop; other site
561275001451	Magnesium ion binding site [ion binding]; other site
561275001452	Type 1 glutamine amidotransferase (GATase1)-like domain; Region: GAT_1; cl00020
561275001453	Protein of unknown function (DUF4229); Region: DUF4229; pfam14012
561275001455	3-oxoacyl-(acyl-carrier-protein) synthase III; Region: fabH; TIGR00747
561275001456	Ketoacyl-acyl carrier protein synthase III (KASIII) initiates the elongation in type II fatty acid synthase systems. It is found in bacteria and plants. Elongation of fatty acids in the type II systems occurs by Claisen condensation of malonyl-acyl...; Region: KAS_III; cd00830
561275001457	dimer interface [polypeptide binding]; other site
561275001458	active site
561275001459	CoA binding pocket [chemical binding]; other site
561275001460	1,4-dihydroxy-2-naphthoate octaprenyltransferase; Region: menA; TIGR00751
561275001461	UbiA prenyltransferase family; Region: UbiA; pfam01040
561275001462	5'-methylthioadenosine phosphorylase; Validated; Region: PRK07823
561275001463	Nucleoside-diphosphate-sugar epimerases [Cell envelope biogenesis, outer membrane / Carbohydrate transport and metabolism]; Region: WcaG; COG0451
561275001464	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
561275001465	NAD(P) binding site [chemical binding]; other site
561275001466	active site
561275001467	DPM_DPG-synthase_like is a member of the Glycosyltransferase 2 superfamily; Region: DPM_DPG-synthase_like; cd04179
561275001468	Ligand binding site; other site
561275001469	Putative Catalytic site; other site
561275001470	DXD motif; other site
561275001471	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3222
561275001472	O-succinylbenzoic acid--CoA ligase; Provisional; Region: PRK07824
561275001473	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
561275001474	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
561275001475	acyl-activating enzyme (AAE) consensus motif; other site
561275001476	acyl-activating enzyme (AAE) consensus motif; other site
561275001477	AMP binding site [chemical binding]; other site
561275001478	active site
561275001479	CoA binding site [chemical binding]; other site
561275001480	Protein of unknown function (DUF3349); Region: DUF3349; pfam11829
561275001481	Phosphate/sulphate permeases [Inorganic ion transport and metabolism]; Region: PitA; COG0306
561275001482	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
561275001483	This domain superfamily is found in a variety of structurally related metalloproteins, including the type I extradiol dioxygenases, glyoxalase I and a group of antibiotic resistance proteins; Region: Glo_EDI_BRP_like; cd06587
561275001484	active site
561275001485	short chain dehydrogenase; Provisional; Region: PRK05866
561275001486	classical (c) SDRs; Region: SDR_c; cd05233
561275001487	NAD(P) binding site [chemical binding]; other site
561275001488	active site
561275001489	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
561275001490	Enoyl-CoA hydratase/isomerase family; Region: ECH; pfam00378
561275001491	substrate binding site [chemical binding]; other site
561275001492	oxyanion hole (OAH) forming residues; other site
561275001493	trimer interface [polypeptide binding]; other site
561275001495	PIN domain of the Pyrobaculum aerophilum Pae0151 and Pae2754 proteins and homologs; Region: PIN_Pae0151; cd09873
561275001496	putative active site [active]
561275001497	homotetrameric interface [polypeptide binding]; other site
561275001498	Post-segregation antitoxin (ccd killing mechanism protein) encoded by the F plasmid [General function prediction only]; Region: COG5302
561275001499	acyl-CoA synthetase; Validated; Region: PRK06188
561275001500	Bacterial Bile acid CoA ligases and similar proteins; Region: BACL_like; cd05929
561275001501	putative active site [active]
561275001502	putative CoA binding site [chemical binding]; other site
561275001503	putative AMP binding site [chemical binding]; other site
561275001504	Predicted metal-dependent hydrolase with the TIM-barrel fold [General function prediction only]; Region: COG1574
561275001505	YtcJ_like metal dependent amidohydrolases. YtcJ is a Bacillus subtilis ORF of unknown function. The Arabidopsis homolog LAF3 has been identified as a factor required for photochrome A signalling; Region: YtcJ_like; cd01300
561275001506	active site
561275001507	O-succinylbenzoate synthase; Provisional; Region: PRK02901
561275001508	o-Succinylbenzoate synthase (OSBS) catalyzes the conversion of 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate (SHCHC) to 4-(2'-carboxyphenyl)-4-oxobutyrate (o-succinylbenzoate or OSB), a reaction in the menaquinone biosynthetic pathway; Region: OSBS; cd03320
561275001509	active site
561275001510	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
561275001511	homoserine O-acetyltransferase; Provisional; Region: metX; cl17114
561275001512	TAP-like protein; Region: Abhydrolase_4; pfam08386
561275001513	2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1- carboxylate synthase; Validated; Region: PRK07449
561275001514	Pyrimidine (PYR) binding domain of 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexadiene-1- carboxylate synthase (MenD) and related proteins; Region: TPP_PYR_MenD; cd07037
561275001515	dimer interface [polypeptide binding]; other site
561275001516	tetramer interface [polypeptide binding]; other site
561275001517	PYR/PP interface [polypeptide binding]; other site
561275001518	TPP binding site [chemical binding]; other site
561275001519	Thiamine pyrophosphate (TPP) family, SHCHC synthase subfamily, TPP-binding module; composed of proteins similar to Escherichia coli 2-succinyl-6-hydroxyl-2,4-cyclohexadiene-1-carboxylic acid (SHCHC) synthase (also called MenD). SHCHC synthase plays a key...; Region: TPP_SHCHC_synthase; cd02009
561275001520	TPP-binding site; other site
561275001521	Protein of unknown function (DUF3592); Region: DUF3592; pfam12158
561275001522	Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438
561275001523	This family is most closely related to the GT1 family of glycosyltransferases. Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. The acceptor molecule can...; Region: GT1_like_2; cd03814
561275001524	Methylase involved in ubiquinone/menaquinone biosynthesis [Coenzyme metabolism]; Region: UbiE; COG2226
561275001525	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275001526	S-adenosylmethionine binding site [chemical binding]; other site
561275001527	Protein of unknown function (DUF732); Region: DUF732; pfam05305
561275001528	Methyltransferase domain; Region: Methyltransf_23; pfam13489
561275001529	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275001530	S-adenosylmethionine binding site [chemical binding]; other site
561275001531	geranylgeranyl reductase family; Region: GG-red-SF; TIGR02032
561275001532	ubiquinone biosynthesis hydroxylase family protein; Provisional; Region: PRK07608; cl17314
561275001533	Geranylgeranyl pyrophosphate synthase [Coenzyme metabolism]; Region: IspA; COG0142
561275001534	Trans-Isoprenyl Diphosphate Synthases, head-to-tail; Region: Trans_IPPS_HT; cd00685
561275001535	substrate binding pocket [chemical binding]; other site
561275001536	chain length determination region; other site
561275001537	substrate-Mg2+ binding site; other site
561275001538	catalytic residues [active]
561275001539	aspartate-rich region 1; other site
561275001540	active site lid residues [active]
561275001541	aspartate-rich region 2; other site
561275001542	heat shock protein HtpX; Provisional; Region: PRK03072
561275001543	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase; Provisional; Region: PRK12439
561275001544	NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus; Region: NAD_Gly3P_dh_N; pfam01210
561275001545	NAD-dependent glycerol-3-phosphate dehydrogenase C-terminus; Region: NAD_Gly3P_dh_C; pfam07479
561275001546	Predicted flavoprotein involved in K+ transport [Inorganic ion transport and metabolism]; Region: TrkA; COG2072
561275001547	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox_3; pfam13738
561275001548	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG1666
561275001549	Proteins similar to Escherichia coli YajQ; Region: YajQ_like; cd11740
561275001550	O-methyltransferase; Region: Methyltransf_2; pfam00891
561275001551	Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124
561275001552	Cytochrome P450; Region: p450; cl12078
561275001553	Domain of unknown function (DUF1918); Region: DUF1918; pfam08940
561275001554	ATP cone domain; Region: ATP-cone; pfam03477
561275001555	Ribonucleotide reductase, all-alpha domain; Region: Ribonuc_red_lgN; pfam00317
561275001556	ribonucleoside-diphosphate reductase, adenosylcobalamin-dependent; Region: NrdJ_Z; TIGR02504
561275001557	Class II ribonucleotide reductase, dimeric form; Region: RNR_II_dimer; cd02888
561275001558	active site
561275001559	dimer interface [polypeptide binding]; other site
561275001560	effector binding site; other site
561275001561	Ribonucleotide reductase and Pyruvate formate lyase; Region: RNR_PFL; cl09939
561275001562	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
561275001563	active site
561275001564	Putative lysophospholipase; Region: Hydrolase_4; pfam12146
561275001565	Alpha/beta hydrolase family; Region: Abhydrolase_5; pfam12695
561275001566	nicotinate phosphoribosyltransferase; Provisional; Region: PRK12484
561275001567	Nicotinate phosphoribosyltransferase (NAPRTase), subgroup A. Nicotinate phosphoribosyltransferase catalyses the formation of NAMN and PPi from 5-phosphoribosy -1-pyrophosphate (PRPP) and nicotinic acid, this is the first, and also rate limiting, reaction...; Region: NAPRTase_A; cd01570
561275001568	active site
561275001569	Putative enzyme of poly-gamma-glutamate biosynthesis (capsule formation) [Cell envelope biogenesis, outer membrane]; Region: PgsA; COG2843
561275001570	CapA and related proteins, metallophosphatase domain; Region: MPP_CapA; cd07381
561275001571	putative active site [active]
561275001572	putative metal binding site [ion binding]; other site
561275001573	hypothetical protein; Provisional; Region: PRK07588
561275001574	ubiquinone biosynthesis hydroxylase family protein; Provisional; Region: PRK07608; cl17314
561275001575	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
561275001576	dimerization interface [polypeptide binding]; other site
561275001577	putative DNA binding site [nucleotide binding]; other site
561275001578	putative Zn2+ binding site [ion binding]; other site
561275001579	Putative hydrophobic ligand-binding SRPBCC domain of Micromonospora echinospora CalC, human Aha1, and related proteins; Region: SRPBCC_CalC_Aha1-like; cd07814
561275001580	putative hydrophobic ligand binding site [chemical binding]; other site
561275001581	uncharacterized Actinobacterial protein TIGR03083; Region: TIGR03083
561275001582	TIGR03086 family protein; Region: TIGR03086
561275001583	N-terminal domain of Streptomyces griseus SgaA (suppression of growth disturbance caused by A-factor at a high concentration under high osmolality during early growth phase), and similar domains; Region: SgaA_N_like; cd07247
561275001584	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
561275001585	N-terminal domain of Streptomyces griseus SgaA (suppression of growth disturbance caused by A-factor at a high concentration under high osmolality during early growth phase), and similar domains; Region: SgaA_N_like; cd07247
561275001586	PE family; Region: PE; pfam00934
561275001587	Ub domain fused to Mut7-C; Region: Ub-Mut7C; pfam14451
561275001588	Uncharacterized conserved protein [Function unknown]; Region: COG1656
561275001589	Protein of unknown function DUF82; Region: DUF82; pfam01927
561275001590	Ribbon-helix-helix protein, copG family; Region: RHH_1; pfam01402
561275001591	PIN domain of ribonucleases (toxins), VapC, FitB, and PAE0151 of bacterial and archaeal toxin/antitoxin-like operons, and other similar homologs; Region: PIN_VapC-like; cd09861
561275001592	putative active site [active]
561275001593	Probable lipoprotein LpqN; Region: Lpp-LpqN; pfam10738
561275001594	Putative alpha-1,2-mannosidase [Carbohydrate transport and metabolism]; Region: COG3537
561275001595	Glycosyl hydrolase family 92; Region: Glyco_hydro_92; pfam07971
561275001596	Uncharacterized protein family (UPF0104); Region: UPF0104; pfam03706
561275001597	Transcriptional regulators [Transcription]; Region: FadR; COG2186
561275001598	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
561275001599	DNA-binding site [nucleotide binding]; DNA binding site
561275001600	FCD domain; Region: FCD; pfam07729
561275001601	ABC-type transport system involved in resistance to organic solvents, permease component [Secondary metabolites biosynthesis, transport, and catabolism]; Region: Ttg2B; COG0767
561275001602	Permease; Region: Permease; pfam02405
561275001603	ABC-type transport system involved in resistance to organic solvents, permease component [Secondary metabolites biosynthesis, transport, and catabolism]; Region: Ttg2B; COG0767
561275001604	Permease; Region: Permease; pfam02405
561275001605	virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996
561275001606	mce related protein; Region: MCE; pfam02470
561275001607	Protein of unknown function (DUF3407); Region: DUF3407; pfam11887
561275001608	ABC-type transport system involved in resistance to organic solvents, periplasmic component [Secondary metabolites biosynthesis, transport, and catabolism]; Region: Ttg2C; COG1463
561275001609	mce related protein; Region: MCE; pfam02470
561275001610	Protein of unknown function (DUF3407); Region: DUF3407; pfam11887
561275001611	virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996
561275001612	mce related protein; Region: MCE; pfam02470
561275001613	virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996
561275001614	mce related protein; Region: MCE; pfam02470
561275001615	Protein of unknown function (DUF3407); Region: DUF3407; pfam11887
561275001616	virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996
561275001617	mce related protein; Region: MCE; pfam02470
561275001618	virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996
561275001619	mce related protein; Region: MCE; pfam02470
561275001620	PIN domain of ribonucleases (toxins), VapC and FitB, of prokaryotic toxin/antitoxin operons, Pyrococcus horikoshii protein PH0500, and other similar bacterial and archaeal homologs; Region: PIN_VapC-FitB; cd09881
561275001621	oligomeric interface; other site
561275001622	putative active site [active]
561275001623	homodimer interface [polypeptide binding]; other site
561275001624	Antitoxin of toxin-antitoxin stability system [Cell division and chromosome partitioning]; Region: Phd; COG4118
561275001625	Predicted ATPase (AAA+ superfamily) [General function prediction only]; Region: COG1373
561275001626	AAA domain; Region: AAA_14; pfam13173
561275001627	Regulators of stationary/sporulation gene expression [Transcription]; Region: AbrB; COG2002
561275001628	looped-hinge helix DNA binding domain, AbrB family; Region: lp_hng_hel_AbrB; TIGR01439
561275001629	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
561275001630	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
561275001631	ATP binding site [chemical binding]; other site
561275001632	Mg2+ binding site [ion binding]; other site
561275001633	G-X-G motif; other site
561275001634	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
561275001635	dimerization interface [polypeptide binding]; other site
561275001636	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
561275001637	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
561275001638	active site
561275001639	phosphorylation site [posttranslational modification]
561275001640	intermolecular recognition site; other site
561275001641	dimerization interface [polypeptide binding]; other site
561275001642	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
561275001643	DNA binding site [nucleotide binding]
561275001644	Domain of Unknown Function (DUF1259); Region: DUF1529; pfam07485
561275001645	Domain of Unknown Function (DUF1259); Region: DUF1529; pfam07485
561275001646	Predicted site-specific integrase-resolvase [DNA replication, recombination, and repair]; Region: COG2452
561275001647	Serine Recombinase (SR) family, IS607-like transposase subfamily, catalytic domain; members contain a DNA binding domain with homology to MerR/SoxR located N-terminal to the catalytic domain. Serine recombinases catalyze site-specific recombination of...; Region: SR_IS607_transposase_like; cd03769
561275001648	catalytic residues [active]
561275001649	catalytic nucleophile [active]
561275001650	Helix-turn-helix domain; Region: HTH_OrfB_IS605; pfam12323
561275001651	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG0675
561275001652	Probable transposase; Region: OrfB_IS605; pfam01385
561275001653	Rv0623-like transcription factor; Region: PSK_trans_fac; pfam07704
561275001654	PIN domain of the VapC-like UPF0110 protein Mb0640 and homologs; Region: PIN_UPF0110; cd09871
561275001655	putative active site [active]
561275001656	SEC-C motif; Region: SEC-C; pfam02810
561275001657	PIN domain of ribonucleases (toxins), VapC and FitB, of prokaryotic toxin/antitoxin operons, Pyrococcus horikoshii protein PH0500, and other similar bacterial and archaeal homologs; Region: PIN_VapC-FitB-like; cd09875
561275001658	putative active site [active]
561275001659	Galactose-1-phosphate uridyl transferase (GalT): This enzyme plays a key role in galactose metabolism by catalysing the transfer of a uridine 5'-phosphoryl group from UDP-galactose 1-phosphate. The structure of E.coli GalT reveals that the enzyme...; Region: GalT; cd00608
561275001660	dimer interface [polypeptide binding]; other site
561275001661	Galactose-1-phosphate uridylyltransferase [Energy production and conversion]; Region: GalT; COG1085
561275001662	active site
561275001663	galactokinase; Provisional; Region: PRK00555
561275001664	Galactokinase galactose-binding signature; Region: GalKase_gal_bdg; pfam10509
561275001665	Protein of unknown function (DUF732); Region: DUF732; pfam05305
561275001666	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4423
561275001667	PIN domain of the VapC-like UPF0110 protein Mb0640 and homologs; Region: PIN_UPF0110; cd09871
561275001668	putative active site [active]
561275001669	Uncharacterized conserved protein [Function unknown]; Region: COG0398
561275001670	SNARE associated Golgi protein; Region: SNARE_assoc; pfam09335
561275001671	Antitoxin of toxin-antitoxin stability system [Cell division and chromosome partitioning]; Region: Phd; COG4118
561275001672	PIN domain of ribonucleases (toxins), VapC and FitB, of prokaryotic toxin/antitoxin operons, Pyrococcus horikoshii protein PH0500, and other similar bacterial and archaeal homologs; Region: PIN_VapC-FitB; cd09881
561275001673	oligomeric interface; other site
561275001674	putative active site [active]
561275001675	homodimer interface [polypeptide binding]; other site
561275001676	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4398
561275001677	FIST N domain; Region: FIST; pfam08495
561275001678	FIST C domain; Region: FIST_C; pfam10442
561275001679	exodeoxyribonuclease V, alpha subunit; Region: recD; TIGR01447
561275001680	AAA domain; Region: AAA_30; pfam13604
561275001681	Family description; Region: UvrD_C_2; pfam13538
561275001683	UvrD/REP helicase N-terminal domain; Region: UvrD-helicase; pfam00580
561275001684	UvrD-like helicase C-terminal domain; Region: UvrD_C; pfam13361
561275001685	exodeoxyribonuclease V, gamma subunit; Region: recC; TIGR01450
561275001686	exonuclease V subunit gamma; Provisional; Region: recC; PRK11069
561275001687	Enoyl-CoA hydratase/carnithine racemase [Lipid metabolism]; Region: CaiD; COG1024
561275001688	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
561275001689	substrate binding site [chemical binding]; other site
561275001690	oxyanion hole (OAH) forming residues; other site
561275001691	trimer interface [polypeptide binding]; other site
561275001692	Metallo-beta-lactamase superfamily; Region: Lactamase_B; cl00446
561275001693	Transcription regulator of the Arc/MetJ class [Transcription]; Region: COG5450
561275001694	50S ribosomal protein L33; Validated; Region: rpmG; PRK00504
561275001695	(R)-hydratase [(R)-specific enoyl-CoA hydratase]. Catalyzes the hydration of trans-2-enoyl CoA to (R)-3-hydroxyacyl-CoA as part of the PHA (polyhydroxyalkanoate) biosynthetic pathway.  The structure of the monomer includes a five-strand antiparallel...; Region: R_hydratase_like; cd03441
561275001696	active site
561275001697	catalytic site [active]
561275001698	SAV4209_like.  Similar in sequence to the Streptomyces avermitilis SAV4209 protein, with a hot dog fold that is similar to those of (R)-specific enoyl-CoA hydratase, the peroxisomal Hydratase-Dehydrogenase-Epimerase (HDE) protein, and the fatty acid...; Region: SAV4209_like; cd03453
561275001699	active site
561275001700	catalytic site [active]
561275001701	(R)-hydratase [(R)-specific enoyl-CoA hydratase]. Catalyzes the hydration of trans-2-enoyl CoA to (R)-3-hydroxyacyl-CoA as part of the PHA (polyhydroxyalkanoate) biosynthetic pathway.  The structure of the monomer includes a five-strand antiparallel...; Region: R_hydratase_like; cd03441
561275001702	active site
561275001703	catalytic site [active]
561275001704	preprotein translocase subunit SecE; Reviewed; Region: secE; PRK07597
561275001705	transcription antitermination protein NusG; Validated; Region: nusG; PRK05609
561275001706	Bacterial N-Utilization Substance G (NusG) N-terminal (NGN) domain, subgroup 1; Region: NGN_Bact_1; cd09891
561275001707	putative homodimer interface [polypeptide binding]; other site
561275001708	NusG contains an NGN domain at its N-terminus and KOW motif at its C-terminus; Region: KOW_NusG; cd06091
561275001709	heterodimer interface [polypeptide binding]; other site
561275001710	homodimer interface [polypeptide binding]; other site
561275001711	50S ribosomal protein L11; Validated; Region: rplK; PRK00140
561275001712	Ribosomal protein L11. Ribosomal protein L11, together with proteins L10 and L7/L12, and 23S rRNA, form the L7/L12 stalk on the surface of the large subunit of the ribosome. The homologous eukaryotic cytoplasmic protein is also called 60S ribosomal...; Region: Ribosomal_L11; cd00349
561275001713	23S rRNA interface [nucleotide binding]; other site
561275001714	L7/L12 interface [polypeptide binding]; other site
561275001715	putative thiostrepton binding site; other site
561275001716	L25 interface [polypeptide binding]; other site
561275001717	Ribosomal protein L1.  The L1 protein, located near the E-site of the ribosome, forms part of the L1 stalk along with 23S rRNA.  In bacteria and archaea, L1 functions both as a ribosomal protein that binds rRNA, and as a translation repressor that binds...; Region: Ribosomal_L1; cd00403
561275001718	mRNA/rRNA interface [nucleotide binding]; other site
561275001719	Mycolic acid cyclopropane synthetase; Region: CMAS; pfam02353
561275001720	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275001721	S-adenosylmethionine binding site [chemical binding]; other site
561275001722	Mycolic acid cyclopropane synthetase; Region: CMAS; pfam02353
561275001723	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cl17173
561275001724	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275001725	S-adenosylmethionine binding site [chemical binding]; other site
561275001726	Mycolic acid cyclopropane synthetase; Region: CMAS; pfam02353
561275001727	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cl17173
561275001728	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275001729	S-adenosylmethionine binding site [chemical binding]; other site
561275001730	Mycolic acid cyclopropane synthetase; Region: CMAS; pfam02353
561275001731	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cl17173
561275001732	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275001733	S-adenosylmethionine binding site [chemical binding]; other site
561275001734	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
561275001735	TAP-like protein; Region: Abhydrolase_4; pfam08386
561275001736	2-polyprenylphenol 6-hydroxylase; Region: UbiB; TIGR01982
561275001737	ABC1 family; Region: ABC1; cl17513
561275001738	RvD6, 533 bp. Region of difference RvD6, inserted region in Mycobacterium bovis BCG Pasteur (position 773511..774043, 533bp), BCG Tokyo (position 743872..744404, 533bp) and Mycobacterium bovis AF2122/97 (position 743871..744403, 533bp) compared to Mycobacterium tuberculosis H37Rv2 (position: 742634..742635) where this sequence has been deleted. Also present in Mycobacterium tuberculosis CDC1551. Leads to BCG_0697 being longer at N-terminus than Rv0648 by 183 aa
561275001739	N-terminal catalytic domain of class II alpha-mannosidases and similar proteins; glycoside hydrolase family 38 (GH38); Region: GH38N_AMII_like; cd10786
561275001740	active site
561275001741	catalytic site [active]
561275001742	Alpha-mannosidase [Carbohydrate transport and metabolism]; Region: AMS1; COG0383
561275001743	Alpha mannosidase, middle domain; Region: Alpha-mann_mid; smart00872
561275001744	NPCBM-associated, NEW3 domain of alpha-galactosidase; Region: NPCBM_assoc; pfam10633
561275001745	Transcriptional regulator/sugar kinase [Transcription / Carbohydrate transport and metabolism]; Region: NagC; COG1940
561275001746	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cl17037
561275001747	Ribosomal protein L10 family, L10 subfamily; composed of bacterial 50S ribosomal protein and eukaryotic mitochondrial 39S ribosomal protein, L10. L10 occupies the L7/L12 stalk of the ribosome. The N-terminal domain (NTD) of L10 interacts with L11 protein...; Region: Ribosomal_L10; cd05797
561275001748	23S rRNA interface [nucleotide binding]; other site
561275001749	Interface with L7/L12 ribosomal proteins [polypeptide binding]; other site
561275001750	Ribosomal protein L7/L12. Ribosomal protein L7/L12 refers to the large ribosomal subunit proteins L7 and L12, which are identical except that L7 is acetylated at the N terminus. It is a component of the L7/L12 stalk, which is located at the surface of...; Region: Ribosomal_L7_L12; cd00387
561275001751	core dimer interface [polypeptide binding]; other site
561275001752	peripheral dimer interface [polypeptide binding]; other site
561275001753	L10 interface [polypeptide binding]; other site
561275001754	L11 interface [polypeptide binding]; other site
561275001755	putative EF-Tu interaction site [polypeptide binding]; other site
561275001756	putative EF-G interaction site [polypeptide binding]; other site
561275001757	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275001758	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275001759	WHG domain; Region: WHG; pfam13305
561275001760	Lignostilbene-alpha,beta-dioxygenase and related enzymes [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3670
561275001761	Retinal pigment epithelial membrane protein; Region: RPE65; pfam03055
561275001762	ABC-type transport system involved in resistance to organic solvents, ATPase component [Secondary metabolites biosynthesis, transport, and catabolism]; Region: Ttg2A; COG1127
561275001763	ATP-binding cassette transport system involved in resistant to organic solvents; Region: ABC_Org_Solvent_Resistant; cd03261
561275001764	Walker A/P-loop; other site
561275001765	ATP binding site [chemical binding]; other site
561275001766	Q-loop/lid; other site
561275001767	ABC transporter signature motif; other site
561275001768	Walker B; other site
561275001769	D-loop; other site
561275001770	H-loop/switch region; other site
561275001771	PIN (PilT N terminus) domain: Superfamily; Region: PIN_SF; cl14812
561275001772	putative active site [active]
561275001773	Transcription regulator of the Arc/MetJ class [Transcription]; Region: COG5450
561275001774	Predicted metal-dependent membrane protease [General function prediction only]; Region: COG1266
561275001775	Growth inhibitor [Signal transduction mechanisms]; Region: MazF; COG2337
561275001776	Predicted nucleic acid-binding protein, contains PIN domain [General function prediction only]; Region: COG1848
561275001777	Arylsulfatase A and related enzymes [Inorganic ion transport and metabolism]; Region: AslA; COG3119
561275001778	Sulfatase; Region: Sulfatase; pfam00884
561275001779	Concanavalin A-like lectin/glucanases superfamily; Region: Laminin_G_3; pfam13385
561275001780	PIN (PilT N terminus) domain: Superfamily; Region: PIN_SF; cl14812
561275001781	putative active site [active]
561275001782	DNA-directed RNA polymerase subunit beta; Reviewed; Region: rpoB; PRK00405
561275001783	RNA polymerase beta subunit. RNA polymerases catalyse the DNA dependent polymerization of RNA. Prokaryotes contain a single RNA polymerase compared to three in eukaryotes (not including mitochondrial. and chloroplast polymerases). Each RNA polymerase...; Region: RNA_pol_B_RPB2; cl17585
561275001784	RNA polymerase Rpb2, domain 2; Region: RNA_pol_Rpb2_2; pfam04561
561275001785	RNA polymerase beta subunit. RNA polymerases catalyse the DNA dependent polymerization of RNA. Prokaryotes contain a single RNA polymerase compared to three in eukaryotes (not including mitochondrial. and chloroplast polymerases). Each RNA polymerase...; Region: RNA_pol_B_RPB2; cd00653
561275001786	RNA polymerase beta subunit. RNA polymerases catalyse the DNA dependent polymerization of RNA. Prokaryotes contain a single RNA polymerase compared to three in eukaryotes (not including mitochondrial. and chloroplast polymerases). Each RNA polymerase...; Region: RNA_pol_B_RPB2; cd00653
561275001787	RPB10 interaction site [polypeptide binding]; other site
561275001788	RPB1 interaction site [polypeptide binding]; other site
561275001789	RPB11 interaction site [polypeptide binding]; other site
561275001790	RPB3 interaction site [polypeptide binding]; other site
561275001791	RPB12 interaction site [polypeptide binding]; other site
561275001792	RNA polymerase Rpb1, domain 1; Region: RNA_pol_Rpb1_1; pfam04997
561275001793	RNA polymerase I subunit A N-terminus; Region: RPOLA_N; smart00663
561275001794	RNA polymerase Rpb1, domain 3; Region: RNA_pol_Rpb1_3; pfam04983
561275001795	RNA polymerase Rpb1, domain 4; Region: RNA_pol_Rpb1_4; pfam05000
561275001796	RNA polymerase Rpb1, domain 5; Region: RNA_pol_Rpb1_5; pfam04998
561275001797	Largest subunit (beta') of Bacterial DNA-dependent RNA polymerase (RNAP), C-terminal domain; Region: RNAP_beta'_C; cd02655
561275001798	Rpb1 (beta') - Rpb6 (omega) interaction site [polypeptide binding]; other site
561275001799	G-loop; other site
561275001800	Largest subunit (beta') of Bacterial DNA-dependent RNA polymerase (RNAP), C-terminal domain; Region: RNAP_beta'_C; cd02655
561275001801	DNA binding site [nucleotide binding]
561275001802	Rpb1 (beta') - Rpb2 (beta) interaction site [polypeptide binding]; other site
561275001803	Neutral/alkaline non-lysosomal ceramidase; Region: Ceramidase_alk; pfam04734
561275001804	endonuclease IV; Provisional; Region: PRK01060
561275001805	AP endonuclease family 2; These endonucleases play a role in DNA repair. Cleave phosphodiester bonds at apurinic or apyrimidinic sites; the alignment also contains hexulose-6-phosphate isomerases, enzymes that catalyze the epimerization of...; Region: AP2Ec; cd00019
561275001806	AP (apurinic/apyrimidinic) site pocket; other site
561275001807	DNA interaction; other site
561275001808	Metal-binding active site; metal-binding site
561275001809	Poly(3-hydroxybutyrate) depolymerase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: LpqC; COG3509
561275001810	Fructose/tagarose-bisphosphate aldolase class II. This family includes fructose-1,6-bisphosphate (FBP) and tagarose 1,6-bisphosphate (TBP) aldolases. FBP-aldolase is homodimeric and used in gluconeogenesis and glycolysis; the enzyme controls the...; Region: FTBP_aldolase_II; cl17181
561275001811	isovaleryl CoA dehydrogenase; Provisional; Region: PRK11561
561275001812	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
561275001813	active site
561275001814	enoyl-CoA hydratase; Provisional; Region: PRK12478
561275001815	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
561275001816	substrate binding site [chemical binding]; other site
561275001817	oxyanion hole (OAH) forming residues; other site
561275001818	trimer interface [polypeptide binding]; other site
561275001819	Phenylacetic acid-responsive transcriptional repressor [Transcription]; Region: PaaX; COG3327
561275001820	PaaX-like protein; Region: PaaX; pfam07848
561275001821	PaaX-like protein C-terminal domain; Region: PaaX_C; pfam08223
561275001822	Enoyl-CoA hydratase/carnithine racemase [Lipid metabolism]; Region: CaiD; COG1024
561275001823	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
561275001824	substrate binding site [chemical binding]; other site
561275001825	oxyanion hole (OAH) forming residues; other site
561275001826	trimer interface [polypeptide binding]; other site
561275001827	Predicted drug exporters of the RND superfamily [General function prediction only]; Region: COG2409
561275001828	Mycobacterium membrane protein; Region: Mycobact_memb; pfam05423
561275001829	Protein of unknown function (DUF3060); Region: DUF3060; pfam11259
561275001830	Protein of unknown function (DUF3060); Region: DUF3060; pfam11259
561275001831	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275001832	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275001833	WHG domain; Region: WHG; pfam13305
561275001834	S12-like family, 30S ribosomal protein S12 subfamily; S12 is located at the interface of the large and small ribosomal subunits of prokaryotes, chloroplasts and mitochondria, where it plays an important role in both tRNA and ribosomal subunit...; Region: Ribosomal_S12; cd03368
561275001835	S17 interaction site [polypeptide binding]; other site
561275001836	S8 interaction site; other site
561275001837	16S rRNA interaction site [nucleotide binding]; other site
561275001838	streptomycin interaction site [chemical binding]; other site
561275001839	23S rRNA interaction site [nucleotide binding]; other site
561275001840	aminoacyl-tRNA interaction site (A-site) [nucleotide binding]; other site
561275001841	30S ribosomal protein S7; Validated; Region: PRK05302
561275001842	elongation factor G; Reviewed; Region: PRK00007
561275001843	Elongation factor G (EF-G) family involved in both the elongation and ribosome recycling phases of protein synthesis; Region: EF-G; cd01886
561275001844	G1 box; other site
561275001845	putative GEF interaction site [polypeptide binding]; other site
561275001846	GTP/Mg2+ binding site [chemical binding]; other site
561275001847	Switch I region; other site
561275001848	G2 box; other site
561275001849	G3 box; other site
561275001850	Switch II region; other site
561275001851	G4 box; other site
561275001852	G5 box; other site
561275001853	EFG_mtEFG_II: this subfamily represents the domain II of elongation factor G (EF-G) in bacteria and, the C-terminus of mitochondrial Elongation factor G1 (mtEFG1) and G2 (mtEFG2)_like proteins found in eukaryotes. During the process of peptide synthesis...; Region: EFG_mtEFG_II; cd04088
561275001854	EFG_mtEFG1_IV: domains similar to domain IV of the bacterial translational elongation factor (EF) EF-G. Included in this group is a domain of mitochondrial Elongation factor G1 (mtEFG1) proteins homologous to domain IV of EF-G. Eukaryotic cells harbor 2...; Region: EFG_mtEFG1_IV; cd01434
561275001855	EFG_mtEFG_C: domains similar to the C-terminal domain of the bacterial translational elongation factor (EF) EF-G.  Included in this group is the C-terminus of mitochondrial Elongation factor G1 (mtEFG1) and G2 (mtEFG2) proteins. Eukaryotic cells harbor 2...; Region: EFG_mtEFG_C; cd03713
561275001856	elongation factor Tu; Reviewed; Region: PRK00049
561275001857	Elongation Factor Tu (EF-Tu) GTP-binding proteins; Region: EF_Tu; cd01884
561275001858	G1 box; other site
561275001859	GEF interaction site [polypeptide binding]; other site
561275001860	GTP/Mg2+ binding site [chemical binding]; other site
561275001861	Switch I region; other site
561275001862	G2 box; other site
561275001863	G3 box; other site
561275001864	Switch II region; other site
561275001865	G4 box; other site
561275001866	G5 box; other site
561275001867	Translation_Factor_II_like: Elongation factor Tu (EF-Tu) domain II-like proteins. Elongation factor Tu consists of three structural domains, this family represents the second domain. Domain II adopts a beta barrel structure and is involved in binding to...; Region: Translation_Factor_II_like; cl02787
561275001868	Domain III of elongation factor (EF) Tu. Ef-Tu consists of three structural domains, designated I, II and III. Domain III adopts a beta barrel structure. Domain III is involved in binding to both charged tRNA and binding to elongation factor Ts (EF-Ts); Region: EFTU_III; cd03707
561275001869	Antibiotic Binding Site [chemical binding]; other site
561275001870	Short C-terminal domain; Region: SHOCT; pfam09851
561275001871	oxidoreductase, SDR family; Region: SDR_subfam_1; TIGR03971
561275001872	classical (c) SDRs; Region: SDR_c; cd05233
561275001873	NAD(P) binding site [chemical binding]; other site
561275001874	active site
561275001875	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox_2; pfam07992
561275001876	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
561275001877	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4427
561275001878	mycofactocin system transcriptional regulator; Region: mycofact_TetR; TIGR03968
561275001879	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275001880	putative mycofactocin binding protein MftB; Region: mycofact_MftB; TIGR03967
561275001881	mycofactocin radical SAM maturase; Region: mycofact_rSAM; TIGR03962
561275001882	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
561275001883	FeS/SAM binding site; other site
561275001884	radical SAM additional 4Fe4S-binding SPASM domain; Region: rSAM_more_4Fe4S; TIGR04085
561275001885	heme/flavin dehydrogenase, mycofactocin system; Region: actino_HemFlav; TIGR03966
561275001886	TIM barrel proteins share a structurally conserved phosphate binding motif and in general share an eight beta/alpha closed barrel structure. Specific for this family is the conserved phosphate binding site at the edges of strands 7 and 8. The phosphate...; Region: TIM_phosphate_binding; cl17186
561275001887	phosphate binding site [ion binding]; other site
561275001888	mycofactocin system creatininase family protein; Region: mycofact_creat; TIGR03964
561275001889	mycofactocin system glycosyltransferase; Region: mycofact_glyco; TIGR03965
561275001890	Subfamily of Glycosyltransferase Family GT2 of unknown function; Region: GT_2_like_c; cd04186
561275001891	Probable Catalytic site; other site
561275001892	metal-binding site
561275001893	dehydrogenase, Rv0697 family; Region: Rv0697; TIGR03970
561275001894	GMC oxidoreductase; Region: GMC_oxred_C; pfam05199
561275001895	30S ribosomal protein S10; Reviewed; Region: rpsJ; PRK00596
561275001896	50S ribosomal protein L3; Validated; Region: rplC; PRK00001
561275001897	50S ribosomal protein L4; Provisional; Region: rplD; PRK05319
561275001898	50S ribosomal protein L23; Reviewed; Region: rplW; PRK05738
561275001899	50S ribosomal protein L2; Validated; Region: rplB; PRK09374
561275001900	Ribosomal Proteins L2, RNA binding domain; Region: Ribosomal_L2; pfam00181
561275001901	Ribosomal Proteins L2, C-terminal domain; Region: Ribosomal_L2_C; pfam03947
561275001902	30S ribosomal protein S19; Reviewed; Region: rpsS; PRK00357
561275001903	Ribosomal protein L22/L17e.  L22 (L17 in eukaryotes) is a core protein of the large ribosomal subunit.  It is the only ribosomal protein that interacts with all six domains of 23S rRNA, and is one of the proteins important for directing the proper...; Region: Ribosomal_L22; cd00336
561275001904	putative translocon binding site; other site
561275001905	protein-rRNA interface [nucleotide binding]; other site
561275001906	30S ribosomal protein S3; Reviewed; Region: rpsC; PRK00310
561275001907	K homology RNA-binding (KH) domain of the prokaryotic 30S small ribosomal subunit protein S3. S3  is part of the head region of the 30S ribosomal subunit and is believed to interact with mRNA as it threads its way from the latch into the channel.  The KH...; Region: 30S_S3_KH; cd02412
561275001908	G-X-X-G motif; other site
561275001909	Ribosomal protein S3, C-terminal domain; Region: Ribosomal_S3_C; pfam00189
561275001910	Ribosomal_L16_L10e: L16 is an essential protein in the large ribosomal subunit of bacteria, mitochondria, and chloroplasts. Large subunits that lack L16 are defective in peptidyl transferase activity, peptidyl-tRNA hydrolysis activity, association with...; Region: Ribosomal_L16_L10e; cd01433
561275001911	23S rRNA interface [nucleotide binding]; other site
561275001912	5S rRNA interface [nucleotide binding]; other site
561275001913	putative antibiotic binding site [chemical binding]; other site
561275001914	L25 interface [polypeptide binding]; other site
561275001915	L27 interface [polypeptide binding]; other site
561275001916	Ribosomal L29 protein/HIP.  L29 is a protein of the large ribosomal Subunit. A homolog, called heparin/heparan sulfate interacting protein (HIP), has also been identified in mammals.  L29 is located on the surface of the large ribosomal subunit, where it...; Region: Ribosomal_L29_HIP; cd00427
561275001917	putative translocon interaction site; other site
561275001918	23S rRNA interface [nucleotide binding]; other site
561275001919	signal recognition particle (SRP54) interaction site; other site
561275001920	L23 interface [polypeptide binding]; other site
561275001921	trigger factor interaction site; other site
561275001922	30S ribosomal protein S17; Reviewed; Region: rpsQ; PRK05610
561275001923	Arylsulfatase A and related enzymes [Inorganic ion transport and metabolism]; Region: AslA; COG3119
561275001924	Sulfatase; Region: Sulfatase; pfam00884
561275001925	Laminin G domain; Laminin G-like domains are usually Ca++ mediated receptors that can have binding sites for steroids, beta1 integrins, heparin, sulfatides, fibulin-1, and alpha-dystroglycans. Proteins that contain LamG domains serve a variety of...; Region: LamG; cl17353
561275001926	Uncharacterized conserved protein [Function unknown]; Region: COG1262
561275001927	Formylglycine-generating sulfatase enzyme; Region: FGE-sulfatase; pfam03781
561275001928	50S ribosomal protein L14; Validated; Region: rplN; PRK05483
561275001929	50S ribosomal protein L24; Reviewed; Region: rplX; PRK00004
561275001930	KOW motif of Ribosomal Protein L26; Region: KOW_RPL26; cd06089
561275001931	RNA binding site [nucleotide binding]; other site
561275001932	50S ribosomal protein L5; Validated; Region: rplE; PRK00010
561275001933	Ribosomal protein L5; Region: Ribosomal_L5; pfam00281
561275001934	ribosomal L5P family C-terminus; Region: Ribosomal_L5_C; pfam00673
561275001935	30S ribosomal protein S14; Reviewed; Region: rpsN; PRK08061
561275001936	30S ribosomal protein S8; Validated; Region: rpsH; PRK00136
561275001937	50S ribosomal protein L6; Validated; Region: rplF; PRK05498
561275001938	Ribosomal protein L6; Region: Ribosomal_L6; pfam00347
561275001939	Ribosomal protein L6; Region: Ribosomal_L6; pfam00347
561275001940	Ribosomal L18/L5e:  L18 (L5e) is a ribosomal protein found in the central protuberance (CP) of the large subunit. L18 binds 5S rRNA and induces a conformational change that stimulates the binding of L5 to 5S rRNA. Association of 5S rRNA with 23S rRNA...; Region: Ribosomal_L18_L5e; cd00432
561275001941	5S rRNA interface [nucleotide binding]; other site
561275001942	23S rRNA interface [nucleotide binding]; other site
561275001943	L5 interface [polypeptide binding]; other site
561275001944	30S ribosomal protein S5; Validated; Region: rpsE; PRK00550
561275001945	Ribosomal protein S5, N-terminal domain; Region: Ribosomal_S5; pfam00333
561275001946	Ribosomal protein S5, C-terminal domain; Region: Ribosomal_S5_C; pfam03719
561275001947	Ribosomal protein L30, which is found in eukaryotes and prokaryotes but not in archaea, is one of the smallest ribosomal proteins with a molecular mass of about 7kDa. L30 binds the 23SrRNA as well as the 5S rRNA and is one of five ribosomal proteins that...; Region: Ribosomal_L30; cd01658
561275001948	23S rRNA binding site [nucleotide binding]; other site
561275001949	50S ribosomal protein L15; Reviewed; Region: rplO; PRK05592
561275001950	Signal peptide peptidase A (SppA) 67K type, a serine protease, has catalytic Ser-Lys dyad; Region: S49_SppA_67K_type; cd07018
561275001951	tandem repeat interface [polypeptide binding]; other site
561275001952	signal peptide peptidase SppA, 36K type; Region: SppA_dom; TIGR00706
561275001953	oligomer interface [polypeptide binding]; other site
561275001954	active site residues [active]
561275001955	signal peptide peptidase SppA, 36K type; Region: SppA_dom; TIGR00706
561275001956	Signal peptide peptidase A (SppA), a serine protease, has catalytic Ser-Lys dyad; Region: S49_Sppa_N_C; cd07023
561275001957	tandem repeat interface [polypeptide binding]; other site
561275001958	oligomer interface [polypeptide binding]; other site
561275001959	active site residues [active]
561275001960	O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315
561275001961	methyltransferase, TIGR00027 family; Region: mthyl_TIGR00027
561275001962	O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315
561275001963	methyltransferase, TIGR00027 family; Region: mthyl_TIGR00027
561275001964	Class II Aldolase and Adducin head (N-terminal) domain. Aldolases are ubiquitous enzymes catalyzing central steps of carbohydrate metabolism. Based on enzymatic mechanisms, this superfamily has been divided into two distinct classes (Class I and II); Region: Aldolase_II; cd00398
561275001965	intersubunit interface [polypeptide binding]; other site
561275001966	active site
561275001967	Zn2+ binding site [ion binding]; other site
561275001968	Phosphoglycerate dehydrogenase and related dehydrogenases [Amino acid transport and metabolism]; Region: SerA; COG0111
561275001969	Formate/glycerate dehydrogenases, D-specific 2-hydroxy acid dehydrogenases and related dehydrogenases; Region: FDH_GDH_like; cl17240
561275001970	NAD binding site [chemical binding]; other site
561275001971	Sugar (pentulose and hexulose) kinases [Carbohydrate transport and metabolism]; Region: XylB; COG1070
561275001972	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cl17037
561275001973	nucleotide binding site [chemical binding]; other site
561275001974	Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302
561275001975	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
561275001976	Coenzyme A binding pocket [chemical binding]; other site
561275001977	O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315
561275001978	methyltransferase, TIGR00027 family; Region: mthyl_TIGR00027
561275001979	preprotein translocase subunit SecY; Reviewed; Region: secY; PRK09204
561275001980	SecY translocase; Region: SecY; pfam00344
561275001981	adenylate kinase; Reviewed; Region: adk; PRK00279
561275001982	Adenylate kinase (ADK) catalyzes the reversible phosphoryl transfer from adenosine triphosphates (ATP) to adenosine monophosphates (AMP) and to yield adenosine diphosphates (ADP). This enzyme is required for the biosynthesis of ADP and is essential for...; Region: ADK; cd01428
561275001983	AMP-binding site [chemical binding]; other site
561275001984	ATP-AMP (Ap5A)-binding site [chemical binding]; other site
561275001985	Methionine Aminopeptidase 1. E.C. 3.4.11.18. Also known as methionyl aminopeptidase and Peptidase M. Catalyzes release of N-terminal amino acids, preferentially methionine, from peptides and arylamides; Region: MetAP1; cd01086
561275001986	active site
561275001987	RNA polymerase sigma factor SigL; Provisional; Region: PRK09645
561275001988	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
561275001989	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
561275001990	DNA binding residues [nucleotide binding]
561275001991	Predicted transmembrane transcriptional regulator (anti-sigma factor) [Transcription]; Region: COG5662
561275001992	Putative zinc-finger; Region: zf-HC2; pfam13490
561275001993	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
561275001994	MarR family; Region: MarR; pfam01047
561275001995	uncharacterized Actinobacterial protein TIGR03083; Region: TIGR03083
561275001996	TIGR03086 family protein; Region: TIGR03086
561275001997	Domain of unknown function (DUF4226); Region: DUF4226; pfam10774
561275001998	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3464
561275001999	Transposase; Region: DDE_Tnp_ISL3; pfam01610
561275002000	Helix-turn-helix domain; Region: HTH_17; pfam12728
561275002001	helicase/secretion neighborhood putative DEAH-box helicase; Region: DECH_helic; TIGR03817
561275002002	PE family; Region: PE; pfam00934
561275002003	Ribbon-helix-helix protein, copG family; Region: RHH_1; pfam01402
561275002004	Mycobacterium tuberculosis PIN domain family; Region: Mtu_PIN_fam; TIGR00028
561275002005	6-phosphogluconate dehydrogenase-like protein; Reviewed; Region: PRK09599
561275002006	3-hydroxyisobutyrate dehydrogenase; Region: HIBADH; TIGR01692
561275002007	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275002008	Isobutyryl-CoA dehydrogenase; Region: IBD; cd01162
561275002009	substrate binding pocket [chemical binding]; other site
561275002010	FAD binding site [chemical binding]; other site
561275002011	catalytic base [active]
561275002012	Methylmalonate semialdehyde dehydrogenase and ALDH family members 6A1 and 6B2; Region: ALDH_F6_MMSDH; cd07085
561275002013	methylmalonic acid semialdehyde dehydrogenase; Region: MMSDH; TIGR01722
561275002014	tetrameric interface [polypeptide binding]; other site
561275002015	NAD binding site [chemical binding]; other site
561275002016	catalytic residues [active]
561275002017	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
561275002018	catalytic core [active]
561275002019	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275002020	PPE family; Region: PPE; pfam00823
561275002021	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275002022	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275002023	Helix-turn-helix domain; Region: HTH_28; pfam13518
561275002024	Winged helix-turn helix; Region: HTH_29; pfam13551
561275002025	Mycobacterium bovis BCG Pasteur has a single copy of IS6110, while BCG Tokyo has two copies of IS6110.
561275002026	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
561275002027	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
561275002028	active site
561275002029	phosphorylation site [posttranslational modification]
561275002030	intermolecular recognition site; other site
561275002031	dimerization interface [polypeptide binding]; other site
561275002032	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
561275002033	DNA binding site [nucleotide binding]
561275002034	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
561275002035	dimerization interface [polypeptide binding]; other site
561275002036	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
561275002037	dimer interface [polypeptide binding]; other site
561275002038	phosphorylation site [posttranslational modification]
561275002039	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
561275002040	ATP binding site [chemical binding]; other site
561275002041	Mg2+ binding site [ion binding]; other site
561275002042	G-X-G motif; other site
561275002043	Diadenosine tetraphosphate (Ap4A) hydrolase and other HIT family hydrolases [Nucleotide transport and metabolism / Carbohydrate transport and metabolism / General function prediction only]; Region: Hit; COG0537
561275002044	nucleotide binding site/active site [active]
561275002045	HIT family signature motif; other site
561275002046	catalytic residue [active]
561275002047	Nuclear transport factor 2 (NTF2) domain; Region: NTF2; pfam02136
561275002048	oxidoreductase, Rxyl_3153 family; Region: Rxyl_3153; TIGR03989
561275002049	Class III alcohol dehydrogenase; Region: Zn_ADH_class_III; cd08279
561275002050	NAD binding site [chemical binding]; other site
561275002051	catalytic Zn binding site [ion binding]; other site
561275002052	substrate binding site [chemical binding]; other site
561275002053	structural Zn binding site [ion binding]; other site
561275002054	Nuclear transport factor 2 (NTF2-like) superfamily. This family includes members of the NTF2 family, Delta-5-3-ketosteroid isomerases, Scytalone Dehydratases, and the beta subunit of Ring hydroxylating dioxygenases. This family is a classic example of...; Region: NTF2_like; cl09109
561275002055	Ferredoxin [Energy production and conversion]; Region: Fer; COG1141
561275002056	Protein of unknown function (DUF1271); Region: DUF1271; cl01443
561275002057	Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124
561275002058	Cytochrome P450; Region: p450; cl12078
561275002059	short chain dehydrogenase; Provisional; Region: PRK07775
561275002060	classical (c) SDRs; Region: SDR_c; cd05233
561275002061	NAD(P) binding site [chemical binding]; other site
561275002062	active site
561275002063	Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124
561275002064	Cytochrome P450; Region: p450; cl12078
561275002065	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275002066	aldehyde dehydrogenase, Rv0768 family; Region: aldehy_Rv0768; TIGR04284
561275002067	Rhodococcus ruber 6-oxolauric acid dehydrogenase-like and related proteins; Region: ALDH_CddD-AldA-like; cd07089
561275002068	NAD binding site [chemical binding]; other site
561275002069	catalytic residues [active]
561275002070	short chain dehydrogenase; Provisional; Region: PRK07774
561275002071	classical (c) SDRs; Region: SDR_c; cd05233
561275002072	NAD(P) binding site [chemical binding]; other site
561275002073	active site
561275002074	6-phosphogluconate dehydrogenase-like protein; Reviewed; Region: PRK09599
561275002075	NAD binding domain of 6-phosphogluconate dehydrogenase; Region: NAD_binding_2; pfam03446
561275002076	Uncharacterized homolog of gamma-carboxymuconolactone decarboxylase subunit [Function unknown]; Region: COG0599
561275002077	phosphoribosylamine--glycine ligase; Provisional; Region: PRK00885
561275002078	Phosphoribosylglycinamide synthetase, N domain; Region: GARS_N; pfam02844
561275002079	Phosphoribosylglycinamide synthetase, ATP-grasp (A) domain; Region: GARS_A; pfam01071
561275002080	Phosphoribosylglycinamide synthetase, C domain; Region: GARS_C; pfam02843
561275002081	Gamma-glutamyltransferase [Amino acid transport and metabolism]; Region: Ggt; COG0405
561275002082	Gamma-glutamyltranspeptidase; Region: G_glu_transpept; pfam01019
561275002083	Predicted esterase [General function prediction only]; Region: COG0627
561275002084	S-formylglutathione hydrolase; Region: PLN02442
561275002085	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3226
561275002086	Predicted nuclease (RNAse H fold) [General function prediction only]; Region: COG4328
561275002087	Adenylsuccinate lyase (ASL)_subgroup 2; Region: Adenylsuccinate_lyase_2; cd03302
561275002088	Adenylosuccinate lyase [Nucleotide transport and metabolism]; Region: PurB; COG0015
561275002089	tetramer interface [polypeptide binding]; other site
561275002090	active site
561275002091	Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124
561275002092	Cytochrome P450; Region: p450; cl12078
561275002093	non-metazoan 5-aminoimidazole-4-(N-succinylcarboxamide) ribonucleotide (SAICAR) synthase; Region: SAICAR_synt_Sc; cd01414
561275002094	ATP binding site [chemical binding]; other site
561275002095	active site
561275002096	substrate binding site [chemical binding]; other site
561275002097	Protease II [Amino acid transport and metabolism]; Region: PtrB; COG1770
561275002098	Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326
561275002099	drug resistance transporter, EmrB/QacA subfamily; Region: efflux_EmrB; TIGR00711
561275002100	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
561275002101	putative substrate translocation pore; other site
561275002102	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
561275002103	Predicted deacetylase [General function prediction only]; Region: COG3233
561275002104	Putative catalytic domain of uncharacterized bacterial proteins from the carbohydrate esterase 4 superfamily; Region: CE4_u10; cd11374
561275002105	putative active site [active]
561275002106	putative Zn binding site [ion binding]; other site
561275002107	potential frameshift: common BLAST hit: gi|148821991|ref|YP_001286745.1|  FAD-binding dehydrogenase
561275002108	putative FAD-binding dehydrogenase; Reviewed; Region: PRK12834
561275002109	putative FAD-binding dehydrogenase; Reviewed; Region: PRK12834
561275002110	Metallo-beta-lactamase superfamily; Region: Lactamase_B; cl00446
561275002111	phosphoribosylformylglycinamidine synthase subunit PurS; Reviewed; Region: PRK05974
561275002112	phosphoribosylformylglycinamidine synthase I; Provisional; Region: PRK03619
561275002113	Type 1 glutamine amidotransferase (GATase1)-like domain found in Formylglycinamide ribonucleotide amidotransferase; Region: GATase1_FGAR_AT; cd01740
561275002114	putative active site [active]
561275002115	catalytic triad [active]
561275002116	Transglutaminase-like enzymes, putative cysteine proteases [Amino acid transport and metabolism]; Region: COG1305
561275002117	Transglutaminase/protease-like homologues; Region: TGc; smart00460
561275002118	Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cl07892
561275002119	probable F420-dependent oxidoreductase, Rv1855c family; Region: F420_Rv1855c; TIGR03560
561275002120	N5,N10-methylenetetrahydromethanopterin reductase (Mer) catalyzes the reduction of N5,N10-methylenetetrahydromethanopterin with reduced coenzyme F420 to N5-methyltetrahydromethanopterin and oxidized coenzyme F420; Region: Tetrahydromethanopterin_reductase; cd01097
561275002121	Transcriptional regulators [Transcription]; Region: PhnF; COG2188
561275002122	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
561275002123	DNA-binding site [nucleotide binding]; DNA binding site
561275002124	UTRA domain; Region: UTRA; pfam07702
561275002125	Uncharacterized conserved protein [Function unknown]; Region: COG1359
561275002126	Pyruvate/2-oxoglutarate dehydrogenase complex, dihydrolipoamide dehydrogenase (E3) component, and related enzymes [Energy production and conversion]; Region: Lpd; COG1249
561275002127	Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852
561275002128	Pyruvate/2-oxoglutarate dehydrogenase complex, dihydrolipoamide dehydrogenase (E3) component, and related enzymes [Energy production and conversion]; Region: Lpd; COG1249
561275002129	Formate/glycerate dehydrogenases, D-specific 2-hydroxy acid dehydrogenases and related dehydrogenases; Region: FDH_GDH_like; cl17240
561275002130	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
561275002131	nonfunctional due to frameshift
561275002132	Uncharacterized protein, linocin/CFP29 homolog [Function unknown]; Region: COG1659
561275002133	Dyp-type peroxidase family; Region: Dyp_perox; pfam04261
561275002134	M18 Peptidase Aspartyl aminopeptidase; Region: M18_DAP; cd05658
561275002135	Aminopeptidase I zinc metalloprotease (M18); Region: Peptidase_M18; pfam02127
561275002136	active site
561275002137	metal binding site [ion binding]; metal-binding site
561275002138	This domain superfamily is found in a variety of structurally related metalloproteins, including the type I extradiol dioxygenases, glyoxalase I and a group of antibiotic resistance proteins; Region: Glo_EDI_BRP_like; cd06587
561275002139	active site
561275002140	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
561275002141	Acetyltransferases, including N-acetylases of ribosomal proteins [Translation, ribosomal structure and biogenesis]; Region: RimL; COG1670
561275002142	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
561275002143	phosphoribosylformylglycinamidine synthase II; Provisional; Region: PRK01213
561275002144	PurL subunit of the formylglycinamide ribonucleotide amidotransferase (FGAR-AT), first repeat. FGAR-AT catalyzes the ATP-dependent conversion of formylglycinamide ribonucleotide (FGAR) and glutamine to formylglycinamidine ribonucleotide (FGAM), ADP; Region: PurL_repeat1; cd02203
561275002145	dimerization interface [polypeptide binding]; other site
561275002146	ATP binding site [chemical binding]; other site
561275002147	PurL subunit of the formylglycinamide ribonucleotide amidotransferase (FGAR-AT), second repeat. FGAR-AT catalyzes the ATP-dependent conversion of formylglycinamide ribonucleotide (FGAR) and glutamine to formylglycinamidine ribonucleotide (FGAM), ADP; Region: PurL_repeat2; cd02204
561275002148	dimerization interface [polypeptide binding]; other site
561275002149	ATP binding site [chemical binding]; other site
561275002150	CAAX protease self-immunity; Region: Abi; pfam02517
561275002151	Predicted phosphohydrolases [General function prediction only]; Region: Icc; COG1409
561275002152	Enterobacter aerogenes GpdQ and related proteins, metallophosphatase domain; Region: MPP_GpdQ; cd07402
561275002153	active site
561275002154	metal binding site [ion binding]; metal-binding site
561275002155	hexamer interface [polypeptide binding]; other site
561275002156	Protein of unknown function (DUF3184); Region: DUF3184; pfam11380
561275002157	amidophosphoribosyltransferase; Provisional; Region: PRK07847
561275002158	Glutamine amidotransferases class-II (GN-AT)_GPAT- type. This domain is found at the N-terminus of  glutamine phosphoribosylpyrophosphate (Prpp) amidotransferase (GPATase) . The glutaminase domain catalyzes amide nitrogen transfer from glutamine to the...; Region: GPATase_N; cd00715
561275002159	active site
561275002160	tetramer interface [polypeptide binding]; other site
561275002161	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
561275002162	active site
561275002163	phosphoribosylaminoimidazole synthetase; Region: purM; TIGR00878
561275002164	PurM (Aminoimidazole Ribonucleotide [AIR] synthetase), one of eleven enzymes required for purine biosynthesis, catalyzes the conversion of formylglycinamide ribonucleotide (FGAM) and ATP to AIR, ADP, and Pi, the fifth step in de novo purine biosynthesis; Region: PurM; cd02196
561275002165	dimerization interface [polypeptide binding]; other site
561275002166	putative ATP binding site [chemical binding]; other site
561275002167	Protein of unknown function (DUF3073); Region: DUF3073; pfam11273
561275002168	Predicted aminomethyltransferase related to GcvT [General function prediction only]; Region: COG0354
561275002169	folate-binding protein YgfZ; Region: ygfZ_signature; TIGR03317
561275002170	Branched-chain amino acid aminotransferase/4-amino-4-deoxychorismate lyase [Amino acid transport and metabolism / Coenzyme metabolism]; Region: IlvE; COG0115
561275002171	ADCL_like: 4-Amino-4-deoxychorismate lyase:  is a member of the fold-type IV of PLP dependent enzymes that converts 4-amino-4-deoxychorismate (ADC) to p-aminobenzoate and pyruvate.  Based on the information available from the crystal structure, most...; Region: ADCL_like; cd01559
561275002172	pyridoxal 5'-phosphate binding site [chemical binding]; other site
561275002173	catalytic residue [active]
561275002174	nitrobindin heme-binding domain; Region: nitrobindin; cd07828
561275002175	heme-binding site [chemical binding]; other site
561275002176	Protein of unknown function (DUF1416); Region: DUF1416; pfam07210
561275002177	Rhodanese-related sulfurtransferase [Inorganic ion transport and metabolism]; Region: SseA; COG2897
561275002178	Thiosulfate sulfurtransferase (TST), N-terminal, inactive domain. TST contains 2 copies of the Rhodanese Homology Domain; this is the 1st repeat, which does not contain the catalytically active Cys residue. The role of the 1st repeat is uncertain, but it...; Region: TST_Repeat_1; cd01448
561275002179	active site residue [active]
561275002180	Thiosulfate sulfurtransferase (TST), C-terminal, catalytic domain. TST contains 2 copies of the Rhodanese Homology Domain; this is the second repeat. Only the second repeat contains the catalytically active Cys residue; Region: TST_Repeat_2; cd01449
561275002181	active site residue [active]
561275002182	TRX family; composed of two groups: Group I, which includes proteins that exclusively encode a TRX domain; and Group II, which are composed of fusion proteins of TRX and additional domains. Group I TRX is a small ancient protein that alter the redox...; Region: TRX_family; cd02947
561275002183	catalytic residues [active]
561275002184	Protein of unknown function (DUF2993); Region: DUF2993; pfam11209
561275002185	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
561275002186	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
561275002187	DNA binding site [nucleotide binding]
561275002188	mycothiol synthase; Region: mycothiol_MshD; TIGR03448
561275002189	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
561275002190	Coenzyme A binding pocket [chemical binding]; other site
561275002191	ATP-binding cassette domain of the phosphate transport system; Region: ABC_PstB_phosphate_transporter; cd03260
561275002192	Walker A/P-loop; other site
561275002193	ATP binding site [chemical binding]; other site
561275002194	Q-loop/lid; other site
561275002196	phosphate transport system regulatory protein PhoU; Region: phoU_full; TIGR02135
561275002197	PhoU domain; Region: PhoU; pfam01895
561275002198	PhoU domain; Region: PhoU; pfam01895
561275002199	cell envelope-related function transcriptional attenuator common domain; Region: lytR_cpsA_psr; TIGR00350
561275002200	LytR cell envelope-related transcriptional attenuator; Region: LytR_C; pfam13399
561275002201	putative TIM-barrel protein, nifR3 family; Region: nifR3_yhdG; TIGR00737
561275002202	Dihydrouridine synthase-like (DUS-like) FMN-binding domain. Members of this family catalyze the reduction of the 5,6-double bond of a uridine residue on tRNA. Dihydrouridine modification of tRNA is widely observed in prokaryotes and eukaryotes, and also...; Region: DUS_like_FMN; cd02801
561275002203	FMN binding site [chemical binding]; other site
561275002204	active site
561275002205	catalytic residues [active]
561275002206	substrate binding site [chemical binding]; other site
561275002207	Fatty acid desaturase; Region: FA_desaturase_2; pfam03405
561275002208	Acyl ACP desaturase, ferritin-like diiron-binding domain; Region: Acyl_ACP_Desat; cd01050
561275002209	homodimer interface [polypeptide binding]; other site
561275002210	putative substrate binding pocket [chemical binding]; other site
561275002211	diiron center [ion binding]; other site
561275002212	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275002213	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3662
561275002214	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
561275002215	dimerization interface [polypeptide binding]; other site
561275002216	putative DNA binding site [nucleotide binding]; other site
561275002217	putative Zn2+ binding site [ion binding]; other site
561275002218	Nucleoside deaminases include adenosine, guanine and cytosine deaminases. These enzymes are Zn dependent and catalyze the deamination of nucleosides. The zinc ion in the active site plays a central role in the proposed catalytic mechanism, activating a...; Region: nucleoside_deaminase; cd01285
561275002219	dimer interface [polypeptide binding]; other site
561275002220	catalytic motif [active]
561275002221	nucleoside/Zn binding site; other site
561275002222	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG0675
561275002223	O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315
561275002224	methyltransferase, TIGR00027 family; Region: mthyl_TIGR00027
561275002225	TIGR04255 family protein; Region: sporadTIGR04255
561275002226	PE family; Region: PE; pfam00934
561275002227	PE family; Region: PE; pfam00934
561275002228	PknH-like extracellular domain; Region: PknH_C; pfam14032
561275002229	Predicted nucleotidyltransferase [General function prediction    only]; Region: COG4849
561275002230	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4861
561275002231	Uncharacterized protein conserved in bacteria (DUF2186); Region: DUF2186; pfam09952
561275002232	D-ala-D-ala dipeptidase; Region: Peptidase_M15; cl00813
561275002233	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275002234	S-adenosylmethionine binding site [chemical binding]; other site
561275002235	proline-specific peptidase, Bacillus coagulans-type subfamily; Region: pro_imino_pep_2; TIGR01250
561275002236	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
561275002237	putative substrate translocation pore; other site
561275002238	Major Facilitator Superfamily; Region: MFS_1; pfam07690
561275002239	Pyruvate/2-oxoglutarate dehydrogenase complex, dehydrogenase (E1) component, eukaryotic type, alpha subunit [Energy production and conversion]; Region: AcoA; COG1071
561275002240	Thiamine pyrophosphate (TPP) family, E1 of PDC_ADC_BCADC subfamily, TPP-binding module; composed of proteins similar to the E1 components of the human pyruvate dehydrogenase complex (PDC), the acetoin dehydrogenase complex (ADC) and the branched chain...; Region: TPP_E1_PDC_ADC_BCADC; cd02000
561275002241	tetramer interface [polypeptide binding]; other site
561275002242	TPP-binding site [chemical binding]; other site
561275002243	heterodimer interface [polypeptide binding]; other site
561275002244	phosphorylation loop region [posttranslational modification]
561275002245	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
561275002246	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
561275002247	active site
561275002248	phosphorylation site [posttranslational modification]
561275002249	intermolecular recognition site; other site
561275002250	dimerization interface [polypeptide binding]; other site
561275002251	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
561275002252	DNA binding residues [nucleotide binding]
561275002253	dimerization interface [polypeptide binding]; other site
561275002254	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: COG4585
561275002255	Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase; Region: HATPase_c; pfam02518
561275002256	Putative multicopper oxidases [Secondary metabolites biosynthesis, transport, and catabolism]; Region: SufI; COG2132
561275002257	Multicopper oxidase; Region: Cu-oxidase_3; pfam07732
561275002258	Multicopper oxidase; Region: Cu-oxidase; pfam00394
561275002259	Multicopper oxidase; Region: Cu-oxidase_2; pfam07731
561275002260	Cysteine synthase [Amino acid transport and metabolism]; Region: CysK; COG0031
561275002261	CBS_like: This subgroup includes Cystathionine beta-synthase (CBS) and Cysteine synthase. CBS is a unique heme-containing enzyme that catalyzes a pyridoxal 5'-phosphate (PLP)-dependent condensation of serine and homocysteine to give cystathionine; Region: CBS_like; cd01561
561275002262	dimer interface [polypeptide binding]; other site
561275002263	pyridoxal 5'-phosphate binding site [chemical binding]; other site
561275002264	catalytic residue [active]
561275002265	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
561275002266	multidrug resistance protein MdtH; Provisional; Region: PRK11646
561275002267	putative substrate translocation pore; other site
561275002268	Helix-turn-helix domain of transposase family ISL3; Region: HTH_Tnp_ISL3; pfam13542
561275002269	short chain dehydrogenase; Provisional; Region: PRK05876
561275002270	classical (c) SDRs; Region: SDR_c; cd05233
561275002271	NAD(P) binding site [chemical binding]; other site
561275002272	active site
561275002273	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
561275002274	Pyruvate decarboxylase and related thiamine pyrophosphate-requiring enzymes [Carbohydrate transport and metabolism / Coenzyme metabolism / General function prediction only]; Region: COG3961
561275002275	Pyrimidine (PYR) binding domain of pyruvate decarboxylase (PDC), indolepyruvate decarboxylase (IPDC) and related proteins; Region: TPP_PYR_PDC_IPDC_like; cd07038
561275002276	dimer interface [polypeptide binding]; other site
561275002277	PYR/PP interface [polypeptide binding]; other site
561275002278	TPP binding site [chemical binding]; other site
561275002279	Thiamine pyrophosphate enzyme, central domain; Region: TPP_enzyme_M; pfam00205
561275002280	Thiamine pyrophosphate (TPP) family, PDC_IPDC subfamily, TPP-binding module; composed of proteins similar to pyruvate decarboxylase (PDC) and indolepyruvate decarboxylase (IPDC). PDC, a key enzyme in alcoholic fermentation, catalyzes the conversion of...; Region: TPP_PDC_IPDC; cd02005
561275002281	TPP-binding site [chemical binding]; other site
561275002282	dimer interface [polypeptide binding]; other site
561275002283	Ligand-binding SRPBCC domain of an uncharacterized subfamily of proteins; Region: SRPBCC_2; cd07819
561275002284	putative hydrophobic ligand binding site [chemical binding]; other site
561275002285	Predicted acyl-CoA transferases/carnitine dehydratase [Energy production and conversion]; Region: CaiB; COG1804
561275002286	CoA-transferase family III; Region: CoA_transf_3; pfam02515
561275002287	Ligand-binding SRPBCC domain of an uncharacterized subfamily of proteins; Region: SRPBCC_2; cd07819
561275002288	putative hydrophobic ligand binding site [chemical binding]; other site
561275002289	Ligand-binding SRPBCC domain of an uncharacterized subfamily of proteins; Region: SRPBCC_2; cd07819
561275002290	putative hydrophobic ligand binding site [chemical binding]; other site
561275002291	aminotransferase; Validated; Region: PRK07777
561275002292	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
561275002293	pyridoxal 5'-phosphate binding site [chemical binding]; other site
561275002294	homodimer interface [polypeptide binding]; other site
561275002295	catalytic residue [active]
561275002296	acetyl-CoA acetyltransferase; Validated; Region: PRK08242
561275002297	Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751
561275002298	dimer interface [polypeptide binding]; other site
561275002299	active site
561275002300	multifunctional fatty acid oxidation complex subunit alpha; Reviewed; Region: fadB; PRK11730
561275002301	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
561275002302	substrate binding site [chemical binding]; other site
561275002303	oxyanion hole (OAH) forming residues; other site
561275002304	trimer interface [polypeptide binding]; other site
561275002305	3-hydroxyacyl-CoA dehydrogenase, NAD binding domain; Region: 3HCDH_N; pfam02737
561275002306	3-hydroxyacyl-CoA dehydrogenase, C-terminal domain; Region: 3HCDH; pfam00725
561275002307	Helicase conserved C-terminal domain; Region: Helicase_C_3; pfam13625
561275002308	DNA or RNA helicases of superfamily II [Transcription / DNA replication, recombination, and repair]; Region: SSL2; COG1061
561275002309	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
561275002310	ATP binding site [chemical binding]; other site
561275002311	putative Mg++ binding site [ion binding]; other site
561275002312	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
561275002313	nucleotide binding region [chemical binding]; other site
561275002314	ATP-binding site [chemical binding]; other site
561275002315	Helicase conserved C-terminal domain; Region: Helicase_C_3; pfam13625
561275002316	WYL domain; Region: WYL; pfam13280
561275002317	MoaC family, prokaryotic and eukaryotic. Members of this family are involved in molybdenum cofactor (Moco) biosynthesis, an essential cofactor of a diverse group of redox enzymes. MoaC, a small hexameric protein, converts, together with MoaA, a guanosine...; Region: MoaC_PE; cd01420
561275002318	trimer interface [polypeptide binding]; other site
561275002319	dimer interface [polypeptide binding]; other site
561275002320	putative active site [active]
561275002321	MogA_MoaB family. Members of this family are involved in biosynthesis of the molybdenum cofactor (MoCF) an essential cofactor of a diverse group of redox enzymes. MoCF biosynthesis is an evolutionarily conserved pathway present in eubacteria, archaea; Region: MogA_MoaB; cd00886
561275002322	MPT binding site; other site
561275002323	trimer interface [polypeptide binding]; other site
561275002324	MoaE family. Members of this family are involved in biosynthesis of the molybdenum cofactor (Moco), an essential cofactor for a diverse group of redox enzymes. Moco biosynthesis is an evolutionarily conserved pathway present in eubacteria, archaea and...; Region: MoaE; cd00756
561275002325	MoaE homodimer interface [polypeptide binding]; other site
561275002326	MoaD interaction [polypeptide binding]; other site
561275002327	active site residues [active]
561275002328	Transglycosylase-like domain; Region: Transglycosylas; pfam06737
561275002329	Ubiquitin domain of MoaD-like proteins; Region: MoaD; cd00754
561275002330	MoaE interaction surface [polypeptide binding]; other site
561275002331	MoeB interaction surface [polypeptide binding]; other site
561275002332	thiocarboxylated glycine; other site
561275002333	molybdenum cofactor biosynthesis protein A; Reviewed; Region: moaA; PRK00164
561275002334	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
561275002335	FeS/SAM binding site; other site
561275002336	Molybdenum Cofactor Synthesis C; Region: Mob_synth_C; pfam06463
561275002337	hypothetical protein; Provisional; Region: PRK11770
561275002338	Domain of unknown function (DUF307); Region: DUF307; pfam03733
561275002339	Domain of unknown function (DUF307); Region: DUF307; pfam03733
561275002340	Cold-Shock Protein (CSP) contains an S1-like cold-shock domain (CSD) that is found in eukaryotes, prokaryotes, and archaea.  CSP's include the major cold-shock proteins CspA and CspB in bacteria and the eukaryotic gene regulatory factor Y-box...; Region: CSP_CDS; cd04458
561275002341	DNA-binding site [nucleotide binding]; DNA binding site
561275002342	RNA-binding motif; other site
561275002343	PE family; Region: PE; pfam00934
561275002344	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
561275002345	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275002346	active site
561275002347	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4398
561275002348	FIST N domain; Region: FIST; pfam08495
561275002349	FIST C domain; Region: FIST_C; pfam10442
561275002350	Protein of unknown function (DUF2771); Region: DUF2771; pfam10969
561275002351	H+ Antiporter protein; Region: 2A0121; TIGR00900
561275002352	Protein of unknown function (DUF3027); Region: DUF3027; pfam11228
561275002353	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275002354	PPE family; Region: PPE; pfam00823
561275002355	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275002356	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275002357	Protein of unknown function (DUF2530); Region: DUF2530; pfam10745
561275002358	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
561275002359	MarR family; Region: MarR; pfam01047
561275002360	NAD(P)+-dependent aldehyde dehydrogenase superfamily; Region: ALDH-SF; cl11961
561275002361	rRNA methylases [Translation, ribosomal structure and biogenesis]; Region: SpoU; COG0566
561275002362	SpoU rRNA Methylase family; Region: SpoU_methylase; pfam00588
561275002363	Protein of unknown function (DUF2537); Region: DUF2537; pfam10801
561275002364	Protein of unknown function (DUF3071); Region: DUF3071; pfam11268
561275002365	phosphoserine aminotransferase, putative; Region: serC_3; TIGR01366
561275002366	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
561275002367	catalytic residue [active]
561275002368	P-aminobenzoate N-oxygenase AurF; Region: AurF; pfam11583
561275002369	Ferredoxin [Energy production and conversion]; Region: COG1146
561275002370	4Fe-4S binding domain; Region: Fer4; pfam00037
561275002371	ferredoxin-NADP+ reductase; Region: PLN02852
561275002372	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
561275002373	This conserved domain belongs to a superfamily including the bleomycin resistance protein, glyoxalase I, and type I ring-cleaving dioxygenases; Region: Glo_EDI_BRP_like_8; cd07246
561275002374	putative dimer interface [polypeptide binding]; other site
561275002375	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
561275002376	Exonuclease-Endonuclease-Phosphatase (EEP) domain superfamily; Region: EEP; cl00490
561275002377	putative catalytic site [active]
561275002378	putative phosphate binding site [ion binding]; other site
561275002379	putative metal binding site [ion binding]; other site
561275002380	Bacillus subtilis (Bs) citrate synthase CS-I_like. CS catalyzes the condensation of acetyl coenzyme A (AcCoA) and oxalacetate (OAA) to form citrate and coenzyme A (CoA), the first step in the citric acid cycle (TCA or Krebs cycle). 2MCS catalyzes the...; Region: BsCS-I_like; cd06109
561275002381	dimer interface [polypeptide binding]; other site
561275002382	Citrate synthase; Region: Citrate_synt; pfam00285
561275002383	active site
561275002384	citrylCoA binding site [chemical binding]; other site
561275002385	oxalacetate/citrate binding site [chemical binding]; other site
561275002386	coenzyme A binding site [chemical binding]; other site
561275002387	catalytic triad [active]
561275002388	Predicted ATPase [General function prediction only]; Region: COG3903
561275002389	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
561275002390	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
561275002391	DNA binding residues [nucleotide binding]
561275002392	dimerization interface [polypeptide binding]; other site
561275002393	Adenylate cyclase, family 3 (some proteins contain HAMP domain) [Signal transduction mechanisms]; Region: CyaA; COG2114
561275002394	cyclase homology domain; Region: CHD; cd07302
561275002395	nucleotidyl binding site; other site
561275002396	metal binding site [ion binding]; metal-binding site
561275002397	dimer interface [polypeptide binding]; other site
561275002398	Predicted flavoprotein involved in K+ transport [Inorganic ion transport and metabolism]; Region: TrkA; COG2072
561275002399	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox_3; pfam13738
561275002400	O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315
561275002401	methyltransferase, TIGR00027 family; Region: mthyl_TIGR00027
561275002402	AAA ATPase domain; Region: AAA_16; pfam13191
561275002403	Predicted ATPase [General function prediction only]; Region: COG3903
561275002404	acyltransferase, WS/DGAT/MGAT; Region: acyl_WS_DGAT; TIGR02946
561275002405	Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007
561275002406	Escherichia coli (Ec) citrate synthase (CS) GltA_like. CS catalyzes the condensation of acetyl coenzyme A (AcCoA) and oxalacetate (OAA) to form citrate and coenzyme A (CoA), the first step in the citric acid cycle (TCA or Krebs cycle). The overall CS...; Region: EcCS_like; cd06114
561275002407	Citrate synthase [Energy production and conversion]; Region: GltA; COG0372
561275002408	dimer interface [polypeptide binding]; other site
561275002409	active site
561275002410	citrylCoA binding site [chemical binding]; other site
561275002411	NADH binding [chemical binding]; other site
561275002412	cationic pore residues; other site
561275002413	oxalacetate/citrate binding site [chemical binding]; other site
561275002414	coenzyme A binding site [chemical binding]; other site
561275002415	catalytic triad [active]
561275002416	Phytoene dehydrogenase and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG1233
561275002417	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
561275002418	Protein of unknown function (DUF2630); Region: DUF2630; pfam10944
561275002419	BON domain; Region: BON; pfam04972
561275002420	Outer membrane protein and related peptidoglycan-associated (lipo)proteins [Cell envelope biogenesis, outer membrane]; Region: OmpA; COG2885
561275002421	Peptidoglycan binding domains similar to the C-terminal domain of outer-membrane protein OmpA; Region: OmpA_C-like; cd07185
561275002422	ligand binding site [chemical binding]; other site
561275002423	Ribosomal protein L4/L1 family; Region: Ribosomal_L4; cl00325
561275002424	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
561275002425	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
561275002426	dimerization interface [polypeptide binding]; other site
561275002427	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
561275002428	dimer interface [polypeptide binding]; other site
561275002429	phosphorylation site [posttranslational modification]
561275002430	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
561275002431	Mg2+ binding site [ion binding]; other site
561275002432	G-X-G motif; other site
561275002433	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
561275002434	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
561275002435	active site
561275002436	phosphorylation site [posttranslational modification]
561275002437	intermolecular recognition site; other site
561275002438	dimerization interface [polypeptide binding]; other site
561275002439	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
561275002440	DNA binding site [nucleotide binding]
561275002441	Carboxyl transferase domain; Region: Carboxyl_trans; pfam01039
561275002442	Acetyl-CoA carboxylase alpha subunit [Lipid metabolism]; Region: AccA; COG0825
561275002443	Enoyl-CoA hydratase/carnithine racemase [Lipid metabolism]; Region: CaiD; COG1024
561275002444	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
561275002445	substrate binding site [chemical binding]; other site
561275002446	oxyanion hole (OAH) forming residues; other site
561275002447	trimer interface [polypeptide binding]; other site
561275002448	Predicted Zn-dependent hydrolases of the beta-lactamase fold [General function prediction only]; Region: COG2220
561275002449	Beta-lactamase superfamily domain; Region: Lactamase_B_2; pfam12706
561275002450	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
561275002451	Beta-lactamase; Region: Beta-lactamase; pfam00144
561275002452	Domain of unknown function (DUF3471); Region: DUF3471; pfam11954
561275002453	Cation transport ATPase [Inorganic ion transport and metabolism]; Region: MgtA; COG0474
561275002454	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
561275002455	Soluble P-type ATPase [General function prediction only]; Region: COG4087
561275002456	MT0933-like antitoxin protein; Region: MT0933_antitox; pfam14013
561275002457	START/RHO_alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) ligand-binding domain superfamily; Region: SRPBCC; cd07812
561275002458	hydrophobic ligand binding site; other site
561275002459	N-terminal domain of Streptomyces griseus SgaA (suppression of growth disturbance caused by A-factor at a high concentration under high osmolality during early growth phase), and similar domains; Region: SgaA_N_like; cd07247
561275002460	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
561275002461	N-terminal domain of Streptomyces griseus SgaA (suppression of growth disturbance caused by A-factor at a high concentration under high osmolality during early growth phase), and similar domains; Region: SgaA_N_like; cd07247
561275002462	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
561275002463	Lignostilbene-alpha,beta-dioxygenase and related enzymes [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3670
561275002464	Retinal pigment epithelial membrane protein; Region: RPE65; pfam03055
561275002465	acetyl-CoA acetyltransferase; Provisional; Region: PRK06289
561275002466	Thiolase domain associated with sterol carrier protein (SCP)-x isoform and related proteins; SCP-2  has multiple roles in intracellular lipid circulation and metabolism. The N-terminal presequence in the SCP-x isoform represents a peroxisomal...; Region: SCP-x_thiolase; cd00829
561275002467	active site
561275002468	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275002469	PPE family; Region: PPE; pfam00823
561275002470	PE family; Region: PE; pfam00934
561275002471	BCCT family transporter; Region: BCCT; pfam02028
561275002472	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4453
561275002473	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
561275002474	Coenzyme A binding pocket [chemical binding]; other site
561275002475	Transposase, Mutator family; Region: Transposase_mut; pfam00872
561275002476	MULE transposase domain; Region: MULE; pfam10551
561275002477	Predicted site-specific integrase-resolvase [DNA replication, recombination, and repair]; Region: COG2452
561275002478	Serine Recombinase (SR) family, IS607-like transposase subfamily, catalytic domain; members contain a DNA binding domain with homology to MerR/SoxR located N-terminal to the catalytic domain. Serine recombinases catalyze site-specific recombination of...; Region: SR_IS607_transposase_like; cd03769
561275002479	catalytic residues [active]
561275002480	catalytic nucleophile [active]
561275002481	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG0675
561275002482	Probable transposase; Region: OrfB_IS605; pfam01385
561275002483	GGCT-like domains, also called AIG2-like family. Gamma-glutamyl cyclotransferase (GGCT) catalyzes the formation of pyroglutamic acid (5-oxoproline) from dipeptides containing gamma-glutamyl, and is a dimeric protein. In Homo sapiens, the protein is...; Region: GGCT_like; cd06661
561275002484	putative active site pocket [active]
561275002485	dimerization interface [polypeptide binding]; other site
561275002486	putative catalytic residue [active]
561275002487	Phage-related replication protein [General function prediction only]; Region: COG4195
561275002488	manganese transport protein MntH; Reviewed; Region: PRK00701
561275002489	Natural resistance-associated macrophage protein; Region: Nramp; pfam01566
561275002490	Multimeric flavodoxin WrbA [General function prediction only]; Region: WrbA; COG0655
561275002491	NADPH-dependent FMN reductase; Region: FMN_red; pfam03358
561275002492	Uncharacterized conserved protein related to dihydrodipicolinate reductase [Function unknown]; Region: COG3804
561275002493	short chain dehydrogenase; Provisional; Region: PRK07814
561275002494	classical (c) SDRs; Region: SDR_c; cd05233
561275002495	NAD(P) binding site [chemical binding]; other site
561275002496	active site
561275002497	phosphate ABC transporter, phosphate-binding protein; Region: 3a0107s03; TIGR00975
561275002498	phosphate ABC transporter, permease protein PstC; Region: phosphate_pstC; TIGR02138
561275002499	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
561275002500	dimer interface [polypeptide binding]; other site
561275002501	conserved gate region; other site
561275002502	putative PBP binding loops; other site
561275002503	ABC-ATPase subunit interface; other site
561275002504	ABC-type phosphate transport system, permease component [Inorganic ion transport and metabolism]; Region: PstA; COG0581
561275002505	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
561275002506	dimer interface [polypeptide binding]; other site
561275002507	conserved gate region; other site
561275002508	putative PBP binding loops; other site
561275002509	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cl00427
561275002510	ABC-ATPase subunit interface; other site
561275002511	Uncharacterized conserved protein [Function unknown]; Region: COG3391
561275002512	NHL repeat; Region: NHL; pfam01436
561275002513	NHL repeat; Region: NHL; pfam01436
561275002514	NHL repeat; Region: NHL; pfam01436
561275002515	NHL repeat; Region: NHL; pfam01436
561275002516	NHL repeat; Region: NHL; pfam01436
561275002517	Serine/Threonine protein kinases, catalytic domain; Region: S_TKc; smart00220
561275002518	Catalytic domain of Protein Kinases; Region: PKc; cd00180
561275002519	active site
561275002520	ATP binding site [chemical binding]; other site
561275002521	substrate binding site [chemical binding]; other site
561275002522	Protein Kinases, catalytic domain; Region: PKc_like; cl09925
561275002523	substrate binding site [chemical binding]; other site
561275002524	activation loop (A-loop); other site
561275002525	activation loop (A-loop); other site
561275002526	PBP superfamily domain; Region: PBP_like_2; cl17296
561275002527	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
561275002528	Walker A/P-loop; other site
561275002529	ATP binding site [chemical binding]; other site
561275002530	ATP-binding cassette domain of the phosphate transport system; Region: ABC_PstB_phosphate_transporter; cd03260
561275002531	Q-loop/lid; other site
561275002532	ABC transporter signature motif; other site
561275002533	Walker B; other site
561275002534	D-loop; other site
561275002535	H-loop/switch region; other site
561275002536	phosphate ABC transporter, phosphate-binding protein; Region: 3a0107s03; TIGR00975
561275002537	phosphate ABC transporter, permease protein PstC; Region: phosphate_pstC; TIGR02138
561275002538	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
561275002539	dimer interface [polypeptide binding]; other site
561275002540	conserved gate region; other site
561275002541	putative PBP binding loops; other site
561275002542	ABC-ATPase subunit interface; other site
561275002543	ABC-type phosphate transport system, permease component [Inorganic ion transport and metabolism]; Region: PstA; COG0581
561275002544	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
561275002545	dimer interface [polypeptide binding]; other site
561275002546	conserved gate region; other site
561275002547	putative PBP binding loops; other site
561275002548	ABC-ATPase subunit interface; other site
561275002549	Ku protein, prokaryotic; Region: Ku_bact; TIGR02772
561275002550	Ku-core domain, Ku-like subfamily; composed of prokaryotic homologs of the eukaryotic DNA binding protein Ku. The alignment includes the core domain shared by the prokaryotic YkoV-like proteins and the eukaryotic Ku70 and Ku80. The prokaryotic Ku...; Region: KU_like; cd00789
561275002551	putative DNA binding site [nucleotide binding]; other site
561275002552	putative homodimer interface [polypeptide binding]; other site
561275002553	ATP-dependent DNA ligase; Reviewed; Region: PRK09632
561275002554	MtLigD_Pol_like: Polymerase (Pol) domain of bacterial LigD proteins similar to Mycobacterium tuberculosis (Mt)LigD. The LigD Pol domain belongs to the archaeal/eukaryal primase (AEP) superfamily. In prokaryotes, LigD along with Ku is required for...; Region: MtLigD_Pol_like; cd04863
561275002555	nucleotide binding site [chemical binding]; other site
561275002556	DNA ligase D, 3'-phosphoesterase domain; Region: LigD_PE_dom; TIGR02777
561275002557	Adenylation domain of Mycobacterium tuberculosis LigD and LigC-like ATP-dependent DNA ligases; Region: Adenylation_DNA_ligase_LigD_LigC; cd07906
561275002558	active site
561275002559	DNA binding site [nucleotide binding]
561275002560	The Oligonucleotide/oligosaccharide binding (OB)-fold domain of ATP-dependent DNA ligase LigD is a DNA-binding module that is part of the catalytic core unit; Region: OBF_DNA_ligase_LigD; cd07971
561275002561	DNA binding site [nucleotide binding]
561275002562	2-keto-4-pentenoate hydratase/2-oxohepta-3-ene-1,7-dioic acid hydratase (catechol pathway) [Secondary metabolites biosynthesis, transport, and catabolism]; Region: MhpD; COG0179
561275002563	Fumarylacetoacetate (FAA) hydrolase family; Region: FAA_hydrolase; pfam01557
561275002564	Zn-dependent hydrolases, including glyoxylases [General function prediction only]; Region: GloB; COG0491
561275002565	probable F420-dependent oxidoreductase, Rv2161c family; Region: F420_Rv2161c; TIGR03619
561275002566	Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cl07892
561275002567	Sulphate Transporter and Anti-Sigma factor antagonist) domain of anti-anti-sigma factors, key regulators of anti-sigma factors by phosphorylation; Region: STAS_anti-anti-sigma_factors; cd07043
561275002568	anti sigma factor interaction site; other site
561275002569	regulatory phosphorylation site [posttranslational modification]; other site
561275002570	Predicted flavoprotein involved in K+ transport [Inorganic ion transport and metabolism]; Region: TrkA; COG2072
561275002571	Formamidopyrimidine-DNA glycosylase [DNA replication, recombination, and repair]; Region: Nei; COG0266
561275002572	Formamidopyrimidine-DNA glycosylase H2TH domain; Region: H2TH; pfam06831
561275002573	Zinc finger found in FPG and IleRS; Region: zf-FPG_IleRS; pfam06827
561275002574	short chain dehydrogenase; Provisional; Region: PRK08251
561275002575	classical (c) SDR, subgroup 6; Region: SDR_c6; cd05350
561275002576	putative NAD(P) binding site [chemical binding]; other site
561275002577	active site
561275002578	glucose-6-phosphate isomerase; Reviewed; Region: pgi; PRK00179
561275002579	Phosphoglucose isomerase (PGI) contains two SIS (Sugar ISomerase) domains. This classification is based on the alignment of the first SIS domain. PGI is a multifunctional enzyme which as an intracellular dimer catalyzes the reversible isomerization of...; Region: SIS_PGI_1; cd05015
561275002580	active site
561275002581	dimer interface [polypeptide binding]; other site
561275002582	Phosphoglucose isomerase (PGI) contains two SIS (Sugar ISomerase) domains. This classification is based on the alignment of the second SIS domain. PGI is a multifunctional enzyme which as an intracellular dimer catalyzes the reversible isomerization of...; Region: SIS_PGI_2; cd05016
561275002583	dimer interface [polypeptide binding]; other site
561275002584	active site
561275002585	hypothetical protein; Provisional; Region: PRK07857
561275002586	ATP-dependent DNA helicase PcrA; Region: pcrA; TIGR01073
561275002587	Part of AAA domain; Region: AAA_19; pfam13245
561275002588	Family description; Region: UvrD_C_2; pfam13538
561275002589	Membrane proteins related to metalloendopeptidases [Cell envelope biogenesis, outer membrane]; Region: NlpD; COG0739
561275002590	Peptidase family M23; Region: Peptidase_M23; pfam01551
561275002591	succinyl-CoA synthetase subunit beta; Provisional; Region: sucC; PRK00696
561275002592	ATP-grasp domain; Region: ATP-grasp_2; pfam08442
561275002593	CoA-ligase; Region: Ligase_CoA; pfam00549
561275002594	succinyl-CoA synthetase subunit alpha; Validated; Region: PRK05678
561275002595	CoA binding domain; Region: CoA_binding; smart00881
561275002596	CoA-ligase; Region: Ligase_CoA; pfam00549
561275002597	probable F420-dependent oxidoreductase, Rv2161c family; Region: F420_Rv2161c; TIGR03619
561275002598	Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cl07892
561275002599	BCG Tokyo has a 53-bp deletion from the end of Rv0953c to Rv0952, which mean that the distance between the two genes decreased to 9 bp.
561275002600	phosphoribosylglycinamide formyltransferase; Reviewed; Region: purN; PRK05647
561275002601	Phosphoribosylglycinamide formyltransferase (GAR transformylase, GART); Region: FMT_core_GART; cd08645
561275002602	active site
561275002603	substrate binding site [chemical binding]; other site
561275002604	cosubstrate binding site; other site
561275002605	catalytic site [active]
561275002606	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase; Provisional; Region: purH; PRK00881
561275002607	Inosine monophosphate cyclohydrolase domain. This is the N-terminal domain in the purine biosynthesis pathway protein ATIC (purH). The bifunctional ATIC protein contains a C-terminal  ATIC formylase domain that formylates...; Region: IMPCH; cd01421
561275002608	purine monophosphate binding site [chemical binding]; other site
561275002609	dimer interface [polypeptide binding]; other site
561275002610	putative catalytic residues [active]
561275002611	AICARFT/IMPCHase bienzyme; Region: AICARFT_IMPCHas; smart00798
561275002612	AICARFT/IMPCHase bienzyme; Region: AICARFT_IMPCHas; cl03362
561275002613	Mg-chelatase subunit ChlI [Coenzyme metabolism]; Region: ChlI; COG1239
561275002614	Magnesium chelatase, subunit ChlI; Region: Mg_chelatase; pfam01078
561275002615	Uncharacterized protein with a von Willebrand factor type A (vWA) domain [General function prediction only]; Region: COG4867
561275002616	Von Willebrand factor type A (vWA) domain was originally found in the blood coagulation protein von Willebrand factor (vWF). Typically, the vWA domain is made up of approximately 200 amino acid residues folded into a classic a/b para-rossmann type of...; Region: vWFA; cl00057
561275002617	metal ion-dependent adhesion site (MIDAS); other site
561275002618	PIN domain of the Pyrobaculum aerophilum Pae0151 and Pae2754 proteins and homologs; Region: PIN_Pae0151; cd09873
561275002619	homotetrameric interface [polypeptide binding]; other site
561275002620	putative active site [active]
561275002621	metal binding site [ion binding]; metal-binding site
561275002622	Alpha/beta hydrolase; Region: Abhydrolase_8; pfam06259
561275002623	Domain of unknown function (DUF1707); Region: DUF1707; pfam08044
561275002624	Thermus thermophilus CsoR, a Cu(I)-sensing transcriptional regulator, and related domains; this domain family was previously known as part of DUF156; Region: TthCsoR-like_DUF156; cd10151
561275002625	putative homodimer interface [polypeptide binding]; other site
561275002626	putative homotetramer interface [polypeptide binding]; other site
561275002627	allosteric switch controlling residues; other site
561275002628	putative metal binding site [ion binding]; other site
561275002629	putative homodimer-homodimer interface [polypeptide binding]; other site
561275002630	Protein of unknown function (DUF1490); Region: DUF1490; pfam07371
561275002631	copper-(or silver)-translocating P-type ATPase; Region: ATPase-IB1_Cu; TIGR01511
561275002632	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
561275002633	Soluble P-type ATPase [General function prediction only]; Region: COG4087
561275002634	enoyl-CoA hydratase; Provisional; Region: PRK07827
561275002635	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
561275002636	substrate binding site [chemical binding]; other site
561275002637	oxyanion hole (OAH) forming residues; other site
561275002638	trimer interface [polypeptide binding]; other site
561275002639	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275002640	Acyl-CoA dehydrogenase; Region: ACAD; cd00567
561275002641	active site
561275002642	Acetyl/propionyl-CoA carboxylase, alpha subunit [Lipid metabolism]; Region: COG4770
561275002643	Carbamoyl-phosphate synthase L chain, N-terminal domain; Region: CPSase_L_chain; pfam00289
561275002644	ATP-grasp domain; Region: ATP-grasp_4; cl17255
561275002645	Biotin carboxylase C-terminal domain; Region: Biotin_carb_C; smart00878
561275002646	The biotinyl-domain or biotin carboxyl carrier protein (BCCP) domain is present in all biotin-dependent enzymes, such as acetyl-CoA carboxylase, pyruvate carboxylase, propionyl-CoA carboxylase, methylcrotonyl-CoA carboxylase, geranyl-CoA carboxylase; Region: biotinyl_domain; cd06850
561275002647	carboxyltransferase (CT) interaction site; other site
561275002648	biotinylation site [posttranslational modification]; other site
561275002649	Acetyl-CoA carboxylase, carboxyltransferase component (subunits alpha and beta) [Lipid metabolism]; Region: COG4799
561275002650	Acetyl-CoA carboxylase alpha subunit [Lipid metabolism]; Region: AccA; cl17345
561275002651	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275002652	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
561275002653	active site
561275002654	Protein of unknown function (DUF1446); Region: DUF1446; pfam07287
561275002655	potential frameshift: common BLAST hit: gi|148660757|ref|YP_001282280.1| PE-PGRS family protein
561275002656	PE family; Region: PE; pfam00934
561275002657	PE family; Region: PE; pfam00934
561275002658	Uncharacterized conserved protein [Function unknown]; Region: COG3391
561275002659	40-residue YVTN family beta-propeller repeat; Region: beta_rpt_yvtn; TIGR02276
561275002660	40-residue YVTN family beta-propeller repeat; Region: beta_rpt_yvtn; TIGR02276
561275002661	PE family; Region: PE; pfam00934
561275002662	Uncharacterized conserved protein [Function unknown]; Region: COG3391
561275002663	40-residue YVTN family beta-propeller repeat; Region: beta_rpt_yvtn; TIGR02276
561275002664	40-residue YVTN family beta-propeller repeat; Region: beta_rpt_yvtn; TIGR02276
561275002665	40-residue YVTN family beta-propeller repeat; Region: beta_rpt_yvtn; TIGR02276
561275002666	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
561275002667	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
561275002668	active site
561275002669	phosphorylation site [posttranslational modification]
561275002670	intermolecular recognition site; other site
561275002671	dimerization interface [polypeptide binding]; other site
561275002672	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
561275002673	DNA binding site [nucleotide binding]
561275002674	heavy metal sensor kinase; Region: cztS_silS_copS; TIGR01386
561275002675	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
561275002676	dimerization interface [polypeptide binding]; other site
561275002677	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
561275002678	dimer interface [polypeptide binding]; other site
561275002679	phosphorylation site [posttranslational modification]
561275002680	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
561275002681	ATP binding site [chemical binding]; other site
561275002682	Mg2+ binding site [ion binding]; other site
561275002683	G-X-G motif; other site
561275002684	periplasmic serine protease, Do/DeqQ family; Region: degP_htrA_DO; TIGR02037
561275002685	Trypsin-like peptidase domain; Region: Trypsin_2; pfam13365
561275002686	MogA_MoaB family. Members of this family are involved in biosynthesis of the molybdenum cofactor (MoCF) an essential cofactor of a diverse group of redox enzymes. MoCF biosynthesis is an evolutionarily conserved pathway present in eubacteria, archaea; Region: MogA_MoaB; cd00886
561275002687	MPT binding site; other site
561275002688	trimer interface [polypeptide binding]; other site
561275002689	large-conductance mechanosensitive channel; Reviewed; Region: mscL; PRK00567
561275002690	Large-conductance mechanosensitive channel, MscL; Region: MscL; pfam01741
561275002691	ABC-type antimicrobial peptide transport system, ATPase component [Defense mechanisms]; Region: SalX; COG1136
561275002692	ATP-binding cassette domain of the transporters involved in export of lipoprotein and macrolide, and cell division protein; Region: ABC_MJ0796_LolCDE_FtsE; cd03255
561275002693	Walker A/P-loop; other site
561275002694	ATP binding site [chemical binding]; other site
561275002695	Q-loop/lid; other site
561275002696	ABC transporter signature motif; other site
561275002697	Walker B; other site
561275002698	D-loop; other site
561275002699	H-loop/switch region; other site
561275002700	ABC-type transport system, involved in lipoprotein release, permease component [Cell envelope biogenesis, outer membrane]; Region: LolE; COG4591
561275002701	MacB-like periplasmic core domain; Region: MacB_PCD; pfam12704
561275002702	FtsX-like permease family; Region: FtsX; pfam02687
561275002703	MacB-like periplasmic core domain; Region: MacB_PCD; pfam12704
561275002704	ABC-type antimicrobial peptide transport system, permease component [Defense mechanisms]; Region: SalY; COG0577
561275002705	FtsX-like permease family; Region: FtsX; pfam02687
561275002706	Predicted secreted hydrolase [General function prediction only]; Region: COG5621
561275002707	Geranylgeranyl pyrophosphate synthase [Coenzyme metabolism]; Region: IspA; COG0142
561275002708	Trans-Isoprenyl Diphosphate Synthases, head-to-tail; Region: Trans_IPPS_HT; cd00685
561275002709	substrate binding pocket [chemical binding]; other site
561275002710	chain length determination region; other site
561275002711	substrate-Mg2+ binding site; other site
561275002712	catalytic residues [active]
561275002713	aspartate-rich region 1; other site
561275002714	active site lid residues [active]
561275002715	aspartate-rich region 2; other site
561275002716	SAF domains of the flagella basal body P-ring formation protein FlgA and the flp pilus assembly CpaB; Region: SAF_CpaB_FlgA_like; cd11614
561275002717	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2331
561275002718	5-formyltetrahydrofolate cyclo-ligase [Coenzyme metabolism]; Region: COG0212
561275002719	5-formyltetrahydrofolate cyclo-ligase family; Region: 5-FTHF_cyc-lig; pfam01812
561275002720	UDP-glucose pyrophosphorylase [Cell envelope biogenesis, outer membrane]; Region: GalU; COG1210
561275002721	dTDP-glucose pyrophosphorylase [Cell envelope biogenesis, outer membrane]; Region: RfbA; COG1209
561275002722	active site
561275002723	Molybdopterin biosynthesis enzyme [Coenzyme metabolism]; Region: MoeA; COG0303
561275002724	MoeA family. Members of this family are involved in biosynthesis of the molybdenum cofactor (MoCF), an essential cofactor of a diverse group of redox enzymes. MoCF biosynthesis is an evolutionarily conserved pathway present in eubacteria, archaea and...; Region: MoeA; cd00887
561275002725	dimer interface [polypeptide binding]; other site
561275002726	putative functional site; other site
561275002727	putative MPT binding site; other site
561275002728	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
561275002729	Acetyltransferases, including N-acetylases of ribosomal proteins [Translation, ribosomal structure and biogenesis]; Region: RimL; COG1670
561275002730	cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases [Signal transduction mechanisms]; Region: Crp; COG0664
561275002731	effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038
561275002732	ligand binding site [chemical binding]; other site
561275002733	flexible hinge region; other site
561275002734	Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302
561275002735	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
561275002736	Coenzyme A binding pocket [chemical binding]; other site
561275002737	Alkylated DNA repair protein [DNA replication, recombination, and repair]; Region: AlkB; COG3145
561275002738	arginine deiminase; Provisional; Region: PRK01388
561275002739	Dolichyl-phosphate-mannose--protein O-mannosyl transferase [Posttranslational modification, protein turnover, chaperones]; Region: PMT1; COG1928
561275002740	Dolichyl-phosphate-mannose-protein mannosyltransferase; Region: PMT_2; cl17364
561275002741	Predicted methyltransferases [General function prediction only]; Region: COG0313
561275002742	Ribosomal RNA small subunit methyltransferase I, also known as rRNA (cytidine-2'-O-)-methyltransferase RsmI; Region: RsmI; cd11648
561275002743	putative SAM binding site [chemical binding]; other site
561275002744	putative homodimer interface [polypeptide binding]; other site
561275002745	aminodeoxychorismate synthase component I; Provisional; Region: PRK05877
561275002746	aminodeoxychorismate synthase, component I, bacterial clade; Region: pabB; TIGR00553
561275002747	methionyl-tRNA synthetase; Reviewed; Region: PRK11893
561275002748	catalytic core domain of methioninyl-tRNA synthetases; Region: MetRS_core; cd00814
561275002749	active site
561275002750	HIGH motif; other site
561275002751	KMSKS motif; other site
561275002752	Anticodon-binding domain of methionyl tRNA synthetases; Region: Anticodon_Ia_Met; cd07957
561275002753	tRNA binding surface [nucleotide binding]; other site
561275002754	anticodon binding site; other site
561275002755	Predicted metal-dependent hydrolases with the TIM-barrel fold [General function prediction only]; Region: COG1099
561275002756	TatD like proteins;  E.coli TatD is a cytoplasmic protein, shown to have magnesium dependent DNase activity; Region: TatD_DNAse; cd01310
561275002757	active site
561275002758	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3583
561275002759	Domain of unknown function (DUF348); Region: DUF348; pfam03990
561275002760	Domain of unknown function (DUF348); Region: DUF348; pfam03990
561275002761	G5 domain; Region: G5; pfam07501
561275002762	Transglycosylase-like domain; Region: Transglycosylas; pfam06737
561275002763	16S ribosomal RNA methyltransferase KsgA/Dim1 family protein; Reviewed; Region: ksgA; PRK00274
561275002764	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275002765	S-adenosylmethionine binding site [chemical binding]; other site
561275002766	4-diphosphocytidyl-2-C-methyl-D-erythritol kinase; Provisional; Region: PRK03188
561275002767	Increased loss of mitochondrial DNA protein 1; Region: Ilm1; pfam10311
561275002768	GHMP kinases C terminal; Region: GHMP_kinases_C; pfam08544
561275002769	long-chain-fatty-acid--CoA ligase; Validated; Region: PRK07768
561275002770	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
561275002771	acyl-activating enzyme (AAE) consensus motif; other site
561275002772	AMP binding site [chemical binding]; other site
561275002773	active site
561275002774	CoA binding site [chemical binding]; other site
561275002775	Peptidyl-tRNA hydrolase (PTH) is a monomeric protein that cleaves the ester bond linking the nascent peptide and tRNA when peptidyl-tRNA is released prematurely from the ribosome. This ensures the recycling of peptidyl-tRNAs into tRNAs produced through...; Region: PTH; cd00462
561275002776	putative active site [active]
561275002777	catalytic residue [active]
561275002778	Ribosomal L25/TL5/CTC N-terminal 5S rRNA binding domain; Region: Ribosomal_L25_TL5_CTC; cd00495
561275002779	ribosomal protein L25, Ctc-form; Region: ctc_TL5; TIGR00731
561275002780	5S rRNA interface [nucleotide binding]; other site
561275002781	CTC domain interface [polypeptide binding]; other site
561275002782	L16 interface [polypeptide binding]; other site
561275002783	Probable lipoprotein LpqN; Region: Lpp-LpqN; pfam10738
561275002784	N-terminal domain of ribose phosphate pyrophosphokinase; Region: Pribosyltran_N; pfam13793
561275002785	ribose-phosphate pyrophosphokinase; Provisional; Region: PRK03092
561275002786	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
561275002787	active site
561275002788	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase; Provisional; Region: glmU; PRK14352
561275002789	N-terminal domain of bacterial GlmU; Region: GT2_GlmU_N_bac; cd02540
561275002790	Substrate binding site; other site
561275002791	Mg++ binding site; other site
561275002792	N-acetyl-glucosamine-1-phosphate uridyltransferase (GlmU), C-terminal left-handed beta-helix (LbH) acetyltransferase domain: GlmU is also known as UDP-N-acetylglucosamine pyrophosphorylase. It is a bifunctional bacterial enzyme that catalyzes two...; Region: LbH_GlmU_C; cd03353
561275002793	active site
561275002794	substrate binding site [chemical binding]; other site
561275002795	CoA binding site [chemical binding]; other site
561275002796	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275002797	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275002798	Transcription-repair coupling factor (superfamily II helicase) [DNA replication, recombination, and repair / Transcription]; Region: Mfd; COG1197
561275002799	CarD-like/TRCF domain; Region: CarD_TRCF; smart01058
561275002800	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
561275002801	ATP binding site [chemical binding]; other site
561275002802	putative Mg++ binding site [ion binding]; other site
561275002803	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
561275002804	nucleotide binding region [chemical binding]; other site
561275002805	ATP-binding site [chemical binding]; other site
561275002806	This domain is found in proteins necessary for strand-specific repair in DNA such as TRCF in Escherichia coli; Region: TRCF; smart00982
561275002807	nucleoside triphosphate pyrophosphohydrolase; Reviewed; Region: PRK12334
561275002808	Nucleoside Triphosphate Pyrophosphohydrolase (EC 3.6.1.8) N-terminal tandem-domain of MazG proteins from Escherichia coli and bacterial homologs; Region: NTP-PPase_MazG_Nterm; cd11528
561275002809	homodimer interface [polypeptide binding]; other site
561275002810	metal binding site [ion binding]; metal-binding site
561275002811	Nucleoside Triphosphate Pyrophosphohydrolase (EC 3.6.1.8) MazG-like domain superfamily; Region: NTP-PPase; cl16941
561275002812	Membrane-bound lytic murein transglycosylase B [Cell envelope biogenesis, outer membrane]; Region: MltB; COG2951
561275002813	Lytic Transglycosylase (LT)  and Goose Egg White Lysozyme (GEWL) domain. Members include the soluble and insoluble membrane-bound LTs in bacteria, the LTs in bacteriophage lambda, as well as, the eukaryotic "goose-type" lysozymes (GEWL).  LTs...; Region: LT_GEWL; cd00254
561275002814	N-acetyl-D-glucosamine binding site [chemical binding]; other site
561275002815	enolase; Provisional; Region: eno; PRK00077
561275002816	Enolase: Enolases are homodimeric enzymes that catalyse the reversible dehydration of 2-phospho-D-glycerate to phosphoenolpyruvate as part of the glycolytic and gluconeogenesis pathways. The reaction is facilitated by the presence of metal ions; Region: enolase; cd03313
561275002817	dimer interface [polypeptide binding]; other site
561275002818	metal binding site [ion binding]; metal-binding site
561275002819	substrate binding pocket [chemical binding]; other site
561275002820	Septum formation initiator [Cell division and chromosome partitioning]; Region: COG2919
561275002821	Septum formation initiator; Region: DivIC; pfam04977
561275002822	Uncharacterized conserved protein [Function unknown]; Region: COG1507
561275002823	exopolyphosphatase; Region: exo_poly_only; TIGR03706
561275002824	Ppx/GppA phosphatase family; Region: Ppx-GppA; pfam02541
561275002825	DNA-binding transcriptional activator KdpE; Provisional; Region: PRK10529
561275002826	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
561275002827	active site
561275002828	phosphorylation site [posttranslational modification]
561275002829	intermolecular recognition site; other site
561275002830	dimerization interface [polypeptide binding]; other site
561275002831	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
561275002832	DNA binding site [nucleotide binding]
561275002833	Osmosensitive K+ channel histidine kinase [Signal transduction mechanisms]; Region: KdpD; COG2205
561275002834	Osmosensitive K+ channel His kinase sensor domain; Region: KdpD; pfam02702
561275002835	USP domain is located between the N-terminal sensor domain and C-terminal catalytic domain of this Osmosensitive K+ channel histidine kinase family. The family of KdpD sensor kinase proteins regulates the kdpFABC operon responsible for potassium...; Region: USP_OKCHK; cd01987
561275002836	Ligand Binding Site [chemical binding]; other site
561275002837	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
561275002838	dimer interface [polypeptide binding]; other site
561275002839	phosphorylation site [posttranslational modification]
561275002840	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
561275002841	ATP binding site [chemical binding]; other site
561275002842	Mg2+ binding site [ion binding]; other site
561275002843	G-X-G motif; other site
561275002844	K+-transporting ATPase, KdpA; Region: kdpA; TIGR00680
561275002845	potassium-transporting ATPase subunit B; Provisional; Region: PRK01122
561275002846	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
561275002847	Soluble P-type ATPase [General function prediction only]; Region: COG4087
561275002848	potassium-transporting ATPase subunit C; Provisional; Region: PRK14001
561275002849	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
561275002850	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
561275002851	dimer interface [polypeptide binding]; other site
561275002852	phosphorylation site [posttranslational modification]
561275002853	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
561275002854	ATP binding site [chemical binding]; other site
561275002855	Mg2+ binding site [ion binding]; other site
561275002856	G-X-G motif; other site
561275002857	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
561275002858	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
561275002859	active site
561275002860	phosphorylation site [posttranslational modification]
561275002861	intermolecular recognition site; other site
561275002862	dimerization interface [polypeptide binding]; other site
561275002863	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
561275002864	DNA binding site [nucleotide binding]
561275002865	Transposase and inactivated derivatives, IS5 family [DNA replication, recombination, and repair]; Region: COG3039
561275002866	Transposase DDE domain; Region: DDE_Tnp_1_6; pfam13751
561275002867	Transposase and inactivated derivatives, IS5 family [DNA replication, recombination, and repair]; Region: COG3039
561275002868	Proteins of 100 residues with WXG; Region: WXG100; pfam06013
561275002869	WXG100 family type VII secretion target; Region: WXG100_ESAT6; TIGR03930
561275002870	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275002871	PPE family; Region: PPE; pfam00823
561275002872	Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484
561275002873	PE family; Region: PE; pfam00934
561275002874	Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484
561275002876	Putative transposase of IS4/5 family (DUF4096); Region: DUF4096; pfam13340
561275002877	Trypsin-like serine proteases, typically periplasmic, contain C-terminal PDZ domain [Posttranslational modification, protein turnover, chaperones]; Region: DegQ; COG0265
561275002878	Trypsin-like peptidase domain; Region: Trypsin_2; pfam13365
561275002879	Predicted transcriptional regulator [Transcription]; Region: COG5340
561275002880	Domain of unknown function (DUF4095); Region: DUF4095; pfam13338
561275002881	Nucleotidyl transferase of unknown function (DUF1814); Region: DUF1814; pfam08843
561275002882	Transposase, Mutator family; Region: Transposase_mut; pfam00872
561275002883	MULE transposase domain; Region: MULE; pfam10551
561275002884	Transcriptional regulators [Transcription]; Region: MarR; COG1846
561275002885	MarR family; Region: MarR_2; pfam12802
561275002886	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
561275002887	This enzymatic domain is part of bacterial polyketide synthases; Region: PKS_KR; smart00822
561275002888	NAD(P) binding site [chemical binding]; other site
561275002889	active site
561275002890	Nucleotidyl transferase of unknown function (DUF1814); Region: DUF1814; pfam08843
561275002891	Helix-turn-helix domain; Region: HTH_17; pfam12728
561275002892	DNA breaking-rejoining enzymes, C-terminal catalytic domain. The DNA breaking-rejoining enzyme superfamily includes type IB topoisomerases and tyrosine recombinases that share the same fold in their catalytic domain containing six conserved active site...; Region: DNA_BRE_C; cl00213
561275002893	Domain of unknown function (DUF427); Region: DUF427; cl00998
561275002894	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2343
561275002895	Uncharacterized conserved protein [Function unknown]; Region: COG3391
561275002896	long-chain-fatty-acid--CoA ligase; Validated; Region: PRK06187
561275002897	Fatty acyl-CoA synthetases similar to LC-FACS from Thermus thermophiles; Region: ttLC_FACS_AlkK_like; cd12119
561275002898	dimer interface [polypeptide binding]; other site
561275002899	acyl-activating enzyme (AAE) consensus motif; other site
561275002900	putative active site [active]
561275002901	AMP binding site [chemical binding]; other site
561275002902	putative CoA binding site [chemical binding]; other site
561275002903	Uncharacterized conserved protein related to dihydrodipicolinate reductase [Function unknown]; Region: COG3804
561275002904	Polyketide cyclase / dehydrase and lipid transport; Region: Polyketide_cyc2; pfam10604
561275002905	hydrophobic ligand binding site; other site
561275002906	Predicted glutamine amidotransferase [General function prediction only]; Region: COG0121
561275002907	Glutamine amidotransferases class-II (Gn-AT)_YafJ-type.  YafJ is a glutamine amidotransferase-like protein of unknown function found in prokaryotes, eukaryotes and archaea.  YafJ has a conserved structural fold similar to those of other class II...; Region: YafJ; cd01908
561275002908	putative active site [active]
561275002909	putative dimer interface [polypeptide binding]; other site
561275002910	Patatin-like phospholipase; Region: Patatin; pfam01734
561275002911	Predicted esterase of the alpha-beta hydrolase superfamily [General function prediction only]; Region: RssA; COG1752
561275002912	nucleophile elbow; other site
561275002913	hypothetical protein; Provisional; Region: PRK10279
561275002914	Bacterial patatin-like phospholipase domain containing protein 6; Region: Pat_NTE_like_bacteria; cd07228
561275002915	active site
561275002916	nucleophile elbow; other site
561275002917	Cysteine dioxygenase type I; Region: CDO_I; pfam05995
561275002918	Rhodanese Homology Domain (RHOD); an alpha beta fold domain found duplicated in the rhodanese protein. The cysteine containing enzymatically active version of the domain is also found in the Cdc25 class of protein phosphatases and a variety of proteins...; Region: RHOD; cl00125
561275002919	active site residue [active]
561275002920	PE family; Region: PE; pfam00934
561275002921	I-RD02, 717 bp. Region of difference I-RD02,inserted region in Mycobacterium bovis BCG Pasteur(position 1221856..1222572, 717bp), Mycobacterium bovis AF2122/97 (position 1191818..1192534, 717bp), and BCG Tokyo (position 1193517..1193910, 394bp)compared to Mycobacterium tuberculosis H37Rv (position:1191366..1191367). In-frame insertion in PE_PGRS20 gene(Rv1068c) in Mycobacterium bovis and Mycobacterium BCG Pasteur, and frame-shift insertion in Mycobacterium BCG Tokyo. As a result, the both gene of Mycobacterium bovis (2193bp) and Mycobacterium BCG Pasteur (2193bp) became longer than that of M. truberculosis (1392bp), and the gene of BCG Tokyo divided into two parts, 615bp.
561275002922	PE family; Region: PE; pfam00934
561275002923	Predicted membrane protein [Function unknown]; Region: COG4425
561275002924	Predicted membrane protein (DUF2319); Region: DUF2319; pfam10081
561275002925	enoyl-CoA hydratase; Provisional; Region: PRK05862
561275002926	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
561275002927	substrate binding site [chemical binding]; other site
561275002928	oxyanion hole (OAH) forming residues; other site
561275002929	trimer interface [polypeptide binding]; other site
561275002930	3-hydroxyisobutyryl-CoA hydrolase; Provisional; Region: PRK05617
561275002931	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
561275002932	substrate binding site [chemical binding]; other site
561275002933	oxyanion hole (OAH) forming residues; other site
561275002934	trimer interface [polypeptide binding]; other site
561275002935	2-enoyl-CoA Hydratase C-terminal region; Region: ECH_C; pfam13766
561275002936	Predicted membrane protein [Function unknown]; Region: COG4760
561275002937	Domain of unknown function (DUF4095); Region: DUF4095; pfam13338
561275002938	Superfamily of nucleases including Short Patch Repair (Vsr) Endonucleases, archaeal Holliday junction resolvases, MutH methy-directed DNA mismatch-repair endonucleases, and catalytic domains of many restriction endonucleases, such as EcoRI, BamHI, and...; Region: Restriction_endonuclease_like; cl00277
561275002939	acetyl-CoA acetyltransferase; Provisional; Region: PRK07851
561275002940	Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751
561275002941	dimer interface [polypeptide binding]; other site
561275002942	active site
561275002943	SGNH_hydrolase subfamily, FeeA, FeeB and similar esterases/lipases. FeeA and FeeB are part of a biosynthetic gene cluster and may participate in the biosynthesis of long-chain N-acyltyrosines by providing saturated and unsaturated fatty acids, which it...; Region: FeeA_FeeB_like; cd01836
561275002944	active site
561275002945	catalytic triad [active]
561275002946	oxyanion hole [active]
561275002947	Esterase/lipase [Lipid metabolism]; Region: Aes; COG0657
561275002948	Protein of unknown function (DUF2424); Region: DUF2424; pfam10340
561275002949	cystathionine beta-synthase; Region: cysta_beta; TIGR01137
561275002950	CBS_like: This subgroup includes Cystathionine beta-synthase (CBS) and Cysteine synthase. CBS is a unique heme-containing enzyme that catalyzes a pyridoxal 5'-phosphate (PLP)-dependent condensation of serine and homocysteine to give cystathionine; Region: CBS_like; cd01561
561275002951	dimer interface [polypeptide binding]; other site
561275002952	pyridoxal 5'-phosphate binding site [chemical binding]; other site
561275002953	catalytic residue [active]
561275002954	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains associated with the pyridoxal-phosphate (PALP) dependent enzyme domain upstream.   The vitamin B6 complex comprises pyridoxine, pyridoxal, and pyridoxamine, as well...; Region: CBS_pair_PALP_assoc2; cd04609
561275002955	RDD family; Region: RDD; pfam06271
561275002956	cystathionine gamma-synthase; Provisional; Region: PRK07811
561275002957	CGS_like: Cystathionine gamma-synthase is a PLP dependent enzyme and catalyzes the committed step of methionine biosynthesis. This pathway is unique to microorganisms and plants, rendering the enzyme an attractive target for the development of...; Region: CGS_like; cd00614
561275002958	homodimer interface [polypeptide binding]; other site
561275002959	substrate-cofactor binding pocket; other site
561275002960	pyridoxal 5'-phosphate binding site [chemical binding]; other site
561275002961	catalytic residue [active]
561275002962	transcription elongation factor GreA; Reviewed; Region: greA; PRK00226
561275002963	Transcription elongation factor, N-terminal; Region: GreA_GreB_N; pfam03449
561275002964	Transcription elongation factor, GreA/GreB, C-term; Region: GreA_GreB; pfam01272
561275002965	Domain of unknown function (DUF4307); Region: DUF4307; pfam14155
561275002966	mycothiol conjugate amidase Mca; Region: mycothiol_Mca; TIGR03446
561275002967	Highly conserved protein containing a thioredoxin domain [Posttranslational modification, protein turnover, chaperones]; Region: COG1331
561275002968	TRX domain, SSP411 protein family; members of this family are highly conserved proteins present in eukaryotes, bacteria and archaea, about 600-800 amino acids in length, which contain a TRX domain with a redox active CXXC motif. The human/rat protein; Region: SSP411; cd02955
561275002969	catalytic residues [active]
561275002970	AGE domain; N-acyl-D-glucosamine 2-epimerase domain; Responsible for intermediate epimerization during biosynthesis of N-acetylneuraminic acid. Catalytic mechanism is believed to be via nucleotide elimination and readdition and is ATP modulated. AGE is...; Region: AGE; cl00183
561275002971	Predicted membrane protein, hemolysin III homolog [General function prediction only]; Region: COG1272
561275002972	channel protein, hemolysin III family; Region: hlyIII; TIGR01065
561275002973	Undecaprenyl pyrophosphate synthase [Lipid metabolism]; Region: UppS; COG0020
561275002974	Cis (Z)-Isoprenyl Diphosphate Synthases (cis-IPPS); homodimers which catalyze the successive 1'-4 condensation of the isopentenyl diphosphate (IPP) molecule to trans,trans-farnesyl diphosphate (FPP) or to cis,trans-FPP to form long-chain polyprenyl...; Region: CIS_IPPS; cd00475
561275002975	catalytic residue [active]
561275002976	putative FPP diphosphate  binding site; other site
561275002977	putative FPP binding hydrophobic cleft; other site
561275002978	dimer interface [polypeptide binding]; other site
561275002979	putative IPP diphosphate binding site; other site
561275002980	PE family; Region: PE; pfam00934
561275002981	Undecaprenyl pyrophosphate synthase [Lipid metabolism]; Region: UppS; COG0020
561275002982	Cis (Z)-Isoprenyl Diphosphate Synthases (cis-IPPS); homodimers which catalyze the successive 1'-4 condensation of the isopentenyl diphosphate (IPP) molecule to trans,trans-farnesyl diphosphate (FPP) or to cis,trans-FPP to form long-chain polyprenyl...; Region: CIS_IPPS; cl00230
561275002983	putative IPP diphosphate binding site; other site
561275002984	PE family; Region: PE; pfam00934
561275002985	Glycosyl hydrolase family 12; Region: Glyco_hydro_12; pfam01670
561275002986	PE family; Region: PE; pfam00934
561275002987	pantothenate kinase; Provisional; Region: PRK05439
561275002988	Pantothenate kinase (PanK) catalyzes the phosphorylation of pantothenic acid to form 4'-phosphopantothenic, which is the first of five steps in coenzyme A (CoA) biosynthetic pathway. The reaction carried out by this enzyme is a key regulatory point...; Region: PanK; cd02025
561275002989	ATP-binding site [chemical binding]; other site
561275002990	CoA-binding site [chemical binding]; other site
561275002991	Mg2+-binding site [ion binding]; other site
561275002992	serine hydroxymethyltransferase; Reviewed; Region: glyA; PRK00011
561275002993	Serine-glycine hydroxymethyltransferase (SHMT). This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). SHMT carries out interconversion of serine and glycine; it catalyzes the transfer of hydroxymethyl...; Region: SHMT; cd00378
561275002994	dimer interface [polypeptide binding]; other site
561275002995	active site
561275002996	glycine-pyridoxal phosphate binding site [chemical binding]; other site
561275002997	folate binding site [chemical binding]; other site
561275002998	Ferritin-like superfamily of diiron-containing four-helix-bundle proteins; Region: Ferritin_like; cl00264
561275002999	dinuclear metal binding motif [ion binding]; other site
561275003000	NYN ribonuclease and ATPase of PhoH family domains [General    function prediction only]; Region: COG1875
561275003001	PIN domain of bacterial Smg6-like homologs with PhoH-like ATPase domains; Region: PIN_PhoHL-ATPase; cd09883
561275003002	putative active site [active]
561275003003	PhoH-like protein; Region: PhoH; pfam02562
561275003004	Predicted xylanase/chitin deacetylase [Carbohydrate transport and metabolism]; Region: CDA1; COG0726
561275003005	Catalytic NodB homology domain of rhizobial NodB-like proteins; Region: CE4_NodB_like_6s_7s; cd10917
561275003006	NodB motif; other site
561275003007	active site
561275003008	catalytic site [active]
561275003009	metal binding site [ion binding]; metal-binding site
561275003010	fumarate hydratase; Reviewed; Region: fumC; PRK00485
561275003011	Class II fumarases; Region: Fumarase_classII; cd01362
561275003012	active site
561275003013	tetramer interface [polypeptide binding]; other site
561275003014	Bacterial fructose-1,6-bisphosphatase, glpX-encoded; Region: FBPase_glpX; pfam03320
561275003015	Bacterial fructose-1,6-bisphosphatase, glpX-encoded. A dimeric enzyme dependent on Mg(2+). glpX-encoded FPBase (FBPase class II) differs from other members of the inositol-phosphatase superfamily by permutation of secondary structure elements. The core...; Region: FBPase_glpX; cd01516
561275003016	putative active site [active]
561275003017	Protein of unknown function (DUF4245); Region: DUF4245; pfam14030
561275003018	Predicted permease, member of the PurR regulon [General function prediction only]; Region: yhhT; COG0628
561275003019	Domain of unknown function DUF20; Region: UPF0118; pfam01594
561275003020	Growth inhibitor [Signal transduction mechanisms]; Region: MazF; COG2337
561275003021	Carboxylesterase type B [Lipid metabolism]; Region: PnbA; COG2272
561275003022	Esterases and lipases (includes fungal lipases, cholinesterases, etc.)  These enzymes act on carboxylic esters (EC: 3.1.1.-). The catalytic apparatus involves three residues (catalytic triad): a serine, a glutamate or aspartate and a histidine.These...; Region: Esterase_lipase; cd00312
561275003023	Esterases and lipases (includes fungal lipases, cholinesterases, etc.)  These enzymes act on carboxylic esters (EC: 3.1.1.-). The catalytic apparatus involves three residues (catalytic triad): a serine, a glutamate or aspartate and a histidine.These...; Region: Esterase_lipase; cd00312
561275003024	3beta-hydroxysteroid dehydrogenases (3b-HSD)-like, extended (e) SDRs; Region: 3b-HSD-like_SDR_e; cd05241
561275003025	3-beta hydroxysteroid dehydrogenase/isomerase family; Region: 3Beta_HSD; pfam01073
561275003026	putative NAD(P) binding site [chemical binding]; other site
561275003027	active site
561275003028	putative substrate binding site [chemical binding]; other site
561275003029	exodeoxyribonuclease VII, small subunit; Region: xseB; TIGR01280
561275003030	Exonuclease VII, large subunit [DNA replication, recombination, and repair]; Region: XseA; COG1570
561275003031	ExoVII_LU_OBF: A subfamily of OB folds corresponding to the N-terminal OB-fold domain of Escherichia coli exodeoxyribonuclease VII (ExoVII) large subunit. E. coli ExoVII is composed of two non-identical subunits. E. coli ExoVII is a...; Region: ExoVII_LU_OBF; cd04489
561275003032	generic binding surface II; other site
561275003033	generic binding surface I; other site
561275003034	4-Hydroxy-3-methylbut-2-enyl diphosphate reductase IspH [Lipid metabolism]; Region: lytB; COG0761
561275003035	4-hydroxy-3-methylbut-2-enyl diphosphate reductase; Reviewed; Region: ispH; PRK01045
561275003036	Yip1 domain; Region: Yip1; pfam04893
561275003037	GTP-binding protein YchF; Reviewed; Region: PRK09601
561275003038	YchF GTPase; Region: YchF; cd01900
561275003039	G1 box; other site
561275003040	GTP/Mg2+ binding site [chemical binding]; other site
561275003041	Switch I region; other site
561275003042	G2 box; other site
561275003043	Switch II region; other site
561275003044	G3 box; other site
561275003045	G4 box; other site
561275003046	G5 box; other site
561275003047	TGS_YchF_C: This subfamily represents TGS domain-containing YchF GTP-binding protein, a universally conserved GTPase whose function is unknown. The N-terminal domain of the YchF protein belongs to the Obg-like family of GTPases, and some members of the...; Region: TGS_YchF_C; cd04867
561275003048	Uncharacterized protein conserved in bacteria (DUF2191); Region: DUF2191; pfam09957
561275003049	Predicted nucleic acid-binding protein, contains PIN domain [General function prediction only]; Region: VapC; COG1487
561275003050	putative active site [active]
561275003051	Uncharacterized conserved protein [Function unknown]; Region: COG1359
561275003052	Adenylate cyclase, family 3 (some proteins contain HAMP domain) [Signal transduction mechanisms]; Region: CyaA; COG2114
561275003053	cyclase homology domain; Region: CHD; cd07302
561275003054	nucleotidyl binding site; other site
561275003055	metal binding site [ion binding]; metal-binding site
561275003056	dimer interface [polypeptide binding]; other site
561275003057	glucose-6-phosphate 1-dehydrogenase; Region: zwf; TIGR00871
561275003058	Glucose-6-phosphate dehydrogenase, NAD binding domain; Region: G6PD_N; pfam00479
561275003059	Glucose-6-phosphate dehydrogenase, C-terminal domain; Region: G6PD_C; pfam02781
561275003060	6-phosphogluconate dehydrogenase-like protein; Reviewed; Region: PRK09599
561275003061	6-phosphogluconate dehydrogenase (decarboxylating); Region: gnd_rel; TIGR00872
561275003062	Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697
561275003063	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
561275003064	Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007
561275003065	pyruvate phosphate dikinase; Provisional; Region: PRK05878
561275003066	Pyruvate phosphate dikinase, PEP/pyruvate binding domain; Region: PPDK_N; pfam01326
561275003067	PEP-utilising enzyme, mobile domain; Region: PEP-utilizers; cl17700
561275003068	Domain of unknown function (DUF222); Region: DUF222; pfam02720
561275003069	HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085
561275003070	active site
561275003071	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
561275003072	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
561275003073	non-specific DNA binding site [nucleotide binding]; other site
561275003074	salt bridge; other site
561275003075	sequence-specific DNA binding site [nucleotide binding]; other site
561275003076	Predicted transcriptional regulator [General function prediction only]; Region: COG3800
561275003077	Domain of unknown function (DUF955); Region: DUF955; pfam06114
561275003078	Predicted transcriptional regulator (DUF2083); Region: DUF2083; pfam09856
561275003079	Uncharacterized protein involved in propionate catabolism [General function prediction only]; Region: PrpD; COG2079
561275003080	citrate synthase; Provisional; Region: PRK14033
561275003081	Citrate synthase (CS), citryl-CoA lyase (CCL), the C-terminal portion of the single-subunit type ATP-citrate lyase (ACL) and the C-terminal portion of the large subunit of the two-subunit type ACL. CS catalyzes the condensation of acetyl coenzyme A; Region: CS_ACL-C_CCL; cl00416
561275003082	oxalacetate binding site [chemical binding]; other site
561275003083	citrylCoA binding site [chemical binding]; other site
561275003084	coenzyme A binding site [chemical binding]; other site
561275003085	catalytic triad [active]
561275003086	Transmembrane protein of unknown function (DUF3556); Region: DUF3556; pfam12077
561275003087	5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase; Provisional; Region: PRK05222
561275003088	CIMS - Cobalamine-independent methonine synthase, or MetE, N-terminal domain_like. Many members have been characterized as 5-methyltetrahydropteroyltriglutamate-homocysteine methyltransferases, EC:2.1.1.14, mostly from bacteria and plants. This enzyme...; Region: CIMS_N_terminal_like; cd03312
561275003089	THF binding site; other site
561275003090	CIMS - Cobalamine-independent methonine synthase, or MetE, C-terminal domain_like. Many members have been characterized as 5-methyltetrahydropteroyltriglutamate-homocysteine methyltransferases, EC:2.1.1.14, mostly from bacteria and plants. This enzyme...; Region: CIMS_C_terminal_like; cd03311
561275003091	substrate binding site [chemical binding]; other site
561275003092	THF binding site; other site
561275003093	zinc-binding site [ion binding]; other site
561275003094	PPE family; Region: PPE; pfam00823
561275003095	Condensing enzymes; Family of enzymes that catalyze a (decarboxylating or non-decarboxylating) Claisen-like condensation reaction. Members are share strong structural similarity, and are involved in the synthesis and degradation of fatty acids, and the...; Region: cond_enzymes; cl09938
561275003096	active site
561275003097	Enoyl-CoA hydratase/carnithine racemase [Lipid metabolism]; Region: CaiD; COG1024
561275003098	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
561275003099	substrate binding site [chemical binding]; other site
561275003100	oxyanion hole (OAH) forming residues; other site
561275003101	Dehydrogenases (flavoproteins) [Energy production and conversion]; Region: FixC; COG0644
561275003102	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG1755
561275003103	CAAX protease self-immunity; Region: Abi; pfam02517
561275003104	enoyl-CoA hydratase; Provisional; Region: PRK06688
561275003105	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cl15762
561275003106	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
561275003107	trimer interface [polypeptide binding]; other site
561275003108	enoyl-CoA hydratase; Provisional; Region: PRK06688
561275003109	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
561275003110	substrate binding site [chemical binding]; other site
561275003111	oxyanion hole (OAH) forming residues; other site
561275003112	trimer interface [polypeptide binding]; other site
561275003113	Predicted acyl-CoA transferases/carnitine dehydratase [Energy production and conversion]; Region: CaiB; COG1804
561275003114	CoA-transferase family III; Region: CoA_transf_3; pfam02515
561275003115	17hydroxysteroid dehydrogenase type 10 (HSD10)-like, classical (c) SDRs; Region: HSD10-like_SDR_c; cd05371
561275003116	NAD binding site [chemical binding]; other site
561275003117	homodimer interface [polypeptide binding]; other site
561275003118	homotetramer interface [polypeptide binding]; other site
561275003119	active site
561275003120	MMPL family; Region: MMPL; pfam03176
561275003121	MMPL family; Region: MMPL; pfam03176
561275003122	Domain of unknown function (DUF222); Region: DUF222; pfam02720
561275003123	HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085
561275003124	active site
561275003125	Putative transposase of IS4/5 family (DUF4096); Region: DUF4096; pfam13340
561275003127	NAD-dependent deacetylase; Provisional; Region: PRK00481
561275003128	SIRT5_Af1_CobB: Eukaryotic, archaeal and prokaryotic group (class3) which includes human sirtuin SIRT5, Archaeoglobus fulgidus Sir2-Af1, and E. coli CobB; and are members of the SIR2 family of proteins, silent information regulator 2 (Sir2) enzymes which...; Region: SIRT5_Af1_CobB; cd01412
561275003129	NAD+ binding site [chemical binding]; other site
561275003130	substrate binding site [chemical binding]; other site
561275003131	Zn binding site [ion binding]; other site
561275003132	Predicted transcriptional regulators [Transcription]; Region: COG1725
561275003133	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
561275003134	DNA-binding site [nucleotide binding]; DNA binding site
561275003135	O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315
561275003136	Leucine carboxyl methyltransferase; Region: LCM; pfam04072
561275003137	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3797
561275003138	PPOX class probable F420-dependent enzyme; Region: Rv1155_F420; TIGR03618
561275003139	uncharacterized HhH-GPD family protein; Region: TIGR03252
561275003140	minor groove reading motif; other site
561275003141	helix-hairpin-helix signature motif; other site
561275003142	mannosyltransferase; Provisional; Region: pimE; PRK13375
561275003143	PCD_DCoH: The bifunctional protein pterin-4alpha-carbinolamine dehydratase (PCD), also known as DCoH  (dimerization cofactor of hepatocyte nuclear factor-1), is both a transcription activator and a metabolic enzyme.  DCoH stimulates gene expression by...; Region: PCD_DCoH; cd00488
561275003144	aromatic arch; other site
561275003145	DCoH dimer interaction site [polypeptide binding]; other site
561275003146	DCoH /HNF-1 dimer interaction site [polypeptide binding]; other site
561275003147	DCoH tetramer interaction site [polypeptide binding]; other site
561275003148	substrate binding site [chemical binding]; other site
561275003149	The MutT pyrophosphohydrolase is a prototypical Nudix hydrolase that catalyzes the hydrolysis of nucleoside and deoxynucleoside triphosphates (NTPs and dNTPs) by substitution at a beta-phosphorus to yield a nucleotide monophosphate (NMP) and inorganic...; Region: MutT_pyrophosphohydrolase; cd03425
561275003150	active site
561275003151	8-oxo-dGMP binding site [chemical binding]; other site
561275003152	nudix motif; other site
561275003153	metal binding site [ion binding]; metal-binding site
561275003154	Nitrate reductase alpha subunit [Energy production and conversion]; Region: NarG; COG5013
561275003155	Respiratory nitrate reductase A (NarGHI), alpha chain (NarG) and related proteins. Under anaerobic conditions in the presence of nitrate, E. coli synthesizes the cytoplasmic membrane-bound quinol-nitrate oxidoreductase (NarGHI), which reduces nitrate to...; Region: MopB_Nitrate-R-NarG-like; cd02750
561275003156	[4Fe-4S] binding site [ion binding]; other site
561275003157	Molybdopterin-Binding (MopB) domain of the MopB superfamily of proteins, a  large, diverse, heterogeneous superfamily of enzymes that, in general, bind molybdopterin as a cofactor. The MopB domain is found in a wide variety of molybdenum- and...; Region: Molybdopterin-Binding; cl09928
561275003158	Molybdopterin-Binding (MopB) domain of the MopB superfamily of proteins, a  large, diverse, heterogeneous superfamily of enzymes that, in general, bind molybdopterin as a cofactor. The MopB domain is found in a wide variety of molybdenum- and...; Region: Molybdopterin-Binding; cl09928
561275003159	Molybdopterin-Binding (MopB) domain of the MopB superfamily of proteins, a  large, diverse, heterogeneous superfamily of enzymes that, in general, bind molybdopterin as a cofactor. The MopB domain is found in a wide variety of molybdenum- and...; Region: Molybdopterin-Binding; cl09928
561275003160	Respiratory nitrate reductase A (NarGHI), alpha chain (NarG) and related proteins. Under anaerobic conditions in the presence of nitrate, E. coli synthesizes the cytoplasmic membrane-bound quinol-nitrate oxidoreductase (NarGHI), which reduces nitrate to...; Region: MopB_CT_Nitrate-R-NarG-like; cd02776
561275003161	molybdopterin cofactor binding site; other site
561275003162	Nitrate reductase beta subunit [Energy production and conversion]; Region: NarY; COG1140
561275003163	nitrate reductase molybdenum cofactor assembly chaperone; Region: narJ; TIGR00684
561275003164	Nitrate reductase gamma subunit; Region: Nitrate_red_gam; pfam02665
561275003165	Predicted membrane GTPase involved in stress response [Signal transduction mechanisms]; Region: TypA; COG1217
561275003166	Tyrosine phosphorylated protein A (TypA)/BipA family belongs to ribosome-binding GTPases; Region: TypA_BipA; cd01891
561275003167	G1 box; other site
561275003168	putative GEF interaction site [polypeptide binding]; other site
561275003169	GTP/Mg2+ binding site [chemical binding]; other site
561275003170	Switch I region; other site
561275003171	G2 box; other site
561275003172	G3 box; other site
561275003173	Switch II region; other site
561275003174	G4 box; other site
561275003175	G5 box; other site
561275003176	BipA_TypA_II: domain II of BipA (also called TypA) having homology to domain II of the elongation factors (EFs) EF-G and EF-Tu.  BipA is a highly conserved protein with global regulatory properties in Escherichia coli. BipA is phosphorylated on a...; Region: BipA_TypA_II; cd03691
561275003177	BipA_TypA_C: a C-terminal portion of BipA or TypA having homology to the C terminal domains of the elongation factors EF-G and EF-2. A member of the ribosome binding GTPase superfamily, BipA is widely distributed in bacteria and plants.  BipA is a highly...; Region: BipA_TypA_C; cd03710
561275003178	ABC-type dipeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: DdpA; COG0747
561275003179	The substrate-binding domain of mycobacterial lipoprotein Lpqw contains type 2 periplasmic binding fold; Region: PBP2_Lpqw; cd08501
561275003180	The substrate-binding domain of an ABC-type nickel/oligopeptide-like import system contains the type 2 periplasmic binding fold; Region: PBP2_NikA_DppA_OppA_like; cl01709
561275003181	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275003182	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275003184	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275003185	PPE family; Region: PPE; pfam00823
561275003186	PE family; Region: PE; pfam00934
561275003187	N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D- glucopyranoside deacetylase; Region: mycothiol_MshB; TIGR03445
561275003188	PE family; Region: PE; pfam00934
561275003189	FO synthase; Reviewed; Region: fbiC; PRK09234
561275003190	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
561275003191	FeS/SAM binding site; other site
561275003192	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
561275003193	FeS/SAM binding site; other site
561275003194	NADH:flavin oxidoreductases, Old Yellow Enzyme family [Energy production and conversion]; Region: NemA; COG1902
561275003195	2,4-dienoyl-CoA reductase (DCR) FMN-binding domain. DCR in E. coli  is an iron-sulfur flavoenzyme which contains FMN, FAD, and a 4Fe-4S cluster. It is also a monomer, unlike that of its eukaryotic counterparts which form homotetramers and lack the...; Region: DCR_FMN; cd02930
561275003196	active site
561275003197	FMN binding site [chemical binding]; other site
561275003198	2,4-decadienoyl-CoA binding site; other site
561275003199	catalytic residue [active]
561275003200	4Fe-4S cluster binding site [ion binding]; other site
561275003201	Uncharacterized NAD(FAD)-dependent dehydrogenases [General function prediction only]; Region: HcaD; COG0446
561275003202	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
561275003203	Predicted transcriptional regulators [Transcription]; Region: COG1695
561275003204	Transcriptional regulator PadR-like family; Region: PadR; pfam03551
561275003205	Virulence activator alpha C-term; Region: Vir_act_alpha_C; pfam10400
561275003206	4Fe-4S dicluster domain; Region: Fer4_9; pfam13187
561275003207	4Fe-4S binding domain; Region: Fer4; pfam00037
561275003208	N-succinyldiaminopimelate aminotransferase; Reviewed; Region: PRK07865
561275003209	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
561275003210	pyridoxal 5'-phosphate binding site [chemical binding]; other site
561275003211	homodimer interface [polypeptide binding]; other site
561275003212	catalytic residue [active]
561275003213	DNA or RNA helicases of superfamily II [Transcription / DNA replication, recombination, and repair]; Region: SSL2; COG1061
561275003214	Type III restriction enzyme, res subunit; Region: ResIII; pfam04851
561275003215	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cl17251
561275003216	ATP binding site [chemical binding]; other site
561275003217	putative Mg++ binding site [ion binding]; other site
561275003218	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cl17351
561275003219	ATP-binding site [chemical binding]; other site
561275003220	Polyketide synthase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3321
561275003221	polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833
561275003222	active site
561275003223	Acyl transferase domain in polyketide synthase (PKS) enzymes; Region: PKS_AT; smart00827
561275003224	Dehydratase domain in polyketide synthase (PKS) enzymes; Region: PKS_DH; smart00826
561275003225	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
561275003226	enoyl reductase of polyketide synthase; Region: enoyl_red; cd05195
561275003227	Enoylreductase; Region: PKS_ER; smart00829
561275003228	NAD(P) binding site [chemical binding]; other site
561275003229	KR domain; Region: KR; pfam08659
561275003230	beta-ketoacyl reductase (KR) domain of fatty acid synthase (FAS), subgroup 2, complex (x); Region: KR_2_FAS_SDR_x; cd08955
561275003231	putative NADP binding site [chemical binding]; other site
561275003232	active site
561275003233	Phosphopantetheine attachment site; Region: PKS_PP; smart00823
561275003234	Non-ribosomal peptide synthetase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: EntF; COG1020
561275003235	Predicted drug exporters of the RND superfamily [General function prediction only]; Region: COG2409
561275003236	PE-PPE domain; Region: PE-PPE; pfam08237
561275003237	acyl-CoA synthetase; Validated; Region: PRK05850
561275003238	Fatty acyl-AMP ligase (FAAL); Region: FAAL; cd05931
561275003239	acyl-activating enzyme (AAE) consensus motif; other site
561275003240	active site
561275003241	Regulator of polyketide synthase expression [Signal transduction mechanisms / Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG2508
561275003242	PucR C-terminal helix-turn-helix domain; Region: HTH_30; pfam13556
561275003243	Delta(1)-pyrroline-5-carboxylate dehydrogenase, ALDH families 4 and 17; Region: ALDH_F4-17_P5CDH; cd07123
561275003244	delta-1-pyrroline-5-carboxylate dehydrogenase, group 1; Region: D1pyr5carbox1; TIGR01236
561275003245	Glutamate binding site [chemical binding]; other site
561275003246	NAD binding site [chemical binding]; other site
561275003247	catalytic residues [active]
561275003248	Proline dehydrogenase; Region: Pro_dh; pfam01619
561275003249	RNA polymerase sigma factor SigI; Provisional; Region: sigI; PRK09635
561275003250	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
561275003251	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
561275003252	DNA binding residues [nucleotide binding]
561275003253	In Mycobacterium tuberculosis strain H37Rv, Mycobacterium bovis AF2122/97 and Mycobacterium bovis BCG Tokyo, sigI (290 aa) and Rv1189/Mb1221 (304 aa) exist as two genes. In Mycobacterium bovis BCG Pasteur they have been fused in-frame following a 1548bp deletion (N-RD18) at position corresponding to H37Rv 1332921-1334468.
561275003254	haloalkane dehalogenase; Provisional; Region: PRK03204
561275003255	Novel bacterial esterase that cleaves esters on halogenated cyclic compounds; Region: Esterase_713_like; cl17303
561275003256	catalytic site [active]
561275003257	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
561275003258	Alpha/beta hydrolase of unknown function (DUF1057); Region: DUF1057; pfam06342
561275003259	Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697
561275003260	PGAP1-like protein; Region: PGAP1; pfam07819
561275003261	acyl-CoA synthetase; Validated; Region: PRK07787
561275003262	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
561275003263	acyl-activating enzyme (AAE) consensus motif; other site
561275003264	AMP binding site [chemical binding]; other site
561275003265	active site
561275003266	CoA binding site [chemical binding]; other site
561275003267	Regulator of polyketide synthase expression [Signal transduction mechanisms / Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG2508
561275003268	PucR C-terminal helix-turn-helix domain; Region: HTH_30; pfam13556
561275003269	PE family; Region: PE; pfam00934
561275003270	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275003271	PPE family; Region: PPE; pfam00823
561275003272	Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484
561275003273	WXG100 family type VII secretion target; Region: WXG100_ESAT6; TIGR03930
561275003274	Proteins of 100 residues with WXG; Region: WXG100; pfam06013
561275003275	Transposase, Mutator family; Region: Transposase_mut; pfam00872
561275003276	MULE transposase domain; Region: MULE; pfam10551
561275003277	metabolite-proton symporter; Region: 2A0106; TIGR00883
561275003278	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
561275003279	putative substrate translocation pore; other site
561275003280	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase; Region: DapD_actino; TIGR03535
561275003281	Putative 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate (THDP) N-succinyltransferase (THP succinyltransferase), C-terminal left-handed parallel alpha-helix (LbH) domain: This group is composed of mostly uncharacterized proteins containing an N-terminal...; Region: LbH_THP_succinylT_putative; cd04649
561275003282	putative trimer interface [polypeptide binding]; other site
561275003283	putative CoA binding site [chemical binding]; other site
561275003284	succinyl-diaminopimelate desuccinylase; Reviewed; Region: PRK13007
561275003285	M20 Peptidase actinobacterial DapE encoded N-succinyl-L,L-diaminopimelic acid desuccinylase; Region: M20_DapE_actinobac; cd05647
561275003286	metal binding site [ion binding]; metal-binding site
561275003287	putative dimer interface [polypeptide binding]; other site
561275003288	flagellar biosynthesis regulator FlhF; Validated; Region: flhF; PRK05703
561275003289	TIGR00730 family protein; Region: TIGR00730
561275003290	long-chain-acyl-CoA synthetase; Validated; Region: PRK08279
561275003291	Fatty acid transport proteins (FATP) play dual roles as fatty acid transporters and its activation enzymes; Region: FATP_FACS; cd05940
561275003292	acyl-activating enzyme (AAE) consensus motif; other site
561275003293	putative AMP binding site [chemical binding]; other site
561275003294	putative active site [active]
561275003295	putative CoA binding site [chemical binding]; other site
561275003296	DHPS subgroup of Pterin binding enzymes. DHPS (dihydropteroate synthase), a functional homodimer, catalyzes the condensation of p-aminobenzoic acid (pABA) in the de novo biosynthesis of folate, which is an essential cofactor in both nucleic acid and...; Region: DHPS; cd00739
561275003297	dihydropteroate synthase; Region: DHPS; TIGR01496
561275003298	substrate binding pocket [chemical binding]; other site
561275003299	dimer interface [polypeptide binding]; other site
561275003300	inhibitor binding site; inhibition site
561275003301	putative glucosyl-3-phosphoglycerate synthase; Provisional; Region: PRK13915
561275003302	Glycosyltransferases involved in cell wall biogenesis [Cell envelope biogenesis, outer membrane]; Region: WcaA; COG0463
561275003303	DivIVA domain; Region: DivI1A_domain; TIGR03544
561275003304	DNA-3-methyladenine glycosylase I; Region: tag; TIGR00624
561275003305	Protein of unknown function (DUF3117); Region: DUF3117; pfam11314
561275003306	glycogen synthase, Corynebacterium family; Region: glgA_Coryne; TIGR02149
561275003307	This family is most closely related to the GT1 family of glycosyltransferases and named after YqgM in Bacillus licheniformis about which little is known. Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to...; Region: GT1_YqgM_like; cd03801
561275003308	glucose-1-phosphate adenylyltransferase; Provisional; Region: glgC; PRK00844
561275003309	ADP-glucose pyrophosphorylase is involved in the biosynthesis of glycogen or starch; Region: ADP_Glucose_PP; cd02508
561275003310	ligand binding site; other site
561275003311	oligomer interface; other site
561275003312	Glucose-1-phosphate adenylyltransferase, C-terminal Left-handed parallel beta helix (LbH) domain: Glucose-1-phosphate adenylyltransferase is also known as ADP-glucose synthase or ADP-glucose pyrophosphorylase. It catalyzes the first committed and...; Region: LbH_G1P_AT_C; cd04651
561275003313	dimer interface [polypeptide binding]; other site
561275003314	N-terminal domain interface [polypeptide binding]; other site
561275003315	sulfate 1 binding site; other site
561275003316	PE family; Region: PE; pfam00934
561275003317	putative hydrolase, CocE/NonD family; Region: /NonD; TIGR00976
561275003318	Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326
561275003319	X-Pro dipeptidyl-peptidase C-terminal non-catalytic domain; Region: PepX_C; smart00939
561275003320	Putative protein-S-isoprenylcysteine methyltransferase [Posttranslational modification, protein turnover, chaperones]; Region: STE14; COG2020
561275003321	Putative exporter of polyketide antibiotics [Cell envelope biogenesis, outer membrane]; Region: TnrB3; COG3559
561275003322	ABC-type multidrug transport system, ATPase component [Defense mechanisms]; Region: CcmA; COG1131
561275003323	ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230
561275003324	Walker A/P-loop; other site
561275003325	ATP binding site [chemical binding]; other site
561275003326	Q-loop/lid; other site
561275003327	ABC transporter signature motif; other site
561275003328	Walker B; other site
561275003329	D-loop; other site
561275003330	H-loop/switch region; other site
561275003331	Domain of unknown function (DUF4162); Region: DUF4162; pfam13732
561275003332	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275003333	Predicted O-methyltransferase [General function prediction only]; Region: COG4122
561275003334	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275003335	S-adenosylmethionine binding site [chemical binding]; other site
561275003336	RNA polymerase sigma factor SigE; Reviewed; Region: PRK09647
561275003337	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
561275003338	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
561275003339	DNA binding residues [nucleotide binding]
561275003340	Trypsin-like serine proteases, typically periplasmic, contain C-terminal PDZ domain [Posttranslational modification, protein turnover, chaperones]; Region: DegQ; COG0265
561275003341	Trypsin-like peptidase domain; Region: Trypsin_2; pfam13365
561275003342	PDZ domain of tryspin-like serine proteases, such as DegP/HtrA, which are oligomeric proteins involved in heat-shock response, chaperone function, and apoptosis. May be responsible for substrate recognition and/or binding, as most PDZ domains bind...; Region: PDZ_serine_protease; cd00987
561275003343	protein binding site [polypeptide binding]; other site
561275003344	sec-independent translocase; Provisional; Region: PRK03100
561275003345	Predicted sugar phosphatases of the HAD superfamily [Carbohydrate transport and metabolism]; Region: NagD; COG0647
561275003346	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
561275003347	active site
561275003348	motif I; other site
561275003349	motif II; other site
561275003350	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
561275003351	Predicted membrane protein [Function unknown]; Region: COG3428
561275003352	Bacterial PH domain; Region: DUF304; pfam03703
561275003353	Uncharacterized conserved protein [Function unknown]; Region: COG3402
561275003354	Domain of unknown function DUF59; Region: DUF59; cl00941
561275003355	ATPases involved in chromosome partitioning [Cell division and chromosome partitioning]; Region: Mrp; COG0489
561275003356	MRP (Multiple Resistance and pH adaptation) is a homologue of the Fer4_NifH superfamily. Like the other members of the superfamily, MRP contains a ATP-binding domain at the N-termini. It is found in bacteria as a membrane-spanning protein and functions...; Region: MRP-like; cd02037
561275003357	Membrane-bound lytic murein transglycosylase B [Cell envelope biogenesis, outer membrane]; Region: MltB; COG2951
561275003358	Lytic Transglycosylase (LT)  and Goose Egg White Lysozyme (GEWL) domain. Members include the soluble and insoluble membrane-bound LTs in bacteria, the LTs in bacteriophage lambda, as well as, the eukaryotic "goose-type" lysozymes (GEWL).  LTs...; Region: LT_GEWL; cd00254
561275003359	N-acetyl-D-glucosamine binding site [chemical binding]; other site
561275003360	catalytic residue [active]
561275003361	Predicted membrane protein [Function unknown]; Region: COG4420
561275003362	Mg/Co/Ni transporter MgtE (contains CBS domain) [Inorganic ion transport and metabolism]; Region: MgtE; COG2239
561275003363	MgtE intracellular N domain; Region: MgtE_N; smart00924
561275003364	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domain in the magnesium transporter, MgtE.  MgtE and its homologs are found in eubacteria, archaebacteria, and eukaryota. Members of this family transport Mg2+ or other...; Region: CBS_pair_Mg_transporter; cd04606
561275003365	Domain of unknown function (DUF4190); Region: DUF4190; pfam13828
561275003366	ABC-type sugar transport system, periplasmic component [Carbohydrate transport and metabolism]; Region: UgpB; COG1653
561275003367	Bacterial extracellular solute-binding protein; Region: SBP_bac_1; pfam01547
561275003368	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
561275003369	dimer interface [polypeptide binding]; other site
561275003370	conserved gate region; other site
561275003371	putative PBP binding loops; other site
561275003372	ABC-ATPase subunit interface; other site
561275003373	ABC-type sugar transport system, permease component [Carbohydrate transport and metabolism]; Region: UgpE; COG0395
561275003374	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
561275003375	dimer interface [polypeptide binding]; other site
561275003376	conserved gate region; other site
561275003377	ABC-ATPase subunit interface; other site
561275003378	glycerol-3-phosphate transporter ATP-binding subunit; Provisional; Region: ugpC; PRK11650
561275003379	The N-terminal ATPase domain of the maltose transporter, MalK; Region: ABC_MalK_N; cd03301
561275003380	Walker A/P-loop; other site
561275003381	ATP binding site [chemical binding]; other site
561275003382	Q-loop/lid; other site
561275003383	ABC transporter signature motif; other site
561275003384	Walker B; other site
561275003385	D-loop; other site
561275003386	H-loop/switch region; other site
561275003387	Mg2+ and Co2+ transporters [Inorganic ion transport and metabolism]; Region: CorA; COG0598
561275003388	Mycobacterium tuberculosis CorA-like subfamily; Region: MtCorA-like; cd12830
561275003389	oligomer interface [polypeptide binding]; other site
561275003390	metal binding site [ion binding]; metal-binding site
561275003391	metal binding site [ion binding]; metal-binding site
561275003392	putative Cl binding site [ion binding]; other site
561275003393	basic sphincter; other site
561275003394	hydrophobic gate; other site
561275003395	periplasmic entrance; other site
561275003396	malate dehydrogenase; Provisional; Region: PRK05442
561275003397	Chloroplast-like malate dehydrogenases; Region: MDH_choloroplast_like; cd01338
561275003398	NAD(P) binding site [chemical binding]; other site
561275003399	dimer interface [polypeptide binding]; other site
561275003400	malate binding site [chemical binding]; other site
561275003401	Mycobacterium tuberculosis PIN domain family; Region: Mtu_PIN_fam; TIGR00028
561275003402	PE family; Region: PE; pfam00934
561275003403	Substrate binding domain of ABC-type glycine betaine transport system; Region: OpuAC; pfam04069
561275003404	Short-chain alcohol dehydrogenase of unknown specificity [General function prediction only]; Region: COG4221
561275003405	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
561275003406	NAD(P) binding site [chemical binding]; other site
561275003407	active site
561275003408	Cytotoxic translational repressor of toxin-antitoxin stability system [Translation, ribosomal structure and biogenesis / Cell division and chromosome partitioning]; Region: RelE; COG2026
561275003409	Antitoxin of toxin-antitoxin stability system [Cell division and chromosome partitioning]; Region: StbD; COG2161
561275003410	alpha-ketoglutarate decarboxylase; Reviewed; Region: kgd; PRK12270
561275003411	2-oxoacid dehydrogenases acyltransferase (catalytic domain); Region: 2-oxoacid_dh; pfam00198
561275003412	Thiamine pyrophosphate (TPP) family, E1 of OGDC-like subfamily, TPP-binding module; composed of proteins similar to the E1 component of the 2-oxoglutarate dehydrogenase multienzyme complex (OGDC). OGDC catalyzes the oxidative decarboxylation of...; Region: TPP_E1_OGDC_like; cd02016
561275003413	TPP-binding site [chemical binding]; other site
561275003414	Transketolase, pyrimidine binding domain; Region: Transket_pyr; pfam02779
561275003415	dimer interface [polypeptide binding]; other site
561275003416	PYR/PP interface [polypeptide binding]; other site
561275003417	TPP binding site [chemical binding]; other site
561275003418	drug resistance transporter, EmrB/QacA subfamily; Region: efflux_EmrB; TIGR00711
561275003419	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
561275003420	putative substrate translocation pore; other site
561275003421	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
561275003422	Predicted nuclease (RecB family) [General function prediction only]; Region: COG2251
561275003423	RNase_H superfamily; Region: RNase_H_2; pfam13482
561275003424	Superfamily I DNA and RNA helicases and helicase subunits [DNA replication, recombination, and repair]; Region: COG1112
561275003425	Part of AAA domain; Region: AAA_19; pfam13245
561275003426	AAA domain; Region: AAA_12; pfam13087
561275003427	LppP/LprE lipoprotein; Region: Lipoprotein_21; pfam14041
561275003428	Superfamily II DNA and RNA helicases [DNA replication, recombination, and repair / Transcription / Translation, ribosomal structure and biogenesis]; Region: SrmB; COG0513
561275003429	DEAD-box helicases. A diverse family of proteins involved in ATP-dependent RNA unwinding, needed in a variety of cellular processes including splicing, ribosome biogenesis and RNA degradation. The name derives from the sequence of the Walker  B motif; Region: DEADc; cd00268
561275003430	ATP binding site [chemical binding]; other site
561275003431	Mg++ binding site [ion binding]; other site
561275003432	motif III; other site
561275003433	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
561275003434	nucleotide binding region [chemical binding]; other site
561275003435	ATP-binding site [chemical binding]; other site
561275003436	RNA recognition motif in Escherichia coli cold-shock DEAD box protein A (CsdA) and similar proteins; Region: RRM_EcCsdA_like; cd12499
561275003437	putative RNA binding site [nucleotide binding]; other site
561275003438	Acyltransferase family; Region: Acyl_transf_3; pfam01757
561275003439	RD13, 3007 bp. Region of difference RD13, deleted region in Mycobacterium bovis BCG Pasteur (position 1432652..1432653), BCG Tokyo (position 1405537..1405538), and Mycobacterium bovis AF2122/97 (position 1404174..1404175) compared to Mycobacterium tuberculosis H37Rv (position: 1402931..1405937). Removes gene Rv1256c and merges truncated genes Rv1257c and Rv1255c
561275003440	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
561275003441	H+ Antiporter protein; Region: 2A0121; TIGR00900
561275003442	putative substrate translocation pore; other site
561275003443	Family-5 Uracil-DNA glycosylases (UDG), found in thermophilic organisms; Region: UDG_F5_TTUDGB_like; cd10031
561275003444	Fe-S cluster binding site [ion binding]; other site
561275003445	DNA binding site [nucleotide binding]
561275003446	active site
561275003447	hypothetical protein; Provisional; Region: PRK07236
561275003448	ubiquinone biosynthesis hydroxylase family protein; Provisional; Region: PRK07608; cl17314
561275003449	Domain of unknown function (DUF385); Region: DUF385; pfam04075
561275003450	HINT (histidine triad nucleotide-binding protein) subgroup: Members of this CD belong to the superfamily of histidine triad hydrolases that act on alpha-phosphate of ribonucleotides. This subgroup includes members from all three forms of cellular life; Region: HINT_subgroup; cd01277
561275003451	HIT family signature motif; other site
561275003452	catalytic residue [active]
561275003453	amidase; Provisional; Region: PRK12470
561275003454	Amidase; Region: Amidase; pfam01425
561275003455	Adenylate cyclase, family 3 (some proteins contain HAMP domain) [Signal transduction mechanisms]; Region: CyaA; COG2114
561275003456	cyclase homology domain; Region: CHD; cd07302
561275003457	nucleotidyl binding site; other site
561275003458	metal binding site [ion binding]; metal-binding site
561275003459	dimer interface [polypeptide binding]; other site
561275003460	Serine/Threonine protein kinases, catalytic domain; Region: S_TKc; smart00220
561275003461	Catalytic domain of Protein Kinases; Region: PKc; cd00180
561275003462	active site
561275003463	ATP binding site [chemical binding]; other site
561275003464	substrate binding site [chemical binding]; other site
561275003465	activation loop (A-loop); other site
561275003466	PknH-like extracellular domain; Region: PknH_C; pfam14032
561275003467	DNA-binding transcriptional activator of the SARP family [Signal transduction mechanisms]; Region: DnrI; COG3629
561275003468	Transcriptional regulatory protein, C terminal; Region: Trans_reg_C; pfam00486
561275003469	DNA binding site [nucleotide binding]
561275003470	Forkhead associated domain (FHA); found in eukaryotic and prokaryotic proteins. Putative nuclear signalling domain. FHA domains may bind phosphothreonine, phosphoserine and sometimes phosphotyrosine. In eukaryotes, many FHA domain-containing proteins...; Region: FHA; cd00060
561275003471	FOG: FHA domain [Signal transduction mechanisms]; Region: COG1716
561275003472	phosphopeptide binding site; other site
561275003473	Peptidase family C39 mostly contains bacteriocin-processing endopeptidases from bacteria. The cysteine peptidases in family C39 cleave the "double-glycine" leader peptides from the precursors of various bacteriocins (mostly non-lantibiotic); Region: Peptidase_C39_like; cl00296
561275003474	putative active site [active]
561275003475	Domain of unknown function (DUF4189); Region: DUF4189; pfam13827
561275003476	Protein of unknown function (DUF1396); Region: DUF1396; pfam07161
561275003477	Protein of unknown function (DUF732); Region: DUF732; pfam05305
561275003478	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
561275003479	ATP-binding cassette domain of glucan transporter and related proteins, subfamily C; Region: ABCC_Glucan_exporter_like; cd03254
561275003480	ABC-type cobalt transport system, ATPase component [Inorganic ion transport and metabolism]; Region: CbiO; COG1122
561275003481	Walker A/P-loop; other site
561275003482	ATP binding site [chemical binding]; other site
561275003483	Q-loop/lid; other site
561275003484	ABC transporter signature motif; other site
561275003485	Walker B; other site
561275003486	D-loop; other site
561275003487	H-loop/switch region; other site
561275003488	ABC-type multidrug transport system, ATPase and permease components [Defense mechanisms]; Region: MdlB; COG1132
561275003489	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
561275003490	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
561275003491	Walker A/P-loop; other site
561275003492	ATP binding site [chemical binding]; other site
561275003493	Q-loop/lid; other site
561275003494	ABC transporter signature motif; other site
561275003495	Walker B; other site
561275003496	D-loop; other site
561275003497	H-loop/switch region; other site
561275003498	Protein of unknown function (DUF3558); Region: DUF3558; pfam12079
561275003499	Protein of unknown function (DUF3558); Region: DUF3558; pfam12079
561275003500	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
561275003501	catalytic core [active]
561275003502	DNA repair exonuclease [DNA replication, recombination, and repair]; Region: SbcD; COG0420
561275003503	Mre11 nuclease, N-terminal metallophosphatase domain; Region: MPP_Mre11_N; cd00840
561275003504	active site
561275003505	metal binding site [ion binding]; metal-binding site
561275003506	DNA binding site [nucleotide binding]
561275003507	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
561275003508	Walker A/P-loop; other site
561275003509	ATP binding site [chemical binding]; other site
561275003510	choline dehydrogenase; Validated; Region: PRK02106
561275003511	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
561275003512	GMC oxidoreductase; Region: GMC_oxred_C; pfam05199
561275003513	ABC-type dipeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: DdpA; COG0747
561275003514	The substrate-binding domain of mycobacterial lipoprotein Lpqw contains type 2 periplasmic binding fold; Region: PBP2_Lpqw; cd08501
561275003515	glutathione transporter ATP-binding protein; Provisional; Region: PRK10261
561275003516	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
561275003517	Walker A/P-loop; other site
561275003518	ATP binding site [chemical binding]; other site
561275003519	Q-loop/lid; other site
561275003520	ABC transporter signature motif; other site
561275003521	Walker B; other site
561275003522	D-loop; other site
561275003523	H-loop/switch region; other site
561275003524	Oligopeptide/dipeptide transporter, C-terminal region; Region: oligo_HPY; cl07097
561275003525	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
561275003526	Walker A/P-loop; other site
561275003527	ATP binding site [chemical binding]; other site
561275003528	Q-loop/lid; other site
561275003529	ABC transporter signature motif; other site
561275003530	Walker B; other site
561275003531	D-loop; other site
561275003532	H-loop/switch region; other site
561275003533	Oligopeptide/dipeptide transporter, C-terminal region; Region: oligo_HPY; pfam08352
561275003534	ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppC; COG1173
561275003535	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
561275003536	dimer interface [polypeptide binding]; other site
561275003537	conserved gate region; other site
561275003538	putative PBP binding loops; other site
561275003539	ABC-ATPase subunit interface; other site
561275003540	oligopeptide transporter permease; Reviewed; Region: oppB; PRK09471
561275003541	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
561275003542	dimer interface [polypeptide binding]; other site
561275003543	conserved gate region; other site
561275003544	putative PBP binding loops; other site
561275003545	ABC-ATPase subunit interface; other site
561275003546	Carbonic anhydrases (CA) are zinc-containing enzymes that catalyze the reversible hydration of carbon dioxide in a two-step mechanism in which the nucleophilic attack of a zinc-bound hydroxide ion on carbon dioxide is followed by the regeneration of an...; Region: beta_CA_cladeD; cd03379
561275003547	active site clefts [active]
561275003548	zinc binding site [ion binding]; other site
561275003549	dimer interface [polypeptide binding]; other site
561275003550	sulfate adenylyltransferase, small subunit; Region: CysD; TIGR02039
561275003551	This domain is found in phosphoadenosine phosphosulphate (PAPS) reductase enzymes or PAPS sulphotransferase. PAPS reductase is part of the adenine nucleotide alpha hydrolases superfamily also including N type ATP PPases and ATP sulphurylases. A highly...; Region: PAPS_reductase; cd01713
561275003552	Active Sites [active]
561275003553	bifunctional sulfate adenylyltransferase subunit 1/adenylylsulfate kinase protein; Provisional; Region: PRK05506
561275003554	CysN, together with protein CysD, forms the ATP sulfurylase (ATPS) complex; Region: CysN_ATPS; cd04166
561275003555	CysD dimerization site [polypeptide binding]; other site
561275003556	G1 box; other site
561275003557	putative GEF interaction site [polypeptide binding]; other site
561275003558	GTP/Mg2+ binding site [chemical binding]; other site
561275003559	Switch I region; other site
561275003560	G2 box; other site
561275003561	G3 box; other site
561275003562	Switch II region; other site
561275003563	G4 box; other site
561275003564	G5 box; other site
561275003565	CysN_NodQ_II: This subfamily represents the domain II of the large subunit of ATP sulfurylase (ATPS): CysN or the N-terminal portion of NodQ, found mainly in proteobacteria and homologous to the domain II of EF-Tu. Escherichia coli ATPS consists of CysN...; Region: CysN_NodQ_II; cd03695
561275003566	TCysN_NoDQ_II: This subfamily represents the domain II of the large subunit of ATP sulfurylase (ATPS): CysN or the N-terminal portion of NodQ, found mainly in proteobacteria and homologous to the domain II of EF-Tu. Escherichia coli ATPS consists of CysN...; Region: CysN_NoDQ_III; cd04095
561275003567	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
561275003568	Adenosine 5'-phosphosulfate kinase (APSK) catalyzes the phosphorylation of adenosine 5'-phosphosulfate to form 3'-phosphoadenosine 5'-phosphosulfate (PAPS). The end-product PAPS is a biologically "activated" sulfate form...; Region: APSK; cd02027
561275003569	Walker A/P-loop; other site
561275003570	ligand-binding site [chemical binding]; other site
561275003571	ATP binding site [chemical binding]; other site
561275003572	Rrf2 family protein; Region: rrf2_super; TIGR00738
561275003573	Transcriptional regulator; Region: Rrf2; pfam02082
561275003574	Lysine Motif is a small domain involved in binding peptidoglycan; Region: LysM; cd00118
561275003575	Lysine Motif is a small domain involved in binding peptidoglycan; Region: LysM; cd00118
561275003576	Putative esterase; Region: Esterase; pfam00756
561275003577	Predicted hydrolase of the alpha/beta superfamily [General function prediction only]; Region: COG2819
561275003578	Predicted membrane protein [Function unknown]; Region: COG4325
561275003579	Predicted membrane protein (DUF2254); Region: DUF2254; pfam10011
561275003580	Protein of unknown function (DUF732); Region: DUF732; pfam05305
561275003581	arginyl-tRNA synthetase; Reviewed; Region: argS; PRK01611
561275003582	Arginyl tRNA synthetase N terminal dom; Region: Arg_tRNA_synt_N; smart01016
561275003583	catalytic core domain of arginyl-tRNA synthetases; Region: ArgRS_core; cd00671
561275003584	active site
561275003585	HIGH motif; other site
561275003586	KMSK motif region; other site
561275003587	Anticodon-binding domain of arginyl tRNA synthetases; Region: Anticodon_Ia_Arg; cd07956
561275003588	tRNA binding surface [nucleotide binding]; other site
561275003589	anticodon binding site; other site
561275003590	diaminopimelate decarboxylase; Region: lysA; TIGR01048
561275003591	Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzyme Diaminopimelate Decarboxylase; Region: PLPDE_III_DapDC; cd06828
561275003592	active site
561275003593	pyridoxal 5'-phosphate (PLP) binding site [chemical binding]; other site
561275003594	substrate binding site [chemical binding]; other site
561275003595	catalytic residues [active]
561275003596	dimer interface [polypeptide binding]; other site
561275003597	homoserine dehydrogenase; Provisional; Region: PRK06349
561275003598	Homoserine dehydrogenase, NAD binding domain; Region: NAD_binding_3; pfam03447
561275003599	Homoserine dehydrogenase; Region: Homoserine_dh; pfam00742
561275003600	ACT_HSDH_Hom CD includes the C-terminal ACT domain of the NAD(P)H-dependent, homoserine dehydrogenase (HSDH) and related domains; Region: ACT_HSDH-Hom; cd04881
561275003601	threonine synthase; Reviewed; Region: PRK06721
561275003602	Threonine synthase is a pyridoxal phosphate (PLP) dependent enzyme that catalyses the last reaction in the synthesis of  threonine from aspartate. It proceeds by converting O-phospho-L-homoserine (OPH) into threonine and inorganic phosphate. In plants; Region: Thr-synth_1; cd01563
561275003603	homodimer interface [polypeptide binding]; other site
561275003604	pyridoxal 5'-phosphate binding site [chemical binding]; other site
561275003605	catalytic residue [active]
561275003606	Homoserine kinase [Amino acid transport and metabolism]; Region: ThrB; COG0083
561275003607	transcription termination factor Rho; Provisional; Region: PRK12678
561275003608	Rho termination factor, N-terminal domain; Region: Rho_N; smart00959
561275003609	S1_like: Ribosomal protein S1-like RNA-binding domain. Found in a wide variety of RNA-associated proteins. Originally identified in S1 ribosomal protein. This superfamily also contains the Cold Shock Domain (CSD), which is a homolog of the S1 domain; Region: S1_like; cl09927
561275003610	RNA binding site [nucleotide binding]; other site
561275003611	Transcription termination factor rho is a bacterial ATP-dependent RNA/DNA helicase. It is a homohexamer. Each monomer consists of an N-terminal domain of the OB fold, which is responsible for binding to cysteine rich nucleotides. This alignment is of the...; Region: rho_factor; cd01128
561275003612	multimer interface [polypeptide binding]; other site
561275003613	Walker A motif; other site
561275003614	ATP binding site [chemical binding]; other site
561275003615	Walker B motif; other site
561275003616	50S ribosomal protein L31; Reviewed; Region: rpmE; PRK00019
561275003617	peptide chain release factor 1; Region: prfA; TIGR00019
561275003618	This domain is found in peptide chain release factors; Region: PCRF; smart00937
561275003619	RF-1 domain; Region: RF-1; pfam00472
561275003620	N5-glutamine S-adenosyl-L-methionine-dependent methyltransferase; Provisional; Region: PRK09328
561275003621	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275003622	S-adenosylmethionine binding site [chemical binding]; other site
561275003623	Putative translation factor (SUA5) [Translation, ribosomal structure and biogenesis]; Region: SUA5; COG0009
561275003624	UDP-N-acetylmuramyl pentapeptide phosphotransferase/UDP-N- acetylglucosamine-1-phosphate transferase [Cell envelope biogenesis, outer membrane]; Region: Rfe; COG0472
561275003625	This subfamily contains Escherichia coli WecA, Bacillus subtilis TagO and related proteins. WecA is an UDP-N-acetylglucosamine (GlcNAc):undecaprenyl-phosphate (Und-P) GlcNAc-1-phosphate transferase that catalyzes the formation of a phosphodiester bond...; Region: GT_WecA_like; cd06853
561275003626	Mg++ binding site [ion binding]; other site
561275003627	putative catalytic motif [active]
561275003628	substrate binding site [chemical binding]; other site
561275003629	F0F1-type ATP synthase, subunit a [Energy production and conversion]; Region: AtpB; COG0356
561275003630	F0F1 ATP synthase subunit A; Validated; Region: PRK05815
561275003631	F0F1 ATP synthase subunit C; Validated; Region: PRK05880
561275003632	F0F1 ATP synthase subunit B; Validated; Region: PRK05759
561275003633	F0F1-type ATP synthase, subunit b [Energy production and conversion]; Region: AtpF; COG0711
561275003634	F0F1 ATP synthase subunit delta; Provisional; Region: PRK13428
561275003635	F0F1 ATP synthase subunit B; Validated; Region: PRK05759
561275003636	F0F1 ATP synthase subunit delta; Provisional; Region: PRK13430
561275003637	F0F1 ATP synthase subunit alpha; Validated; Region: PRK09281
561275003638	ATP synthase alpha/beta family, beta-barrel domain; Region: ATP-synt_ab_N; pfam02874
561275003639	RecA-like NTPases. This family includes the NTP binding domain of F1 and V1 H+ATPases, DnaB and related helicases as well as bacterial RecA and related eukaryotic and archaeal recombinases. This group also includes bacterial conjugation proteins and...; Region: RecA-like_NTPases; cl17233
561275003640	Walker A motif; other site
561275003641	ATP binding site [chemical binding]; other site
561275003642	Walker B motif; other site
561275003643	ATP synthase alpha/beta chain, C terminal domain; Region: ATP-synt_ab_C; pfam00306
561275003644	mitochondrial ATP synthase gamma subunit; Region: F1-ATPase_gamma; cd12151
561275003645	core domain interface [polypeptide binding]; other site
561275003646	delta subunit interface [polypeptide binding]; other site
561275003647	epsilon subunit interface [polypeptide binding]; other site
561275003648	F0F1 ATP synthase subunit beta; Validated; Region: PRK09280
561275003649	ATP synthase alpha/beta family, beta-barrel domain; Region: ATP-synt_ab_N; pfam02874
561275003650	F1 ATP synthase beta subunit, nucleotide-binding domain. The F-ATPase is found in bacterial plasma membranes, mitochondrial inner membranes and in chloroplast thylakoid membranes. It has also been found in the archaea Methanosarcina barkeri. It uses a...; Region: F1-ATPase_beta; cd01133
561275003651	alpha subunit interaction interface [polypeptide binding]; other site
561275003652	Walker A motif; other site
561275003653	ATP binding site [chemical binding]; other site
561275003654	Walker B motif; other site
561275003655	inhibitor binding site; inhibition site
561275003656	ATP synthase alpha/beta chain, C terminal domain; Region: ATP-synt_ab_C; pfam00306
561275003657	F0F1 ATP synthase subunit epsilon; Validated; Region: atpC; PRK00571
561275003658	mitochondrial ATP synthase delta subunit; Region: F1-ATPase_delta; cd12152
561275003659	gamma subunit interface [polypeptide binding]; other site
561275003660	epsilon subunit interface [polypeptide binding]; other site
561275003661	LBP interface [polypeptide binding]; other site
561275003662	Protein of unknown function (DUF2550); Region: DUF2550; pfam10739
561275003663	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3464
561275003664	Transposase; Region: DDE_Tnp_ISL3; pfam01610
561275003665	cob(I)alamin adenosyltransferase [Coenzyme transport and    metabolism]; Region: COG2096
561275003666	UDP-N-acetylglucosamine 1-carboxyvinyltransferase; Region: murA; TIGR01072
561275003667	UDP-N-acetylglucosamine enolpyruvyl transferase catalyzes enolpyruvyl transfer as part of the first step in the biosynthesis of peptidoglycan, a component of the bacterial cell wall. The reaction is phosphoenolpyruvate + UDP-N-acetyl-D-glucosamine =...; Region: UdpNAET; cd01555
561275003668	hinge; other site
561275003669	active site
561275003670	methylated-DNA--protein-cysteine methyltransferase; Provisional; Region: PRK00901
561275003671	6-O-methylguanine DNA methyltransferase, ribonuclease-like domain; Region: Methyltransf_1N; pfam02870
561275003672	The DNA repair protein O6-alkylguanine-DNA alkyltransferase (ATase; also known as AGT, AGAT and MGMT) reverses O6-alkylation DNA damage by transferring O6-alkyl adducts to an active site cysteine irreversibly, without inducing DNA strand breaks. ATases...; Region: ATase; cd06445
561275003673	DNA binding site [nucleotide binding]
561275003674	active site
561275003675	Adenosine deaminase [Nucleotide transport and metabolism]; Region: Ada; COG2169
561275003676	Metal binding domain of Ada; Region: Ada_Zn_binding; pfam02805
561275003677	AlkA N-terminal domain; Region: AlkA_N; pfam06029
561275003678	3-methyladenine DNA glycosylase/8-oxoguanine DNA glycosylase [DNA replication, recombination, and repair]; Region: AlkA; COG0122
561275003679	endonuclease III; includes endonuclease III (DNA-(apurinic or apyrimidinic site) lyase), alkylbase DNA glycosidases (Alka-family) and other DNA glycosidases; Region: ENDO3c; cd00056
561275003680	minor groove reading motif; other site
561275003681	helix-hairpin-helix signature motif; other site
561275003682	substrate binding pocket [chemical binding]; other site
561275003683	active site
561275003684	HAMP domain; Region: HAMP; pfam00672
561275003685	Adenylate cyclase, family 3 (some proteins contain HAMP domain) [Signal transduction mechanisms]; Region: CyaA; COG2114
561275003686	cyclase homology domain; Region: CHD; cd07302
561275003687	nucleotidyl binding site; other site
561275003688	metal binding site [ion binding]; metal-binding site
561275003689	dimer interface [polypeptide binding]; other site
561275003690	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
561275003691	dimerization interface [polypeptide binding]; other site
561275003692	Adenylate cyclase, family 3 (some proteins contain HAMP domain) [Signal transduction mechanisms]; Region: CyaA; COG2114
561275003693	cyclase homology domain; Region: CHD; cd07302
561275003694	nucleotidyl binding site; other site
561275003695	metal binding site [ion binding]; metal-binding site
561275003696	dimer interface [polypeptide binding]; other site
561275003697	Methyl-accepting chemotaxis protein [Cell motility and secretion / Signal transduction mechanisms]; Region: Tar; COG0840
561275003698	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
561275003699	dimerization interface [polypeptide binding]; other site
561275003700	Adenylate cyclase, family 3 (some proteins contain HAMP domain) [Signal transduction mechanisms]; Region: CyaA; COG2114
561275003701	cyclase homology domain; Region: CHD; cd07302
561275003702	nucleotidyl binding site; other site
561275003703	metal binding site [ion binding]; metal-binding site
561275003704	dimer interface [polypeptide binding]; other site
561275003705	Predicted nuclease of the RecB family [DNA replication, recombination, and repair]; Region: COG1637
561275003706	hypothetical protein; Provisional; Region: PRK03298
561275003707	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
561275003708	Methylmalonyl-CoA epimerase (MMCE); Region: MMCE; cd07249
561275003709	dimer interface [polypeptide binding]; other site
561275003710	substrate binding site [chemical binding]; other site
561275003711	metal binding site [ion binding]; metal-binding site
561275003712	putative acyltransferase; Provisional; Region: PRK05790
561275003713	Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751
561275003714	dimer interface [polypeptide binding]; other site
561275003715	active site
561275003716	Thioredoxin domain-containing protein [Posttranslational modification, protein turnover, chaperones]; Region: COG3118
561275003717	ybbN protein family; ybbN is a hypothetical protein containing a redox-inactive TRX-like domain. Its gene has been sequenced from several gammaproteobacteria and actinobacteria; Region: ybbN; cd02956
561275003718	PE family; Region: PE; pfam00934
561275003719	glycogen branching enzyme; Provisional; Region: PRK05402
561275003720	N-terminal Early set domain associated with the catalytic domain of prokaryotic glycogen branching enzyme; Region: E_set_GBE_prok_N; cd02855
561275003721	Alpha amylase catalytic domain found in the Glycogen branching enzyme (also called 1,4-alpha-glucan branching enzyme); Region: AmyAc_Glg_BE; cd11322
561275003722	active site
561275003723	catalytic site [active]
561275003724	Alpha amylase, C-terminal all-beta domain; Region: Alpha-amylase_C; pfam02806
561275003725	Domain of unknown function (DUF3416); Region: DUF3416; pfam11896
561275003726	Alpha amylase catalytic domain found in GlgE-like proteins; Region: AmyAc_GlgE_like; cd11344
561275003727	Glycosidases [Carbohydrate transport and metabolism]; Region: AmyA; COG0366
561275003728	active site
561275003729	homodimer interface [polypeptide binding]; other site
561275003730	catalytic site [active]
561275003731	acceptor binding site [chemical binding]; other site
561275003732	This family is most closely related to the oligosaccharide phosphorylase domain family and other unidentified sequences. Oligosaccharide phosphorylase catalyzes the breakdown of oligosaccharides into glucose-1-phosphate units. They are important...; Region: GT1_Glycogen_Phosphorylase_like; cd04299
561275003733	putative homodimer interface [polypeptide binding]; other site
561275003734	putative active site pocket [active]
561275003735	alpha-glucan phosphorylases; Region: more_P_ylases; TIGR02094
561275003736	Rad3-related DNA helicases [Transcription / DNA replication, recombination, and repair]; Region: DinG; COG1199
561275003737	DEAD/DEAH box helicase; Region: DEAD; pfam00270
561275003738	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cl17251
561275003739	Helicase C-terminal domain; Region: Helicase_C_2; pfam13307
561275003740	nicotinate phosphoribosyltransferase; Validated; Region: PRK09243
561275003741	Nicotinate phosphoribosyltransferase (NAPRTase), subgroup A. Nicotinate phosphoribosyltransferase catalyses the formation of NAMN and PPi from 5-phosphoribosy -1-pyrophosphate (PRPP) and nicotinic acid, this is the first, and also rate limiting, reaction...; Region: NAPRTase_A; cd01570
561275003742	active site
561275003743	ATP-dependent Clp protease adaptor protein ClpS; Reviewed; Region: clpS; PRK00033
561275003744	Domain of unknown function (DUF2017); Region: DUF2017; pfam09438
561275003745	nylC-like family; composed of proteins with similarity to Flavobacterium endo-type 6-aminohexanoate-oligomer hydrolase (EIII), the product of the nylon oligomer degradation gene, nylC. EIII is an amide hydrolase that catalyzes the degradation of...; Region: nylC_like; cd02252
561275003746	nylC-like family; composed of proteins with similarity to Flavobacterium endo-type 6-aminohexanoate-oligomer hydrolase (EIII), the product of the nylon oligomer degradation gene, nylC. EIII is an amide hydrolase that catalyzes the degradation of...; Region: nylC_like; cd02252
561275003747	putative active site pocket [active]
561275003748	cleavage site
561275003749	Mpr1p, Pad1p N-terminal (MPN) domains with catalytic isopeptidase activity (metal-binding); Region: MPN_like; cd08070
561275003750	MPN+ (JAMM) motif; other site
561275003751	Zinc-binding site [ion binding]; other site
561275003752	Ubiquitin domain of MoaD-like proteins; Region: MoaD; cd00754
561275003753	MoaE interaction surface [polypeptide binding]; other site
561275003754	MoeB interaction surface [polypeptide binding]; other site
561275003755	thiocarboxylated glycine; other site
561275003756	Cysteine synthase [Amino acid transport and metabolism]; Region: CysK; COG0031
561275003757	CBS_like: This subgroup includes Cystathionine beta-synthase (CBS) and Cysteine synthase. CBS is a unique heme-containing enzyme that catalyzes a pyridoxal 5'-phosphate (PLP)-dependent condensation of serine and homocysteine to give cystathionine; Region: CBS_like; cd01561
561275003758	dimer interface [polypeptide binding]; other site
561275003759	pyridoxal 5'-phosphate binding site [chemical binding]; other site
561275003760	catalytic residue [active]
561275003761	Rhomboid family; Region: Rhomboid; pfam01694
561275003762	glutamate racemase; Provisional; Region: PRK00865
561275003763	Metal-dependent hydrolases of the beta-lactamase superfamily III [General function prediction only]; Region: ElaC; COG1234
561275003764	ribonuclease PH; Reviewed; Region: rph; PRK00173
561275003765	Ribonuclease PH; Region: RNase_PH_bact; cd11362
561275003766	hexamer interface [polypeptide binding]; other site
561275003767	active site
561275003768	NTPase/HAM1.  This family consists of the HAM1 protein and pyrophosphate-releasing xanthosine/ inosine triphosphatase. HAM1 protects the cell against mutagenesis by the base analog 6-N-hydroxylaminopurine (HAP) in E. Coli and S. cerevisiae. A...; Region: HAM1; cd00515
561275003769	active site
561275003770	dimerization interface [polypeptide binding]; other site
561275003771	Domain of unknown function (DUF3817); Region: DUF3817; pfam12823
561275003772	Glucitol operon activator [Transcription]; Region: GutM; COG4578
561275003773	acyl carrier protein; Validated; Region: PRK05883
561275003774	long-chain-fatty-acid--[acyl-carrier-protein] ligase; Validated; Region: PRK05851
561275003775	Fatty acyl-AMP ligase (FAAL); Region: FAAL; cd05931
561275003776	acyl-activating enzyme (AAE) consensus motif; other site
561275003777	active site
561275003778	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275003779	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
561275003780	active site
561275003781	Acetyltransferase (GNAT) domain; Region: Acetyltransf_8; pfam13523
561275003782	Siderophore biosynthesis protein domain; Region: AlcB; smart01006
561275003783	Siderophore-interacting protein [Inorganic ion transport and metabolism]; Region: ViuB; COG2375
561275003784	Siderophore interacting proteins share the domain structure of the ferredoxin reductase like family. Siderophores are produced in various bacteria (and some plants) to extract iron from hosts. Binding constants are high, so iron can be pilfered from...; Region: siderophore_interacting; cd06193
561275003785	FAD binding pocket [chemical binding]; other site
561275003786	FAD binding motif [chemical binding]; other site
561275003787	phosphate binding motif [ion binding]; other site
561275003788	NAD binding pocket [chemical binding]; other site
561275003789	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
561275003790	Predicted ATPase involved in cell division [Cell division and chromosome partitioning]; Region: FtsE; COG2884
561275003791	Walker A/P-loop; other site
561275003792	ATP binding site [chemical binding]; other site
561275003793	Q-loop/lid; other site
561275003794	ABC transporter signature motif; other site
561275003795	Walker B; other site
561275003796	D-loop; other site
561275003797	H-loop/switch region; other site
561275003798	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
561275003799	ABC-type antimicrobial peptide transport system, ATPase component [Defense mechanisms]; Region: SalX; COG1136
561275003800	Walker A/P-loop; other site
561275003801	ATP binding site [chemical binding]; other site
561275003802	Q-loop/lid; other site
561275003803	ABC transporter signature motif; other site
561275003804	Walker B; other site
561275003805	D-loop; other site
561275003806	H-loop/switch region; other site
561275003807	3-ketoacyl-(acyl-carrier-protein) reductase; Validated; Region: fabG; PRK05653
561275003808	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
561275003809	NAD(P) binding site [chemical binding]; other site
561275003810	active site
561275003811	tetracycline repressor protein TetR; Provisional; Region: PRK13756
561275003812	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275003813	Tetracyclin repressor, C-terminal all-alpha domain; Region: TetR_C; pfam02909
561275003814	FOG: GAF domain [Signal transduction mechanisms]; Region: FhlA; COG2203
561275003815	GAF domain; Region: GAF; pfam01590
561275003816	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
561275003817	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
561275003818	metal binding site [ion binding]; metal-binding site
561275003819	active site
561275003820	I-site; other site
561275003821	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
561275003822	hypothetical protein; Provisional; Region: PRK07877
561275003823	Superfamily of activating enzymes (E1) of the ubiquitin-like proteins. This family includes classical ubiquitin-activating enzymes E1, ubiquitin-like (ubl) activating enzymes and other mechanistic homologes, like MoeB, Thif1 and others. The common...; Region: E1_enzyme_family; cd01483
561275003824	ATP binding site [chemical binding]; other site
561275003825	substrate interface [chemical binding]; other site
561275003826	Proteins of this family catalyze the reduction of flavin or nitrocompounds using NAD(P)H as electron donor in a obligatory two-electron transfer,  utilizing FMN or FAD as cofactor. They are often found to be homodimers. Enzymes of this family are...; Region: Nitro_FMN_reductase; cl00514
561275003827	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
561275003828	Adenylate cyclase, family 3 (some proteins contain HAMP domain) [Signal transduction mechanisms]; Region: CyaA; COG2114
561275003829	cyclase homology domain; Region: CHD; cd07302
561275003830	nucleotidyl binding site; other site
561275003831	dimer interface [polypeptide binding]; other site
561275003832	metal binding site [ion binding]; metal-binding site
561275003833	AAA ATPase domain; Region: AAA_16; pfam13191
561275003834	Predicted ATPase [General function prediction only]; Region: COG3903
561275003835	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
561275003836	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
561275003837	DNA binding residues [nucleotide binding]
561275003838	dimerization interface [polypeptide binding]; other site
561275003839	Adenylate cyclase, family 3 (some proteins contain HAMP domain) [Signal transduction mechanisms]; Region: CyaA; COG2114
561275003840	cyclase homology domain; Region: CHD; cd07302
561275003841	probable F420-dependent oxidoreductase, Rv3093c family; Region: F420_Rv3093c; TIGR03841
561275003842	N5,N10-methylenetetrahydromethanopterin reductase (Mer) catalyzes the reduction of N5,N10-methylenetetrahydromethanopterin with reduced coenzyme F420 to N5-methyltetrahydromethanopterin and oxidized coenzyme F420; Region: Tetrahydromethanopterin_reductase; cd01097
561275003843	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275003844	PPE family; Region: PPE; pfam00823
561275003845	Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484
561275003846	PAS fold; Region: PAS_4; pfam08448
561275003847	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
561275003848	putative active site [active]
561275003849	heme pocket [chemical binding]; other site
561275003850	Serine phosphatase RsbU, regulator of sigma subunit [Signal transduction mechanisms / Transcription]; Region: RsbU; COG2208
561275003851	Stage II sporulation protein E (SpoIIE); Region: SpoIIE; pfam07228
561275003852	Anti-sigma regulatory factor (Ser/Thr protein kinase) [Signal transduction mechanisms]; Region: RsbW; COG2172
561275003853	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cl00075
561275003854	Sulphate Transporter and Anti-Sigma factor antagonist) domain of anti-anti-sigma factors, key regulators of anti-sigma factors by phosphorylation; Region: STAS_anti-anti-sigma_factors; cd07043
561275003855	anti sigma factor interaction site; other site
561275003856	regulatory phosphorylation site [posttranslational modification]; other site
561275003857	Sulphate Transporter and Anti-Sigma factor antagonist) domain of anti-anti-sigma factors, key regulators of anti-sigma factors by phosphorylation; Region: STAS_anti-anti-sigma_factors; cd07043
561275003858	anti sigma factor interaction site; other site
561275003859	regulatory phosphorylation site [posttranslational modification]; other site
561275003860	Nucleotidyltransferase (NT) domain of RelA- and SpoT-like ppGpp synthetases and hydrolases; Region: NT_Rel-Spo_like; cd05399
561275003861	synthetase active site [active]
561275003862	NTP binding site [chemical binding]; other site
561275003863	metal binding site [ion binding]; metal-binding site
561275003864	Beta-lactamase; Region: Beta-lactamase; pfam00144
561275003865	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
561275003866	Protein of unknown function (DUF1396); Region: DUF1396; pfam07161
561275003867	potential frameshift: common BLAST hit: gi|148661162|ref|YP_001282685.1| desaturase-related protein
561275003868	Cytochrome b5-like Heme/Steroid binding domain; Region: Cyt-b5; pfam00173
561275003869	Fatty acid desaturase [Lipid metabolism]; Region: DesA; COG3239
561275003870	The membrane fatty acid desaturase (Membrane_FADS)-like CD includes membrane FADSs, alkane hydroxylases, beta carotene ketolases (CrtW-like), hydroxylases (CrtR-like), and other related proteins. They are present in all groups of organisms with the...; Region: Membrane-FADS-like; cl00615
561275003871	putative di-iron ligands [ion binding]; other site
561275003872	Predicted naringenin-chalcone synthase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: BcsA; COG3424
561275003873	Chalcone and stilbene synthases; plant-specific polyketide synthases (PKS) and related enzymes, also called type III PKSs. PKS generate an array of different products, dependent on the nature of the starter molecule. They share a common chemical strategy; Region: CHS_like; cd00831
561275003874	malonyl-CoA binding site [chemical binding]; other site
561275003875	dimer interface [polypeptide binding]; other site
561275003876	active site
561275003877	product binding site; other site
561275003878	potential frameshift: common BLAST hit: gi|121637303|ref|YP_977526.1| glycolipid sulfotransferase
561275003879	Sulfotransferase domain; Region: Sulfotransfer_1; pfam00685
561275003880	Dehydroquinate synthase-like (DHQ-like) and iron-containing alcohol dehydrogenases (Fe-ADH); Region: DHQ_Fe-ADH; cl02872
561275003881	uncharacterized domain; Region: TIGR00702
561275003882	YcaO-like family; Region: YcaO; pfam02624
561275003883	Uncharacterized conserved protein [Function unknown]; Region: COG3482
561275003884	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275003885	S-adenosylmethionine binding site [chemical binding]; other site
561275003886	Domain of unknown function (DUF222); Region: DUF222; pfam02720
561275003887	HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085
561275003888	active site
561275003889	bifunctional pyrimidine regulatory protein PyrR uracil phosphoribosyltransferase; Provisional; Region: PRK05205
561275003890	Pyrimidine operon attenuation protein/uracil phosphoribosyltransferase [Nucleotide transport and metabolism]; Region: PyrR; COG2065
561275003891	aspartate carbamoyltransferase catalytic subunit; Provisional; Region: pyrB; PRK00856
561275003892	Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding domain; Region: OTCace_N; pfam02729
561275003893	Aspartate/ornithine carbamoyltransferase, Asp/Orn binding domain; Region: OTCace; pfam00185
561275003894	dihydroorotase; Validated; Region: pyrC; PRK09357
561275003895	Superfamily of metallo-dependent hydrolases (also called amidohydrolase superfamily) is a large group of proteins that show conservation in their 3-dimensional fold (TIM barrel) and in details of their active site. The vast majority of the members have a...; Region: metallo-dependent_hydrolases; cl00281
561275003896	Dihydroorotase (DHOase), subgroup IIa; DHOases catalyze the reversible interconversion of carbamoyl aspartate to dihydroorotate, a key reaction in pyrimidine biosynthesis. This subgroup also contains proteins that lack the active site, like unc-33, a C; Region: DHOase_IIa; cd01317
561275003897	active site
561275003898	carbamoyl phosphate synthase small subunit; Reviewed; Region: PRK12564
561275003899	Carbamoyl-phosphate synthase small chain, CPSase domain; Region: CPSase_sm_chain; smart01097
561275003900	Small chain of the glutamine-dependent form of carbamoyl phosphate synthase, CPSase II; Region: GATase1_CPSase; cd01744
561275003901	catalytic site [active]
561275003902	subunit interface [polypeptide binding]; other site
561275003903	carbamoyl phosphate synthase large subunit; Reviewed; Region: carB; PRK05294
561275003904	Carbamoyl-phosphate synthase L chain, N-terminal domain; Region: CPSase_L_chain; pfam00289
561275003905	ATP-grasp domain; Region: ATP-grasp_4; cl17255
561275003906	Carbamoyl-phosphate synthetase large chain, oligomerisation domain; Region: CPSase_L_D3; pfam02787
561275003907	Carbamoyl-phosphate synthase L chain, N-terminal domain; Region: CPSase_L_chain; pfam00289
561275003908	ATP-grasp domain; Region: ATP-grasp_4; cl17255
561275003909	Methylglyoxal synthase-like domain from type II glutamine-dependent carbamoyl phosphate synthetase (CSP). CSP, a CarA and CarB heterodimer, catalyzes the production of carbamoyl phosphate which is subsequently employed in the metabolic pathways...; Region: MGS_CPS_II; cd01424
561275003910	IMP binding site; other site
561275003911	dimer interface [polypeptide binding]; other site
561275003912	interdomain contacts; other site
561275003913	partial ornithine binding site; other site
561275003914	Orotidine 5'-phosphate decarboxylase (ODCase) is a dimeric enzyme that decarboxylates orotidine 5'-monophosphate (OMP) to form uridine 5'-phosphate (UMP), an essential step in the pyrimidine biosynthetic pathway. In mammals, UMP synthase...; Region: OMP_decarboxylase_like; cd04725
561275003915	active site
561275003916	dimer interface [polypeptide binding]; other site
561275003917	PE family; Region: PE; pfam00934
561275003918	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275003919	PPE family; Region: PPE; pfam00823
561275003920	Guanylate kinase [Nucleotide transport and metabolism]; Region: Gmk; COG0194
561275003921	Guanosine monophosphate kinase (GMPK, EC 2.7.4.8), also known as guanylate kinase (GKase), catalyzes the reversible phosphoryl transfer from adenosine triphosphate (ATP) to guanosine monophosphate (GMP) to yield adenosine diphosphate (ADP) and guanosine...; Region: GMPK; cd00071
561275003922	catalytic site [active]
561275003923	G-X2-G-X-G-K; other site
561275003924	DNA-directed RNA polymerase, omega subunit; Region: rpoZ; TIGR00690
561275003925	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate synthase; Validated; Region: PRK05579
561275003926	Flavoprotein; Region: Flavoprotein; pfam02441
561275003927	DNA / pantothenate metabolism flavoprotein; Region: DFP; pfam04127
561275003928	S-adenosylmethionine synthetase, N-terminal domain; Region: S-AdoMet_synt_N; pfam00438
561275003929	S-adenosylmethionine synthetase; Validated; Region: PRK05250
561275003930	S-adenosylmethionine synthetase, central domain; Region: S-AdoMet_synt_M; pfam02772
561275003931	S-adenosylmethionine synthetase, C-terminal domain; Region: S-AdoMet_synt_C; pfam02773
561275003932	Predicted flavoprotein involved in K+ transport [Inorganic ion transport and metabolism]; Region: TrkA; COG2072
561275003933	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox_3; pfam13738
561275003934	Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124
561275003935	Cytochrome P450; Region: p450; cl12078
561275003936	Arabinose-binding domain of AraC transcription regulator, N-term; Region: Arabinose_bd; pfam12625
561275003937	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
561275003938	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
561275003939	PE family; Region: PE; pfam00934
561275003940	PIN domain of ribonucleases (toxins), VapC and FitB, of prokaryotic toxin/antitoxin operons, Pyrococcus horikoshii protein PH0500, and other similar bacterial and archaeal homologs; Region: PIN_VapC-FitB; cd09881
561275003941	oligomeric interface; other site
561275003942	putative active site [active]
561275003943	homodimer interface [polypeptide binding]; other site
561275003944	Ribbon-helix-helix protein, copG family; Region: RHH_1; pfam01402
561275003945	Esterases and lipases (includes fungal lipases, cholinesterases, etc.)  These enzymes act on carboxylic esters (EC: 3.1.1.-). The catalytic apparatus involves three residues (catalytic triad): a serine, a glutamate or aspartate and a histidine.These...; Region: Esterase_lipase; cd00312
561275003946	alpha/beta hydrolase fold; Region: Abhydrolase_3; pfam07859
561275003947	substrate binding pocket [chemical binding]; other site
561275003948	Esterases and lipases (includes fungal lipases, cholinesterases, etc.)  These enzymes act on carboxylic esters (EC: 3.1.1.-). The catalytic apparatus involves three residues (catalytic triad): a serine, a glutamate or aspartate and a histidine.These...; Region: Esterase_lipase; cd00312
561275003949	alpha/beta hydrolase fold; Region: Abhydrolase_3; pfam07859
561275003950	substrate binding pocket [chemical binding]; other site
561275003951	Predicted membrane protein [Function unknown]; Region: COG3714
561275003952	primosome assembly protein PriA; Provisional; Region: PRK14873
561275003953	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275003954	S-adenosylmethionine binding site [chemical binding]; other site
561275003955	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
561275003956	MarR family; Region: MarR; pfam01047
561275003957	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275003958	S-adenosylmethionine binding site [chemical binding]; other site
561275003959	methionyl-tRNA formyltransferase; Reviewed; Region: fmt; PRK00005
561275003960	Methionyl-tRNA formyltransferase, N-terminal hydrolase domain; Region: FMT_core_Met-tRNA-FMT_N; cd08646
561275003961	putative active site [active]
561275003962	substrate binding site [chemical binding]; other site
561275003963	putative cosubstrate binding site; other site
561275003964	catalytic site [active]
561275003965	C-terminal domain of Formyltransferase and other enzymes; Region: Met_tRNA_FMT_C; cd08704
561275003966	substrate binding site [chemical binding]; other site
561275003967	N-terminal RNA binding domain of the methyltransferase Sun. The rRNA-specific 5-methylcytidine transferase Sun, also known as RrmB or Fmu shares the RNA-binding non-catalytic domain with the transcription termination factor NusB. The precise biological...; Region: Methyltransferase_Sun; cd00620
561275003968	NOL1/NOP2/sun family; Region: Nol1_Nop2_Fmu; pfam01189
561275003969	NOL1/NOP2/sun family putative RNA methylase; Region: nop2p; TIGR00446
561275003970	Ribulose-5-phosphate 3-epimerase (RPE). This enzyme catalyses the interconversion of D-ribulose 5-phosphate (Ru5P) into D-xylulose 5-phosphate, as part of the Calvin cycle (reductive pentose phosphate pathway) in chloroplasts and in the oxidative pentose...; Region: RPE; cd00429
561275003971	ribulose-phosphate 3-epimerase; Region: rpe; TIGR01163
561275003972	substrate binding site [chemical binding]; other site
561275003973	hexamer interface [polypeptide binding]; other site
561275003974	metal binding site [ion binding]; metal-binding site
561275003975	riboflavin biosynthesis protein RibD; Region: eubact_ribD; TIGR00326
561275003976	Riboflavin-specific deaminase. Riboflavin biosynthesis protein RibD (Diaminohydroxyphosphoribosylaminopyrimidine deaminase) catalyzes the deamination of 2,5-diamino-6-ribosylamino-4(3H)-pyrimidinone 5'-phosphate, which is an intermediate step in the...; Region: Riboflavin_deaminase-reductase; cd01284
561275003977	catalytic motif [active]
561275003978	Zn binding site [ion binding]; other site
561275003979	RibD C-terminal domain; Region: RibD_C; pfam01872
561275003980	drug resistance transporter, EmrB/QacA subfamily; Region: efflux_EmrB; TIGR00711
561275003981	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
561275003982	putative substrate translocation pore; other site
561275003983	Protein of unknown function (DUF1396); Region: DUF1396; pfam07161
561275003984	riboflavin synthase subunit alpha; Provisional; Region: PRK09289
561275003985	Lumazine binding domain; Region: Lum_binding; pfam00677
561275003986	Lumazine binding domain; Region: Lum_binding; pfam00677
561275003987	Predicted amino acid aldolase or racemase [Amino acid transport and metabolism]; Region: COG3616
561275003988	Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzymes; Region: PLPDE_III; cl00261
561275003989	Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzymes; Region: PLPDE_III; cl00261
561275003990	Predicted amino acid aldolase or racemase [Amino acid transport and metabolism]; Region: COG3616
561275003991	bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II protein; Provisional; Region: PRK09311
561275003992	3,4-dihydroxy-2-butanone 4-phosphate synthase; Region: DHBP_synthase; pfam00926
561275003993	GTP cyclohydrolase II (RibA).  GTP cyclohydrolase II catalyzes the conversion of GTP to 2,5-diamino-6-ribosylamino-4(3H)-pyrimidinone 5' phosphate, formate, pyrophosphate (APy), and GMP in the biosynthetic pathway of riboflavin. Riboflavin is the...; Region: GTP_cyclohydro2; cd00641
561275003994	dimerization interface [polypeptide binding]; other site
561275003995	active site
561275003996	lumazine synthase (6,7-dimethyl-8-ribityllumazine synthase, LS), catalyzes the penultimate step in the biosynthesis of riboflavin (vitamin B2); type-I; Region: Lumazine_synthase-I; cd09209
561275003997	homopentamer interface [polypeptide binding]; other site
561275003998	active site
561275003999	Protein of unknown function (DUF2581); Region: DUF2581; pfam10756
561275004000	PknH-like extracellular domain; Region: PknH_C; pfam14032
561275004001	Ricin-type beta-trefoil lectin domain; Region: Ricin_B_lectin; pfam00652
561275004002	Ricin-type beta-trefoil; Carbohydrate-binding domain formed from presumed gene triplication. The domain is found in a variety of molecules serving diverse functions such as enzymatic activity, inhibitory toxicity and signal transduction. Highly specific...; Region: RICIN; cd00161
561275004003	putative sugar binding sites [chemical binding]; other site
561275004004	Q-X-W motif; other site
561275004005	excinuclease ABC subunit C; Validated; Region: uvrC; PRK00558
561275004006	Catalytic GIY-YIG domain of nucleotide excision repair endonucleases UvrC, Cho, and similar proteins; Region: GIY-YIG_UvrC_Cho; cd10434
561275004007	GIY-YIG motif/motif A; other site
561275004008	active site
561275004009	catalytic site [active]
561275004010	putative DNA binding site [nucleotide binding]; other site
561275004011	metal binding site [ion binding]; metal-binding site
561275004012	UvrB/uvrC motif; Region: UVR; pfam02151
561275004013	UvrC Helix-hairpin-helix N-terminal; Region: UvrC_HhH_N; pfam08459
561275004014	Helix-hairpin-helix motif; Region: HHH; pfam00633
561275004015	P-loop ATPase protein family; Region: ATP_bind_2; pfam03668
561275004016	conserved hypothetical protein, cofD-related; Region: CofD_related; TIGR01826
561275004017	family of mostly uncharacterized proteins similar to B.subtilis YvcK; Region: YvcK_like; cd07187
561275004018	phosphate binding site [ion binding]; other site
561275004019	putative substrate binding pocket [chemical binding]; other site
561275004020	dimer interface [polypeptide binding]; other site
561275004021	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG1481
561275004022	Sporulation Regulator WhiA N terminal; Region: WhiA_N; pfam10298
561275004023	acyltransferase, WS/DGAT/MGAT; Region: acyl_WS_DGAT; TIGR02946
561275004024	Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007
561275004025	alpha/beta hydrolase fold; Region: Abhydrolase_3; pfam07859
561275004026	Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326
561275004027	acyl-CoA synthetase; Provisional; Region: PRK13382
561275004028	Bacterial Bile acid CoA ligases and similar proteins; Region: BACL_like; cd05929
561275004029	acyl-activating enzyme (AAE) consensus motif; other site
561275004030	putative AMP binding site [chemical binding]; other site
561275004031	putative active site [active]
561275004032	putative CoA binding site [chemical binding]; other site
561275004033	1-acyl-sn-glycerol-3-phosphate acyltransferase [Lipid metabolism]; Region: PlsC; COG0204
561275004034	Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: MGAT-like; Region: LPLAT_MGAT-like; cd07987
561275004035	putative acyl-acceptor binding pocket; other site
561275004036	Regulator of polyketide synthase expression [Signal transduction mechanisms / Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG2508
561275004037	PucR C-terminal helix-turn-helix domain; Region: HTH_30; pfam13556
561275004038	PE family; Region: PE; pfam00934
561275004039	PE-PPE domain; Region: PE-PPE; pfam08237
561275004040	Transmembrane protein of unknown function (DUF3556); Region: DUF3556; pfam12077
561275004041	Phytoene dehydrogenase and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG1233
561275004042	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
561275004043	IgD-like repeat domain of mycobacterial L,D-transpeptidases; Region: LDT_IgD_like_1; cd13431
561275004044	Uncharacterized protein conserved in bacteria [Function unknown]; Region: ErfK; COG1376
561275004045	L,D-transpeptidase catalytic domain; Region: YkuD; pfam03734
561275004046	Glyceraldehyde-3-phosphate dehydrogenase/erythrose-4-phosphate dehydrogenase [Carbohydrate transport and metabolism]; Region: GapA; COG0057
561275004047	Glyceraldehyde 3-phosphate dehydrogenase, NAD binding domain; Region: Gp_dh_N; pfam00044
561275004048	Glyceraldehyde 3-phosphate dehydrogenase, C-terminal domain; Region: Gp_dh_C; pfam02800
561275004049	Phosphoglycerate kinase; Region: PGK; pfam00162
561275004050	Phosphoglycerate kinase (PGK) is a monomeric enzyme which catalyzes the transfer of the high-energy phosphate group of 1,3-bisphosphoglycerate to ADP, forming ATP and 3-phosphoglycerate. This reaction represents the first of the two substrate-level...; Region: Phosphoglycerate_kinase; cd00318
561275004051	substrate binding site [chemical binding]; other site
561275004052	hinge regions; other site
561275004053	ADP binding site [chemical binding]; other site
561275004054	catalytic site [active]
561275004055	triosephosphate isomerase; Provisional; Region: PRK14567
561275004056	Triosephosphate isomerase (TIM) is a glycolytic enzyme that catalyzes the interconversion of dihydroxyacetone phosphate and D-glyceraldehyde-3-phosphate. The reaction is very efficient and requires neither cofactors nor metal ions. TIM, usually...; Region: TIM; cd00311
561275004057	substrate binding site [chemical binding]; other site
561275004058	dimer interface [polypeptide binding]; other site
561275004059	catalytic triad [active]
561275004060	SnoaL-like domain; Region: SnoaL_2; pfam12680
561275004061	Preprotein translocase SecG subunit; Region: SecG; cl09123
561275004062	PE family; Region: PE; pfam00934
561275004063	The MopB_DMSOR-BSOR-TMAOR CD contains dimethylsulfoxide reductase (DMSOR), biotin sulfoxide reductase (BSOR),  trimethylamine N-oxide reductase (TMAOR) and other related proteins. DMSOR always catalyzes the reduction of DMSO to dimethylsulfide, but its...; Region: MopB_DMSOR-BSOR-TMAOR; cd02769
561275004064	molybdopterin guanine dinucleotide-containing S/N-oxide reductases; Region: bisC_fam; TIGR00509
561275004065	molybdopterin cofactor binding site [chemical binding]; other site
561275004066	substrate binding site [chemical binding]; other site
561275004067	The MopB_DMSOR-BSOR-TMAOR CD contains dimethylsulfoxide reductase (DMSOR), biotin sulfoxide reductase (BSOR),  trimethylamine N-oxide reductase (TMAOR) and other related proteins. DMSOR always catalyzes the reduction of DMSO to dimethylsulfide, but its...; Region: MopB_CT_DMSOR-BSOR-TMAOR; cd02793
561275004068	molybdopterin cofactor binding site; other site
561275004069	START/RHO_alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) ligand-binding domain superfamily; Region: SRPBCC; cl14643
561275004070	hydrophobic ligand binding site; other site
561275004071	7bp:CTTCCCC deletion in BCG Tokyo after 191:C of the Mb region, and 15-bp:CGCTTCCCCCCCCCC deletion in BCG Pasteur after 189:C of the Mb region. In Mb, 19-bp:CCCCCCCCCCCCCCCCCC insertion after 197:C from the 3' end of Rv1444c in the intergenic region between Rv1143c and Rv1444c of Mycobacterium tuberculosis H37Rv. 23Cs in BCG Tokyo, 17Cs in BCG Pasteur.
561275004072	Proteins of 100 residues with WXG; Region: WXG100; cl02005
561275004073	6-phosphogluconolactonase/Glucosamine-6-phosphate isomerase/deaminase [Carbohydrate transport and metabolism]; Region: NagB; COG0363
561275004074	6PGL: 6-Phosphogluconolactonase (6PGL) subfamily; 6PGL catalyzes the second step of the oxidative phase of the pentose phosphate pathway, the hydrolyzation of 6-phosphoglucono-1,5-lactone (delta form) to 6-phosphogluconate. 6PGL is thought to guard...; Region: 6PGL; cd01400
561275004075	putative active site [active]
561275004076	glucose-6-phosphate dehydrogenase assembly protein OpcA; Region: OpcA; TIGR00534
561275004077	Glucose-6-P dehydrogenase subunit [Carbohydrate transport and metabolism]; Region: COG3429
561275004078	glucose-6-phosphate 1-dehydrogenase; Validated; Region: PRK05722
561275004079	Glucose-6-phosphate dehydrogenase, NAD binding domain; Region: G6PD_N; pfam00479
561275004080	Glucose-6-phosphate dehydrogenase, C-terminal domain; Region: G6PD_C; pfam02781
561275004081	Transaldolase-like proteins from plants and bacteria; Region: Transaldolase_like; cd00955
561275004082	putative active site [active]
561275004083	transaldolase; Provisional; Region: PRK03903
561275004084	catalytic residue [active]
561275004085	Transketolase [Carbohydrate transport and metabolism]; Region: TktA; COG0021
561275004086	Thiamine pyrophosphate (TPP) family, Transketolase (TK) subfamily, TPP-binding module; TK catalyzes the transfer of a two-carbon unit from ketose phosphates to aldose phosphates. In heterotrophic organisms, TK provides a link between glycolysis and the...; Region: TPP_TK; cd02012
561275004087	TPP-binding site [chemical binding]; other site
561275004088	dimer interface [polypeptide binding]; other site
561275004089	Pyrimidine (PYR) binding domain of 1-deoxy-D-xylulose-5-phosphate synthase (DXS), transketolase (TK), and related proteins; Region: TPP_PYR_DXS_TK_like; cd07033
561275004090	PYR/PP interface [polypeptide binding]; other site
561275004091	dimer interface [polypeptide binding]; other site
561275004092	TPP binding site [chemical binding]; other site
561275004093	PE family; Region: PE; pfam00934
561275004094	protoheme IX farnesyltransferase; Provisional; Region: PRK04375
561275004095	UbiA prenyltransferase family; Region: UbiA; pfam01040
561275004096	PE family; Region: PE; pfam00934
561275004097	Regulator of polyketide synthase expression [Signal transduction mechanisms / Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG2508
561275004098	PucR C-terminal helix-turn-helix domain; Region: HTH_30; pfam13556
561275004099	Quinone oxidoreductase (QOR); Region: QOR2; cd05286
561275004100	quinone oxidoreductase, NADPH-dependent; Provisional; Region: PRK10754
561275004101	NADP binding site [chemical binding]; other site
561275004102	dimer interface [polypeptide binding]; other site
561275004103	Uncharacterized protein required for cytochrome oxidase assembly [Posttranslational modification, protein turnover, chaperones]; Region: CtaA; COG1612
561275004104	Cytochrome oxidase assembly protein; Region: COX15-CtaA; pfam02628
561275004105	ABC transporter efflux protein, DrrB family; Region: Mtu_efflux; TIGR00025
561275004106	ABC-2 family transporter protein; Region: ABC2_membrane_3; pfam12698
561275004107	ABC-type multidrug transport system, ATPase component [Defense mechanisms]; Region: CcmA; COG1131
561275004108	ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230
561275004109	Walker A/P-loop; other site
561275004110	ATP binding site [chemical binding]; other site
561275004111	Q-loop/lid; other site
561275004112	ABC transporter signature motif; other site
561275004113	Walker B; other site
561275004114	D-loop; other site
561275004115	H-loop/switch region; other site
561275004116	carotene biosynthesis associated membrane protein; Region: crt_membr; TIGR03459
561275004117	Predicted transcriptional regulator [Transcription]; Region: COG2345
561275004118	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
561275004119	putative DNA binding site [nucleotide binding]; other site
561275004120	putative Zn2+ binding site [ion binding]; other site
561275004121	Transcriptional regulator PadR-like family; Region: PadR; cl17335
561275004122	cysteine desulfurase activator complex subunit SufB; Provisional; Region: PRK11814; cl03223
561275004123	Hedgehog/Intein domain, found in Hedgehog proteins as well as proteins which contain inteins and undergo protein splicing (e.g. DnaB, RIR1-2, GyrA and Pol). In protein splicing an intervening polypeptide sequence - the intein - is excised from a protein; Region: Hint; cd00081
561275004124	protein-splicing catalytic site; other site
561275004125	thioester formation/cholesterol transfer; other site
561275004126	Intein/homing endonuclease [DNA replication, recombination, and repair]; Region: COG1372
561275004127	Hint (Hedgehog/Intein) domain C-terminal region; Region: HintC; smart00305
561275004128	cysteine desulfurase activator complex subunit SufB; Provisional; Region: PRK11814; cl03223
561275004129	Cysteine desulfurase activator SufB [Posttranslational modification, protein turnover, chaperones]; Region: SufB; COG0719
561275004130	FeS assembly protein SufD; Region: sufD; TIGR01981
561275004131	Cysteine desulfurase activator ATPase [Posttranslational modification, protein turnover, chaperones]; Region: sufC; COG0396
561275004132	ABC-type transport system involved in Fe-S cluster assembly, ATPase component; Region: ABC_FeS_Assembly; cd03217
561275004133	Walker A/P-loop; other site
561275004134	ATP binding site [chemical binding]; other site
561275004135	Q-loop/lid; other site
561275004136	ABC transporter signature motif; other site
561275004137	Walker B; other site
561275004138	D-loop; other site
561275004139	H-loop/switch region; other site
561275004140	Selenocysteine lyase/Cysteine desulfurase [Posttranslational modification, protein turnover, chaperones]; Region: csdA; COG0520
561275004141	Cysteine desulfurase (SufS)-like. This family belongs to the pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to cysteine desulfurase (SufS) and selenocysteine lyase. SufS...; Region: SufS_like; cd06453
561275004142	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
561275004143	catalytic residue [active]
561275004144	NifU homolog involved in Fe-S cluster formation [Energy production and conversion]; Region: IscU; COG0822
561275004145	Iron-sulfur cluster scaffold-like proteins; Region: IscU_like; cd06664
561275004146	trimerization site [polypeptide binding]; other site
561275004147	active site
561275004148	Predicted metal-sulfur cluster biosynthetic enzyme [General function prediction only]; Region: PaaD; COG2151
561275004149	acyl-CoA dehydrogenase; Provisional; Region: PTZ00456
561275004150	Acyl-CoA dehydrogenase N terminal; Region: AcylCoA_DH_N; pfam12418
561275004151	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
561275004152	active site
561275004153	Acetyl-CoA dehydrogenase C-terminal like; Region: Acyl-CoA_dh_C; pfam12806
561275004154	PE family; Region: PE; pfam00934
561275004155	heavy metal-(Cd/Co/Hg/Pb/Zn)-translocating P-type ATPase; Region: ATPase-IB2_Cd; TIGR01512
561275004156	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
561275004157	TRX family; composed of two groups: Group I, which includes proteins that exclusively encode a TRX domain; and Group II, which are composed of fusion proteins of TRX and additional domains. Group I TRX is a small ancient protein that alter the redox...; Region: TRX_family; cd02947
561275004158	catalytic residues [active]
561275004159	TRX family; composed of two groups: Group I, which includes proteins that exclusively encode a TRX domain; and Group II, which are composed of fusion proteins of TRX and additional domains. Group I TRX is a small ancient protein that alter the redox...; Region: TRX_family; cd02947
561275004160	catalytic residues [active]
561275004161	enoyl-CoA hydratase; Provisional; Region: PRK05864
561275004162	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
561275004163	substrate binding site [chemical binding]; other site
561275004164	oxyanion hole (OAH) forming residues; other site
561275004165	trimer interface [polypeptide binding]; other site
561275004166	ATPase components of ABC transporters with duplicated ATPase domains [General function prediction only]; Region: Uup; COG0488
561275004167	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
561275004168	Walker A/P-loop; other site
561275004169	ATP binding site [chemical binding]; other site
561275004170	Q-loop/lid; other site
561275004171	ABC transporter signature motif; other site
561275004172	Walker B; other site
561275004173	D-loop; other site
561275004174	H-loop/switch region; other site
561275004175	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
561275004176	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275004177	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275004178	aconitate hydratase; Validated; Region: PRK09277
561275004179	Aconitase catalytic domain; Aconitase catalyzes the reversible isomerization of citrate and isocitrate as part of the TCA cycle; Region: Aconitase; cl00285
561275004180	substrate binding site [chemical binding]; other site
561275004181	ligand binding site [chemical binding]; other site
561275004182	Aconitase A swivel domain. This is the major form of the TCA cycle enzyme aconitate hydratase, also known as aconitase and citrate hydro-lyase. It includes bacterial and archaeal aconitase A, and the eukaryotic cytosolic form of aconitase. This group...; Region: AcnA_IRP_Swivel; cd01580
561275004183	substrate binding site [chemical binding]; other site
561275004184	Cell wall-associated hydrolases (invasion-associated proteins) [Cell envelope biogenesis, outer membrane]; Region: Spr; COG0791
561275004185	NlpC/P60 family; Region: NLPC_P60; pfam00877
561275004186	Cell wall-associated hydrolases (invasion-associated proteins) [Cell envelope biogenesis, outer membrane]; Region: Spr; COG0791
561275004187	NlpC/P60 family; Region: NLPC_P60; pfam00877
561275004188	MoxR-like ATPases [General function prediction only]; Region: COG0714
561275004189	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
561275004190	Walker A motif; other site
561275004191	ATP binding site [chemical binding]; other site
561275004192	Walker B motif; other site
561275004193	arginine finger; other site
561275004194	Uncharacterized conserved protein (some members contain a von Willebrand factor type A (vWA) domain) [General function prediction only]; Region: COG1721
561275004195	Protein of unknown function DUF58; Region: DUF58; pfam01882
561275004196	hypothetical protein; Provisional; Region: PRK13685
561275004197	Von Willebrand factor type A (vWA) domain was originally found in the blood coagulation protein von Willebrand factor (vWF). Typically, the vWA domain is made up of approximately 200 amino acid residues folded into a classic a/b para-rossmann type of...; Region: vWFA; cd00198
561275004198	metal ion-dependent adhesion site (MIDAS); other site
561275004199	Domain of unknown function (DUF4095); Region: DUF4095; pfam13338
561275004200	beta-Keto acyl carrier protein reductase (BKR), involved in Type II FAS, classical (c) SDRs; Region: BKR_SDR_c; cd05333
561275004201	3-oxoacyl-(acyl-carrier-protein) reductase; Region: 3oxo_ACP_reduc; TIGR01830
561275004202	NAD(P) binding site [chemical binding]; other site
561275004203	homotetramer interface [polypeptide binding]; other site
561275004204	homodimer interface [polypeptide binding]; other site
561275004205	active site
561275004206	enoyl-(acyl carrier protein) reductase; Provisional; Region: PRK07889
561275004207	Enoyl acyl carrier protein (ACP) reductase (ENR), divergent SDR; Region: ENR_SDR; cd05372
561275004208	NAD binding site [chemical binding]; other site
561275004209	homotetramer interface [polypeptide binding]; other site
561275004210	homodimer interface [polypeptide binding]; other site
561275004211	substrate binding site [chemical binding]; other site
561275004212	active site
561275004213	ferrochelatase; Reviewed; Region: hemH; PRK00035
561275004214	Ferrochelatase, N-terminal domain: Ferrochelatase (protoheme ferrolyase or HemH) is the terminal enzyme of the heme biosynthetic pathway. It catalyzes the insertion of ferrous iron into the protoporphyrin IX ring yielding protoheme. This enzyme is...; Region: Ferrochelatase_N; cd03411
561275004215	C-terminal domain interface [polypeptide binding]; other site
561275004216	active site
561275004217	Ferrochelatase, C-terminal domain: Ferrochelatase (protoheme ferrolyase or HemH) is the terminal enzyme of the heme biosynthetic pathway. It catalyzes the insertion of ferrous iron into the protoporphyrin IX ring yielding protoheme. This enzyme is...; Region: Ferrochelatase_C; cd00419
561275004218	active site
561275004219	N-terminal domain interface [polypeptide binding]; other site
561275004220	NfeD-like C-terminal, partner-binding; Region: NfeD; pfam01957
561275004221	Membrane protease subunits, stomatin/prohibitin homologs [Posttranslational modification, protein turnover, chaperones]; Region: HflC; COG0330
561275004222	Band_7_stomatin_like: A subgroup of the band 7 domain of flotillin (reggie) like proteins similar to stomatin and podicin (two lipid raft-associated integral membrane proteins). Individual proteins of this band 7 domain family may cluster to form...; Region: Band_7_stomatin_like; cd03403
561275004223	Coenzyme B12-dependent-methylmalonyl coenzyme A (CoA) mutase (MCM)-like family; contains proteins similar to MCM, and the large subunit of Streptomyces coenzyme B12-dependent isobutyryl-CoA mutase (ICM). MCM catalyzes the isomerization of...; Region: MM_CoA_mutase; cl00817
561275004224	Uncharacterized conserved protein [Function unknown]; Region: COG0398
561275004225	SNARE associated Golgi protein; Region: SNARE_assoc; pfam09335
561275004226	methylmalonyl-CoA mutase, heterodimeric type, beta chain; Region: mmCoA_mut_beta; TIGR00642
561275004227	Coenzyme B12-dependent-methylmalonyl coenzyme A (CoA) mutase (MCM) family, Beta subunit-like subfamily; contains bacterial proteins similar to the beta subunit of MCMs from Propionbacterium shermanni and Streptomyces cinnamonensis, which are alpha/beta...; Region: MM_CoA_mutase_beta; cd03677
561275004228	heterodimer interface [polypeptide binding]; other site
561275004229	substrate interaction site [chemical binding]; other site
561275004230	Methylmalonyl-CoA mutase, C-terminal domain/subunit (cobalamin-binding) [Lipid metabolism]; Region: Sbm; COG2185
561275004231	methylmalonyl-CoA mutase; Reviewed; Region: PRK09426
561275004232	Coenzyme B12-dependent-methylmalonyl coenzyme A (CoA) mutase (MCM) family, Alpha subunit-like subfamily; contains proteins similar to the alpha subunit of Propionbacterium shermanni MCM, as well as human and E. coli MCM. Members of this subfamily contain...; Region: MM_CoA_mutase_alpha_like; cd03679
561275004233	active site
561275004234	substrate binding site [chemical binding]; other site
561275004235	coenzyme B12 binding site [chemical binding]; other site
561275004236	methylmalonyl CoA mutase B12 binding domain. This domain binds to B12 (adenosylcobamide), which initiates the conversion of succinyl CoA and methylmalonyl CoA by forming an adenosyl radical, which then undergoes a rearrangement exchanging a hydrogen atom...; Region: MM_CoA_mut_B12_BD; cd02071
561275004237	B12 binding site [chemical binding]; other site
561275004238	cobalt ligand [ion binding]; other site
561275004239	Growth inhibitor [Signal transduction mechanisms]; Region: MazF; COG2337
561275004240	membrane ATPase/protein kinase; Provisional; Region: PRK09435
561275004241	The function of this protein family is unkown. The protein sequences are similar to the ArgK protein in E. coli. ArgK protein is a membrane ATPase which is required for transporting arginine, ornithine and lysine into the cells by the arginine and...; Region: ArgK-like; cd03114
561275004242	Walker A; other site
561275004243	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
561275004244	Beta-lactamase; Region: Beta-lactamase; pfam00144
561275004245	Methyltransferase domain; Region: Methyltransf_31; pfam13847
561275004246	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275004247	S-adenosylmethionine binding site [chemical binding]; other site
561275004248	Dodecin; Region: Dodecin; pfam07311
561275004249	undecaprenyl phosphate 4-deoxy-4-formamido-L-arabinose transferase; Provisional; Region: PRK10714
561275004250	Bacterial DPM1_like enzymes are related to eukaryotic DPM1; Region: DPM1_like_bac; cd04187
561275004251	Ligand binding site; other site
561275004252	Putative Catalytic site; other site
561275004253	DXD motif; other site
561275004254	Protein involved in biosynthesis of mitomycin antibiotics/polyketide fumonisin [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG5285
561275004255	Glycosyl hydrolase families 32 and 68, which for the clan GH-J; Region: GH_J; cd08979
561275004256	active site
561275004257	Predicted pyridoxal phosphate-dependent enzyme apparently involved in regulation of cell wall biogenesis [Cell envelope biogenesis, outer membrane]; Region: WecE; COG0399
561275004258	3-amino-5-hydroxybenzoic acid synthase family (AHBA_syn). AHBA_syn family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The members of this CD are involved in various biosynthetic pathways for secondary...; Region: AHBA_syn; cd00616
561275004259	inhibitor-cofactor binding pocket; inhibition site
561275004260	pyridoxal 5'-phosphate binding site [chemical binding]; other site
561275004261	catalytic residue [active]
561275004262	Putative Acyltransferase (AT), Left-handed parallel beta-Helix (LbH) domain; This group is composed of mostly uncharacterized proteins containing an N-terminal helical subdomain followed by a LbH domain. The alignment contains 6 turns, each containing...; Region: LbH_AT_putative; cd03360
561275004263	sugar O-acyltransferase, sialic acid O-acetyltransferase NeuD family; Region: NeuD_NnaD; TIGR03570
561275004264	putative trimer interface [polypeptide binding]; other site
561275004265	putative CoA binding site [chemical binding]; other site
561275004266	RD4, 12732 bp. Region of difference RD4, deleted region in Mycobacterium bovis BCG Pasteur (position 1721089-1721090), BCG Tokyo (position 1693982..1693983), and Mycobacterium bovis AF2122/97 (position 1692761..1692762) compared to Mycobacterium tuberculosis H37Rv2 (position: 1696017..1708748). Removes genes Rv1506-Rv1516
561275004267	Protein of unknown function (DUF2910); Region: DUF2910; pfam11139
561275004268	Glycosyltransferases involved in cell wall biogenesis [Cell envelope biogenesis, outer membrane]; Region: WcaA; COG0463
561275004269	Glycosyl transferase family 2; Region: Glycos_transf_2; pfam00535
561275004270	active site
561275004271	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394
561275004272	Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes. PLP combines with an alpha-amino acid to form a compound called a Schiff base or aldimine intermediate, which depending on the reaction, is the...; Region: AAT_I; cl00321
561275004273	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394
561275004274	Glycosyltransferases involved in cell wall biogenesis [Cell envelope biogenesis, outer membrane]; Region: WcaA; COG0463
561275004275	active site
561275004276	acyl-CoA synthetase; Validated; Region: PRK05850
561275004277	Fatty acyl-AMP ligase (FAAL); Region: FAAL; cd05931
561275004278	acyl-activating enzyme (AAE) consensus motif; other site
561275004279	active site
561275004280	Transport protein; Region: actII; TIGR00833
561275004281	Methyltransferase domain; Region: Methyltransf_23; pfam13489
561275004282	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275004283	S-adenosylmethionine binding site [chemical binding]; other site
561275004284	Glycosyl transferases, related to UDP-glucuronosyltransferase [Carbohydrate transport and metabolism / Signal transduction mechanisms]; Region: COG1819
561275004285	This family includes the Gtfs, a group of homologous glycosyltransferases involved in the final stages of the biosynthesis of antibiotics vancomycin and related chloroeremomycin. Gtfs transfer sugar moieties from an activated NDP-sugar donor to the...; Region: GT1_Gtf_like; cd03784
561275004286	homodimer interface [polypeptide binding]; other site
561275004287	active site
561275004288	TDP-binding site; other site
561275004289	acceptor substrate-binding pocket; other site
561275004290	Predicted glycosyltransferases [General function prediction only]; Region: COG1216
561275004291	Subfamily of Glycosyltransferase Family GT2 of unknown function; Region: GT_2_like_c; cd04186
561275004292	Probable Catalytic site; other site
561275004293	metal-binding site
561275004294	Glycosyl transferases, related to UDP-glucuronosyltransferase [Carbohydrate transport and metabolism / Signal transduction mechanisms]; Region: COG1819
561275004295	This family includes the Gtfs, a group of homologous glycosyltransferases involved in the final stages of the biosynthesis of antibiotics vancomycin and related chloroeremomycin. Gtfs transfer sugar moieties from an activated NDP-sugar donor to the...; Region: GT1_Gtf_like; cd03784
561275004296	homodimer interface [polypeptide binding]; other site
561275004297	active site
561275004298	TDP-binding site; other site
561275004299	acceptor substrate-binding pocket; other site
561275004300	Polyketide synthase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3321
561275004301	polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833
561275004302	active site
561275004303	Acyl transferase domain; Region: Acyl_transf_1; pfam00698
561275004304	Dehydratase domain in polyketide synthase (PKS) enzymes; Region: PKS_DH; smart00826
561275004305	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
561275004306	enoyl reductase of polyketide synthase; Region: enoyl_red; cd05195
561275004307	Enoylreductase; Region: PKS_ER; smart00829
561275004308	NAD(P) binding site [chemical binding]; other site
561275004309	beta-ketoacyl reductase (KR) domain of fatty acid synthase (FAS), subgroup 2, complex (x); Region: KR_2_FAS_SDR_x; cd08955
561275004310	This enzymatic domain is part of bacterial polyketide synthases; Region: PKS_KR; smart00822
561275004311	putative NADP binding site [chemical binding]; other site
561275004312	active site
561275004313	Phosphopantetheine attachment site; Region: PKS_PP; smart00823
561275004314	acyl-CoA synthetase; Validated; Region: PRK05850
561275004315	Fatty acyl-AMP ligase (FAAL); Region: FAAL; cd05931
561275004316	acyl-activating enzyme (AAE) consensus motif; other site
561275004317	active site
561275004318	Threonine dehydrogenase and related Zn-dependent dehydrogenases [Amino acid transport and metabolism / General function prediction only]; Region: Tdh; COG1063
561275004319	Medium chain reductase/dehydrogenase (MDR)/zinc-dependent alcohol dehydrogenase-like family; Region: MDR; cl16912
561275004320	NAD(P) binding site [chemical binding]; other site
561275004321	Uncharacterized conserved protein [Function unknown]; Region: COG2128
561275004322	Carboxymuconolactone decarboxylase family; Region: CMD; pfam02627
561275004323	PaaI_thioesterase is a tetrameric acyl-CoA thioesterase with a hot dog fold and one of several proteins responsible for phenylacetic acid (PA) degradation in bacteria.  Although orthologs of PaaI exist in archaea and eukaryotes, their function has not...; Region: PaaI_thioesterase; cd03443
561275004324	CoenzymeA binding site [chemical binding]; other site
561275004325	subunit interaction site [polypeptide binding]; other site
561275004326	PHB binding site; other site
561275004327	Nitronate monooxygenase; Region: NMO; pfam03060
561275004328	2-Nitropropane dioxygenase (NPD), one of the nitroalkane oxidizing enzyme families, catalyzes oxidative denitrification of nitroalkanes to their corresponding carbonyl compounds and nitrites. NDP is a member of the NAD(P)H-dependent flavin oxidoreductase...; Region: NPD_like; cd04730
561275004329	FMN binding site [chemical binding]; other site
561275004330	substrate binding site [chemical binding]; other site
561275004331	putative catalytic residue [active]
561275004332	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275004333	isoleucyl-tRNA synthetase; Reviewed; Region: ileS; PRK06039
561275004334	catalytic core domain of isoleucyl-tRNA synthetases; Region: IleRS_core; cd00818
561275004335	HIGH motif; other site
561275004336	catalytic core domain of isoleucyl-tRNA synthetases; Region: IleRS_core; cd00818
561275004337	active site
561275004338	KMSKS motif; other site
561275004339	Anticodon-binding domain of archaeal, bacterial, and eukaryotic cytoplasmic isoleucyl tRNA synthetases; Region: Anticodon_Ia_Ile_ABEc; cd07961
561275004340	tRNA binding surface [nucleotide binding]; other site
561275004341	anticodon binding site; other site
561275004342	DNA polymerase IV; Provisional; Region: PRK03348
561275004343	DNA Polymerase IV/Kappa; Region: PolY_Pol_IV_kappa; cd03586
561275004344	active site
561275004345	DNA binding site [nucleotide binding]
561275004346	Type II (periplasmic) bacterial L-asparaginase; Region: L-asparaginase_II; cd08964
561275004347	active site
561275004348	homodimer interface [polypeptide binding]; other site
561275004349	homotetramer interface [polypeptide binding]; other site
561275004350	lipoprotein signal peptidase; Provisional; Region: PRK14764
561275004351	lipoprotein signal peptidase; Provisional; Region: PRK14787
561275004352	Pseudouridylate synthases, 23S RNA-specific [Translation, ribosomal structure and biogenesis]; Region: RluA; COG0564
561275004353	Pseudouridine synthase, RsuA/RluD family; Region: PseudoU_synth_RluCD_like; cd02869
561275004354	active site
561275004355	Uncharacterized protein conserved in bacteria, putative lipoprotein [Function unknown]; Region: LprI; COG4461
561275004356	Protein of unknown function (DUF1311); Region: DUF1311; pfam07007
561275004357	Membrane-bound lysozyme-inhibitor of c-type lysozyme; Region: MliC; pfam09864
561275004358	Truncated hemoglobins (trHbs) are a family of oxygen-binding heme proteins found in cyanobacteria, eubacteria, unicellular eukaryotes, and plants. The truncated hemoglobins have a characteristic two-over-two alpha helical folding pattern that is distinct...; Region: Trunc_globin; cd00454
561275004359	apolar tunnel; other site
561275004360	heme binding site [chemical binding]; other site
561275004361	dimerization interface [polypeptide binding]; other site
561275004362	short chain dehydrogenase; Provisional; Region: PRK05866
561275004363	classical (c) SDRs; Region: SDR_c; cd05233
561275004364	NAD(P) binding site [chemical binding]; other site
561275004365	active site
561275004366	Short-chain dehydrogenases of various substrate specificities [General function prediction only]; Region: DltE; COG0300
561275004367	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
561275004368	NAD(P) binding site [chemical binding]; other site
561275004369	active site
561275004370	START/RHO_alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) ligand-binding domain superfamily; Region: SRPBCC; cd07812
561275004371	hydrophobic ligand binding site; other site
561275004372	DNA polymerase III subunit alpha; Validated; Region: dnaE; PRK05673
561275004373	Polymerase and Histidinol Phosphatase domain of alpha-subunit of bacterial polymerase III DnaE3; Region: PHP_PolIIIA_DnaE3; cd12113
561275004374	active site
561275004375	PHP Thumb interface [polypeptide binding]; other site
561275004376	metal binding site [ion binding]; metal-binding site
561275004377	DnaE_OBF: A subfamily of OB folds corresponding to the C-terminal OB-fold nucleic acid binding domain of Thermus aquaticus and Escherichia coli type C replicative DNA polymerase III alpha subunit (DnaE). The DNA polymerase holoenzyme of E. coli contains...; Region: DnaE_OBF; cd04485
561275004378	generic binding surface II; other site
561275004379	generic binding surface I; other site
561275004380	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275004381	PPE family; Region: PPE; pfam00823
561275004382	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275004383	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275004384	Long-chain acyl-CoA synthetases (AMP-forming) [Lipid metabolism]; Region: FAA1; COG1022
561275004385	Long-chain fatty acid CoA synthetases and Bubblegum-like very long-chain fatty acid CoA synthetases; Region: VL_LC_FACS_like; cd05907
561275004386	acyl-activating enzyme (AAE) consensus motif; other site
561275004387	putative AMP binding site [chemical binding]; other site
561275004388	putative active site [active]
561275004389	putative CoA binding site [chemical binding]; other site
561275004390	glycerol-3-phosphate acyltransferase; Reviewed; Region: PRK11915
561275004391	Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: GPAT-like; Region: LPLAT_DHAPAT-like; cd07993
561275004392	putative acyl-acceptor binding pocket; other site
561275004393	fumarate reductase, flavoprotein subunit; Region: fum_red_Fp; TIGR01176
561275004394	L-aspartate oxidase; Provisional; Region: PRK06175
561275004395	Fumarate reductase flavoprotein C-term; Region: Succ_DH_flav_C; pfam02910
561275004396	fumarate reductase iron-sulfur subunit; Provisional; Region: PRK12385
561275004397	2Fe-2S iron-sulfur cluster binding domain; Region: Fer2_3; pfam13085
561275004398	Succinate:quinone oxidoreductase (SQR) and Quinol:fumarate reductase (QFR) family, transmembrane subunits; SQR catalyzes the oxidation of succinate to fumarate coupled to the reduction of quinone to quinol, while QFR catalyzes the reverse reaction. SQR; Region: SQR_QFR_TM; cl00881
561275004399	Iron-sulfur protein interface; other site
561275004400	proximal heme binding site [chemical binding]; other site
561275004401	Quinol:fumarate reductase (QFR) Type D subfamily, 13kD hydrophobic subunit D; QFR couples the reduction of fumarate to succinate to the oxidation of quinol to quinone, the opposite reaction to that catalyzed by the related protein, succinate:quinine...; Region: QFR_TypeD_subunitD; cd00547
561275004402	Iron-sulfur protein interface; other site
561275004403	proximal quinone binding site [chemical binding]; other site
561275004404	C-subunit interface; other site
561275004405	distal quinone binding site; other site
561275004406	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275004407	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275004408	Mycobacterium membrane protein; Region: Mycobact_memb; pfam05423
561275004409	TbD1, 2153 bp. Region of difference TbD1, inserted region in Mycobacterium bovis BCG Pasteur (position 1774132..1776284, 2153bp), BCG Tokyo (position 1747034..1749186, 2153bp) and Mycobacterium bovis AF2122/97 (position 1745809..1747961, 2153bp) compared to Mycobacterium tuberculosis H37Rv2 (position: 1761789..1761790). This deletion in Mycobacterium tuberculosis modern strains, e.g. H37Rv, merges truncated genes mmpS6 and mmpL6 in an uniq gene, mmpL6 (Rv1557)
561275004410	Predicted drug exporters of the RND superfamily [General function prediction only]; Region: COG2409
561275004411	Domain of unknown function (DUF385); Region: DUF385; pfam04075
561275004412	threonine dehydratase; Validated; Region: PRK08639
561275004413	Threonine dehydratase: The first step in amino acid degradation is the removal of nitrogen. Although the nitrogen atoms of most amino acids are transferred to alpha-ketoglutarate before removal, the alpha-amino group of threonine can be directly...; Region: Thr-dehyd; cd01562
561275004414	tetramer interface [polypeptide binding]; other site
561275004415	pyridoxal 5'-phosphate binding site [chemical binding]; other site
561275004416	catalytic residue [active]
561275004417	C-terminal regulatory domain of Threonine dehydratase; Region: Thr_dehydrat_C; pfam00585
561275004418	Transcription regulator of the Arc/MetJ class [Transcription]; Region: COG5450
561275004419	PIN domain of the Rv0301 toxin of Mycobacterium tuberculosis and other uncharacterized, annotated PilT protein domain proteins; Region: PIN_MtRv0301; cd09882
561275004420	putative active site [active]
561275004421	Alpha amylase catalytic domain family; Region: AmyAc_family; cl07893
561275004422	Domain of unknown function (DUF3459); Region: DUF3459; pfam11941
561275004423	N-terminal Early set domain associated with the catalytic domain of Maltooligosyl trehalose trehalohydrolase (also called Glycosyltrehalose trehalohydrolase) and similar proteins; Region: E_set_MTHase_like_N; cd02853
561275004424	Alpha amylase catalytic domain found in Glycosyltrehalose trehalohydrolase (also called Maltooligosyl trehalose Trehalohydrolase); Region: AmyAc_GTHase; cd11325
561275004425	catalytic site [active]
561275004426	malto-oligosyltrehalose synthase; Region: trehalose_TreY; TIGR02401
561275004427	Alpha amylase catalytic domain found in maltooligosyl trehalose synthase (MTSase); Region: AmyAc_MTSase; cd11336
561275004428	active site
561275004429	catalytic site [active]
561275004430	RD17, 806bp. Region of difference RD17, deleted region in Mycobacterium bovis AF2122/97 (position: 1754245..1754246) compared to Mycobacterium tuberculosis H37Rv2 (position: 1768074..1768879, 806bp), Mycobacterium bovis BCG Pasteur (position: 1782568..1783373, 806bp), and BCG Tokyo (position 1755470..1756275). This deletion, in Mycobacterium bovis AF2122/97, splits treY in 2 genes treYa and treYb
561275004431	glycogen debranching enzyme GlgX; Region: glgX_debranch; TIGR02100
561275004432	N-terminal Early set domain associated with the catalytic domain of Glycogen debranching enzyme and bacterial isoamylase (also called glycogen 6-glucanohydrolase); Region: E_set_GDE_Isoamylase_N; cd02856
561275004433	Alpha amylase catalytic domain found in glycogen debranching enzymes; Region: AmyAc_Glg_debranch; cd11326
561275004434	active site
561275004435	catalytic site [active]
561275004436	Predicted acyltransferases [Lipid metabolism]; Region: COG1835
561275004437	Cell wall-associated hydrolases (invasion-associated proteins) [Cell envelope biogenesis, outer membrane]; Region: Spr; COG0791
561275004438	NlpC/P60 family; Region: NLPC_P60; pfam00877
561275004439	adenosylmethionine--8-amino-7-oxononanoate transaminase; Provisional; Region: PRK05964
561275004440	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
561275004441	inhibitor-cofactor binding pocket; inhibition site
561275004442	pyridoxal 5'-phosphate binding site [chemical binding]; other site
561275004443	catalytic residue [active]
561275004444	8-amino-7-oxononanoate synthase; Reviewed; Region: PRK05958
561275004445	Aminotransferase class I and II; Region: Aminotran_1_2; pfam00155
561275004446	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
561275004447	catalytic residue [active]
561275004448	dithiobiotin synthetase; Reviewed; Region: bioD; PRK00090
561275004449	2'-5' RNA ligase superfamily; Region: 2_5_RNA_ligase2; pfam13563
561275004450	Domain of unknown function (DUF222); Region: DUF222; pfam02720
561275004451	HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085
561275004452	active site
561275004453	RD3, 9247 bp. Region of difference RD3 (phiRv1), deleted region in Mycobacterium bovis BCG Pasteur (position 1793772..1793773) and BCG Tokyo (position 1766674..1766675) compared to Mycobacterium tuberculosis H37Rv2 (position: 1779279..1788525) and Mycobacterium bovis AF2122/97 (position 1764645..1773891). Removes genes Rv1573c-Rv1586c and merges truncated genes Rv1587c and Rv1572c
561275004454	Domain of unknown function (DUF222); Region: DUF222; pfam02720
561275004455	biotin synthase; Validated; Region: PRK06256
561275004456	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
561275004457	FeS/SAM binding site; other site
561275004458	Biotin and Thiamin Synthesis associated domain; Region: BATS; pfam06968
561275004459	Protein of unknown function (DUF2567); Region: DUF2567; pfam10821
561275004460	Secretory lipase; Region: LIP; pfam03583
561275004461	ADP-ribose pyrophosphatase [Nucleotide transport and metabolism]; Region: COG1051
561275004462	nudix motif; other site
561275004463	quinolinate synthetase; Provisional; Region: PRK09375
561275004464	L-aspartate oxidase; Provisional; Region: PRK07804
561275004465	L-aspartate oxidase; Provisional; Region: PRK06175
561275004466	Fumarate reductase flavoprotein C-term; Region: Succ_DH_flav_C; pfam02910
561275004467	nicotinate-nucleotide pyrophosphorylase; Provisional; Region: PRK07896
561275004468	Quinolinate phosphoribosyl transferase (QAPRTase or QPRTase), also called nicotinate-nucleotide pyrophosphorylase, is involved in the de novo synthesis of NAD in both prokaryotes and eukaryotes. It catalyses the reaction of quinolinic acid (QA) with...; Region: QPRTase; cd01572
561275004469	dimerization interface [polypeptide binding]; other site
561275004470	active site
561275004471	Methyltransferase domain; Region: Methyltransf_11; pfam08241
561275004472	S-adenosylmethionine binding site [chemical binding]; other site
561275004473	deazaflavin-dependent oxidoreductase, nitroreductase family; Region: hi_GC_TIGR00026
561275004474	Histidinol dehydrogenase; Region: Histidinol_dh; pfam00815
561275004475	Histidinol dehydrogenase, HisD, E.C 1.1.1.23. Histidinol dehydrogenase catalyzes the last two steps in the L-histidine biosynthesis pathway, which is conserved in bacteria, archaea, fungi, and plants. These last two steps are (i) the NAD-dependent...; Region: Histidinol_dh; cd06572
561275004476	NAD binding site [chemical binding]; other site
561275004477	dimerization interface [polypeptide binding]; other site
561275004478	product binding site; other site
561275004479	substrate binding site [chemical binding]; other site
561275004480	zinc binding site [ion binding]; other site
561275004481	catalytic residues [active]
561275004482	histidinol-phosphate aminotransferase; Provisional; Region: PRK03317
561275004483	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
561275004484	pyridoxal 5'-phosphate binding site [chemical binding]; other site
561275004485	homodimer interface [polypeptide binding]; other site
561275004486	catalytic residue [active]
561275004487	Imidazoleglycerol-phosphate dehydratase; Region: IGPD; cd07914
561275004488	4-fold oligomerization interface [polypeptide binding]; other site
561275004489	putative active site pocket [active]
561275004490	metal binding residues [ion binding]; metal-binding site
561275004491	3-fold/trimer interface [polypeptide binding]; other site
561275004492	imidazole glycerol phosphate synthase subunit HisH; Provisional; Region: hisH; PRK13146
561275004493	Type 1 glutamine amidotransferase (GATase1) domain found in imidazole glycerol phosphate synthase (IGPS); Region: GATase1_IGP_Synthase; cd01748
561275004494	putative active site [active]
561275004495	oxyanion strand; other site
561275004496	catalytic triad [active]
561275004497	HisA.  Phosphoribosylformimino-5-aminoimidazole carboxamide ribonucleotide (ProFAR) isomerase catalyzes the fourth step in histidine biosynthesis, an isomerisation of the aminoaldose moiety of ProFAR to the aminoketose of PRFAR (N-(5'-phospho-D-1...; Region: HisA; cd04732
561275004498	Histidine biosynthesis protein; Region: His_biosynth; pfam00977
561275004499	catalytic residues [active]
561275004500	Inositol-monophosphatase-like domains. This family of phosphatases is dependent on bivalent metal ions such as Mg++, and many members are inhibited by Li+ (which is thought to displace a bivalent ion in the active site). Substrates include fructose-1; Region: IMPase_like; cd01637
561275004501	Archaeal fructose-1,6-bisphosphatase and related enzymes of inositol monophosphatase family [Carbohydrate transport and metabolism]; Region: SuhB; COG0483
561275004502	active site
561275004503	The cyclase subunit of imidazoleglycerol phosphate synthase (HisF). Imidazole glycerol phosphate synthase (IGPS) catalyzes the fifth step of histidine biosynthesis, the formation of the imidazole ring. IGPS converts N1-(5'-phosphoribulosyl)...; Region: HisF; cd04731
561275004504	Histidine biosynthesis protein; Region: His_biosynth; pfam00977
561275004505	substrate binding site [chemical binding]; other site
561275004506	glutamase interaction surface [polypeptide binding]; other site
561275004507	phosphoribosyl-AMP cyclohydrolase; Reviewed; Region: hisI; PRK00051
561275004508	Ca2+/H+ antiporter [Inorganic ion transport and metabolism]; Region: ChaA; COG0387
561275004509	Sodium/calcium exchanger protein; Region: Na_Ca_ex; pfam01699
561275004510	Peroxiredoxin [Posttranslational modification, protein turnover, chaperones]; Region: AhpC; COG0450
561275004511	Peroxiredoxin (PRX) family, Bacterioferritin comigratory protein (BCP) subfamily; composed of thioredoxin-dependent thiol peroxidases, widely expressed in pathogenic bacteria, that protect cells against toxicity from reactive oxygen species by reducing...; Region: PRX_BCP; cd03017
561275004512	catalytic triad [active]
561275004513	anthranilate synthase component I; Provisional; Region: PRK13571
561275004514	Anthranilate synthase component I, N terminal region; Region: Anth_synt_I_N; pfam04715
561275004515	chorismate binding enzyme; Region: Chorismate_bind; pfam00425
561275004516	Tryptophan-associated transmembrane protein (Trp_oprn_chp); Region: Trp_oprn_chp; pfam09534
561275004517	Indole-3-glycerol phosphate synthase (IGPS); an enzyme in the tryptophan biosynthetic pathway, catalyzing the ring closure reaction of 1-(o-carboxyphenylamino)-1-deoxyribulose-5-phosphate (CdRP) to indole-3-glycerol phosphate (IGP), accompanied by the...; Region: IGPS; cd00331
561275004518	active site
561275004519	ribulose/triose binding site [chemical binding]; other site
561275004520	phosphate binding site [ion binding]; other site
561275004521	substrate (anthranilate) binding pocket [chemical binding]; other site
561275004522	product (indole) binding pocket [chemical binding]; other site
561275004523	tryptophan synthase, beta subunit; Region: trpB; TIGR00263
561275004524	Tryptophan synthase-beta:  Trptophan synthase is a bifunctional enzyme that catalyses the last two steps in the biosynthesis of L-tryptophan via its alpha and beta reactions. In the alpha reaction, indole 3-glycerol phosphate is cleaved reversibly to...; Region: Trp-synth_B; cd06446
561275004525	pyridoxal 5'-phosphate binding site [chemical binding]; other site
561275004526	catalytic residue [active]
561275004527	Ttryptophan synthase (TRPS) alpha subunit (TSA). TPRS is a bifunctional tetrameric enzyme (2 alpha and 2 beta subunits) that catalyzes the last two steps of L-tryptophan biosynthesis. Alpha and beta subunit catalyze two distinct reactions which are both...; Region: Tryptophan_synthase_alpha; cd04724
561275004528	substrate binding site [chemical binding]; other site
561275004529	active site
561275004530	catalytic residues [active]
561275004531	heterodimer interface [polypeptide binding]; other site
561275004532	prolipoprotein diacylglyceryl transferase; Reviewed; Region: PRK13108
561275004533	Prolipoprotein diacylglyceryltransferase [Cell envelope biogenesis, outer membrane]; Region: Lgt; COG0682
561275004534	TM2 domain; Region: TM2; pfam05154
561275004535	Protein of unknown function (DUF2752); Region: DUF2752; pfam10825
561275004536	pyruvate kinase; Provisional; Region: PRK06247
561275004537	Pyruvate kinase (PK):  Large allosteric enzyme that regulates glycolysis through binding of the substrate, phosphoenolpyruvate, and one or more allosteric effectors. Like other allosteric enzymes, PK has a high substrate affinity R state and a low...; Region: Pyruvate_Kinase; cl17342
561275004538	domain interfaces; other site
561275004539	active site
561275004540	Acyl-CoA thioesterase [Lipid metabolism]; Region: TesB; COG1946
561275004541	Thioesterase II (TEII) is thought to regenerate misprimed nonribosomal peptide synthetases (NRPSs) as well as modular polyketide synthases (PKSs) by hydrolyzing acetyl groups bound to the peptidyl carrier protein (PCP) and acyl carrier protein (ACP)...; Region: Thioesterase_II_repeat2; cd03445
561275004542	active site
561275004543	Thioesterase II (TEII) is thought to regenerate misprimed nonribosomal peptide synthetases (NRPSs) as well as modular polyketide synthases (PKSs) by hydrolyzing acetyl groups bound to the peptidyl carrier protein (PCP) and acyl carrier protein (ACP)...; Region: Thioesterase_II_repeat1; cd03444
561275004544	catalytic triad [active]
561275004545	dimer interface [polypeptide binding]; other site
561275004546	Uncharacterized conserved protein [Function unknown]; Region: COG2898
561275004547	Uncharacterized conserved protein (DUF2156); Region: DUF2156; pfam09924
561275004548	thiol reductant ABC exporter, CydC subunit; Region: CydC; TIGR02868
561275004549	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
561275004550	ATP-binding cassette domain of multidrug resistance protein-like transporters; Region: ABCC_MRP_Like; cd03228
561275004551	Walker A/P-loop; other site
561275004552	Walker A/P-loop; other site
561275004553	ATP binding site [chemical binding]; other site
561275004554	ATP binding site [chemical binding]; other site
561275004555	Q-loop/lid; other site
561275004556	ABC-type transport system involved in cytochrome bd biosynthesis, ATPase and permease components [Energy production and conversion / Posttranslational modification, protein turnover, chaperones]; Region: CydD; COG4988
561275004557	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
561275004558	Walker A/P-loop; other site
561275004559	ATP binding site [chemical binding]; other site
561275004560	Q-loop/lid; other site
561275004561	ABC transporter signature motif; other site
561275004562	Walker B; other site
561275004563	D-loop; other site
561275004564	H-loop/switch region; other site
561275004565	cytochrome d ubiquinol oxidase subunit 2; Provisional; Region: PRK15003; cl12219
561275004566	Cytochrome oxidase subunit II; Region: Cyto_ox_2; pfam02322
561275004567	cytochrome d terminal oxidase subunit 1; Provisional; Region: PRK15097
561275004568	Bacterial Cytochrome Ubiquinol Oxidase; Region: Bac_Ubq_Cox; pfam01654
561275004569	Uncharacterized conserved protein [Function unknown]; Region: HdeD; COG3247
561275004570	Adenylyl- / guanylyl cyclase, catalytic domain; Region: CYCc; smart00044
561275004571	cyclase homology domain; Region: CHD; cd07302
561275004572	nucleotidyl binding site; other site
561275004573	metal binding site [ion binding]; metal-binding site
561275004574	dimer interface [polypeptide binding]; other site
561275004575	Response regulator with putative antiterminator output domain [Signal transduction mechanisms]; Region: AmiR; COG3707
561275004576	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
561275004577	active site
561275004578	phosphorylation site [posttranslational modification]
561275004579	intermolecular recognition site; other site
561275004580	dimerization interface [polypeptide binding]; other site
561275004581	ANTAR domain; Region: ANTAR; pfam03861
561275004582	lipid-transfer protein; Provisional; Region: PRK06059
561275004583	Thiolase domain associated with sterol carrier protein (SCP)-x isoform and related proteins; SCP-2  has multiple roles in intracellular lipid circulation and metabolism. The N-terminal presequence in the SCP-x isoform represents a peroxisomal...; Region: SCP-x_thiolase; cd00829
561275004584	active site
561275004585	Predicted nucleic-acid-binding protein containing a Zn-ribbon [General function prediction only]; Region: COG1545
561275004586	Rubredoxin-like zinc ribbon domain (DUF35_N); Region: DUF35_N; pfam12172
561275004587	DUF35 OB-fold domain; Region: DUF35; pfam01796
561275004588	DNA polymerase I; Provisional; Region: PRK05755
561275004589	PIN domain of the 5'-3' exonuclease of Taq DNA polymerase I and homologs; Region: PIN_53EXO; cd09859
561275004590	active site
561275004591	metal binding site 1 [ion binding]; metal-binding site
561275004592	putative 5' ssDNA interaction site; other site
561275004593	metal binding site 3; metal-binding site
561275004594	metal binding site 2 [ion binding]; metal-binding site
561275004595	H3TH domain of the 5'-3' exonuclease of Taq DNA polymerase I and homologs; Region: H3TH_53EXO; cd09898
561275004596	putative DNA binding site [nucleotide binding]; other site
561275004597	putative metal binding site [ion binding]; other site
561275004598	3'-5' exonuclease; Region: 35EXOc; smart00474
561275004599	inactive DEDDy 3'-5' exonuclease domain of Bacillus stearothermophilus DNA polymerase I and similar family-A DNA polymerases; Region: DNA_polA_I_Bacillus_like_exo; cd06140
561275004600	Polymerase I functions primarily to fill DNA gaps that arise during DNA repair, recombination and replication; Region: DNA_pol_A_pol_I_C; cd08637
561275004601	active site
561275004602	DNA binding site [nucleotide binding]
561275004603	catalytic site [active]
561275004604	30S ribosomal protein S1; Reviewed; Region: rpsA; PRK07899
561275004605	S1_RPS1_repeat_ec1_hs1: Ribosomal protein S1 (RPS1) domain. RPS1 is a component of the small ribosomal subunit thought to be involved in the recognition and binding of mRNA's during translation initiation. The bacterial RPS1 domain architecture...; Region: S1_RPS1_repeat_ec1_hs1; cd05687
561275004606	RNA binding site [nucleotide binding]; other site
561275004607	S1_RPS1_repeat_ec2_hs2: Ribosomal protein S1 (RPS1) domain. RPS1 is a component of the small ribosomal subunit thought to be involved in the recognition and binding of mRNA's during translation initiation. The bacterial RPS1 domain architecture...; Region: S1_RPS1_repeat_ec2_hs2; cd04465
561275004608	RNA binding site [nucleotide binding]; other site
561275004609	S1_like: Ribosomal protein S1-like RNA-binding domain. Found in a wide variety of RNA-associated proteins. Originally identified in S1 ribosomal protein. This superfamily also contains the Cold Shock Domain (CSD), which is a homolog of the S1 domain; Region: S1_like; cl09927
561275004610	RNA binding site [nucleotide binding]; other site
561275004611	S1_RPS1_repeat_hs4: Ribosomal protein S1 (RPS1) domain. RPS1 is a component of the small ribosomal subunit thought to be involved in the recognition and binding of mRNA's during translation initiation. The bacterial RPS1 domain architecture consists...; Region: S1_RPS1_repeat_hs4; cd05692
561275004612	RNA binding site [nucleotide binding]; other site
561275004613	dephospho-CoA kinase/protein folding accessory domain-containing protein; Provisional; Region: coaE; PRK03333
561275004614	Dephospho-coenzyme A kinase (DPCK, EC 2.7.1.24) catalyzes the phosphorylation of dephosphocoenzyme A (dCoA) to yield CoA, which is the final step in CoA biosynthesis; Region: DPCK; cd02022
561275004615	CoA-binding site [chemical binding]; other site
561275004616	ATP-binding [chemical binding]; other site
561275004617	Uncharacterized conserved protein [Function unknown]; Region: GrpB; COG2320
561275004618	Predicted RNA-binding protein, associated with RNAses E/G family [General function prediction only]; Region: COG2306
561275004619	excinuclease ABC subunit B; Provisional; Region: PRK05298
561275004620	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
561275004621	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
561275004622	nucleotide binding region [chemical binding]; other site
561275004623	ATP-binding site [chemical binding]; other site
561275004624	Ultra-violet resistance protein B; Region: UvrB; pfam12344
561275004625	UvrB/uvrC motif; Region: UVR; pfam02151
561275004626	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
561275004627	Major Facilitator Superfamily; Region: MFS_1; pfam07690
561275004628	putative substrate translocation pore; other site
561275004629	Predicted membrane protein [Function unknown]; Region: COG5305
561275004630	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
561275004631	Ligand Binding Site [chemical binding]; other site
561275004632	Zn-dependent hydrolases, including glyoxylases [General function prediction only]; Region: GloB; COG0491
561275004633	excinuclease ABC subunit A; Reviewed; Region: uvrA; PRK00349
561275004634	ATP-binding cassette domain I of the excision repair protein UvrA; Region: ABC_UvrA_I; cd03270
561275004635	ATP-binding cassette domain I of the excision repair protein UvrA; Region: ABC_UvrA_I; cd03270
561275004636	ATP-binding cassette domain II of the excision repair protein UvrA; Region: ABC_UvrA_II; cd03271
561275004637	Phage shock protein A (IM30), suppresses sigma54-dependent transcription [Transcription / Signal transduction mechanisms]; Region: PspA; COG1842
561275004638	Predicted esterase [General function prediction only]; Region: COG0627
561275004639	lysyl-tRNA synthetase; Provisional; Region: lysS; PRK02983
561275004640	Uncharacterized conserved protein (DUF2156); Region: DUF2156; pfam09924
561275004641	LysRS_N: N-terminal, anticodon recognition domain of lysyl-tRNA synthetases (LysRS). These enzymes are homodimeric class 2b aminoacyl-tRNA synthetases (aaRSs). This domain is a beta-barrel domain (OB fold) involved in binding the tRNA anticodon stem-loop; Region: LysRS_N; cd04322
561275004642	dimer interface [polypeptide binding]; other site
561275004643	putative anticodon binding site; other site
561275004644	Class II tRNA amino-acyl synthetase-like catalytic core domain. Class II amino acyl-tRNA synthetases (aaRS) share a common fold and generally attach an amino acid to the 3' OH of ribose of the appropriate tRNA.   PheRS is an exception in that it...; Region: class_II_aaRS-like_core; cl00268
561275004645	motif 1; other site
561275004646	dimer interface [polypeptide binding]; other site
561275004647	active site
561275004648	motif 2; other site
561275004649	motif 3; other site
561275004650	translation initiation factor IF-3; Reviewed; Region: infC; PRK00028
561275004651	Translation initiation factor IF-3, N-terminal domain; Region: IF3_N; pfam05198
561275004652	Translation initiation factor IF-3, C-terminal domain; Region: IF3_C; pfam00707
561275004653	50S ribosomal protein L35; Reviewed; Region: rpmI; PRK00172
561275004654	Ribosomal protein L20; Region: Ribosomal_L20; cd07026
561275004655	23S rRNA binding site [nucleotide binding]; other site
561275004656	L21 binding site [polypeptide binding]; other site
561275004657	L13 binding site [polypeptide binding]; other site
561275004658	rRNA methylases [Translation, ribosomal structure and biogenesis]; Region: SpoU; COG0566
561275004659	SpoU rRNA Methylase family; Region: SpoU_methylase; pfam00588
561275004660	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3662
561275004661	PE family; Region: PE; pfam00934
561275004662	Adenylate cyclase, family 3 (some proteins contain HAMP domain) [Signal transduction mechanisms]; Region: CyaA; COG2114
561275004663	cyclase homology domain; Region: CHD; cd07302
561275004664	nucleotidyl binding site; other site
561275004665	metal binding site [ion binding]; metal-binding site
561275004666	dimer interface [polypeptide binding]; other site
561275004667	phenylalanyl-tRNA synthetase subunit alpha; Validated; Region: pheS; PRK00488
561275004668	Aminoacyl tRNA synthetase class II, N-terminal domain; Region: Phe_tRNA-synt_N; pfam02912
561275004669	Phenylalanyl-tRNA synthetase (PheRS) alpha chain catalytic core domain. PheRS belongs to class II aminoacyl-tRNA synthetases (aaRS) based upon its structure and the presence of three characteristic sequence motifs. This domain is primarily responsible...; Region: PheRS_alpha_core; cd00496
561275004670	dimer interface [polypeptide binding]; other site
561275004671	motif 1; other site
561275004672	active site
561275004673	motif 2; other site
561275004674	motif 3; other site
561275004675	phenylalanyl-tRNA synthetase subunit beta; Reviewed; Region: pheT; PRK00629
561275004676	tRNA-binding-domain-containing prokaryotic phenylalanly tRNA synthetase (PheRS) beta chain.  PheRS aminoacylate phenylalanine transfer RNAs (tRNAphe). PheRSs belong structurally to class II aminoacyl tRNA synthetases (aaRSs) but, as they aminoacylate...; Region: tRNA_bind_bactPheRS; cd02796
561275004677	putative tRNA-binding site [nucleotide binding]; other site
561275004678	B3/4 domain; Region: B3_4; pfam03483
561275004679	tRNA synthetase B5 domain; Region: B5; smart00874
561275004680	Phenylalanyl-tRNA synthetase (PheRS) beta chain core domain. PheRS belongs to class II aminoacyl-tRNA synthetases (aaRS) based upon its structure. While class II aaRSs generally aminoacylate the 3'-OH ribose of the appropriate tRNA,  PheRS is an...; Region: PheRS_beta_core; cd00769
561275004681	dimer interface [polypeptide binding]; other site
561275004682	motif 1; other site
561275004683	motif 3; other site
561275004684	motif 2; other site
561275004685	Ferredoxin-fold anticodon binding domain; Region: FDX-ACB; pfam03147
561275004686	PE family; Region: PE; pfam00934
561275004687	N-acetyl-gamma-glutamyl-phosphate reductase, common form; Region: argC; TIGR01850
561275004688	Semialdehyde dehydrogenase, NAD binding domain; Region: Semialdhyde_dh; smart00859
561275004689	Ornithine acetyltransferase (OAT) family; also referred to as ArgJ. OAT catalyzes the first and fifth steps in arginine biosynthesis, coupling acetylation of glutamate with deacetylation of N-acetylornithine, which allows recycling of the acetyl group in...; Region: OAT; cd02152
561275004690	heterotetramer interface [polypeptide binding]; other site
561275004691	active site pocket [active]
561275004692	cleavage site
561275004693	AAK_NAGK-C: N-Acetyl-L-glutamate kinase - cyclic (NAGK-C) catalyzes the phosphorylation of the gamma-COOH group of N-acetyl-L-glutamate (NAG) by ATP in the second step of arginine biosynthesis found in some bacteria and photosynthetic organisms using the...; Region: AAK_NAGK-C; cd04250
561275004694	feedback inhibition sensing region; other site
561275004695	homohexameric interface [polypeptide binding]; other site
561275004696	nucleotide binding site [chemical binding]; other site
561275004697	N-acetyl-L-glutamate binding site [chemical binding]; other site
561275004698	acetylornithine aminotransferase; Provisional; Region: argD; PRK03244
561275004699	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
561275004700	inhibitor-cofactor binding pocket; inhibition site
561275004701	pyridoxal 5'-phosphate binding site [chemical binding]; other site
561275004702	catalytic residue [active]
561275004703	ornithine carbamoyltransferase; Provisional; Region: PRK00779
561275004704	Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding domain; Region: OTCace_N; pfam02729
561275004705	Aspartate/ornithine carbamoyltransferase, Asp/Orn binding domain; Region: OTCace; pfam00185
561275004706	arginine repressor; Provisional; Region: PRK03341
561275004707	Arginine repressor, DNA binding domain; Region: Arg_repressor; pfam01316
561275004708	Arginine repressor, C-terminal domain; Region: Arg_repressor_C; pfam02863
561275004709	argininosuccinate synthase; Provisional; Region: PRK13820
561275004710	Argininosuccinate synthase. The Argininosuccinate synthase is a urea cycle enzyme that catalyzes the penultimate step in arginine biosynthesis: the ATP-dependent ligation of citrulline to aspartate to form argininosuccinate, AMP and pyrophosphate .  In...; Region: Argininosuccinate_Synthase; cd01999
561275004711	ANP binding site [chemical binding]; other site
561275004712	Substrate Binding Site II [chemical binding]; other site
561275004713	Substrate Binding Site I [chemical binding]; other site
561275004714	argininosuccinate lyase; Provisional; Region: PRK00855
561275004715	Argininosuccinate lyase (argininosuccinase, ASAL); Region: Argininosuccinate_lyase; cd01359
561275004716	active sites [active]
561275004717	tetramer interface [polypeptide binding]; other site
561275004718	Predicted naringenin-chalcone synthase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: BcsA; COG3424
561275004719	Chalcone and stilbene synthases; plant-specific polyketide synthases (PKS) and related enzymes, also called type III PKSs. PKS generate an array of different products, dependent on the nature of the starter molecule. They share a common chemical strategy; Region: CHS_like; cd00831
561275004720	malonyl-CoA binding site [chemical binding]; other site
561275004721	dimer interface [polypeptide binding]; other site
561275004722	active site
561275004723	product binding site; other site
561275004724	Polyketide synthase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3321
561275004725	polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833
561275004726	active site
561275004727	Acyl transferase domain in polyketide synthase (PKS) enzymes; Region: PKS_AT; smart00827
561275004728	Dehydratase domain in polyketide synthase (PKS) enzymes; Region: PKS_DH; smart00826
561275004729	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
561275004730	Enoylreductase; Region: PKS_ER; smart00829
561275004731	enoyl reductase of polyketide synthase; Region: enoyl_red; cd05195
561275004732	NAD(P) binding site [chemical binding]; other site
561275004733	beta-ketoacyl reductase (KR) domain of fatty acid synthase (FAS), subgroup 3, complex (x); Region: KR_3_FAS_SDR_x; cd08956
561275004734	This enzymatic domain is part of bacterial polyketide synthases; Region: PKS_KR; smart00822
561275004735	putative NADP binding site [chemical binding]; other site
561275004736	active site
561275004737	Phosphopantetheine attachment site; Region: PKS_PP; smart00823
561275004738	Polyketide synthase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3321
561275004739	polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833
561275004740	active site
561275004741	Acyl transferase domain in polyketide synthase (PKS) enzymes; Region: PKS_AT; smart00827
561275004742	Dehydratase domain in polyketide synthase (PKS) enzymes; Region: PKS_DH; smart00826
561275004743	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
561275004744	enoyl reductase of polyketide synthase; Region: enoyl_red; cd05195
561275004745	Enoylreductase; Region: PKS_ER; smart00829
561275004746	NAD(P) binding site [chemical binding]; other site
561275004747	Medium chain reductase/dehydrogenase (MDR)/zinc-dependent alcohol dehydrogenase-like family; Region: MDR; cl16912
561275004748	beta-ketoacyl reductase (KR) domain of fatty acid synthase (FAS), subgroup 3, complex (x); Region: KR_3_FAS_SDR_x; cd08956
561275004749	This enzymatic domain is part of bacterial polyketide synthases; Region: PKS_KR; smart00822
561275004750	putative NADP binding site [chemical binding]; other site
561275004751	active site
561275004752	Phosphopantetheine attachment site; Region: PKS_PP; smart00823
561275004753	Beta-ketoacyl synthase; Region: PKS_KS; smart00825
561275004754	polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833
561275004755	active site
561275004756	malonyl CoA-acyl carrier protein transacylase; Region: fabD; TIGR00128
561275004757	Acyl transferase domain in polyketide synthase (PKS) enzymes; Region: PKS_AT; smart00827
561275004758	Phosphopantetheine attachment site; Region: PKS_PP; smart00823
561275004759	Predicted naringenin-chalcone synthase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: BcsA; COG3424
561275004760	Chalcone and stilbene synthases; plant-specific polyketide synthases (PKS) and related enzymes, also called type III PKSs. PKS generate an array of different products, dependent on the nature of the starter molecule. They share a common chemical strategy; Region: CHS_like; cd00831
561275004761	malonyl-CoA binding site [chemical binding]; other site
561275004762	dimer interface [polypeptide binding]; other site
561275004763	active site
561275004764	product binding site; other site
561275004765	Cytochrome P450; Region: p450; cl12078
561275004766	Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124
561275004767	ATPase components of ABC transporters with duplicated ATPase domains [General function prediction only]; Region: Uup; COG0488
561275004768	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
561275004769	ABC transporter; Region: ABC_tran_2; pfam12848
561275004770	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
561275004771	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2343
561275004772	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
561275004773	putative substrate translocation pore; other site
561275004774	Transglutaminase-like enzymes, putative cysteine proteases [Amino acid transport and metabolism]; Region: COG1305
561275004775	Transglutaminase-like superfamily; Region: Transglut_core; pfam01841
561275004776	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
561275004777	dimerization interface [polypeptide binding]; other site
561275004778	putative DNA binding site [nucleotide binding]; other site
561275004779	putative Zn2+ binding site [ion binding]; other site
561275004780	Rhodanese Homology Domain (RHOD); an alpha beta fold domain found duplicated in the rhodanese protein. The cysteine containing enzymatically active version of the domain is also found in the Cdc25 class of protein phosphatases and a variety of proteins...; Region: RHOD; cl00125
561275004781	active site residue [active]
561275004782	cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases [Signal transduction mechanisms]; Region: Crp; COG0664
561275004783	effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038
561275004784	ligand binding site [chemical binding]; other site
561275004785	flexible hinge region; other site
561275004786	Crp-like helix-turn-helix domain; Region: HTH_Crp_2; pfam13545
561275004787	Peroxiredoxin (PRX)-like 2 family; hypothetical proteins that show sequence similarity to PRXs. Members of this group contain a CXXC motif, similar to TRX. The second cysteine in the motif corresponds to the peroxidatic cysteine of PRX, however, these...; Region: PRX_like2; cd02970
561275004788	putative catalytic residues [active]
561275004789	TlpA-like family, suppressor for copper sensitivity D protein (ScsD) and actinobacterial DsbE homolog subfamily; composed of ScsD, the DsbE homolog of Mycobacterium tuberculosis (MtbDsbE) and similar proteins, all containing a redox-active CXXC motif; Region: TlpA_like_ScsD_MtbDsbE; cd03011
561275004790	Thioredoxin-like; Region: Thioredoxin_8; pfam13905
561275004791	catalytic residues [active]
561275004792	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275004793	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
561275004794	active site
561275004795	ABC-type phosphate/phosphonate transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: PhnD; COG3221
561275004796	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
561275004797	substrate binding pocket [chemical binding]; other site
561275004798	membrane-bound complex binding site; other site
561275004799	Predicted Fe-S oxidoreductases [General function prediction only]; Region: COG0535
561275004800	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
561275004801	FeS/SAM binding site; other site
561275004802	DivIVA protein; Region: DivIVA; pfam05103
561275004803	ATP synthase B/B' CF(0); Region: ATP-synt_B; cl17192
561275004804	acyl-CoA synthetase; Validated; Region: PRK07868
561275004805	PHB de-polymerase C-terminus; Region: PHB_depo_C; pfam06850
561275004806	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
561275004807	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
561275004808	acyl-activating enzyme (AAE) consensus motif; other site
561275004809	AMP binding site [chemical binding]; other site
561275004810	active site
561275004811	CoA binding site [chemical binding]; other site
561275004812	Uncharacterized conserved protein [Function unknown]; Region: COG2835
561275004813	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275004814	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275004815	ABC-type multidrug transport system, permease component [Defense mechanisms]; Region: COG0842
561275004816	ABC-2 type transporter; Region: ABC2_membrane; cl17235
561275004817	ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230
561275004818	ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system; Region: PQQ_ABC_ATP; TIGR03864
561275004819	Walker A/P-loop; other site
561275004820	ATP binding site [chemical binding]; other site
561275004821	Q-loop/lid; other site
561275004822	ABC transporter signature motif; other site
561275004823	Walker B; other site
561275004824	D-loop; other site
561275004825	H-loop/switch region; other site
561275004826	Alkyladenine DNA glycosylase catalyzes the first step in base excision repair; Region: AAG; cd00540
561275004827	active site
561275004828	DNA binding site [nucleotide binding]
561275004829	tyrosyl-tRNA synthetase; Validated; Region: PRK05912
561275004830	catalytic core domain of tyrosinyl-tRNA synthetase; Region: TyrRS_core; cd00805
561275004831	active site
561275004832	HIGH motif; other site
561275004833	dimer interface [polypeptide binding]; other site
561275004834	KMSKS motif; other site
561275004835	S4 RNA-binding domain; Region: S4; smart00363
561275004836	RNA binding surface [nucleotide binding]; other site
561275004837	Protein of unknown function (DUF732); Region: DUF732; pfam05305
561275004838	Tetratrico peptide repeat; Region: TPR_5; pfam12688
561275004839	Predicted sugar phosphatases of the HAD superfamily [Carbohydrate transport and metabolism]; Region: NagD; COG0647
561275004840	Haloacid dehalogenase-like hydrolase; Region: Hydrolase_6; pfam13344
561275004841	HAD-hyrolase-like; Region: Hydrolase_like; pfam13242
561275004842	Predicted rRNA methylase [Translation, ribosomal structure and biogenesis]; Region: COG1189
561275004843	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
561275004844	RNA binding surface [nucleotide binding]; other site
561275004845	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275004846	S-adenosylmethionine binding site [chemical binding]; other site
561275004847	inorganic polyphosphate/ATP-NAD kinase; Provisional; Region: ppnK; PRK03372
561275004848	ATP-NAD kinase; Region: NAD_kinase; pfam01513
561275004849	DNA repair protein RecN; Region: recN; TIGR00634
561275004850	ATP-binding cassette domain of RecN; Region: ABC_RecN; cd03241
561275004851	Walker A/P-loop; other site
561275004852	ATP binding site [chemical binding]; other site
561275004853	Q-loop/lid; other site
561275004854	ATP-binding cassette domain of RecN; Region: ABC_RecN; cd03241
561275004855	ABC transporter signature motif; other site
561275004856	Walker B; other site
561275004857	D-loop; other site
561275004858	H-loop/switch region; other site
561275004859	Uncharacterized membrane-anchored protein conserved in bacteria [Function unknown]; Region: COG4825
561275004860	Thiamine pyrophosphokinase; Region: TPK; cl08415
561275004861	Thiamine pyrophosphokinase C terminal; Region: TPPK_C; pfam12555
561275004862	Protein of unknown function (DUF3186); Region: DUF3186; pfam11382
561275004863	CTP synthetase; Validated; Region: pyrG; PRK05380
561275004864	CTP synthetase (CTPs) is a two-domain protein, which consists of an N-terminal synthetase domain and C-terminal glutaminase domain. The enzymes hydrolyze the amide bond of glutamine to ammonia and glutamate at the glutaminase domains and transfer nascent...; Region: CTGs; cd03113
561275004865	Catalytic site [active]
561275004866	active site
561275004867	UTP binding site [chemical binding]; other site
561275004868	Type 1 glutamine amidotransferase (GATase1) domain found in Cytidine Triphosphate Synthetase; Region: GATase1_CTP_Synthase; cd01746
561275004869	active site
561275004870	putative oxyanion hole; other site
561275004871	catalytic triad [active]
561275004872	ADP-ribose pyrophosphatase (ADPRase) catalyzes the hydrolysis of ADP-ribose and a variety of additional ADP-sugar conjugates to AMP and ribose-5-phosphate. Like other members of the Nudix hydrolase superfamily, it requires a divalent cation, such as Mg2+; Region: ADPRase_NUDT5; cd03424
561275004873	dimer interface [polypeptide binding]; other site
561275004874	ADP-ribose binding site [chemical binding]; other site
561275004875	active site
561275004876	nudix motif; other site
561275004877	metal binding site [ion binding]; metal-binding site
561275004878	site-specific tyrosine recombinase XerD; Reviewed; Region: xerD; PRK00283
561275004879	DNA breaking-rejoining enzymes, C-terminal catalytic domain. The DNA breaking-rejoining enzyme superfamily includes type IB topoisomerases and tyrosine recombinases that share the same fold in their catalytic domain containing six conserved active site...; Region: DNA_BRE_C; cl00213
561275004880	active site
561275004881	DNA binding site [nucleotide binding]
561275004882	Int/Topo IB signature motif; other site
561275004883	Domain of unknown function (DUF222); Region: DUF222; pfam02720
561275004884	HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085
561275004885	active site
561275004886	Predicted O-methyltransferase [General function prediction only]; Region: COG4122
561275004887	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275004888	S-adenosylmethionine binding site [chemical binding]; other site
561275004889	D-alanine/D-serine/glycine permease; Provisional; Region: PRK11049
561275004890	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275004891	PPE family; Region: PPE; pfam00823
561275004892	Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484
561275004893	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275004894	PPE family; Region: PPE; pfam00823
561275004895	Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484
561275004896	Sulfate permease and related transporters (MFS superfamily) [Inorganic ion transport and metabolism]; Region: SUL1; COG0659
561275004897	Sulfate transporter family; Region: Sulfate_transp; pfam00916
561275004898	Sulphate Transporter and Anti-Sigma factor antagonist domain of SulP-like sulfate transporters, plays a role in the function and regulation of the transport activity, proposed general NTP binding function; Region: STAS_SulP_like_sulfate_transporter; cd07042
561275004899	ATPases involved in chromosome partitioning [Cell division and chromosome partitioning]; Region: Soj; COG1192
561275004900	ParA and ParB of Caulobacter crescentus belong to a conserved family of bacterial proteins implicated in chromosome segregation. ParB binds to DNA sequences adjacent to the origin of replication and localizes to opposite cell poles shortly following the...; Region: ParA; cd02042
561275004901	P-loop; other site
561275004902	Magnesium ion binding site [ion binding]; other site
561275004903	ParA and ParB of Caulobacter crescentus belong to a conserved family of bacterial proteins implicated in chromosome segregation. ParB binds to DNA sequences adjacent to the origin of replication and localizes to opposite cell poles shortly following the...; Region: ParA; cd02042
561275004904	Magnesium ion binding site [ion binding]; other site
561275004905	Rec8/ScpA/Scc1-like protein (kleisin family) [Replication,    recombination, and repair]; Region: scpA; COG1354
561275004906	Chromosome segregation and condensation protein B [DNA replication, recombination and repair]; Region: scpB; COG1386
561275004907	16S rRNA uridine-516 pseudouridylate synthase and related pseudouridylate synthases [Translation, ribosomal structure and biogenesis]; Region: RsuA; COG1187
561275004908	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
561275004909	RNA binding surface [nucleotide binding]; other site
561275004910	Pseudouridine synthases, RsuA subfamily; Region: PseudoU_synth_RsuA_like; cd02870
561275004911	active site
561275004912	cytidylate kinase; Provisional; Region: cmk; PRK00023
561275004913	Cytidine monophosphate kinase (CMPK) catalyzes the reversible phosphorylation of cytidine monophosphate (CMP) to produce cytidine diphosphate (CDP), using ATP as the preferred phosphoryl donor; Region: CMPK; cd02020
561275004914	CMP-binding site; other site
561275004915	The sites determining sugar specificity; other site
561275004916	GTP-binding protein Der; Reviewed; Region: PRK03003
561275004917	EngA1 GTPase contains the first domain of EngA; Region: EngA1; cd01894
561275004918	GTP/Mg2+ binding site [chemical binding]; other site
561275004919	Switch I region; other site
561275004920	G2 box; other site
561275004921	Switch II region; other site
561275004922	G3 box; other site
561275004923	G4 box; other site
561275004924	G5 box; other site
561275004925	EngA2 GTPase contains the second domain of EngA; Region: EngA2; cd01895
561275004926	G1 box; other site
561275004927	GTP/Mg2+ binding site [chemical binding]; other site
561275004928	Switch I region; other site
561275004929	G2 box; other site
561275004930	G3 box; other site
561275004931	Switch II region; other site
561275004932	G4 box; other site
561275004933	G5 box; other site
561275004934	short chain dehydrogenase; Provisional; Region: PRK07060
561275004935	classical (c) SDRs; Region: SDR_c; cd05233
561275004936	NAD(P) binding site [chemical binding]; other site
561275004937	active site
561275004938	3-hydroxyacyl-CoA dehydrogenase [Lipid metabolism]; Region: FadB; COG1250
561275004939	3-hydroxyacyl-CoA dehydrogenase, NAD binding domain; Region: 3HCDH_N; pfam02737
561275004940	3-hydroxyacyl-CoA dehydrogenase, C-terminal domain; Region: 3HCDH; pfam00725
561275004941	Kynurenine formamidase [Amino acid transport and metabolism]; Region: COG1878
561275004942	Cupin domain; Region: Cupin_2; pfam07883
561275004943	Prokaryotic protein of unknown function (DUF849); Region: DUF849; pfam05853
561275004944	Transcriptional regulator [Transcription]; Region: IclR; COG1414
561275004945	helix_turn_helix, cAMP Regulatory protein C-terminus; DNA binding domain of prokaryotic regulatory proteins belonging to the catabolite activator protein family; Region: HTH_CRP; cd00092
561275004946	putative switch regulator; other site
561275004947	non-specific DNA interactions [nucleotide binding]; other site
561275004948	DNA binding site [nucleotide binding]
561275004949	sequence specific DNA binding site [nucleotide binding]; other site
561275004950	putative cAMP binding site [chemical binding]; other site
561275004951	Bacterial transcriptional regulator; Region: IclR; pfam01614
561275004952	PIN domain of the Pyrobaculum aerophilum Pae0151 and Pae2754 proteins and homologs; Region: PIN_Pae0151; cd09873
561275004953	putative active site [active]
561275004954	homotetrameric interface [polypeptide binding]; other site
561275004955	metal binding site [ion binding]; metal-binding site
561275004956	biotin carboxylase-like protein; Validated; Region: PRK06524
561275004957	ATP-grasp domain; Region: ATP-grasp_4; pfam13535
561275004958	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
561275004959	Beta-lactamase; Region: Beta-lactamase; pfam00144
561275004960	Predicted transcriptional regulators [Transcription]; Region: COG1733
561275004961	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
561275004962	dimerization interface [polypeptide binding]; other site
561275004963	putative DNA binding site [nucleotide binding]; other site
561275004964	putative Zn2+ binding site [ion binding]; other site
561275004965	Predicted transcriptional regulators [Transcription]; Region: COG1733
561275004966	FAD/FMN-containing dehydrogenases [Energy production and conversion]; Region: GlcD; COG0277
561275004967	FAD binding domain; Region: FAD_binding_4; pfam01565
561275004968	Berberine and berberine like; Region: BBE; pfam08031
561275004969	TIGR03086 family protein; Region: TIGR03086
561275004970	uncharacterized Actinobacterial protein TIGR03083; Region: TIGR03083
561275004971	O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315
561275004972	methyltransferase, TIGR00027 family; Region: mthyl_TIGR00027
561275004973	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
561275004974	Beta-lactamase; Region: Beta-lactamase; pfam00144
561275004975	succinic semialdehyde dehydrogenase; Reviewed; Region: gabD2; PRK09407
561275004976	Mycobacterium tuberculosis succinate-semialdehyde dehydrogenase 2-like; Region: ALDH_SSADH2_GabD2; cd07101
561275004977	NAD(P) binding site [chemical binding]; other site
561275004978	catalytic residues [active]
561275004979	Peroxiredoxin (PRX)-like 1 family; hypothetical proteins that show sequence similarity to PRXs. Members of this group contain a conserved cysteine that aligns to the first cysteine in the CXXC motif of TRX. This does not correspond to the peroxidatic...; Region: PRX_like1; cd02969
561275004980	putative catalytic residue [active]
561275004981	Pyruvate/2-oxoglutarate dehydrogenase complex, dihydrolipoamide acyltransferase (E2) component, and related enzymes [Energy production and conversion]; Region: AceF; COG0508
561275004982	2-oxoacid dehydrogenases acyltransferase (catalytic domain); Region: 2-oxoacid_dh; pfam00198
561275004983	Tellurite resistance protein and related permeases [Inorganic ion transport and metabolism]; Region: TehA; COG1275
561275004984	The Tellurite-resistance/Dicarboxylate Transporter (TDT) family; Region: TDT_like_1; cd09319
561275004985	gating phenylalanine in ion channel; other site
561275004986	Molybdopterin-Binding (MopB) domain of the MopB superfamily of proteins, a  large, diverse, heterogeneous superfamily of enzymes that, in general, bind molybdopterin as a cofactor. The MopB domain is found in a wide variety of molybdenum- and...; Region: Molybdopterin-Binding; cl09928
561275004987	Nitrate reductase delta subunit [Energy production and conversion]; Region: NarJ; COG2180
561275004988	Nitrate reductase gamma subunit; Region: Nitrate_red_gam; pfam02665
561275004989	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
561275004990	nitrite extrusion protein (nitrite facilitator); Region: 2A0108; TIGR00886
561275004991	putative substrate translocation pore; other site
561275004992	Domain of unknown function (DUF1876); Region: DUF1876; pfam08962
561275004993	Sulfate permease and related transporters (MFS superfamily) [Inorganic ion transport and metabolism]; Region: SUL1; COG0659
561275004994	Sulfate transporter N-terminal domain with GLY motif; Region: Sulfate_tra_GLY; pfam13792
561275004995	Sulfate transporter family; Region: Sulfate_transp; pfam00916
561275004996	Sulphate Transporter and Anti-Sigma factor antagonist domain of SulP-like sulfate transporters, plays a role in the function and regulation of the transport activity, proposed general NTP binding function; Region: STAS_SulP_like_sulfate_transporter; cd07042
561275004997	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4423
561275004998	PIN (PilT N terminus) domain: Superfamily; Region: PIN_SF; cl14812
561275004999	putative active site [active]
561275005000	Protein tyrosine kinase; Region: Pkinase_Tyr; pfam07714
561275005001	Catalytic domain of Protein Kinases; Region: PKc; cd00180
561275005002	active site
561275005003	ATP binding site [chemical binding]; other site
561275005004	substrate binding site [chemical binding]; other site
561275005005	activation loop (A-loop); other site
561275005006	Protein-disulfide isomerase [Posttranslational modification, protein turnover, chaperones]; Region: DsbG; COG1651
561275005007	Thioredoxin; Region: Thioredoxin_4; cl17273
561275005008	Isopentenyldiphosphate isomerase [Lipid metabolism]; Region: Idi; COG1443
561275005009	Isopentenyl diphosphate (IPP) isomerase, a member of the Nudix hydrolase superfamily, is a key enzyme in the isoprenoid biosynthetic pathway. Isoprenoids comprise a large family of natural products including sterols, carotenoids, dolichols and prenylated...; Region: IPP_Isomerase; cd02885
561275005010	active site
561275005011	metal binding site [ion binding]; metal-binding site
561275005012	nudix motif; other site
561275005013	Serine/Threonine protein kinases, catalytic domain; Region: S_TKc; smart00220
561275005014	Catalytic domain of Protein Kinases; Region: PKc; cd00180
561275005015	active site
561275005016	ATP binding site [chemical binding]; other site
561275005017	substrate binding site [chemical binding]; other site
561275005018	activation loop (A-loop); other site
561275005019	FOG: FHA domain [Signal transduction mechanisms]; Region: COG1716
561275005020	Forkhead associated domain (FHA); found in eukaryotic and prokaryotic proteins. Putative nuclear signalling domain. FHA domains may bind phosphothreonine, phosphoserine and sometimes phosphotyrosine. In eukaryotes, many FHA domain-containing proteins...; Region: FHA; cd00060
561275005021	phosphopeptide binding site; other site
561275005022	FOG: FHA domain [Signal transduction mechanisms]; Region: COG1716
561275005023	Forkhead associated domain (FHA); found in eukaryotic and prokaryotic proteins. Putative nuclear signalling domain. FHA domains may bind phosphothreonine, phosphoserine and sometimes phosphotyrosine. In eukaryotes, many FHA domain-containing proteins...; Region: FHA; cd00060
561275005024	phosphopeptide binding site; other site
561275005025	Eye pigment and drug resistance transporter subfamily G of the ATP-binding cassette superfamily; Region: ABCG_EPDR; cd03213
561275005026	The Eye Pigment Precursor Transporter (EPP) Family protein; Region: 3a01204; TIGR00955
561275005027	Walker A/P-loop; other site
561275005028	ATP binding site [chemical binding]; other site
561275005029	Q-loop/lid; other site
561275005030	ABC transporter signature motif; other site
561275005031	Walker B; other site
561275005032	D-loop; other site
561275005033	H-loop/switch region; other site
561275005034	ABC-2 type transporter; Region: ABC2_membrane; pfam01061
561275005035	acyl-CoA synthetase; Provisional; Region: PRK13388
561275005036	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
561275005037	acyl-activating enzyme (AAE) consensus motif; other site
561275005038	AMP binding site [chemical binding]; other site
561275005039	active site
561275005040	CoA binding site [chemical binding]; other site
561275005041	hypothetical protein; Provisional; Region: PRK06185
561275005042	ubiquinone biosynthesis hydroxylase family protein; Provisional; Region: PRK07608; cl17314
561275005043	ubiquinone biosynthesis hydroxylase family protein; Provisional; Region: PRK07608; cl17314
561275005044	Predicted dehydrogenases and related proteins [General function prediction only]; Region: MviM; COG0673
561275005045	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275005046	PPE family; Region: PPE; pfam00823
561275005047	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275005048	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275005049	Domain of unknown function (DUF4185); Region: DUF4185; pfam13810
561275005050	Phospholipase C [Cell envelope biogenesis, outer membrane]; Region: PlcC; COG3511
561275005051	Phosphoesterase family; Region: Phosphoesterase; pfam04185
561275005052	RvD2, 6804 bp. Region of difference RvD2, substituted region in Mycobacterium bovis BCG Pasteur (position 1992782..1999585, 6804bp), BCG Tokyo (position 1965684..1972487, 6804bp) and Mycobacterium bovis AF2122/97 (position 1973095..1979898, 6804bp) compared to Mycobacterium tuberculosis H37Rv2 (position: 1987703..1989057, 1355bp). In Mycobacterium bovis BCG Pasteur and Mycobacterium bovis AF2122/97, this region encodes genes equivalent to Mycobacterium tuberculosis strain CDC1551, MT1800-MT1802 and complete gene for plcDand cut1. In Mycobacterium tuberculosis strain H37Rv, insertion of an IS6110 element (encoding genes Rv1756c and Rv1757c) removes genes MT1800-MT1802 and truncates plcD(Rv1555c) and cut1(Rv1758)
561275005053	Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438
561275005054	This family is most closely related to the GT1 family of glycosyltransferases. Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. The acceptor molecule can...; Region: GT1_like_2; cd03814
561275005055	sulfite oxidase; Provisional; Region: PLN00177
561275005056	Subgroup of sulfite oxidase (SO) family molybdopterin binding domains that contains conserved dimerization domain. This molybdopterin cofactor (Moco) binding domain is found in a variety of oxidoreductases, main members of this family are nitrate...; Region: SO_family_Moco_dimer; cd02110
561275005057	Moco binding site; other site
561275005058	metal coordination site [ion binding]; other site
561275005059	dimerization interface [polypeptide binding]; other site
561275005060	Transport protein; Region: actII; TIGR00833
561275005061	Cutinase; Region: Cutinase; pfam01083
561275005062	acyltransferase, WS/DGAT/MGAT; Region: acyl_WS_DGAT; TIGR02946
561275005063	Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007
561275005064	Uncharacterized conserved protein [Function unknown]; Region: COG0393
561275005065	Putative heavy-metal-binding; Region: YbjQ_1; cl00426
561275005066	RvD3, 953 bp/1352 bp. Region of difference RvD3, substituted region in Mycobacterium bovis BCG Pasteur (position 2006573..2007525, 953 bp), BCG Tokyo (position 1979478..1980430, 953bp) and Mycobacterium bovis AF2122/97 (position 1986940..1987892, 953bp) compared to Mycobacterium tuberculosis strain H37Rv (position 1996101..1997452, 1352bp). In Mycobacterium tuberculosis strain H37Rv, this region bears a copy of IS6110 while in Mycobacterium bovis BCG Pasteur and Mycobacterium bovis AF2122/97, this region encodes 2 genes, also found in Mycobacterium tuberculosis strain CDC1551, MT1812 and MT1813
561275005067	Domain of unknown function (DUF222); Region: DUF222; pfam02720
561275005068	HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085
561275005069	active site
561275005070	RD14, 9068 bp. Region of difference RD14, deleted region in Mycobacterium bovis BCG Pasteur (position 2008298..2008299) compared to Mycobacterium tuberculosis H37Rv2 (position: 1998226..2007293) and Mycobacterium bovis AF2122/97 (position 1988666..1997751). Removes genes Rv1765A-Rv1772 and merges truncated genes Rv1773c and Rv1765c
561275005071	Integrase core domain; Region: rve; pfam00665
561275005072	Transcriptional regulators CsoR (copper-sensitive operon repressor), RcnR, and FrmR, and related domains; this domain superfamily was previously known as DUF156; Region: CsoR-like_DUF156; cd10148
561275005073	putative homotetramer interface [polypeptide binding]; other site
561275005074	putative homodimer interface [polypeptide binding]; other site
561275005075	putative allosteric switch controlling residues; other site
561275005076	putative metal binding site [ion binding]; other site
561275005077	putative homodimer-homodimer interface [polypeptide binding]; other site
561275005078	Uncharacterized homolog of gamma-carboxymuconolactone decarboxylase subunit [Function unknown]; Region: COG0599
561275005079	PE family; Region: PE; pfam00934
561275005080	Predicted amino acid aldolase or racemase [Amino acid transport and metabolism]; Region: COG3616
561275005081	Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzymes Similar to D-Serine Dehydratase and D-Threonine Aldolase, Unknown Group 2; Region: PLPDE_III_DSD_D-TA_like_2; cd06813
561275005082	dimer interface [polypeptide binding]; other site
561275005083	active site
561275005084	pyridoxal 5'-phosphate (PLP) binding site [chemical binding]; other site
561275005085	substrate binding site [chemical binding]; other site
561275005086	catalytic residue [active]
561275005087	Predicted aminopeptidases [General function prediction only]; Region: Iap; COG2234
561275005088	Zinc peptidases M18, M20, M28, and M42; Region: Zinc_peptidase_like; cl14876
561275005089	metal binding site [ion binding]; metal-binding site
561275005090	FAD-linked oxidoreductase; Region: bact_FAD_ox; TIGR01679
561275005091	FAD binding domain; Region: FAD_binding_4; pfam01565
561275005092	D-arabinono-1,4-lactone oxidase; Region: ALO; pfam04030
561275005093	ANTAR (AmiR and NasR transcription antitermination regulators) is an RNA-binding domain found in bacterial transcription antitermination regulatory proteins; Region: ANTAR; smart01012
561275005094	helix_turn_helix isocitrate lyase regulation; Region: HTH_ICLR; smart00346
561275005095	Transcriptional regulator [Transcription]; Region: IclR; COG1414
561275005096	Bacterial transcriptional regulator; Region: IclR; pfam01614
561275005097	FAD/FMN-containing dehydrogenases [Energy production and conversion]; Region: GlcD; COG0277
561275005098	FAD binding domain; Region: FAD_binding_4; pfam01565
561275005099	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275005100	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275005101	Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124
561275005102	Cytochrome P450; Region: p450; cl12078
561275005103	Domain of unknown function (DUF4407); Region: DUF4407; pfam14362
561275005104	4-alpha-glucanotransferase [Carbohydrate transport and metabolism]; Region: MalQ; COG1640
561275005105	Protein of unknown function (DUF690); Region: DUF690; pfam05108
561275005106	type VII secretion protein EccCa; Region: T7SS_EccC_a; TIGR03924
561275005107	FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580
561275005108	type VII secretion protein EccCb; Region: T7SS_EccC_b; TIGR03925
561275005109	FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580
561275005110	Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124
561275005111	Cytochrome P450; Region: p450; cl12078
561275005112	Ferredoxin [Energy production and conversion]; Region: Fer; COG1141
561275005113	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275005114	PPE family; Region: PPE; pfam00823
561275005115	Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484
561275005116	PE family; Region: PE; pfam00934
561275005117	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275005118	PPE family; Region: PPE; pfam00823
561275005119	Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484
561275005120	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275005121	PPE family; Region: PPE; pfam00823
561275005122	Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484
561275005123	PE family; Region: PE; pfam00934
561275005124	WXG100 family type VII secretion target; Region: WXG100_ESAT6; TIGR03930
561275005125	Proteins of 100 residues with WXG; Region: WXG100; pfam06013
561275005126	EspG family; Region: ESX-1_EspG; pfam14011
561275005127	type VII secretion integral membrane protein EccD; Region: T7SS_EccD; TIGR03920
561275005128	Peptidase domain in the S8 and S53 families; Region: Peptidases_S8_S53; cl10459
561275005129	catalytic residues [active]
561275005130	type VII secretion-associated serine protease mycosin; Region: T7SS_mycosin; TIGR03921
561275005131	Peptidase domain in the S8 and S53 families; Region: Peptidases_S8_S53; cd00306
561275005132	active site
561275005133	catalytic residues [active]
561275005134	type VII secretion protein EccE; Region: T7SS_EccE; TIGR03923
561275005135	type VII secretion AAA-ATPase EccA; Region: T7SS_EccA; TIGR03922
561275005136	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
561275005137	Walker A motif; other site
561275005138	ATP binding site [chemical binding]; other site
561275005139	Walker B motif; other site
561275005140	arginine finger; other site
561275005141	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275005142	PPE family; Region: PPE; pfam00823
561275005143	PE-PPE domain; Region: PE-PPE; pfam08237
561275005144	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275005145	PPE family; Region: PPE; pfam00823
561275005146	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275005147	PPE family; Region: PPE; pfam00823
561275005148	PE family; Region: PE; pfam00934
561275005149	Protein of unknown function (DUF732); Region: DUF732; pfam05305
561275005150	PE family; Region: PE; pfam00934
561275005151	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275005152	PPE family; Region: PPE; pfam00823
561275005153	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275005154	PPE family; Region: PPE; pfam00823
561275005155	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275005156	PPE family; Region: PPE; pfam00823
561275005158	Protein of unknown function (DUF732); Region: DUF732; pfam05305
561275005159	Uncharacterized membrane protein [Function unknown]; Region: SapB; COG1285
561275005160	MgtC family; Region: MgtC; pfam02308
561275005161	NADH dehydrogenase, FAD-containing subunit [Energy production and conversion]; Region: Ndh; COG1252
561275005162	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
561275005163	Domain of unknown function (DUF4189); Region: DUF4189; pfam13827
561275005164	Sterol desaturase [Lipid metabolism]; Region: ERG3; COG3000
561275005165	Fatty acid hydroxylase superfamily; Region: FA_hydroxylase; pfam04116
561275005166	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275005167	similar to hypothetical protein
561275005168	hypothetical protein; Validated; Region: PRK07121
561275005169	PE family; Region: PE; pfam00934
561275005170	ABC-type uncharacterized transport system, permease and ATPase components [General function prediction only]; Region: COG4178
561275005171	ABC transporter transmembrane region 2; Region: ABC_membrane_2; pfam06472
561275005172	ATP-binding cassette domain of peroxisomal transporter, subfamily D; Region: ABCD_peroxisomal_ALDP; cd03223
561275005173	hypothetical protein; Provisional; Region: PRK05858
561275005174	Pyrimidine (PYR) binding domain of POX and related proteins; Region: TPP_PYR_POX_like; cd07035
561275005175	PYR/PP interface [polypeptide binding]; other site
561275005176	dimer interface [polypeptide binding]; other site
561275005177	TPP binding site [chemical binding]; other site
561275005178	Thiamine pyrophosphate enzyme, central domain; Region: TPP_enzyme_M; pfam00205
561275005179	Thiamine pyrophosphate (TPP) family, BZL_OCoD_HPCL subfamily, TPP-binding module; composed of proteins similar to benzaldehyde lyase (BZL), oxalyl-CoA decarboxylase (OCoD) and 2-hydroxyphytanoyl-CoA lyase (2-HPCL). Pseudomonas fluorescens biovar I BZL...; Region: TPP_BZL_OCoD_HPCL; cd02004
561275005180	TPP-binding site; other site
561275005181	dimer interface [polypeptide binding]; other site
561275005182	preprotein translocase subunit SecA; Reviewed; Region: PRK12326
561275005183	SecA preprotein cross-linking domain; Region: SecA_PP_bind; pfam01043
561275005184	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cl17351
561275005185	nucleotide binding region [chemical binding]; other site
561275005186	ATP-binding site [chemical binding]; other site
561275005187	Phosphatidylglycerophosphate synthase [Lipid metabolism]; Region: PgsA; COG0558
561275005188	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3879
561275005189	Bacterial protein of unknown function (DUF881); Region: DUF881; pfam05949
561275005190	Uncharacterized conserved protein (small basic protein) [Function unknown]; Region: Sbp; COG3856
561275005191	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3879
561275005192	Bacterial protein of unknown function (DUF881); Region: DUF881; pfam05949
561275005193	Glycine cleavage H-protein. Glycine cleavage H-proteins are part of the glycine cleavage system (GCS) found in bacteria, archea and the mitochondria of eukaryotes. GCS is a multienzyme complex consisting of 4 different components (P-, H-, T- and...; Region: GCS_H; cd06848
561275005194	lipoyl attachment site [posttranslational modification]; other site
561275005195	FOG: FHA domain [Signal transduction mechanisms]; Region: COG1716
561275005196	Forkhead associated domain (FHA); found in eukaryotic and prokaryotic proteins. Putative nuclear signalling domain. FHA domains may bind phosphothreonine, phosphoserine and sometimes phosphotyrosine. In eukaryotes, many FHA domain-containing proteins...; Region: FHA; cd00060
561275005197	phosphopeptide binding site; other site
561275005198	Helix-Turn-Helix DNA binding domain of MerR-like transcription regulators; Region: HTH_MerR-like; cd00592
561275005199	MerR HTH family regulatory protein; Region: MerR_1; pfam13411
561275005200	DNA binding residues [nucleotide binding]
561275005201	Bifunctional nuclease; Region: DNase-RNase; pfam02577
561275005202	Helix-Turn-Helix DNA binding domain of GlnR-like transcription regulators; Region: HTH_GlnR-like; cd01105
561275005203	DNA binding residues [nucleotide binding]
561275005204	MerR HTH family regulatory protein; Region: MerR_1; pfam13411
561275005205	putative dimer interface [polypeptide binding]; other site
561275005206	glycine dehydrogenase; Provisional; Region: PRK05367
561275005207	Glycine cleavage system P-protein, alpha- and beta-subunits. This family consists of Glycine cleavage system P-proteins EC:1.4.4.2 from bacterial, mammalian and plant sources. The P protein is part of the glycine decarboxylase multienzyme complex EC:2.1; Region: GDC-P; cd00613
561275005208	pyridoxal 5'-phosphate binding site [chemical binding]; other site
561275005209	tetramer interface [polypeptide binding]; other site
561275005210	catalytic residue [active]
561275005211	Glycine cleavage system P-protein, alpha- and beta-subunits. This family consists of Glycine cleavage system P-proteins EC:1.4.4.2 from bacterial, mammalian and plant sources. The P protein is part of the glycine decarboxylase multienzyme complex EC:2.1; Region: GDC-P; cd00613
561275005212	tetramer interface [polypeptide binding]; other site
561275005213	pyridoxal 5'-phosphate binding site [chemical binding]; other site
561275005214	catalytic residue [active]
561275005215	haloalkane dehalogenase; Provisional; Region: PRK03204
561275005216	Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697
561275005217	putative hydrolase, CocE/NonD family; Region: /NonD; TIGR00976
561275005218	X-Pro dipeptidyl-peptidase C-terminal non-catalytic domain; Region: PepX_C; pfam08530
561275005219	Von Willebrand factor type A (vWA) domain was originally found in the blood coagulation protein von Willebrand factor (vWF). Typically, the vWA domain is made up of approximately 200 amino acid residues folded into a classic a/b para-rossmann type of...; Region: vWFA; cl00057
561275005220	metal ion-dependent adhesion site (MIDAS); other site
561275005221	Malate synthase G (MSG), monomeric enzyme present in some bacteria. In general, malate synthase catalyzes the Claisen condensation of glyoxylate and acetyl-CoA to malyl-CoA , which hydrolyzes to malate and CoA. This reaction is part of the glyoxylate...; Region: malate_synt_G; cd00728
561275005222	active site
561275005223	PIN domain of ribonucleases (toxins), VapC, FitB, and PAE0151 of bacterial and archaeal toxin/antitoxin-like operons, and other similar homologs; Region: PIN_VapC-like; cd09861
561275005224	putative active site [active]
561275005226	Domain of unknown function DUF21; Region: DUF21; pfam01595
561275005227	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains associated with the CorC_HlyC domain. CorC_HlyC is a transporter associated domain. This small domain is found in Na+/H+ antiporters, in proteins involved in...; Region: CBS_pair_CorC_HlyC_assoc; cd04590
561275005228	FOG: CBS domain [General function prediction only]; Region: COG0517
561275005229	Hemolysins and related proteins containing CBS domains [General function prediction only]; Region: TlyC; COG1253
561275005230	Domain of unknown function DUF21; Region: DUF21; pfam01595
561275005231	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains associated with the CorC_HlyC domain. CorC_HlyC is a transporter associated domain. This small domain is found in Na+/H+ antiporters, in proteins involved in...; Region: CBS_pair_CorC_HlyC_assoc; cd04590
561275005232	Transporter associated domain; Region: CorC_HlyC; smart01091
561275005233	inosine 5-monophosphate dehydrogenase; Validated; Region: PRK07807
561275005234	TIM barrel proteins share a structurally conserved phosphate binding motif and in general share an eight beta/alpha closed barrel structure. Specific for this family is the conserved phosphate binding site at the edges of strands 7 and 8. The phosphate...; Region: TIM_phosphate_binding; cl17186
561275005235	The CBS domain, named after human CBS, is a small domain originally identified in cystathionine beta-synthase and is subsequently found in a wide range of different proteins. CBS domains usually occur in tandem repeats. They associate to form a so-called...; Region: CBS_pair; cd02205
561275005236	IMPDH: The catalytic domain of the inosine monophosphate dehydrogenase. IMPDH catalyzes the NAD-dependent oxidation of inosine 5'-monophosphate (IMP) to xanthosine 5' monophosphate (XMP). It is a rate-limiting step in the de novo synthesis of...; Region: IMPDH; cd00381
561275005237	active site
561275005238	6-phosphogluconate dehydrogenase-like protein; Reviewed; Region: PRK09599
561275005239	NAD binding domain of 6-phosphogluconate dehydrogenase; Region: NAD_binding_2; pfam03446
561275005240	6-phosphogluconate dehydrogenase, C-terminal domain; Region: 6PGD; pfam00393
561275005241	Zn-dependent protease with chaperone function [Posttranslational modification, protein turnover, chaperones]; Region: HtpX; COG0501
561275005242	Predicted transcriptional regulator [Transcription]; Region: COG3682
561275005243	PaaI_thioesterase is a tetrameric acyl-CoA thioesterase with a hot dog fold and one of several proteins responsible for phenylacetic acid (PA) degradation in bacteria.  Although orthologs of PaaI exist in archaea and eukaryotes, their function has not...; Region: PaaI_thioesterase; cd03443
561275005244	CoenzymeA binding site [chemical binding]; other site
561275005245	subunit interaction site [polypeptide binding]; other site
561275005246	PHB binding site; other site
561275005247	Urease gamma-subunit; Urease is a nickel-dependent metalloenzyme that catalyzes the hydrolysis of urea to form ammonia and carbon dioxide. Nickel-dependent ureases are found in bacteria, archaea, fungi and plants. Their primary role is to allow the use...; Region: Urease_gamma; cd00390
561275005248	alpha-gamma subunit interface [polypeptide binding]; other site
561275005249	beta-gamma subunit interface [polypeptide binding]; other site
561275005250	Urease beta-subunit; Urease is a nickel-dependent metalloenzyme that catalyzes the hydrolysis of urea to form ammonia and carbon dioxide. Nickel-dependent ureases are found in bacteria, archaea, fungi and plants. Their primary role is to allow the use of...; Region: Urease_beta; cd00407
561275005251	gamma-beta subunit interface [polypeptide binding]; other site
561275005252	alpha-beta subunit interface [polypeptide binding]; other site
561275005253	urease subunit alpha; Reviewed; Region: ureC; PRK13206
561275005254	Urease alpha-subunit; Urease is a nickel-dependent metalloenzyme that catalyzes the hydrolysis of urea to form ammonia and carbon dioxide. Nickel-dependent ureases are found in bacteria, fungi and plants. Their primary role is to allow the use of...; Region: Urease_alpha; cd00375
561275005255	subunit interactions [polypeptide binding]; other site
561275005256	active site
561275005257	flap region; other site
561275005258	Urease accessory protein UreF [Posttranslational modification, protein turnover, chaperones]; Region: UreF; COG0830
561275005259	UreF; Region: UreF; pfam01730
561275005260	The Fer4_NifH superfamily contains a variety of proteins which share a common ATP-binding domain. Functionally, proteins in this superfamily use the energy from hydrolysis of NTP to transfer electron or ion; Region: Fer4_NifH; cl17203
561275005261	UreD urease accessory protein; Region: UreD; cl00530
561275005262	NADH dehydrogenase, FAD-containing subunit [Energy production and conversion]; Region: Ndh; COG1252
561275005263	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
561275005264	probable F420-dependent oxidoreductase, Rv1855c family; Region: F420_Rv1855c; TIGR03560
561275005265	Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cl07892
561275005266	N5,N10-methylenetetrahydromethanopterin reductase (Mer) catalyzes the reduction of N5,N10-methylenetetrahydromethanopterin with reduced coenzyme F420 to N5-methyltetrahydromethanopterin and oxidized coenzyme F420; Region: Tetrahydromethanopterin_reductase; cd01097
561275005267	classical (c) SDRs; Region: SDR_c; cd05233
561275005268	gluconate 5-dehydrogenase; Provisional; Region: PRK08213
561275005269	NAD(P) binding site [chemical binding]; other site
561275005270	active site
561275005271	ABC-type molybdate transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: ModA; COG0725
561275005272	Bacterial extracellular solute-binding protein; Region: SBP_bac_1; cl17199
561275005273	sulfate transport protein; Provisional; Region: cysT; CHL00187
561275005274	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
561275005275	dimer interface [polypeptide binding]; other site
561275005276	conserved gate region; other site
561275005277	putative PBP binding loops; other site
561275005278	ABC-ATPase subunit interface; other site
561275005279	ABC-type sulfate/molybdate transport systems, ATPase component [Inorganic ion transport and metabolism]; Region: CysA; COG1118
561275005280	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
561275005281	Walker A/P-loop; other site
561275005282	ATP binding site [chemical binding]; other site
561275005283	Q-loop/lid; other site
561275005284	ABC transporter signature motif; other site
561275005285	Walker B; other site
561275005286	D-loop; other site
561275005287	H-loop/switch region; other site
561275005288	TOBE domain; Region: TOBE; pfam03459
561275005289	Fibronectin-attachment protein (FAP); Region: FAP; pfam07174
561275005290	Predicted membrane protein [Function unknown]; Region: COG2261
561275005291	Cinnamyl alcohol dehydrogenases (CAD); Region: CAD2; cd08298
561275005292	zinc-binding alcohol dehydrogenase family protein; Region: adh_fam_2; TIGR02822
561275005293	putative NAD(P) binding site [chemical binding]; other site
561275005294	putative substrate binding site [chemical binding]; other site
561275005295	catalytic Zn binding site [ion binding]; other site
561275005296	structural Zn binding site [ion binding]; other site
561275005297	CAAX protease self-immunity; Region: Abi; pfam02517
561275005298	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2258
561275005299	MOSC domain; Region: MOSC; pfam03473
561275005300	short chain dehydrogenase; Provisional; Region: PRK07825
561275005301	classical (c) SDRs; Region: SDR_c; cd05233
561275005302	NAD(P) binding site [chemical binding]; other site
561275005303	active site
561275005304	Predicted acyl-CoA transferases/carnitine dehydratase [Energy production and conversion]; Region: CaiB; COG1804
561275005305	CoA-transferase family III; Region: CoA_transf_3; pfam02515
561275005306	Predicted acyl-CoA transferases/carnitine dehydratase [Energy production and conversion]; Region: CaiB; COG1804
561275005307	CoA-transferase family III; Region: CoA_transf_3; pfam02515
561275005308	acetyl-CoA acetyltransferase; Validated; Region: PRK08257
561275005309	Thiolase domain associated with sterol carrier protein (SCP)-x isoform and related proteins; SCP-2  has multiple roles in intracellular lipid circulation and metabolism. The N-terminal presequence in the SCP-x isoform represents a peroxisomal...; Region: SCP-x_thiolase; cd00829
561275005310	active site
561275005311	hypothetical protein; Provisional; Region: PRK12320
561275005312	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
561275005313	phenylpropionate dioxygenase ferredoxin reductase subunit; Provisional; Region: PRK09754
561275005314	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
561275005315	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
561275005316	Domain of unknown function (DUF385); Region: DUF385; pfam04075
561275005317	Isopentenyl diphosphate isomerase (BS_ypgA, MTH48 and related proteins) [Coenzyme transport and metabolism]; Region: idi; COG1304
561275005318	Family of homologous FMN-dependent alpha-hydroxyacid oxidizing enzymes. This family occurs in both prokaryotes and eukaryotes. Members of this family include flavocytochrome b2 (FCB2), glycolate oxidase (GOX), lactate monooxygenase (LMO), mandelate...; Region: alpha_hydroxyacid_oxid_FMN; cd02809
561275005319	active site
561275005320	substrate binding site [chemical binding]; other site
561275005321	FMN binding site [chemical binding]; other site
561275005322	putative catalytic residues [active]
561275005323	Uncharacterized conserved protein [Function unknown]; Region: COG5579
561275005324	PPOX class probable F420-dependent enzyme; Region: Rv1155_F420; TIGR03618
561275005325	Bacterioferritin (cytochrome b1) [Inorganic ion transport and metabolism]; Region: Bfr; COG2193
561275005326	Bacterioferritin, ferritin-like diiron-binding domain; Region: Bacterioferritin; cd00907
561275005327	heme binding site [chemical binding]; other site
561275005328	ferroxidase pore; other site
561275005329	ferroxidase diiron center [ion binding]; other site
561275005330	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
561275005331	putative substrate translocation pore; other site
561275005332	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
561275005333	Ribosomal protein L13.  Protein L13, a large ribosomal subunit protein, is one of five proteins required for an early folding intermediate of 23S rRNA in the assembly of the large subunit. L13 is situated on the bottom of the large subunit, near the...; Region: Ribosomal_L13; cl00333
561275005334	23S rRNA interface [nucleotide binding]; other site
561275005335	L3 interface [polypeptide binding]; other site
561275005336	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
561275005337	Glutamine synthetase [Amino acid transport and metabolism]; Region: GlnA; COG0174
561275005338	Glutamine synthetase, catalytic domain; Region: Gln-synt_C; pfam00120
561275005339	Predicted metal-dependent hydrolase of the TIM-barrel fold [General function prediction only]; Region: COG2159
561275005340	Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124
561275005341	Cytochrome P450; Region: p450; cl12078
561275005342	Mycobacterium 19 kDa lipoprotein antigen; Region: Myco_19_kDa; pfam05481
561275005343	short chain dehydrogenase; Provisional; Region: PRK08267
561275005344	classical (c) SDR, subgroup 9; Region: SDR_c9; cd08931
561275005345	putative NAD(P) binding site [chemical binding]; other site
561275005346	active site
561275005347	START/RHO_alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) ligand-binding domain superfamily; Region: SRPBCC; cd07812
561275005348	hydrophobic ligand binding site; other site
561275005349	Transglycosylase-like domain; Region: Transglycosylas; pfam06737
561275005350	chorismate mutase; Provisional; Region: PRK09269
561275005351	chorismate mutase, putative; Region: CM_mono2; TIGR01806
561275005352	Putative esterase; Region: Esterase; pfam00756
561275005353	Leucine carboxyl methyltransferase; Region: LCM; cl01306
561275005354	O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315
561275005355	Leucine carboxyl methyltransferase; Region: LCM; cl01306
561275005356	Uncharacterized conserved protein [Function unknown]; Region: COG2353
561275005357	Nitronate monooxygenase; Region: NMO; pfam03060
561275005358	2-Nitropropane dioxygenase (NPD), one of the nitroalkane oxidizing enzyme families, catalyzes oxidative denitrification of nitroalkanes to their corresponding carbonyl compounds and nitrites. NDP is a member of the NAD(P)H-dependent flavin oxidoreductase...; Region: NPD_like; cd04730
561275005359	FMN binding site [chemical binding]; other site
561275005360	substrate binding site [chemical binding]; other site
561275005361	putative catalytic residue [active]
561275005362	Medium chain reductase/dehydrogenase (MDR)/zinc-dependent alcohol dehydrogenase-like family; Region: MDR; cl16912
561275005363	Threonine dehydrogenase and related Zn-dependent dehydrogenases [Amino acid transport and metabolism / General function prediction only]; Region: Tdh; COG1063
561275005364	Medium chain reductase/dehydrogenase (MDR)/zinc-dependent alcohol dehydrogenase-like family; Region: MDR; cl16912
561275005365	Threonine dehydrogenase and related Zn-dependent dehydrogenases [Amino acid transport and metabolism / General function prediction only]; Region: Tdh; COG1063
561275005366	NAD(P) binding site [chemical binding]; other site
561275005367	O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315
561275005368	methyltransferase, TIGR00027 family; Region: mthyl_TIGR00027
561275005369	D-tyrosyl-tRNA(Tyr) deacylase; Provisional; Region: PRK05273
561275005370	putative active site [active]
561275005371	dimerization interface [polypeptide binding]; other site
561275005372	putative tRNAtyr binding site [nucleotide binding]; other site
561275005373	Domain of unknown function DUF77; Region: DUF77; pfam01910
561275005374	Macro domain, Unknown family 2. The macro domain is a high-affinity ADP-ribose binding module found in a variety of proteins as a stand-alone domain or in combination with other domains like in histone macroH2A and some PARPs (poly ADP-ribose polymerases)...; Region: Macro_2; cd03330
561275005375	putative ADP-ribose binding site [chemical binding]; other site
561275005376	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
561275005377	Adenylate cyclase, family 3 (some proteins contain HAMP domain) [Signal transduction mechanisms]; Region: CyaA; COG2114
561275005378	cyclase homology domain; Region: CHD; cd07302
561275005379	nucleotidyl binding site; other site
561275005380	metal binding site [ion binding]; metal-binding site
561275005381	dimer interface [polypeptide binding]; other site
561275005382	competence damage-inducible protein A; Provisional; Region: PRK00549
561275005383	Competence-damaged protein. CinA is the first gene in the competence- inducible (cin) operon and is thought to be specifically required at some stage in the process of transformation. This domain is closely related to a domain, found in a variety of...; Region: cinA; cd00885
561275005384	putative MPT binding site; other site
561275005385	Uncharacterized protein (competence- and mitomycin-induced) [General function prediction only]; Region: CinA; COG1546
561275005386	putative sialic acid transporter; Region: 2A0112; TIGR00891
561275005387	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
561275005388	putative substrate translocation pore; other site
561275005389	Predicted membrane protein [Function unknown]; Region: COG1950
561275005390	Sulphate Transporter and Anti-Sigma factor antagonist) domain of anti-anti-sigma factors, key regulators of anti-sigma factors by phosphorylation; Region: STAS_anti-anti-sigma_factors; cd07043
561275005391	anti sigma factor interaction site; other site
561275005392	regulatory phosphorylation site [posttranslational modification]; other site
561275005393	Glycine/D-amino acid oxidases (deaminating) [Amino acid transport and metabolism]; Region: DadA; COG0665
561275005394	Domain of unknown function (DUF4262); Region: DUF4262; pfam14081
561275005395	catalase/hydroperoxidase HPI(I); Provisional; Region: PRK15061
561275005396	N-terminal catalytic domain of catalase-peroxidases; Region: catalase_peroxidase_1; cd00649
561275005397	dimer interface [polypeptide binding]; other site
561275005398	active site
561275005399	heme binding site [chemical binding]; other site
561275005400	C-terminal non-catalytic domain of catalase-peroxidases; Region: catalase_peroxidase_2; cd08200
561275005401	Ferric uptake regulator(Fur) and related metalloregulatory proteins; typically iron-dependent, DNA-binding repressors and activators; Region: Fur_like; cd07153
561275005402	metal binding site 2 [ion binding]; metal-binding site
561275005403	putative DNA binding helix; other site
561275005404	metal binding site 1 [ion binding]; metal-binding site
561275005405	dimer interface [polypeptide binding]; other site
561275005406	structural Zn2+ binding site [ion binding]; other site
561275005407	PhosphatidylEthanolamine-Binding Protein (PEBP) domain present in bacteria and archaea; Region: PEBP_bact_arch; cd00865
561275005408	substrate binding site [chemical binding]; other site
561275005409	PhosphatidylEthanolamine-Binding Protein (PEBP) domain present in bacteria and archaea; Region: PEBP_bact_arch; cd00865
561275005410	substrate binding site [chemical binding]; other site
561275005411	NADPH:quinone reductase and related Zn-dependent oxidoreductases [Energy production and conversion / General function prediction only]; Region: Qor; COG0604
561275005412	Medium chain dehydrogenases/reductase (MDR)/zinc-dependent alcohol dehydrogenase-like family; Region: MDR3; cd08275
561275005413	putative NAD(P) binding site [chemical binding]; other site
561275005414	Zn-dependent hydrolases, including glyoxylases [General function prediction only]; Region: GloB; COG0491
561275005415	Members of the ICL/PEPM enzyme family catalyze either P-C or C-C bond formation/cleavage. Known members are phosphoenolpyruvate mutase (PEPM), phosphonopyruvate hydrolase (PPH), carboxyPEP mutase (CPEP mutase), oxaloacetate hydrolase (OAH), isocitrate...; Region: ICL_PEPM; cd00377
561275005416	tetramer interface [polypeptide binding]; other site
561275005417	active site
561275005418	Mg2+/Mn2+ binding site [ion binding]; other site
561275005419	Members of the ICL/PEPM_KPHMT enzyme superfamily catalyze the formation and cleavage of either P-C or C-C bonds. Typical members are phosphoenolpyruvate mutase (PEPM), phosphonopyruvate hydrolase (PPH), carboxyPEP mutase (CPEP mutase), oxaloacetate...; Region: ICL_KPHMT; cl00435
561275005420	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275005421	PPE family; Region: PPE; pfam00823
561275005422	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275005423	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275005424	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275005425	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275005426	I-RD03, 552 bp. Region of difference I-RD03, inserted region in Mycobacterium bovis BCG Pasteur (position 2164395..2164946, 552bp), BCG Tokyo (position 2146386..2146937, 552bp), and Mycobacterium bovis AF2122/97 (position 2153645..2154127, 483bp) compared to Mycobacterium tuberculosis H37Rv (position: 2163375..2163376). In-frame insertion in PPE34 gene
561275005427	S-RD04, 628 bp. Region of difference S-RD04, inserted region in Mycobacterium bovis BCG Pasteur (position 2167434..2168061, 628bp), BCG Tokyo (position 2149425..2150052, 628bp) and Mycobacterium bovis AF2122/97 (position 2156909..2157536, 628bp) compared to Mycobacterium tuberculosis H37Rv (position: 2165851-2165902, 52bp). In-frame insertion in PPE34 gene
561275005429	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275005430	PPE family; Region: PPE; pfam00823
561275005431	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275005432	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275005433	Pyrabactin resistance 1 (PYR1), PYR1-like (PYL), regulatory component of abscisic acid receptors (RCARs), and related proteins; Region: PYR_PYL_RCAR_like; cd07821
561275005434	putative hydrophobic ligand binding site [chemical binding]; other site
561275005435	protein interface [polypeptide binding]; other site
561275005436	gate; other site
561275005437	1-acyl-sn-glycerol-3-phosphate acyltransferase [Lipid metabolism]; Region: PlsC; COG0204
561275005438	Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: MGAT-like; Region: LPLAT_MGAT-like; cd07987
561275005439	putative acyl-acceptor binding pocket; other site
561275005440	haloacid dehalogenase-like hydrolase; Region: HAD; cl17202
561275005441	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
561275005442	Beta-lactamase; Region: Beta-lactamase; pfam00144
561275005443	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
561275005444	Beta-lactamase; Region: Beta-lactamase; pfam00144
561275005445	putative fatty-acid--CoA ligase; Provisional; Region: PRK12476
561275005446	Fatty acyl-AMP ligase (FAAL); Region: FAAL; cd05931
561275005447	acyl-activating enzyme (AAE) consensus motif; other site
561275005448	active site
561275005449	Domain of unknown function (DUF1942); Region: DUF1942; pfam09167
561275005450	Uncharacterized conserved protein [Function unknown]; Region: COG3361
561275005451	short chain dehydrogenase; Provisional; Region: PRK05867
561275005452	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
561275005453	NAD(P) binding site [chemical binding]; other site
561275005454	active site
561275005455	TIGR03085 family protein; Region: TIGR03085
561275005456	Putative intracellular protease/amidase [General function prediction only]; Region: ThiJ; COG0693
561275005457	Type 1 glutamine amidotransferase (GATase1)-like domain; Region: GAT_1; cl00020
561275005458	Type 1 glutamine amidotransferase (GATase1)-like domain found in a subgroup of proteins similar to PfpI from Pyrococcus furiosus; Region: GATase1_PfpI_2; cd03139
561275005459	Type 1 glutamine amidotransferase (GATase1)-like domain; Region: GAT_1; cl00020
561275005460	conserved cys residue [active]
561275005461	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
561275005462	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
561275005463	Peroxiredoxin (PRX) family, Atypical 2-cys PRX subfamily; composed of PRXs containing peroxidatic and resolving cysteines, similar to the homodimeric thiol specific antioxidant (TSA) protein also known as TRX-dependent thiol peroxidase (Tpx). Tpx is a...; Region: PRX_Atyp2cys; cd03014
561275005464	dimer interface [polypeptide binding]; other site
561275005465	catalytic triad [active]
561275005466	peroxidatic and resolving cysteines [active]
561275005467	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275005468	Acyl-CoA dehydrogenase, N-terminal domain; Region: Acyl-CoA_dh_N; pfam02771
561275005469	Acyl-CoA dehydrogenase; Region: ACAD; cd00567
561275005470	active site
561275005471	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275005472	Putative acyl-CoA dehydrogenases similar to fadE6, fadE17, and fadE26; Region: ACAD_fadE6_17_26; cd01152
561275005473	FAD binding site [chemical binding]; other site
561275005474	substrate binding site [chemical binding]; other site
561275005475	catalytic base [active]
561275005476	enoyl-CoA hydratase; Provisional; Region: PRK08290
561275005477	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
561275005478	substrate binding site [chemical binding]; other site
561275005479	oxyanion hole (OAH) forming residues; other site
561275005480	trimer interface [polypeptide binding]; other site
561275005481	Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cl07892
561275005482	Coenzyme F420-dependent N5,N10-methylene tetrahydromethanopterin reductase and related flavin-dependent oxidoreductases [Energy production and conversion]; Region: COG2141
561275005483	anthranilate dioxygenase reductase; Provisional; Region: antC; PRK11872
561275005484	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
561275005485	catalytic loop [active]
561275005486	iron binding site [ion binding]; other site
561275005487	Benzoate dioxygenase reductase (BenDO) FAD/NAD binding domain. Oxygenases oxidize hydrocarbons using dioxygen as the oxidant. As a Class I bacterial dioxygenases, benzoate dioxygenase like proteins combine an [2Fe-2S] cluster containing N-terminal...; Region: BenDO_FAD_NAD; cd06209
561275005488	FAD binding pocket [chemical binding]; other site
561275005489	FAD binding motif [chemical binding]; other site
561275005490	phosphate binding motif [ion binding]; other site
561275005491	beta-alpha-beta structure motif; other site
561275005492	NAD binding pocket [chemical binding]; other site
561275005493	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
561275005494	Putative lysophospholipase; Region: Hydrolase_4; pfam12146
561275005495	Flavin reductase like domain; Region: Flavin_Reduct; smart00903
561275005496	3,4-dihydroxy-2-butanone 4-phosphate synthase [Coenzyme metabolism]; Region: RibB; COG0108
561275005497	3,4-dihydroxy-2-butanone 4-phosphate synthase; Region: DHBP_synthase; pfam00926
561275005498	GTP cyclohydrolase II [Coenzyme metabolism]; Region: RibA; COG0807
561275005499	dimerization interface [polypeptide binding]; other site
561275005500	active site
561275005501	classical (c) SDR, subgroup 12; Region: SDR_c12; cd08944
561275005502	putative NAD(P) binding site [chemical binding]; other site
561275005503	active site
561275005504	homodimer interface [polypeptide binding]; other site
561275005505	Growth inhibitor [Signal transduction mechanisms]; Region: MazF; COG2337
561275005506	SEC-C motif; Region: SEC-C; pfam02810
561275005507	Domain of unknown function (DUF222); Region: DUF222; pfam02720
561275005508	HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085
561275005509	active site
561275005510	Plasmid stability protein [General function prediction only]; Region: StbC; COG4691
561275005511	Predicted nucleic acid-binding protein, contains PIN domain [General function prediction only]; Region: VapC; COG1487
561275005512	Phage derived protein Gp49-like (DUF891); Region: Gp49; pfam05973
561275005513	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
561275005514	non-specific DNA binding site [nucleotide binding]; other site
561275005515	salt bridge; other site
561275005516	sequence-specific DNA binding site [nucleotide binding]; other site
561275005517	Plasmid stabilization system protein [General function prediction only]; Region: ParE; COG3668
561275005518	Uncharacterized protein family (UPF0156); Region: RHH_2; pfam03693
561275005519	PIN domain of the hypothetical protein MT3492 of Mycobacterium tuberculosis CDC1551 and other uncharacterized, annotated PilT protein domain proteins; Region: PIN_MT3492; cd09874
561275005520	putative active site [active]
561275005521	Antitoxin of toxin-antitoxin stability system [Cell division and chromosome partitioning]; Region: Phd; COG4118
561275005522	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275005523	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275005524	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275005525	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275005526	Permease; Region: Permease; cl00510
561275005527	RD7, 12719 bp. Region of difference RD7, deleted region in Mycobacterium bovis BCG Pasteur (position 2210166..2210167), BCG Tokyo (position 2192257..2192258) and Mycobacterium bovis AF2122/97 (position 2199640..2199641) compared to Mycobacterium tuberculosis H37Rv (position: 2208006..2220724). Removes genes Rv1965-Rv1977 and truncates genes Rv1964 and Rv1978. Immediatly followed, in Mycobacterium bovis BCG Pasteur (position 2210500..2210501), by a second deletion of 10787bp, RD2 region, which removes genes Rv1979c-Rv1787 and merges truncated genes Rv1978 and Rv1988
561275005528	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275005529	S-adenosylmethionine binding site [chemical binding]; other site
561275005530	RD2, 10787 bp. Region of difference RD2, deleted region in Mycobacterium bovis BCG Pasteur (position 2210500..2210501) compared to Mycobacterium tuberculosis H37Rv (position: 2221059..2231845) and Mycobacterium bovis AF2122/97 (position 2199975..2210761). Removes genes Rv1979-Rv1987, and merges truncated part of Rv1978 and Rv1988. This region is downstream of a previous deletionof 12719bp, RD7 region, specific to Mycobacterium bovis BCG Pasteur and BCG Tokyo which remove genes Rv1965-Rv1977 and truncates Rv1964 and Rv1978
561275005531	Amino acid transporters [Amino acid transport and metabolism]; Region: PotE; COG0531
561275005532	Protein of unknown function (DUF3298); Region: DUF3298; pfam11738
561275005533	ribonucleotide-diphosphate reductase subunit beta; Provisional; Region: nrdF2; PRK13966
561275005534	Ribonucleotide Reductase, R2/beta subunit, ferritin-like diiron-binding domain; Region: RNRR2; cd01049
561275005535	dimer interface [polypeptide binding]; other site
561275005536	putative radical transfer pathway; other site
561275005537	diiron center [ion binding]; other site
561275005538	tyrosyl radical; other site
561275005539	PIN domain of the VapC-like UPF0110 protein Mb0640 and homologs; Region: PIN_UPF0110; cd09871
561275005540	putative active site [active]
561275005541	PE family; Region: PE; pfam00934
561275005542	Cutinase; Region: Cutinase; pfam01083
561275005543	chromosome replication initiation inhibitor protein; Validated; Region: PRK03635
561275005544	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
561275005545	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
561275005546	dimerization interface [polypeptide binding]; other site
561275005547	Lysine efflux permease [General function prediction only]; Region: COG1279
561275005548	Cellulose binding domain; Region: CBM_2; pfam00553
561275005549	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275005550	S-adenosylmethionine binding site [chemical binding]; other site
561275005551	Uncharacterized conserved protein [Function unknown]; Region: COG5654
561275005552	putative toxin-antitoxin system antitoxin component, TIGR02293 family; Region: TAS_TIGR02293
561275005553	Protein of unknown function (DUF2384); Region: DUF2384; pfam09722
561275005554	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
561275005555	Growth inhibitor [Signal transduction mechanisms]; Region: MazF; COG2337
561275005556	heavy metal-(Cd/Co/Hg/Pb/Zn)-translocating P-type ATPase; Region: ATPase-IB2_Cd; TIGR01512
561275005557	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
561275005558	Protein of unknown function (DUF1490); Region: DUF1490; pfam07371
561275005559	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
561275005560	dimerization interface [polypeptide binding]; other site
561275005561	putative DNA binding site [nucleotide binding]; other site
561275005562	putative Zn2+ binding site [ion binding]; other site
561275005563	Hemerythrin-like domain; Region: Hr-like; cd12108
561275005564	Fe binding site [ion binding]; other site
561275005565	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
561275005566	Ligand Binding Site [chemical binding]; other site
561275005567	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
561275005568	Ligand Binding Site [chemical binding]; other site
561275005569	Cation transport ATPase [Inorganic ion transport and metabolism]; Region: MgtA; COG0474
561275005570	Cation transporter/ATPase, N-terminus; Region: Cation_ATPase_N; smart00831
561275005571	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
561275005572	Putative hydrolase of sodium-potassium ATPase alpha subunit; Region: Hydrolase_like2; pfam13246
561275005573	Soluble P-type ATPase [General function prediction only]; Region: COG4087
561275005574	Cation transporting ATPase, C-terminus; Region: Cation_ATPase_C; pfam00689
561275005575	Members of the ICL/PEPM enzyme family catalyze either P-C or C-C bond formation/cleavage. Known members are phosphoenolpyruvate mutase (PEPM), phosphonopyruvate hydrolase (PPH), carboxyPEP mutase (CPEP mutase), oxaloacetate hydrolase (OAH), isocitrate...; Region: ICL_PEPM; cd00377
561275005576	Phosphoenolpyruvate phosphomutase; Region: PEP_mutase; pfam13714
561275005577	tetramer interface [polypeptide binding]; other site
561275005578	active site
561275005579	Mg2+/Mn2+ binding site [ion binding]; other site
561275005580	Amino acid transporters [Amino acid transport and metabolism]; Region: PotE; COG0531
561275005581	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox_3; pfam13738
561275005582	Acyl-ACP thioesterase [Lipid metabolism]; Region: FatA; COG3884
561275005583	3beta17beta hydroxysteroid dehydrogenase-like, classical (c) SDRs; Region: 3beta-17beta-HSD_like_SDR_c; cd05341
561275005584	homotetramer interface [polypeptide binding]; other site
561275005585	3-ketoacyl-(acyl-carrier-protein) reductase; Validated; Region: fabG; PRK05653
561275005586	NAD binding site [chemical binding]; other site
561275005587	homodimer interface [polypeptide binding]; other site
561275005588	active site
561275005589	Methyltransferase domain; Region: Methyltransf_23; pfam13489
561275005590	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275005591	S-adenosylmethionine binding site [chemical binding]; other site
561275005592	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2187
561275005593	Predicted kinase [General function prediction only]; Region: COG0645
561275005594	AAA domain; Region: AAA_17; pfam13207
561275005595	Universal stress protein family; Region: Usp; pfam00582
561275005596	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
561275005597	Ligand Binding Site [chemical binding]; other site
561275005598	beta-phosphoglucomutase family hydrolase; Region: PGMB-YQAB-SF; TIGR02009
561275005599	Trehalose-6-phosphatase [Carbohydrate transport and metabolism]; Region: OtsB; COG1877
561275005600	trehalose-6-phosphate phosphatase; Provisional; Region: PRK10187; cl17105
561275005601	Trehalose and maltose hydrolases (possible phosphorylases) [Carbohydrate transport and metabolism]; Region: ATH1; COG1554
561275005602	Glycosyl hydrolase family 65, N-terminal domain; Region: Glyco_hydro_65N; pfam03636
561275005603	Glycosyl hydrolase family 65 central catalytic domain; Region: Glyco_hydro_65m; pfam03632
561275005604	Glycosyl hydrolase family 65, C-terminal domain; Region: Glyco_hydro_65C; pfam03633
561275005605	Ferredoxin [Energy production and conversion]; Region: COG1146
561275005606	Rat sarcoma (Ras)-like superfamily of small guanosine triphosphatases (GTPases); Region: Ras_like_GTPase; cl17170
561275005607	Predicted ATPase (AAA+ superfamily) [General function prediction only]; Region: COG1373
561275005608	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
561275005609	Walker A motif; other site
561275005610	ATP binding site [chemical binding]; other site
561275005611	Walker B motif; other site
561275005612	arginine finger; other site
561275005613	Transcription regulator of the Arc/MetJ class [Transcription]; Region: COG5450
561275005614	PIN domain of the Rv0301 toxin of Mycobacterium tuberculosis and other uncharacterized, annotated PilT protein domain proteins; Region: PIN_MtRv0301; cd09882
561275005615	putative active site [active]
561275005616	Transcriptional regulators [Transcription]; Region: MarR; COG1846
561275005617	MarR family; Region: MarR_2; pfam12802
561275005618	Phage envelope protein [General function prediction only]; Region: COG5562
561275005619	Transposase; Region: DEDD_Tnp_IS110; pfam01548
561275005620	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3547
561275005621	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3547
561275005622	Transposase IS116/IS110/IS902 family; Region: Transposase_20; pfam02371
561275005623	Domain of unknown function (DUF222); Region: DUF222; pfam02720
561275005624	HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085
561275005625	active site
561275005626	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
561275005627	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
561275005628	non-specific DNA binding site [nucleotide binding]; other site
561275005629	salt bridge; other site
561275005630	sequence-specific DNA binding site [nucleotide binding]; other site
561275005631	Predicted Zn peptidase [Amino acid transport and metabolism]; Region: COG2856
561275005632	Uncharacterized conserved protein [Function unknown]; Region: COG2442
561275005633	Predicted helicase [General function prediction only]; Region: COG4889
561275005634	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
561275005635	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
561275005636	non-specific DNA binding site [nucleotide binding]; other site
561275005637	salt bridge; other site
561275005638	sequence-specific DNA binding site [nucleotide binding]; other site
561275005639	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4683
561275005640	RvD1, 5000 bp. Region of difference RvD1, inserted region in Mycobacterium bovis BCG Pasteur (position 2247374..2252373, 5000bp), BCG Tokyo (position 2240152..2240151, 5000bp) and Mycobacterium bovis AF2122/97 (position 2247638..2252637, 5000bp) compared to Mycobacterium tuberculosis H37Rv (position: 2268721..2268722). Leads to 2 extra genes, Mb2046c and Mb2047c and a longer one, Rv2024c
561275005641	Predicted helicase [General function prediction only]; Region: COG4889
561275005642	Restriction endonuclease; Region: Mrr_cat_2; pfam13156
561275005643	Type III restriction enzyme, res subunit; Region: ResIII; pfam04851
561275005644	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
561275005645	ATP binding site [chemical binding]; other site
561275005646	putative Mg++ binding site [ion binding]; other site
561275005647	Helicase conserved C-terminal domain; Region: Helicase_C; pfam00271
561275005648	ATP-binding site [chemical binding]; other site
561275005649	Methyltransferase domain; Region: Methyltransf_26; pfam13659
561275005650	Predicted Co/Zn/Cd cation transporters [Inorganic ion transport and metabolism]; Region: MMT1; COG0053
561275005651	cation diffusion facilitator family transporter; Region: CDF; TIGR01297
561275005652	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
561275005653	Ligand Binding Site [chemical binding]; other site
561275005654	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
561275005655	Ligand Binding Site [chemical binding]; other site
561275005656	FOG: GAF domain [Signal transduction mechanisms]; Region: FhlA; COG2203
561275005657	Domain present in phytochromes and cGMP-specific phosphodiesterases; Region: GAF; smart00065
561275005658	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: COG4585
561275005659	Histidine kinase; Region: HisKA_3; pfam07730
561275005660	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
561275005661	Ligand Binding Site [chemical binding]; other site
561275005662	Fructose-1-phosphate kinase and related fructose-6-phosphate kinase (PfkB) [Carbohydrate transport and metabolism]; Region: FruK; COG1105
561275005663	1-phosphofructokinase (FruK), minor 6-phosphofructokinase (pfkB) and related sugar kinases. FruK plays an important role in the predominant pathway for fructose utilisation.This group also contains tagatose-6-phophate kinase, an enzyme of the tagatose...; Region: FruK_PfkB_like; cd01164
561275005664	putative substrate binding site [chemical binding]; other site
561275005665	putative ATP binding site [chemical binding]; other site
561275005666	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
561275005667	active site
561275005668	Erythromycin esterase homolog [General function prediction only]; Region: COG2312
561275005669	Molecular chaperone (small heat shock protein) [Posttranslational modification, protein turnover, chaperones]; Region: IbpA; COG0071
561275005670	Alpha-crystallin domain (ACD) of alpha-crystallin-type small(s) heat shock proteins (Hsps). sHsps are small stress induced proteins with monomeric masses between 12 -43 kDa, whose common feature is the Alpha-crystallin domain  (ACD). sHsps are generally...; Region: ACD_sHsps-like; cd06464
561275005671	putative dimer interface [polypeptide binding]; other site
561275005672	Proteins of this family catalyze the reduction of flavin or nitrocompounds using NAD(P)H as electron donor in a obligatory two-electron transfer,  utilizing FMN or FAD as cofactor. They are often found to be homodimers. Enzymes of this family are...; Region: Nitro_FMN_reductase; cl00514
561275005673	dimer interface [polypeptide binding]; other site
561275005674	Protein of unknown function (DUF3097); Region: DUF3097; pfam11296
561275005675	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
561275005676	putative DNA binding site [nucleotide binding]; other site
561275005677	dimerization interface [polypeptide binding]; other site
561275005678	putative Zn2+ binding site [ion binding]; other site
561275005679	Ligand-binding SRPBCC domain of Micromonospora echinospora CalC and related proteins; Region: SRPBCC_CalC; cd08891
561275005680	putative hydrophobic ligand binding site [chemical binding]; other site
561275005681	CLM binding site; other site
561275005682	L1 loop; other site
561275005683	DNA binding site [nucleotide binding]
561275005684	uncharacterized Actinobacterial protein TIGR03083; Region: TIGR03083
561275005685	Mycothiol maleylpyruvate isomerase N-terminal domain; Region: MDMPI_N; pfam11716
561275005686	MDMPI C-terminal domain; Region: MDMPI_C; pfam07398
561275005687	Predicted esterase of the alpha-beta hydrolase superfamily [General function prediction only]; Region: RssA; COG1752
561275005688	ExoU and VipD-like proteins; homologus to patatin, cPLA2, and iPLA2; Region: Pat_ExoU_VipD_like; cd07207
561275005689	nucleophile elbow; other site
561275005690	Patatins and Phospholipases; Region: Patatin_and_cPLA2; cl11396
561275005691	glycerol-3-phosphate transporter ATP-binding subunit; Provisional; Region: ugpC; PRK11650
561275005692	The N-terminal ATPase domain of the maltose transporter, MalK; Region: ABC_MalK_N; cd03301
561275005693	Walker A/P-loop; other site
561275005694	ATP binding site [chemical binding]; other site
561275005695	Q-loop/lid; other site
561275005696	ABC transporter signature motif; other site
561275005697	Walker B; other site
561275005698	D-loop; other site
561275005699	H-loop/switch region; other site
561275005700	TOBE domain; Region: TOBE_2; pfam08402
561275005701	ABC-type sugar transport system, permease component [Carbohydrate transport and metabolism]; Region: UgpE; COG0395
561275005702	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
561275005703	dimer interface [polypeptide binding]; other site
561275005704	conserved gate region; other site
561275005705	putative PBP binding loops; other site
561275005706	ABC-ATPase subunit interface; other site
561275005707	ABC-type spermidine/putrescine transport system, permease component II [Amino acid transport and metabolism]; Region: PotC; COG1177
561275005708	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
561275005709	dimer interface [polypeptide binding]; other site
561275005710	conserved gate region; other site
561275005711	putative PBP binding loops; other site
561275005712	ABC-ATPase subunit interface; other site
561275005713	Bacterial extracellular solute-binding protein; Region: SBP_bac_8; pfam13416
561275005714	Bacterial extracellular solute-binding protein; Region: SBP_bac_1; pfam01547
561275005715	Nuclear transport factor 2 (NTF2) domain; Region: NTF2; pfam02136
561275005716	Nicotinamidase/pyrazinamidase (PZase). Nicotinamidase, a ubiquitous enzyme in prokaryotes, converts nicotinamide to nicotinic acid (niacin) and ammonia, which in turn can be recycled to make nicotinamide adenine dinucleotide (NAD). The same enzyme is...; Region: nicotinamidase; cd01011
561275005717	Isochorismatase family; Region: Isochorismatase; pfam00857
561275005718	catalytic triad [active]
561275005719	metal binding site [ion binding]; metal-binding site
561275005720	conserved cis-peptide bond; other site
561275005721	Protein of Unknown function (DUF2784); Region: DUF2784; pfam10861
561275005722	Carboxylesterase type B [Lipid metabolism]; Region: PnbA; COG2272
561275005723	Esterases and lipases (includes fungal lipases, cholinesterases, etc.)  These enzymes act on carboxylic esters (EC: 3.1.1.-). The catalytic apparatus involves three residues (catalytic triad): a serine, a glutamate or aspartate and a histidine.These...; Region: Esterase_lipase; cd00312
561275005724	substrate binding pocket [chemical binding]; other site
561275005725	catalytic triad [active]
561275005726	hypothetical protein; Provisional; Region: PRK05865
561275005727	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
561275005728	NAD(P) binding site [chemical binding]; other site
561275005729	active site
561275005730	PEP-utilising enzyme, mobile domain; Region: PEP-utilizers; pfam00391
561275005731	Polyketide synthase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3321
561275005732	polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833
561275005733	active site
561275005734	Acyl transferase domain in polyketide synthase (PKS) enzymes; Region: PKS_AT; smart00827
561275005735	Dehydratase domain in polyketide synthase (PKS) enzymes; Region: PKS_DH; smart00826
561275005736	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
561275005737	enoyl reductase of polyketide synthase; Region: enoyl_red; cd05195
561275005738	Enoylreductase; Region: PKS_ER; smart00829
561275005739	NAD(P) binding site [chemical binding]; other site
561275005740	beta-ketoacyl reductase (KR) domain of fatty acid synthase (FAS), subgroup 3, complex (x); Region: KR_3_FAS_SDR_x; cd08956
561275005741	This enzymatic domain is part of bacterial polyketide synthases; Region: PKS_KR; smart00822
561275005742	putative NADP binding site [chemical binding]; other site
561275005743	active site
561275005744	Phosphopantetheine attachment site; Region: PKS_PP; smart00823
561275005745	Polyketide synthase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3321
561275005746	polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833
561275005747	active site
561275005748	Acyl transferase domain in polyketide synthase (PKS) enzymes; Region: PKS_AT; smart00827
561275005749	Dehydratase domain in polyketide synthase (PKS) enzymes; Region: PKS_DH; smart00826
561275005750	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
561275005751	enoyl reductase of polyketide synthase; Region: enoyl_red; cd05195
561275005752	Enoylreductase; Region: PKS_ER; smart00829
561275005753	NAD(P) binding site [chemical binding]; other site
561275005754	beta-ketoacyl reductase (KR) domain of fatty acid synthase (FAS), subgroup 3, complex (x); Region: KR_3_FAS_SDR_x; cd08956
561275005755	This enzymatic domain is part of bacterial polyketide synthases; Region: PKS_KR; smart00822
561275005756	putative NADP binding site [chemical binding]; other site
561275005757	active site
561275005758	Phosphopantetheine attachment site; Region: PKS_PP; smart00823
561275005759	Domain of unknown function (DUF4109); Region: DUF4109; pfam13397
561275005760	Apolipoprotein N-acyltransferase [Cell envelope biogenesis, outer membrane]; Region: Lnt; COG0815
561275005761	Apolipoprotein N-acyl transferase (class 9 nitrilases); Region: ALP_N-acyl_transferase; cd07571
561275005762	putative active site [active]
561275005763	catalytic triad [active]
561275005764	putative dimer interface [polypeptide binding]; other site
561275005765	dolichyl-phosphate beta-D-mannosyltransferase; Region: PLN02726
561275005766	DPM1_like represents putative enzymes similar to eukaryotic DPM1; Region: DPM1_like; cd06442
561275005767	Ligand binding site; other site
561275005768	Putative Catalytic site; other site
561275005769	DXD motif; other site
561275005770	Predicted metal-dependent hydrolase with the TIM-barrel fold [General function prediction only]; Region: COG1574
561275005771	YtcJ_like metal dependent amidohydrolases. YtcJ is a Bacillus subtilis ORF of unknown function. The Arabidopsis homolog LAF3 has been identified as a factor required for photochrome A signalling; Region: YtcJ_like; cd01300
561275005772	active site
561275005773	phage T7 F exclusion suppressor FxsA; Reviewed; Region: fxsA; PRK11463
561275005774	Dienelactone hydrolase and related enzymes [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG0412
561275005775	BAAT / Acyl-CoA thioester hydrolase C terminal; Region: BAAT_C; pfam08840
561275005776	30S ribosomal protein S18; Provisional; Region: PRK13401
561275005777	30S ribosomal protein S14; Reviewed; Region: rpsN; PRK08881
561275005778	50S ribosomal protein L33; Validated; Region: rpmG; PRK00595
561275005779	50S ribosomal protein L28; Reviewed; Region: rpmB; PRK00359
561275005780	ABC-type metal ion transport system, periplasmic component/surface adhesin [Inorganic ion transport and metabolism]; Region: LraI; COG0803
561275005781	Helical backbone metal receptor (TroA-like domain). These proteins have been shown to function in the ABC transport of ferric siderophores and metal ions such as Mn2+, Fe3+, Cu2+ and/or Zn2+.  Their ligand binding site is formed in the interface between...; Region: TroA-like; cl00262
561275005782	intersubunit interface [polypeptide binding]; other site
561275005783	PPOX class probable F420-dependent enzyme, Rv2061 family; Region: Rv2061_F420; TIGR03666
561275005784	cobaltochelatase subunit CobN; Reviewed; Region: cobN; PRK05989
561275005785	CobN subunit of cobaltochelatase, bchH and chlH subunits of magnesium chelatases, and similar proteins; Region: CobN_like; cd10150
561275005786	CobN subunit of cobaltochelatase, bchH and chlH subunits of magnesium chelatases, and similar proteins; Region: CobN_like; cd10150
561275005787	precorrin-3B synthase; Region: CobG; TIGR02435
561275005788	Nitrite/Sulfite reductase ferredoxin-like half domain; Region: NIR_SIR_ferr; pfam03460
561275005789	precorrin-8X methylmutase; Reviewed; Region: cobH; PRK08285
561275005790	Precorrin-8X methylmutase; Region: CbiC; pfam02570
561275005791	Precorrin-2 C20-methyltransferase, also named CobI or CbiL; Region: Precorrin_2_C20_MT; cd11645
561275005792	active site
561275005793	SAM binding site [chemical binding]; other site
561275005794	homodimer interface [polypeptide binding]; other site
561275005795	Precorrin-3B C(17)-methyltransferase (CobJ/CbiH); Region: Precorrin_3B_C17_MT; cd11646
561275005796	active site
561275005797	SAM binding site [chemical binding]; other site
561275005798	homodimer interface [polypeptide binding]; other site
561275005799	Methyltransferase domain; Region: Methyltransf_31; pfam13847
561275005800	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275005801	S-adenosylmethionine binding site [chemical binding]; other site
561275005802	Beta-lactamase class A [Defense mechanisms]; Region: PenP; COG2367
561275005803	Beta-lactamase enzyme family; Region: Beta-lactamase2; pfam13354
561275005804	RNA polymerase sigma factor SigC; Reviewed; Region: PRK09649
561275005805	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
561275005806	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
561275005807	DNA binding residues [nucleotide binding]
561275005808	Precorrin-6x reductase [Coenzyme metabolism]; Region: CobK; COG2099
561275005809	Precorrin-6x reductase CbiJ/CobK; Region: CbiJ; cl00922
561275005810	Precorrin-4 C11-methyltransferase (CbiF/CobM); Region: Precorrin-4_C11-MT; cd11641
561275005811	active site
561275005812	SAM binding site [chemical binding]; other site
561275005813	homodimer interface [polypeptide binding]; other site
561275005814	Precorrin-6Y methyltransferase, the cobalamin biosynthesis enzyme CbiE; Region: Precorrin-6Y-methylase; cd11644
561275005815	active site
561275005816	SAM binding site [chemical binding]; other site
561275005817	Precorrin-6B methylase 2 [Coenzyme metabolism]; Region: CobL; COG2242
561275005818	precorrin-6Y C5,15-methyltransferase (decarboxylating), CbiT subunit; Region: CbiT; TIGR02469
561275005819	S-AdoMet dependent tetrapyrrole methylases; Region: TP_methylase; cl00304
561275005820	Catalytic domain of phosphoinositide-specific phospholipase C-like phosphodiesterases superfamily; Region: PI-PLCc_GDPD_SF; cl14615
561275005821	active site
561275005822	catalytic site [active]
561275005823	RD9, 2029 bp. Region of difference RD9, deleted region in Mycobacterium bovis BCG Pasteur (position 2313726..2313727), BCG Tokyo (position 2306504..2306505) and Mycobacterium bovis AF2122/97 (position 2313987..2313988) compared to Mycobacterium tuberculosis H37Rv2 (position: 2330073..2332101). Removes genes Rv2073-Rv2074 and truncates Rv2075c
561275005824	Protein of unknown function (DUF2563); Region: DUF2563; pfam10817
561275005825	Alpha/beta hydrolase; Region: Abhydrolase_8; pfam06259
561275005827	putative transposase OrfB; Reviewed; Region: PHA02517
561275005828	Serine/Threonine protein kinases, catalytic domain; Region: S_TKc; smart00220
561275005829	Catalytic domain of Protein Kinases; Region: PKc; cd00180
561275005830	active site
561275005831	ATP binding site [chemical binding]; other site
561275005832	substrate binding site [chemical binding]; other site
561275005833	activation loop (A-loop); other site
561275005834	PknH-like extracellular domain; Region: PknH_C; pfam14032
561275005835	Xaa-Pro aminopeptidase [Amino acid transport and metabolism]; Region: PepP; COG0006
561275005836	Similar to Prolidase and Aminopeptidase P. The members of this subfamily presumably catalyse hydrolysis of Xaa-Pro dipeptides and/or release of any N-terminal amino acid, including proline, that is linked with proline; Region: APP-like; cd01092
561275005837	active site
561275005838	5'-3' exonuclease, N-terminal resolvase-like domain; Region: 5_3_exonuc_N; pfam02739
561275005839	PIN domain of the 5'-3' exonuclease of Taq DNA polymerase I and homologs; Region: PIN_53EXO; cd09859
561275005840	active site
561275005841	metal binding site 1 [ion binding]; metal-binding site
561275005842	putative 5' ssDNA interaction site; other site
561275005843	metal binding site 3; metal-binding site
561275005844	metal binding site 2 [ion binding]; metal-binding site
561275005845	H3TH domain of the 5'-3' exonuclease of Taq DNA polymerase I and homologs; Region: H3TH_53EXO; cd09898
561275005846	putative DNA binding site [nucleotide binding]; other site
561275005847	putative metal binding site [ion binding]; other site
561275005848	Domain of unknown function (DUF4333); Region: DUF4333; pfam14230
561275005849	Superfamily II RNA helicase [DNA replication, recombination, and repair]; Region: COG4581
561275005850	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
561275005851	ATP binding site [chemical binding]; other site
561275005852	putative Mg++ binding site [ion binding]; other site
561275005853	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
561275005854	nucleotide binding region [chemical binding]; other site
561275005855	ATP-binding site [chemical binding]; other site
561275005856	DSHCT (NUC185) domain; Region: DSHCT; pfam08148
561275005857	Sec-independent protein secretion pathway component TatC [Intracellular trafficking and secretion]; Region: TatC; COG0805
561275005858	twin arginine translocase protein A; Provisional; Region: tatA; PRK00575
561275005859	mttA/Hcf106 family; Region: MttA_Hcf106; pfam02416
561275005860	Predicted transcriptional regulator [Transcription]; Region: COG2378
561275005861	WYL domain; Region: WYL; pfam13280
561275005862	Predicted transcriptional regulator [Transcription]; Region: COG2378
561275005863	WYL domain; Region: WYL; pfam13280
561275005864	proteasome accessory factor PafA; Region: pupylate_PafA; TIGR03686
561275005865	PE family; Region: PE; pfam00934
561275005866	Domain of unknown function (DUF222); Region: DUF222; pfam02720
561275005867	HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085
561275005868	active site
561275005869	Superfamily II DNA/RNA helicases, SNF2 family [Transcription / DNA replication, recombination, and repair]; Region: HepA; COG0553
561275005870	SNF2 Helicase protein; Region: DUF3670; pfam12419
561275005871	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
561275005872	ATP binding site [chemical binding]; other site
561275005873	putative Mg++ binding site [ion binding]; other site
561275005874	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
561275005875	nucleotide binding region [chemical binding]; other site
561275005876	ATP-binding site [chemical binding]; other site
561275005877	Uncharacterized conserved protein [Function unknown]; Region: COG4279
561275005878	PIN domain of ribonucleases (toxins), VapC, FitB, and PAE0151 of bacterial and archaeal toxin/antitoxin-like operons, and other similar homologs; Region: PIN_VapC-like; cd09861
561275005879	putative active site [active]
561275005880	PE family; Region: PE; pfam00934
561275005881	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275005882	PPE family; Region: PPE; pfam00823
561275005883	proteasome, alpha subunit, bacterial type; Region: 20S_bact_alpha; TIGR03691
561275005884	proteasome_protease_HslV. This group contains the eukaryotic proteosome alpha and beta subunits and the prokaryotic protease hslV subunit. Proteasomes are large multimeric self-compartmentalizing proteases, involved in the clearance of misfolded proteins; Region: proteasome_protease_HslV; cd01906
561275005885	active site
561275005886	proteasome, beta subunit, bacterial type; Region: 20S_bact_beta; TIGR03690
561275005887	proteasome_protease_HslV. This group contains the eukaryotic proteosome alpha and beta subunits and the prokaryotic protease hslV subunit. Proteasomes are large multimeric self-compartmentalizing proteases, involved in the clearance of misfolded proteins; Region: proteasome_protease_HslV; cd01906
561275005888	active site
561275005889	Pup-like protein; Region: Pup; pfam05639
561275005890	proteasome accessory factor PafA2; Region: pupylate_PafA2; TIGR03688
561275005891	proteasome ATPase; Region: pup_AAA; TIGR03689
561275005892	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
561275005893	Walker A motif; other site
561275005894	ATP binding site [chemical binding]; other site
561275005895	Walker B motif; other site
561275005896	arginine finger; other site
561275005897	Type 1 periplasmic binding fold superfamily; Region: Periplasmic_Binding_Protein_Type_1; cl10011
561275005898	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG1550
561275005899	tRNA(1-methyladenosine) methyltransferase and related methyltransferases [Translation, ribosomal structure and biogenesis]; Region: GCD14; COG2519
561275005900	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275005901	RecB family exonuclease [DNA replication, recombination, and repair]; Region: COG2887
561275005902	Predicted membrane protein [Function unknown]; Region: COG3918
561275005903	ATP phosphoribosyltransferase; Reviewed; Region: hisG; PRK00489
561275005904	ATP phosphoribosyltransferase; Region: hisG; TIGR00070
561275005905	ATP phosphoribosyltransferase, C-terminal domain; Region: HisG_C-term; TIGR03455
561275005906	Nucleoside Triphosphate Pyrophosphohydrolase (EC 3.6.1.8) MazG-like domain found in Mycobacterium tuberculosis phosphoribosyl-ATP pyrophosphohydrolase (HisE or PRATP-PH) and its bacterial homologs; Region: NTP-PPase_HisE; cd11547
561275005907	homodimer interface [polypeptide binding]; other site
561275005908	putative metal binding site [ion binding]; other site
561275005909	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275005910	PPE family; Region: PPE; pfam00823
561275005911	Methionine synthase I (cobalamin-dependent), methyltransferase domain [Amino acid transport and metabolism]; Region: MetH; COG0646
561275005912	5-methyltetrahydrofolate--homocysteine methyltransferase; Region: metH; TIGR02082
561275005913	MeTr subgroup of pterin binding enzymes. This family includes cobalamin-dependent methyltransferases such as methyltetrahydrofolate, corrinoid iron-sulfur protein methyltransferase (MeTr) and methionine synthase (MetH).  Cobalamin-dependent...; Region: MeTr; cd00740
561275005914	substrate binding pocket [chemical binding]; other site
561275005915	B12 binding domain of methionine synthase. This domain binds methylcobalamin, which it uses as an intermediate methyl carrier from methyltetrahydrofolate (CH3H4folate) to homocysteine (Hcy); Region: methionine_synthase_B12_BD; cd02069
561275005916	B12 binding site [chemical binding]; other site
561275005917	cobalt ligand [ion binding]; other site
561275005918	Vitamin B12 dependent methionine synthase, activation domain; Region: Met_synt_B12; pfam02965
561275005919	PAC2 family; Region: PAC2; pfam09754
561275005920	Gamma-aminobutyrate permease and related permeases [Amino acid transport and metabolism]; Region: AnsP; COG1113
561275005921	short chain dehydrogenase; Provisional; Region: PRK05872
561275005922	classical (c) SDRs; Region: SDR_c; cd05233
561275005923	NAD(P) binding site [chemical binding]; other site
561275005924	active site
561275005925	catalytic core domain of cysteinyl tRNA synthetase; Region: CysRS_core; cd00672
561275005926	cysteinyl-tRNA synthetase; Provisional; Region: PRK12418
561275005927	active site
561275005928	HIGH motif; other site
561275005929	nucleotidyl transferase superfamily; Region: nt_trans; cl00015
561275005930	active site
561275005931	KMSKS motif; other site
561275005932	Anticodon-binding domain of cysteinyl tRNA synthetases and domain found in MshC; Region: Anticodon_Ia_Cys_like; cd07955
561275005933	putative tRNA binding surface [nucleotide binding]; other site
561275005934	CysQ, a 3'-Phosphoadenosine-5'-phosphosulfate (PAPS) 3'-phosphatase, is a bacterial member of the inositol monophosphatase family. It has been proposed that CysQ helps control intracellular levels of PAPS, which is an intermediate in...; Region: CysQ; cd01638
561275005935	active site
561275005936	Ribbon-helix-helix protein, copG family; Region: RHH_1; pfam01402
561275005937	conserved hypothetical protein; Region: TIGR03843
561275005938	conserved hypothetical protein; Region: TIGR03847
561275005939	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
561275005940	catalytic core [active]
561275005941	undecaprenyl-diphosphatase UppP; Region: undec_PP_bacA; TIGR00753
561275005942	dihydroorotate dehydrogenase, subfamily 2; Region: pyrD_sub2; TIGR01036
561275005943	Dihydroorotate dehydrogenase (DHOD) class 2. DHOD catalyzes the oxidation of (S)-dihydroorotate to orotate. This is the fourth step and the only redox reaction in the de novo biosynthesis of UMP, the precursor of all pyrimidine nucleotides. DHOD requires...; Region: DHOD_2_like; cd04738
561275005944	quinone interaction residues [chemical binding]; other site
561275005945	active site
561275005946	catalytic residues [active]
561275005947	FMN binding site [chemical binding]; other site
561275005948	substrate binding site [chemical binding]; other site
561275005949	PhosphatidylEthanolamine-Binding Protein (PEBP) domain present in bacteria and archaea; Region: PEBP_bact_arch; cd00865
561275005950	substrate binding site [chemical binding]; other site
561275005951	hypothetical protein; Provisional; Region: PRK07906
561275005952	M20 Peptidase, carboxypeptidase yscS-like; Region: M20_yscS_like; cd05675
561275005953	putative metal binding site [ion binding]; other site
561275005954	Plasmid stabilisation system protein; Region: Plasmid_stabil; cl17483
561275005955	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
561275005956	active site
561275005957	DivIVA domain; Region: DivI1A_domain; TIGR03544
561275005958	Cell division initiation protein [Cell division and chromosome partitioning]; Region: DivIVA; COG3599
561275005959	ATP synthase B/B' CF(0); Region: ATP-synt_B; cl17192
561275005960	Predicted integral membrane protein [Function unknown]; Region: COG0762
561275005961	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG1799
561275005962	Predicted enzyme with a TIM-barrel fold [General function prediction only]; Region: COG0325
561275005963	pyridoxal 5'-phosphate (PLP) binding site [chemical binding]; other site
561275005964	catalytic residue [active]
561275005965	Multicopper polyphenol oxidase (laccase) [Secondary metabolites biosynthesis, transport and catabolism]; Region: yfiH; COG1496
561275005966	uncharacterized protein, YfiH family; Region: TIGR00726
561275005967	cell division protein FtsZ; Validated; Region: PRK09330
561275005968	FtsZ is a GTPase that is similar to the eukaryotic tubulins and is essential for cell division in prokaryotes.  FtsZ is capable of polymerizing in a GTP-driven process into structures similar to those formed by tubulin. FtsZ forms a ring-shaped septum at...; Region: FtsZ_type1; cd02201
561275005969	nucleotide binding site [chemical binding]; other site
561275005970	SulA interaction site; other site
561275005971	Cell division septal protein [Cell envelope biogenesis, outer membrane]; Region: FtsQ; COG1589
561275005972	POTRA domain, FtsQ-type; Region: POTRA_1; pfam08478
561275005973	Cell division protein FtsQ; Region: FtsQ; pfam03799
561275005974	UDP-N-acetylmuramate--L-alanine ligase; Provisional; Region: murC; PRK00421
561275005975	Mur ligase family, catalytic domain; Region: Mur_ligase; pfam01225
561275005976	Mur ligase middle domain; Region: Mur_ligase_M; pfam08245
561275005977	Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875
561275005978	MurG is an N-acetylglucosaminyltransferase, the last enzyme involved in the intracellular phase of peptidoglycan biosynthesis. It transfers N-acetyl-D-glucosamine (GlcNAc) from UDP-GlcNAc to the C4 hydroxyl of a lipid-linked N-acetylmuramoyl pentapeptide...; Region: GT1_MurG; cd03785
561275005979	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase; Region: murG; TIGR01133
561275005980	active site
561275005981	homodimer interface [polypeptide binding]; other site
561275005982	cell division protein FtsW; Region: ftsW; TIGR02614
561275005983	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate synthetase; Provisional; Region: murD; PRK03369
561275005984	Mur ligase middle domain; Region: Mur_ligase_M; pfam08245
561275005985	Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875
561275005986	phospho-N-acetylmuramoyl-pentapeptide-transferase; Provisional; Region: mraY; PRK00108
561275005987	Phospho-N-acetylmuramoyl-pentapeptide-transferase (mraY) is an enzyme responsible for the formation of the first lipid intermediate in the synthesis of bacterial cell wall peptidoglycan. It catalyzes the formation of...; Region: GT_MraY; cd06852
561275005988	Mg++ binding site [ion binding]; other site
561275005989	putative catalytic motif [active]
561275005990	putative substrate binding site [chemical binding]; other site
561275005991	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase; Region: murF; TIGR01143
561275005992	Mur ligase middle domain; Region: Mur_ligase_M; pfam08245
561275005993	Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875
561275005994	UDP-N-acetylmuramoylalanyl-D-glutamate--2, 6-diaminopimelate ligase; Provisional; Region: murE; PRK00139
561275005995	Mur ligase family, catalytic domain; Region: Mur_ligase; pfam01225
561275005996	Mur ligase middle domain; Region: Mur_ligase_M; pfam08245
561275005997	Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875
561275005998	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275005999	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275006000	probable F420-dependent oxidoreductase, Rv2161c family; Region: F420_Rv2161c; TIGR03619
561275006001	Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cl07892
561275006002	N5,N10-methylenetetrahydromethanopterin reductase (Mer) catalyzes the reduction of N5,N10-methylenetetrahydromethanopterin with reduced coenzyme F420 to N5-methyltetrahydromethanopterin and oxidized coenzyme F420; Region: Tetrahydromethanopterin_reductase; cd01097
561275006003	PE family; Region: PE; pfam00934
561275006004	Cell division protein FtsI/penicillin-binding protein 2 [Cell envelope biogenesis, outer membrane]; Region: FtsI; COG0768
561275006005	Penicillin-binding Protein dimerisation domain; Region: PBP_dimer; pfam03717
561275006006	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; pfam00905
561275006007	Predicted S-adenosylmethionine-dependent methyltransferase involved in cell envelope biogenesis [Cell envelope biogenesis, outer membrane]; Region: COG0275
561275006008	MraW methylase family; Region: Methyltransf_5; pfam01795
561275006009	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2001
561275006010	MraZ protein; Region: MraZ; pfam02381
561275006011	MraZ protein; Region: MraZ; pfam02381
561275006012	Protein of unknown function (DUF3040); Region: DUF3040; pfam11239
561275006013	Protein of unknown function (DUF3153); Region: DUF3153; pfam11353
561275006014	Geranylgeranyl pyrophosphate synthase [Coenzyme metabolism]; Region: IspA; COG0142
561275006015	Trans-Isoprenyl Diphosphate Synthases, head-to-tail; Region: Trans_IPPS_HT; cd00685
561275006016	substrate binding pocket [chemical binding]; other site
561275006017	chain length determination region; other site
561275006018	substrate-Mg2+ binding site; other site
561275006019	catalytic residues [active]
561275006020	aspartate-rich region 1; other site
561275006021	active site lid residues [active]
561275006022	aspartate-rich region 2; other site
561275006023	carotene biosynthesis associated membrane protein; Region: crt_membr; TIGR03459
561275006024	Serine/Threonine protein kinases, catalytic domain; Region: S_TKc; smart00220
561275006025	Catalytic domain of Protein Kinases; Region: PKc; cd00180
561275006026	active site
561275006027	ATP binding site [chemical binding]; other site
561275006028	substrate binding site [chemical binding]; other site
561275006029	Protein Kinases, catalytic domain; Region: PKc_like; cl09925
561275006030	substrate binding site [chemical binding]; other site
561275006031	activation loop (A-loop); other site
561275006032	activation loop (A-loop); other site
561275006033	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3547
561275006034	Transposase IS116/IS110/IS902 family; Region: Transposase_20; pfam02371
561275006035	3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) synthase [Amino acid transport and metabolism]; Region: AroG; COG3200
561275006036	Protein of unknown function (DUF2029); Region: DUF2029; cl09812
561275006037	1-acyl-sn-glycerol-3-phosphate acyltransferase [Lipid metabolism]; Region: PlsC; COG0204
561275006038	Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: AGPAT-like; Region: LPLAT_AGPAT-like; cd07989
561275006039	putative acyl-acceptor binding pocket; other site
561275006040	Predicted ATPase involved in chromosome partitioning [Cell division and chromosome partitioning]; Region: ArsA; COG0003
561275006041	ArsA ATPase functionas as an efflux pump located on the inner membrane of the cell. This ATP-driven oxyanion pump catalyzes the extrusion of arsenite, antimonite and arsenate. Maintenance of a low intracellular concentration of oxyanion produces...; Region: ArsA; cd02035
561275006042	DTAP/Switch II; other site
561275006043	Switch I; other site
561275006044	Ligand-binding SRPBCC domain of an uncharacterized subfamily of proteins; Region: SRPBCC_2; cd07819
561275006045	putative hydrophobic ligand binding site [chemical binding]; other site
561275006046	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
561275006047	Long-chain acyl-CoA synthetases (AMP-forming) [Lipid metabolism]; Region: FAA1; COG1022
561275006048	Long-chain fatty acid CoA synthetases and Bubblegum-like very long-chain fatty acid CoA synthetases; Region: VL_LC_FACS_like; cd05907
561275006049	acyl-activating enzyme (AAE) consensus motif; other site
561275006050	putative AMP binding site [chemical binding]; other site
561275006051	putative active site [active]
561275006052	putative CoA binding site [chemical binding]; other site
561275006053	This family is most closely related to the GT1 family of glycosyltransferases and named after YqgM in Bacillus licheniformis about which little is known. Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to...; Region: GT1_YqgM_like; cd03801
561275006054	Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438
561275006055	Peptidase MA superfamily; Region: Peptidase_MA_2; pfam13485
561275006056	Cell wall-associated hydrolases (invasion-associated proteins) [Cell envelope biogenesis, outer membrane]; Region: Spr; COG0791
561275006057	NlpC/P60 family; Region: NLPC_P60; pfam00877
561275006058	hypothetical protein; Validated; Region: PRK07883
561275006059	DEDDh 3'-5' exonuclease domain family; Region: DEDDh; cd06127
561275006060	active site
561275006061	catalytic site [active]
561275006062	substrate binding site [chemical binding]; other site
561275006063	Catalytic GIY-YIG domain of nucleotide excision repair endonucleases UvrC, Cho, and similar proteins; Region: GIY-YIG_UvrC_Cho; cd10434
561275006064	GIY-YIG motif/motif A; other site
561275006065	active site
561275006066	catalytic site [active]
561275006067	putative DNA binding site [nucleotide binding]; other site
561275006068	metal binding site [ion binding]; metal-binding site
561275006069	anthranilate phosphoribosyltransferase; Provisional; Region: trpD; PRK00188
561275006070	Glycosyl transferase family, helical bundle domain; Region: Glycos_trans_3N; pfam02885
561275006071	Glycosyl transferase family, a/b domain; Region: Glycos_transf_3; pfam00591
561275006072	Heme-copper oxidase subunit III.  Heme-copper oxidases are transmembrane protein complexes in the respiratory chains of prokaryotes and mitochondria which couple the reduction of molecular oxygen to water to, proton pumping across the membrane. The...; Region: Heme_Cu_Oxidase_III_like; cd00386
561275006073	Subunit I/III interface [polypeptide binding]; other site
561275006074	Cytochrome c, mono- and diheme variants [Energy production and conversion]; Region: CccA; COG2010
561275006075	Cytochrome c; Region: Cytochrom_C; pfam00034
561275006076	Cytochrome C oxidase, cbb3-type, subunit III; Region: Cytochrome_CBB3; pfam13442
561275006077	Rieske Fe-S protein [Energy production and conversion]; Region: QcrA; COG0723
561275006078	Rieske domain; a [2Fe-2S] cluster binding domain commonly found in Rieske non-heme iron oxygenase (RO) systems such as naphthalene and biphenyl dioxygenases, as well as in plant/cyanobacterial chloroplast b6f and mitochondrial cytochrome bc(1) complexes; Region: Rieske; cd03467
561275006079	iron-sulfur cluster [ion binding]; other site
561275006080	[2Fe-2S] cluster binding site [ion binding]; other site
561275006081	Cytochrome b subunit of the bc complex [Energy production and conversion]; Region: QcrB; COG1290
561275006082	Cytochrome b (N-terminus)/b6/petB:  Cytochrome b is a subunit of cytochrome bc1, an 11-subunit mitochondrial respiratory enzyme. Cytochrome b spans the mitochondrial membrane with 8 transmembrane helices (A-H) in eukaryotes. In plants and cyanobacteria; Region: Cytochrome_b_N; cl00859
561275006083	heme bH binding site [chemical binding]; other site
561275006084	intrachain domain interface; other site
561275006085	heme bL binding site [chemical binding]; other site
561275006086	interchain domain interface [polypeptide binding]; other site
561275006087	Cytochrome b(N-terminal)/b6/petB; Region: Cytochrom_B_N_2; pfam13631
561275006088	Qo binding site; other site
561275006089	Protein of unknown function (DUF2561); Region: DUF2561; pfam10812
561275006090	Mycobacterium membrane protein; Region: Mycobact_memb; pfam05423
561275006091	Cytochrome c oxidase subunit IV; Region: Cyt_c_ox_IV; pfam12270
561275006092	Heme/copper-type cytochrome/quinol oxidases, subunit 2 [Energy production and conversion]; Region: CyoA; COG1622
561275006093	Cytochrome C oxidase subunit II, periplasmic domain; Region: COX2; pfam00116
561275006094	Asparagine synthase (glutamine-hydrolyzing) [Amino acid transport and metabolism]; Region: AsnB; COG0367
561275006095	Glutamine amidotransferases class-II (GATase) asparagine synthase_B type.  Asparagine synthetase B catalyses the ATP-dependent conversion of aspartate to asparagine. This enzyme is a homodimer, with each monomer composed of a  glutaminase domain and a...; Region: AsnB; cd00712
561275006096	dimer interface [polypeptide binding]; other site
561275006097	active site
561275006098	The C-terminal domain of Asparagine Synthase B. This domain is always found associated n-terminal amidotransferase domain. Family members that contain this domain catalyse the conversion of aspartate to asparagine. Asparagine synthetase B  catalyzes the...; Region: Asn_Synthase_B_C; cd01991
561275006099	Ligand Binding Site [chemical binding]; other site
561275006100	Molecular Tunnel; other site
561275006101	Ribokinase-like subgroup A.  Found in bacteria and archaea, this subgroup is part of the ribokinase/pfkB superfamily.  Its oligomerization state is unknown at this time; Region: ribokinase_group_A; cd01942
561275006102	Sugar kinases, ribokinase family [Carbohydrate transport and metabolism]; Region: RbsK; COG0524
561275006103	substrate binding site [chemical binding]; other site
561275006104	ATP binding site [chemical binding]; other site
561275006105	Fe-S cluster assembly scaffold protein [Posttranslational modification, protein turnover, chaperones]; Region: sufA; COG0316
561275006106	Glycerate kinase family; Region: Gly_kinase; pfam02595
561275006107	Protein of unknown function (DUF3043); Region: DUF3043; pfam11241
561275006108	Phosphoribosyltransferase; Region: DBI_PRT; pfam02277
561275006109	Nicotinate-nucleotide-dimethylbenzimidazole phosphoribosyltransferase (DMB-PRT), also called CobT; Region: DMB-PRT_CobT; cd02439
561275006110	putative dimer interface [polypeptide binding]; other site
561275006111	active site pocket [active]
561275006112	putative cataytic base [active]
561275006113	Cobalamin-5-phosphate synthase; Region: CobS; pfam02654
561275006114	branched-chain amino acid aminotransferase; Provisional; Region: PRK13357
561275006115	BCAT_beta_family: Branched-chain aminotransferase catalyses the transamination of the branched-chain amino acids  leusine, isoleucine and valine to their respective alpha-keto acids, alpha-ketoisocaproate, alpha-keto-beta-methylvalerate and...; Region: BCAT_beta_family; cd01557
561275006116	homodimer interface [polypeptide binding]; other site
561275006117	substrate-cofactor binding pocket; other site
561275006118	catalytic residue [active]
561275006119	glycine cleavage system aminomethyltransferase T; Reviewed; Region: gcvT; PRK00389
561275006120	Glycine cleavage T-protein C-terminal barrel domain; Region: GCV_T_C; pfam08669
561275006121	cyclase homology domain; Region: CHD; cd07302
561275006122	Adenylate cyclase, family 3 (some proteins contain HAMP domain) [Signal transduction mechanisms]; Region: CyaA; COG2114
561275006123	nucleotidyl binding site; other site
561275006124	metal binding site [ion binding]; metal-binding site
561275006125	dimer interface [polypeptide binding]; other site
561275006126	multifunctional aminopeptidase A; Provisional; Region: PRK00913
561275006127	Cytosol aminopeptidase family, N-terminal and catalytic domains.  Family M17 contains zinc- and manganese-dependent exopeptidases ( EC  3.4.11.1), including leucine aminopeptidase. They catalyze removal of amino acids from the N-terminus of a protein and...; Region: Peptidase_M17; cd00433
561275006128	interface (dimer of trimers) [polypeptide binding]; other site
561275006129	Substrate-binding/catalytic site; other site
561275006130	Zn-binding sites [ion binding]; other site
561275006131	short chain dehydrogenase; Validated; Region: PRK05855
561275006132	Putative lysophospholipase; Region: Hydrolase_4; pfam12146
561275006133	classical (c) SDRs; Region: SDR_c; cd05233
561275006134	NAD(P) binding site [chemical binding]; other site
561275006135	active site
561275006136	dihydrolipoamide acetyltransferase; Reviewed; Region: PRK11855
561275006137	Lipoyl domain of the dihydrolipoyl acyltransferase component (E2) of 2-oxo acid dehydrogenases. 2-oxo acid dehydrogenase multienzyme complexes, like pyruvate dehydrogenase (PDH), 2-oxoglutarate dehydrogenase (OGDH) and branched-chain 2-oxo acid...; Region: lipoyl_domain; cd06849
561275006138	E3 interaction surface; other site
561275006139	lipoyl attachment site [posttranslational modification]; other site
561275006140	Lipoyl domain of the dihydrolipoyl acyltransferase component (E2) of 2-oxo acid dehydrogenases. 2-oxo acid dehydrogenase multienzyme complexes, like pyruvate dehydrogenase (PDH), 2-oxoglutarate dehydrogenase (OGDH) and branched-chain 2-oxo acid...; Region: lipoyl_domain; cd06849
561275006141	E3 interaction surface; other site
561275006142	lipoyl attachment site [posttranslational modification]; other site
561275006143	e3 binding domain; Region: E3_binding; pfam02817
561275006144	2-oxoacid dehydrogenases acyltransferase (catalytic domain); Region: 2-oxoacid_dh; pfam00198
561275006145	atypical (a) SDRs, subgroup 8; Region: SDR_a8; cd05242
561275006146	Predicted nucleoside-diphosphate sugar epimerase [General function prediction only]; Region: COG1090
561275006147	putative NAD(P) binding site [chemical binding]; other site
561275006148	putative active site [active]
561275006149	lipoate-protein ligase B; Provisional; Region: PRK14345
561275006150	lipoyl synthase; Provisional; Region: PRK05481
561275006151	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
561275006152	FeS/SAM binding site; other site
561275006153	Domain of unknown function (DUF4191); Region: DUF4191; pfam13829
561275006154	RDD family; Region: RDD; pfam06271
561275006155	glutamine synthetase, type I; Region: GlnA; TIGR00653
561275006156	Glutamine synthetase, beta-Grasp domain; Region: Gln-synt_N; pfam03951
561275006157	Glutamine synthetase, catalytic domain; Region: Gln-synt_C; pfam00120
561275006158	bifunctional glutamine-synthetase adenylyltransferase/deadenyltransferase; Provisional; Region: PRK14109
561275006159	Nucleotidyltransferase (NT) domain of Escherichia coli adenylyltransferase (GlnE), Escherichia coli uridylyl transferase (GlnD), and similar proteins; Region: NT_GlnE_GlnD_like; cd05401
561275006160	metal binding triad; other site
561275006161	GlnD PII-uridylyltransferase; Region: GlnD_UR_UTase; pfam08335
561275006162	Nucleotidyltransferase (NT) domain of Escherichia coli adenylyltransferase (GlnE), Escherichia coli uridylyl transferase (GlnD), and similar proteins; Region: NT_GlnE_GlnD_like; cd05401
561275006163	metal binding triad; other site
561275006164	GlnD PII-uridylyltransferase; Region: GlnD_UR_UTase; pfam08335
561275006165	Glutamine synthetase [Amino acid transport and metabolism]; Region: GlnA; COG0174
561275006166	Glutamine synthetase, beta-Grasp domain; Region: Gln-synt_N; pfam03951
561275006167	Glutamine synthetase, catalytic domain; Region: Gln-synt_C; pfam00120
561275006168	alpha/beta hydrolase fold; Region: Abhydrolase_1; pfam00561
561275006169	TAP-like protein; Region: Abhydrolase_4; pfam08386
561275006170	alpha/beta hydrolase fold; Region: Abhydrolase_1; pfam00561
561275006171	TAP-like protein; Region: Abhydrolase_4; pfam08386
561275006172	Ketopantoate hydroxymethyltransferase (KPHMT) is the first enzyme in the pantothenate biosynthesis pathway. Ketopantoate hydroxymethyltransferase (KPHMT) catalyzes the first committed step in the biosynthesis of pantothenate (vitamin B5), which is a...; Region: KPHMT-like; cd06557
561275006173	oligomerization interface [polypeptide binding]; other site
561275006174	active site
561275006175	metal binding site [ion binding]; metal-binding site
561275006176	CYTH-like (also known as triphosphate tunnel metalloenzyme (TTM)-like) Phosphatases; Region: CYTH-like_Pase; cd07374
561275006177	putative active site; other site
561275006178	putative metal binding residues [ion binding]; other site
561275006179	signature motif; other site
561275006180	putative triphosphate binding site [ion binding]; other site
561275006181	The CHAD domain is an alpha-helical domain functionally associated with some members of the adenylate cyclase family; Region: CHAD; smart00880
561275006182	Uncharacterized protein conserved in bacteria (DUF2086); Region: DUF2086; cl17606
561275006183	Uncharacterized protein conserved in bacteria (DUF2086); Region: DUF2086; pfam09859
561275006184	bifunctional RNase H/acid phosphatase; Provisional; Region: PRK07238
561275006185	RNAse HI family that includes Archaeal RNase HI; Region: RNase_HI_archaeal_like; cd09279
561275006186	RNA/DNA hybrid binding site [nucleotide binding]; other site
561275006187	active site
561275006188	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
561275006189	catalytic core [active]
561275006190	Zn-ribbon protein, possibly nucleic acid-binding [General function prediction only]; Region: COG1579
561275006191	Putative zinc ribbon domain; Region: DUF164; pfam02591
561275006192	NIF3 (NGG1p interacting factor 3); Region: NIF3; cl15371
561275006193	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3323
561275006194	Uncharacterized conserved protein [Function unknown]; Region: COG0327
561275006195	NIF3 (NGG1p interacting factor 3); Region: NIF3; pfam01784
561275006196	hypothetical protein; Provisional; Region: PRK07908
561275006197	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
561275006198	pyridoxal 5'-phosphate binding site [chemical binding]; other site
561275006199	homodimer interface [polypeptide binding]; other site
561275006200	catalytic residue [active]
561275006201	Predicted phosphatases [General function prediction only]; Region: Gph; COG0546
561275006202	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
561275006203	active site
561275006204	motif I; other site
561275006205	motif II; other site
561275006206	Low molecular weight phosphatase family; Region: LMWPc; cd00115
561275006207	Low molecular weight phosphotyrosine protein phosphatase; Region: LMWPc; pfam01451
561275006208	active site
561275006209	SURF1 superfamily. Surf1/Shy1 has been implicated in the posttranslational steps of the biogenesis of the mitochondrially-encoded Cox1 subunit of cytochrome c oxidase (complex IV). Cytochrome c oxidase (complex IV), the terminal electron-transferring...; Region: SURF1; cd06662
561275006210	cobalamin biosynthesis protein; Provisional; Region: cobD; PRK01209
561275006211	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3662
561275006212	Peroxiredoxin [Posttranslational modification, protein turnover, chaperones]; Region: AhpC; COG0450
561275006213	Peroxiredoxin (PRX) family, AhpE-like subfamily; composed of proteins similar to Mycobacterium tuberculosis AhpE. AhpE is described as a 1-cys PRX because of the absence of a resolving cysteine. The structure and sequence of AhpE, however, show greater...; Region: PRX_AhpE_like; cd03018
561275006214	dimer interface [polypeptide binding]; other site
561275006215	catalytic triad [active]
561275006216	Protein of unknown function (DUF3052); Region: DUF3052; pfam11253
561275006217	pyruvate dehydrogenase subunit E1; Reviewed; Region: aceE; PRK09405
561275006218	Thiamine pyrophosphate (TPP) family, E1 of E. coli PDC-like subfamily, TPP-binding module; composed of proteins similar to the E1 component of the Escherichia coli pyruvate dehydrogenase multienzyme complex (PDC). PDC catalyzes the oxidative...; Region: TPP_E1_EcPDC_like; cd02017
561275006219	dimer interface [polypeptide binding]; other site
561275006220	TPP-binding site [chemical binding]; other site
561275006221	Regulator of polyketide synthase expression [Signal transduction mechanisms / Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG2508
561275006222	PucR C-terminal helix-turn-helix domain; Region: HTH_30; pfam13556
561275006223	(acyl-carrier-protein) S-malonyltransferase [Lipid metabolism]; Region: FabD; COG0331
561275006224	malonyl CoA-acyl carrier protein transacylase; Region: fabD; TIGR00128
561275006225	acyl carrier protein; Provisional; Region: acpP; PRK00982
561275006226	3-oxoacyl-(acyl carrier protein) synthase II; Reviewed; Region: PRK07910
561275006227	Beta-ketoacyl-acyl carrier protein (ACP) synthase (KAS), type I and II. KASs are responsible for the elongation steps in fatty acid biosynthesis. KASIII catalyses the initial condensation and KAS I and II catalyze further elongation steps by Claisen...; Region: KAS_I_II; cd00834
561275006228	dimer interface [polypeptide binding]; other site
561275006229	active site
561275006230	3-oxoacyl-(acyl carrier protein) synthase II; Reviewed; Region: PRK07910
561275006231	Beta-ketoacyl-acyl carrier protein (ACP) synthase (KAS), type I and II. KASs are responsible for the elongation steps in fatty acid biosynthesis. KASIII catalyses the initial condensation and KAS I and II catalyze further elongation steps by Claisen...; Region: KAS_I_II; cd00834
561275006232	dimer interface [polypeptide binding]; other site
561275006233	active site
561275006234	Acetyl-CoA carboxylase, carboxyltransferase component (subunits alpha and beta) [Lipid metabolism]; Region: COG4799
561275006235	malonate decarboxylase subunit beta; Reviewed; Region: PRK07189; cl17682
561275006236	Acetyl-CoA carboxylase alpha subunit [Lipid metabolism]; Region: AccA; cl17345
561275006237	Superfamily of nucleases including Short Patch Repair (Vsr) Endonucleases, archaeal Holliday junction resolvases, MutH methy-directed DNA mismatch-repair endonucleases, and catalytic domains of many restriction endonucleases, such as EcoRI, BamHI, and...; Region: Restriction_endonuclease_like; cl00277
561275006238	Glycerol-3-phosphate dehydrogenase [Energy production and conversion]; Region: GlpA; COG0578
561275006239	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275006240	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275006241	FAD/FMN-containing dehydrogenases [Energy production and conversion]; Region: GlcD; COG0277
561275006242	FAD binding domain; Region: FAD_binding_4; pfam01565
561275006243	diacylglycerol kinase; Reviewed; Region: PRK11914
561275006244	Diacylglycerol kinase catalytic domain; Region: DAGK_cat; pfam00781
561275006245	Protein of unknown function (DUF3145); Region: DUF3145; pfam11343
561275006246	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
561275006247	Beta-lactamase; Region: Beta-lactamase; pfam00144
561275006248	Methyltransferase domain; Region: Methyltransf_31; pfam13847
561275006249	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275006250	S-adenosylmethionine binding site [chemical binding]; other site
561275006251	S-(hydroxymethyl)mycothiol dehydrogenase; Region: mycoS_dep_FDH; TIGR03451
561275006252	Class III alcohol dehydrogenase; Region: Zn_ADH_class_III; cd08279
561275006253	NAD binding site [chemical binding]; other site
561275006254	catalytic Zn binding site [ion binding]; other site
561275006255	substrate binding site [chemical binding]; other site
561275006256	structural Zn binding site [ion binding]; other site
561275006257	Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849
561275006258	Apolipoprotein N-acyltransferase [Cell envelope biogenesis, outer membrane]; Region: Lnt; COG0815
561275006259	Apolipoprotein N-acyl transferase (class 9 nitrilases); Region: ALP_N-acyl_transferase; cd07571
561275006260	putative active site [active]
561275006261	catalytic triad [active]
561275006262	putative dimer interface [polypeptide binding]; other site
561275006263	short chain dehydrogenase; Provisional; Region: PRK05854
561275006264	retinol dehydrogenase (retinol-DH), Light dependent Protochlorophyllide (Pchlide) OxidoReductase (LPOR) and related proteins, classical (c) SDRs; Region: retinol-DH_like_SDR_c_like; cd05327
561275006265	putative NAD(P) binding site [chemical binding]; other site
561275006266	active site
561275006267	Molecular chaperone [Posttranslational modification, protein turnover, chaperones]; Region: DnaK; COG0443
561275006268	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cl17037
561275006269	nucleotide binding site [chemical binding]; other site
561275006270	Major Facilitator Superfamily; Region: MFS_1; pfam07690
561275006271	Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124
561275006272	Cytochrome P450; Region: p450; cl12078
561275006273	Sulfotransferase domain; Region: Sulfotransfer_1; pfam00685
561275006274	Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124
561275006275	Cytochrome P450; Region: p450; cl12078
561275006276	Septum formation; Region: Septum_form; pfam13845
561275006277	Protein of unknown function (DUF2695); Region: DUF2695; pfam10905
561275006278	Predicted membrane protein [Function unknown]; Region: COG2149
561275006279	Domain of unknown function (DUF202); Region: DUF202; pfam02656
561275006280	Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124
561275006281	Cytochrome P450; Region: p450; cl12078
561275006282	Glycerophosphodiester phosphodiesterase domain of uncharacterized bacterial protein Rv2277c and similar proteins; Region: GDPD_Rv2277c_like; cd08580
561275006283	Glycerophosphoryl diester phosphodiesterase family; Region: GDPD; pfam03009
561275006284	putative active site [active]
561275006285	catalytic site [active]
561275006286	putative metal binding site [ion binding]; other site
561275006287	glycolate oxidase, subunit GlcD; Region: glcD; TIGR00387
561275006288	FAD binding domain; Region: FAD_binding_4; pfam01565
561275006289	Phosphate/sulphate permeases [Inorganic ion transport and metabolism]; Region: PitA; COG0306
561275006290	Phosphate/sulphate permeases [Inorganic ion transport and metabolism]; Region: PitA; COG0306
561275006291	Transcriptional regulator [Transcription]; Region: LysR; COG0583
561275006292	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
561275006293	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
561275006294	dimerization interface [polypeptide binding]; other site
561275006295	Esterases and lipases (includes fungal lipases, cholinesterases, etc.)  These enzymes act on carboxylic esters (EC: 3.1.1.-). The catalytic apparatus involves three residues (catalytic triad): a serine, a glutamate or aspartate and a histidine.These...; Region: Esterase_lipase; cd00312
561275006296	alpha/beta hydrolase fold; Region: Abhydrolase_3; pfam07859
561275006297	Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326
561275006298	acyltransferase, WS/DGAT/MGAT; Region: acyl_WS_DGAT; TIGR02946
561275006299	Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007
561275006300	Protein Disulfide Oxidoreductases and Other Proteins with a Thioredoxin fold; Region: Thioredoxin_like; cl00388
561275006301	Na+/H+ antiporter, bacterial form; Region: a_cpa1; TIGR00831
561275006302	CDP-diacylglycerol pyrophosphatase [Lipid metabolism]; Region: Cdh; COG2134
561275006303	Rhodanese-related sulfurtransferase [Inorganic ion transport and metabolism]; Region: SseA; COG2897
561275006304	Thiosulfate sulfurtransferase (TST), N-terminal, inactive domain. TST contains 2 copies of the Rhodanese Homology Domain; this is the 1st repeat, which does not contain the catalytically active Cys residue. The role of the 1st repeat is uncertain, but it...; Region: TST_Repeat_1; cd01448
561275006305	active site residue [active]
561275006306	Thiosulfate sulfurtransferase (TST), C-terminal, catalytic domain. TST contains 2 copies of the Rhodanese Homology Domain; this is the second repeat. Only the second repeat contains the catalytically active Cys residue; Region: TST_Repeat_2; cd01449
561275006307	active site residue [active]
561275006308	Nucleoside phosphorylase [Nucleotide transport and metabolism]; Region: Pfs; COG0775
561275006309	Bifunctional PLP-dependent enzyme with beta-cystathionase and maltose regulon repressor activities [Amino acid transport and metabolism]; Region: MalY; COG1168
561275006310	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
561275006311	pyridoxal 5'-phosphate binding site [chemical binding]; other site
561275006312	homodimer interface [polypeptide binding]; other site
561275006313	catalytic residue [active]
561275006314	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3196
561275006315	haloalkane dehalogenase; Provisional; Region: PRK00870
561275006316	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660
561275006317	Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248
561275006318	active site
561275006319	catalytic tetrad [active]
561275006320	heat shock protein 90; Provisional; Region: PRK05218
561275006321	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
561275006322	ATP binding site [chemical binding]; other site
561275006323	Mg2+ binding site [ion binding]; other site
561275006324	G-X-G motif; other site
561275006325	Zn-dependent hydrolases, including glyoxylases [General function prediction only]; Region: GloB; COG0491
561275006326	Cutinase; Region: Cutinase; pfam01083
561275006327	Domain of unknown function (DUF1918); Region: DUF1918; pfam08940
561275006328	Predicted metal-dependent hydrolase of the TIM-barrel fold [General function prediction only]; Region: COG2159
561275006329	Uncharacterized protein containing a NRPS condensation (elongation) domain [General function prediction only]; Region: COG4908
561275006330	Uncharacterized conserved protein [Function unknown]; Region: COG0398
561275006331	SNARE associated Golgi protein; Region: SNARE_assoc; pfam09335
561275006332	Alpha/beta hydrolase family; Region: Abhydrolase_5; pfam12695
561275006333	Uncharacterized conserved protein [Function unknown]; Region: COG2442
561275006334	DNA breaking-rejoining enzymes, C-terminal catalytic domain. The DNA breaking-rejoining enzyme superfamily includes type IB topoisomerases and tyrosine recombinases that share the same fold in their catalytic domain containing six conserved active site...; Region: DNA_BRE_C; cl00213
561275006335	DNA binding site [nucleotide binding]
561275006336	active site
561275006337	Int/Topo IB signature motif; other site
561275006338	Helix-Turn-Helix DNA binding domain of truncated MerR-like proteins; Region: HTH_MerR-trunc; cd04762
561275006339	DNA binding residues [nucleotide binding]
561275006340	Family description; Region: UvrD_C_2; pfam13538
561275006341	Uncharacterized conserved protein [Function unknown]; Region: COG2128
561275006342	Predicted Zn-dependent proteases and their inactivated homologs [General function prediction only]; Region: TldD; COG0312
561275006343	Predicted Zn-dependent proteases and their inactivated homologs [General function prediction only]; Region: TldD; COG0312
561275006344	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
561275006345	putative PBP binding loops; other site
561275006346	ABC-ATPase subunit interface; other site
561275006347	ABC-type sugar transport system, permease component [Carbohydrate transport and metabolism]; Region: UgpE; COG0395
561275006348	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
561275006349	dimer interface [polypeptide binding]; other site
561275006350	conserved gate region; other site
561275006351	putative PBP binding loops; other site
561275006352	ABC-ATPase subunit interface; other site
561275006353	ABC-type sugar transport system, periplasmic component [Carbohydrate transport and metabolism]; Region: UgpB; COG1653
561275006354	Bacterial extracellular solute-binding protein; Region: SBP_bac_1; pfam01547
561275006355	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
561275006356	Ligand Binding Site [chemical binding]; other site
561275006357	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
561275006358	Ligand Binding Site [chemical binding]; other site
561275006359	amino acid transporter; Region: 2A0306; TIGR00909
561275006360	C-terminus of AA_permease; Region: AA_permease_C; pfam13906
561275006361	Ornithine/acetylornithine aminotransferase [Amino acid transport and metabolism]; Region: ArgD; COG4992
561275006362	Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes. PLP combines with an alpha-amino acid to form a compound called a Schiff base or aldimine intermediate, which depending on the reaction, is the...; Region: AAT_I; cl00321
561275006363	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
561275006364	catalytic residue [active]
561275006365	Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes. PLP combines with an alpha-amino acid to form a compound called a Schiff base or aldimine intermediate, which depending on the reaction, is the...; Region: AAT_I; cl00321
561275006366	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
561275006367	Amidinotransferase; Region: Amidinotransf; pfam02274
561275006368	N-Dimethylarginine dimethylaminohydrolase [Amino acid transport and metabolism]; Region: COG1834
561275006369	helix_turn_helix ASNC type; Region: HTH_ASNC; smart00344
561275006370	Winged helix-turn-helix DNA-binding; Region: HTH_24; pfam13412
561275006371	putative DNA binding site [nucleotide binding]; other site
561275006372	putative Zn2+ binding site [ion binding]; other site
561275006373	AsnC family; Region: AsnC_trans_reg; pfam01037
561275006374	ABC-type cobalt transport system, permease component CbiQ and related transporters [Inorganic ion transport and metabolism]; Region: CbiQ; COG0619
561275006375	First domain of the ATP-binding cassette component of cobalt transport system; Region: ABC_cobalt_CbiO_domain1; cd03225
561275006376	cobalt transport protein ATP-binding subunit; Region: cbiO; TIGR01166
561275006377	Walker A/P-loop; other site
561275006378	ATP binding site [chemical binding]; other site
561275006379	Q-loop/lid; other site
561275006380	ABC transporter signature motif; other site
561275006381	Walker B; other site
561275006382	D-loop; other site
561275006383	H-loop/switch region; other site
561275006384	ABC-type cobalt transport system, ATPase component [Inorganic ion transport and metabolism]; Region: CbiO; COG1122
561275006385	First domain of the ATP-binding cassette component of cobalt transport system; Region: ABC_cobalt_CbiO_domain1; cd03225
561275006386	Walker A/P-loop; other site
561275006387	ATP binding site [chemical binding]; other site
561275006388	Q-loop/lid; other site
561275006389	ABC transporter signature motif; other site
561275006390	Walker B; other site
561275006391	D-loop; other site
561275006392	H-loop/switch region; other site
561275006393	MarR family; Region: MarR; pfam01047
561275006394	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
561275006395	PE family; Region: PE; pfam00934
561275006396	Nitrate/nitrite transporter [Inorganic ion transport and metabolism]; Region: NarK; COG2223
561275006397	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
561275006398	putative substrate translocation pore; other site
561275006399	LppP/LprE lipoprotein; Region: Lipoprotein_21; pfam14041
561275006400	Molybdopterin-Binding (MopB) domain of the MopB superfamily of proteins, a  large, diverse, heterogeneous superfamily of enzymes that, in general, bind molybdopterin as a cofactor. The MopB domain is found in a wide variety of molybdenum- and...; Region: Molybdopterin-Binding; cl09928
561275006401	Ferredoxin reductase (FNR), an FAD and NAD(P) binding protein, was intially identified as a chloroplast reductase activity, catalyzing the electron transfer from reduced iron-sulfur protein ferredoxin to NADP+ as the final step in the electron transport...; Region: FNR_like; cl06868
561275006402	malate dehydrogenase; Provisional; Region: PRK13529
561275006403	Malic enzyme, N-terminal domain; Region: malic; pfam00390
561275006404	NAD(P) binding domain of malic enzyme (ME), subgroup 1; Region: NAD_bind_1_malic_enz; cd05312
561275006405	NAD(P) binding site [chemical binding]; other site
561275006406	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
561275006407	Major Facilitator Superfamily; Region: MFS_1; pfam07690
561275006408	putative substrate translocation pore; other site
561275006409	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
561275006410	putative substrate translocation pore; other site
561275006411	Cysteine synthase [Amino acid transport and metabolism]; Region: CysK; COG0031
561275006412	CBS_like: This subgroup includes Cystathionine beta-synthase (CBS) and Cysteine synthase. CBS is a unique heme-containing enzyme that catalyzes a pyridoxal 5'-phosphate (PLP)-dependent condensation of serine and homocysteine to give cystathionine; Region: CBS_like; cd01561
561275006413	dimer interface [polypeptide binding]; other site
561275006414	pyridoxal 5'-phosphate binding site [chemical binding]; other site
561275006415	catalytic residue [active]
561275006416	Serine acetyltransferase, N-terminal; Region: SATase_N; cl05762
561275006417	serine O-acetyltransferase; Region: cysE; TIGR01172
561275006418	Serine acetyltransferase (SAT): SAT catalyzes the CoA-dependent acetylation of the side chain hydroxyl group of L-serine to form O-acetylserine, as the first step of a two-step biosynthetic pathway in bacteria and plants leading to the formation of...; Region: LbH_SAT; cd03354
561275006419	trimer interface [polypeptide binding]; other site
561275006420	active site
561275006421	substrate binding site [chemical binding]; other site
561275006422	CoA binding site [chemical binding]; other site
561275006423	hypothetical protein; Provisional; Region: PRK14851
561275006424	hypothetical protein; Validated; Region: PRK08223
561275006425	Superfamily of activating enzymes (E1) of the ubiquitin-like proteins. This family includes classical ubiquitin-activating enzymes E1, ubiquitin-like (ubl) activating enzymes and other mechanistic homologes, like MoeB, Thif1 and others. The common...; Region: E1_enzyme_family; cd01483
561275006426	ATP binding site [chemical binding]; other site
561275006427	substrate interface [chemical binding]; other site
561275006428	MMPL family; Region: MMPL; pfam03176
561275006429	MMPL family; Region: MMPL; pfam03176
561275006430	Transport protein; Region: actII; TIGR00833
561275006431	PE family; Region: PE; pfam00934
561275006432	DNA primase; Validated; Region: dnaG; PRK05667
561275006433	CHC2 zinc finger; Region: zf-CHC2; pfam01807
561275006434	DNA primase catalytic core, N-terminal domain; Region: Toprim_N; pfam08275
561275006435	TOPRIM_DnaG_primases: The topoisomerase-primase (TORPIM) nucleotidyl transferase/hydrolase domain found in the active site regions of proteins similar to Escherichia coli DnaG. Primases synthesize RNA primers for the initiation of DNA replication. DnaG...; Region: TOPRIM_DnaG_primases; cd03364
561275006436	active site
561275006437	metal binding site [ion binding]; metal-binding site
561275006438	interdomain interaction site; other site
561275006439	DnaB-helicase binding domain of primase; Region: DnaB_bind; pfam10410
561275006440	DNA primase DnaG DnaB-binding; Region: DnaG_DnaB_bind; smart00766
561275006441	deoxyguanosinetriphosphate triphosphohydrolase-like protein; Provisional; Region: PRK03007
561275006442	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
561275006443	Zn2+ binding site [ion binding]; other site
561275006444	Mg2+ binding site [ion binding]; other site
561275006445	Phosphohydrolase-associated domain; Region: HD_assoc; pfam13286
561275006446	Repair protein; Region: Repair_PSII; pfam04536
561275006447	Proteins of 100 residues with WXG; Region: WXG100; cl02005
561275006448	PPE family; Region: PPE; pfam00823
561275006449	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275006450	PPE family; Region: PPE; pfam00823
561275006451	RD5, 8963 bp. Region of difference RD5, deleted region in Mycobacterium bovis BCG Pasteur (position 2603164..2603165), BCG Tokyo (position 2595936..2595937) and Mycobacterium bovis AF2122/97 (position 2603664..2603665) compared to Mycobacterium tuberculosis H37Rv (position: 2626068..2635030). Removes genes Rv2347c-Rv2352c and truncates genes Rv2346c and Rv2353c. In Mycobacterium bovis, Mycobacterium bovis BCG Pasteur, and BCG Tokyo, additional recombination events occurred: -1- the loss of a copy of IS6110 which leads to the loss of Rv2354 and Rv2355. -2- Recombination between PPE39(Rv2353c) and PPE40(Rv2356c) resulting, for Mycobacterium bovis AF2122/97, in two genes, PPE71 and PPE40, and for Mycobacterium bovis BCG Pasteur and BCG Tokyo in one gene, PPE71
561275006452	N-RD5, 3298 bp. Region of difference N-RD5, deleted region in Mycobacterium bovis BCG Pasteur (position 2603740..2603741), BCG Tokyo (position 2596511..2596512) and Mycobacterium bovis AF2122/97 (position 2604210..2604211) compared to Mycobacterium tuberculosis H37Rv (position: 2635577..2638874). In Mycobacterium bovis, Mycobacterium bovis BCG Pasteur, and BCG Tokyo, additional recombination events occurred: -1- the loss of a copy of IS6110 which lead to the loss of Rv2354 and Rv2355. -2- Recombination between PPE39 and PPE40 resulting, in Mycobacterium bovis AF2122/97, in two genes, PPE71 and PPE40. In Mycobacterium bovis BCG Pasteur and BCG Tokyo, there have been a 2579bp deletion (position 2604022..2604023) equivalent to M. bovis position 2604493..2607071, these have resulted in an in-frame fusion of the 5'-end of PPE40 with the 3'-end of PPE71 probably due to a homologous recombination event between codons 68 and 174 of PPE40 as the PPE40 and PPE71 genes have identical 5'-ends (first 535 bp)
561275006453	NN-RD5, 2579 bp. Region of difference NN-RD5. Compared to Mycobacterium bovis, there has been a 2579bp deletion (position 2604022..2604023) equivalent to M. bovis position 2604493..2607071, this has resulted in anin-frame fusion of the 5'-end of PPE40 with the 3'-end ofPPE71 probably due to a homologous recombination event between codons 68 and 174 of PPE40 as the PPE40 and PPE71 genes have identical 5'-ends (first 535 bp). Differs from Mb2376c (PPE71) by extra 11aa, insertion of A at position 68 due to 3bp insertion (present in PPE40) and STNVGSGNIG at position 307 due to 30 bp insertion. M. bovis BCG Pasteur and BCG Tokyo, thus has three copies of tandem repeat STNVGSGNIG compared to two in Mb2376c. The 3'-end of PPE71 of M. bovis BCG Pasteur and BCG Tokyo have also been truncated as a result of the same deletion described in Mycobacterium bovis, 8963bp deletion (RD5)
561275006454	glycyl-tRNA synthetase; Provisional; Region: PRK04173
561275006455	Class II tRNA amino-acyl synthetase-like catalytic core domain. Class II amino acyl-tRNA synthetases (aaRS) share a common fold and generally attach an amino acid to the 3' OH of ribose of the appropriate tRNA.   PheRS is an exception in that it...; Region: class_II_aaRS-like_core; cl00268
561275006456	motif 1; other site
561275006457	Glycyl-tRNA synthetase (GlyRS)-like class II core catalytic domain. GlyRS functions as a homodimer in eukaryotes, archaea and some bacteria and as a heterotetramer in the remainder of prokaryotes. It is responsible for the attachment of glycine to the 3...; Region: GlyRS-like_core; cd00774
561275006458	active site
561275006459	motif 2; other site
561275006460	motif 3; other site
561275006461	GlyRS Glycyl-anticodon binding domain. GlyRS belongs to class II aminoacyl-tRNA synthetases (aaRS). This alignment contains the anticodon binding domain, which is responsible for specificity in tRNA-binding, so that the activated amino acid is...; Region: GlyRS_anticodon; cd00858
561275006462	anticodon binding site; other site
561275006463	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
561275006464	dimerization interface [polypeptide binding]; other site
561275006465	putative DNA binding site [nucleotide binding]; other site
561275006466	putative Zn2+ binding site [ion binding]; other site
561275006467	Ferric uptake regulator(Fur) and related metalloregulatory proteins; typically iron-dependent, DNA-binding repressors and activators; Region: Fur_like; cd07153
561275006468	metal binding site 2 [ion binding]; metal-binding site
561275006469	putative DNA binding helix; other site
561275006470	metal binding site 1 [ion binding]; metal-binding site
561275006471	dimer interface [polypeptide binding]; other site
561275006472	structural Zn2+ binding site [ion binding]; other site
561275006473	Undecaprenyl pyrophosphate synthase [Lipid metabolism]; Region: UppS; COG0020
561275006474	Cis (Z)-Isoprenyl Diphosphate Synthases (cis-IPPS); homodimers which catalyze the successive 1'-4 condensation of the isopentenyl diphosphate (IPP) molecule to trans,trans-farnesyl diphosphate (FPP) or to cis,trans-FPP to form long-chain polyprenyl...; Region: CIS_IPPS; cd00475
561275006475	catalytic residue [active]
561275006476	putative FPP diphosphate  binding site; other site
561275006477	putative FPP binding hydrophobic cleft; other site
561275006478	dimer interface [polypeptide binding]; other site
561275006479	putative IPP diphosphate binding site; other site
561275006480	DNA repair protein RecO; Reviewed; Region: recO; PRK00085
561275006481	Recombination protein O N terminal; Region: RecO_N; pfam11967
561275006482	Recombination protein O C terminal; Region: RecO_C; pfam02565
561275006483	amidase; Provisional; Region: PRK06061
561275006484	Amidase; Region: Amidase; pfam01425
561275006485	GTPase Era; Reviewed; Region: era; PRK00089
561275006486	E. coli Ras-like protein (Era) is a multifunctional GTPase; Region: Era; cd04163
561275006487	G1 box; other site
561275006488	GTP/Mg2+ binding site [chemical binding]; other site
561275006489	Switch I region; other site
561275006490	G2 box; other site
561275006491	Switch II region; other site
561275006492	G3 box; other site
561275006493	G4 box; other site
561275006494	G5 box; other site
561275006495	KH domain; Region: KH_2; pfam07650
561275006496	Hemolysins and related proteins containing CBS domains [General function prediction only]; Region: TlyC; COG1253
561275006497	Domain of unknown function DUF21; Region: DUF21; pfam01595
561275006498	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains associated with the CorC_HlyC domain. CorC_HlyC is a transporter associated domain. This small domain is found in Na+/H+ antiporters, in proteins involved in...; Region: CBS_pair_CorC_HlyC_assoc; cd04590
561275006499	Transporter associated domain; Region: CorC_HlyC; smart01091
561275006500	metal-binding heat shock protein; Provisional; Region: PRK00016
561275006501	K homology RNA-binding domain; Region: KH; smart00322
561275006502	Phosphate starvation-inducible protein PhoH, predicted ATPase [Signal transduction mechanisms]; Region: PhoH; COG1702
561275006503	PhoH-like protein; Region: PhoH; pfam02562
561275006504	Regulator of polyketide synthase expression [Signal transduction mechanisms / Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG2508
561275006505	PE family; Region: PE; pfam00934
561275006506	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG1385
561275006507	RNA methyltransferase, RsmE family; Region: TIGR00046
561275006508	chaperone protein DnaJ; Provisional; Region: PRK14278
561275006509	DnaJ domain or J-domain.  DnaJ/Hsp40 (heat shock protein 40) proteins are highly conserved and play crucial roles in protein translation, folding, unfolding, translocation, and degradation. They act primarily by stimulating the ATPase activity of Hsp70s; Region: DnaJ; cd06257
561275006510	HSP70 interaction site [polypeptide binding]; other site
561275006511	Zinc finger domain of DnaJ and HSP40; Region: DnaJ_zf; cd10719
561275006512	Zn binding sites [ion binding]; other site
561275006513	C-terminal substrate binding domain of DnaJ and HSP40; Region: DnaJ_C; cd10747
561275006514	dimer interface [polypeptide binding]; other site
561275006515	heat-inducible transcription repressor; Provisional; Region: hrcA; PRK00082
561275006516	Transcription regulator of the Arc/MetJ class [Transcription]; Region: COG5450
561275006517	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3251
561275006518	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
561275006519	Condensation domain; Region: Condensation; pfam00668
561275006520	Non-ribosomal peptide synthetase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: EntF; COG1020
561275006521	The adenylation domain of nonribosomal peptide synthetases (NRPS); Region: A_NRPS; cd05930
561275006522	acyl-activating enzyme (AAE) consensus motif; other site
561275006523	AMP binding site [chemical binding]; other site
561275006524	Condensation domain; Region: Condensation; pfam00668
561275006525	non-ribosomal peptide synthase domain TIGR01720; Region: NRPS-para261
561275006526	Condensation domain; Region: Condensation; pfam00668
561275006527	Non-ribosomal peptide synthetase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: EntF; COG1020
561275006528	HxxPF-repeated domain; Region: HxxPF_rpt; pfam13745
561275006529	The adenylation domain of nonribosomal peptide synthetases (NRPS); Region: A_NRPS; cd05930
561275006530	acyl-activating enzyme (AAE) consensus motif; other site
561275006531	AMP binding site [chemical binding]; other site
561275006532	Phosphopantetheine attachment site; Region: PP-binding; pfam00550
561275006533	Condensation domain; Region: Condensation; pfam00668
561275006534	Non-ribosomal peptide synthetase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: EntF; COG1020
561275006535	HxxPF-repeated domain; Region: HxxPF_rpt; pfam13745
561275006536	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
561275006537	Phosphopantetheine attachment site; Region: PP-binding; pfam00550
561275006538	malonyl CoA-acyl carrier protein transacylase; Region: fabD; TIGR00128
561275006539	Acyl transferase domain in polyketide synthase (PKS) enzymes; Region: PKS_AT; smart00827
561275006540	ketoreductase (KR) and fatty acid synthase (FAS), complex (x) SDRs; Region: KR_FAS_SDR_x; cd05274
561275006541	NADP binding site [chemical binding]; other site
561275006542	This enzymatic domain is part of bacterial polyketide synthases; Region: PKS_KR; smart00822
561275006543	active site
561275006544	Phosphopantetheine attachment site; Region: PKS_PP; smart00823
561275006545	polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833
561275006546	Beta-ketoacyl synthase; Region: PKS_KS; smart00825
561275006547	active site
561275006548	Aryl carrier domain [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3433
561275006549	Condensation domain; Region: Condensation; pfam00668
561275006550	Non-ribosomal peptide synthetase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: EntF; COG1020
561275006551	Nonribosomal peptide synthase; Region: NRPS; pfam08415
561275006552	The adenylation domain of nonribosomal peptide synthetases (NRPS), including Streptoalloteichus tallysomycin biosynthesis genes; Region: A_NRPS_TlmIV_like; cd12114
561275006553	acyl-activating enzyme (AAE) consensus motif; other site
561275006554	AMP binding site [chemical binding]; other site
561275006555	Phosphopantetheine attachment site; Region: PP-binding; pfam00550
561275006556	Predicted thioesterase involved in non-ribosomal peptide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: GrsT; COG3208
561275006557	Peptide arylation enzymes [Secondary metabolites biosynthesis, transport, and catabolism]; Region: EntE; COG1021
561275006558	2,3-dihydroxybenzoate-AMP ligase; Region: 23DHB-AMP_lg; cd05920
561275006559	acyl-activating enzyme (AAE) consensus motif; other site
561275006560	active site
561275006561	AMP binding site [chemical binding]; other site
561275006562	substrate binding site [chemical binding]; other site
561275006563	Esterase/lipase [Lipid metabolism]; Region: Aes; COG0657
561275006564	salicylate synthase MbtI; Reviewed; Region: PRK07912
561275006565	chorismate binding enzyme; Region: Chorismate_bind; pfam00425
561275006566	Predicted permease [General function prediction only]; Region: COG3329
561275006567	coproporphyrinogen III oxidase; Validated; Region: PRK05628
561275006568	Transglycosylase-like domain; Region: Transglycosylas; pfam06737
561275006569	Sulfite reductase, beta subunit (hemoprotein) [Inorganic ion transport and metabolism]; Region: CysI; COG0155
561275006570	Nitrite/Sulfite reductase ferredoxin-like half domain; Region: NIR_SIR_ferr; pfam03460
561275006571	Nitrite/Sulfite reductase ferredoxin-like half domain; Region: NIR_SIR_ferr; pfam03460
561275006572	3'-phosphoadenosine 5'-phosphosulfate sulfotransferase (PAPS reductase)/FAD synthetase and related enzymes [Amino acid transport and metabolism / Coenzyme metabolism]; Region: CysH; COG0175
561275006573	This domain is found in phosphoadenosine phosphosulphate (PAPS) reductase enzymes or PAPS sulphotransferase. PAPS reductase is part of the adenine nucleotide alpha hydrolases superfamily also including N type ATP PPases and ATP sulphurylases. A highly...; Region: PAPS_reductase; cd01713
561275006574	Active Sites [active]
561275006575	Sirohydrochlorin ferrochelatase [Inorganic ion transport and metabolism]; Region: COG2138
561275006576	Sirohydrochlorin cobalt chelatase (CbiX) and sirohydrochlorin iron chelatase (SirB), N-terminal domain. SirB catalyzes the ferro-chelation of sirohydrochlorin to siroheme, the prosthetic group of sulfite and nitrite reductases. CbiX is a cobaltochelatase; Region: CbiX_SirB_N; cd03416
561275006577	putative active site [active]
561275006578	Sirohydrochlorin cobalt chelatase (CbiX) and sirohydrochlorin iron chelatase (SirB), C-terminal domain. SirB catalyzes the ferro-chelation of sirohydrochlorin to siroheme, the prosthetic group of sulfite and nitrite reductases. CbiX is a cobaltochelatase; Region: CbiX_SirB_C; cd03414
561275006579	putative active site [active]
561275006580	Gamma-glutamyltransferase [Amino acid transport and metabolism]; Region: Ggt; COG0405
561275006581	Gamma-glutamyltranspeptidase; Region: G_glu_transpept; pfam01019
561275006582	OPT oligopeptide transporter protein; Region: OPT; cl14607
561275006583	OPT oligopeptide transporter protein; Region: OPT; cl14607
561275006584	PE family; Region: PE; pfam00934
561275006585	ATP-binding cassette domain of the sulfate transporter; Region: ABC_CysA_sulfate_importer; cd03296
561275006586	sulfate ABC transporter, ATP-binding protein; Region: 3a0106s01; TIGR00968
561275006587	Walker A/P-loop; other site
561275006588	ATP binding site [chemical binding]; other site
561275006589	Q-loop/lid; other site
561275006590	ABC transporter signature motif; other site
561275006591	Walker B; other site
561275006592	D-loop; other site
561275006593	H-loop/switch region; other site
561275006594	sulfate transport protein; Provisional; Region: cysT; CHL00187
561275006595	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
561275006596	dimer interface [polypeptide binding]; other site
561275006597	conserved gate region; other site
561275006598	putative PBP binding loops; other site
561275006599	ABC-ATPase subunit interface; other site
561275006600	sulfate transport protein; Provisional; Region: cysT; CHL00187
561275006601	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
561275006602	dimer interface [polypeptide binding]; other site
561275006603	conserved gate region; other site
561275006604	putative PBP binding loops; other site
561275006605	ABC-ATPase subunit interface; other site
561275006606	ABC-type sulfate transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: Sbp; COG1613
561275006607	Bacterial extracellular solute-binding protein; Region: SBP_bac_11; pfam13531
561275006608	Glucoamylase and related glycosyl hydrolases [Carbohydrate transport and metabolism]; Region: SGA1; COG3387
561275006609	Glycosyl hydrolases family 15; Region: Glyco_hydro_15; pfam00723
561275006610	PknH-like extracellular domain; Region: PknH_C; pfam14032
561275006611	GTP-binding protein LepA; Provisional; Region: PRK05433
561275006612	LepA also known as Elongation Factor 4 (EF4); Region: LepA; cd01890
561275006613	G1 box; other site
561275006614	putative GEF interaction site [polypeptide binding]; other site
561275006615	GTP/Mg2+ binding site [chemical binding]; other site
561275006616	Switch I region; other site
561275006617	G2 box; other site
561275006618	G3 box; other site
561275006619	Switch II region; other site
561275006620	G4 box; other site
561275006621	G5 box; other site
561275006622	lepA_II: This subfamily represents the domain II of LepA, a GTP-binding protein localized in the cytoplasmic membrane. The N-terminal domain of LepA shares regions of homology to translation factors. In terms of interaction with the ribosome, EF-G, EF-Tu...; Region: lepA_II; cd03699
561275006623	lepA_C: This family represents the C-terminal region of LepA, a GTP-binding protein localized in the cytoplasmic membrane.   LepA is ubiquitous in Bacteria and Eukaryota (e.g. Saccharomyces cerevisiae GUF1p), but is missing from Archaea. LepA exhibits...; Region: lepA_C; cd03709
561275006624	GTP-binding protein LepA C-terminus; Region: LepA_C; pfam06421
561275006625	PemK-like protein; Region: PemK; pfam02452
561275006626	The CBS domain, named after human CBS, is a small domain originally identified in cystathionine beta-synthase and is subsequently found in a wide range of different proteins. CBS domains usually occur in tandem repeats. They associate to form a so-called...; Region: CBS_pair_10; cd04623
561275006627	FOG: CBS domain [General function prediction only]; Region: COG0517
561275006628	ribonuclease Z; Reviewed; Region: PRK00055
561275006629	PE family; Region: PE; pfam00934
561275006630	Transglutaminase-like enzymes, putative cysteine proteases [Amino acid transport and metabolism]; Region: COG1305
561275006631	Bacterial transglutaminase-like N-terminal region; Region: Bact_transglu_N; pfam08379
561275006632	Transglutaminase-like superfamily; Region: Transglut_core; pfam01841
561275006633	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2307
561275006634	A predicted alpha-helical domain with a conserved ER motif; Region: Alpha-E; pfam04168
561275006635	Uncharacterized conserved protein [Function unknown]; Region: COG2308
561275006636	30S ribosomal protein S20; Reviewed; Region: rpsT; PRK00239
561275006637	hypothetical protein; Reviewed; Region: PRK07914
561275006638	DNA polymerase III, delta subunit; Region: DNA_pol3_delta; pfam06144
561275006639	Predicted membrane metal-binding protein [General function prediction only]; Region: ComEC; COG0658
561275006640	Competence protein; Region: Competence; pfam03772
561275006641	Helix-hairpin-helix motif; Region: HHH_3; pfam12836
561275006642	Helix-hairpin-helix motif; Region: HHH; pfam00633
561275006643	Predicted acetyltransferase involved in intracellular survival and related acetyltransferases [General function prediction only]; Region: Eis; COG4552
561275006644	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
561275006645	Coenzyme A binding pocket [chemical binding]; other site
561275006646	Uncharacterized protein conserved in bacteria [Function unknown]; Region: DegV; COG1307
561275006647	Uncharacterized protein, DegV family COG1307; Region: DegV; pfam02645
561275006648	SGNH_hydrolase, or GDSL_hydrolase, is a diverse family of lipases and esterases. The tertiary fold of the enzyme is substantially different from that of the alpha/beta hydrolase family and unique among all known hydrolases; its active site closely...; Region: SGNH_hydrolase; cd00229
561275006649	active site
561275006650	catalytic triad [active]
561275006651	oxyanion hole [active]
561275006652	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
561275006653	catalytic core [active]
561275006654	Uncharacterized homolog of plant Iojap protein [Function unknown]; Region: COG0799
561275006655	Nicotinamide/nicotinate mononucleotide adenylyltransferase; Region: NMNAT; cd02165
561275006656	nicotinic acid mononucleotide adenylyltransferase; Provisional; Region: nadD; PRK00071
561275006657	active site
561275006658	(T/H)XGH motif; other site
561275006659	Methyltransferase domain; Region: Methyltransf_23; pfam13489
561275006660	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275006661	S-adenosylmethionine binding site [chemical binding]; other site
561275006662	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3547
561275006663	Transposase IS116/IS110/IS902 family; Region: Transposase_20; pfam02371
561275006664	Transposase; Region: DEDD_Tnp_IS110; pfam01548
561275006665	Protein containing von Willebrand factor type A (vWA) domain [General function prediction only]; Region: CoxE; COG3552
561275006666	Von Willebrand factor type A (vWA) domain was originally found in the blood coagulation protein von Willebrand factor (vWF). Typically, the vWA domain is made up of approximately 200 amino acid residues folded into a classic a/b para-rossmann type of...; Region: vWFA; cl00057
561275006667	metal ion-dependent adhesion site (MIDAS); other site
561275006668	ATPases associated with a variety of cellular activities; Region: AAA; smart00382
561275006669	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
561275006670	Walker A motif; other site
561275006671	ATP binding site [chemical binding]; other site
561275006672	Walker B motif; other site
561275006673	arginine finger; other site
561275006674	Gamma-glutamyl phosphate reductase (GPR), aldehyde dehydrogenase families 18 and 19; Region: ALDH_F18-19_ProA-GPR; cd07079
561275006675	gamma-glutamyl phosphate reductase; Region: proA; TIGR00407
561275006676	putative catalytic cysteine [active]
561275006679	Peroxiredoxin [Posttranslational modification, protein turnover, chaperones]; Region: AhpC; COG0450
561275006680	Peroxiredoxin (PRX) family, Typical 2-Cys PRX subfamily; PRXs are thiol-specific antioxidant (TSA) proteins, which confer a protective role in cells through its peroxidase activity by reducing hydrogen peroxide, peroxynitrite, and organic hydroperoxides; Region: PRX_Typ2cys; cd03015
561275006681	dimer interface [polypeptide binding]; other site
561275006682	decamer (pentamer of dimers) interface [polypeptide binding]; other site
561275006683	catalytic triad [active]
561275006684	peroxidatic and resolving cysteines [active]
561275006685	alkylhydroperoxidase, AhpD family; Region: ahpD; TIGR00777
561275006686	alkylhydroperoxidase AhpD family core domain; Region: ahpD_dom; TIGR00778
561275006687	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275006688	PPE family; Region: PPE; pfam00823
561275006689	PE family; Region: PE; pfam00934
561275006690	Small-conductance mechanosensitive channel [Cell envelope biogenesis, outer membrane]; Region: MscS; COG0668
561275006691	Mechanosensitive ion channel; Region: MS_channel; pfam00924
561275006692	effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038
561275006693	cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases [Signal transduction mechanisms]; Region: Crp; COG0664
561275006694	ligand binding site [chemical binding]; other site
561275006695	flexible hinge region; other site
561275006696	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
561275006697	dimerization interface [polypeptide binding]; other site
561275006698	Adenylyl- / guanylyl cyclase, catalytic domain; Region: CYCc; smart00044
561275006699	cyclase homology domain; Region: CHD; cd07302
561275006700	nucleotidyl binding site; other site
561275006701	metal binding site [ion binding]; metal-binding site
561275006702	dimer interface [polypeptide binding]; other site
561275006703	Sugar kinases, ribokinase family [Carbohydrate transport and metabolism]; Region: RbsK; COG0524
561275006704	Ribokinase catalyses the phosphorylation of ribose to ribose-5-phosphate using ATP. This reaction is the first step in the ribose metabolism. It traps ribose within the cell after uptake and also prepares the sugar for use in the synthesis of nucleotides...; Region: ribokinase; cd01174
561275006705	substrate binding site [chemical binding]; other site
561275006706	dimer interface [polypeptide binding]; other site
561275006707	ATP binding site [chemical binding]; other site
561275006708	Putative protein-S-isoprenylcysteine methyltransferase [Posttranslational modification, protein turnover, chaperones]; Region: STE14; COG2020
561275006709	NAD synthetase; Reviewed; Region: nadE; PRK02628
561275006710	Glutamine aminotransferase (GAT, glutaminase) domain of glutamine-dependent NAD synthetases (class 7 and 8 nitrilases); Region: GAT_Gln-NAD-synth; cd07570
561275006711	multimer interface [polypeptide binding]; other site
561275006712	active site
561275006713	catalytic triad [active]
561275006714	protein interface 1 [polypeptide binding]; other site
561275006715	NAD+ synthase is a homodimer, which catalyzes the final step in de novo nicotinamide adenine dinucleotide (NAD+) biosynthesis, an amide transfer from either ammonia or glutamine to nicotinic acid adenine dinucleotide (NaAD). The conversion of NaAD to NAD...; Region: NAD_synthase; cd00553
561275006716	homodimer interface [polypeptide binding]; other site
561275006717	NAD binding pocket [chemical binding]; other site
561275006718	ATP binding pocket [chemical binding]; other site
561275006719	Mg binding site [ion binding]; other site
561275006720	active-site loop [active]
561275006721	gamma-glutamyl kinase; Provisional; Region: PRK05429
561275006722	AAK_G5K_ProB: Glutamate-5-kinase (G5K) catalyzes glutamate-dependent ATP cleavage; G5K transfers the terminal phosphoryl group of ATP to the gamma-carboxyl group of glutamate, in the first and controlling step of proline (and, in mammals, ornithine)...; Region: AAK_G5K_ProB; cd04242
561275006723	nucleotide binding site [chemical binding]; other site
561275006724	homotetrameric interface [polypeptide binding]; other site
561275006725	putative phosphate binding site [ion binding]; other site
561275006726	putative allosteric binding site; other site
561275006727	PUA domain; Region: PUA; pfam01472
561275006728	GTPase CgtA; Reviewed; Region: obgE; PRK12296
561275006729	GTP1/OBG; Region: GTP1_OBG; pfam01018
561275006730	Obg GTPase; Region: Obg; cd01898
561275006731	G1 box; other site
561275006732	GTP/Mg2+ binding site [chemical binding]; other site
561275006733	Switch I region; other site
561275006734	G2 box; other site
561275006735	G3 box; other site
561275006736	Switch II region; other site
561275006737	G4 box; other site
561275006738	G5 box; other site
561275006739	Domain of unknown function (DUF1967); Region: DUF1967; pfam09269
561275006740	50S ribosomal protein L27; Validated; Region: rpmA; PRK05435
561275006741	50S ribosomal protein L21; Validated; Region: rplU; PRK05573
561275006742	Na+/H+-dicarboxylate symporters [Energy production and conversion]; Region: GltP; COG1301
561275006743	Sodium:dicarboxylate symporter family; Region: SDF; cl00573
561275006744	ribonuclease, Rne/Rng family; Region: RNaseEG; TIGR00757
561275006745	S1_RNase_E: RNase E and RNase G, S1-like RNA-binding domain. RNase E is an essential endoribonuclease in the processing and degradation of RNA. In addition to its role in mRNA degradation, RNase E has also been implicated in the processing of rRNA, and...; Region: S1_RNase_E; cd04453
561275006746	homodimer interface [polypeptide binding]; other site
561275006747	oligonucleotide binding site [chemical binding]; other site
561275006748	Nucleoside diphosphate kinase Group I (NDPk_I)-like: NDP kinase domains are present in a large family of structurally and functionally conserved proteins from bacteria to humans that generally catalyze the transfer of gamma-phosphates of a nucleoside...; Region: NDPk_I; cd04413
561275006749	active site
561275006750	multimer interface [polypeptide binding]; other site
561275006751	Protein of unknown function (DUF4233); Region: DUF4233; pfam14017
561275006752	Folylpolyglutamate synthase [Coenzyme metabolism]; Region: FolC; COG0285
561275006753	Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875
561275006754	valyl-tRNA synthetase; Reviewed; Region: valS; PRK05729
561275006755	nucleotidyl transferase superfamily; Region: nt_trans; cl00015
561275006756	active site
561275006757	HIGH motif; other site
561275006758	nucleotide binding site [chemical binding]; other site
561275006759	Leucyl-tRNA synthetase, Domain 2; Region: tRNA-synt_1_2; pfam13603
561275006760	catalytic core domain of valyl-tRNA synthetases; Region: ValRS_core; cd00817
561275006761	active site
561275006762	KMSKS motif; other site
561275006763	Anticodon-binding domain of valyl tRNA synthetases; Region: Anticodon_Ia_Val; cd07962
561275006764	tRNA binding surface [nucleotide binding]; other site
561275006765	anticodon binding site; other site
561275006766	Valyl tRNA synthetase tRNA binding arm; Region: Val_tRNA-synt_C; pfam10458
561275006767	Uncharacterized conserved protein [Function unknown]; Region: COG3268
561275006768	NAD(P) binding domain of amino acid dehydrogenase-like proteins; Region: NAD_bind_amino_acid_DH; cl17226
561275006769	NAD(P) binding pocket [chemical binding]; other site
561275006770	Transglycosylase-like domain; Region: Transglycosylas; pfam06737
561275006771	molybdopterin-guanine dinucleotide biosynthesis protein MobA; Reviewed; Region: mobA; PRK00317
561275006772	MobA catalyzes the formation of molybdopterin guanine dinucleotide; Region: MobA; cd02503
561275006773	GTP binding site; other site
561275006774	2-oxoglutarate ferredoxin oxidoreductase subunit beta; Reviewed; Region: PRK11867
561275006775	Thiamine pyrophosphate (TPP family), 2-oxoglutarate ferredoxin oxidoreductase (OGFOR) subfamily, TPP-binding module; OGFOR catalyzes the oxidative decarboxylation of 2-oxo-acids, with ferredoxin acting as an electron acceptor. In the TCA cycle, OGFOR...; Region: TPP_OGFOR; cd03375
561275006776	TPP-binding site [chemical binding]; other site
561275006777	Pyruvate:ferredoxin oxidoreductase and related 2-oxoacid:ferredoxin oxidoreductases, gamma subunit [Energy production and conversion]; Region: PorG; COG1014
561275006778	2-oxoacid:acceptor oxidoreductase, alpha subunit; Region: OAFO_sf; TIGR03710
561275006779	Pyrimidine (PYR) binding domain of pyruvate ferredoxin oxidoreductase (PFOR), indolepyruvate ferredoxin oxidoreductase alpha subunit (IOR-alpha), and related proteins; Region: TPP_PYR_PFOR_IOR-alpha_like; cd07034
561275006780	dimer interface [polypeptide binding]; other site
561275006781	PYR/PP interface [polypeptide binding]; other site
561275006782	TPP binding site [chemical binding]; other site
561275006783	substrate binding site [chemical binding]; other site
561275006784	Major Facilitator Superfamily; Region: MFS_1; pfam07690
561275006785	ATP-dependent protease ATP-binding subunit ClpX; Provisional; Region: clpX; PRK05342
561275006786	ClpX C4-type zinc finger; Region: zf-C4_ClpX; pfam06689
561275006787	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
561275006788	Walker A motif; other site
561275006789	ATP binding site [chemical binding]; other site
561275006790	Walker B motif; other site
561275006791	C-terminal, D2-small domain, of ClpB protein; Region: ClpB_D2-small; smart01086
561275006792	homocysteine methyltransferase; Provisional; Region: mmuM; PRK09485
561275006793	Homocysteine S-methyltransferase; Region: S-methyl_trans; pfam02574
561275006794	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
561275006795	Major Facilitator Superfamily; Region: MFS_1; pfam07690
561275006796	putative substrate translocation pore; other site
561275006797	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
561275006798	ATP-dependent Clp protease proteolytic subunit; Reviewed; Region: PRK12553
561275006799	Caseinolytic protease (ClpP) is an ATP-dependent, highly conserved serine protease; Region: S14_ClpP_2; cd07017
561275006800	oligomer interface [polypeptide binding]; other site
561275006801	active site residues [active]
561275006802	Clp protease; Region: CLP_protease; pfam00574
561275006803	Caseinolytic protease (ClpP) is an ATP-dependent, highly conserved serine protease; Region: S14_ClpP_2; cd07017
561275006804	oligomer interface [polypeptide binding]; other site
561275006805	active site residues [active]
561275006806	trigger factor; Provisional; Region: tig; PRK01490
561275006807	FKBP-type peptidyl-prolyl cis-trans isomerase; Region: FKBP_C; pfam00254
561275006808	Bacterial trigger factor protein (TF) C-terminus; Region: Trigger_C; pfam05698
561275006809	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
561275006810	Beta-lactamase; Region: Beta-lactamase; pfam00144
561275006811	Formamidopyrimidine-DNA glycosylase [DNA replication, recombination, and repair]; Region: Nei; COG0266
561275006812	N-terminal domain of the actinomycetal Nei1 and related DNA glycosylases; Region: AcNei1_N; cd08970
561275006813	putative DNA binding site [nucleotide binding]; other site
561275006814	catalytic residue [active]
561275006815	putative H2TH interface [polypeptide binding]; other site
561275006816	putative catalytic residues [active]
561275006817	Formamidopyrimidine-DNA glycosylase H2TH domain; Region: H2TH; pfam06831
561275006818	Zinc finger found in FPG and IleRS; Region: zf-FPG_IleRS; pfam06827
561275006819	ribose-5-phosphate isomerase B; Provisional; Region: PRK05571
561275006820	DSBA-like thioredoxin domain; Region: DSBA; pfam01323
561275006821	Protein Disulfide Oxidoreductases and Other Proteins with a Thioredoxin fold; Region: Thioredoxin_like; cl00388
561275006822	aminopeptidase N, Streptomyces lividans type; Region: pepN_strep_liv; TIGR02412
561275006823	Peptidase M1 family containing Aminopeptidase N; Region: M1_APN_3; cd09602
561275006824	Zn binding site [ion binding]; other site
561275006825	Restriction endonuclease [Defense mechanisms]; Region: McrA; COG1403
561275006826	HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085
561275006827	active site
561275006828	Truncated hemoglobins (trHbs) are a family of oxygen-binding heme proteins found in cyanobacteria, eubacteria, unicellular eukaryotes, and plants. The truncated hemoglobins have a characteristic two-over-two alpha helical folding pattern that is distinct...; Region: Trunc_globin; cd00454
561275006829	apolar tunnel; other site
561275006830	heme binding site [chemical binding]; other site
561275006831	dimerization interface [polypeptide binding]; other site
561275006832	Alpha amylase catalytic domain found in oligo-1,6-glucosidase (also called isomaltase; sucrase-isomaltase; alpha-limit dextrinase), trehalose synthase (also called maltose alpha-D-glucosyltransferase), and related proteins; Region: AmyAc_OligoGlu_TS; cd11332
561275006833	alpha,alpha-phosphotrehalase; Region: trehalose_treC; TIGR02403
561275006834	active site
561275006835	catalytic site [active]
561275006836	Domain of unknown function (DUF3459); Region: DUF3459; pfam11941
561275006837	4-hydroxybenzoyl-CoA thioesterase (4HBT). Catalyzes the final step in the 4-chlorobenzoate degradation pathway in which 4-chlorobenzoate is converted to 4-hydroxybenzoate in certain soil-dwelling bacteria. 4HBT forms a homotetramer with four active sites; Region: 4HBT; cd00586
561275006838	active site
561275006839	NAD-specific glutamate dehydrogenase [Amino acid transport and metabolism]; Region: COG2902
561275006840	putative ABC transporter ATP-binding protein; Reviewed; Region: PRK11819
561275006841	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
561275006842	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
561275006843	ABC transporter; Region: ABC_tran_2; pfam12848
561275006844	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
561275006845	SSB_OBF: A subfamily of OB folds similar to the OB fold of ssDNA-binding protein (SSB). SSBs bind with high affinity to ssDNA. They bind to and protect ssDNA intermediates during DNA metabolic pathways. All bacterial and eukaryotic SSBs studied to date...; Region: SSB_OBF; cd04496
561275006846	dimer interface [polypeptide binding]; other site
561275006847	Single-stranded DNA-binding protein [DNA replication, recombination, and repair]; Region: Ssb; COG0629
561275006848	ssDNA binding site [nucleotide binding]; other site
561275006849	tetramer (dimer of dimers) interface [polypeptide binding]; other site
561275006850	glycerol-3-phosphate acyltransferase; Validated; Region: PRK03355
561275006851	Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: GPAT-like; Region: LPLAT_DHAPAT-like; cd07993
561275006852	putative acyl-acceptor binding pocket; other site
561275006853	Phosphoserine phosphatase [Amino acid transport and metabolism]; Region: SerB; COG0560
561275006854	HAD-superfamily subfamily IB hydrolase, TIGR01490; Region: HAD-SF-IB-hyp1
561275006855	1-acyl-sn-glycerol-3-phosphate acyltransferase [Lipid metabolism]; Region: PlsC; COG0204
561275006856	Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: AGPAT-like; Region: LPLAT_AGPAT-like; cd07989
561275006857	putative acyl-acceptor binding pocket; other site
561275006858	Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007
561275006859	acyltransferase, WS/DGAT/MGAT; Region: acyl_WS_DGAT; TIGR02946
561275006860	Esterase/lipase [Lipid metabolism]; Region: Aes; COG0657
561275006861	Esterases and lipases (includes fungal lipases, cholinesterases, etc.)  These enzymes act on carboxylic esters (EC: 3.1.1.-). The catalytic apparatus involves three residues (catalytic triad): a serine, a glutamate or aspartate and a histidine.These...; Region: Esterase_lipase; cd00312
561275006862	Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326
561275006863	enoyl-CoA hydratase; Provisional; Region: PRK05870
561275006864	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
561275006865	substrate binding site [chemical binding]; other site
561275006866	oxyanion hole (OAH) forming residues; other site
561275006867	trimer interface [polypeptide binding]; other site
561275006869	PE family; Region: PE; pfam00934
561275006870	Adenylate cyclase, family 3 (some proteins contain HAMP domain) [Signal transduction mechanisms]; Region: CyaA; COG2114
561275006871	cyclase homology domain; Region: CHD; cd07302
561275006872	nucleotidyl binding site; other site
561275006873	metal binding site [ion binding]; metal-binding site
561275006874	dimer interface [polypeptide binding]; other site
561275006875	Predicted ATPase [General function prediction only]; Region: COG3903
561275006876	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
561275006877	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
561275006878	DNA binding residues [nucleotide binding]
561275006879	dimerization interface [polypeptide binding]; other site
561275006880	PE family; Region: PE; pfam00934
561275006881	TIGR00725 family protein; Region: TIGR00725
561275006882	thymidylate synthase; Provisional; Region: thyA; PRK00956
561275006883	Mycobacterium tuberculosis PIN domain family; Region: Mtu_PIN_fam; TIGR00028
561275006884	branched-chain alpha-keto acid dehydrogenase subunit E2; Reviewed; Region: PRK11856
561275006885	Lipoyl domain of the dihydrolipoyl acyltransferase component (E2) of 2-oxo acid dehydrogenases. 2-oxo acid dehydrogenase multienzyme complexes, like pyruvate dehydrogenase (PDH), 2-oxoglutarate dehydrogenase (OGDH) and branched-chain 2-oxo acid...; Region: lipoyl_domain; cd06849
561275006886	E3 interaction surface; other site
561275006887	lipoyl attachment site [posttranslational modification]; other site
561275006888	e3 binding domain; Region: E3_binding; pfam02817
561275006889	2-oxoacid dehydrogenases acyltransferase (catalytic domain); Region: 2-oxoacid_dh; pfam00198
561275006890	Pyruvate/2-oxoglutarate dehydrogenase complex, dehydrogenase (E1) component, eukaryotic type, beta subunit [Energy production and conversion]; Region: AcoB; COG0022
561275006891	Pyrimidine (PYR) binding domain of the beta subunits of the E1 components of human pyruvate dehydrogenase complex (E1- PDHc) and related proteins; Region: TPP_PYR_E1-PDHc-beta_like; cd07036
561275006892	alpha subunit interface [polypeptide binding]; other site
561275006893	TPP binding site [chemical binding]; other site
561275006894	heterodimer interface [polypeptide binding]; other site
561275006895	Transketolase, C-terminal domain; Region: Transketolase_C; pfam02780
561275006896	pyruvate dehydrogenase E1 component, alpha subunit; Region: PDH_E1_alph_x; TIGR03181
561275006897	Thiamine pyrophosphate (TPP) family, E1 of PDC_ADC_BCADC subfamily, TPP-binding module; composed of proteins similar to the E1 components of the human pyruvate dehydrogenase complex (PDC), the acetoin dehydrogenase complex (ADC) and the branched chain...; Region: TPP_E1_PDC_ADC_BCADC; cd02000
561275006898	tetramer interface [polypeptide binding]; other site
561275006899	TPP-binding site [chemical binding]; other site
561275006900	heterodimer interface [polypeptide binding]; other site
561275006901	phosphorylation loop region [posttranslational modification]
561275006902	Citrate lyase beta subunit [Carbohydrate transport and metabolism]; Region: CitE; COG2301
561275006903	FkbR2 is a Streptomyces hygroscopicus protein with a hot dog fold that belongs to a conserved family of proteins found in prokaryotes and archaea but not in eukaryotes. FkbR2  has sequence similarity to (R)-specific enoyl-CoA hydratase, the peroxisomal...; Region: FkbR2; cd03451
561275006904	putative active site [active]
561275006905	putative catalytic site [active]
561275006906	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275006907	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
561275006908	active site
561275006909	Acetyl/propionyl-CoA carboxylase, alpha subunit [Lipid metabolism]; Region: COG4770
561275006910	Carbamoyl-phosphate synthase L chain, N-terminal domain; Region: CPSase_L_chain; pfam00289
561275006911	Carbamoyl-phosphate synthase L chain, ATP binding domain; Region: CPSase_L_D2; pfam02786
561275006912	Biotin carboxylase C-terminal domain; Region: Biotin_carb_C; smart00878
561275006913	The biotinyl-domain or biotin carboxyl carrier protein (BCCP) domain is present in all biotin-dependent enzymes, such as acetyl-CoA carboxylase, pyruvate carboxylase, propionyl-CoA carboxylase, methylcrotonyl-CoA carboxylase, geranyl-CoA carboxylase; Region: biotinyl_domain; cd06850
561275006914	carboxyltransferase (CT) interaction site; other site
561275006915	biotinylation site [posttranslational modification]; other site
561275006916	Acetyl-CoA carboxylase, carboxyltransferase component (subunits alpha and beta) [Lipid metabolism]; Region: COG4799
561275006917	malonate decarboxylase subunit beta; Reviewed; Region: PRK07189; cl17682
561275006918	Acetyl-CoA carboxylase alpha subunit [Lipid metabolism]; Region: AccA; cl17345
561275006919	3-oxoacid CoA-transferase, B subunit; Region: pcaJ_scoB_fam; TIGR02428
561275006920	Acyl CoA:acetate/3-ketoacid CoA transferase, alpha subunit [Lipid metabolism]; Region: AtoD; COG1788
561275006921	AMP-binding domain protein; Validated; Region: PRK08315
561275006922	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
561275006923	Uncharacterized subfamily of fatty acid CoA ligase (FACL); Region: FACL_like_2; cd05917
561275006924	acyl-activating enzyme (AAE) consensus motif; other site
561275006925	acyl-activating enzyme (AAE) consensus motif; other site
561275006926	putative AMP binding site [chemical binding]; other site
561275006927	putative active site [active]
561275006928	putative CoA binding site [chemical binding]; other site
561275006929	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275006930	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275006931	Permeases of the major facilitator superfamily [General function prediction only]; Region: COG2270
561275006932	Short-chain dehydrogenases of various substrate specificities [General function prediction only]; Region: DltE; COG0300
561275006933	classical (c) SDRs; Region: SDR_c; cd05233
561275006934	NAD(P) binding site [chemical binding]; other site
561275006935	active site
561275006936	Bacterial protein of unknown function (DUF853); Region: DUF853; pfam05872
561275006937	DEDDh 3'-5' exonuclease domain of oligoribonuclease and similar proteins; Region: Orn; cd06135
561275006938	catalytic site [active]
561275006939	putative active site [active]
561275006940	putative substrate binding site [chemical binding]; other site
561275006941	dimer interface [polypeptide binding]; other site
561275006942	Transposase, Mutator family; Region: Transposase_mut; pfam00872
561275006943	MULE transposase domain; Region: MULE; pfam10551
561275006944	Domain of unknown function (DUF4411); Region: DUF4411; pfam14367
561275006945	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
561275006946	non-specific DNA binding site [nucleotide binding]; other site
561275006947	salt bridge; other site
561275006948	sequence-specific DNA binding site [nucleotide binding]; other site
561275006949	Predicted Zn peptidase [Amino acid transport and metabolism]; Region: COG2856
561275006950	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2739; cl17893
561275006951	IgD-like repeat domain of mycobacterial L,D-transpeptidases; Region: LDT_IgD_like_1; cd13431
561275006952	IgD-like repeat domain of mycobacterial L,D-transpeptidases; Region: LDT_IgD_like_2; cd13432
561275006953	Uncharacterized protein conserved in bacteria [Function unknown]; Region: ErfK; COG1376
561275006954	L,D-transpeptidase catalytic domain; Region: YkuD; pfam03734
561275006955	PE family; Region: PE; pfam00934
561275006956	Protein of unknown function (DUF3618); Region: DUF3618; pfam12277
561275006957	Peroxiredoxin (PRX) family, Bacterioferritin comigratory protein (BCP) subfamily; composed of thioredoxin-dependent thiol peroxidases, widely expressed in pathogenic bacteria, that protect cells against toxicity from reactive oxygen species by reducing...; Region: PRX_BCP; cd03017
561275006958	Thioredoxin-like; Region: Thioredoxin_8; pfam13905
561275006959	catalytic triad [active]
561275006960	hypothetical protein; Provisional; Region: PRK07907
561275006961	M20 Dipeptidases; Region: M20_Dipept_like; cd03893
561275006962	active site
561275006963	metal binding site [ion binding]; metal-binding site
561275006964	dimer interface [polypeptide binding]; other site
561275006965	4'-phosphopantetheinyl transferase; Provisional; Region: acpS; PRK00070
561275006966	(acyl-carrier-protein) S-malonyltransferase [Lipid metabolism]; Region: FabD; COG0331
561275006967	Enoyl reductase domain of yeast-type FAS1 [Lipid metabolism]; Region: COG4981
561275006968	TIM barrel proteins share a structurally conserved phosphate binding motif and in general share an eight beta/alpha closed barrel structure. Specific for this family is the conserved phosphate binding site at the edges of strands 7 and 8. The phosphate...; Region: TIM_phosphate_binding; cl17186
561275006969	phosphate binding site [ion binding]; other site
561275006970	Domain of unknown function (DUF1729); Region: DUF1729; pfam08354
561275006971	FAS_MaoC, the MaoC-like hot dog fold of the fatty acid synthase, beta subunit.  Other enzymes with this fold include MaoC dehydratase, Hydratase-Dehydrogenase-Epimerase protein (HDE), and 17-beta-hydroxysteriod dehydrogenase (HSD); Region: FAS_MaoC; cd03447
561275006972	putative active site [active]
561275006973	putative catalytic site [active]
561275006974	(acyl-carrier-protein) S-malonyltransferase [Lipid metabolism]; Region: FabD; COG0331
561275006975	malonyl CoA-acyl carrier protein transacylase; Region: fabD; TIGR00128
561275006976	3-oxoacyl-[acyl-carrier protein]; Region: COG4982
561275006977	ketoacyl reductase (KR) domain of fungal-type fatty acid synthase (fFAS), classical (c)-like SDRs; Region: KR_fFAS_SDR_c_like; cd08950
561275006978	putative NAD(P) binding site [chemical binding]; other site
561275006979	active site
561275006980	"elongating" condensing enzymes are a subclass of decarboxylating condensing enzymes, including beta-ketoacyl [ACP] synthase, type I and II and polyketide synthases.They are characterized by the utlization of acyl carrier protein (ACP)...; Region: elong_cond_enzymes; cd00828
561275006981	3-oxoacyl-(acyl-carrier-protein) synthase [Lipid metabolism / Secondary metabolites biosynthesis, transport, and catabolism]; Region: FabB; COG0304
561275006982	active site
561275006983	Domain of unknown function (DUF1906); Region: DUF1906; pfam08924
561275006984	PIN domain of the Rv0301 toxin of Mycobacterium tuberculosis and other uncharacterized, annotated PilT protein domain proteins; Region: PIN_MtRv0301; cd09882
561275006985	putative active site [active]
561275006986	Restriction endonuclease [Defense mechanisms]; Region: Mrr; COG1715
561275006987	Mrr N-terminal domain; Region: Mrr_N; pfam14338
561275006988	Restriction endonuclease; Region: Mrr_cat; pfam04471
561275006989	ERCC4 domain; Region: ERCC4; pfam02732
561275006990	Lsr2; Region: Lsr2; pfam11774
561275006991	PIN domain of ribonucleases (toxins), VapC, FitB, and PAE0151 of bacterial and archaeal toxin/antitoxin-like operons, and other similar homologs; Region: PIN_VapC-like; cd09861
561275006992	putative active site [active]
561275006993	Arginine/lysine/ornithine decarboxylases [Amino acid transport and metabolism]; Region: LdcC; COG1982
561275006994	Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes. PLP combines with an alpha-amino acid to form a compound called a Schiff base or aldimine intermediate, which depending on the reaction, is the...; Region: AAT_I; cl00321
561275006995	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
561275006996	catalytic residue [active]
561275006997	Orn/Lys/Arg decarboxylase, C-terminal domain; Region: OKR_DC_1_C; pfam03711
561275006998	Transcription termination factor NusB (N protein-Utilization Substance B). NusB plays a key role in the regulation of ribosomal RNA biosynthesis in eubacteria by modulating the efficiency of transcriptional antitermination. NusB along with other Nus...; Region: Terminator_NusB; cd00619
561275006999	putative RNA binding site [nucleotide binding]; other site
561275007000	elongation factor P; Validated; Region: PRK00529
561275007001	Elongation factor P (EF-P) KOW-like domain; Region: EFP_N; pfam08207
561275007002	S1_EF-P_repeat_1: Translation elongation factor P (EF-P), S1-like RNA-binding domain, repeat 1. EF-P stimulates the peptidyltransferase activity in the prokaryotic 70S ribosome. EF-P enhances the synthesis of certain dipeptides with...; Region: S1_EF-P_repeat_1; cd04470
561275007003	RNA binding site [nucleotide binding]; other site
561275007004	S1_EF-P_repeat_2: Translation elongation factor P (EF-P), S1-like RNA-binding domain, repeat 1. EF-P stimulates the peptidyltransferase activity in the prokaryotic 70S ribosome. EF-P enhances the synthesis of certain dipeptides with...; Region: S1_EF-P_repeat_2; cd05794
561275007005	RNA binding site [nucleotide binding]; other site
561275007006	Xaa-Pro aminopeptidase [Amino acid transport and metabolism]; Region: PepP; COG0006
561275007007	Creatinase/Prolidase N-terminal domain; Region: Creatinase_N; pfam01321
561275007008	Similar to Prolidase and Aminopeptidase P. The members of this subfamily presumably catalyse hydrolysis of Xaa-Pro dipeptides and/or release of any N-terminal amino acid, including proline, that is linked with proline; Region: APP-like; cd01092
561275007009	active site
561275007010	Dehydroquinase (DHQase), type II. Dehydroquinase (or 3-dehydroquinate dehydratase) catalyzes the reversible dehydration of 3-dehydroquinate to form 3-dehydroshikimate. This reaction is part of two metabolic pathways: the biosynthetic shikimate pathway...; Region: DHQase_II; cd00466
561275007011	Dehydroquinase class II; Region: DHquinase_II; pfam01220
561275007012	trimer interface [polypeptide binding]; other site
561275007013	active site
561275007014	dimer interface [polypeptide binding]; other site
561275007015	Dehydroquinate synthase (DHQS) catalyzes the conversion of DAHP to DHQ in shikimate pathway for aromatic compounds synthesis; Region: DHQS; cd08195
561275007016	active site
561275007017	dimer interface [polypeptide binding]; other site
561275007018	metal binding site [ion binding]; metal-binding site
561275007019	shikimate kinase; Reviewed; Region: aroK; PRK00131
561275007020	Shikimate kinase (SK) is the fifth enzyme in the shikimate pathway, a seven-step biosynthetic pathway which converts erythrose-4-phosphate to chorismic acid, found in bacteria, fungi and plants. Chorismic acid is a important intermediate in the synthesis...; Region: SK; cd00464
561275007021	ADP binding site [chemical binding]; other site
561275007022	magnesium binding site [ion binding]; other site
561275007023	putative shikimate binding site; other site
561275007024	Chorismate synthase [Amino acid transport and metabolism]; Region: AroC; COG0082
561275007025	Chorismase synthase, the enzyme catalyzing the final step of the shikimate pathway; Region: Chorismate_synthase; cd07304
561275007026	Tetramer interface [polypeptide binding]; other site
561275007027	active site
561275007028	FMN-binding site [chemical binding]; other site
561275007029	Alpha/beta hydrolase; Region: Abhydrolase_8; pfam06259
561275007030	I-RD05, 656 bp. Region of difference I-RD05, inserted region in Mycobacterium bovis BCG Pasteur (position 2830679..2831334, 656bp), BCG Tokyo (position 2823452..2824107, 656bp) and Mycobacterium bovis AF2122/97 (position 2833680..2834335, 656bp) compared to Mycobacterium tuberculosis H37Rv (position: 2866882..2866883). Leads to extra gene, lprR, similar to adjacent lppA and lppB
561275007031	digalactosyldiacylglycerol synthase; Region: PLN02846
561275007032	Transcription regulator of the Arc/MetJ class [Transcription]; Region: COG5450
561275007033	PIN domain of the Rv0301 toxin of Mycobacterium tuberculosis and other uncharacterized, annotated PilT protein domain proteins; Region: PIN_MtRv0301; cd09882
561275007034	putative active site [active]
561275007035	Ribbon-helix-helix protein, copG family; Region: RHH_1; pfam01402
561275007036	PIN domain of ribonucleases (toxins), VapC and FitB, of prokaryotic toxin/antitoxin operons, Pyrococcus horikoshii protein PH0500, and other similar bacterial and archaeal homologs; Region: PIN_VapC-FitB; cd09881
561275007037	oligomeric interface; other site
561275007038	putative active site [active]
561275007039	homodimer interface [polypeptide binding]; other site
561275007040	Predicted nucleic acid-binding protein, contains PIN domain [General function prediction only]; Region: COG2402
561275007041	putative active site [active]
561275007042	Ribbon-helix-helix protein, copG family; Region: RHH_1; pfam01402
561275007043	Type II secretory pathway, prepilin signal peptidase PulO and related peptidases [Cell motility and secretion / Posttranslational modification, protein turnover, chaperones / Intracellular trafficking and secretion]; Region: PulO; COG1989
561275007044	Type IV leader peptidase family; Region: Peptidase_A24; pfam01478
561275007045	shikimate-5-dehydrogenase, fungal AROM-type; Region: Shik-DH-AROM; TIGR01809
561275007046	Shikimate dehydrogenase substrate binding domain; Region: Shikimate_dh_N; pfam08501
561275007047	NAD(P) binding domain of Shikimate dehydrogenase; Region: NAD_bind_Shikimate_DH; cd01065
561275007048	NAD(P) binding site [chemical binding]; other site
561275007049	shikimate binding site; other site
561275007050	Aminodeoxychorismate lyase [Coenzyme transport and metabolism]; Region: COG1559
561275007051	proteins similar to Escherichia coli yceG; Region: yceG_like; cd08010
561275007052	dimerization interface [polypeptide binding]; other site
561275007053	Holliday junction resolvase-like protein; Reviewed; Region: PRK00109
561275007054	alanyl-tRNA synthetase; Reviewed; Region: alaS; PRK00252
561275007055	Alanyl-tRNA synthetase (AlaRS) class II core catalytic domain. AlaRS is a homodimer. It is responsible for the attachment of alanine to the 3' OH group of ribose of the appropriate tRNA. This domain is primarily responsible for ATP-dependent...; Region: AlaRS_core; cd00673
561275007056	motif 1; other site
561275007057	active site
561275007058	motif 2; other site
561275007059	motif 3; other site
561275007060	Threonyl and Alanyl tRNA synthetase second additional domain; Region: tRNA_SAD; smart00863
561275007061	DHHA1 domain; Region: DHHA1; pfam02272
561275007062	Uncharacterized conserved protein [Function unknown]; Region: COG0432
561275007063	recombination factor protein RarA; Reviewed; Region: PRK13342
561275007064	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
561275007065	Walker A motif; other site
561275007066	ATP binding site [chemical binding]; other site
561275007067	Walker B motif; other site
561275007068	arginine finger; other site
561275007069	MgsA AAA+ ATPase C terminal; Region: MgsA_C; pfam12002
561275007070	Predicted integral membrane protein [Function unknown]; Region: COG5473
561275007071	Protein of unknown function (DUF2652); Region: DUF2652; pfam10851
561275007072	MacB-like periplasmic core domain; Region: MacB_PCD; pfam12704
561275007073	ATP-binding cassette domain of the transporters involved in export of lipoprotein and macrolide, and cell division protein; Region: ABC_MJ0796_LolCDE_FtsE; cd03255
561275007074	ABC-type antimicrobial peptide transport system, ATPase component [Defense mechanisms]; Region: SalX; COG1136
561275007075	Walker A/P-loop; other site
561275007076	ATP binding site [chemical binding]; other site
561275007077	Q-loop/lid; other site
561275007078	ABC transporter signature motif; other site
561275007079	Walker B; other site
561275007080	D-loop; other site
561275007081	H-loop/switch region; other site
561275007082	effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038
561275007083	cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases [Signal transduction mechanisms]; Region: Crp; COG0664
561275007084	ligand binding site [chemical binding]; other site
561275007085	flexible hinge region; other site
561275007086	cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases [Signal transduction mechanisms]; Region: Crp; COG0664
561275007087	effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038
561275007088	ligand binding site [chemical binding]; other site
561275007089	flexible hinge region; other site
561275007090	Predicted esterase of the alpha-beta hydrolase superfamily [General function prediction only]; Region: RssA; COG1752
561275007091	Patatin-like phospholipase domain containing protein 6, protein 7, and fungal NTE1; Region: Pat_PNPLA6_PNPLA7_NTE1_like; cd07205
561275007092	active site
561275007093	nucleophile elbow; other site
561275007094	potential frameshift: common BLAST hit: gi|148662405|ref|YP_001283928.1| transglutaminase family protein
561275007095	Transglutaminase-like enzymes, putative cysteine proteases [Amino acid transport and metabolism]; Region: COG1305
561275007096	Bacterial transglutaminase-like N-terminal region; Region: Bact_transglu_N; pfam08379
561275007097	Transglutaminase-like superfamily; Region: Transglut_core; pfam01841
561275007098	Putative amidoligase enzyme (DUF2126); Region: DUF2126; pfam09899
561275007099	Putative amidoligase enzyme (DUF2126); Region: DUF2126; pfam09899
561275007100	Uncharacterized conserved protein [Function unknown]; Region: COG2308
561275007101	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2307
561275007102	A predicted alpha-helical domain with a conserved ER motif; Region: Alpha-E; pfam04168
561275007103	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4307
561275007104	Uncharacterized protein conserved in bacteria (DUF2248); Region: DUF2248; pfam10005
561275007105	Transglutaminase-like enzymes, putative cysteine proteases [Amino acid transport and metabolism]; Region: COG1305
561275007106	Bacterial transglutaminase-like N-terminal region; Region: Bact_transglu_N; pfam08379
561275007107	Transglutaminase/protease-like homologues; Region: TGc; smart00460
561275007108	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3801
561275007109	Predicted membrane protein [Function unknown]; Region: COG4129
561275007110	Fusaric acid resistance protein-like; Region: FUSC_2; pfam13515
561275007111	aspartyl-tRNA synthetase; Validated; Region: aspS; PRK00476
561275007112	EcAspRS_like_N: N-terminal, anticodon recognition domain of the type found in Escherichia coli aspartyl-tRNA synthetase (AspRS), the human mitochondrial (mt) AspRS-2, the discriminating (D) Thermus thermophilus AspRS-1, and the nondiscriminating (ND)...; Region: EcAspRS_like_N; cd04317
561275007113	dimer interface [polypeptide binding]; other site
561275007114	anticodon binding site; other site
561275007115	Asp tRNA synthetase (aspRS) class II core domain. Class II assignment is based upon its structure and the presence of three characteristic sequence motifs. AspRS is a homodimer, which attaches a specific amino acid to the 3' OH group of ribose of...; Region: AspRS_core; cd00777
561275007116	homodimer interface [polypeptide binding]; other site
561275007117	motif 1; other site
561275007118	active site
561275007119	motif 2; other site
561275007120	GAD domain; Region: GAD; pfam02938
561275007121	Class II tRNA amino-acyl synthetase-like catalytic core domain. Class II amino acyl-tRNA synthetases (aaRS) share a common fold and generally attach an amino acid to the 3' OH of ribose of the appropriate tRNA.   PheRS is an exception in that it...; Region: class_II_aaRS-like_core; cl00268
561275007122	active site
561275007123	motif 3; other site
561275007124	2-dehydropantoate 2-reductase; Provisional; Region: PRK12921
561275007125	Ketopantoate reductase PanE/ApbA; Region: ApbA; pfam02558
561275007126	Ketopantoate reductase PanE/ApbA C terminal; Region: ApbA_C; pfam08546
561275007127	Pyrabactin resistance 1 (PYR1), PYR1-like (PYL), regulatory component of abscisic acid receptors (RCARs), and related proteins; Region: PYR_PYL_RCAR_like; cd07821
561275007128	putative hydrophobic ligand binding site [chemical binding]; other site
561275007129	protein interface [polypeptide binding]; other site
561275007130	gate; other site
561275007131	Predicted metalloprotease [General function prediction only]; Region: COG2321
561275007132	Putative neutral zinc metallopeptidase; Region: Zn_peptidase; pfam04228
561275007133	Predicted phosphohydrolases [General function prediction only]; Region: Icc; COG1409
561275007134	metallophosphatase superfamily, metallophosphatase domain; Region: MPP_superfamily; cl13995
561275007135	active site
561275007136	metal binding site [ion binding]; metal-binding site
561275007137	DNA repair photolyase [DNA replication, recombination, and repair]; Region: SplB; COG1533
561275007138	haloalkane dehalogenase; Provisional; Region: PRK03592
561275007139	histidyl-tRNA synthetase; Reviewed; Region: hisS; PRK00037
561275007140	Class II Histidinyl-tRNA synthetase (HisRS)-like catalytic core domain. HisRS is a homodimer. It is responsible for the attachment of histidine to the 3' OH group of ribose of the appropriate tRNA. This domain is primarily responsible for...; Region: HisRS-like_core; cd00773
561275007141	dimer interface [polypeptide binding]; other site
561275007142	motif 1; other site
561275007143	active site
561275007144	motif 2; other site
561275007145	motif 3; other site
561275007146	HisRS Histidyl-anticodon binding domain. HisRS belongs to class II aminoacyl-tRNA synthetases (aaRS). This alignment contains the anticodon binding domain, which is responsible for specificity in tRNA-binding, so that the activated amino acid is...; Region: HisRS_anticodon; cd00859
561275007147	anticodon binding site; other site
561275007148	Zn-dependent hydrolases, including glyoxylases [General function prediction only]; Region: GloB; COG0491
561275007149	cyclophilin: cyclophilin-type peptidylprolyl cis- trans isomerases. This family contains eukaryotic, bacterial and archeal proteins which exhibit a peptidylprolyl cis- trans isomerases activity (PPIase, Rotamase) and in addition bind the...; Region: cyclophilin; cd00317
561275007150	active site
561275007151	(p)ppGpp synthetase, RelA/SpoT family; Region: spoT_relA; TIGR00691
561275007152	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
561275007153	Zn2+ binding site [ion binding]; other site
561275007154	Mg2+ binding site [ion binding]; other site
561275007155	Nucleotidyltransferase (NT) domain of RelA- and SpoT-like ppGpp synthetases and hydrolases; Region: NT_Rel-Spo_like; cd05399
561275007156	synthetase active site [active]
561275007157	NTP binding site [chemical binding]; other site
561275007158	metal binding site [ion binding]; metal-binding site
561275007159	TGS_RelA_SpoT: The RelA (SpoT) protein, also referred to as ppGpp hydrolase/synthetase, is a ribosome-associated protein that is activated during amino acid starvation and thought to mediate the stringent response. RelA contains a TGS domain, named after...; Region: TGS_RelA_SpoT; cd01668
561275007160	ACT  domain found C-terminal of the RelA/SpoT domains; Region: ACT_RelA-SpoT; cd04876
561275007161	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
561275007162	active site
561275007163	The substrate-binding domain of an ABC-type nickel/oligopeptide-like import system contains the type 2 periplasmic binding fold; Region: PBP2_NikA_DppA_OppA_like; cl01709
561275007164	ABC-type dipeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: DdpA; COG0747
561275007165	preprotein translocase subunit SecF; Reviewed; Region: secF; PRK13022
561275007166	Protein export membrane protein; Region: SecD_SecF; pfam02355
561275007167	preprotein translocase subunit SecD; Reviewed; Region: secD; PRK05812
561275007168	protein-export membrane protein, SecD/SecF family; Region: 2A0604s01; TIGR00916
561275007169	preprotein translocase subunit YajC; Validated; Region: yajC; PRK05886
561275007170	4-aminobutyrate aminotransferase; Provisional; Region: PRK06058
561275007171	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
561275007172	inhibitor-cofactor binding pocket; inhibition site
561275007173	pyridoxal 5'-phosphate binding site [chemical binding]; other site
561275007174	catalytic residue [active]
561275007175	Long-chain acyl-CoA synthetases (AMP-forming) [Lipid metabolism]; Region: FAA1; COG1022
561275007176	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
561275007177	acyl-activating enzyme (AAE) consensus motif; other site
561275007178	AMP binding site [chemical binding]; other site
561275007179	active site
561275007180	CoA binding site [chemical binding]; other site
561275007181	Putative dehydrogenase domain of multifunctional non-ribosomal peptide synthetases and related enzymes [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3320
561275007182	extended (e) SDRs, subgroup 1; Region: SDR_e1; cd05235
561275007183	putative NAD(P) binding site [chemical binding]; other site
561275007184	active site
561275007185	putative substrate binding site [chemical binding]; other site
561275007186	PE family; Region: PE; pfam00934
561275007187	Holliday junction DNA helicase RuvB; Reviewed; Region: ruvB; PRK00080
561275007188	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
561275007189	Walker A motif; other site
561275007190	ATP binding site [chemical binding]; other site
561275007191	Walker B motif; other site
561275007192	arginine finger; other site
561275007193	Holliday junction DNA helicase ruvB C-terminus; Region: RuvB_C; pfam05491
561275007194	Holliday junction DNA helicase RuvA; Reviewed; Region: ruvA; PRK00116
561275007195	RuvA N terminal domain; Region: RuvA_N; pfam01330
561275007196	Holliday junction resolvases (HJRs) are endonucleases that specifically resolve Holliday junction DNA intermediates during homologous recombination. HJR's occur in archaea, bacteria, and in the mitochondria of certain fungi, however this CD...; Region: RuvC_resolvase; cd00529
561275007197	active site
561275007198	putative DNA-binding cleft [nucleotide binding]; other site
561275007199	dimer interface [polypeptide binding]; other site
561275007200	Regulators of stationary/sporulation gene expression [Transcription]; Region: AbrB; COG2002
561275007201	looped-hinge helix DNA binding domain, AbrB family; Region: lp_hng_hel_AbrB; TIGR01439
561275007202	PIN domain of ribonucleases (toxins), VapC, FitB, and PAE0151 of bacterial and archaeal toxin/antitoxin-like operons, and other similar homologs; Region: PIN_VapC-like; cd09861
561275007203	putative active site [active]
561275007204	Domain of unknown function (DUF4178); Region: DUF4178; pfam13785
561275007205	Protein of unknown function DUF2617; Region: DUF2617; pfam10936
561275007206	Domain of unknown function (DUF4247); Region: DUF4247; pfam14042
561275007207	Domain of Unknown Function (DUF350); Region: DUF350; pfam03994
561275007208	Predicted spermidine synthase with an N-terminal membrane domain [General function prediction only]; Region: COG4262
561275007209	Spermine/spermidine synthase; Region: Spermine_synth; pfam01564
561275007210	Plasmid stability protein [General function prediction only]; Region: StbC; COG4691
561275007211	Mycobacterium tuberculosis PIN domain family; Region: Mtu_PIN_fam; TIGR00028
561275007212	hypothetical protein; Validated; Region: PRK00110
561275007213	Glutamine Amidotransferase (GATase_I) involved in pyridoxine biosynthesis; Region: GATase1_PB; cd01749
561275007214	predicted active site [active]
561275007215	catalytic triad [active]
561275007216	acyl-CoA thioesterase II; Region: tesB; TIGR00189
561275007217	Thioesterase II (TEII) is thought to regenerate misprimed nonribosomal peptide synthetases (NRPSs) as well as modular polyketide synthases (PKSs) by hydrolyzing acetyl groups bound to the peptidyl carrier protein (PCP) and acyl carrier protein (ACP)...; Region: Thioesterase_II_repeat2; cd03445
561275007218	active site
561275007219	Thioesterase II (TEII) is thought to regenerate misprimed nonribosomal peptide synthetases (NRPSs) as well as modular polyketide synthases (PKSs) by hydrolyzing acetyl groups bound to the peptidyl carrier protein (PCP) and acyl carrier protein (ACP)...; Region: Thioesterase_II_repeat1; cd03444
561275007220	catalytic triad [active]
561275007221	dimer interface [polypeptide binding]; other site
561275007222	pyridoxal 5'-phosphate synthase, synthase subunit Pdx1; Region: TIGR00343
561275007223	PdxS is a subunit of the pyridoxal 5'-phosphate (PLP) synthase, an important enzyme in deoxyxylulose 5-phosphate (DXP)-independent pathway for de novo biosynthesis of PLP,  present in some eubacteria, in archaea, fungi, plants, plasmodia, and some...; Region: pdxS; cd04727
561275007224	active site
561275007225	multimer interface [polypeptide binding]; other site
561275007226	Pyridoxamine-phosphate oxidase [Coenzyme metabolism]; Region: PdxH; COG0259
561275007227	Pyridoxamine 5'-phosphate oxidase; Region: Pyridox_oxidase; pfam01243
561275007228	Pyridoxine 5'-phosphate oxidase C-terminal dimerisation region; Region: PNPOx_C; pfam10590
561275007229	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275007230	PPE family; Region: PPE; pfam00823
561275007231	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275007232	PE-PPE domain; Region: PE-PPE; pfam08237
561275007233	Members of the Nudix hydrolase superfamily catalyze the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily requires a divalent cation, such as Mg2+ or Mn2+, for their activity and contain a highly...; Region: Nudix_Hydrolase_26; cd04685
561275007234	nudix motif; other site
561275007235	Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438
561275007236	This family is most closely related to the GT1 family of glycosyltransferases and named after YqgM in Bacillus licheniformis about which little is known. Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to...; Region: GT1_YqgM_like; cd03801
561275007237	Bacterial lipid A biosynthesis acyltransferase; Region: Lip_A_acyltrans; pfam03279
561275007238	Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: LABLAT-like; Region: LPLAT_LABLAT-like; cd07984
561275007239	putative acyl-acceptor binding pocket; other site
561275007240	Phosphatidylglycerophosphate synthase [Lipid metabolism]; Region: PgsA; COG0558
561275007241	FHIT (fragile histidine family): FHIT proteins, related to the HIT family carry a motif HxHxH/Qxx (x, is a hydrophobic amino acid), On the basis of sequence, substrate specificity, structure, evolution and mechanism, HIT proteins are classified into...; Region: FHIT; cd01275
561275007242	nucleotide binding site/active site [active]
561275007243	HIT family signature motif; other site
561275007244	catalytic residue [active]
561275007245	threonyl-tRNA synthetase; Reviewed; Region: thrS; PRK12305
561275007246	Threonyl and Alanyl tRNA synthetase second additional domain; Region: tRNA_SAD; pfam07973
561275007247	Threonyl-tRNA synthetase (ThrRS) class II core catalytic domain. ThrRS is a homodimer. It is responsible for the attachment of threonine to the 3' OH group of ribose of the appropriate tRNA. This domain is primarily responsible for ATP-dependent...; Region: ThrRS_core; cd00771
561275007248	active site
561275007249	dimer interface [polypeptide binding]; other site
561275007250	motif 1; other site
561275007251	motif 2; other site
561275007252	motif 3; other site
561275007253	ThrRS Threonyl-anticodon binding domain. ThrRS belongs to class II aminoacyl-tRNA synthetases (aaRS). This alignment contains the anticodon binding domain, which is responsible for specificity in tRNA-binding, so that the activated amino acid is...; Region: ThrRS_anticodon; cd00860
561275007254	anticodon binding site; other site
561275007255	TIM barrel proteins share a structurally conserved phosphate binding motif and in general share an eight beta/alpha closed barrel structure. Specific for this family is the conserved phosphate binding site at the edges of strands 7 and 8. The phosphate...; Region: TIM_phosphate_binding; cl17186
561275007256	phosphate binding site [ion binding]; other site
561275007257	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4762
561275007258	Predicted transcriptional regulator [Transcription]; Region: COG2345
561275007259	Helix-turn-helix domain; Region: HTH_20; pfam12840
561275007260	Uncharacterized conserved protein, contains double-stranded beta-helix domain [Function unknown]; Region: COG1917
561275007261	Predicted transcriptional regulator [Transcription]; Region: COG2345
561275007262	Helix-turn-helix domain; Region: HTH_20; pfam12840
561275007263	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275007264	S-adenosylmethionine binding site [chemical binding]; other site
561275007265	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cl17173
561275007266	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
561275007267	Ligand Binding Site [chemical binding]; other site
561275007268	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
561275007269	Ligand Binding Site [chemical binding]; other site
561275007270	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
561275007271	Ligand Binding Site [chemical binding]; other site
561275007272	Universal stress protein family; Region: Usp; pfam00582
561275007273	Ligand Binding Site [chemical binding]; other site
561275007274	SpoIVFB Site-2 protease (S2P), a zinc metalloprotease (MEROPS family M50B), regulates intramembrane proteolysis (RIP), and is involved in the pro-sigmaK pathway of bacterial spore formation. In this subgroup, SpoIVFB (sporulation protein, stage IV cell...; Region: S2P-M50_SpoIVFB_CBS; cd06164
561275007275	active site
561275007276	Peptidase family M50; Region: Peptidase_M50; pfam02163
561275007277	putative substrate binding region [chemical binding]; other site
561275007278	FOG: CBS domain [General function prediction only]; Region: COG0517
561275007279	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains in association with either the SpoIVFB domain (sporulation protein, stage IV cell wall formation, F locus, promoter-distal B) or the chloride channel protein EriC; Region: CBS_pair_SpoIVFB_EriC_assoc; cd04612
561275007280	FOG: CBS domain [General function prediction only]; Region: COG0517
561275007281	The CBS domain, named after human CBS, is a small domain originally identified in cystathionine beta-synthase and is subsequently found in a wide range of different proteins. CBS domains usually occur in tandem repeats. They associate to form a so-called...; Region: CBS_pair_9; cd04622
561275007282	peptide chain release factor 1; Provisional; Region: PRK04011
561275007283	SHS2 domain protein implicated in nucleic acid metabolism [General function prediction    only]; Region: COG1371
561275007284	Uncharacterized conserved protein [Function unknown]; Region: RtcB; COG1690
561275007285	hypothetical protein; Reviewed; Region: PRK09588
561275007286	Domain of unknown function (DUF1876); Region: DUF1876; pfam08962
561275007287	Hemerythrin-like domain; Region: Hr-like; cd12108
561275007288	Fe binding site [ion binding]; other site
561275007289	PE family; Region: PE; pfam00934
561275007290	Chloramphenicol (Cm) phosphotransferase (CPT). Cm-inactivating enzyme; modifies the primary (C-3) hydroxyl of the antibiotic. Related structurally to shikimate kinase II; Region: CPT; cd00227
561275007291	P-loop motif; other site
561275007292	ATP binding site [chemical binding]; other site
561275007293	Chloramphenicol (Cm) binding site [chemical binding]; other site
561275007294	catalytic residue [active]
561275007295	Uncharacterized membrane-associated protein [Function unknown]; Region: DedA; COG0586
561275007296	SNARE associated Golgi protein; Region: SNARE_assoc; cl00429
561275007297	Sulphate Transporter and Anti-Sigma factor antagonist) domain of anti-anti-sigma factors, key regulators of anti-sigma factors by phosphorylation; Region: STAS_anti-anti-sigma_factors; cd07043
561275007298	anti sigma factor interaction site; other site
561275007299	regulatory phosphorylation site [posttranslational modification]; other site
561275007300	hypothetical protein; Provisional; Region: PRK02237
561275007301	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
561275007302	Transcriptional regulators [Transcription]; Region: MarR; COG1846
561275007303	putative DNA binding site [nucleotide binding]; other site
561275007304	putative Zn2+ binding site [ion binding]; other site
561275007305	This conserved domain belongs to a superfamily including the bleomycin resistance protein, glyoxalase I, and type I ring-cleaving dioxygenases; Region: Glo_EDI_BRP_like_20; cd07254
561275007306	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
561275007307	putative metal binding site [ion binding]; other site
561275007308	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
561275007309	dimerization interface [polypeptide binding]; other site
561275007310	putative DNA binding site [nucleotide binding]; other site
561275007311	putative Zn2+ binding site [ion binding]; other site
561275007312	Arsenite efflux pump ACR3 and related permeases [Inorganic ion transport and metabolism]; Region: ACR3; COG0798
561275007313	arsenical-resistance protein; Region: acr3; TIGR00832
561275007314	Protein-tyrosine-phosphatase [Signal transduction mechanisms]; Region: Wzb; COG0394
561275007315	Low molecular weight phosphatase family; Region: LMWPc; cd00115
561275007316	active site
561275007317	RD11, 10982 bp. Region of difference RD11, phiRv2, deleted region in Mycobacterium bovis BCG Pasteur (position 2934526..2934527), BCG Tokyo (positon 2927298..2927299) and Mycobacterium bovis AF2122/97 (position 2937478..2937479) compared to Mycobacterium tuberculosis H37Rv2 (position: 2970017-2980998). Removes genes Rv2645-Rv2659c. The region comprises a copy of IS6110 and the phiRv2 prophage
561275007318	potential protein location (hypothetical protein) that overlaps protein (hypothetical arginine rich protein)
561275007319	potential protein location (hypothetical arginine rich protein) that overlaps protein (hypothetical protein)
561275007320	Transposase, Mutator family; Region: Transposase_mut; pfam00872
561275007321	MULE transposase domain; Region: MULE; pfam10551
561275007322	ATP-binding subunits of Clp protease and DnaK/DnaJ chaperones [Posttranslational modification, protein turnover, chaperones]; Region: clpA; COG0542
561275007323	Acetyltransferase (GNAT) domain; Region: Acetyltransf_10; pfam13673
561275007324	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
561275007325	Coenzyme A binding pocket [chemical binding]; other site
561275007326	AFG1-like ATPase; Region: AFG1_ATPase; pfam03969
561275007327	hypothetical protein; Provisional; Region: PRK14059
561275007328	Pyrimidine reductase, riboflavin biosynthesis [Coenzyme metabolism]; Region: RibD; COG1985
561275007329	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
561275007330	TAP-like protein; Region: Abhydrolase_4; pfam08386
561275007331	Protein of unknown function (DUF2029); Region: DUF2029; pfam09594
561275007332	Conserved domain frequently associated with peptide methionine sulfoxide reductase [Posttranslational modification, protein turnover, chaperones]; Region: COG0229
561275007333	SelR domain; Region: SelR; pfam01641
561275007334	Methyltransferase domain; Region: Methyltransf_31; pfam13847
561275007335	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275007336	S-adenosylmethionine binding site [chemical binding]; other site
561275007337	Predicted heme peroxidase involved in anaerobic stress response [General function prediction only]; Region: ywfI; COG3253
561275007338	protoporphyrinogen oxidase; Reviewed; Region: PRK11883
561275007339	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
561275007340	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
561275007341	Uroporphyrinogen decarboxylase (URO-D) is a dimeric cytosolic enzyme that decarboxylates the four acetate side chains of uroporphyrinogen III (uro-III) to create coproporphyrinogen III, without requiring any prosthetic groups or cofactors. This reaction...; Region: URO-D; cd00717
561275007342	substrate binding site [chemical binding]; other site
561275007343	active site
561275007344	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
561275007345	Enoyl-CoA hydratase/carnithine racemase [Lipid metabolism]; Region: CaiD; COG1024
561275007346	substrate binding site [chemical binding]; other site
561275007347	oxyanion hole (OAH) forming residues; other site
561275007348	trimer interface [polypeptide binding]; other site
561275007349	Protein of unknown function (DUF3000); Region: DUF3000; pfam11452
561275007350	Ribonuclease D [Translation, ribosomal structure and biogenesis]; Region: Rnd; COG0349
561275007351	DEDDy 3'-5' exonuclease domain of Ribonuclease D and similar proteins; Region: RNaseD_exo; cd06142
561275007352	catalytic site [active]
561275007353	putative active site [active]
561275007354	putative substrate binding site [chemical binding]; other site
561275007355	Deoxyxylulose-5-phosphate synthase [Coenzyme metabolism / Lipid metabolism]; Region: Dxs; COG1154
561275007356	Thiamine pyrophosphate (TPP) family, DXS subfamily, TPP-binding module; 1-Deoxy-D-xylulose-5-phosphate synthase (DXS) is a regulatory enzyme of the mevalonate-independent pathway involved in terpenoid biosynthesis. Terpeniods are plant natural products...; Region: TPP_DXS; cd02007
561275007357	TPP-binding site; other site
561275007358	Pyrimidine (PYR) binding domain of 1-deoxy-D-xylulose-5-phosphate synthase (DXS), transketolase (TK), and related proteins; Region: TPP_PYR_DXS_TK_like; cd07033
561275007359	PYR/PP interface [polypeptide binding]; other site
561275007360	dimer interface [polypeptide binding]; other site
561275007361	TPP binding site [chemical binding]; other site
561275007362	Transketolase, C-terminal domain; Region: Transketolase_C; pfam02780
561275007363	The CBS domain, named after human CBS, is a small domain originally identified in cystathionine beta-synthase and is subsequently found in a wide range of different proteins. CBS domains usually occur in tandem repeats. They associate to form a so-called...; Region: CBS_pair; cd02205
561275007364	Na+/H+ antiporter NhaD and related arsenite permeases [Inorganic ion transport and metabolism]; Region: ArsB; COG1055
561275007365	Permease P (pink-eyed dilution). Mutations in the human melanosomal P gene were responsible for classic phenotype of oculocutaneous albinism type 2 (OCA2). Although the precise function of the P protein is unknown, it was predicted to regulate the...; Region: P_permease; cd01116
561275007366	transmembrane helices; other site
561275007367	Na+/H+ antiporter NhaD and related arsenite permeases [Inorganic ion transport and metabolism]; Region: ArsB; COG1055
561275007368	Permease P (pink-eyed dilution). Mutations in the human melanosomal P gene were responsible for classic phenotype of oculocutaneous albinism type 2 (OCA2). Although the precise function of the P protein is unknown, it was predicted to regulate the...; Region: P_permease; cd01116
561275007369	transmembrane helices; other site
561275007370	ABC-type multidrug transport system, ATPase component [Defense mechanisms]; Region: CcmA; COG1131
561275007371	ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230
561275007372	Walker A/P-loop; other site
561275007373	ATP binding site [chemical binding]; other site
561275007374	Q-loop/lid; other site
561275007375	ABC transporter signature motif; other site
561275007376	Walker B; other site
561275007377	D-loop; other site
561275007378	H-loop/switch region; other site
561275007379	TRAM domain; Region: TRAM; cl01282
561275007380	SAM-dependent methyltransferases related to tRNA (uracil-5-)-methyltransferase [Translation, ribosomal structure and biogenesis]; Region: TrmA; COG2265
561275007381	Amino acid transporters [Amino acid transport and metabolism]; Region: PotE; COG0531
561275007382	K+ transport systems, NAD-binding component [Inorganic ion transport and metabolism]; Region: TrkA; COG0569
561275007383	TrkA-N domain; Region: TrkA_N; pfam02254
561275007384	TrkA-C domain; Region: TrkA_C; pfam02080
561275007385	K+ transport systems, NAD-binding component [Inorganic ion transport and metabolism]; Region: TrkA; COG0569
561275007386	TrkA-N domain; Region: TrkA_N; pfam02254
561275007387	TrkA-C domain; Region: TrkA_C; pfam02080
561275007388	Protein of unknown function (DUF3159); Region: DUF3159; pfam11361
561275007389	RecG_wedge_OBF: A subfamily of OB folds corresponding to the OB fold found in the N-terminal (wedge) domain of Escherichia coli RecG. RecG is a branched-DNA-specific helicase, which catalyzes the interconversion of a DNA replication fork to a...; Region: RecG_wedge_OBF; cd04488
561275007390	generic binding surface II; other site
561275007391	ssDNA binding site; other site
561275007392	Protein of unknown function (DUF3710); Region: DUF3710; pfam12502
561275007393	Trimeric dUTP diphosphatases; Region: trimeric_dUTPase; cd07557
561275007394	trimer interface [polypeptide binding]; other site
561275007395	active site
561275007396	Protein of unknown function (DUF3093); Region: DUF3093; pfam11292
561275007397	Domain of unknown function (DUF4193); Region: DUF4193; pfam13834
561275007398	LytR cell envelope-related transcriptional attenuator; Region: LytR_C; pfam13399
561275007399	Archaeal fructose-1,6-bisphosphatase and related enzymes of inositol monophosphatase family [Carbohydrate transport and metabolism]; Region: SuhB; COG0483
561275007400	IMPase, inositol monophosphatase and related domains. A family of Mg++ dependent phosphatases, inhibited by lithium, many of which may act on inositol monophosphate substrate. They dephosphorylate inositol phosphate to generate inositol, which may be...; Region: IMPase; cd01639
561275007401	active site
561275007402	dimerization interface [polypeptide binding]; other site
561275007403	Transcriptional regulator/sugar kinase [Transcription / Carbohydrate transport and metabolism]; Region: NagC; COG1940
561275007404	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cl17037
561275007405	RNA polymerase sigma factor SigB; Reviewed; Region: PRK07921
561275007406	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
561275007407	Sigma-70 region 3; Region: Sigma70_r3; pfam04539
561275007408	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
561275007409	DNA binding residues [nucleotide binding]
561275007410	This group of proteins belong to a large family of YjgF/YER057c/UK114-like proteins present in bacteria, archaea, and eukaryotes with no definitive function.  The conserved domain is similar in structure to chorismate mutase but there is no sequence...; Region: YjgF_YER057c_UK114_like_6; cd06154
561275007411	homotrimer interaction site [polypeptide binding]; other site
561275007412	putative active site [active]
561275007413	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3502
561275007414	Ribonuclease BN family enzyme [Replication, recombination, and repair]; Region: Rbn; COG1295
561275007415	Protein of unknown function (DUF3039); Region: DUF3039; pfam11238
561275007416	Protein of unknown function (DUF3099); Region: DUF3099; pfam11298
561275007417	RNA polymerase sigma factor SigB; Reviewed; Region: PRK07921
561275007418	Sigma-70 factor, region 1.2; Region: Sigma70_r1_2; pfam00140
561275007419	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
561275007420	Sigma-70 region 3; Region: Sigma70_r3; pfam04539
561275007421	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
561275007422	DNA binding residues [nucleotide binding]
561275007423	Mn-dependent transcriptional regulator [Transcription]; Region: TroR; COG1321
561275007424	Iron dependent repressor, N-terminal DNA binding domain; Region: Fe_dep_repress; pfam01325
561275007425	Iron dependent repressor, metal binding and dimerisation domain; Region: Fe_dep_repr_C; pfam02742
561275007426	This entry represents the core domain of the ferrous iron (Fe2+) transport protein FeoA found in bacteria; Region: FeoA; smart00899
561275007427	Domain of unknown function (DUF4192); Region: DUF4192; pfam13830
561275007428	soluble pyridine nucleotide transhydrogenase; Provisional; Region: PRK05249
561275007429	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
561275007430	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
561275007431	Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852
561275007432	PAC2 family; Region: PAC2; pfam09754
561275007433	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
561275007434	methyl indole-3-acetate methyltransferase; Region: PLN02211; cl17657
561275007435	Predicted epimerase, PhzC/PhzF homolog [General function prediction only]; Region: COG0384
561275007436	nitrobindin heme-binding domain; Region: nitrobindin; cd07828
561275007437	heme-binding site [chemical binding]; other site
561275007438	transcriptional regulator NrdR; Validated; Region: nrdR; PRK00464
561275007439	ATP cone domain; Region: ATP-cone; pfam03477
561275007440	LysM domain; Region: LysM; pfam01476
561275007441	LexA repressor; Validated; Region: PRK00215
561275007442	LexA DNA binding domain; Region: LexA_DNA_bind; pfam01726
561275007443	Peptidase S24 LexA-like proteins are involved in the SOS response leading to the repair of single-stranded DNA within the bacterial cell. This family includes: the lambda repressor CI/C2 family and related bacterial prophage repressor proteins; LexA (EC...; Region: S24_LexA-like; cd06529
561275007444	Catalytic site [active]
561275007445	Uncharacterized protein potentially involved in peptidoglycan biosynthesis [Cell envelope biogenesis, outer membrane]; Region: COG5479
561275007446	LGFP repeat; Region: LGFP; pfam08310
561275007447	LGFP repeat; Region: LGFP; pfam08310
561275007448	LGFP repeat; Region: LGFP; pfam08310
561275007449	LGFP repeat; Region: LGFP; pfam08310
561275007450	LGFP repeat; Region: LGFP; pfam08310
561275007451	Integral membrane protein TerC family; Region: TerC; cl10468
561275007452	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275007453	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
561275007454	active site
561275007455	GTPases [General function prediction only]; Region: HflX; COG2262
561275007456	GTP-binding GTPase N-terminal; Region: GTP-bdg_N; pfam13167
561275007457	HflX GTPase family; Region: HflX; cd01878
561275007458	G1 box; other site
561275007459	GTP/Mg2+ binding site [chemical binding]; other site
561275007460	Switch I region; other site
561275007461	G2 box; other site
561275007462	G3 box; other site
561275007463	Switch II region; other site
561275007464	G4 box; other site
561275007465	G5 box; other site
561275007466	diaminopimelate epimerase; Region: DapF; TIGR00652
561275007467	Diaminopimelate epimerase; Region: DAP_epimerase; pfam01678
561275007468	Diaminopimelate epimerase; Region: DAP_epimerase; pfam01678
561275007469	tRNA delta(2)-isopentenylpyrophosphate transferase [Translation, ribosomal structure and biogenesis]; Region: MiaA; COG0324
561275007470	tRNA delta(2)-isopentenylpyrophosphate transferase; Reviewed; Region: miaA; PRK00091
561275007471	Subunit B of Class III Extradiol ring-cleavage dioxygenases; Region: Extradiol_Dioxygenase_3B_like; cl00599
561275007472	active site
561275007473	metal binding site [ion binding]; metal-binding site
561275007474	Domain of Unknown Function (DUF349); Region: DUF349; pfam03993
561275007475	Domain of Unknown Function (DUF349); Region: DUF349; pfam03993
561275007476	Domain of Unknown Function (DUF349); Region: DUF349; pfam03993
561275007477	(dimethylallyl)adenosine tRNA methylthiotransferase; Provisional; Region: PRK14326
561275007478	Uncharacterized protein family UPF0004; Region: UPF0004; pfam00919
561275007479	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
561275007480	FeS/SAM binding site; other site
561275007481	TRAM domain; Region: TRAM; cl01282
561275007482	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
561275007483	FeS/SAM binding site; other site
561275007484	Uncharacterized protein conserved in bacteria [General function prediction only]; Region: OraA; COG2137
561275007485	DNA recombination protein RecA; Reviewed; Region: recA; PRK09519
561275007486	RecA is a  bacterial enzyme which has roles in homologous recombination, DNA repair, and the induction of the SOS response.  RecA couples ATP hydrolysis to DNA strand exchange; Region: recA; cd00983
561275007487	hexamer interface [polypeptide binding]; other site
561275007488	Walker A motif; other site
561275007489	ATP binding site [chemical binding]; other site
561275007490	Walker B motif; other site
561275007491	Hedgehog/Intein domain, found in Hedgehog proteins as well as proteins which contain inteins and undergo protein splicing (e.g. DnaB, RIR1-2, GyrA and Pol). In protein splicing an intervening polypeptide sequence - the intein - is excised from a protein; Region: Hint; cd00081
561275007492	protein-splicing catalytic site; other site
561275007493	thioester formation/cholesterol transfer; other site
561275007494	Hint (Hedgehog/Intein) domain C-terminal region; Region: HintC; smart00305
561275007495	recA bacterial DNA recombination protein; Region: RecA; cl17211
561275007496	FhuF 2Fe-2S C-terminal domain; Region: FhuF_C; pfam11575
561275007497	Protein of unknown function (DUF3046); Region: DUF3046; pfam11248
561275007498	Glycosyl transferases, related to UDP-glucuronosyltransferase [Carbohydrate transport and metabolism / Signal transduction mechanisms]; Region: COG1819
561275007499	Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. The acceptor molecule can be a lipid, a protein, a heterocyclic compound, or another carbohydrate...; Region: Glycosyltransferase_GTB_type; cl10013
561275007500	Limonene-1,2-epoxide hydrolase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: LimA; COG4308
561275007501	similar to PE-PGRS family protein; In Mycobacterium bovis BCG Pasteur, BCG Tokyo, and Mycobacterium bovis, deletions of a single base (t-*)leads to frameshifted products PE_PGRS47a (10 aa) and PE_PGRS47b (424 aa), respectively
561275007502	PE family; Region: PE; pfam00934
561275007503	potential frameshift: common BLAST hit: gi|148823930|ref|YP_001288684.1| arginine rich protein
561275007504	Protein of unknown function (DUF3046); Region: DUF3046; pfam11248
561275007505	Phage shock protein A (IM30), suppresses sigma54-dependent transcription [Transcription / Signal transduction mechanisms]; Region: PspA; COG1842
561275007506	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
561275007507	non-specific DNA binding site [nucleotide binding]; other site
561275007508	salt bridge; other site
561275007509	sequence-specific DNA binding site [nucleotide binding]; other site
561275007510	Phosphatidylglycerophosphate synthase [Lipid metabolism]; Region: PgsA; COG0558
561275007511	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
561275007512	Coenzyme A binding pocket [chemical binding]; other site
561275007513	DNA segregation ATPase FtsK/SpoIIIE and related proteins [Cell division and chromosome partitioning]; Region: FtsK; COG1674
561275007514	FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580
561275007515	This domain directs oriented DNA translocation and forms a winged helix structure; Region: Ftsk_gamma; smart00843
561275007516	Uncharacterized conserved protein [Function unknown]; Region: COG1359
561275007517	3-ketoacyl-(acyl-carrier-protein) reductase; Reviewed; Region: PRK12826
561275007518	classical (c) SDRs; Region: SDR_c; cd05233
561275007519	NAD(P) binding site [chemical binding]; other site
561275007520	active site
561275007521	O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315
561275007522	methyltransferase, TIGR00027 family; Region: mthyl_TIGR00027
561275007523	mRNA degradation ribonucleases J1/J2 (metallo-beta-lactamase superfamily) [Translation, ribosomal structure and biogenesis; Replication, recombination and repair]; Region: COG0595
561275007524	Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849
561275007525	RNA-metabolising metallo-beta-lactamase; Region: RMMBL; pfam07521
561275007526	Dihydrodipicolinate synthase/N-acetylneuraminate lyase [Amino acid transport and metabolism / Cell envelope biogenesis, outer membrane]; Region: DapA; COG0329
561275007527	Dihydrodipicolinate synthase (DHDPS); Region: DHDPS; cd00950
561275007528	dimer interface [polypeptide binding]; other site
561275007529	active site
561275007530	catalytic residue [active]
561275007531	FAD-dependent thymidylate synthase; Reviewed; Region: thyX; PRK00847
561275007532	Type I restriction modification DNA specificity domain; Region: Methylase_S; pfam01420
561275007533	HsdM N-terminal domain; Region: HsdM_N; pfam12161
561275007534	N-6 DNA Methylase; Region: N6_Mtase; pfam02384
561275007535	Methyltransferase domain; Region: Methyltransf_26; pfam13659
561275007536	PIN domain of the Rv0301 toxin of Mycobacterium tuberculosis and other uncharacterized, annotated PilT protein domain proteins; Region: PIN_MtRv0301; cd09882
561275007537	putative active site [active]
561275007538	Transcription regulator of the Arc/MetJ class [Transcription]; Region: COG5450
561275007539	PIN domain of the VapC-like UPF0110 protein Mb0640 and homologs; Region: PIN_UPF0110; cd09871
561275007540	putative active site [active]
561275007541	Rv0623-like transcription factor; Region: PSK_trans_fac; pfam07704
561275007542	Type I restriction modification DNA specificity domain; Region: Methylase_S; pfam01420
561275007543	Restriction endonuclease S subunits [Defense mechanisms]; Region: HsdS; COG0732
561275007544	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3214
561275007545	Dihydrofolate reductase [Coenzyme metabolism]; Region: FolA; COG0262
561275007546	Dihydrofolate reductase (DHFR). Reduces 7,8-dihydrofolate to 5,6,7,8-tetrahydrofolate with NADPH as a cofactor. This is an essential step in the biosynthesis of deoxythymidine phosphate since 5,6,7,8-tetrahydrofolate is required to regenerate 5; Region: DHFR; cd00209
561275007547	folate binding site [chemical binding]; other site
561275007548	NADP+ binding site [chemical binding]; other site
561275007549	thymidylate synthase; Reviewed; Region: thyA; PRK01827
561275007550	Thymidylate synthase and pyrimidine hydroxymethylase: Thymidylate synthase (TS) and deoxycytidylate hydroxymethylase (dCMP-HMase) are homologs that catalyze analogous alkylation of C5 of pyrimidine nucleotides. Both enzymes are involved in the...; Region: TS_Pyrimidine_HMase; cd00351
561275007551	dimerization interface [polypeptide binding]; other site
561275007552	active site
561275007553	Dienelactone hydrolase family; Region: DLH; pfam01738
561275007554	BAAT / Acyl-CoA thioester hydrolase C terminal; Region: BAAT_C; pfam08840
561275007555	3-ketoacyl-(acyl-carrier-protein) reductase; Provisional; Region: fabG; PRK07231
561275007556	classical (c) SDRs; Region: SDR_c; cd05233
561275007557	NAD(P) binding site [chemical binding]; other site
561275007558	active site
561275007559	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275007560	PPE family; Region: PPE; pfam00823
561275007561	Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484
561275007562	PE family; Region: PE; pfam00934
561275007563	Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484
561275007564	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275007565	PPE family; Region: PPE; pfam00823
561275007566	Multimeric flavodoxin WrbA [General function prediction only]; Region: WrbA; COG0655
561275007567	dihydrodipicolinate reductase; Provisional; Region: PRK00048
561275007568	Dihydrodipicolinate reductase, N-terminus; Region: DapB_N; pfam01113
561275007569	Dihydrodipicolinate reductase, C-terminus; Region: DapB_C; pfam05173
561275007570	Acetyltransferase (GNAT) domain; Region: Acetyltransf_10; pfam13673
561275007571	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
561275007572	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
561275007573	Coenzyme A binding pocket [chemical binding]; other site
561275007574	Flavodoxin reductases (ferredoxin-NADPH reductases) family 1 [Energy production and conversion]; Region: Hmp; COG1018
561275007575	Phthalate dioxygenase reductase (PDR) is an FMN-dependent reductase that mediates electron transfer from NADH to FMN to an iron sulfur cluster. PDR has an an N-terminal  ferrredoxin reductase (FNR)-like NAD(H) binding domain and a C-terminal iron-sulfur; Region: PDR_like; cd06185
561275007576	FMN-binding pocket [chemical binding]; other site
561275007577	flavin binding motif; other site
561275007578	phosphate binding motif [ion binding]; other site
561275007579	beta-alpha-beta structure motif; other site
561275007580	NAD binding pocket [chemical binding]; other site
561275007581	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
561275007582	catalytic loop [active]
561275007583	iron binding site [ion binding]; other site
561275007584	Predicted metal-dependent hydrolase [General function prediction only]; Region: COG3687
561275007585	Predicted metal-dependent hydrolase; Region: Metal_hydrol; pfam10118
561275007586	START/RHO_alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) ligand-binding domain superfamily; Region: SRPBCC; cd07812
561275007587	hydrophobic ligand binding site; other site
561275007588	helix_turn_helix ASNC type; Region: HTH_ASNC; smart00344
561275007589	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
561275007590	putative DNA binding site [nucleotide binding]; other site
561275007591	putative Zn2+ binding site [ion binding]; other site
561275007592	AsnC family; Region: AsnC_trans_reg; pfam01037
561275007593	Formate/glycerate dehydrogenases, D-specific 2-hydroxy acid dehydrogenases and related dehydrogenases; Region: FDH_GDH_like; cl17240
561275007594	Formate/glycerate dehydrogenases, D-specific 2-hydroxy acid dehydrogenases and related dehydrogenases; Region: FDH_GDH_like; cl17240
561275007595	NAD binding site [chemical binding]; other site
561275007596	Nitronate monooxygenase; Region: NMO; pfam03060
561275007597	2-Nitropropane dioxygenase (NPD), one of the nitroalkane oxidizing enzyme families, catalyzes oxidative denitrification of nitroalkanes to their corresponding carbonyl compounds and nitrites. NDP is a member of the NAD(P)H-dependent flavin oxidoreductase...; Region: NPD_like; cd04730
561275007598	FMN binding site [chemical binding]; other site
561275007599	substrate binding site [chemical binding]; other site
561275007600	putative catalytic residue [active]
561275007601	Predicted Zn-dependent peptidases [General function prediction only]; Region: PqqL; COG0612
561275007602	Insulinase (Peptidase family M16); Region: Peptidase_M16; pfam00675
561275007603	Peptidase M16 inactive domain; Region: Peptidase_M16_C; pfam05193
561275007604	guanosine pentaphosphate synthetase I/polynucleotide phosphorylase; Region: pppGpp_PNP; TIGR02696
561275007605	RNase PH-like 3'-5' exoribonucleases; Region: RNase_PH; cl03114
561275007606	oligomer interface [polypeptide binding]; other site
561275007607	RNA binding site [nucleotide binding]; other site
561275007608	Polyribonucleotide nucleotidyltransferase, RNA binding domain; Region: PNPase; pfam03726
561275007609	Polyribonucleotide nucleotidyltransferase, repeat 2; Region: RNase_PH_PNPase_2; cd11364
561275007610	RNase E interface [polypeptide binding]; other site
561275007611	trimer interface [polypeptide binding]; other site
561275007612	active site
561275007613	Polynucleotide phosphorylase (PNPase) K homology RNA-binding domain (KH). PNPase is a polyribonucleotide nucleotidyl transferase that degrades mRNA in prokaryotes and plant chloroplasts. The C-terminal region of PNPase contains domains homologous to...; Region: PNPase_KH; cd02393
561275007614	putative nucleic acid binding region [nucleotide binding]; other site
561275007615	G-X-X-G motif; other site
561275007616	S1_PNPase: Polynucleotide phosphorylase (PNPase), ), S1-like RNA-binding domain. PNPase  is a polyribonucleotide nucleotidyl transferase that degrades mRNA. It is a trimeric multidomain protein. The C-terminus contains the S1 domain which binds ssRNA; Region: S1_PNPase; cd04472
561275007617	RNA binding site [nucleotide binding]; other site
561275007618	domain interface; other site
561275007619	Ribosomal protein S15 (prokaryotic)_S13 (eukaryotic) binds the central domain of 16S rRNA and is required for assembly of the small ribosomal subunit and for intersubunit association, thus representing a key element in the assembly of the whole ribosome; Region: Ribosomal_S15p_S13e; cd00353
561275007620	16S/18S rRNA binding site [nucleotide binding]; other site
561275007621	S13e-L30e interaction site [polypeptide binding]; other site
561275007622	25S rRNA binding site [nucleotide binding]; other site
561275007623	bifunctional riboflavin kinase/FMN adenylyltransferase; Reviewed; Region: PRK05627
561275007624	FAD synthetase, N-terminal domain of the bifunctional enzyme; Region: FAD_synthetase_N; cd02064
561275007625	active site
561275007626	Riboflavin kinase; Region: Flavokinase; pfam01687
561275007627	Antiactivator of flagellar biosynthesis FleN, an ATPase [Cell motility]; Region: flhG; COG0455
561275007628	This protein family consists of proteins similar to the cpaE protein of the Caulobacter pilus assembly and the orf4 protein of Actinobacillus pilus formation gene cluster. The function of these proteins are unkown. The Caulobacter pilus assembly contains...; Region: CpaE_like; cd03111
561275007629	Mn-dependent transcriptional regulator [Transcription]; Region: TroR; COG1321
561275007630	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
561275007631	putative DNA binding site [nucleotide binding]; other site
561275007632	Iron dependent repressor, metal binding and dimerisation domain; Region: Fe_dep_repr_C; pfam02742
561275007633	FeoA domain; Region: FeoA; pfam04023
561275007634	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275007635	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
561275007636	active site
561275007637	lipid-transfer protein; Provisional; Region: PRK08256
561275007638	Thiolase domain associated with sterol carrier protein (SCP)-x isoform and related proteins; SCP-2  has multiple roles in intracellular lipid circulation and metabolism. The N-terminal presequence in the SCP-x isoform represents a peroxisomal...; Region: SCP-x_thiolase; cd00829
561275007639	active site
561275007640	Helix-turn-helix domain; Region: HTH_OrfB_IS605; pfam12323
561275007641	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG0675
561275007642	Probable transposase; Region: OrfB_IS605; pfam01385
561275007643	Predicted site-specific integrase-resolvase [DNA replication, recombination, and repair]; Region: COG2452
561275007644	Serine Recombinase (SR) family, IS607-like transposase subfamily, catalytic domain; members contain a DNA binding domain with homology to MerR/SoxR located N-terminal to the catalytic domain. Serine recombinases catalyze site-specific recombination of...; Region: SR_IS607_transposase_like; cd03769
561275007645	catalytic residues [active]
561275007646	catalytic nucleophile [active]
561275007647	tRNA pseudouridine synthase B; Provisional; Region: truB; PRK03287
561275007648	Pseudouridine synthase, Escherichia coli TruB like; Region: PseudoU_synth_EcTruB; cd02573
561275007649	RNA binding site [nucleotide binding]; other site
561275007650	active site
561275007651	tRNA Pseudouridine synthase II, C terminal; Region: TruB_C; pfam09142
561275007652	Phosphopantetheinyl transferase component of siderophore synthetase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: EntD; COG2977
561275007653	4'-phosphopantetheinyl transferase superfamily; Region: ACPS; pfam01648
561275007654	Predicted phosphohydrolases [General function prediction only]; Region: Icc; COG1409
561275007655	metallophosphatase superfamily, metallophosphatase domain; Region: MPP_superfamily; cl13995
561275007656	active site
561275007657	metal binding site [ion binding]; metal-binding site
561275007658	Uncharacterized conserved protein [Function unknown]; Region: COG4717
561275007659	Alpha/beta hydrolase; Region: Abhydrolase_8; pfam06259
561275007660	Protein of unknown function (DUF3558); Region: DUF3558; pfam12079
561275007661	Predicted acyl esterases [General function prediction only]; Region: COG2936
561275007662	X-Pro dipeptidyl-peptidase C-terminal non-catalytic domain; Region: PepX_C; smart00939
561275007663	Growth inhibitor [Signal transduction mechanisms]; Region: MazF; COG2337
561275007664	Uncharacterized conserved protein [Function unknown]; Region: COG5586
561275007665	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4453
561275007666	Integrase core domain; Region: rve; pfam00665
561275007668	Helix-turn-helix domain; Region: HTH_28; pfam13518
561275007669	Winged helix-turn helix; Region: HTH_29; pfam13551
561275007670	Integrase core domain; Region: rve; pfam00665
561275007671	Integrase core domain; Region: rve_3; pfam13683
561275007672	Mu transposase, C-terminal; Region: Mu-transpos_C; pfam09299
561275007673	Type II secretory pathway, component ExeA (predicted ATPase) [Intracellular trafficking and secretion]; Region: ExeA; COG3267
561275007674	S-RD06, 4921 bp, Region of difference S-RD06. The DR region is composed of near-perfect tandem direct repeats of 36 bases pairs (GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC), separated in 2 stretches by the insertion of an IS6110 element inside one copy. In Mycobacterium bovis BCG Pasteur (position 3072633..3077553, 4921bp) and BCG Tokyo (position 3065406..3070326, 4921bp), it is composed of 49 copies (19.5 and 29.5), compared to 42 copies (17.5 and 24.5) in Mycobacterium bovis AF (position 3075735..3080138, 4404bp) and 42 copies (18.5 and 23.5) in Mycobacterium tuberculosis strain H37Rv (position 3119185..3123576,4392bp).
561275007675	putative transposase OrfB; Reviewed; Region: PHA02517
561275007676	HTH-like domain; Region: HTH_21; pfam13276
561275007677	Integrase core domain; Region: rve; pfam00665
561275007678	Integrase core domain; Region: rve_3; pfam13683
561275007679	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
561275007680	Transposase; Region: HTH_Tnp_1; cl17663
561275007681	CRISPR/Cas system-associated protein Cas2; Region: Cas2_I_II_III; cd09638
561275007682	CRISPR/Cas system-associated protein Cas1; Region: Cas1_I-II-III; cd09636
561275007684	CRISPR/Cas system-associated protein Csm6; Region: Csm6_III-A; cl09873
561275007685	CRISPR/Cas system-associated RAMP superfamily protein Csm5; Region: Csm5_III-A; cd09662
561275007686	CRISPR/Cas system-associated RAMP superfamily protein Csm4; Region: Csm4_III-A; cd09663
561275007687	CRISPR/Cas system-associated RAMP superfamily protein Csm3; Region: Csm3_III-A; cd09684
561275007688	CRISPR/Cas system-associated protein Csm2; Region: Csm2_III-A; cd09647
561275007689	Predicted CRISPR-associated polymerase [Defense mechanisms]; Region: COG1353
561275007690	CRISPR/Cas system-associated protein Cas10; Region: Cas10_III; cd09680
561275007691	CRISPR/Cas system-associated RAMP superfamily protein Cas6; Region: Cas6-I-III; cd09652
561275007692	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4293
561275007693	Uncharacterized conserved protein [Function unknown]; Region: COG2253
561275007694	Protein of unknown function (DUF2005); Region: DUF2005; pfam09407
561275007695	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4293
561275007696	Uncharacterized conserved protein (DUF2277); Region: DUF2277; pfam10041
561275007697	PIN domain of the VapC-like Sll0205 protein and homologs; Region: PIN_Sll0205; cd09872
561275007698	putative active site [active]
561275007699	Antitoxin of toxin-antitoxin stability system [Cell division and chromosome partitioning]; Region: Phd; COG4118
561275007700	enoyl-CoA hydratase; Provisional; Region: PRK06190
561275007701	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
561275007702	substrate binding site [chemical binding]; other site
561275007703	oxyanion hole (OAH) forming residues; other site
561275007704	trimer interface [polypeptide binding]; other site
561275007705	glycerol-3-phosphate transporter ATP-binding subunit; Provisional; Region: ugpC; PRK11650
561275007706	The N-terminal ATPase domain of the maltose transporter, MalK; Region: ABC_MalK_N; cd03301
561275007707	Walker A/P-loop; other site
561275007708	ATP binding site [chemical binding]; other site
561275007709	Q-loop/lid; other site
561275007710	ABC transporter signature motif; other site
561275007711	Walker B; other site
561275007712	D-loop; other site
561275007713	H-loop/switch region; other site
561275007715	ABC-type sugar transport system, periplasmic component [Carbohydrate transport and metabolism]; Region: UgpB; COG1653
561275007716	Bacterial extracellular solute-binding protein; Region: SBP_bac_1; pfam01547
561275007717	ABC-type sugar transport system, permease component [Carbohydrate transport and metabolism]; Region: UgpE; COG0395
561275007718	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
561275007719	dimer interface [polypeptide binding]; other site
561275007720	conserved gate region; other site
561275007721	putative PBP binding loops; other site
561275007722	ABC-ATPase subunit interface; other site
561275007723	ABC-type polysaccharide transport system, permease component [Carbohydrate transport and metabolism]; Region: LplB; COG4209
561275007724	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
561275007725	dimer interface [polypeptide binding]; other site
561275007726	conserved gate region; other site
561275007727	putative PBP binding loops; other site
561275007728	ABC-ATPase subunit interface; other site
561275007729	Na+-driven multidrug efflux pump [Defense mechanisms]; Region: NorM; COG0534
561275007730	DinF and similar proteins, a subfamily of the multidrug and toxic compound extrusion (MATE)-like proteins; Region: MATE_DinF_like; cd13136
561275007731	Exopolyphosphatase-related proteins [General function prediction only]; Region: COG0618
561275007732	DHH family; Region: DHH; pfam01368
561275007733	ribosome-binding factor A; Validated; Region: rbfA; PRK00521
561275007734	Translation initiation factor IF-2, N-terminal region; Region: IF2_N; pfam04760
561275007735	Translation initiation factor IF-2, N-terminal region; Region: IF2_N; pfam04760
561275007736	Translation initiation factor 2 (IF-2; GTPase) [Translation, ribosomal structure and biogenesis]; Region: InfB; COG0532
561275007737	Initiation Factor 2 (IF2)/ eukaryotic Initiation Factor 5B (eIF5B) family; Region: IF2_eIF5B; cd01887
561275007738	G1 box; other site
561275007739	putative GEF interaction site [polypeptide binding]; other site
561275007740	GTP/Mg2+ binding site [chemical binding]; other site
561275007741	Switch I region; other site
561275007742	G2 box; other site
561275007743	G3 box; other site
561275007744	Switch II region; other site
561275007745	G4 box; other site
561275007746	G5 box; other site
561275007747	This family represents the domain II of bacterial Initiation Factor 2 (IF2) and its eukaryotic mitochondrial homologue mtIF2. IF2, the largest initiation factor is an essential GTP binding protein. In E. coli three natural forms of IF2 exist in the cell; Region: IF2_mtIF2_II; cd03702
561275007748	Translation-initiation factor 2; Region: IF-2; pfam11987
561275007749	mtIF2_IVc: this family represents the C2 subdomain of domain IV of mitochondrial translation initiation factor 2 (mtIF2) which adopts a beta-barrel fold displaying a high degree of structural similarity with domain II of the translation elongation factor...; Region: mtIF2_IVc; cd03692
561275007750	Predicted nucleic-acid-binding protein implicated in transcription termination [Transcription]; Region: COG2740
561275007751	putative RNA binding cleft [nucleotide binding]; other site
561275007752	transcription elongation factor NusA; Provisional; Region: nusA; PRK12327
561275007753	NusA N-terminal domain; Region: NusA_N; pfam08529
561275007754	S1_NusA: N-utilizing substance A protein (NusA), S1-like RNA-binding domain. S1-like RNA-binding domains are found in a wide variety of RNA-associated proteins. NusA is a transcription elongation factor containing an N-terminal catalytic domain and three...; Region: S1_NusA; cd04455
561275007755	RNA binding site [nucleotide binding]; other site
561275007756	homodimer interface [polypeptide binding]; other site
561275007757	NusA_K homology RNA-binding domain (KH). NusA is an essential multifunctional transcription elongation factor that is universally conserved among prokaryotes and archaea. NusA anti-termination function plays an important role in the expression of...; Region: NusA_KH; cd02134
561275007758	G-X-X-G motif; other site
561275007759	NusA_K homology RNA-binding domain (KH). NusA is an essential multifunctional transcription elongation factor that is universally conserved among prokaryotes and archaea. NusA anti-termination function plays an important role in the expression of...; Region: NusA_KH; cd02134
561275007760	G-X-X-G motif; other site
561275007761	ribosome maturation protein RimP; Reviewed; Region: PRK00092
561275007762	Sm and related proteins; Region: Sm_like; cl00259
561275007763	Bacillus subtilis YxlS-like, C-terminal domain; Region: YlxS_C; cd01734
561275007764	putative oligomer interface [polypeptide binding]; other site
561275007765	putative RNA binding site [nucleotide binding]; other site
561275007766	Mitochondrial ATP synthase g subunit; Region: ATP-synt_G; pfam04718
561275007767	Ferritin-like superfamily of diiron-containing four-helix-bundle proteins; Region: Ferritin_like; cd00657
561275007768	dinuclear metal binding motif [ion binding]; other site
561275007769	prolyl-tRNA synthetase; Provisional; Region: PRK09194
561275007770	Prolyl-tRNA synthetase (ProRS) class II core catalytic domain. ProRS is a homodimer. It is responsible for the attachment of proline to the 3' OH group of ribose of the appropriate tRNA. This domain is primarily responsible for ATP-dependent...; Region: ProRS_core_prok; cd00779
561275007771	dimer interface [polypeptide binding]; other site
561275007772	motif 1; other site
561275007773	active site
561275007774	motif 2; other site
561275007775	YbaK-like.  The YbaK family of deacylase domains includes the INS amino acid-editing domain of  the bacterial class II prolyl tRNA synthetase (ProRS), and it's trans-acting homologs, YbaK, ProX, and PrdX. The primary function of INS is to hydrolyze...; Region: YbaK_like; cl00022
561275007776	putative deacylase active site [active]
561275007777	Class II tRNA amino-acyl synthetase-like catalytic core domain. Class II amino acyl-tRNA synthetases (aaRS) share a common fold and generally attach an amino acid to the 3' OH of ribose of the appropriate tRNA.   PheRS is an exception in that it...; Region: class_II_aaRS-like_core; cl00268
561275007778	active site
561275007779	motif 3; other site
561275007780	ProRS Prolyl-anticodon binding domain, short version found predominantly in bacteria. ProRS belongs to class II aminoacyl-tRNA synthetases (aaRS). This alignment contains the anticodon binding domain, which is responsible for specificity in tRNA-binding; Region: ProRS_anticodon_short; cd00861
561275007781	anticodon binding site; other site
561275007782	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
561275007783	drug resistance transporter, EmrB/QacA subfamily; Region: efflux_EmrB; TIGR00711
561275007784	putative substrate translocation pore; other site
561275007785	Siroheme synthase (precorrin-2 oxidase/ferrochelatase domain) [Coenzyme metabolism]; Region: CysG; COG1648
561275007786	Putative NAD(P)-binding; Region: NAD_binding_7; pfam13241
561275007787	Uroporphyrin-III C-methyltransferase (S-Adenosyl-L-methionine:uroporphyrinogen III methyltransferase, SUMT); Region: SUMT; cd11642
561275007788	homodimer interface [polypeptide binding]; other site
561275007789	active site
561275007790	SAM binding site [chemical binding]; other site
561275007791	VNTR3155 is located between Rv2847c and Rv2848c. Differs from BCG Pasteur by a 54-bp in VNTR3155 locus of BCG Tokyo. The copy number of the 54-bp unit is 4 in BCG Tokyo and 3 in BCG Pasteur.
561275007792	cobyrinic acid a,c-diamide synthase; Validated; Region: PRK01077
561275007793	The Fer4_NifH superfamily contains a variety of proteins which share a common ATP-binding domain. Functionally, proteins in this superfamily use the energy from hydrolysis of NTP to transfer electron or ion; Region: Fer4_NifH; cl17203
561275007794	Type 1 glutamine amidotransferase (GATase1) domain found in Cobyrinic Acid a,c-Diamide Synthase; Region: GATase1_CobB; cd03130
561275007795	catalytic triad [active]
561275007796	ATP:corrinoid adenosyltransferase [Coenzyme metabolism]; Region: BtuR; COG2109
561275007797	ATP:corrinoid adenosyltransferase BtuR/CobO/CobP. This family consists of the BtuR, CobO, CobP proteins all of which are Cob(I)alamin (vitamin B12) adenosyltransferase, which is involved in cobalamin (vitamin B12) biosynthesis. This enzyme is a homodimer; Region: CobA_CobO_BtuR; cd00561
561275007798	homodimer interface [polypeptide binding]; other site
561275007799	Walker A motif; other site
561275007800	ATP binding site [chemical binding]; other site
561275007801	hydroxycobalamin binding site [chemical binding]; other site
561275007802	Walker B motif; other site
561275007803	cobaltochelatase subunit; Region: Cob-chelat-sub; TIGR02442
561275007804	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
561275007805	Walker A motif; other site
561275007806	ATP binding site [chemical binding]; other site
561275007807	Walker B motif; other site
561275007808	arginine finger; other site
561275007809	Magnesium chelatase: Mg-chelatase catalyses the insertion of Mg into protoporphyrin IX (Proto). In chlorophyll biosynthesis, insertion of Mg2+ into protoporphyrin IX is catalysed by magnesium chelatase in an ATP-dependent reaction. Magnesium chelatase is...; Region: vWA_Magnesium_chelatase; cd01451
561275007810	metal ion-dependent adhesion site (MIDAS); other site
561275007811	Predicted acyltransferase [General function prediction only]; Region: ElaA; COG2153
561275007812	malate:quinone oxidoreductase; Validated; Region: PRK05257
561275007813	malate:quinone-oxidoreductase; Region: mal_quin_oxido; TIGR01320
561275007814	PE family; Region: PE; pfam00934
561275007815	Lysophospholipase [Lipid metabolism]; Region: PldB; COG2267
561275007816	Putative lysophospholipase; Region: Hydrolase_4; pfam12146
561275007817	mycothione reductase; Reviewed; Region: PRK07846
561275007818	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
561275007819	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
561275007820	Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852
561275007821	High-affinity nickel permease [Inorganic ion transport and metabolism]; Region: HoxN; COG3376
561275007822	The Fer4_NifH superfamily contains a variety of proteins which share a common ATP-binding domain. Functionally, proteins in this superfamily use the energy from hydrolysis of NTP to transfer electron or ion; Region: Fer4_NifH; cl17203
561275007823	The Fer4_NifH superfamily contains a variety of proteins which share a common ATP-binding domain. Functionally, proteins in this superfamily use the energy from hydrolysis of NTP to transfer electron or ion; Region: Fer4_NifH; cl17203
561275007824	short chain dehydrogenase; Provisional; Region: PRK06057
561275007825	classical (c) SDRs; Region: SDR_c; cd05233
561275007826	NAD(P) binding site [chemical binding]; other site
561275007827	active site
561275007828	Aldehyde dehydrogenase family; Region: Aldedh; pfam00171
561275007829	NAD(P)+ dependent aldehyde dehydrogenase family; Region: ALDH; cd07078
561275007830	NAD(P) binding site [chemical binding]; other site
561275007831	catalytic residues [active]
561275007832	Predicted glutamine amidotransferases [General function prediction only]; Region: COG2071
561275007833	Subgroup of proteins having the Type 1 glutamine amidotransferase (GATase1) domain; Region: GATase1_2; cd01745
561275007834	catalytic triad [active]
561275007835	Glutamine synthetase [Amino acid transport and metabolism]; Region: GlnA; COG0174
561275007836	Glutamine synthetase, beta-Grasp domain; Region: Gln-synt_N; pfam03951
561275007837	Glutamine synthetase, catalytic domain; Region: Gln-synt_C; pfam00120
561275007838	Methionine Aminopeptidase 1. E.C. 3.4.11.18. Also known as methionyl aminopeptidase and Peptidase M. Catalyzes release of N-terminal amino acids, preferentially methionine, from peptides and arylamides; Region: MetAP1; cd01086
561275007839	active site
561275007840	Domain of unknown function (DUF1707); Region: DUF1707; pfam08044
561275007841	PIN domain of ribonucleases (toxins), VapC, FitB, and PAE0151 of bacterial and archaeal toxin/antitoxin-like operons, and other similar homologs; Region: PIN_VapC-like; cd09861
561275007842	putative active site [active]
561275007843	NTF2-like N-terminal transpeptidase domain; Region: MecA_N; pfam05223
561275007844	Cell division protein FtsI/penicillin-binding protein 2 [Cell envelope biogenesis, outer membrane]; Region: FtsI; COG0768
561275007845	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; pfam00905
561275007846	Antitoxin of toxin-antitoxin stability system [Cell division and chromosome partitioning]; Region: StbD; COG2161
561275007847	Cytotoxic translational repressor of toxin-antitoxin stability system [Translation, ribosomal structure and biogenesis / Cell division and chromosome partitioning]; Region: RelE; COG2026
561275007848	Predicted acetyltransferase [General function prediction only]; Region: COG3393
561275007849	Domain of unknown function (DUF4081); Region: DUF4081; pfam13312
561275007850	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase; Reviewed; Region: ispG; PRK00366
561275007851	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase; Validated; Region: PRK00694
561275007852	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase; Validated; Region: PRK00694
561275007853	Predicted membrane-associated Zn-dependent proteases 1 [Cell envelope biogenesis, outer membrane]; Region: COG0750
561275007854	RseP-like Site-2 proteases (S2P), zinc metalloproteases (MEROPS family M50A), cleave transmembrane domains of substrate proteins, regulating intramembrane proteolysis (RIP) of diverse signal transduction mechanisms. In Escherichia coli, the S2P homolog...; Region: S2P-M50_PDZ_RseP-like; cd06163
561275007855	active site
561275007856	PDZ domain of bacterial and plant zinc metalloprotases, presumably membrane-associated or integral membrane proteases, which may be involved in signalling and regulatory mechanisms. May be responsible for substrate recognition and/or binding, as most PDZ...; Region: PDZ_metalloprotease; cd00989
561275007857	protein binding site [polypeptide binding]; other site
561275007858	1-deoxy-D-xylulose 5-phosphate reductoisomerase; Provisional; Region: PRK05447
561275007859	1-deoxy-D-xylulose 5-phosphate reductoisomerase; Region: DXP_reductoisom; pfam02670
561275007860	1-deoxy-D-xylulose 5-phosphate reductoisomerase C-terminal; Region: DXP_redisom_C; pfam08436
561275007861	DXP reductoisomerase C-terminal domain; Region: DXPR_C; pfam13288
561275007862	Ribbon-helix-helix protein, copG family; Region: RHH_1; pfam01402
561275007863	Mycobacterium tuberculosis PIN domain family; Region: Mtu_PIN_fam; TIGR00028
561275007864	Secreted and surface protein containing fasciclin-like repeats [Cell envelope biogenesis, outer membrane]; Region: COG2335
561275007865	Fasciclin domain; Region: Fasciclin; pfam02469
561275007866	Cytochrome c biogenesis protein [Posttranslational modification, protein turnover, chaperones]; Region: CcdA; COG0785
561275007867	Cytochrome C biogenesis protein transmembrane region; Region: DsbD; cl15788
561275007868	TlpA-like family, DipZ-like subfamily; composed uncharacterized proteins containing a TlpA-like TRX domain. Some members show domain architectures similar to that of E. coli DipZ protein (also known as DsbD). The only eukaryotic members of the TlpA...; Region: TlpA_like_DipZ_like; cd03012
561275007869	Thioredoxin-like; Region: Thioredoxin_8; pfam13905
561275007870	catalytic residues [active]
561275007871	Secreted and surface protein containing fasciclin-like repeats [Cell envelope biogenesis, outer membrane]; Region: COG2335
561275007872	Fasciclin domain; Region: Fasciclin; pfam02469
561275007873	Protein of unknown function (DUF2631); Region: DUF2631; pfam10939
561275007874	Cytochrome c biogenesis protein [Posttranslational modification, protein turnover, chaperones]; Region: CcdA; COG0785
561275007875	TlpA-like family, suppressor for copper sensitivity D protein (ScsD) and actinobacterial DsbE homolog subfamily; composed of ScsD, the DsbE homolog of Mycobacterium tuberculosis (MtbDsbE) and similar proteins, all containing a redox-active CXXC motif; Region: TlpA_like_ScsD_MtbDsbE; cd03011
561275007876	Thioredoxin-like; Region: Thioredoxin_8; pfam13905
561275007877	catalytic residues [active]
561275007878	ribosomal RNA large subunit methyltransferase N; Provisional; Region: PRK14459
561275007879	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
561275007880	FeS/SAM binding site; other site
561275007881	CDP-diglyceride synthetase [Lipid metabolism]; Region: CdsA; COG0575
561275007882	Cytidylyltransferase family; Region: CTP_transf_1; pfam01148
561275007883	ribosome recycling factor; Reviewed; Region: frr; PRK00083
561275007884	Ribosome recycling factor (RRF). Ribosome recycling factor dissociates the posttermination complex, composed of the ribosome, deacylated tRNA, and mRNA, after termination of translation.  Thus ribosomes are "recycled" and ready for another...; Region: RRF; cd00520
561275007885	hinge region; other site
561275007886	UMP kinase (UMPK)-Ec, the microbial/chloroplast uridine monophosphate kinase (uridylate kinase) enzyme that catalyzes UMP phosphorylation and plays a key role in pyrimidine nucleotide biosynthesis; regulation of this process is via feed-back control and...; Region: AAK_UMPK-PyrH-Ec; cd04254
561275007887	putative nucleotide binding site [chemical binding]; other site
561275007888	uridine monophosphate binding site [chemical binding]; other site
561275007889	homohexameric interface [polypeptide binding]; other site
561275007890	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
561275007891	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
561275007892	DNA binding site [nucleotide binding]
561275007893	Helix-turn-helix domain; Region: HTH_OrfB_IS605; pfam12323
561275007894	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG0675
561275007895	Probable transposase; Region: OrfB_IS605; pfam01385
561275007896	Predicted site-specific integrase-resolvase [DNA replication, recombination, and repair]; Region: COG2452
561275007897	Serine Recombinase family, catalytic domain; a DNA binding domain may be present either N- or C-terminal to the catalytic domain. These enzymes perform site-specific recombination of DNA molecules by a concerted, four-strand cleavage and rejoining...; Region: Ser_Recombinase; cl02788
561275007898	catalytic residues [active]
561275007899	catalytic nucleophile [active]
561275007900	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
561275007901	MarR family; Region: MarR; pfam01047
561275007902	amidase; Provisional; Region: PRK07869
561275007903	Amidase; Region: Amidase; pfam01425
561275007904	elongation factor Ts; Provisional; Region: tsf; PRK09377
561275007905	UBA/TS-N domain; Region: UBA; pfam00627
561275007906	Elongation factor TS; Region: EF_TS; pfam00889
561275007907	Elongation factor TS; Region: EF_TS; pfam00889
561275007908	Ribosomal protein S2 (RPS2), involved in formation of the translation initiation complex, where it might contact the messenger RNA and several components of the ribosome. It has been shown that in Escherichia coli RPS2 is essential for the binding of...; Region: RPS2; cd01425
561275007909	rRNA interaction site [nucleotide binding]; other site
561275007910	S8 interaction site; other site
561275007911	putative laminin-1 binding site; other site
561275007912	Membrane proteins related to metalloendopeptidases [Cell envelope biogenesis, outer membrane]; Region: NlpD; COG0739
561275007913	Peptidase family M23; Region: Peptidase_M23; pfam01551
561275007914	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275007915	PPE family; Region: PPE; pfam00823
561275007916	Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484
561275007917	probable F420-dependent oxidoreductase, MSMEG_2516 family; Region: F420_MSMEG_2516; TIGR03621
561275007918	Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cl07892
561275007919	site-specific tyrosine recombinase XerC; Reviewed; Region: xerC; PRK00236
561275007920	DNA breaking-rejoining enzymes, C-terminal catalytic domain. The DNA breaking-rejoining enzyme superfamily includes type IB topoisomerases and tyrosine recombinases that share the same fold in their catalytic domain containing six conserved active site...; Region: DNA_BRE_C; cl00213
561275007921	active site
561275007922	DNA binding site [nucleotide binding]
561275007923	Int/Topo IB signature motif; other site
561275007924	Siderophore-interacting protein [Inorganic ion transport and metabolism]; Region: ViuB; COG2375
561275007925	Siderophore interacting proteins share the domain structure of the ferredoxin reductase like family. Siderophores are produced in various bacteria (and some plants) to extract iron from hosts. Binding constants are high, so iron can be pilfered from...; Region: siderophore_interacting; cd06193
561275007926	FAD binding pocket [chemical binding]; other site
561275007927	FAD binding motif [chemical binding]; other site
561275007928	phosphate binding motif [ion binding]; other site
561275007929	NAD binding pocket [chemical binding]; other site
561275007930	Predicted Rossmann fold nucleotide-binding protein involved in DNA uptake [DNA replication, recombination, and repair / Intracellular trafficking and secretion]; Region: Smf; COG0758
561275007931	DNA protecting protein DprA; Region: dprA; TIGR00732
561275007932	Predicted ATPase with chaperone activity [Posttranslational modification, protein turnover, chaperones]; Region: COG0606
561275007933	Subunit ChlI of Mg-chelatase; Region: ChlI; pfam13541
561275007934	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
561275007935	Walker A motif; other site
561275007936	ATP binding site [chemical binding]; other site
561275007937	Walker B motif; other site
561275007938	Magnesium chelatase, subunit ChlI; Region: Mg_chelatase_2; pfam13335
561275007939	hypothetical protein; Reviewed; Region: PRK12497
561275007940	formate dehydrogenase accessory protein; Reviewed; Region: PRK00724
561275007941	oxidoreductase alpha (molybdopterin) subunit; Region: Fdhalpha-like; TIGR01701
561275007942	The MopB_ydeP CD includes a group of related uncharacterized bacterial molybdopterin-binding oxidoreductase-like domains with a putative molybdopterin cofactor binding site. These members belong to the molybdopterin_binding (MopB) superfamily of proteins; Region: MopB_ydeP; cd02767
561275007943	putative molybdopterin cofactor binding site [chemical binding]; other site
561275007944	The MopB_CT_ydeP CD includes a group of related uncharacterized bacterial molybdopterin-binding oxidoreductase-like domains with a putative molybdopterin cofactor binding site. This CD is of the conserved molybdopterin_binding C-terminal (MopB_CT) region...; Region: MopB_CT_ydeP; cd02787
561275007945	putative molybdopterin cofactor binding site; other site
561275007946	Protein of unknown function (DUF2469); Region: DUF2469; pfam10611
561275007947	bacterial Ribonuclease HII-like; Region: RNase_HII_bacteria_HII_like; cd07182
561275007948	RNA/DNA hybrid binding site [nucleotide binding]; other site
561275007949	active site
561275007950	signal peptidase I, bacterial type; Region: sigpep_I_bact; TIGR02227
561275007951	The S26 Type I signal peptidase (SPase; LepB; leader peptidase B; leader peptidase I; EC 3.4.21.89) family members are essential membrane-bound serine proteases that function to cleave the amino-terminal signal peptide extension from proteins that are...; Region: S26_SPase_I; cd06530
561275007952	Catalytic site [active]
561275007953	The S26 Type I signal peptidase (SPase; LepB; leader peptidase B; leader peptidase I; EC 3.4.21.89) family members are essential membrane-bound serine proteases that function to cleave the amino-terminal signal peptide extension from proteins that are...; Region: S26_SPase_I; cd06530
561275007954	50S ribosomal protein L19; Provisional; Region: rplS; PRK05338
561275007955	Beta-lactamase enzyme family; Region: Beta-lactamase2; cl17872
561275007956	tRNA (guanine-N(1)-)-methyltransferase; Reviewed; Region: trmD; PRK00026
561275007957	16S rRNA-processing protein RimM; Provisional; Region: rimM; PRK00122
561275007958	RimM N-terminal domain; Region: RimM; pfam01782
561275007959	hypothetical protein; Provisional; Region: PRK02821
561275007960	Predicted RNA-binding protein (contains KH domain) [General function prediction only]; Region: COG1837
561275007961	G-X-X-G motif; other site
561275007962	30S ribosomal protein S16; Provisional; Region: rpsP; PRK14520
561275007963	Nuclear transport factor 2 (NTF2-like) superfamily. This family includes members of the NTF2 family, Delta-5-3-ketosteroid isomerases, Scytalone Dehydratases, and the beta subunit of Ring hydroxylating dioxygenases. This family is a classic example of...; Region: NTF2_like; cd00531
561275007964	D-alanyl-D-alanine carboxypeptidase; Region: Peptidase_S11; pfam00768
561275007965	Beta-lactamase enzyme family; Region: Beta-lactamase2; cl17872
561275007966	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275007967	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275007968	N-acyl-D-aspartate/D-glutamate deacylase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3653
561275007969	D-aminoacylases (N-acyl-D-Amino acid amidohydrolases) catalyze the hydrolysis of N-acyl-D-amino acids to produce the corresponding D-amino acids, which are used as intermediates in the synthesis of pesticides, bioactive peptides, and antibiotics; Region: D-aminoacylase; cd01297
561275007970	active site
561275007971	putative substrate binding pocket [chemical binding]; other site
561275007972	Superfamily of metallo-dependent hydrolases (also called amidohydrolase superfamily) is a large group of proteins that show conservation in their 3-dimensional fold (TIM barrel) and in details of their active site. The vast majority of the members have a...; Region: metallo-dependent_hydrolases; cl00281
561275007973	Serine/Threonine protein kinases, catalytic domain; Region: S_TKc; smart00220
561275007974	Catalytic domain of Protein Kinases; Region: PKc; cd00180
561275007975	active site
561275007976	ATP binding site [chemical binding]; other site
561275007977	substrate binding site [chemical binding]; other site
561275007978	activation loop (A-loop); other site
561275007979	Imidazolonepropionase and related amidohydrolases [Secondary metabolites biosynthesis, transport, and catabolism]; Region: HutI; COG1228
561275007980	Metallo-dependent hydrolases, subgroup A is part of the superfamily of metallo-dependent hydrolases, a large group of proteins that show conservation in their 3-dimensional fold (TIM barrel) and in details of their active site. The vast majority of the...; Region: Met_dep_hydrolase_A; cd01299
561275007981	active site
561275007982	signal recognition particle protein; Provisional; Region: PRK10867
561275007983	SRP54-type protein, helical bundle domain; Region: SRP54_N; smart00963
561275007984	The signal recognition particle (SRP) mediates the transport to or across the plasma membrane in bacteria and the endoplasmic reticulum in eukaryotes. SRP recognizes N-terminal sighnal sequences of newly synthesized polypeptides at the ribosome. The...; Region: SRP; cd03115
561275007985	P loop; other site
561275007986	GTP binding site [chemical binding]; other site
561275007987	Signal peptide binding domain; Region: SRP_SPB; pfam02978
561275007988	DNA or RNA helicases of superfamily II [Transcription / DNA replication, recombination, and repair]; Region: SSL2; COG1061
561275007989	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cl17251
561275007990	ATP binding site [chemical binding]; other site
561275007991	putative Mg++ binding site [ion binding]; other site
561275007992	PII uridylyl-transferase; Provisional; Region: PRK03381
561275007993	Nucleotidyltransferase (NT) domain of Escherichia coli adenylyltransferase (GlnE), Escherichia coli uridylyl transferase (GlnD), and similar proteins; Region: NT_GlnE_GlnD_like; cd05401
561275007994	metal binding triad; other site
561275007995	GlnD PII-uridylyltransferase; Region: GlnD_UR_UTase; pfam08335
561275007996	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
561275007997	Zn2+ binding site [ion binding]; other site
561275007998	Mg2+ binding site [ion binding]; other site
561275007999	Nitrogen regulatory protein PII [Amino acid transport and metabolism]; Region: GlnK; COG0347
561275008000	Nitrogen regulatory protein P-II; Region: P-II; smart00938
561275008001	Ammonia permease [Inorganic ion transport and metabolism]; Region: AmtB; COG0004
561275008002	signal recognition particle-docking protein FtsY; Region: ftsY; TIGR00064
561275008003	SRP54-type protein, helical bundle domain; Region: SRP54_N; pfam02881
561275008004	The Fer4_NifH superfamily contains a variety of proteins which share a common ATP-binding domain. Functionally, proteins in this superfamily use the energy from hydrolysis of NTP to transfer electron or ion; Region: Fer4_NifH; cl17203
561275008005	chromosome segregation protein SMC, common bacterial type; Region: SMC_prok_B; TIGR02168
561275008006	ATP-binding cassette domain of barmotin, a member of the SMC protein family; Region: ABC_SMC_barmotin; cd03278
561275008007	Walker A/P-loop; other site
561275008008	ATP binding site [chemical binding]; other site
561275008009	SMC proteins Flexible Hinge Domain; Region: SMC_hinge; smart00968
561275008010	ATP-binding cassette domain of barmotin, a member of the SMC protein family; Region: ABC_SMC_barmotin; cd03278
561275008011	ABC transporter signature motif; other site
561275008012	Walker B; other site
561275008013	D-loop; other site
561275008014	H-loop/switch region; other site
561275008015	acylphosphatase; Provisional; Region: PRK14422
561275008016	Predicted redox protein, regulator of disulfide bond formation [Posttranslational modification, protein turnover, chaperones]; Region: COG1765
561275008017	formamidopyrimidine/5-formyluracil/ 5-hydroxymethyluracil DNA glycosylase; Validated; Region: PRK01103
561275008018	N-terminal domain of Escherichia coli Fpg1/MutM and related bacterial DNA glycosylases; Region: EcFpg-like_N; cd08966
561275008019	DNA binding site [nucleotide binding]
561275008020	catalytic residue [active]
561275008021	H2TH interface [polypeptide binding]; other site
561275008022	putative catalytic residues [active]
561275008023	turnover-facilitating residue; other site
561275008024	intercalation triad [nucleotide binding]; other site
561275008025	8OG recognition residue [nucleotide binding]; other site
561275008026	putative reading head residues; other site
561275008027	Formamidopyrimidine-DNA glycosylase H2TH domain; Region: H2TH; pfam06831
561275008028	Zinc finger found in FPG and IleRS; Region: zf-FPG_IleRS; pfam06827
561275008029	ribonuclease III; Reviewed; Region: rnc; PRK00102
561275008030	RIBOc. Ribonuclease III C terminal domain. This group consists of eukaryotic, bacterial and archeal ribonuclease III (RNAse III) proteins. RNAse III is a double stranded RNA-specific endonuclease. Prokaryotic RNAse III is important in...; Region: RIBOc; cd00593
561275008031	dimerization interface [polypeptide binding]; other site
561275008032	active site
561275008033	metal binding site [ion binding]; metal-binding site
561275008034	Double-stranded RNA binding motif. Binding is not sequence specific but is highly specific for double stranded RNA. Found in a variety of proteins including dsRNA dependent protein kinase PKR, RNA helicases, Drosophila staufen protein, E. coli RNase III; Region: DSRM; cd00048
561275008035	dsRNA binding site [nucleotide binding]; other site
561275008036	Predicted metal-binding, possibly nucleic acid-binding protein [General function prediction only]; Region: COG1399
561275008037	Cell division initiation protein [Cell division and chromosome partitioning]; Region: DivIVA; COG3599
561275008038	The band 7 domain of flotillin (reggie) like proteins. This group contains proteins similar to stomatin, prohibitin, flotillin, HlfK/C and podicin.  Many of these band 7 domain-containing proteins are lipid raft-associated.  Individual proteins of this...; Region: Band_7; cl02525
561275008039	Predicted thioesterase involved in non-ribosomal peptide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: GrsT; COG3208
561275008040	acyl-CoA synthetase; Validated; Region: PRK05850
561275008041	Fatty acyl-AMP ligase (FAAL); Region: FAAL; cd05931
561275008042	acyl-activating enzyme (AAE) consensus motif; other site
561275008043	active site
561275008044	Phosphopantetheine attachment site; Region: PP-binding; pfam00550
561275008045	Polyketide synthase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3321
561275008046	polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833
561275008047	active site
561275008048	Acyl transferase domain; Region: Acyl_transf_1; pfam00698
561275008049	Dehydratase domain in polyketide synthase (PKS) enzymes; Region: PKS_DH; smart00826
561275008050	ketoreductase (KR) and fatty acid synthase (FAS), complex (x) SDRs; Region: KR_FAS_SDR_x; cd05274
561275008051	NADP binding site [chemical binding]; other site
561275008052	KR domain; Region: KR; pfam08659
561275008053	active site
561275008054	Phosphopantetheine attachment site; Region: PKS_PP; smart00823
561275008055	polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833
561275008056	Beta-ketoacyl synthase; Region: PKS_KS; smart00825
561275008057	active site
561275008058	malonyl CoA-acyl carrier protein transacylase; Region: fabD; TIGR00128
561275008059	Acyl transferase domain; Region: Acyl_transf_1; cl08282
561275008060	ketoreductase (KR) and fatty acid synthase (FAS), complex (x) SDRs; Region: KR_FAS_SDR_x; cd05274
561275008061	KR domain; Region: KR; pfam08659
561275008062	NADP binding site [chemical binding]; other site
561275008063	active site
561275008064	Phosphopantetheine attachment site; Region: PKS_PP; smart00823
561275008065	Polyketide synthase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3321
561275008066	polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833
561275008067	active site
561275008068	Acyl transferase domain; Region: Acyl_transf_1; cl08282
561275008069	Dehydratase domain in polyketide synthase (PKS) enzymes; Region: PKS_DH; smart00826
561275008070	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
561275008071	enoyl reductase of polyketide synthase; Region: enoyl_red; cd05195
561275008072	Enoylreductase; Region: PKS_ER; smart00829
561275008073	NAD(P) binding site [chemical binding]; other site
561275008074	beta-ketoacyl reductase (KR) domain of fatty acid synthase (FAS), subgroup 2, complex (x); Region: KR_2_FAS_SDR_x; cd08955
561275008075	KR domain; Region: KR; pfam08659
561275008076	putative NADP binding site [chemical binding]; other site
561275008077	active site
561275008078	Phosphopantetheine attachment site; Region: PKS_PP; smart00823
561275008079	Polyketide synthase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3321
561275008080	polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833
561275008081	active site
561275008082	Acyl transferase domain in polyketide synthase (PKS) enzymes; Region: PKS_AT; smart00827
561275008083	Dehydratase domain in polyketide synthase (PKS) enzymes; Region: PKS_DH; smart00826
561275008084	beta-ketoacyl reductase (KR) domain of fatty acid synthase (FAS), subgroup 2, complex (x); Region: KR_2_FAS_SDR_x; cd08955
561275008085	KR domain; Region: KR; pfam08659
561275008086	putative NADP binding site [chemical binding]; other site
561275008087	active site
561275008088	Phosphopantetheine attachment site; Region: PKS_PP; smart00823
561275008089	Polyketide synthase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3321
561275008090	polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833
561275008091	active site
561275008092	Acyl transferase domain in polyketide synthase (PKS) enzymes; Region: PKS_AT; smart00827
561275008093	Phosphopantetheine attachment site; Region: PP-binding; pfam00550
561275008094	Condensation domain; Region: Condensation; pfam00668
561275008095	non-ribosomal peptide synthase domain TIGR01720; Region: NRPS-para261
561275008096	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
561275008097	daunorubicin resistance ABC transporter ATP-binding subunit; Region: drrA; TIGR01188
561275008098	Walker A/P-loop; other site
561275008099	ATP binding site [chemical binding]; other site
561275008100	Q-loop/lid; other site
561275008101	ABC transporter signature motif; other site
561275008102	Walker B; other site
561275008103	D-loop; other site
561275008104	H-loop/switch region; other site
561275008105	ABC-type multidrug transport system, permease component [Defense mechanisms]; Region: COG0842
561275008106	ABC transporter efflux protein, DrrB family; Region: Mtu_efflux; TIGR00025
561275008107	ABC transporter efflux protein, DrrB family; Region: Mtu_efflux; TIGR00025
561275008108	ABC-type multidrug transport system, permease component [Defense mechanisms]; Region: COG0842
561275008109	acyltransferase PapA5; Provisional; Region: PRK09294
561275008110	Polyketide synthase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3321
561275008111	polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833
561275008112	active site
561275008113	Acyl transferase domain; Region: Acyl_transf_1; pfam00698
561275008114	Dehydratase domain in polyketide synthase (PKS) enzymes; Region: PKS_DH; smart00826
561275008115	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
561275008116	enoyl reductase of polyketide synthase; Region: enoyl_red; cd05195
561275008117	Enoylreductase; Region: PKS_ER; smart00829
561275008118	NAD(P) binding site [chemical binding]; other site
561275008119	beta-ketoacyl reductase (KR) domain of fatty acid synthase (FAS), subgroup 2, complex (x); Region: KR_2_FAS_SDR_x; cd08955
561275008120	KR domain; Region: KR; pfam08659
561275008121	putative NADP binding site [chemical binding]; other site
561275008122	active site
561275008123	Phosphopantetheine attachment site; Region: PKS_PP; smart00823
561275008124	acyl-CoA synthetase; Validated; Region: PRK05850
561275008125	Fatty acyl-AMP ligase (FAAL); Region: FAAL; cd05931
561275008126	acyl-activating enzyme (AAE) consensus motif; other site
561275008127	active site
561275008128	MMPL family; Region: MMPL; pfam03176
561275008129	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG4584
561275008130	Helix-turn-helix domain of Hin and related proteins, a family of DNA-binding domains unique to bacteria and represented by the Hin protein of Salmonella. The basic HTH domain is a simple fold comprised of three core helices that form a right-handed...; Region: HTH_Hin_like; cd00569
561275008131	Integrase core domain; Region: rve; pfam00665
561275008132	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cl17189
561275008133	Protein of unknown function (DUF1396); Region: DUF1396; pfam07161
561275008134	Erythronolide synthase docking; Region: Docking; pfam08990
561275008135	Polyketide synthase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3321
561275008136	polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833
561275008137	active site
561275008138	Acyl transferase domain in polyketide synthase (PKS) enzymes; Region: PKS_AT; smart00827
561275008139	Dehydratase domain in polyketide synthase (PKS) enzymes; Region: PKS_DH; smart00826
561275008140	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
561275008141	Enoylreductase; Region: PKS_ER; smart00829
561275008142	enoyl reductase of polyketide synthase; Region: enoyl_red; cd05195
561275008143	NAD(P) binding site [chemical binding]; other site
561275008144	beta-ketoacyl reductase (KR) domain of fatty acid synthase (FAS), subgroup 3, complex (x); Region: KR_3_FAS_SDR_x; cd08956
561275008145	This enzymatic domain is part of bacterial polyketide synthases; Region: PKS_KR; smart00822
561275008146	putative NADP binding site [chemical binding]; other site
561275008147	active site
561275008148	Phosphopantetheine attachment site; Region: PKS_PP; smart00823
561275008149	acyl-CoA synthetase; Validated; Region: PRK06060
561275008150	Benzoate CoA ligase (BCL) and similar adenylate forming enzymes; Region: BCL_like; cd05919
561275008151	dimer interface [polypeptide binding]; other site
561275008152	acyl-activating enzyme (AAE) consensus motif; other site
561275008153	putative active site [active]
561275008154	putative AMP binding site [chemical binding]; other site
561275008155	putative CoA binding site [chemical binding]; other site
561275008156	chemical substrate binding site [chemical binding]; other site
561275008157	Phosphopantetheine attachment site; Region: PKS_PP; smart00823
561275008158	4-hydroxybenzoate synthetase (chorismate lyase) [Coenzyme metabolism]; Region: UbiC; COG3161
561275008159	acyl-CoA synthetase; Validated; Region: PRK05850
561275008160	Fatty acyl-AMP ligase (FAAL); Region: FAAL; cd05931
561275008161	acyl-activating enzyme (AAE) consensus motif; other site
561275008162	active site
561275008163	Coenzyme F420-dependent N5,N10-methylene tetrahydromethanopterin reductase and related flavin-dependent oxidoreductases [Energy production and conversion]; Region: COG2141
561275008164	N5,N10-methylenetetrahydromethanopterin reductase (Mer) catalyzes the reduction of N5,N10-methylenetetrahydromethanopterin with reduced coenzyme F420 to N5-methyltetrahydromethanopterin and oxidized coenzyme F420; Region: Tetrahydromethanopterin_reductase; cd01097
561275008165	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275008166	S-adenosylmethionine binding site [chemical binding]; other site
561275008167	Uncharacterized conserved protein [Function unknown]; Region: COG3268
561275008168	Methyltransferase domain; Region: Methyltransf_23; pfam13489
561275008169	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275008170	S-adenosylmethionine binding site [chemical binding]; other site
561275008171	methyltransferase, FkbM family; Region: fkbM_fam; TIGR01444
561275008172	methyltransferase, FkbM family; Region: fkbM_fam; TIGR01444
561275008173	WfgS and WfeV are involved in O-antigen biosynthesis; Region: GT_2_WfgS_like; cd06433
561275008174	metal-binding site
561275008175	Glycosyl transferases, related to UDP-glucuronosyltransferase [Carbohydrate transport and metabolism / Signal transduction mechanisms]; Region: COG1819
561275008176	Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. The acceptor molecule can be a lipid, a protein, a heterocyclic compound, or another carbohydrate...; Region: Glycosyltransferase_GTB_type; cl10013
561275008177	Cephalosporin hydroxylase [Defense mechanisms]; Region: CmcI; COG3510
561275008178	Transposase and inactivated derivatives, IS5 family [DNA replication, recombination, and repair]; Region: COG3039
561275008179	Glycosyl transferases, related to UDP-glucuronosyltransferase [Carbohydrate transport and metabolism / Signal transduction mechanisms]; Region: COG1819
561275008180	This family includes the Gtfs, a group of homologous glycosyltransferases involved in the final stages of the biosynthesis of antibiotics vancomycin and related chloroeremomycin. Gtfs transfer sugar moieties from an activated NDP-sugar donor to the...; Region: GT1_Gtf_like; cd03784
561275008181	active site
561275008182	TDP-binding site; other site
561275008183	acceptor substrate-binding pocket; other site
561275008184	Predicted permease; Region: DUF318; pfam03773
561275008185	formyltetrahydrofolate deformylase; Region: PurU; TIGR00655
561275008186	N-terminal ACT domain of formyltetrahydrofolate deformylase (F4HF-DF; formyltetrahydrofolate hydrolase); Region: ACT_F4HF-DF; cd04875
561275008187	Formyltetrahydrofolate deformylase (Formyl-FH4 hydrolase), C-terminal hydrolase domain; Region: FMT_core_Formyl-FH4-Hydrolase_C; cd08648
561275008188	putative active site [active]
561275008189	putative substrate binding site [chemical binding]; other site
561275008190	putative cosubstrate binding site; other site
561275008191	catalytic site [active]
561275008192	phosphopantetheine adenylyltransferase; Provisional; Region: coaD; PRK00168
561275008193	Phosphopantetheine adenylyltransferase; Region: PPAT; cd02163
561275008194	active site
561275008195	(T/H)XGH motif; other site
561275008196	Conserved hypothetical protein 95; Region: Cons_hypoth95; pfam03602
561275008197	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275008198	S-adenosylmethionine binding site [chemical binding]; other site
561275008199	pyruvate carboxylase; Reviewed; Region: PRK12999
561275008200	Carbamoyl-phosphate synthase L chain, N-terminal domain; Region: CPSase_L_chain; pfam00289
561275008201	ATP-grasp domain; Region: ATP-grasp_4; cl17255
561275008202	Biotin carboxylase C-terminal domain; Region: Biotin_carb_C; smart00878
561275008203	Pyruvate carboxylase and Transcarboxylase 5S, carboxyltransferase domain; Region: DRE_TIM_PC_TC_5S; cd07937
561275008204	active site
561275008205	catalytic residues [active]
561275008206	metal binding site [ion binding]; metal-binding site
561275008207	homodimer binding site [polypeptide binding]; other site
561275008208	The biotinyl-domain or biotin carboxyl carrier protein (BCCP) domain is present in all biotin-dependent enzymes, such as acetyl-CoA carboxylase, pyruvate carboxylase, propionyl-CoA carboxylase, methylcrotonyl-CoA carboxylase, geranyl-CoA carboxylase; Region: biotinyl_domain; cd06850
561275008209	carboxyltransferase (CT) interaction site; other site
561275008210	biotinylation site [posttranslational modification]; other site
561275008211	Vitamin K epoxide reductase family in bacteria; Region: VKOR_5; cd12922
561275008212	putative active site [active]
561275008213	redox center [active]
561275008214	DSBA-like thioredoxin domain; Region: DSBA; pfam01323
561275008215	DsbA family; consists of DsbA and DsbA-like proteins, including DsbC, DsbG, glutathione (GSH) S-transferase kappa (GSTK), 2-hydroxychromene-2-carboxylate (HCCA) isomerase, an oxidoreductase (FrnE) presumed to be involved in frenolicin biosynthesis, a...; Region: DsbA_family; cd02972
561275008216	catalytic residues [active]
561275008217	Esterases and lipases (includes fungal lipases, cholinesterases, etc.)  These enzymes act on carboxylic esters (EC: 3.1.1.-). The catalytic apparatus involves three residues (catalytic triad): a serine, a glutamate or aspartate and a histidine.These...; Region: Esterase_lipase; cd00312
561275008218	alpha/beta hydrolase fold; Region: Abhydrolase_3; pfam07859
561275008219	substrate binding pocket [chemical binding]; other site
561275008220	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cl00470
561275008221	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660
561275008222	Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248
561275008223	active site
561275008224	catalytic tetrad [active]
561275008225	Protein of unknown function (DUF1524); Region: DUF1524; pfam07510
561275008226	RecG-like helicase [DNA replication, recombination, and repair / Transcription]; Region: RecG; COG1200
561275008227	RecG_wedge_OBF: A subfamily of OB folds corresponding to the OB fold found in the N-terminal (wedge) domain of Escherichia coli RecG. RecG is a branched-DNA-specific helicase, which catalyzes the interconversion of a DNA replication fork to a...; Region: RecG_wedge_OBF; cd04488
561275008228	generic binding surface II; other site
561275008229	ssDNA binding site; other site
561275008230	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
561275008231	ATP binding site [chemical binding]; other site
561275008232	putative Mg++ binding site [ion binding]; other site
561275008233	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
561275008234	nucleotide binding region [chemical binding]; other site
561275008235	ATP-binding site [chemical binding]; other site
561275008236	DAK2 domain fusion protein YloV; Region: YloV; TIGR03599
561275008237	DAK2 domain; Region: Dak2; cl03685
561275008238	Family 1 of Uracil-DNA glycosylase (UDG) enzymes; Region: UDG_F1; cd10027
561275008239	ligand binding site [chemical binding]; other site
561275008240	active site
561275008241	UGI interface [polypeptide binding]; other site
561275008242	catalytic site [active]
561275008243	thiamine monophosphate kinase; Provisional; Region: PRK05731
561275008244	ThiL (Thiamine-monophosphate kinase) plays a dual role in de novo biosynthesis and in salvage of exogenous thiamine. Thiamine salvage occurs in two steps, with thiamine kinase catalyzing the formation of thiamine phosphate, and ThiL catalyzing the...; Region: ThiL; cd02194
561275008245	ATP binding site [chemical binding]; other site
561275008246	dimerization interface [polypeptide binding]; other site
561275008247	Helix-turn-helix domain; Region: HTH_OrfB_IS605; pfam12323
561275008248	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG0675
561275008249	Probable transposase; Region: OrfB_IS605; pfam01385
561275008250	Predicted site-specific integrase-resolvase [DNA replication, recombination, and repair]; Region: COG2452
561275008251	Serine Recombinase (SR) family, IS607-like transposase subfamily, catalytic domain; members contain a DNA binding domain with homology to MerR/SoxR located N-terminal to the catalytic domain. Serine recombinases catalyze site-specific recombination of...; Region: SR_IS607_transposase_like; cd03769
561275008252	catalytic residues [active]
561275008253	catalytic nucleophile [active]
561275008254	Protein of unknown function (DUF3515); Region: DUF3515; pfam12028
561275008255	VNTR3336 is located between Rv2980 and Rv2981c. Differs from BCG Pasteur by a 59-bp in VNTR3336 locus of BCG Tokyo. The copy number of the 59-bp unit is 6 in BCG Tokyo and 9 in BCG Pasteur.
561275008256	D-alanyl-alanine synthetase A; Reviewed; Region: ddl; PRK01966
561275008257	D-ala D-ala ligase N-terminus; Region: Dala_Dala_lig_N; pfam01820
561275008258	D-ala D-ala ligase C-terminus; Region: Dala_Dala_lig_C; pfam07478
561275008259	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase; Validated; Region: gpsA; PRK00094
561275008260	NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus; Region: NAD_Gly3P_dh_N; pfam01210
561275008261	NAD-dependent glycerol-3-phosphate dehydrogenase C-terminus; Region: NAD_Gly3P_dh_C; pfam07479
561275008262	Predicted nucleotidyltransferase, CobY/MobA/RfbA family [General function prediction only]; Region: COG1920
561275008263	polyphosphate kinase; Provisional; Region: PRK05443
561275008264	Polyphosphate kinase N-terminal domain; Region: PP_kinase_N; pfam13089
561275008265	Polyphosphate kinase middle domain; Region: PP_kinase; pfam02503
561275008266	Catalytic C-terminal domain, first repeat, of Pseudomonas aeruginosa polyphosphate kinase 1 and similar proteins; Region: PLDc_PaPPK1_C1_like; cd09165
561275008267	putative domain interface [polypeptide binding]; other site
561275008268	putative active site [active]
561275008269	catalytic site [active]
561275008270	Catalytic C-terminal domain, second repeat, of Pseudomonas aeruginosa polyphosphate kinase 1 and similar proteins; Region: PLDc_PaPPK1_C2_like; cd09168
561275008271	putative domain interface [polypeptide binding]; other site
561275008272	putative active site [active]
561275008273	catalytic site [active]
561275008274	Diadenosine hexaphosphate (Ap6A) hydrolase is a member of the Nudix hydrolase superfamily. Ap6A hydrolase specifically hydrolyzes diadenosine polyphosphates, but not ATP or diadenosine triphosphate, and it generates ATP as the product. Ap6A, the most...; Region: Ap6A_hydrolase; cd03673
561275008275	active site
561275008276	Ap6A binding site [chemical binding]; other site
561275008277	nudix motif; other site
561275008278	metal binding site [ion binding]; metal-binding site
561275008279	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
561275008280	catalytic core [active]
561275008281	Integration host factor (IHF) and HU are small heterodimeric members of the DNABII protein family that bind and bend DNA, functioning as architectural factors in many cellular processes including transcription, site-specific recombination, and...; Region: HU_IHF; cd00591
561275008282	IHF - DNA interface [nucleotide binding]; other site
561275008283	IHF dimer interface [polypeptide binding]; other site
561275008284	isopropylmalate isomerase small subunit; Provisional; Region: leuD; PRK01641
561275008285	Aconatase-like swivel domain of 3-isopropylmalate dehydratase and related uncharacterized proteins. 3-isopropylmalate dehydratase catalyzes the isomerization between 2-isopropylmalate and 3-isopropylmalate, via the formation of 2-isopropylmaleate...; Region: IPMI_Swivel; cd01577
561275008286	substrate binding site [chemical binding]; other site
561275008287	3-isopropylmalate dehydratase large subunit; Reviewed; Region: PRK00402
561275008288	3-isopropylmalate dehydratase catalyzes the isomerization between 2-isopropylmalate and 3-isopropylmalate; Region: IPMI; cd01583
561275008289	substrate binding site [chemical binding]; other site
561275008290	ligand binding site [chemical binding]; other site
561275008291	helix_turn_helix isocitrate lyase regulation; Region: HTH_ICLR; smart00346
561275008292	Transcriptional regulator [Transcription]; Region: IclR; COG1414
561275008293	Bacterial transcriptional regulator; Region: IclR; pfam01614
561275008294	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275008295	S-adenosylmethionine binding site [chemical binding]; other site
561275008296	Uncharacterized stress protein (general stress protein 26) [General function prediction only]; Region: COG3871
561275008297	PPOX class probable F420-dependent enzyme; Region: Rv1155_F420; TIGR03618
561275008298	glutamyl-tRNA synthetase; Reviewed; Region: gltX; PRK01406
561275008299	nucleotidyl transferase superfamily; Region: nt_trans; cl00015
561275008300	active site
561275008301	HIGH motif; other site
561275008302	nucleotide binding site [chemical binding]; other site
561275008303	catalytic core domain of discriminating glutamyl-tRNA synthetase; Region: GluRS_core; cd00808
561275008304	active site
561275008305	KMSKS motif; other site
561275008306	2-keto-4-pentenoate hydratase/2-oxohepta-3-ene-1,7-dioic acid hydratase (catechol pathway) [Secondary metabolites biosynthesis, transport, and catabolism]; Region: MhpD; COG0179
561275008307	Domain of unknown function (DUF2437); Region: DUF2437; pfam10370
561275008308	Fumarylacetoacetate (FAA) hydrolase family; Region: FAA_hydrolase; pfam01557
561275008309	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
561275008310	Major Facilitator Superfamily; Region: MFS_1; pfam07690
561275008311	putative substrate translocation pore; other site
561275008312	3-isopropylmalate dehydrogenase; Provisional; Region: PRK03437
561275008313	D-3-phosphoglycerate dehydrogenase; Provisional; Region: PRK13581
561275008314	Phosphoglycerate dehydrogenases, NAD-binding and catalytic domains; Region: PGDH_4; cd12173
561275008315	ligand binding site [chemical binding]; other site
561275008316	NAD binding site [chemical binding]; other site
561275008317	dimerization interface [polypeptide binding]; other site
561275008318	catalytic site [active]
561275008319	C-terminal ACT (regulatory) domain of D-3-phosphoglycerate dehydrogenase (3PGDH); Region: ACT_3PGDH-xct; cd04902
561275008320	putative L-serine binding site [chemical binding]; other site
561275008321	Phytoene dehydrogenase and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG1233
561275008322	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
561275008323	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cl01054
561275008324	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cl00080
561275008325	phosphorylation site [posttranslational modification]
561275008326	Domain of Unknown Function (DUF1259); Region: DUF1529; pfam07485
561275008327	Domain of Unknown Function (DUF1259); Region: DUF1529; pfam07485
561275008328	ABC-type uncharacterized transport system, permease component [General function prediction only]; Region: COG0390
561275008329	ketol-acid reductoisomerase; Provisional; Region: PRK05479
561275008330	Acetohydroxy acid isomeroreductase, catalytic domain; Region: IlvN; pfam07991
561275008331	Acetohydroxy acid isomeroreductase, catalytic domain; Region: IlvC; pfam01450
561275008332	acetolactate synthase 3 regulatory subunit; Reviewed; Region: ilvH; PRK11895
561275008333	N-terminal ACT domain of the Escherichia coli IlvH-like regulatory subunit of acetohydroxyacid synthase (AHAS); Region: ACT_AHAS; cd04878
561275008334	putative valine binding site [chemical binding]; other site
561275008335	dimer interface [polypeptide binding]; other site
561275008336	Small subunit of acetolactate synthase; Region: ALS_ss_C; pfam10369
561275008337	acetolactate synthase 1 catalytic subunit; Validated; Region: PRK07789
561275008338	Pyrimidine (PYR) binding domain of POX and related proteins; Region: TPP_PYR_POX_like; cd07035
561275008339	PYR/PP interface [polypeptide binding]; other site
561275008340	dimer interface [polypeptide binding]; other site
561275008341	TPP binding site [chemical binding]; other site
561275008342	Thiamine pyrophosphate enzyme, central domain; Region: TPP_enzyme_M; pfam00205
561275008343	Thiamine pyrophosphate (TPP) family, Acetohydroxyacid synthase (AHAS) subfamily, TPP-binding module; composed of proteins similar to the large catalytic subunit of AHAS. AHAS catalyzes the condensation of two molecules of pyruvate to give the...; Region: TPP_AHAS; cd02015
561275008344	TPP-binding site [chemical binding]; other site
561275008345	dimer interface [polypeptide binding]; other site
561275008346	Protein of unknown function (DUF2581); Region: DUF2581; pfam10756
561275008347	Predicted membrane protein [Function unknown]; Region: COG2259
561275008348	Glucose/sorbosone dehydrogenases [Carbohydrate transport and metabolism]; Region: COG2133
561275008349	Conserved protein/domain typically associated with flavoprotein oxygenases, DIM6/NTAB family [General function prediction only]; Region: COG1853
561275008350	Uncharacterized membrane protein [Function unknown]; Region: SapB; COG1285
561275008351	aspartyl/glutamyl-tRNA amidotransferase subunit B; Validated; Region: gatB; PRK05477
561275008352	GatB/GatE catalytic domain; Region: GatB_N; pfam02934
561275008353	GatB domain; Region: GatB_Yqey; smart00845
561275008354	6-phosphofructokinase; Provisional; Region: PRK03202
561275008355	6-phosphofructokinase; Region: PFKA_ATP; TIGR02482
561275008356	active site
561275008357	ADP/pyrophosphate binding site [chemical binding]; other site
561275008358	dimerization interface [polypeptide binding]; other site
561275008359	allosteric effector site; other site
561275008360	fructose-1,6-bisphosphate binding site; other site
561275008361	Asp-tRNAAsn/Glu-tRNAGln amidotransferase A subunit and related amidases [Translation, ribosomal structure and biogenesis]; Region: GatA; COG0154
561275008362	aspartyl/glutamyl-tRNA amidotransferase subunit A; Reviewed; Region: gatA; PRK00012
561275008363	aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase, C subunit; Region: gatC; TIGR00135
561275008364	ACT_MalLac-Enz CD includes the N-terminal ACT domain of putative NAD-dependent malic enzyme 1, Bacillus subtilis YqkI and related domains; Region: ACT_MalLac-Enz; cd04887
561275008365	NAD-dependent DNA ligase LigA; Validated; Region: ligA; PRK07956
561275008366	NAD+ dependent DNA ligase adenylation domain. DNA ligases catalyze the crucial step of joining the breaks in duplex DNA during DNA replication, repair and recombination, utilizing either ATP or NAD(+) as a cofactor, but using the same basic reaction...; Region: LIGANc; cd00114
561275008367	nucleotide binding pocket [chemical binding]; other site
561275008368	K-X-D-G motif; other site
561275008369	catalytic site [active]
561275008370	NAD-dependent DNA ligase OB-fold domain; Region: DNA_ligase_OB; pfam03120
561275008371	NAD-dependent DNA ligase C4 zinc finger domain; Region: DNA_ligase_ZBD; pfam03119
561275008372	endonuclease III; includes endonuclease III (DNA-(apurinic or apyrimidinic site) lyase), alkylbase DNA glycosidases (Alka-family) and other DNA glycosidases; Region: ENDO3c; cl14786
561275008373	Breast Cancer Suppressor Protein (BRCA1), carboxy-terminal domain. The BRCT domain is found within many DNA damage repair and cell cycle checkpoint proteins. The unique diversity of this domain superfamily allows BRCT modules to interact forming homo...; Region: BRCT; cd00027
561275008374	Dimer interface [polypeptide binding]; other site
561275008375	CIMS - Cobalamine-independent methonine synthase, or MetE. Many members have been characterized as 5-methyltetrahydropteroyltriglutamate-homocysteine methyltransferases, EC:2.1.1.14, mostly from bacteria and plants. This enzyme catalyses the last step in...; Region: CIMS_like; cd03310
561275008376	PknH-like extracellular domain; Region: PknH_C; pfam14032
561275008377	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4842
561275008378	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275008379	PPE family; Region: PPE; pfam00823
561275008380	similar to PE family protein
561275008381	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4842
561275008382	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275008383	PPE family; Region: PPE; pfam00823
561275008384	Transposase, Mutator family; Region: Transposase_mut; pfam00872
561275008385	MULE transposase domain; Region: MULE; pfam10551
561275008386	tRNA methyl transferase; Region: tRNA_Me_trans; pfam03054
561275008387	tRNA methyl transferase. This family represents tRNA(5-methylaminomethyl-2-thiouridine)-methyltransferase which is involved in the biosynthesis of the modified nucleoside 5-methylaminomethyl-2-thiouridine present in the wobble position of some tRNAs; Region: tRNA_Me_trans; cd01998
561275008388	Ligand Binding Site [chemical binding]; other site
561275008389	Cysteine sulfinate desulfinase/cysteine desulfurase and related enzymes [Amino acid transport and metabolism]; Region: NifS; COG1104
561275008390	cysteine desulfurase NifS; Region: FeS_nifS; TIGR03402
561275008391	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
561275008392	catalytic residue [active]
561275008393	1-acyl-sn-glycerol-3-phosphate acyltransferase [Lipid metabolism]; Region: PlsC; COG0204
561275008394	Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: AGPAT-like; Region: LPLAT_AGPAT-like; cd07989
561275008395	putative acyl-acceptor binding pocket; other site
561275008396	Putative hemolysin [General function prediction only]; Region: COG3176
561275008397	Electron transfer flavoprotein, alpha subunit [Energy production and conversion]; Region: FixB; COG2025
561275008398	The electron transfer flavoprotein (ETF) serves as a specific electron acceptor for various mitochondrial dehydrogenases. ETF transfers electrons to the main respiratory chain via ETF-ubiquinone oxidoreductase. ETF is an heterodimer that consists of an...; Region: ETF_alpha; cd01715
561275008399	Electron transfer flavoprotein FAD-binding domain; Region: ETF_alpha; pfam00766
561275008400	The electron transfer flavoprotein (ETF) serves as a specific electron acceptor for various mitochondrial dehydrogenases. ETF transfers electrons to the main respiratory chain via ETF-ubiquinone oxidoreductase. ETF is an heterodimer that consists of an...; Region: ETF_beta; cd01714
561275008401	Ligand binding site [chemical binding]; other site
561275008402	Electron transfer flavoprotein domain; Region: ETF; pfam01012
561275008403	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275008404	S-adenosylmethionine binding site [chemical binding]; other site
561275008405	Uncharacterized conserved protein [Function unknown]; Region: COG1543
561275008406	Catalytic domain of glycoside hydrolase (GH) families 38 and 57, lactam utilization protein LamB/YcsF family proteins, YdjC-family proteins, and similar proteins; Region: GH38-57_N_LamB_YdjC_SF; cl17191
561275008407	Domain of unknown function (DUF1957); Region: DUF1957; pfam09210
561275008408	Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438
561275008409	This family is most closely related to the GT1 family of glycosyltransferases and named after YqgM in Bacillus licheniformis about which little is known. Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to...; Region: GT1_YqgM_like; cd03801
561275008410	Domain of unknown function (DUF4333); Region: DUF4333; pfam14230
561275008411	Domain of unknown function (DUF4333); Region: DUF4333; pfam14230
561275008412	Acetyltransferase (isoleucine patch superfamily) [General function prediction only]; Region: WbbJ; COG0110
561275008413	Maltose O-acyltransferase (MAT)-like: This family is composed of maltose O-acetyltransferase, galactoside O-acetyltransferase (GAT), xenobiotic acyltransferase (XAT) and similar proteins. MAT and GAT catalyze the CoA-dependent acetylation of the...; Region: LbH_MAT_like; cd04647
561275008414	trimer interface [polypeptide binding]; other site
561275008415	active site
561275008416	substrate binding site [chemical binding]; other site
561275008417	CoA binding site [chemical binding]; other site
561275008418	FOG: WD40-like repeat [Function unknown]; Region: COG1520
561275008419	Protein of unknown function (DUF3298); Region: DUF3298; pfam11738
561275008420	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
561275008421	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275008422	S-adenosylmethionine binding site [chemical binding]; other site
561275008423	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
561275008424	Enoyl-CoA hydratase/carnithine racemase [Lipid metabolism]; Region: CaiD; COG1024
561275008425	substrate binding site [chemical binding]; other site
561275008426	oxyanion hole (OAH) forming residues; other site
561275008427	trimer interface [polypeptide binding]; other site
561275008428	ABC-type molybdenum transport system, ATPase component/photorepair protein PhrA [Inorganic ion transport and metabolism]; Region: ModF; COG1119
561275008429	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
561275008430	Walker A/P-loop; other site
561275008431	ATP binding site [chemical binding]; other site
561275008432	Q-loop/lid; other site
561275008433	ABC transporter signature motif; other site
561275008434	Walker B; other site
561275008435	D-loop; other site
561275008436	H-loop/switch region; other site
561275008437	CT domains found N-terminal of phosphoserine phosphatase (PSP, SerB); Region: ACT_PSP_1; cd04870
561275008438	ACT domains found N-terminal of phosphoserine phosphatase (PSP, SerB); Region: ACT_PSP_2; cd04871
561275008439	Phosphoserine phosphatase [Amino acid transport and metabolism]; Region: SerB; COG0560
561275008440	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
561275008441	motif II; other site
561275008442	Heme/copper-type cytochrome/quinol oxidases, subunit 1 [Energy production and conversion]; Region: CyoB; COG0843
561275008443	Ubiquinol oxidase subunit I.  Ubiquinol oxidase, the terminal oxidase in the respiratory chains of aerobic bacteria, is a multi-chain transmembrane protein located in the cell membrane.  It catalyzes the reduction of O2 and simultaneously pumps protons...; Region: Ubiquinol_Oxidase_I; cd01662
561275008444	D-pathway; other site
561275008445	Putative ubiquinol binding site [chemical binding]; other site
561275008446	Low-spin heme (heme b) binding site [chemical binding]; other site
561275008447	Putative water exit pathway; other site
561275008448	Binuclear center (heme o3/CuB) [ion binding]; other site
561275008449	K-pathway; other site
561275008450	Putative proton exit pathway; other site
561275008451	Fe3+-siderophore binding domain FhuD.  These proteins have been shown to function as initial receptors in ABC transport of Fe3+-siderophores in many eubacterial species. They belong to the TroA-like superfamily of helical backbone metal receptor proteins...; Region: FhuD; cd01146
561275008452	Periplasmic binding protein; Region: Peripla_BP_2; pfam01497
561275008453	siderophore binding site; other site
561275008454	Zn-dependent alcohol dehydrogenases [General function prediction only]; Region: AdhP; COG1064
561275008455	Cinnamyl alcohol dehydrogenases (CAD); Region: CAD1; cd05283
561275008456	putative NAD(P) binding site [chemical binding]; other site
561275008457	putative substrate binding site [chemical binding]; other site
561275008458	catalytic Zn binding site [ion binding]; other site
561275008459	structural Zn binding site [ion binding]; other site
561275008460	dimer interface [polypeptide binding]; other site
561275008461	Protein of unknown function (DUF3349); Region: DUF3349; pfam11829
561275008462	ribonucleotide-diphosphate reductase subunit beta; Provisional; Region: nrdF2; PRK13966
561275008463	Ribonucleotide Reductase, R2/beta subunit, ferritin-like diiron-binding domain; Region: RNRR2; cd01049
561275008464	dimer interface [polypeptide binding]; other site
561275008465	putative radical transfer pathway; other site
561275008466	diiron center [ion binding]; other site
561275008467	tyrosyl radical; other site
561275008468	Predicted flavoprotein involved in K+ transport [Inorganic ion transport and metabolism]; Region: TrkA; COG2072
561275008469	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox_3; pfam13738
561275008470	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275008471	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275008472	ribonucleotide-diphosphate reductase subunit alpha; Validated; Region: PRK08188
561275008473	Ribonucleotide reductase N-terminal; Region: RNR_N; pfam08343
561275008474	Class I ribonucleotide reductase; Region: RNR_I; cd01679
561275008475	active site
561275008476	dimer interface [polypeptide binding]; other site
561275008477	catalytic residues [active]
561275008478	effector binding site; other site
561275008479	R2 peptide binding site; other site
561275008480	ribonucleotide reductase stimulatory protein; Reviewed; Region: nrdI; PRK03600
561275008481	NrdH-redoxin (NrdH) family; NrdH is a small monomeric protein with a conserved redox active CXXC motif within a TRX fold, characterized by a glutaredoxin (GRX)-like sequence and TRX-like activity profile. In vitro, it displays protein disulfide reductase...; Region: NrdH; cd02976
561275008482	catalytic residues [active]
561275008483	NADPH-dependent FMN reductase; Region: FMN_red; pfam03358
561275008484	Predicted flavoprotein [General function prediction only]; Region: COG0431
561275008485	DNA polymerase IV; Validated; Region: PRK03352
561275008486	DNA Polymerase IV/Kappa; Region: PolY_Pol_IV_kappa; cd03586
561275008487	active site
561275008488	DNA binding site [nucleotide binding]
561275008489	short chain dehydrogenase; Provisional; Region: PRK07832
561275008490	classical (c) SDRs; Region: SDR_c; cd05233
561275008491	NAD(P) binding site [chemical binding]; other site
561275008492	active site
561275008493	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275008494	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275008495	Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124
561275008496	Cytochrome P450; Region: p450; cl12078
561275008497	Transcriptional regulators [Transcription]; Region: FadR; COG2186
561275008498	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
561275008499	DNA-binding site [nucleotide binding]; DNA binding site
561275008500	This entry represents the C-terminal ligand binding domain of many members of the GntR family; Region: FCD; smart00895
561275008501	Transcriptional regulators [Transcription]; Region: FadR; COG2186
561275008502	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
561275008503	DNA-binding site [nucleotide binding]; DNA binding site
561275008504	FCD domain; Region: FCD; pfam07729
561275008505	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275008506	Acyl-CoA dehydrogenase, N-terminal domain; Region: Acyl-CoA_dh_N; pfam02771
561275008507	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
561275008508	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275008509	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275008510	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
561275008511	active site
561275008512	ATP-dependent DNA ligase; Reviewed; Region: ligB; PRK03180
561275008513	Adenylation domain of archaeal and bacterial LigB-like DNA ligases; Region: Adenylation_DNA_ligase_Arch_LigB; cd07901
561275008514	active site
561275008515	DNA binding site [nucleotide binding]
561275008516	The Oligonucleotide/oligosaccharide binding (OB)-fold domain of archaeal and bacterial ATP-dependent DNA ligases is a DNA-binding module that is part of the catalytic core unit; Region: OBF_DNA_ligase_Arch_LigB; cd07972
561275008517	DNA binding site [nucleotide binding]
561275008518	Carbon starvation protein, predicted membrane protein [Signal transduction mechanisms]; Region: CstA; COG1966
561275008519	Carbon starvation protein CstA; Region: CstA; pfam02554
561275008520	C-terminal domain on CstA (DUF4161); Region: DUF4161; pfam13722
561275008521	Predicted membrane protein [Function unknown]; Region: COG2259
561275008522	Small Multidrug Resistance protein; Region: Multi_Drug_Res; pfam00893
561275008523	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3226
561275008524	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275008525	Protein of unknown function (DUF732); Region: DUF732; pfam05305
561275008526	phosphoglucomutase, alpha-D-glucose phosphate-specific; Region: pgm; TIGR01132
561275008527	This bacterial PGM-like (phosphoglucomutase-like) protein of unknown function belongs to the alpha-D-phosphohexomutase superfamily. The alpha-D-phosphohexomutases include several related enzymes that catalyze a reversible intramolecular phosphoryl...; Region: PGM_like3; cd05801
561275008528	active site
561275008529	substrate binding site [chemical binding]; other site
561275008530	metal binding site [ion binding]; metal-binding site
561275008531	camphor resistance protein CrcB; Provisional; Region: PRK14216
561275008532	camphor resistance protein CrcB; Provisional; Region: PRK14228
561275008533	Uncharacterized ACR, COG1993; Region: DUF190; cl00872
561275008534	Uncharacterized ACR, COG1993; Region: DUF190; cl00872
561275008535	Uncharacterized ACR, COG1993; Region: DUF190; pfam02641
561275008536	Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cl07892
561275008537	Uncharacterized conserved protein [Function unknown]; Region: COG3189
561275008538	Domain of unknown function (DUF222); Region: DUF222; pfam02720
561275008539	HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085
561275008540	active site
561275008541	Citrate lyase beta subunit [Carbohydrate transport and metabolism]; Region: CitE; COG2301
561275008542	Pyrabactin resistance 1 (PYR1), PYR1-like (PYL), regulatory component of abscisic acid receptors (RCARs), and related proteins; Region: PYR_PYL_RCAR_like; cd07821
561275008543	putative hydrophobic ligand binding site [chemical binding]; other site
561275008544	protein interface [polypeptide binding]; other site
561275008545	gate; other site
561275008546	Arylsulfatase A and related enzymes [Inorganic ion transport and metabolism]; Region: AslA; COG3119
561275008547	Sulfatase; Region: Sulfatase; pfam00884
561275008548	probable F420-dependent oxidoreductase, Rv2161c family; Region: F420_Rv2161c; TIGR03619
561275008549	Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cl07892
561275008550	Serine/Threonine protein kinases, catalytic domain; Region: S_TKc; smart00220
561275008551	Catalytic domain of Protein Kinases; Region: PKc; cd00180
561275008552	active site
561275008553	ATP binding site [chemical binding]; other site
561275008554	substrate binding site [chemical binding]; other site
561275008555	activation loop (A-loop); other site
561275008556	ATP-dependent transcriptional regulator [Transcription]; Region: MalT; COG2909
561275008557	AAA ATPase domain; Region: AAA_16; pfam13191
561275008558	Nucleotidyl transferase of unknown function (DUF2204); Region: DUF2204; pfam09970
561275008559	Arabinose-binding domain of AraC transcription regulator, N-term; Region: Arabinose_bd; pfam12625
561275008560	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
561275008561	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
561275008562	Predicted flavoprotein involved in K+ transport [Inorganic ion transport and metabolism]; Region: TrkA; COG2072
561275008563	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox_3; pfam13738
561275008564	Esterase/lipase [Lipid metabolism]; Region: Aes; COG0657
561275008565	short chain dehydrogenase; Provisional; Region: PRK07832
561275008566	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
561275008567	NAD(P) binding site [chemical binding]; other site
561275008568	active site
561275008569	oxidoreductase, Rxyl_3153 family; Region: Rxyl_3153; TIGR03989
561275008570	Class III alcohol dehydrogenase; Region: Zn_ADH_class_III; cd08279
561275008571	NAD binding site [chemical binding]; other site
561275008572	catalytic Zn binding site [ion binding]; other site
561275008573	substrate binding site [chemical binding]; other site
561275008574	structural Zn binding site [ion binding]; other site
561275008575	acyltransferase, WS/DGAT/MGAT; Region: acyl_WS_DGAT; TIGR02946
561275008576	Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007
561275008577	acyltransferase, WS/DGAT/MGAT; Region: acyl_WS_DGAT; TIGR02946
561275008578	Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007
561275008579	Protein of unknown function (DUF1298); Region: DUF1298; pfam06974
561275008580	long-chain-fatty-acid--CoA ligase; Validated; Region: PRK06187
561275008581	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
561275008582	acyl-activating enzyme (AAE) consensus motif; other site
561275008583	AMP binding site [chemical binding]; other site
561275008584	active site
561275008585	CoA binding site [chemical binding]; other site
561275008586	SPFH domain / Band 7 family; Region: Band_7; pfam01145
561275008587	Membrane protease subunits, stomatin/prohibitin homologs [Posttranslational modification, protein turnover, chaperones]; Region: HflC; COG0330
561275008588	Patatin-like phospholipase; Region: Patatin; pfam01734
561275008589	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2354
561275008590	probable F420-dependent oxidoreductase, Rv3093c family; Region: F420_Rv3093c; TIGR03841
561275008591	N5,N10-methylenetetrahydromethanopterin reductase (Mer) catalyzes the reduction of N5,N10-methylenetetrahydromethanopterin with reduced coenzyme F420 to N5-methyltetrahydromethanopterin and oxidized coenzyme F420; Region: Tetrahydromethanopterin_reductase; cd01097
561275008592	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275008593	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
561275008594	active site
561275008595	Predicted transcriptional regulators [Transcription]; Region: COG1733
561275008596	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
561275008597	dimerization interface [polypeptide binding]; other site
561275008598	putative DNA binding site [nucleotide binding]; other site
561275008599	putative Zn2+ binding site [ion binding]; other site
561275008600	Sugar-binding cellulase-like; Region: Cellulase-like; pfam12876
561275008601	PE family; Region: PE; pfam00934
561275008602	alpha/beta hydrolase fold; Region: Abhydrolase_3; pfam07859
561275008603	Protein of unknown function (DUF2424); Region: DUF2424; pfam10340
561275008604	uncharacterized Actinobacterial protein TIGR03083; Region: TIGR03083
561275008605	Mycothiol maleylpyruvate isomerase N-terminal domain; Region: MDMPI_N; pfam11716
561275008606	Medium chain reductase/dehydrogenase (MDR)/zinc-dependent alcohol dehydrogenase-like family; Region: MDR; cl16912
561275008607	Small protein B (SmpB) is a component of the trans-translation system in prokaryotes for releasing stalled ribosome from damaged messenger RNAs; Region: SmpB; cd09294
561275008608	SmpB-tmRNA interface; other site
561275008609	Cell division protein [Cell division and chromosome partitioning]; Region: FtsX; COG2177
561275008610	FtsX-like permease family; Region: FtsX; pfam02687
561275008611	Predicted ATPase involved in cell division [Cell division and chromosome partitioning]; Region: FtsE; COG2884
561275008612	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
561275008613	Walker A/P-loop; other site
561275008614	ATP binding site [chemical binding]; other site
561275008615	Q-loop/lid; other site
561275008616	ABC transporter signature motif; other site
561275008617	Walker B; other site
561275008618	D-loop; other site
561275008619	H-loop/switch region; other site
561275008620	Mechanosensitive ion channel; Region: MS_channel; pfam00924
561275008621	Small-conductance mechanosensitive channel [Cell envelope biogenesis, outer membrane]; Region: MscS; COG0668
561275008622	peptide chain release factor 2; Validated; Region: prfB; PRK00578
561275008623	This domain is found in peptide chain release factors; Region: PCRF; smart00937
561275008624	RF-1 domain; Region: RF-1; pfam00472
561275008625	ferredoxin-NADP+ reductase; Region: PLN02852
561275008626	FAD/FMN-containing dehydrogenases [Energy production and conversion]; Region: GlcD; COG0277
561275008627	FAD binding domain; Region: FAD_binding_4; pfam01565
561275008628	Molybdenum cofactor biosynthesis enzyme [Coenzyme metabolism]; Region: MoaA; COG2896
561275008629	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
561275008630	FeS/SAM binding site; other site
561275008631	Molybdenum Cofactor Synthesis C; Region: Mob_synth_C; pfam06463
561275008632	PCD_DCoH: The bifunctional protein pterin-4alpha-carbinolamine dehydratase (PCD), also known as DCoH  (dimerization cofactor of hepatocyte nuclear factor-1), is both a transcription activator and a metabolic enzyme.  DCoH stimulates gene expression by...; Region: PCD_DCoH; cd00488
561275008633	aromatic arch; other site
561275008634	DCoH dimer interaction site [polypeptide binding]; other site
561275008635	DCoH /HNF-1 dimer interaction site [polypeptide binding]; other site
561275008636	DCoH tetramer interaction site [polypeptide binding]; other site
561275008637	substrate binding site [chemical binding]; other site
561275008638	MoaC family, prokaryotic and eukaryotic. Members of this family are involved in molybdenum cofactor (Moco) biosynthesis, an essential cofactor of a diverse group of redox enzymes. MoaC, a small hexameric protein, converts, together with MoaA, a guanosine...; Region: MoaC_PE; cd01420
561275008639	trimer interface [polypeptide binding]; other site
561275008640	dimer interface [polypeptide binding]; other site
561275008641	putative active site [active]
561275008642	Ubiquitin domain of MoaD-like proteins; Region: MoaD; cd00754
561275008643	MoaE interaction surface [polypeptide binding]; other site
561275008644	MoeB interaction surface [polypeptide binding]; other site
561275008645	thiocarboxylated glycine; other site
561275008646	Predicted phosphatases [General function prediction only]; Region: Gph; COG0546
561275008647	HAD-hyrolase-like; Region: Hydrolase_like; pfam13242
561275008648	Nucleoside deaminases include adenosine, guanine and cytosine deaminases. These enzymes are Zn dependent and catalyze the deamination of nucleosides. The zinc ion in the active site plays a central role in the proposed catalytic mechanism, activating a...; Region: nucleoside_deaminase; cd01285
561275008649	nucleoside/Zn binding site; other site
561275008650	dimer interface [polypeptide binding]; other site
561275008651	catalytic motif [active]
561275008652	Transposase, Mutator family; Region: Transposase_mut; pfam00872
561275008653	MULE transposase domain; Region: MULE; pfam10551
561275008654	molybdopterin biosynthesis-like protein MoeZ; Validated; Region: PRK07878
561275008655	ThiF_MoeB_HesA. Family of E1-like enzymes involved in molybdopterin and thiamine biosynthesis family. The common reaction mechanism catalyzed by MoeB and ThiF, like other E1 enzymes, begins with a nucleophilic attack of the C-terminal carboxylate of MoaD...; Region: ThiF_MoeB_HesA_family; cd00757
561275008656	ATP binding site [chemical binding]; other site
561275008657	substrate interface [chemical binding]; other site
561275008658	Rhodanese Homology Domain (RHOD); an alpha beta fold domain found duplicated in the rhodanese protein. The cysteine containing enzymatically active version of the domain is also found in the Cdc25 class of protein phosphatases and a variety of proteins...; Region: RHOD; cd00158
561275008659	active site residue [active]
561275008660	Rhodanese-related sulfurtransferase [Inorganic ion transport and metabolism]; Region: SseA; COG2897
561275008661	Thiosulfate sulfurtransferase (TST), N-terminal, inactive domain. TST contains 2 copies of the Rhodanese Homology Domain; this is the 1st repeat, which does not contain the catalytically active Cys residue. The role of the 1st repeat is uncertain, but it...; Region: TST_Repeat_1; cd01448
561275008662	active site residue [active]
561275008663	Thiosulfate sulfurtransferase (TST), C-terminal, catalytic domain. TST contains 2 copies of the Rhodanese Homology Domain; this is the second repeat. Only the second repeat contains the catalytically active Cys residue; Region: TST_Repeat_2; cd01449
561275008664	active site residue [active]
561275008665	RD12, 2775 bp. Region of difference RD12, deleted region in Mycobacterium bovis BCG Pasteur (position 3439226..3439227), BCG Tokyo (position 3431876..3431877) and Mycobacterium bovis AF2122/97 (position 3441287..3441288) compared to Mycobacterium tuberculosis H37Rv2 (position: 3484741..3487515). Removes genes Rv3118-Rv3120 and merges truncated genes Rv3117 and Rv3121
561275008666	DNA-binding transcriptional activator of the SARP family [Signal transduction mechanisms]; Region: DnrI; COG3629
561275008667	Transcriptional regulatory protein, C terminal; Region: Trans_reg_C; pfam00486
561275008668	DNA binding site [nucleotide binding]
561275008669	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275008670	PPE family; Region: PPE; pfam00823
561275008671	Proteins of this family catalyze the reduction of flavin or nitrocompounds using NAD(P)H as electron donor in a obligatory two-electron transfer,  utilizing FMN or FAD as cofactor. They are often found to be homodimers. Enzymes of this family are...; Region: Nitro_FMN_reductase; cl00514
561275008672	Integrase core domain; Region: rve; cl01316
561275008673	Pyridoxamine 5'-phosphate oxidase; Region: Pyridox_ox_2; pfam12900
561275008674	acyltransferase, WS/DGAT/MGAT; Region: acyl_WS_DGAT; TIGR02946
561275008675	Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007
561275008676	Proteins of this family catalyze the reduction of flavin or nitrocompounds using NAD(P)H as electron donor in a obligatory two-electron transfer,  utilizing FMN or FAD as cofactor. They are often found to be homodimers. Enzymes of this family are...; Region: Nitro_FMN_reductase; cl00514
561275008677	dimer interface [polypeptide binding]; other site
561275008678	Proteins of this family catalyze the reduction of flavin or nitrocompounds using NAD(P)H as electron donor in a obligatory two-electron transfer,  utilizing FMN or FAD as cofactor. They are often found to be homodimers. Enzymes of this family are...; Region: Nitro_FMN_reductase; cl00514
561275008679	FOG: GAF domain [Signal transduction mechanisms]; Region: FhlA; COG2203
561275008680	Domain present in phytochromes and cGMP-specific phosphodiesterases; Region: GAF; smart00065
561275008681	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: COG4585
561275008682	Histidine kinase; Region: HisKA_3; pfam07730
561275008683	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
561275008684	ATP binding site [chemical binding]; other site
561275008685	Mg2+ binding site [ion binding]; other site
561275008686	G-X-G motif; other site
561275008687	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
561275008688	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
561275008689	active site
561275008690	phosphorylation site [posttranslational modification]
561275008691	intermolecular recognition site; other site
561275008692	dimerization interface [polypeptide binding]; other site
561275008693	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
561275008694	DNA binding residues [nucleotide binding]
561275008695	dimerization interface [polypeptide binding]; other site
561275008696	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
561275008697	Ligand Binding Site [chemical binding]; other site
561275008698	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275008699	PPE family; Region: PPE; pfam00823
561275008700	Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484
561275008701	I-RD08, 1337 bp. Region of difference I-RD08, inserted region in Mycobacterium bovis BCG Pasteur (position 3453376..3454712, 1337bp), BCG Tokyo (position 3446026..3447362, 1337bp) and Mycobacterium bovis AF2122/97 (position 3455438..3456774, 1337bp) compared to Mycobacterium tuberculosis H37Rv (position: 3501665..3501666). Leads to a longer PPE50 gene
561275008702	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275008703	PPE family; Region: PPE; pfam00823
561275008704	Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484
561275008705	Archaeal fructose-1,6-bisphosphatase and related enzymes of inositol monophosphatase family [Carbohydrate transport and metabolism]; Region: SuhB; COG0483
561275008706	Predominantly bacterial family of Mg++ dependend phosphatases, related to inositol monophosphatases. These enzymes may dephosphorylate fructose-1,6-bisphosphate, inositol monophospate, 3'-phosphoadenosine-5'-phosphate,  or similar substrates; Region: Bacterial_IMPase_like_1; cd01641
561275008707	active site
561275008708	AmmeMemoRadiSam system radical SAM enzyme; Region: AmmeMemoSam_rS; TIGR04337
561275008709	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
561275008710	FeS/SAM binding site; other site
561275008711	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275008712	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
561275008713	active site
561275008714	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275008715	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
561275008716	active site
561275008717	NADPH:quinone reductase and related Zn-dependent oxidoreductases [Energy production and conversion / General function prediction only]; Region: Qor; COG0604
561275008718	Quinone oxidoreductase (QOR); Region: QOR1; cd08241
561275008719	NAD(P) binding site [chemical binding]; other site
561275008720	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
561275008721	active site
561275008722	phosphorylation site [posttranslational modification]
561275008723	intermolecular recognition site; other site
561275008724	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275008725	PPE family; Region: PPE; pfam00823
561275008726	NADH dehydrogenase subunit A; Validated; Region: PRK07928
561275008727	NADH dehydrogenase subunit B; Validated; Region: PRK06411
561275008728	NADH dehydrogenase subunit C; Provisional; Region: PRK07785
561275008729	NADH (or F420H2) dehydrogenase, subunit C; Region: NuoC_fam; TIGR01961
561275008730	NADH dehydrogenase I, D subunit; Region: NuoD; TIGR01962
561275008731	NADH dehydrogenase subunit D; Validated; Region: PRK06075
561275008732	NADH dehydrogenase subunit E; Validated; Region: PRK07539
561275008733	TRX-like [2Fe-2S] Ferredoxin (Fd) family, NADH:ubiquinone oxidoreductase (Nuo) subunit E subfamily; Nuo, also called respiratory chain Complex 1, is the entry point for electrons into the respiratory chains of bacteria and the mitochondria of eukaryotes; Region: TRX_Fd_NuoE; cd03064
561275008734	putative dimer interface [polypeptide binding]; other site
561275008735	[2Fe-2S] cluster binding site [ion binding]; other site
561275008736	NADH-quinone oxidoreductase, F subunit; Region: nuoF_fam; TIGR01959
561275008737	SLBB domain; Region: SLBB; pfam10531
561275008738	NADH-ubiquinone oxidoreductase-F iron-sulfur binding region; Region: NADH_4Fe-4S; pfam10589
561275008739	NADH dehydrogenase subunit G; Validated; Region: PRK07860
561275008740	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
561275008741	catalytic loop [active]
561275008742	iron binding site [ion binding]; other site
561275008743	NADH-ubiquinone oxidoreductase-G iron-sulfur binding region; Region: NADH-G_4Fe-4S_3; pfam10588
561275008744	MopB_NDH-1_NuoG2-N7: The second domain of the NuoG subunit (with a [4Fe-4S] cluster, N7) of the NADH-quinone oxidoreductase/NADH dehydrogenase-1 (NDH-1) found in various bacteria. The NDH-1 is the first energy-transducting complex in the respiratory...; Region: MopB_NDH-1_NuoG2-N7; cd02771
561275008745	[4Fe-4S] binding site [ion binding]; other site
561275008746	MopB_CT_NDH-1_NuoG2-N7: C-terminal region of the NuoG-like subunit (of the variant with a [4Fe-4S] cluster, N7) of the NADH-quinone oxidoreductase/NADH dehydrogenase-1 (NDH-1) found in various bacteria. The NDH-1 is the first energy-transducting complex...; Region: MopB_CT_NDH-1_NuoG2-N7; cd02788
561275008747	NADH:ubiquinone oxidoreductase subunit H; Provisional; Region: PRK06076
561275008748	Formate hydrogenlyase subunit 4 [Energy production and conversion]; Region: HyfC; COG0650
561275008749	NADH dehydrogenase subunit I; Provisional; Region: PRK05888
561275008750	4Fe-4S binding domain; Region: Fer4; pfam00037
561275008751	4Fe-4S binding domain; Region: Fer4; pfam00037
561275008752	NADH:ubiquinone oxidoreductase subunit J; Provisional; Region: PRK06638
561275008753	NADH:ubiquinone oxidoreductase subunit K; Validated; Region: PRK05715
561275008754	NADH:ubiquinone oxidoreductase subunit L; Reviewed; Region: PRK06590
561275008755	NADH-Ubiquinone oxidoreductase (complex I), chain 5 N-terminus; Region: Oxidored_q1_N; pfam00662
561275008756	NADH-Ubiquinone/plastoquinone (complex I), various chains; Region: Oxidored_q1; pfam00361
561275008757	NADH:ubiquinone oxidoreductase subunit M; Reviewed; Region: PRK05846
561275008758	NADH-Ubiquinone/plastoquinone (complex I), various chains; Region: Oxidored_q1; pfam00361
561275008759	NADH:ubiquinone oxidoreductase subunit N; Provisional; Region: PRK05777
561275008760	NADH-Ubiquinone/plastoquinone (complex I), various chains; Region: Oxidored_q1; pfam00361
561275008761	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275008762	PPE family; Region: PPE; pfam00823
561275008763	I-RD09, 2146 bp. Region of difference I-RD09, inserted region in Mycobacterium bovis BCG Pasteur (position 3481722..3483867, 2146bp), BCG Tokyo (position 3474372..3476517, 2146bp) and Mycobacterium bovis AF2122/97 (position 3483784..3485929, 2146bp) compared to Mycobacterium tuberculosis H37Rv2 (position: 3528674..3528675). Leads to an additional gene, PPE70
561275008764	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275008765	PPE family; Region: PPE; pfam00823
561275008766	pyrimidine utilization regulatory protein R; Region: RutR; TIGR03613
561275008767	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275008768	Phenylpropionate dioxygenase and related ring-hydroxylating dioxygenases, large terminal subunit [Inorganic ion transport and metabolism / General function prediction only]; Region: HcaE; COG4638
561275008769	Rieske non-heme iron oxygenase (RO) family, N-terminal Rieske domain of the oxygenase alpha subunit; The RO family comprise a large class of aromatic ring-hydroxylating dioxygenases found predominantly in microorganisms. These enzymes enable...; Region: Rieske_RO_Alpha_N; cd03469
561275008770	[2Fe-2S] cluster binding site [ion binding]; other site
561275008771	C-terminal catalytic domain of the oxygenase alpha subunit of an uncharacterized subgroup of Rieske-type non-heme iron aromatic ring-hydroxylating oxygenases; Region: RHO_alpha_C_1; cd08885
561275008772	putative alpha subunit interface [polypeptide binding]; other site
561275008773	putative active site [active]
561275008774	putative substrate binding site [chemical binding]; other site
561275008775	Fe binding site [ion binding]; other site
561275008776	Uncharacterized conserved protein (some members contain a von Willebrand factor type A (vWA) domain) [General function prediction only]; Region: COG1721
561275008777	Protein of unknown function DUF58; Region: DUF58; pfam01882
561275008778	MoxR-like ATPases [General function prediction only]; Region: COG0714
561275008779	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
561275008780	Walker A motif; other site
561275008781	ATP binding site [chemical binding]; other site
561275008782	Walker B motif; other site
561275008783	arginine finger; other site
561275008784	Domain of unknown function (DUF4129); Region: DUF4129; pfam13559
561275008785	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275008786	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275008787	Acyl-CoA dehydrogenase (ACAD) 10 and 11, N-terminal domain, and similar proteins. This subfamily is part of a larger superfamily that includes the catalytic domains of other kinases, such as the typical serine/threonine/tyrosine protein kinases (PKs); Region: ACAD10_11_like; cd05154
561275008788	putative active site [active]
561275008789	putative substrate binding site [chemical binding]; other site
561275008790	ATP binding site [chemical binding]; other site
561275008791	Phosphotransferase enzyme family; Region: APH; pfam01636
561275008792	Monoamine oxidase [Amino acid transport and metabolism]; Region: COG1231
561275008793	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
561275008794	hydroxyglutarate oxidase; Provisional; Region: PRK11728
561275008795	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
561275008796	Putative lysophospholipase; Region: Hydrolase_4; pfam12146
561275008797	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275008798	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275008799	short chain dehydrogenase; Validated; Region: PRK08264
561275008800	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
561275008801	NAD(P) binding site [chemical binding]; other site
561275008802	active site
561275008803	amidase; Provisional; Region: PRK06170
561275008804	Amidase; Region: Amidase; pfam01425
561275008805	Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697
561275008806	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
561275008807	TAP-like protein; Region: Abhydrolase_4; pfam08386
561275008808	Domain of unknown function (DUF385); Region: DUF385; pfam04075
561275008809	Predicted ATPase (AAA+ superfamily) [General function prediction only]; Region: COG1373
561275008810	AAA domain; Region: AAA_14; pfam13173
561275008811	PIN (PilT N terminus) domain: Superfamily; Region: PIN_SF; cl14812
561275008812	putative active site [active]
561275008813	Antitoxin of toxin-antitoxin stability system [Cell division and chromosome partitioning]; Region: Phd; COG4118
561275008814	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4683
561275008815	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
561275008816	non-specific DNA binding site [nucleotide binding]; other site
561275008817	salt bridge; other site
561275008818	sequence-specific DNA binding site [nucleotide binding]; other site
561275008819	RES domain; Region: RES; pfam08808
561275008820	Transposase and inactivated derivatives, IS30 family [DNA replication, recombination, and repair]; Region: Tra8; COG2826
561275008821	Helix-turn-helix domain; Region: HTH_38; pfam13936
561275008822	Integrase core domain; Region: rve; pfam00665
561275008823	Luciferase-like monooxygenase; Region: Bac_luciferase; pfam00296
561275008824	Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cl07892
561275008825	hypothetical protein; Validated; Region: PRK00068
561275008826	Uncharacterized conserved protein [Function unknown]; Region: COG1615
561275008827	Uncharacterized conserved protein [Function unknown]; Region: COG1615; cl09133
561275008828	Predicted secreted protein containing a PDZ domain [Signal transduction mechanisms]; Region: SdrC; COG3480
561275008829	PDZ domain, also called DHR (Dlg homologous region) or GLGF (after a conserved sequence motif). Many PDZ domains bind C-terminal polypeptides, though binding to internal (non-C-terminal) polypeptides and even to lipids has been demonstrated; Region: PDZ; cl00117
561275008830	Lon protease (S16) C-terminal proteolytic domain; Region: Lon_C; pfam05362
561275008831	Uncharacterized conserved protein [Function unknown]; Region: COG5282
561275008832	uncharacterized protein, coenzyme F420 biosynthesis associated; Region: DUF2342_F420; TIGR03883
561275008833	bacteriocin biosynthesis cyclodehydratase domain; Region: cyclo_dehyd_2; TIGR03882
561275008834	ABC1 family; Region: ABC1; pfam03109
561275008835	Phosphotransferase enzyme family; Region: APH; pfam01636
561275008836	Aminoglycoside 3'-phosphotransferase (APH) and Choline Kinase (ChoK) family. The APH/ChoK family is part of a larger superfamily that includes the catalytic domains of other kinases, such as the typical serine/threonine/tyrosine protein kinases (PKs)...; Region: APH_ChoK_like; cd05120
561275008837	active site
561275008838	ATP binding site [chemical binding]; other site
561275008839	Transcription factor WhiB; Region: Whib; pfam02467
561275008840	Superfamily I DNA and RNA helicases [DNA replication, recombination, and repair]; Region: UvrD; COG0210
561275008841	Part of AAA domain; Region: AAA_19; pfam13245
561275008842	Family description; Region: UvrD_C_2; pfam13538
561275008843	HRDC domain; Region: HRDC; pfam00570
561275008844	NrdH-redoxin (NrdH) family; NrdH is a small monomeric protein with a conserved redox active CXXC motif within a TRX fold, characterized by a glutaredoxin (GRX)-like sequence and TRX-like activity profile. In vitro, it displays protein disulfide reductase...; Region: NrdH; cd02976
561275008845	catalytic residues [active]
561275008846	NADH pyrophosphatase; Reviewed; Region: nudC; PRK00241
561275008847	NADH pyrophosphatase-like rudimentary NUDIX domain; Region: NUDIX-like; pfam09296
561275008848	NADH pyrophosphatase zinc ribbon domain; Region: zf-NADH-PPase; pfam09297
561275008849	NADH pyrophosphatase, a member of the Nudix hydrolase superfamily, catalyzes the cleavage of NADH into reduced nicotinamide mononucleotide (NMNH) and AMP. Like other members of the Nudix family, it requires a divalent cation, such as Mg2+ or Mn2+, for...; Region: NADH_pyrophosphatase; cd03429
561275008850	putative NADH binding site [chemical binding]; other site
561275008851	putative active site [active]
561275008852	nudix motif; other site
561275008853	putative metal binding site [ion binding]; other site
561275008854	Ion channel; Region: Ion_trans_2; pfam07885
561275008855	K+ transport systems, NAD-binding component [Inorganic ion transport and metabolism]; Region: TrkA; COG0569
561275008856	TrkA-N domain; Region: TrkA_N; pfam02254
561275008857	UvrD/REP helicase N-terminal domain; Region: UvrD-helicase; pfam00580
561275008858	Part of AAA domain; Region: AAA_19; pfam13245
561275008859	RecB family exonuclease [DNA replication, recombination, and repair]; Region: COG2887
561275008860	UvrD/REP helicase N-terminal domain; Region: UvrD-helicase; pfam00580
561275008861	Superfamily I DNA and RNA helicases [DNA replication, recombination, and repair]; Region: UvrD; COG0210
561275008862	RecB family exonuclease [DNA replication, recombination, and repair]; Region: COG2887
561275008863	alpha/beta hydrolase fold; Region: Abhydrolase_1; pfam00561
561275008864	Novel bacterial esterase that cleaves esters on halogenated cyclic compounds; Region: Esterase_713_like; cl17303
561275008865	The DNA repair protein O6-alkylguanine-DNA alkyltransferase (ATase; also known as AGT, AGAT and MGMT) reverses O6-alkylation DNA damage by transferring O6-alkyl adducts to an active site cysteine irreversibly, without inducing DNA strand breaks. ATases...; Region: ATase; cd06445
561275008866	active site
561275008867	DNA binding site [nucleotide binding]
561275008868	TIGR02569 family protein; Region: TIGR02569_actnb
561275008869	molybdopterin biosynthesis-like protein MoeZ; Validated; Region: PRK07878
561275008870	ThiF_MoeB_HesA. Family of E1-like enzymes involved in molybdopterin and thiamine biosynthesis family. The common reaction mechanism catalyzed by MoeB and ThiF, like other E1 enzymes, begins with a nucleophilic attack of the C-terminal carboxylate of MoaD...; Region: ThiF_MoeB_HesA_family; cd00757
561275008871	ATP binding site [chemical binding]; other site
561275008872	substrate interface [chemical binding]; other site
561275008873	Rhodanese Homology Domain (RHOD); an alpha beta fold domain found duplicated in the rhodanese protein. The cysteine containing enzymatically active version of the domain is also found in the Cdc25 class of protein phosphatases and a variety of proteins...; Region: RHOD; cd00158
561275008874	active site residue [active]
561275008875	Protein of unknown function (DUF3152); Region: DUF3152; pfam11350
561275008876	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275008877	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275008878	Protein of unknown function (DUF3107); Region: DUF3107; pfam11305
561275008879	tRNA-(MS[2]IO[6]A)-hydroxylase (MiaE)-like; Region: MiaE_2; pfam13794
561275008880	DEAD-box helicases. A diverse family of proteins involved in ATP-dependent RNA unwinding, needed in a variety of cellular processes including splicing, ribosome biogenesis and RNA degradation. The name derives from the sequence of the Walker  B motif; Region: DEADc; cd00268
561275008881	DEAD-like helicases superfamily; Region: DEXDc; smart00487
561275008882	ATP binding site [chemical binding]; other site
561275008883	Mg++ binding site [ion binding]; other site
561275008884	motif III; other site
561275008885	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
561275008886	nucleotide binding region [chemical binding]; other site
561275008887	ATP-binding site [chemical binding]; other site
561275008888	ATPases involved in chromosome partitioning [Cell division and chromosome partitioning]; Region: Soj; COG1192
561275008889	ParA and ParB of Caulobacter crescentus belong to a conserved family of bacterial proteins implicated in chromosome segregation. ParB binds to DNA sequences adjacent to the origin of replication and localizes to opposite cell poles shortly following the...; Region: ParA; cd02042
561275008890	P-loop; other site
561275008891	Magnesium ion binding site [ion binding]; other site
561275008892	ParA and ParB of Caulobacter crescentus belong to a conserved family of bacterial proteins implicated in chromosome segregation. ParB binds to DNA sequences adjacent to the origin of replication and localizes to opposite cell poles shortly following the...; Region: ParA; cd02042
561275008893	Magnesium ion binding site [ion binding]; other site
561275008894	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
561275008895	catalytic core [active]
561275008896	Isochorismate synthase [Coenzyme metabolism / Secondary metabolites biosynthesis, transport, and catabolism]; Region: MenF; COG1169
561275008897	chorismate binding enzyme; Region: Chorismate_bind; pfam00425
561275008898	Sphingosine kinase and enzymes related to eukaryotic diacylglycerol kinase [Lipid metabolism / General function prediction only]; Region: LCB5; COG1597
561275008899	Diacylglycerol kinase catalytic domain; Region: DAGK_cat; pfam00781
561275008900	Transcription factor WhiB; Region: Whib; pfam02467
561275008901	Signal transduction histidine kinase; Region: H_kinase_N; pfam12282
561275008902	PAS domain S-box; Region: sensory_box; TIGR00229
561275008903	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: COG3920
561275008904	Histidine kinase; Region: HisKA_2; pfam07568
561275008905	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
561275008906	ATP binding site [chemical binding]; other site
561275008907	Mg2+ binding site [ion binding]; other site
561275008908	G-X-G motif; other site
561275008909	The biotinyl-domain or biotin carboxyl carrier protein (BCCP) domain is present in all biotin-dependent enzymes, such as acetyl-CoA carboxylase, pyruvate carboxylase, propionyl-CoA carboxylase, methylcrotonyl-CoA carboxylase, geranyl-CoA carboxylase; Region: biotinyl_domain; cd06850
561275008910	carboxyltransferase (CT) interaction site; other site
561275008911	biotinylation site [posttranslational modification]; other site
561275008912	mycothiol system anti-sigma-R factor; Region: antisig_RsrA; TIGR03988
561275008913	RNA polymerase sigma-70 factor, TIGR02947 family; Region: SigH_actino
561275008914	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
561275008915	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
561275008916	DNA binding residues [nucleotide binding]
561275008917	short chain dehydrogenase; Provisional; Region: PRK08278
561275008918	human hydroxysteroid dehydrogenase-like protein 2 (HSDL2), classical (c) SDRs; Region: HSDL2_SDR_c; cd09762
561275008919	NAD(P) binding site [chemical binding]; other site
561275008920	homodimer interface [polypeptide binding]; other site
561275008921	active site
561275008922	YbaK-like.  The YbaK family of deacylase domains includes the INS amino acid-editing domain of  the bacterial class II prolyl tRNA synthetase (ProRS), and it's trans-acting homologs, YbaK, ProX, and PrdX. The primary function of INS is to hydrolyze...; Region: YbaK_like; cl00022
561275008923	YbaK-like.  The YbaK family of deacylase domains includes the INS amino acid-editing domain of  the bacterial class II prolyl tRNA synthetase (ProRS), and it's trans-acting homologs, YbaK, ProX, and PrdX. The primary function of INS is to hydrolyze...; Region: YbaK_like; cl00022
561275008924	putative deacylase active site [active]
561275008925	Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302
561275008926	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
561275008927	Coenzyme A binding pocket [chemical binding]; other site
561275008928	Uncharacterized bacterial proteins with similarity to Aminoglycoside 3'-phosphotransferase (APH) and Choline kinase (ChoK) family members. The APH/ChoK subfamily is part of a larger superfamily that includes the catalytic domains of other kinases; Region: APH_ChoK_like_1; cd05155
561275008929	Phosphotransferase enzyme family; Region: APH; pfam01636
561275008930	putative active site [active]
561275008931	putative substrate binding site [chemical binding]; other site
561275008932	ATP binding site [chemical binding]; other site
561275008933	Uncharacterized conserved protein [Function unknown]; Region: COG2135
561275008934	3-phosphoshikimate 1-carboxyvinyltransferase; Provisional; Region: PRK02427
561275008935	EPSP synthase domain. 3-phosphoshikimate 1-carboxyvinyltransferase (5-enolpyruvylshikimate-3-phosphate synthase) (EC 2.5.1.19) catalyses the reaction between shikimate-3-phosphate (S3P) and phosphoenolpyruvate (PEP) to form...; Region: EPSP_synthase; cd01556
561275008936	hinge; other site
561275008937	active site
561275008938	Predicted GTPases [General function prediction only]; Region: COG1162
561275008939	Ribosomal interacting GTPase YjeQ/EngC, a circularly permuted subfamily of the Ras GTPases; Region: YjeQ_EngC; cd01854
561275008940	GTPase/Zn-binding domain interface [polypeptide binding]; other site
561275008941	GTP/Mg2+ binding site [chemical binding]; other site
561275008942	G4 box; other site
561275008943	G5 box; other site
561275008944	G1 box; other site
561275008945	Switch I region; other site
561275008946	G2 box; other site
561275008947	G3 box; other site
561275008948	Switch II region; other site
561275008949	Fatty acid desaturase [Lipid metabolism]; Region: DesA; COG3239
561275008950	The Delta6 Fatty Acid Desaturase (Delta6-FADS)-like CD includes the integral-membrane enzymes: delta-4, delta-5, delta-6, delta-8, delta-8-sphingolipid, and delta-11 desaturases found in vertebrates, higher plants, fungi, and bacteria. These desaturases...; Region: Delta6-FADS-like; cd03506
561275008951	putative di-iron ligands [ion binding]; other site
561275008952	Iron-sulfur binding ferredoxin reductase (FNR) proteins combine the FAD and NAD(P) binding regions of FNR with an iron-sulfur binding cluster domain. Ferredoxin-NADP+ (oxido)reductase is an FAD-containing enzyme that catalyzes the reversible electron...; Region: FNR_iron_sulfur_binding_2; cd06216
561275008953	Flavodoxin reductases (ferredoxin-NADPH reductases) family 1 [Energy production and conversion]; Region: Hmp; COG1018
561275008954	FAD binding pocket [chemical binding]; other site
561275008955	FAD binding motif [chemical binding]; other site
561275008956	phosphate binding motif [ion binding]; other site
561275008957	beta-alpha-beta structure motif; other site
561275008958	NAD binding pocket [chemical binding]; other site
561275008959	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
561275008960	Ferredoxin [Energy production and conversion]; Region: Fdx; COG0633
561275008961	catalytic loop [active]
561275008962	iron binding site [ion binding]; other site
561275008963	polyphosphate kinase 2, PA0141 family; Region: PPK2_P_aer; TIGR03707
561275008964	acyltransferase, WS/DGAT/MGAT; Region: acyl_WS_DGAT; TIGR02946
561275008965	acyltransferase, WS/DGAT/MGAT; Region: acyl_WS_DGAT; TIGR02946
561275008966	Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007
561275008967	Kef-type K+ transport systems, membrane components [Inorganic ion transport and metabolism]; Region: KefB; COG0475
561275008968	Sodium/hydrogen exchanger family; Region: Na_H_Exchanger; pfam00999
561275008969	Putative regulatory, ligand-binding protein related to C-terminal domains of K+ channels [Inorganic ion transport and metabolism]; Region: COG0490
561275008970	TrkA-C domain; Region: TrkA_C; pfam02080
561275008971	Putative protein-S-isoprenylcysteine methyltransferase [Posttranslational modification, protein turnover, chaperones]; Region: STE14; COG2020
561275008972	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
561275008973	drug resistance transporter, EmrB/QacA subfamily; Region: efflux_EmrB; TIGR00711
561275008974	putative substrate translocation pore; other site
561275008975	cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases [Signal transduction mechanisms]; Region: Crp; COG0664
561275008976	effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038
561275008977	ligand binding site [chemical binding]; other site
561275008978	flexible hinge region; other site
561275008979	Predicted esterase of the alpha-beta hydrolase superfamily [General function prediction only]; Region: RssA; COG1752
561275008980	Patatins and Phospholipases; Region: Patatin_and_cPLA2; cl11396
561275008981	nucleophile elbow; other site
561275008982	preprotein translocase subunit SecA; Reviewed; Region: PRK12904
561275008983	SecA preprotein cross-linking domain; Region: SecA_PP_bind; smart00958
561275008984	RaiA ("ribosome-associated inhibitor A", also known as Protein Y (PY), YfiA, and SpotY,  is a stress-response protein that binds the ribosomal subunit interface and arrests translation by interfering with aminoacyl-tRNA binding to the ribosomal...; Region: RaiA; cd00552
561275008985	30S subunit binding site; other site
561275008986	Predicted amidophosphoribosyltransferases [General function prediction only]; Region: ComFC; COG1040
561275008987	active site
561275008988	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cl00309
561275008989	Protein of unknown function (DUF2993); Region: DUF2993; pfam11209
561275008990	lipoprotein LpqB; Provisional; Region: PRK13616
561275008991	Sporulation and spore germination; Region: Germane; pfam10646
561275008992	heavy metal sensor kinase; Region: cztS_silS_copS; TIGR01386
561275008993	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
561275008994	dimerization interface [polypeptide binding]; other site
561275008995	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
561275008996	dimer interface [polypeptide binding]; other site
561275008997	phosphorylation site [posttranslational modification]
561275008998	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
561275008999	ATP binding site [chemical binding]; other site
561275009000	Mg2+ binding site [ion binding]; other site
561275009001	G-X-G motif; other site
561275009002	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
561275009003	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
561275009004	active site
561275009005	phosphorylation site [posttranslational modification]
561275009006	intermolecular recognition site; other site
561275009007	dimerization interface [polypeptide binding]; other site
561275009008	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
561275009009	DNA binding site [nucleotide binding]
561275009010	Thymidylate kinase [Nucleotide transport and metabolism]; Region: Tmk; COG0125
561275009011	Thymidine monophosphate kinase (TMPK), also known as thymidylate kinase, catalyzes the phosphorylation of thymidine monophosphate (TMP) to thymidine diphosphate (TDP) utilizing ATP as its preferred phophoryl donor. TMPK represents the rate-limiting step...; Region: TMPK; cd01672
561275009012	TMP-binding site; other site
561275009013	ATP-binding site [chemical binding]; other site
561275009014	Adenosylhomocysteinase; Provisional; Region: PTZ00075
561275009015	S-Adenosylhomocysteine Hydrolase, NAD-binding and catalytic domains; Region: SAHH; cd00401
561275009016	homotetramer interface [polypeptide binding]; other site
561275009017	ligand binding site [chemical binding]; other site
561275009018	catalytic site [active]
561275009019	NAD binding site [chemical binding]; other site
561275009020	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275009021	probable dihydroxyacetone kinase regulator; Region: DHAK_reg; TIGR02366
561275009022	Rubredoxin [Energy production and conversion]; Region: COG1773
561275009023	Rubredoxin; nonheme iron binding domains containing a [Fe(SCys)4] center. Rubredoxins are small nonheme iron proteins. The iron atom is coordinated by four cysteine residues (Fe(S-Cys)4), but iron can also be replaced by cobalt, nickel or zinc. They are...; Region: rubredoxin; cd00730
561275009024	iron binding site [ion binding]; other site
561275009025	Rubredoxin [Energy production and conversion]; Region: COG1773
561275009026	Rubredoxin; nonheme iron binding domains containing a [Fe(SCys)4] center. Rubredoxins are small nonheme iron proteins. The iron atom is coordinated by four cysteine residues (Fe(S-Cys)4), but iron can also be replaced by cobalt, nickel or zinc. They are...; Region: rubredoxin; cd00730
561275009027	iron binding site [ion binding]; other site
561275009028	Alkane hydroxylase is a bacterial, integral-membrane di-iron enzyme that shares a requirement for iron and oxygen for activity similar to that of the non-heme integral-membrane acyl coenzyme A (CoA) desaturases and acyl lipid desaturases. The alk genes...; Region: Alkane-hydroxylase; cd03512
561275009029	Fatty acid desaturase; Region: FA_desaturase; pfam00487
561275009030	Di-iron ligands [ion binding]; other site
561275009031	amino acid transporter; Region: 2A0306; TIGR00909
561275009032	C-terminus of AA_permease; Region: AA_permease_C; pfam13906
561275009033	2-polyprenyl-6-methoxyphenol hydroxylase and related FAD-dependent oxidoreductases [Coenzyme metabolism / Energy production and conversion]; Region: UbiH; COG0654
561275009034	Phosphomannose isomerase [Carbohydrate transport and metabolism]; Region: ManA; COG1482
561275009035	Alpha-Mannosidase Binding Domain of Atg19/34; Region: ABD; cl15429
561275009036	Alpha-Mannosidase Binding Domain of Atg19/34; Region: ABD; cl15429
561275009037	The phosphomannomutase/phosphoglucomutase (PMM/PGM) bifunctional enzyme catalyzes the reversible conversion of 1-phospho to 6-phospho-sugars (e.g. between mannose-1-phosphate and mannose-6-phosphate or glucose-1-phosphate and glucose-6-phosphate) via a...; Region: PMM_PGM; cd03089
561275009038	phosphomannomutase/phosphoglucomutase; Reviewed; Region: manB; PRK09542
561275009039	active site
561275009040	substrate binding site [chemical binding]; other site
561275009041	metal binding site [ion binding]; metal-binding site
561275009042	Protein of unknown function (DUF3499); Region: DUF3499; pfam12005
561275009043	Minimal MMP-like domain found in a group of hypothetical proteins from alphaproteobacteria and actinobacteria; Region: MMP_TTHA0227_like_1; cd12954
561275009044	Transcription factor WhiB; Region: Whib; pfam02467
561275009045	Uncharacterized protein family UPF0052; Region: UPF0052; pfam01933
561275009046	LPPG:FO 2-phospho-L-lactate transferase; important in F420 biosynthesis; Region: CofD_like; cd07186
561275009047	phosphate binding site [ion binding]; other site
561275009048	dimer interface [polypeptide binding]; other site
561275009049	substrate binding site [chemical binding]; other site
561275009050	F420-0--gamma-glutamyl ligase; Provisional; Region: PRK13294
561275009051	F420-0:Gamma-glutamyl ligase; Region: F420_ligase; cl00644
561275009052	NAD(P)H:flavin oxidoreductase-like family 1.  A subfamily of the nitroreductase family containing uncharacterized proteins that are similar to nitroreductase. Nitroreductase catalyzes the reduction of nitroaromatic compounds such as nitrotoluenes; Region: NADPH_oxidoreductase_1; cd02150
561275009053	putative FMN binding site [chemical binding]; other site
561275009054	Adenine-specific DNA methylase [DNA replication, recombination, and repair]; Region: COG0827
561275009055	Methyltransferase domain; Region: Methyltransf_26; pfam13659
561275009056	Nucleoside-diphosphate-sugar pyrophosphorylase involved in lipopolysaccharide biosynthesis/translation initiation factor 2B, gamma/epsilon subunits (eIF-2Bgamma/eIF-2Bepsilon) [Cell envelope biogenesis, outer membrane / Translation, ribosomal structure...; Region: GCD1; COG1208
561275009057	NTP_transferases catalyze the transfer of nucleotides onto phosphosugars; Region: NTP_transferase; cd04181
561275009058	active site
561275009059	Substrate binding site; other site
561275009060	Mg++ binding site; other site
561275009061	Left-handed parallel beta-Helix (LbetaH or LbH) domain: The alignment contains 5 turns, each containing three imperfect tandem repeats of a hexapeptide repeat motif (X-[STAV]-X-[LIV]-[GAED]-X). Proteins containing hexapeptide repeats are often enzymes...; Region: LbetaH; cl00160
561275009062	Subfamily of Glycosyltransferase Family GT2 of unknown function; Region: GT_2_like_c; cd04186
561275009063	Glycosyltransferase like family 2; Region: Glyco_tranf_2_3; pfam13641
561275009064	Probable Catalytic site; other site
561275009065	metal-binding site
561275009066	dTDP-4-dehydrorhamnose reductase; Region: rmlD; TIGR01214
561275009067	dTDP-6-deoxy-L-lyxo-4-hexulose reductase and related proteins, extended (e) SDRs; Region: dTDP_HR_like_SDR_e; cd05254
561275009068	NADP binding site [chemical binding]; other site
561275009069	active site
561275009070	putative substrate binding site [chemical binding]; other site
561275009071	Transcriptional regulator [Transcription]; Region: LytR; COG1316
561275009072	LytR cell envelope-related transcriptional attenuator; Region: LytR_C; pfam13399
561275009073	TIGR03089 family protein; Region: TIGR03089
561275009074	Protein of unknown function (DUF1490); Region: DUF1490; pfam07371
561275009075	Cation transport ATPase [Inorganic ion transport and metabolism]; Region: ZntA; COG2217
561275009076	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
561275009077	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cl17915
561275009078	active site
561275009079	motif I; other site
561275009080	motif II; other site
561275009081	Predicted Co/Zn/Cd cation transporters [Inorganic ion transport and metabolism]; Region: MMT1; COG0053
561275009082	Predicted acyl-CoA transferases/carnitine dehydratase [Energy production and conversion]; Region: CaiB; COG1804
561275009083	CoA-transferase family III; Region: CoA_transf_3; pfam02515
561275009084	Sulfate permease and related transporters (MFS superfamily) [Inorganic ion transport and metabolism]; Region: SUL1; COG0659
561275009085	Sulfate transporter family; Region: Sulfate_transp; pfam00916
561275009086	Carbonic anhydrase [Inorganic ion transport and metabolism]; Region: CynT; COG0288
561275009087	active site clefts [active]
561275009088	zinc binding site [ion binding]; other site
561275009089	dimer interface [polypeptide binding]; other site
561275009090	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275009091	Short chain acyl-CoA dehydrogenases and eukaryotic short/branched chain acyl-CoA dehydrogenases; Region: SCAD_SBCAD; cd01158
561275009092	FAD binding site [chemical binding]; other site
561275009093	homotetramer interface [polypeptide binding]; other site
561275009094	substrate binding pocket [chemical binding]; other site
561275009095	catalytic base [active]
561275009096	Phosphoribosylcarboxyaminoimidazole (NCAIR) mutase [Nucleotide transport and metabolism]; Region: PurE; COG0041
561275009097	Phosphoribosylaminoimidazole carboxylase (NCAIR synthetase) [Nucleotide transport and metabolism]; Region: PurK; COG0026
561275009098	ATP-grasp domain; Region: ATP-grasp; pfam02222
561275009099	Predicted membrane protein [Function unknown]; Region: COG2246
561275009100	GtrA-like protein; Region: GtrA; pfam04138
561275009101	Bacterial PH domain; Region: DUF304; pfam03703
561275009102	Biotin-(acetyl-CoA carboxylase) ligase [Coenzyme metabolism]; Region: BirA; COG0340
561275009103	Biotin/lipoate A/B protein ligase family; Region: BPL_LplA_LipB; cl14057
561275009104	Biotin protein ligase C terminal domain; Region: BPL_C; pfam02237
561275009105	Acetyl-CoA carboxylase, carboxyltransferase component (subunits alpha and beta) [Lipid metabolism]; Region: COG4799
561275009106	malonate decarboxylase subunit beta; Reviewed; Region: PRK07189; cl17682
561275009107	Acetyl-CoA carboxylase alpha subunit [Lipid metabolism]; Region: AccA; cl17345
561275009108	Acyl-CoA carboxylase epsilon subunit; Region: ACC_epsilon; pfam13822
561275009109	Maf-like protein; Region: Maf; pfam02545
561275009110	Nucleotide binding protein Maf. Maf has been implicated in inhibition of septum formation in eukaryotes, bacteria and archaea, but homologs in B.subtilis and S.cerevisiae are nonessential for cell division. Maf has been predicted to be a nucleotide- or...; Region: Maf; cd00555
561275009111	active site
561275009112	dimer interface [polypeptide binding]; other site
561275009113	Rhodanese-related sulfurtransferase [Inorganic ion transport and metabolism]; Region: SseA; COG2897
561275009114	Thiosulfate sulfurtransferase (TST), N-terminal, inactive domain. TST contains 2 copies of the Rhodanese Homology Domain; this is the 1st repeat, which does not contain the catalytically active Cys residue. The role of the 1st repeat is uncertain, but it...; Region: TST_Repeat_1; cd01448
561275009115	active site residue [active]
561275009116	Thiosulfate sulfurtransferase (TST), C-terminal, catalytic domain. TST contains 2 copies of the Rhodanese Homology Domain; this is the second repeat. Only the second repeat contains the catalytically active Cys residue; Region: TST_Repeat_2; cd01449
561275009117	active site residue [active]
561275009118	Fe-S metabolism associated domain; Region: SufE; pfam02657
561275009119	Acetyl/propionyl-CoA carboxylase, alpha subunit [Lipid metabolism]; Region: COG4770
561275009120	Carbamoyl-phosphate synthase L chain, N-terminal domain; Region: CPSase_L_chain; pfam00289
561275009121	Carbamoyl-phosphate synthase L chain, ATP binding domain; Region: CPSase_L_D2; pfam02786
561275009122	Biotin carboxylase C-terminal domain; Region: Biotin_carb_C; smart00878
561275009123	The biotinyl-domain or biotin carboxyl carrier protein (BCCP) domain is present in all biotin-dependent enzymes, such as acetyl-CoA carboxylase, pyruvate carboxylase, propionyl-CoA carboxylase, methylcrotonyl-CoA carboxylase, geranyl-CoA carboxylase; Region: biotinyl_domain; cd06850
561275009124	carboxyltransferase (CT) interaction site; other site
561275009125	biotinylation site [posttranslational modification]; other site
561275009126	RNA polymerase sigma factor SigF; Reviewed; Region: PRK07122
561275009127	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
561275009128	Sigma-70 region 3; Region: Sigma70_r3; pfam04539
561275009129	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cl17257
561275009130	Anti-sigma regulatory factor (Ser/Thr protein kinase) [Signal transduction mechanisms]; Region: RsbW; COG2172
561275009131	L-lysine aminotransferase; Provisional; Region: PRK08297
561275009132	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
561275009133	inhibitor-cofactor binding pocket; inhibition site
561275009134	pyridoxal 5'-phosphate binding site [chemical binding]; other site
561275009135	catalytic residue [active]
561275009136	putative DNA binding site [nucleotide binding]; other site
561275009137	dimerization interface [polypeptide binding]; other site
561275009138	helix_turn_helix ASNC type; Region: HTH_ASNC; smart00344
561275009139	AsnC-type helix-turn-helix domain; Region: HTH_AsnC-type; pfam13404
561275009140	putative Zn2+ binding site [ion binding]; other site
561275009141	AsnC family; Region: AsnC_trans_reg; pfam01037
561275009142	Domain of unknown function (DUF1338); Region: DUF1338; pfam07063
561275009143	NAD+-dependent alpha-aminoadipic semialdehyde dehydrogenase, ALDH family members 7A1 and 7B; Region: ALDH_F7_AASADH; cd07130
561275009144	Aldehyde dehydrogenase family; Region: Aldedh; pfam00171
561275009145	tetrameric interface [polypeptide binding]; other site
561275009146	NAD binding site [chemical binding]; other site
561275009147	catalytic residues [active]
561275009148	Domain of unknown function (DUF4143); Region: DUF4143; pfam13635
561275009149	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275009150	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275009151	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
561275009152	putative ATP-dependent helicase Lhr; Provisional; Region: PRK09751
561275009153	ATP binding site [chemical binding]; other site
561275009154	putative Mg++ binding site [ion binding]; other site
561275009155	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
561275009156	nucleotide binding region [chemical binding]; other site
561275009157	ATP-binding site [chemical binding]; other site
561275009158	DEAD/H associated; Region: DEAD_assoc; pfam08494
561275009159	Formamidopyrimidine-DNA glycosylase [DNA replication, recombination, and repair]; Region: Nei; COG0266
561275009160	N-terminal domain of the actinomycetal Nei2 and related DNA glycosylases; Region: AcNei2_N; cd08971
561275009161	putative DNA binding site [nucleotide binding]; other site
561275009162	catalytic residue [active]
561275009163	putative H2TH interface [polypeptide binding]; other site
561275009164	putative catalytic residues [active]
561275009165	Formamidopyrimidine-DNA glycosylase H2TH domain; Region: H2TH; pfam06831
561275009166	Poly(3-hydroxybutyrate) depolymerase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: LpqC; COG3509
561275009167	Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326
561275009168	Arylsulfatase A and related enzymes [Inorganic ion transport and metabolism]; Region: AslA; COG3119
561275009169	Sulfatase; Region: Sulfatase; pfam00884
561275009170	Pseudouridine synthase, a subgroup of the RluA family; Region: PSRA_1; cd02558
561275009171	Pseudouridylate synthases, 23S RNA-specific [Translation, ribosomal structure and biogenesis]; Region: RluA; COG0564
561275009172	probable active site [active]
561275009173	phosphate transport system regulatory protein PhoU; Region: phoU_full; TIGR02135
561275009174	PhoU domain; Region: PhoU; pfam01895
561275009175	PhoU domain; Region: PhoU; pfam01895
561275009176	Glycerol-3-phosphate dehydrogenase [Energy production and conversion]; Region: GlpA; COG0578
561275009177	flavoprotein disulfide reductase; Reviewed; Region: PRK07845
561275009178	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
561275009179	Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852
561275009180	GGCT-like domains, also called AIG2-like family. Gamma-glutamyl cyclotransferase (GGCT) catalyzes the formation of pyroglutamic acid (5-oxoproline) from dipeptides containing gamma-glutamyl, and is a dimeric protein. In Homo sapiens, the protein is...; Region: GGCT_like; cd06661
561275009181	putative active site pocket [active]
561275009182	dimerization interface [polypeptide binding]; other site
561275009183	putative catalytic residue [active]
561275009184	Metal-dependent amidase/aminoacylase/carboxypeptidase [General function prediction only]; Region: AbgB; COG1473
561275009185	M20 Peptidase Aminoacylase 1 subfamily; Region: M20_Acy1_like4; cd08014
561275009186	metal binding site [ion binding]; metal-binding site
561275009187	putative dimer interface [polypeptide binding]; other site
561275009188	M20 Peptidase Aminoacylase 1-like protein 2-like, amidohydrolase subfamily; Region: M20_ACY1L2_like; cd05672
561275009189	amidohydrolase; Region: amidohydrolases; TIGR01891
561275009190	metal binding site [ion binding]; metal-binding site
561275009191	purine nucleoside phosphorylase; Provisional; Region: PRK08202
561275009192	phosphoglucomutase-2-like protein; Provisional; Region: PTZ00150
561275009193	This CD includes PGM2 (phosphoglucomutase 2) and PGM2L1 (phosphoglucomutase 2-like 1). The mammalian PGM2 is thought to be a phosphopentomutase that catalyzes the conversion of the nucleoside breakdown products, ribose-1-phosphate and...; Region: PGM2; cd05799
561275009194	active site
561275009195	substrate binding site [chemical binding]; other site
561275009196	metal binding site [ion binding]; metal-binding site
561275009197	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
561275009198	active site
561275009199	Phosphoesterase family; Region: Phosphoesterase; pfam04185
561275009200	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
561275009201	Adenosine deaminase [Nucleotide transport and metabolism]; Region: Add; COG1816
561275009202	adenosine deaminase; Provisional; Region: PRK09358
561275009203	active site
561275009204	thymidine phosphorylase; Reviewed; Region: deoA; PRK05820
561275009205	Glycosyl transferase family, helical bundle domain; Region: Glycos_trans_3N; pfam02885
561275009206	Glycosyl transferase family, a/b domain; Region: Glycos_transf_3; pfam00591
561275009207	Pyrimidine nucleoside phosphorylase C-terminal domain; Region: PYNP_C; pfam07831
561275009208	Cytidine deaminase zinc-binding domain. These enzymes are Zn dependent. The zinc ion in the active site plays a central role in the proposed catalytic mechanism, activating a water molecule to form a hydroxide ion that performs a nucleophilic attack on...; Region: cytidine_deaminase; cd01283
561275009209	active site
561275009210	catalytic motif [active]
561275009211	Zn binding site [ion binding]; other site
561275009212	Succinate:quinone oxidoreductase (SQR) Type A subfamily, Succinate dehydrogenase C (SdhC)-like subunit; SQR catalyzes the oxidation of succinate to fumarate coupled to the reduction of quinone to quinol. Members of this subfamily reduce low potential...; Region: SQR_TypeA_SdhC_like; cd03501
561275009213	putative Iron-sulfur protein interface [polypeptide binding]; other site
561275009214	putative proximal heme binding site [chemical binding]; other site
561275009215	putative SdhD-like interface [polypeptide binding]; other site
561275009216	putative distal heme binding site [chemical binding]; other site
561275009217	Succinate:quinone oxidoreductase (SQR) Type A subfamily, Succinate dehydrogenase D (SdhD)-like subunit; SQR catalyzes the oxidation of succinate to fumarate coupled to the reduction of quinone to quinol. Members of this subfamily reduce low potential...; Region: SQR_TypeA_SdhD_like; cd03500
561275009218	putative Iron-sulfur protein interface [polypeptide binding]; other site
561275009219	putative proximal heme binding site [chemical binding]; other site
561275009220	putative SdhC-like subunit interface [polypeptide binding]; other site
561275009221	putative distal heme binding site [chemical binding]; other site
561275009222	DU2 in BCG Tokyo
561275009224	Pseudouridine synthase, a subgroup of the RluA family; Region: PSRA_1; cd02558
561275009225	Pseudouridylate synthases, 23S RNA-specific [Translation, ribosomal structure and biogenesis]; Region: RluA; COG0564
561275009226	probable active site [active]
561275009227	phosphate transport system regulatory protein PhoU; Region: phoU_full; TIGR02135
561275009228	PhoU domain; Region: PhoU; pfam01895
561275009229	PhoU domain; Region: PhoU; pfam01895
561275009230	Glycerol-3-phosphate dehydrogenase [Energy production and conversion]; Region: GlpA; COG0578
561275009231	flavoprotein disulfide reductase; Reviewed; Region: PRK07845
561275009232	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
561275009233	Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852
561275009234	GGCT-like domains, also called AIG2-like family. Gamma-glutamyl cyclotransferase (GGCT) catalyzes the formation of pyroglutamic acid (5-oxoproline) from dipeptides containing gamma-glutamyl, and is a dimeric protein. In Homo sapiens, the protein is...; Region: GGCT_like; cd06661
561275009235	putative active site pocket [active]
561275009236	dimerization interface [polypeptide binding]; other site
561275009237	putative catalytic residue [active]
561275009238	Metal-dependent amidase/aminoacylase/carboxypeptidase [General function prediction only]; Region: AbgB; COG1473
561275009239	M20 Peptidase Aminoacylase 1 subfamily; Region: M20_Acy1_like4; cd08014
561275009240	metal binding site [ion binding]; metal-binding site
561275009241	putative dimer interface [polypeptide binding]; other site
561275009242	M20 Peptidase Aminoacylase 1-like protein 2-like, amidohydrolase subfamily; Region: M20_ACY1L2_like; cd05672
561275009243	amidohydrolase; Region: amidohydrolases; TIGR01891
561275009244	metal binding site [ion binding]; metal-binding site
561275009245	purine nucleoside phosphorylase; Provisional; Region: PRK08202
561275009246	phosphoglucomutase-2-like protein; Provisional; Region: PTZ00150
561275009247	This CD includes PGM2 (phosphoglucomutase 2) and PGM2L1 (phosphoglucomutase 2-like 1). The mammalian PGM2 is thought to be a phosphopentomutase that catalyzes the conversion of the nucleoside breakdown products, ribose-1-phosphate and...; Region: PGM2; cd05799
561275009248	active site
561275009249	substrate binding site [chemical binding]; other site
561275009250	metal binding site [ion binding]; metal-binding site
561275009251	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
561275009252	active site
561275009253	Phosphoesterase family; Region: Phosphoesterase; pfam04185
561275009254	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
561275009255	Adenosine deaminase [Nucleotide transport and metabolism]; Region: Add; COG1816
561275009256	adenosine deaminase; Provisional; Region: PRK09358
561275009257	active site
561275009258	thymidine phosphorylase; Reviewed; Region: deoA; PRK05820
561275009259	Glycosyl transferase family, helical bundle domain; Region: Glycos_trans_3N; pfam02885
561275009260	Glycosyl transferase family, a/b domain; Region: Glycos_transf_3; pfam00591
561275009261	Pyrimidine nucleoside phosphorylase C-terminal domain; Region: PYNP_C; pfam07831
561275009262	Cytidine deaminase zinc-binding domain. These enzymes are Zn dependent. The zinc ion in the active site plays a central role in the proposed catalytic mechanism, activating a water molecule to form a hydroxide ion that performs a nucleophilic attack on...; Region: cytidine_deaminase; cd01283
561275009263	active site
561275009264	catalytic motif [active]
561275009265	Zn binding site [ion binding]; other site
561275009266	Succinate:quinone oxidoreductase (SQR) Type A subfamily, Succinate dehydrogenase C (SdhC)-like subunit; SQR catalyzes the oxidation of succinate to fumarate coupled to the reduction of quinone to quinol. Members of this subfamily reduce low potential...; Region: SQR_TypeA_SdhC_like; cd03501
561275009267	putative Iron-sulfur protein interface [polypeptide binding]; other site
561275009268	putative proximal heme binding site [chemical binding]; other site
561275009269	putative SdhD-like interface [polypeptide binding]; other site
561275009270	putative distal heme binding site [chemical binding]; other site
561275009271	Succinate:quinone oxidoreductase (SQR) Type A subfamily, Succinate dehydrogenase D (SdhD)-like subunit; SQR catalyzes the oxidation of succinate to fumarate coupled to the reduction of quinone to quinol. Members of this subfamily reduce low potential...; Region: SQR_TypeA_SdhD_like; cd03500
561275009272	putative Iron-sulfur protein interface [polypeptide binding]; other site
561275009273	putative proximal heme binding site [chemical binding]; other site
561275009274	putative SdhC-like subunit interface [polypeptide binding]; other site
561275009275	putative distal heme binding site [chemical binding]; other site
561275009276	DU2
561275009278	Pseudouridine synthase, a subgroup of the RluA family; Region: PSRA_1; cd02558
561275009279	Pseudouridylate synthases, 23S RNA-specific [Translation, ribosomal structure and biogenesis]; Region: RluA; COG0564
561275009280	probable active site [active]
561275009281	phosphate transport system regulatory protein PhoU; Region: phoU_full; TIGR02135
561275009282	PhoU domain; Region: PhoU; pfam01895
561275009283	PhoU domain; Region: PhoU; pfam01895
561275009284	Glycerol-3-phosphate dehydrogenase [Energy production and conversion]; Region: GlpA; COG0578
561275009285	flavoprotein disulfide reductase; Reviewed; Region: PRK07845
561275009286	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
561275009287	Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852
561275009288	GGCT-like domains, also called AIG2-like family. Gamma-glutamyl cyclotransferase (GGCT) catalyzes the formation of pyroglutamic acid (5-oxoproline) from dipeptides containing gamma-glutamyl, and is a dimeric protein. In Homo sapiens, the protein is...; Region: GGCT_like; cd06661
561275009289	putative active site pocket [active]
561275009290	dimerization interface [polypeptide binding]; other site
561275009291	putative catalytic residue [active]
561275009292	Metal-dependent amidase/aminoacylase/carboxypeptidase [General function prediction only]; Region: AbgB; COG1473
561275009293	M20 Peptidase Aminoacylase 1 subfamily; Region: M20_Acy1_like4; cd08014
561275009294	metal binding site [ion binding]; metal-binding site
561275009295	putative dimer interface [polypeptide binding]; other site
561275009296	M20 Peptidase Aminoacylase 1-like protein 2-like, amidohydrolase subfamily; Region: M20_ACY1L2_like; cd05672
561275009297	amidohydrolase; Region: amidohydrolases; TIGR01891
561275009298	metal binding site [ion binding]; metal-binding site
561275009299	purine nucleoside phosphorylase; Provisional; Region: PRK08202
561275009300	phosphoglucomutase-2-like protein; Provisional; Region: PTZ00150
561275009301	This CD includes PGM2 (phosphoglucomutase 2) and PGM2L1 (phosphoglucomutase 2-like 1). The mammalian PGM2 is thought to be a phosphopentomutase that catalyzes the conversion of the nucleoside breakdown products, ribose-1-phosphate and...; Region: PGM2; cd05799
561275009302	active site
561275009303	substrate binding site [chemical binding]; other site
561275009304	metal binding site [ion binding]; metal-binding site
561275009305	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
561275009306	active site
561275009307	Phosphoesterase family; Region: Phosphoesterase; pfam04185
561275009308	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
561275009309	Adenosine deaminase [Nucleotide transport and metabolism]; Region: Add; COG1816
561275009310	adenosine deaminase; Provisional; Region: PRK09358
561275009311	active site
561275009312	thymidine phosphorylase; Reviewed; Region: deoA; PRK05820
561275009313	Glycosyl transferase family, helical bundle domain; Region: Glycos_trans_3N; pfam02885
561275009314	Glycosyl transferase family, a/b domain; Region: Glycos_transf_3; pfam00591
561275009315	Pyrimidine nucleoside phosphorylase C-terminal domain; Region: PYNP_C; pfam07831
561275009316	Cytidine deaminase zinc-binding domain. These enzymes are Zn dependent. The zinc ion in the active site plays a central role in the proposed catalytic mechanism, activating a water molecule to form a hydroxide ion that performs a nucleophilic attack on...; Region: cytidine_deaminase; cd01283
561275009317	active site
561275009318	catalytic motif [active]
561275009319	Zn binding site [ion binding]; other site
561275009320	Succinate:quinone oxidoreductase (SQR) Type A subfamily, Succinate dehydrogenase C (SdhC)-like subunit; SQR catalyzes the oxidation of succinate to fumarate coupled to the reduction of quinone to quinol. Members of this subfamily reduce low potential...; Region: SQR_TypeA_SdhC_like; cd03501
561275009321	putative Iron-sulfur protein interface [polypeptide binding]; other site
561275009322	putative proximal heme binding site [chemical binding]; other site
561275009323	putative SdhD-like interface [polypeptide binding]; other site
561275009324	putative distal heme binding site [chemical binding]; other site
561275009325	Succinate:quinone oxidoreductase (SQR) Type A subfamily, Succinate dehydrogenase D (SdhD)-like subunit; SQR catalyzes the oxidation of succinate to fumarate coupled to the reduction of quinone to quinol. Members of this subfamily reduce low potential...; Region: SQR_TypeA_SdhD_like; cd03500
561275009326	putative Iron-sulfur protein interface [polypeptide binding]; other site
561275009327	putative proximal heme binding site [chemical binding]; other site
561275009328	putative SdhC-like subunit interface [polypeptide binding]; other site
561275009329	putative distal heme binding site [chemical binding]; other site
561275009330	succinate dehydrogenase flavoprotein subunit; Reviewed; Region: sdhA; PRK08205
561275009331	L-aspartate oxidase; Provisional; Region: PRK06175
561275009332	Fumarate reductase flavoprotein C-term; Region: Succ_DH_flav_C; pfam02910
561275009333	succinate dehydrogenase iron-sulfur subunit; Reviewed; Region: sdhB; PRK05950
561275009334	2Fe-2S iron-sulfur cluster binding domain; Region: Fer2_3; pfam13085
561275009335	Mycobacterium tuberculosis PIN domain family; Region: Mtu_PIN_fam; TIGR00028
561275009336	Ribbon-helix-helix protein, copG family; Region: RHH_1; pfam01402
561275009337	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275009338	S-adenosylmethionine binding site [chemical binding]; other site
561275009339	Ubiquitin domain of MoaD-like proteins; Region: MoaD; cd00754
561275009340	MoaE interaction surface [polypeptide binding]; other site
561275009341	MoeB interaction surface [polypeptide binding]; other site
561275009342	thiocarboxylated glycine; other site
561275009343	MoaE family. Members of this family are involved in biosynthesis of the molybdenum cofactor (Moco), an essential cofactor for a diverse group of redox enzymes. Moco biosynthesis is an evolutionarily conserved pathway present in eubacteria, archaea and...; Region: MoaE; cd00756
561275009344	MoaE homodimer interface [polypeptide binding]; other site
561275009345	MoaD interaction [polypeptide binding]; other site
561275009346	active site residues [active]
561275009347	MoaC family, prokaryotic and eukaryotic. Members of this family are involved in molybdenum cofactor (Moco) biosynthesis, an essential cofactor of a diverse group of redox enzymes. MoaC, a small hexameric protein, converts, together with MoaA, a guanosine...; Region: MoaC_PE; cd01420
561275009348	trimer interface [polypeptide binding]; other site
561275009349	dimer interface [polypeptide binding]; other site
561275009350	putative active site [active]
561275009351	PCD_DCoH: The bifunctional protein pterin-4alpha-carbinolamine dehydratase (PCD), also known as DCoH  (dimerization cofactor of hepatocyte nuclear factor-1), is both a transcription activator and a metabolic enzyme.  DCoH stimulates gene expression by...; Region: PCD_DCoH; cd00488
561275009352	aromatic arch; other site
561275009353	DCoH dimer interaction site [polypeptide binding]; other site
561275009354	DCoH /HNF-1 dimer interaction site [polypeptide binding]; other site
561275009355	DCoH tetramer interaction site [polypeptide binding]; other site
561275009356	substrate binding site [chemical binding]; other site
561275009357	RvD5, 4082 bp. Region of difference RvD5, substituted region in Mycobacterium bovis BCG Pasteur (position 3698953..3703034, 4082bp), BCG Tokyo (position 3696850..3700932, 4083bp) and Mycobacterium bovis AF2122/97 (position 3664904..3668985, 4082bp) compared to Mycobacterium tuberculosis H37Rv2 (position: 3710382..3711736, 1355bp). In Mycobacterium bovis BCG Pasteur, BCG Tokyo, and Mycobacterium bovis AF2122/97, this region encodes genes equivalent to Mycobacterium tuberculosis strain CDC1551, MT3426-MT3429. In Mycobacterium tuberculosis strain H37Rv, insertion of an IS6110 element (encoding genes Rv3325 and Rv3326) removes genes MT3426-MT3429
561275009358	Molybdenum cofactor biosynthesis enzyme [Coenzyme metabolism]; Region: MoaA; COG2896
561275009359	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
561275009360	FeS/SAM binding site; other site
561275009361	Molybdenum Cofactor Synthesis C; Region: Mob_synth_C; pfam06463
561275009362	DNA-binding transcriptional activator of the SARP family [Signal transduction mechanisms]; Region: DnrI; COG3629
561275009363	Transcriptional regulatory protein, C terminal; Region: Trans_reg_C; pfam00486
561275009364	DNA binding site [nucleotide binding]
561275009365	Forkhead associated domain (FHA); found in eukaryotic and prokaryotic proteins. Putative nuclear signalling domain. FHA domains may bind phosphothreonine, phosphoserine and sometimes phosphotyrosine. In eukaryotes, many FHA domain-containing proteins...; Region: FHA; cd00060
561275009366	FOG: FHA domain [Signal transduction mechanisms]; Region: COG1716
561275009367	phosphopeptide binding site; other site
561275009368	Transposase; Region: DEDD_Tnp_IS110; pfam01548
561275009369	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3547
561275009370	Transposase IS116/IS110/IS902 family; Region: Transposase_20; pfam02371
561275009371	Uncharacterized conserved protein [Function unknown]; Region: COG2128
561275009372	RNA polymerase sigma factor SigJ; Provisional; Region: PRK09636
561275009373	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
561275009374	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
561275009375	DNA binding residues [nucleotide binding]
561275009376	SnoaL-like domain; Region: SnoaL_2; pfam12680
561275009377	hypothetical protein; Provisional; Region: PRK06541
561275009378	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
561275009379	inhibitor-cofactor binding pocket; inhibition site
561275009380	pyridoxal 5'-phosphate binding site [chemical binding]; other site
561275009381	catalytic residue [active]
561275009382	Beta-lactamase enzyme family; Region: Beta-lactamase2; cl17872
561275009383	D-alanyl-D-alanine carboxypeptidase; Region: Peptidase_S11; pfam00768
561275009384	MFS transporter, sugar porter (SP) family; Region: SP; TIGR00879
561275009385	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
561275009386	N-acetylglucosamine-6-phosphate deacetylase [Carbohydrate transport and metabolism]; Region: NagA; COG1820
561275009387	N-acetylglucosamine-6-phosphate deacetylase, NagA, catalyzes the hydrolysis of the N-acetyl group of N-acetyl-glucosamine-6-phosphate (GlcNAc-6-P) to glucosamine 6-phosphate and acetate. This is the first committed step in the biosynthetic pathway to...; Region: NagA; cd00854
561275009388	active site
561275009389	dimer interface [polypeptide binding]; other site
561275009390	Protein of unknown function (DUF732); Region: DUF732; pfam05305
561275009391	Helix-Turn-Helix DNA binding domain of Heavy Metal Resistance transcription regulators; Region: HTH_HMRTR; cd04770
561275009392	Predicted transcriptional regulators [Transcription]; Region: SoxR; COG0789
561275009393	DNA binding residues [nucleotide binding]
561275009394	dimer interface [polypeptide binding]; other site
561275009395	metal binding site [ion binding]; metal-binding site
561275009396	Virulence factor BrkB; Region: Virul_fac_BrkB; cl07918
561275009397	tryptophanyl-tRNA synthetase II; Reviewed; Region: PRK12282
561275009398	catalytic core domain of tryptophanyl-tRNA synthetase; Region: TrpRS_core; cd00806
561275009399	active site
561275009400	HIGH motif; other site
561275009401	dimer interface [polypeptide binding]; other site
561275009402	KMSKS motif; other site
561275009403	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
561275009404	isocitrate dehydrogenase; Validated; Region: PRK08299
561275009405	O-acetylhomoserine aminocarboxypropyltransferase; Validated; Region: PRK07812
561275009406	CGS_like: Cystathionine gamma-synthase is a PLP dependent enzyme and catalyzes the committed step of methionine biosynthesis. This pathway is unique to microorganisms and plants, rendering the enzyme an attractive target for the development of...; Region: CGS_like; cd00614
561275009407	homodimer interface [polypeptide binding]; other site
561275009408	substrate-cofactor binding pocket; other site
561275009409	pyridoxal 5'-phosphate binding site [chemical binding]; other site
561275009410	catalytic residue [active]
561275009411	homoserine O-acetyltransferase; Provisional; Region: metX; PRK00175
561275009412	homoserine O-acetyltransferase; Region: homoserO_Ac_trn; TIGR01392
561275009413	Methyltransferase domain; Region: Methyltransf_23; pfam13489
561275009414	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275009415	S-adenosylmethionine binding site [chemical binding]; other site
561275009416	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275009417	PPE family; Region: PPE; pfam00823
561275009418	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275009419	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275009420	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275009421	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275009422	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275009423	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275009424	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275009425	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275009426	RD19, 3555 bp. Region of difference RD19, deleted region in Mycobacterium bovis BCG Pasteur (position 3723542..3723543), BCG Tokyo (position 3721455..3721456), and Mycobacterium bovis AF2122/97 (position 3689508..3689509) compared to Mycobacterium tuberculosis H37Rv (position: 3732259..3735813). Internal in-frame deletion of PPE54, Rv3343c
561275009427	PE family; Region: PE; pfam00934
561275009428	Protein of unknown function (DUF3017); Region: DUF3017; pfam11222
561275009430	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275009431	PPE family; Region: PPE; pfam00823
561275009432	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275009433	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275009434	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275009435	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275009436	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275009437	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275009438	Transposase; Region: DEDD_Tnp_IS110; pfam01548
561275009439	Transposase; Region: DDE_Tnp_ISL3; pfam01610
561275009442	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275009443	PPE family; Region: PPE; pfam00823
561275009444	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275009445	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275009446	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275009447	Berberine and berberine like; Region: BBE; pfam08031
561275009448	FAD/FMN-containing dehydrogenases [Energy production and conversion]; Region: GlcD; COG0277
561275009449	Protein of unknown function (DUF732); Region: DUF732; pfam05305
561275009450	Protein of unknown function (DUF3017); Region: DUF3017; pfam11222
561275009451	bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase; Provisional; Region: PRK14193
561275009452	Tetrahydrofolate dehydrogenase/cyclohydrolase, catalytic domain; Region: THF_DHG_CYH; pfam00763
561275009453	NADP binding domain of methylene-tetrahydrofolate dehydrogenase/cyclohydrolase; Region: NAD_bind_m-THF_DH_Cyclohyd; cd01080
561275009454	homodimer interface [polypeptide binding]; other site
561275009455	NADP binding site [chemical binding]; other site
561275009456	substrate binding site [chemical binding]; other site
561275009457	Antitoxin of toxin-antitoxin stability system [Cell division and chromosome partitioning]; Region: StbD; COG2161
561275009458	Plasmid encoded toxin Txe; Region: Plasmid_Txe; pfam06769
561275009459	NADH:flavin oxidoreductases, Old Yellow Enzyme family [Energy production and conversion]; Region: NemA; COG1902
561275009460	Old yellow enzyme (OYE)-like FMN binding domain. OYE was the first flavin-dependent enzyme identified, however its true physiological role remains elusive to this day.  Each monomer of OYE contains FMN as a non-covalently bound cofactor, uses NADPH as a...; Region: OYE_like_FMN_family; cd02803
561275009461	active site
561275009462	FMN binding site [chemical binding]; other site
561275009463	substrate binding site [chemical binding]; other site
561275009464	putative catalytic residue [active]
561275009465	TIM barrel proteins share a structurally conserved phosphate binding motif and in general share an eight beta/alpha closed barrel structure. Specific for this family is the conserved phosphate binding site at the edges of strands 7 and 8. The phosphate...; Region: TIM_phosphate_binding; cl17186
561275009466	phosphate binding site [ion binding]; other site
561275009467	FOG: FHA domain [Signal transduction mechanisms]; Region: COG1716
561275009468	Forkhead associated domain (FHA); found in eukaryotic and prokaryotic proteins. Putative nuclear signalling domain. FHA domains may bind phosphothreonine, phosphoserine and sometimes phosphotyrosine. In eukaryotes, many FHA domain-containing proteins...; Region: FHA; cd00060
561275009469	phosphopeptide binding site; other site
561275009470	Pentapeptide repeats (9 copies); Region: Pentapeptide_4; pfam13599
561275009471	Pentapeptide repeats (8 copies); Region: Pentapeptide; pfam00805
561275009472	Pentapeptide repeats (9 copies); Region: Pentapeptide_4; pfam13599
561275009473	Pentapeptide repeats (8 copies); Region: Pentapeptide; pfam00805
561275009474	Rat sarcoma (Ras)-like superfamily of small guanosine triphosphatases (GTPases); Region: Ras_like_GTPase; cd00882
561275009475	Conserved hypothetical ATP binding protein; Region: ATP_bind_1; pfam03029
561275009476	G1 box; other site
561275009477	GTP/Mg2+ binding site [chemical binding]; other site
561275009478	G2 box; other site
561275009479	Switch I region; other site
561275009480	G3 box; other site
561275009481	Switch II region; other site
561275009482	G4 box; other site
561275009483	G5 box; other site
561275009484	Protein of unknown function (DUF742); Region: DUF742; pfam05331
561275009485	Uncharacterized distant relative of homeotic protein bithoraxoid [General function prediction only]; Region: COG2018
561275009486	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
561275009487	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
561275009488	ATP binding site [chemical binding]; other site
561275009489	Mg2+ binding site [ion binding]; other site
561275009490	G-X-G motif; other site
561275009491	Predicted rRNA methylase (SpoU class) [Translation, ribosomal structure and biogenesis]; Region: CspR; COG0219
561275009492	PE family; Region: PE; pfam00934
561275009493	Proteins of this family catalyze the reduction of flavin or nitrocompounds using NAD(P)H as electron donor in a obligatory two-electron transfer,  utilizing FMN or FAD as cofactor. They are often found to be homodimers. Enzymes of this family are...; Region: Nitro_FMN_reductase; cd02062
561275009494	FMN binding site [chemical binding]; other site
561275009495	dimer interface [polypeptide binding]; other site
561275009496	Pyridoxine 5'-phosphate (PNP) oxidase-like proteins; Region: PNPOx_like; cl00381
561275009497	error-prone DNA polymerase; Validated; Region: dnaE2; PRK05672
561275009498	Polymerase and Histidinol Phosphatase domain; Region: PHP; cl17102
561275009499	active site
561275009500	DnaE_OBF: A subfamily of OB folds corresponding to the C-terminal OB-fold nucleic acid binding domain of Thermus aquaticus and Escherichia coli type C replicative DNA polymerase III alpha subunit (DnaE). The DNA polymerase holoenzyme of E. coli contains...; Region: DnaE_OBF; cd04485
561275009501	generic binding surface II; other site
561275009502	generic binding surface I; other site
561275009503	acyltransferase, WS/DGAT/MGAT; Region: acyl_WS_DGAT; TIGR02946
561275009504	Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007
561275009505	Predicted phosphatase/phosphohexomutase [General function prediction only]; Region: COG0637
561275009506	Trehalose-6-phosphatase [Carbohydrate transport and metabolism]; Region: OtsB; COG1877
561275009507	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
561275009508	active site
561275009509	motif I; other site
561275009510	motif II; other site
561275009511	3-hydroxybutyryl-CoA dehydratase; Validated; Region: PRK05809
561275009512	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
561275009513	substrate binding site [chemical binding]; other site
561275009514	oxyanion hole (OAH) forming residues; other site
561275009515	trimer interface [polypeptide binding]; other site
561275009516	Asp-tRNAAsn/Glu-tRNAGln amidotransferase A subunit and related amidases [Translation, ribosomal structure and biogenesis]; Region: GatA; COG0154
561275009517	Amidase; Region: Amidase; pfam01425
561275009518	Predicted hydrolase (HAD superfamily) [General function prediction only]; Region: COG1011
561275009519	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
561275009520	motif II; other site
561275009521	This group contains class II terpene cyclases, protein prenyltransferases beta subunit, two broadly specific proteinase inhibitors alpha2-macroglobulin (alpha (2)-M) and pregnancy zone protein (PZP) and, the C3 C4 and C5 components of vertebrate...; Region: ISOPREN_C2_like; cl08267
561275009522	This group contains class II terpene cyclases, protein prenyltransferases beta subunit, two broadly specific proteinase inhibitors alpha2-macroglobulin (alpha (2)-M) and pregnancy zone protein (PZP) and, the C3 C4 and C5 components of vertebrate...; Region: ISOPREN_C2_like; cd00688
561275009523	Thiamine pyrophosphate (TPP) enzyme family, TPP-binding module; found in many key metabolic enzymes which use TPP (also known as thiamine diphosphate) as a cofactor. These enzymes include, among others, the E1 components of the pyruvate, the acetoin and...; Region: TPP_enzymes; cl01629
561275009524	TPP-binding site [chemical binding]; other site
561275009525	Transketolase, C-terminal subunit [Carbohydrate transport and metabolism]; Region: COG3958
561275009526	Pyrimidine (PYR) binding domain of 1-deoxy-D-xylulose-5-phosphate synthase (DXS), transketolase (TK), and related proteins; Region: TPP_PYR_DXS_TK_like; cd07033
561275009527	PYR/PP interface [polypeptide binding]; other site
561275009528	dimer interface [polypeptide binding]; other site
561275009529	TPP binding site [chemical binding]; other site
561275009530	Transketolase, C-terminal domain; Region: Transketolase_C; pfam02780
561275009531	4-Hydroxy-3-methylbut-2-enyl diphosphate reductase IspH [Lipid metabolism]; Region: lytB; COG0761
561275009532	4-hydroxy-3-methylbut-2-enyl diphosphate reductase; Reviewed; Region: ispH; PRK01045
561275009533	Geranylgeranyl pyrophosphate synthase [Coenzyme metabolism]; Region: IspA; COG0142
561275009534	Trans-Isoprenyl Diphosphate Synthases, head-to-tail; Region: Trans_IPPS_HT; cd00685
561275009535	substrate binding pocket [chemical binding]; other site
561275009536	chain length determination region; other site
561275009537	substrate-Mg2+ binding site; other site
561275009538	catalytic residues [active]
561275009539	aspartate-rich region 1; other site
561275009540	active site lid residues [active]
561275009541	aspartate-rich region 2; other site
561275009542	PIN domain of the hypothetical protein MT3492 of Mycobacterium tuberculosis CDC1551 and other uncharacterized, annotated PilT protein domain proteins; Region: PIN_MT3492; cd09874
561275009543	putative active site [active]
561275009544	Antitoxin of toxin-antitoxin stability system [Cell division and chromosome partitioning]; Region: Phd; COG4118
561275009545	Transposase and inactivated derivatives, IS5 family [DNA replication, recombination, and repair]; Region: COG3039
561275009546	Transposase domain (DUF772); Region: DUF772; pfam05598
561275009547	Transposase and inactivated derivatives, IS5 family [DNA replication, recombination, and repair]; Region: COG3039
561275009548	Transposase DDE domain; Region: DDE_Tnp_1_6; pfam13751
561275009549	PE family; Region: PE; pfam00934
561275009550	enoyl-CoA hydratase; Region: PLN02864
561275009551	The hotdog fold was initially identified in the E. coli FabA (beta-hydroxydecanoyl-acyl carrier protein (ACP)-dehydratase) structure and subsequently in 4HBT (4-hydroxybenzoyl-CoA thioesterase) from Pseudomonas. A number of other seemingly unrelated...; Region: hot_dog; cl00509
561275009552	HDE_HSD  The R-hydratase-like hot dog fold of the 17-beta-hydroxysteriod dehydrogenase (HSD), and Hydratase-Dehydrogenase-Epimerase (HDE) proteins.  Other enzymes with this fold include MaoC dehydratase, and the fatty acid synthase beta subunit; Region: HDE_HSD; cd03448
561275009553	dimer interaction site [polypeptide binding]; other site
561275009554	substrate-binding tunnel; other site
561275009555	active site
561275009556	catalytic site [active]
561275009557	substrate binding site [chemical binding]; other site
561275009558	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
561275009559	short chain dehydrogenase; Provisional; Region: PRK07201
561275009560	Pseudomonas fluorescens MupV-like, extended (e) SDRs; Region: MupV_like_SDR_e; cd05263
561275009561	putative NAD(P) binding site [chemical binding]; other site
561275009562	active site
561275009563	putative substrate binding site [chemical binding]; other site
561275009564	classical (c) SDRs; Region: SDR_c; cd05233
561275009565	NAD(P) binding site [chemical binding]; other site
561275009566	active site
561275009567	Mycolic acid cyclopropane synthetase; Region: CMAS; pfam02353
561275009568	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275009569	S-adenosylmethionine binding site [chemical binding]; other site
561275009570	NH_3: A subgroup of nucleoside hydrolases. This group contains eukaryotic and bacterial proteins similar to nucleoside hydrolases. Nucleoside hydrolases cleave the N-glycosidic bond in nucleosides generating ribose and the respective base. These enzymes...; Region: nuc_hydro_3; cd02653
561275009571	active site
561275009572	DNA Polymerase Y-family; Region: PolY_like; cd03468
561275009573	DNA binding site [nucleotide binding]
561275009574	GMP synthase; Reviewed; Region: guaA; PRK00074
561275009575	Type 1 glutamine amidotransferase (GATase1) domain found in GMP synthetase; Region: GATase1_GMP_Synthase; cd01742
561275009576	AMP/PPi binding site [chemical binding]; other site
561275009577	candidate oxyanion hole; other site
561275009578	catalytic triad [active]
561275009579	potential glutamine specificity residues [chemical binding]; other site
561275009580	The C-terminal domain of GMP synthetase. It contains two subdomains; the ATP pyrophosphatase domain which closes to the N-termial and the dimerization domain at C-terminal end. The ATP-PPase is a twisted, five-stranded parallel beta-sheet sandwiched...; Region: GMP_synthase_C; cd01997
561275009581	ATP Binding subdomain [chemical binding]; other site
561275009582	Ligand Binding sites [chemical binding]; other site
561275009583	Dimerization subdomain; other site
561275009584	Trans-Isoprenyl Diphosphate Synthases, head-to-head; Region: Trans_IPPS_HH; cd00683
561275009585	active site lid residues [active]
561275009586	substrate binding pocket [chemical binding]; other site
561275009587	catalytic residues [active]
561275009588	substrate-Mg2+ binding site; other site
561275009589	aspartate-rich region 1; other site
561275009590	aspartate-rich region 2; other site
561275009591	Geranylgeranyl pyrophosphate synthase [Coenzyme metabolism]; Region: IspA; COG0142
561275009592	Trans-Isoprenyl Diphosphate Synthases, head-to-tail; Region: Trans_IPPS_HT; cd00685
561275009593	substrate binding pocket [chemical binding]; other site
561275009594	chain length determination region; other site
561275009595	substrate-Mg2+ binding site; other site
561275009596	catalytic residues [active]
561275009597	aspartate-rich region 1; other site
561275009598	active site lid residues [active]
561275009599	aspartate-rich region 2; other site
561275009600	O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315
561275009601	methyltransferase, TIGR00027 family; Region: mthyl_TIGR00027
561275009602	beta-phosphoglucomutase family hydrolase; Region: PGMB-YQAB-SF; TIGR02009
561275009603	HAD-hyrolase-like; Region: Hydrolase_like; pfam13242
561275009604	Trehalose and maltose hydrolases (possible phosphorylases) [Carbohydrate transport and metabolism]; Region: ATH1; COG1554
561275009605	Glycosyl hydrolase family 65, N-terminal domain; Region: Glyco_hydro_65N; pfam03636
561275009606	Glycosyl hydrolase family 65 central catalytic domain; Region: Glyco_hydro_65m; pfam03632
561275009607	Glycosyl hydrolase family 65, C-terminal domain; Region: Glyco_hydro_65C; pfam03633
561275009608	VNTR3820 is located between Rv3401 and Rv3402c. Differs from BCG Pasteur by a 59-bp in VNTR3820 locus of BCG Tokyo. The copy number of the 59-bp unit is 3 in BCG Tokyo and 4 in BCG Pasteur.
561275009609	Predicted pyridoxal phosphate-dependent enzyme apparently involved in regulation of cell wall biogenesis [Cell envelope biogenesis, outer membrane]; Region: WecE; COG0399
561275009610	Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes. PLP combines with an alpha-amino acid to form a compound called a Schiff base or aldimine intermediate, which depending on the reaction, is the...; Region: AAT_I; cl00321
561275009611	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
561275009612	catalytic residue [active]
561275009613	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4529
561275009614	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
561275009615	hypothetical protein; Provisional; Region: PRK07579
561275009616	Formyltransferase, catalytic core domain; Region: FMT_core; cd08369
561275009617	active site
561275009618	cosubstrate binding site; other site
561275009619	substrate binding site [chemical binding]; other site
561275009620	catalytic site [active]
561275009621	nonfunctional due to frameshift. A 22-bp deletion in Rv3405c of BCG Tokyo.
561275009622	RD16 Japan
561275009623	Probable taurine catabolism dioxygenase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: TauD; COG2175
561275009624	Clavaminic acid synthetase (CAS) -like;  CAS is a trifunctional Fe(II)/ 2-oxoglutarate (2OG) oxygenase carrying out three reactions in the biosynthesis of clavulanic acid, an inhibitor of class A serine beta-lactamases. In general, Fe(II)-2OG oxygenases...; Region: CAS_like; cl00184
561275009625	Antitoxin of toxin-antitoxin stability system [Cell division and chromosome partitioning]; Region: Phd; COG4118
561275009626	PIN domain of the hypothetical protein MT3492 of Mycobacterium tuberculosis CDC1551 and other uncharacterized, annotated PilT protein domain proteins; Region: PIN_MT3492; cd09874
561275009627	putative active site [active]
561275009628	Choline dehydrogenase and related flavoproteins [Amino acid transport and metabolism]; Region: BetA; COG2303
561275009629	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
561275009630	GMC oxidoreductase; Region: GMC_oxred_C; pfam05199
561275009631	inosine 5-monophosphate dehydrogenase; Validated; Region: PRK08649
561275009632	TIM barrel proteins share a structurally conserved phosphate binding motif and in general share an eight beta/alpha closed barrel structure. Specific for this family is the conserved phosphate binding site at the edges of strands 7 and 8. The phosphate...; Region: TIM_phosphate_binding; cl17186
561275009633	phosphate binding site [ion binding]; other site
561275009634	inosine 5'-monophosphate dehydrogenase; Reviewed; Region: PRK05567
561275009635	TIM barrel proteins share a structurally conserved phosphate binding motif and in general share an eight beta/alpha closed barrel structure. Specific for this family is the conserved phosphate binding site at the edges of strands 7 and 8. The phosphate...; Region: TIM_phosphate_binding; cl17186
561275009636	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains in the inosine 5' monophosphate dehydrogenase (IMPDH) protein.  IMPDH is an essential enzyme that catalyzes the first step unique to GTP synthesis, playing a...; Region: CBS_pair_IMPDH; cd04601
561275009637	IMPDH: The catalytic domain of the inosine monophosphate dehydrogenase. IMPDH catalyzes the NAD-dependent oxidation of inosine 5'-monophosphate (IMP) to xanthosine 5' monophosphate (XMP). It is a rate-limiting step in the de novo synthesis of...; Region: IMPDH; cd00381
561275009638	active site
561275009639	RNA polymerase sigma factor SigD; Reviewed; Region: PRK09648
561275009640	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
561275009641	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
561275009642	DNA binding residues [nucleotide binding]
561275009643	Transcription factor WhiB; Region: Whib; pfam02467
561275009644	chaperonin GroEL; Reviewed; Region: groEL; PRK12849
561275009645	GroEL_like type I chaperonin. Chaperonins are involved in productive folding of proteins. They share a common general morphology, a double toroid of 2 stacked rings, each composed of 7-9 subunits. The symmetry of type I is seven-fold and they are found...; Region: GroEL; cd03344
561275009646	ring oligomerisation interface [polypeptide binding]; other site
561275009647	ATP/Mg binding site [chemical binding]; other site
561275009648	stacking interactions; other site
561275009649	hinge regions; other site
561275009650	Chaperonin 10 Kd subunit (cpn10 or GroES); Cpn10 cooperates with chaperonin 60 (cpn60 or GroEL), an ATPase, to assist the folding and assembly of proteins and is found in eubacterial cytosol, as well as in the matrix of mitochondria and chloroplasts. It...; Region: cpn10; cd00320
561275009651	oligomerisation interface [polypeptide binding]; other site
561275009652	mobile loop; other site
561275009653	roof hairpin; other site
561275009654	UGMP family protein; Validated; Region: PRK09604
561275009655	ribosomal-protein-alanine acetyltransferase; Region: rimI; TIGR01575
561275009656	Acetyltransferase (GNAT) family; Region: Acetyltransf_1; pfam00583
561275009657	Coenzyme A binding pocket [chemical binding]; other site
561275009658	Inactive homolog of metal-dependent proteases, putative molecular chaperone [Posttranslational modification, protein turnover, chaperones]; Region: COG1214
561275009659	Uncharacterized P-loop hydrolase UPF0079; Region: UPF0079; pfam02367
561275009660	alanine racemase; Reviewed; Region: alr; PRK00053
561275009661	Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzyme Alanine Racemase; Region: PLPDE_III_AR; cd00430
561275009662	active site
561275009663	pyridoxal 5'-phosphate (PLP) binding site [chemical binding]; other site
561275009664	dimer interface [polypeptide binding]; other site
561275009665	substrate binding site [chemical binding]; other site
561275009666	catalytic residues [active]
561275009667	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275009668	PPE family; Region: PPE; pfam00823
561275009669	In Mycobacterium bovis BCG Pasteur, BCG Tokyo, and Mycobacterium bovis, a large deletion of 4926 bp (RD6) leads to the loss of the COOH part of PPE57, and the following CDSs, PPE58, Rv3427c, Rv3428c and the NH2-part of PPE59 compared to Mycobacterium tuberculosis strain H37Rv
561275009670	Integrase core domain; Region: rve; pfam00665
561275009671	Integrase core domain; Region: rve_3; pfam13683
561275009672	Transposase, Mutator family; Region: Transposase_mut; pfam00872
561275009673	MULE transposase domain; Region: MULE; pfam10551
561275009674	DOPA decarboxylase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to DOPA/tyrosine decarboxylase (DDC), histidine decarboxylase (HDC), and...; Region: DOPA_deC_like; cd06450
561275009675	pyridoxal 5'-phosphate binding site [chemical binding]; other site
561275009676	catalytic residue [active]
561275009677	Uncharacterized conserved protein [Function unknown]; Region: COG0062
561275009678	B.subtilis YXKO protein of unknown function and related proteins. Based on the conservation of the ATP binding site, the substrate binding site and the Mg2+binding site and structural homology this group is a member of the ribokinase-like superfamily; Region: YXKO-related; cd01171
561275009679	putative substrate binding site [chemical binding]; other site
561275009680	putative ATP binding site [chemical binding]; other site
561275009681	glucosamine--fructose-6-phosphate aminotransferase; Reviewed; Region: PRK00331
561275009682	Glutamine amidotransferases class-II (Gn-AT)_GFAT-type. This domain is found at the N-terminus of glucosamine-6P synthase (GlmS, or GFAT in humans).  The glutaminase domain catalyzes amide nitrogen transfer from glutamine to the appropriate substrate. In...; Region: GFAT; cd00714
561275009683	glutaminase active site [active]
561275009684	SIS (Sugar ISomerase) domain repeat 1 found in Glucosamine 6-phosphate synthase (GlmS) and Glucosamine-6-phosphate deaminase (GlmD). The SIS domain is found in many phosphosugar isomerases and phosphosugar binding proteins. GlmS contains a N-terminal...; Region: SIS_GlmS_GlmD_1; cd05008
561275009685	dimer interface [polypeptide binding]; other site
561275009686	active site
561275009687	SIS (Sugar ISomerase) domain repeat 2 found in Glucosamine 6-phosphate synthase (GlmS) and Glucosamine-6-phosphate deaminase (GlmD). The SIS domain is found in many phosphosugar isomerases and phosphosugar binding proteins. GlmS contains a N-terminal...; Region: SIS_GlmS_GlmD_2; cd05009
561275009688	dimer interface [polypeptide binding]; other site
561275009689	active site
561275009690	Protein of unknown function (DUF2510); Region: DUF2510; pfam10708
561275009691	phosphoglucosamine mutase; Provisional; Region: glmM; PRK14318
561275009692	GlmM is a bacterial phosphoglucosamine mutase (PNGM) that belongs to the alpha-D-phosphohexomutase superfamily. It is required for the interconversion of glucosamine-6-phosphate and glucosamine-1-phosphate in the biosynthetic pathway of...; Region: GlmM; cd05802
561275009693	active site
561275009694	substrate binding site [chemical binding]; other site
561275009695	metal binding site [ion binding]; metal-binding site
561275009696	30S ribosomal protein S9; Reviewed; Region: rpsI; PRK00132
561275009697	Ribosomal protein L13.  Protein L13, a large ribosomal subunit protein, is one of five proteins required for an early folding intermediate of 23S rRNA in the assembly of the large subunit. L13 is situated on the bottom of the large subunit, near the...; Region: Ribosomal_L13; cd00392
561275009698	23S rRNA interface [nucleotide binding]; other site
561275009699	L3 interface [polypeptide binding]; other site
561275009700	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4842
561275009701	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4842
561275009702	type VII secretion-associated protein, Rv3446c family, C-terminal domain; Region: T7SS_Rv3446c; TIGR03931
561275009703	type VII secretion protein EccCa; Region: T7SS_EccC_a; TIGR03924
561275009704	FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580
561275009705	type VII secretion protein EccCb; Region: T7SS_EccC_b; TIGR03925
561275009706	FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580
561275009707	FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580
561275009708	type VII secretion integral membrane protein EccD; Region: T7SS_EccD; TIGR03920
561275009709	type VII secretion-associated serine protease mycosin; Region: T7SS_mycosin; TIGR03921
561275009710	Peptidase domain in the S8 and S53 families; Region: Peptidases_S8_S53; cl10459
561275009711	active site
561275009712	catalytic residues [active]
561275009713	Protein of unknown function (DUF690); Region: DUF690; pfam05108
561275009714	Cutinase; Region: Cutinase; pfam01083
561275009715	Cutinase; Region: Cutinase; pfam01083
561275009716	Solute carrier families 5 and 6-like; solute binding domain; Region: SLC5-6-like_sbd; cl00456
561275009717	Eukaryotic and bacterial pseudouridine synthases similar to E.  coli TruA; Region: PseudoU_synth_EcTruA; cd02570
561275009718	tRNA pseudouridine synthase A; Validated; Region: truA; PRK00021
561275009719	active site
561275009720	dimerization interface 3.5A [polypeptide binding]; other site
561275009721	50S ribosomal protein L17; Validated; Region: rplQ; PRK05591
561275009722	DNA-directed RNA polymerase subunit alpha; Provisional; Region: PRK05182
561275009723	N-terminal domain of the Alpha subunit of Bacterial RNA polymerase; Region: RNAP_alpha_NTD; cd06928
561275009724	alphaNTD - beta interaction site [polypeptide binding]; other site
561275009725	alphaNTD homodimer interface [polypeptide binding]; other site
561275009726	alphaNTD - beta' interaction site [polypeptide binding]; other site
561275009727	Bacterial RNA polymerase, alpha chain C terminal domain; Region: RNA_pol_A_CTD; pfam03118
561275009728	30S ribosomal protein S4; Validated; Region: rpsD; PRK05327
561275009729	Ribosomal protein S4/S9 N-terminal domain; Region: Ribosomal_S4; pfam00163
561275009730	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
561275009731	RNA binding surface [nucleotide binding]; other site
561275009732	30S ribosomal protein S11; Validated; Region: PRK05309
561275009733	30S ribosomal protein S13; Validated; Region: rpsM; PRK05179
561275009734	30S ribosomal protein S13; Region: bact_S13; TIGR03631
561275009735	50S ribosomal protein L36; Reviewed; Region: rpmJ; PRK00465
561275009736	S1_IF1: Translation Initiation Factor IF1, S1-like RNA-binding domain. IF1 contains an S1-like RNA-binding domain, which is found in a wide variety of RNA-associated proteins. Translation initiation includes a number of interrelated steps preceding the...; Region: S1_IF1; cd04451
561275009737	rRNA binding site [nucleotide binding]; other site
561275009738	predicted 30S ribosome binding site; other site
561275009739	probable F420-dependent oxidoreductase, MSMEG_4141 family; Region: F420_MSMEG_4141; TIGR03620
561275009740	F420-dependent oxidoreductase, MSMEG_4879 family; Region: F420_MSMEG_4879; TIGR03564
561275009741	dTDP-D-glucose 4,6-dehydratase [Cell envelope biogenesis, outer membrane]; Region: RfbB; COG1088
561275009742	dTDP-D-glucose 4,6-dehydratase, extended (e) SDRs; Region: dTDP_GD_SDR_e; cd05246
561275009743	NAD binding site [chemical binding]; other site
561275009744	substrate binding site [chemical binding]; other site
561275009745	homodimer interface [polypeptide binding]; other site
561275009746	active site
561275009747	dTDP-4-dehydrorhamnose 3,5-epimerase; Region: dTDP_sugar_isom; pfam00908
561275009748	Domain of unknown function (DUF222); Region: DUF222; pfam02720
561275009749	Domain of unknown function (DUF222); Region: DUF222; pfam02720
561275009750	HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085
561275009751	active site
561275009752	Nucleoside-diphosphate-sugar epimerases [Cell envelope biogenesis, outer membrane / Carbohydrate transport and metabolism]; Region: WcaG; COG0451
561275009753	extended (e) SDRs; Region: SDR_e; cd08946
561275009754	NAD(P) binding site [chemical binding]; other site
561275009755	active site
561275009756	4-hyroxy-2-oxovalerate/4-hydroxy-2-oxopentanoic acid aldolase,; Validated; Region: PRK08195
561275009757	DRE-TIM metallolyase superfamily; Region: DRE_TIM_metallolyase; cl07974
561275009758	active site
561275009759	catalytic residues [active]
561275009760	metal binding site [ion binding]; metal-binding site
561275009761	Thiamine pyrophosphate-requiring enzymes [acetolactate synthase, pyruvate dehydrogenase (cytochrome), glyoxylate carboligase, phosphonopyruvate decarboxylase] [Amino acid transport and metabolism / Coenzyme metabolism]; Region: IlvB; COG0028
561275009762	Pyrimidine (PYR) binding domain of POX and related proteins; Region: TPP_PYR_POX_like; cd07035
561275009763	PYR/PP interface [polypeptide binding]; other site
561275009764	dimer interface [polypeptide binding]; other site
561275009765	TPP binding site [chemical binding]; other site
561275009766	Thiamine pyrophosphate enzyme, central domain; Region: TPP_enzyme_M; pfam00205
561275009767	Thiamine pyrophosphate (TPP) enzyme family, TPP-binding module; found in many key metabolic enzymes which use TPP (also known as thiamine diphosphate) as a cofactor. These enzymes include, among others, the E1 components of the pyruvate, the acetoin and...; Region: TPP_enzymes; cd00568
561275009768	TPP-binding site [chemical binding]; other site
561275009769	Mannose-6-phosphate isomerase [Carbohydrate transport and metabolism]; Region: {ManC}; COG0662
561275009770	Nuclear transport factor 2 (NTF2-like) superfamily. This family includes members of the NTF2 family, Delta-5-3-ketosteroid isomerases, Scytalone Dehydratases, and the beta subunit of Ring hydroxylating dioxygenases. This family is a classic example of...; Region: NTF2_like; cd00531
561275009771	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
561275009772	Novel bacterial esterase that cleaves esters on halogenated cyclic compounds; Region: Esterase_713_like; cl17303
561275009773	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
561275009774	metabolite-proton symporter; Region: 2A0106; TIGR00883
561275009775	putative substrate translocation pore; other site
561275009776	PE family; Region: PE; pfam00934
561275009777	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275009778	PPE family; Region: PPE; pfam00823
561275009779	Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484
561275009780	patatin-related protein; Region: TIGR03607
561275009781	In Mycobacterium tuberculosis strain H37Rv, Rv3479 exists as a single gene. In Mycobacterium bovis BCG Pasteur, BCG Tokyo, and Mycobacterium bovis, a 713 bp deletion (RD18) splits Rv3479 into 2 parts, Mb3507 and Mb3508. Differs from Rv3479 by 1aa, R174L in Mycobacterium bovis, BCG Pasteur, and BCG Tokyo
561275009782	Protein of unknown function (DUF3376); Region: DUF3376; pfam11856
561275009783	acyltransferase, WS/DGAT/MGAT; Region: acyl_WS_DGAT; TIGR02946
561275009784	Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007
561275009785	Protein of unknown function (DUF1298); Region: DUF1298; pfam06974
561275009786	Protein of unknown function (DUF2910); Region: DUF2910; pfam11139
561275009787	Protein of unknown function (DUF2510); Region: DUF2510; pfam10708
561275009788	LppP/LprE lipoprotein; Region: Lipoprotein_21; pfam14041
561275009789	Transcriptional regulator [Transcription]; Region: LytR; COG1316
561275009790	LytR cell envelope-related transcriptional attenuator; Region: LytR_C; pfam13399
561275009791	short chain dehydrogenase; Provisional; Region: PRK05875
561275009792	classical (c) SDRs; Region: SDR_c; cd05233
561275009793	NAD(P) binding site [chemical binding]; other site
561275009794	active site
561275009795	Predicted membrane protein [Function unknown]; Region: COG2259
561275009796	Protein of unknown function (DUF2424); Region: DUF2424; pfam10340
561275009797	alpha/beta hydrolase fold; Region: Abhydrolase_3; pfam07859
561275009798	Predicted transcriptional regulators [Transcription]; Region: COG1695
561275009799	Transcriptional regulator PadR-like family; Region: PadR; pfam03551
561275009800	Trehalose-6-phosphate synthase [Carbohydrate transport and metabolism]; Region: OtsA; COG0380
561275009801	Trehalose-6-Phosphate Synthase (TPS) is a glycosyltransferase that catalyses the synthesis of alpha,alpha-1,1-trehalose-6-phosphate from glucose-6-phosphate using a UDP-glucose donor. It is a key enzyme in the trehalose synthesis pathway. Trehalose is a...; Region: GT1_TPS; cd03788
561275009802	active site
561275009803	homotetramer interface [polypeptide binding]; other site
561275009804	virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996
561275009805	mce related protein; Region: MCE; pfam02470
561275009806	virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996
561275009807	mce related protein; Region: MCE; pfam02470
561275009808	mce related protein; Region: MCE; pfam02470
561275009809	virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996
561275009810	Protein of unknown function (DUF3407); Region: DUF3407; pfam11887
561275009811	virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996
561275009812	mce related protein; Region: MCE; pfam02470
561275009813	virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996
561275009814	mce related protein; Region: MCE; pfam02470
561275009815	virulence factor Mce family protein; Region: Mtu_fam_mce; TIGR00996
561275009816	mce related protein; Region: MCE; pfam02470
561275009817	Protein of unknown function (DUF3407); Region: DUF3407; pfam11887
561275009818	ABC-type transport system involved in resistance to organic solvents, permease component [Secondary metabolites biosynthesis, transport, and catabolism]; Region: Ttg2B; COG0767
561275009819	Permease; Region: Permease; pfam02405
561275009820	ABC-type transport system involved in resistance to organic solvents, permease component [Secondary metabolites biosynthesis, transport, and catabolism]; Region: Ttg2B; COG0767
561275009821	Permease; Region: Permease; pfam02405
561275009822	3-ketoacyl-(acyl-carrier-protein) reductase; Provisional; Region: fabG; PRK07792
561275009823	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
561275009824	NAD(P) binding site [chemical binding]; other site
561275009825	active site
561275009826	Ferredoxin [Energy production and conversion]; Region: Fer; COG1141
561275009827	Protein of unknown function (DUF1271); Region: DUF1271; cl01443
561275009828	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275009829	Putative acyl-CoA dehydrogenases similar to fadE6, fadE17, and fadE26; Region: ACAD_fadE6_17_26; cd01152
561275009830	FAD binding site [chemical binding]; other site
561275009831	substrate binding site [chemical binding]; other site
561275009832	catalytic base [active]
561275009833	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275009834	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
561275009835	active site
561275009836	acyl-CoA synthetase; Validated; Region: PRK07867
561275009837	Fatty acid transport proteins (FATP) play dual roles as fatty acid transporters and its activation enzymes; Region: FATP_FACS; cd05940
561275009838	acyl-activating enzyme (AAE) consensus motif; other site
561275009839	putative AMP binding site [chemical binding]; other site
561275009840	putative active site [active]
561275009841	putative CoA binding site [chemical binding]; other site
561275009842	PE family; Region: PE; pfam00934
561275009843	PE family; Region: PE; pfam00934
561275009844	RD20, 603 bp. Region of difference RD20, deleted region in Mycobacterium bovis BCG Pasteur (position 3913496..3913497), BCG Tokyo (position 3911405..3911406), and Mycobacterium bovis AF2122/97 (position 3879493..3879494) compared to Mycobacterium tuberculosis H37Rv (position: 3933940..3934542). In-frame deletion in PE_PGRS54 gene.
561275009845	I-RD10, 1152 bp. Region of difference I-RD10, inserted region of 1152bp (position 3915236..3916387,1152bp) and 1179bp (position 3912915..3914093), in Mycobacterium bovis BCG Pasteur and in BCG Tokyo, compared to Mycobacterium tuberculosis H37Rv (position: 3936338..3936339) and of 1827bp (position 3914354..3916180, 1827bp) compared to Mycobacterium bovis AF2122/97 (position 3880368..3880369). In-frame insertion in PE_PGRS54 gene.
561275009846	hypothetical protein; Validated; Region: PRK07586
561275009847	Pyrimidine (PYR) binding domain of POX and related proteins; Region: TPP_PYR_POX_like; cd07035
561275009848	PYR/PP interface [polypeptide binding]; other site
561275009849	dimer interface [polypeptide binding]; other site
561275009850	TPP binding site [chemical binding]; other site
561275009851	Thiamine pyrophosphate (TPP) family, BFDC subfamily, TPP-binding module; composed of proteins similar to Pseudomonas putida benzoylformate decarboxylase (BFDC). P. putida BFDC plays a role in the mandelate pathway, catalyzing the conversion of...; Region: TPP_BFDC; cd02002
561275009852	TPP-binding site [chemical binding]; other site
561275009853	dimer interface [polypeptide binding]; other site
561275009854	Predicted metal-dependent hydrolase of the TIM-barrel fold [General function prediction only]; Region: COG2159
561275009855	PE family; Region: PE; pfam00934
561275009856	I-RD11, 344 bp. Region of difference I-RD11, inserted region in Mycobacterium bovis BCG Pasteur (position 3921785..3922128, 344bp) and Mycobacterium bovis AF2122/97 (position 3885973..3886316, 344bp) compared to Mycobacterium tuberculosis H37Rv (position: 3941726..3941727) and BCG Tokyo (position 3919383..3919384). Merges PE_PGRS55(Rv3511) and PE_PGRS56(Rv3512) in a single gene, PE_PGRS55. The PE_PGRS55 gene of BCG Tokyo (5088bp) is 345bp shorter than that of BCG Pasteur (5433bp). As 345bp is the length of a repeat in the gene, the difference reflected the copy number of both BCG strains.
561275009857	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
561275009858	CoA binding site [chemical binding]; other site
561275009859	PE family; Region: PE; pfam00934
561275009860	S-RD12, 925 bp. Region of difference S-RD12, substituted region in Mycobacterium bovis BCG Pasteur (position 3927720..3928644, 925bp), BCG Tokyo (position 3925082..3926006, 925bp) and Mycobacterium bovis AF2122/97 (position 3892403..3892967, 565bp) compared to Mycobacterium tuberculosis H37Rv (position 3947672..3949750, 2079bp). In Mycobacterium bovis BCG Pasteur, an in-frame insertion of 360bp in PE_PGRS57 gene leads to a longer product compared to Mycobacterium bovis AF2122/97 ones.
561275009861	acyl-CoA synthetase; Validated; Region: PRK07798
561275009862	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
561275009863	Uncharacterized subfamily of fatty acid CoA ligase (FACL); Region: FACL_like_5; cd05924
561275009864	acyl-activating enzyme (AAE) consensus motif; other site
561275009865	acyl-activating enzyme (AAE) consensus motif; other site
561275009866	putative AMP binding site [chemical binding]; other site
561275009867	putative active site [active]
561275009868	putative CoA binding site [chemical binding]; other site
561275009869	enoyl-CoA hydratase; Provisional; Region: PRK07799
561275009870	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
561275009871	substrate binding site [chemical binding]; other site
561275009872	oxyanion hole (OAH) forming residues; other site
561275009873	trimer interface [polypeptide binding]; other site
561275009874	Domain of unknown function (DUF4095); Region: DUF4095; pfam13338
561275009875	Cytochrome P450; Region: p450; cl12078
561275009876	Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124
561275009877	Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124
561275009878	Acetoacetate decarboxylase (ADC); Region: ADC; pfam06314
561275009879	N5,N10-methylenetetrahydromethanopterin reductase (Mer) catalyzes the reduction of N5,N10-methylenetetrahydromethanopterin with reduced coenzyme F420 to N5-methyltetrahydromethanopterin and oxidized coenzyme F420; Region: Tetrahydromethanopterin_reductase; cd01097
561275009880	probable F420-dependent oxidoreductase, Rv3520c family; Region: F420_Rv3520c; TIGR03559
561275009881	DUF35 OB-fold domain; Region: DUF35; pfam01796
561275009882	Predicted nucleic-acid-binding protein containing a Zn-ribbon [General function prediction only]; Region: COG1545
561275009883	DUF35 OB-fold domain; Region: DUF35; pfam01796
561275009884	lipid-transfer protein; Provisional; Region: PRK07937
561275009885	Thiolase domain associated with sterol carrier protein (SCP)-x isoform and related proteins; SCP-2  has multiple roles in intracellular lipid circulation and metabolism. The N-terminal presequence in the SCP-x isoform represents a peroxisomal...; Region: SCP-x_thiolase; cd00829
561275009886	active site
561275009887	acetyl-CoA acetyltransferase; Provisional; Region: PRK08313
561275009888	Thiolase domain associated with sterol carrier protein (SCP)-x isoform and related proteins; SCP-2  has multiple roles in intracellular lipid circulation and metabolism. The N-terminal presequence in the SCP-x isoform represents a peroxisomal...; Region: SCP-x_thiolase; cd00829
561275009889	active site
561275009890	NHL repeat; Region: NHL; pfam01436
561275009891	Uncharacterized conserved protein [Function unknown]; Region: COG3391
561275009892	NHL repeat; Region: NHL; pfam01436
561275009893	NHL repeat; Region: NHL; pfam01436
561275009894	NHL repeat; Region: NHL; pfam01436
561275009895	NHL repeat; Region: NHL; pfam01436
561275009896	Carbonic anhydrases/acetyltransferases, isoleucine patch superfamily [General function prediction only]; Region: PaaY; COG0663
561275009897	Gamma carbonic anhydrase-like: This family is composed of gamma carbonic anhydrase (CA), Ferripyochelin Binding Protein (FBP), E. coli paaY protein, and similar proteins. CAs are zinc-containing enzymes that catalyze the reversible hydration of carbon...; Region: LbH_gamma_CA_like; cd04645
561275009898	trimer interface [polypeptide binding]; other site
561275009899	putative metal binding site [ion binding]; other site
561275009900	Phenylpropionate dioxygenase and related ring-hydroxylating dioxygenases, large terminal subunit [Inorganic ion transport and metabolism / General function prediction only]; Region: HcaE; COG4638
561275009901	The alignment model represents the N-terminal rieske iron-sulfur domain of KshA, the oxygenase component of 3-ketosteroid 9-alpha-hydroxylase (KSH).  The terminal oxygenase component of KSH is a key enzyme in the microbial steroid degradation pathway; Region: Rieske_RO_Alpha_KSH; cd03531
561275009902	Sulfotransferase family; Region: Sulfotransfer_3; pfam13469
561275009903	short chain dehydrogenase; Provisional; Region: PRK07890
561275009904	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
561275009905	NAD(P) binding site [chemical binding]; other site
561275009906	active site
561275009907	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275009908	PPE family; Region: PPE; pfam00823
561275009909	Polymorphic PE/PPE proteins C terminal; Region: PE_PPE_C; pfam12484
561275009910	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275009911	PPE family; Region: PPE; pfam00823
561275009912	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275009913	Pentapeptide repeats (8 copies); Region: Pentapeptide_2; pfam01469
561275009914	4-hyroxy-2-oxovalerate/4-hydroxy-2-oxopentanoic acid aldolase,; Validated; Region: PRK08195
561275009915	4-hydroxy-2-oxovalerate aldolase, N-terminal catalytic TIM barrel domain; Region: DRE_TIM_HOA; cd07943
561275009916	active site
561275009917	catalytic residues [active]
561275009918	metal binding site [ion binding]; metal-binding site
561275009919	DmpG-like communication domain; Region: DmpG_comm; pfam07836
561275009920	acetaldehyde dehydrogenase; Validated; Region: PRK08300
561275009921	Semialdehyde dehydrogenase, NAD binding domain; Region: Semialdhyde_dh; smart00859
561275009922	Prokaryotic acetaldehyde dehydrogenase, dimerisation; Region: AcetDehyd-dimer; pfam09290
561275009923	2-keto-4-pentenoate hydratase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3971
561275009924	3-ketosteroid-delta-1-dehydrogenase; Reviewed; Region: PRK07843
561275009925	putative FAD-binding dehydrogenase; Reviewed; Region: PRK12834
561275009926	enoyl-CoA hydratase; Region: PLN02864
561275009927	The hotdog fold was initially identified in the E. coli FabA (beta-hydroxydecanoyl-acyl carrier protein (ACP)-dehydratase) structure and subsequently in 4HBT (4-hydroxybenzoyl-CoA thioesterase) from Pseudomonas. A number of other seemingly unrelated...; Region: hot_dog; cl00509
561275009928	HDE_HSD  The R-hydratase-like hot dog fold of the 17-beta-hydroxysteriod dehydrogenase (HSD), and Hydratase-Dehydrogenase-Epimerase (HDE) proteins.  Other enzymes with this fold include MaoC dehydratase, and the fatty acid synthase beta subunit; Region: HDE_HSD; cd03448
561275009929	dimer interaction site [polypeptide binding]; other site
561275009930	substrate-binding tunnel; other site
561275009931	active site
561275009932	catalytic site [active]
561275009933	substrate binding site [chemical binding]; other site
561275009934	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275009935	PPE family; Region: PPE; pfam00823
561275009936	PE-PPE domain; Region: PE-PPE; pfam08237
561275009937	lipid-transfer protein; Provisional; Region: PRK07855
561275009938	Thiolase domain associated with sterol carrier protein (SCP)-x isoform and related proteins; SCP-2  has multiple roles in intracellular lipid circulation and metabolism. The N-terminal presequence in the SCP-x isoform represents a peroxisomal...; Region: SCP-x_thiolase; cd00829
561275009939	active site
561275009940	SAV4209 is a Streptomyces avermitilis protein with a hot dog fold that is similar to those of (R)-specific enoyl-CoA hydratase, the peroxisomal Hydratase-Dehydrogenase-Epimerase (HDE) protein, and the fatty acid synthase beta subunit.  The alpha- and...; Region: SAV4209; cd03455
561275009941	putative active site [active]
561275009942	putative catalytic site [active]
561275009943	(R)-hydratase [(R)-specific enoyl-CoA hydratase]. Catalyzes the hydration of trans-2-enoyl CoA to (R)-3-hydroxyacyl-CoA as part of the PHA (polyhydroxyalkanoate) biosynthetic pathway.  The structure of the monomer includes a five-strand antiparallel...; Region: R_hydratase_like; cd03441
561275009944	active site
561275009945	catalytic site [active]
561275009946	Predicted nucleic-acid-binding protein containing a Zn-ribbon [General function prediction only]; Region: COG1545
561275009947	DUF35 OB-fold domain; Region: DUF35; pfam01796
561275009948	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275009949	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
561275009950	active site
561275009951	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275009952	Acyl-CoA dehydrogenase, N-terminal domain; Region: Acyl-CoA_dh_N; pfam02771
561275009953	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
561275009954	active site
561275009955	Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124
561275009956	Cytochrome P450; Region: p450; cl12078
561275009957	acetyl-CoA acetyltransferase; Provisional; Region: PRK07850
561275009958	Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751
561275009959	dimer interface [polypeptide binding]; other site
561275009960	active site
561275009961	Domain of unknown function (DUF385); Region: DUF385; pfam04075
561275009962	short chain dehydrogenase; Provisional; Region: PRK07791
561275009963	(3R)-hydroxyacyl-CoA dehydrogenase-like, classical(c)-like SDRs; Region: hydroxyacyl-CoA-like_DH_SDR_c-like; cd05353
561275009964	homodimer interface [polypeptide binding]; other site
561275009965	NAD binding site [chemical binding]; other site
561275009966	active site
561275009967	short chain dehydrogenase; Provisional; Region: PRK07856
561275009968	classical (c) SDRs; Region: SDR_c; cd05233
561275009969	NAD(P) binding site [chemical binding]; other site
561275009970	active site
561275009971	enoyl-CoA hydratase; Provisional; Region: PRK06495
561275009972	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
561275009973	substrate binding site [chemical binding]; other site
561275009974	oxyanion hole (OAH) forming residues; other site
561275009975	trimer interface [polypeptide binding]; other site
561275009976	Acyl CoA:acetate/3-ketoacid CoA transferase, alpha subunit [Lipid metabolism]; Region: AtoD; COG1788
561275009977	Acyl CoA:acetate/3-ketoacid CoA transferase, beta subunit [Lipid metabolism]; Region: AtoA; COG2057
561275009978	Nitronate monooxygenase; Region: NMO; pfam03060
561275009979	2-Nitropropane dioxygenase (NPD), one of the nitroalkane oxidizing enzyme families, catalyzes oxidative denitrification of nitroalkanes to their corresponding carbonyl compounds and nitrites. NDP is a member of the NAD(P)H-dependent flavin oxidoreductase...; Region: NPD_like; cd04730
561275009980	FMN binding site [chemical binding]; other site
561275009981	substrate binding site [chemical binding]; other site
561275009982	putative catalytic residue [active]
561275009983	Fatty acid desaturase [Lipid metabolism]; Region: DesA; COG3239
561275009984	Beta-carotene hydroxylase (CrtR), the carotenoid zeaxanthin biosynthetic enzyme catalyzes the addition of hydroxyl groups to the beta-ionone rings of beta-carotene to form zeaxanthin and is found in bacteria and red algae. Carotenoids are important...; Region: CrtR_beta-carotene-hydroxylase; cd03514
561275009985	putative di-iron ligands [ion binding]; other site
561275009986	phenylacetate-CoA oxygenase/reductase, PaaK subunit; Region: PA_CoA_Oxy5; TIGR02160
561275009987	NAD(P) binding domain of ferredoxin reductase like phenylacetic acid (PA) degradation oxidoreductase. PA oxidoreductases of E. coli hydroxylate PA-CoA in the second step of PA degradation. Members of this group typically fuse a ferredoxin reductase-like...; Region: PA_degradation_oxidoreductase_like; cd06214
561275009988	FAD binding pocket [chemical binding]; other site
561275009989	FAD binding motif [chemical binding]; other site
561275009990	phosphate binding motif [ion binding]; other site
561275009991	beta-alpha-beta structure motif; other site
561275009992	NAD(p) ribose binding residues [chemical binding]; other site
561275009993	NAD binding pocket [chemical binding]; other site
561275009994	NAD(P)-pyrophosphate-nicotinamide binding residues [chemical binding]; other site
561275009995	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
561275009996	catalytic loop [active]
561275009997	iron binding site [ion binding]; other site
561275009998	Domain of unknown function (DUF4095); Region: DUF4095; pfam13338
561275009999	Superfamily of nucleases including Short Patch Repair (Vsr) Endonucleases, archaeal Holliday junction resolvases, MutH methy-directed DNA mismatch-repair endonucleases, and catalytic domains of many restriction endonucleases, such as EcoRI, BamHI, and...; Region: Restriction_endonuclease_like; cl00277
561275010000	putative active site [active]
561275010001	acetyl-CoA acetyltransferase; Provisional; Region: PRK07801
561275010002	Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751
561275010003	dimer interface [polypeptide binding]; other site
561275010004	active site
561275010005	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275010006	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275010007	PPE-repeat proteins [Cell motility and secretion]; Region: COG5651
561275010008	PPE family; Region: PPE; pfam00823
561275010009	short chain dehydrogenase; Provisional; Region: PRK07831
561275010010	classical (c) SDRs; Region: SDR_c; cd05233
561275010011	NAD(P) binding site [chemical binding]; other site
561275010012	active site
561275010013	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275010014	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
561275010015	active site
561275010016	long-chain-fatty-acid--CoA ligase; Validated; Region: PRK07656
561275010017	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
561275010018	Uncharacterized subfamily of fatty acid CoA ligase (FACL); Region: FACL_like_2; cd05917
561275010019	acyl-activating enzyme (AAE) consensus motif; other site
561275010020	putative AMP binding site [chemical binding]; other site
561275010021	putative active site [active]
561275010022	putative CoA binding site [chemical binding]; other site
561275010023	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275010024	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
561275010025	active site
561275010026	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275010027	Acyl-CoA dehydrogenase, N-terminal domain; Region: Acyl-CoA_dh_N; pfam02771
561275010028	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
561275010029	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275010030	active site
561275010031	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275010032	Acyl-CoA dehydrogenase, N-terminal domain; Region: Acyl-CoA_dh_N; pfam02771
561275010033	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
561275010034	active site
561275010035	aspartate aminotransferase; Provisional; Region: PRK05764
561275010036	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
561275010037	pyridoxal 5'-phosphate binding site [chemical binding]; other site
561275010038	homodimer interface [polypeptide binding]; other site
561275010039	catalytic residue [active]
561275010040	Arylamine N-acetyltransferase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: NhoA; COG2162
561275010041	Flavin reductase like domain; Region: Flavin_Reduct; smart00903
561275010042	2,3-dihydroxybiphenyl 1,2-dioxygenase; Region: 23dbph12diox; TIGR03213
561275010043	N-terminal domain of 2,3-dihydroxybiphenyl 1,2-dioxygenase (BphC, EC 1.13.11.39) 1 from Rhodococcus globerulus P6 (BphC1-RGP6) and similar proteins; Region: BphC1-RGP6_N_like; cd07252
561275010044	C-terminal domain of 2,3-dihydroxybiphenyl 1,2-dioxygenase (BphC, EC 1.13.11.39) 1 from Rhodococcus globerulus P6 (BphC1-RGP6) and similar proteins; Region: BphC1-RGP6_C_like; cd07237
561275010045	active site
561275010046	Fe binding site [ion binding]; other site
561275010047	2-hydroxy-6-oxo-6-phenylhexa-2,4-dienoate hydrolase; Region: biphenyl_bphD; TIGR03343
561275010048	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275010049	Naphthocyclinone hydroxylase; Region: NcnH; cd01159
561275010050	Flavin binding site [chemical binding]; other site
561275010051	Flavodoxin reductases (ferredoxin-NADPH reductases) family 1 [Energy production and conversion]; Region: Hmp; COG1018
561275010052	NAD(P) binding domain of ferredoxin reductase like phenylacetic acid (PA) degradation oxidoreductase. PA oxidoreductases of E. coli hydroxylate PA-CoA in the second step of PA degradation. Members of this group typically fuse a ferredoxin reductase-like...; Region: PA_degradation_oxidoreductase_like; cd06214
561275010053	FAD binding pocket [chemical binding]; other site
561275010054	FAD binding motif [chemical binding]; other site
561275010055	phosphate binding motif [ion binding]; other site
561275010056	beta-alpha-beta structure motif; other site
561275010057	NAD(p) ribose binding residues [chemical binding]; other site
561275010058	NAD binding pocket [chemical binding]; other site
561275010059	NAD(P)-pyrophosphate-nicotinamide binding residues [chemical binding]; other site
561275010060	Ferredoxin [Energy production and conversion]; Region: Fdx; COG0633
561275010061	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
561275010062	catalytic loop [active]
561275010063	iron binding site [ion binding]; other site
561275010064	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275010065	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
561275010066	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
561275010067	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275010068	active site
561275010069	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275010070	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275010071	Transcriptional regulators [Transcription]; Region: PurR; COG1609
561275010072	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
561275010073	DNA binding site [nucleotide binding]
561275010074	domain linker motif; other site
561275010075	Ligand-binding domain of uncharacterized DNA-binding regulatory proteins that are members of the LacI-GalR family of bacterial transcription repressors; Region: PBP1_LacI_like_3; cd06279
561275010076	putative dimerization interface [polypeptide binding]; other site
561275010077	putative ligand binding site [chemical binding]; other site
561275010078	PknH-like extracellular domain; Region: PknH_C; pfam14032
561275010079	Predicted Zn-dependent hydrolases of the beta-lactamase fold [General function prediction only]; Region: COG2220
561275010080	Metallo-beta-lactamase superfamily; Region: Lactamase_B; cl00446
561275010081	Na+/H+ antiporter NhaD and related arsenite permeases [Inorganic ion transport and metabolism]; Region: ArsB; COG1055
561275010082	Anion permease ArsB/NhaD.  These permeases have been shown to translocate sodium, arsenate, antimonite, sulfate and organic anions across biological membranes in all three kingdoms of life.  A typical anion permease contains 8-13 transmembrane helices...; Region: ArsB_NhaD_permease; cl17221
561275010083	transmembrane helices; other site
561275010084	Anion permease ArsB/NhaD.  These permeases have been shown to translocate sodium, arsenate, antimonite, sulfate and organic anions across biological membranes in all three kingdoms of life.  A typical anion permease contains 8-13 transmembrane helices...; Region: ArsB_NhaD_permease; cl17221
561275010085	rRNA methylases [Translation, ribosomal structure and biogenesis]; Region: SpoU; COG0566
561275010086	RNA 2'-O ribose methyltransferase substrate binding; Region: SpoU_sub_bind; smart00967
561275010087	SpoU rRNA Methylase family; Region: SpoU_methylase; pfam00588
561275010088	cysteinyl-tRNA synthetase; Validated; Region: cysS; PRK00260
561275010089	nucleotidyl transferase superfamily; Region: nt_trans; cl00015
561275010090	active site
561275010091	HIGH motif; other site
561275010092	nucleotide binding site [chemical binding]; other site
561275010093	catalytic core domain of cysteinyl tRNA synthetase; Region: CysRS_core; cd00672
561275010094	KMSKS motif; other site
561275010095	Anticodon-binding domain of class Ia aminoacyl tRNA synthetases and similar domains; Region: Anticodon_Ia_like; cl12020
561275010096	MECDP_synthase (2-C-methyl-D-erythritol-2,4-cyclodiphosphate synthase), encoded by the ispF gene, catalyzes the formation of 2-C-methyl-D-erythritol 2,4-cyclodiphosphate (MEC) in the non-mevalonate deoxyxylulose (DOXP) pathway for isoprenoid biosynthesis; Region: MECDP_synthase; cd00554
561275010097	homotrimer interaction site [polypeptide binding]; other site
561275010098	zinc binding site [ion binding]; other site
561275010099	CDP-binding sites; other site
561275010100	CDP-ME synthetase is involved in mevalonate-independent isoprenoid production; Region: CDP-ME_synthetase; cd02516
561275010101	substrate binding site; other site
561275010102	dimer interface; other site
561275010103	Transcriptional regulators, similar to M. xanthus CarD [Transcription]; Region: COG1329
561275010104	DNA repair protein RadA; Provisional; Region: PRK11823
561275010105	Sms (bacterial radA) DNA repair protein. This protein is not related to archael radA any more than is to other RecA-like NTPases. Sms has a role in recombination and recombinational repair and is responsible for the stabilization or processing of...; Region: Sms; cd01121
561275010106	Walker A motif/ATP binding site; other site
561275010107	ATP binding site [chemical binding]; other site
561275010108	Walker B motif; other site
561275010109	Subunit ChlI of Mg-chelatase; Region: ChlI; pfam13541
561275010110	DNA integrity scanning protein DisA; Provisional; Region: PRK13482
561275010111	DisA bacterial checkpoint controller nucleotide-binding; Region: DisA_N; pfam02457
561275010112	DisA bacterial checkpoint controller linker region; Region: DisA-linker; pfam10635
561275010113	Carbonic anhydrases (CA) are zinc-containing enzymes that catalyze the reversible hydration of carbon dioxide in a two-step mechanism in which the nucleophilic attack of a zinc-bound hydroxide ion on carbon dioxide is followed by the regeneration of an...; Region: beta_CA_cladeC; cd03378
561275010114	active site clefts [active]
561275010115	zinc binding site [ion binding]; other site
561275010116	dimer interface [polypeptide binding]; other site
561275010117	endonuclease III; includes endonuclease III (DNA-(apurinic or apyrimidinic site) lyase), alkylbase DNA glycosidases (Alka-family) and other DNA glycosidases; Region: ENDO3c; cd00056
561275010118	endonuclease III; Region: ENDO3c; smart00478
561275010119	minor groove reading motif; other site
561275010120	helix-hairpin-helix signature motif; other site
561275010121	substrate binding pocket [chemical binding]; other site
561275010122	active site
561275010123	iron-sulpphur binding domain in DNA-(apurinic or apyrimidinic site) lyase (subfamily of ENDO3); Region: FES; smart00525
561275010124	PE family; Region: PE; pfam00934
561275010125	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
561275010126	Novel bacterial esterase that cleaves esters on halogenated cyclic compounds; Region: Esterase_713_like; cl17303
561275010127	catalytic site [active]
561275010128	Uncharacterized enzyme involved in biosynthesis of extracellular polysaccharides [General function prediction only]; Region: COG2329
561275010129	Beta-lactamase class A [Defense mechanisms]; Region: PenP; COG2367
561275010130	Beta-lactamase enzyme family; Region: Beta-lactamase2; pfam13354
561275010131	Ami_2 domain; Region: Ami_2; smart00644
561275010132	amidase catalytic site [active]
561275010133	Zn binding residues [ion binding]; other site
561275010134	substrate binding site [chemical binding]; other site
561275010135	PE family; Region: PE; pfam00934
561275010136	ATP-binding subunits of Clp protease and DnaK/DnaJ chaperones [Posttranslational modification, protein turnover, chaperones]; Region: clpA; COG0542
561275010137	Clp amino terminal domain; Region: Clp_N; pfam02861
561275010138	Clp amino terminal domain; Region: Clp_N; pfam02861
561275010139	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
561275010140	Walker A motif; other site
561275010141	ATP binding site [chemical binding]; other site
561275010142	Walker B motif; other site
561275010143	arginine finger; other site
561275010144	UvrB/uvrC motif; Region: UVR; pfam02151
561275010145	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
561275010146	Walker A motif; other site
561275010147	ATP binding site [chemical binding]; other site
561275010148	Walker B motif; other site
561275010149	C-terminal, D2-small domain, of ClpB protein; Region: ClpB_D2-small; pfam10431
561275010150	Lsr2; Region: Lsr2; pfam11774
561275010151	lysyl-tRNA synthetase; Reviewed; Region: lysS; PRK00484
561275010152	LysRS_N: N-terminal, anticodon recognition domain of lysyl-tRNA synthetases (LysRS). These enzymes are homodimeric class 2b aminoacyl-tRNA synthetases (aaRSs). This domain is a beta-barrel domain (OB fold) involved in binding the tRNA anticodon stem-loop; Region: LysRS_N; cd04322
561275010153	dimer interface [polypeptide binding]; other site
561275010154	putative anticodon binding site; other site
561275010155	Class II tRNA amino-acyl synthetase-like catalytic core domain. Class II amino acyl-tRNA synthetases (aaRS) share a common fold and generally attach an amino acid to the 3' OH of ribose of the appropriate tRNA.   PheRS is an exception in that it...; Region: class_II_aaRS-like_core; cl00268
561275010156	motif 1; other site
561275010157	dimer interface [polypeptide binding]; other site
561275010158	active site
561275010159	motif 2; other site
561275010160	motif 3; other site
561275010161	pantothenate kinase; Reviewed; Region: PRK13318
561275010162	Aspartate alpha-decarboxylase or L-aspartate 1-decarboxylase, a pyruvoyl group-dependent  decarboxylase in beta-alanine production; Region: Asp_decarbox; cd06919
561275010163	tetramerization interface [polypeptide binding]; other site
561275010164	active site
561275010165	Pantoate-beta-alanine ligase; Region: PanC; cd00560
561275010166	pantoate--beta-alanine ligase; Region: panC; TIGR00018
561275010167	active site
561275010168	ATP-binding site [chemical binding]; other site
561275010169	pantoate-binding site; other site
561275010170	HXXH motif; other site
561275010171	Rossmann-like domain; Region: Rossmann-like; pfam10727
561275010172	Uncharacterized conserved protein [Function unknown]; Region: COG5495
561275010173	Domain of unknown function (DUF2520); Region: DUF2520; pfam10728
561275010174	Protein of unknown function (DUF3180); Region: DUF3180; pfam11377
561275010175	7,8-dihydro-6-hydroxymethylpterin-pyrophosphokinase (HPPK). Folate derivatives are essential cofactors in the biosynthesis of purines, pyrimidines, and amino acids as well as formyl-tRNA. Mammalian cells are able to utilize pre-formed folates after...; Region: HPPK; cd00483
561275010176	catalytic center binding site [active]
561275010177	ATP binding site [chemical binding]; other site
561275010178	Dihydroneopterin aldolase (DHNA) and 7,8-dihydroneopterin triphosphate epimerase domain (DHNTPE); these enzymes have been designated folB and folX, respectively. Folate derivatives are essential cofactors in the biosynthesis of purines, pyrimidines, and...; Region: DHNA_DHNTPE; cd00534
561275010179	homooctamer interface [polypeptide binding]; other site
561275010180	active site
561275010181	DHPS subgroup of Pterin binding enzymes. DHPS (dihydropteroate synthase), a functional homodimer, catalyzes the condensation of p-aminobenzoic acid (pABA) in the de novo biosynthesis of folate, which is an essential cofactor in both nucleic acid and...; Region: DHPS; cd00739
561275010182	dihydropteroate synthase; Region: DHPS; TIGR01496
561275010183	substrate binding pocket [chemical binding]; other site
561275010184	dimer interface [polypeptide binding]; other site
561275010185	inhibitor binding site; inhibition site
561275010186	GTP cyclohydrolase I (GTP-CH-I) catalyzes the conversion of GTP into dihydroneopterin triphosphate.  The enzyme product is the precursor of tetrahydrofolate in eubacteria, fungi, and plants and of the folate analogs in methanogenic bacteria.  In...; Region: GTP_cyclohydro1; cd00642
561275010187	homodecamer interface [polypeptide binding]; other site
561275010188	GTP cyclohydrolase I; Provisional; Region: PLN03044
561275010189	active site
561275010190	putative catalytic site residues [active]
561275010191	zinc binding site [ion binding]; other site
561275010192	GTP-CH-I/GFRP interaction surface; other site
561275010193	FtsH Extracellular; Region: FtsH_ext; pfam06480
561275010194	ATP-dependent metalloprotease FtsH; Region: FtsH_fam; TIGR01241
561275010195	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
561275010196	Walker A motif; other site
561275010197	ATP binding site [chemical binding]; other site
561275010198	Walker B motif; other site
561275010199	arginine finger; other site
561275010200	Peptidase family M41; Region: Peptidase_M41; pfam01434
561275010201	chromosomal replication initiation protein; Provisional; Region: dnaA; PRK14086
561275010202	VNTR4052 is located within Rv3611. Differs from BCG Pasteur by a 111-bp in VNTR4052 locus of BCG Tokyo. The copy number of the 111-bp unit is 4 in BCG Tokyo and 5 in BCG Pasteur.
561275010203	Protein of unknown function (DUF2580); Region: DUF2580; pfam10824
561275010204	RD8, 5894 bp. Region of difference RD8, deleted region in Mycobacterium bovis BCG Pasteur (position: 4035754..4035755), BCG Tokyo (position: 4033005..4033006), and Mycobacterium bovis AF2122/97 (position: 3999970..3999971) compared to Mycobacterium tuberculosis H37Rv (position: 4056840..4062733). Removes genes Rv3617-Rv3622c and truncates Rv3623
561275010205	Uncharacterized conserved protein [Function unknown]; Region: COG2968
561275010206	Protein of unknown function (DUF541); Region: SIMPL; pfam04402
561275010207	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
561275010208	active site
561275010209	tRNA(Ile)-lysidine synthase MesJ [Cell cycle control, cell division, chromosome partitioning]; Region: MesJ; COG0037
561275010210	N-terminal domain of predicted ATPase of the PP-loop faimly implicated in cell cycle control [Cell division and chromosome partitioning]. This is a subfamily of Adenine nucleotide alpha hydrolases superfamily.Adeninosine nucleotide alpha hydrolases...; Region: PP-ATPase; cd01992
561275010211	Ligand Binding Site [chemical binding]; other site
561275010212	Uncharacterized conserved protein [Function unknown]; Region: COG5282
561275010213	uncharacterized protein, coenzyme F420 biosynthesis associated; Region: DUF2342_F420; TIGR03883
561275010214	D-Ala-D-Ala carboxypeptidase 3 (S13) family; Region: Peptidase_S13; pfam02113
561275010215	D-alanyl-D-alanine carboxypeptidase, serine-type, PBP4 family; Region: PBP4; TIGR00666
561275010216	Inorganic pyrophosphatase. These enzymes hydrolyze inorganic pyrophosphate (PPi) to two molecules of orthophosphates (Pi). The reaction requires bivalent cations. The enzymes in general exist as homooligomers; Region: pyrophosphatase; cd00412
561275010217	dimer interface [polypeptide binding]; other site
561275010218	substrate binding site [chemical binding]; other site
561275010219	metal binding sites [ion binding]; metal-binding site
561275010220	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2899
561275010221	DPM_DPG-synthase_like is a member of the Glycosyltransferase 2 superfamily; Region: DPM_DPG-synthase_like; cd04179
561275010222	Ligand binding site; other site
561275010223	Putative Catalytic site; other site
561275010224	DXD motif; other site
561275010225	Uncharacterized conserved protein (DUF2304); Region: DUF2304; cl01034
561275010226	Protein involved in biosynthesis of mitomycin antibiotics/polyketide fumonisin [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG5285
561275010227	Nucleoside-diphosphate-sugar epimerases [Cell envelope biogenesis, outer membrane / Carbohydrate transport and metabolism]; Region: WcaG; COG0451
561275010228	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
561275010229	NAD(P) binding site [chemical binding]; other site
561275010230	active site
561275010231	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG4584
561275010232	Helix-turn-helix domain of Hin and related proteins, a family of DNA-binding domains unique to bacteria and represented by the Hin protein of Salmonella. The basic HTH domain is a simple fold comprised of three core helices that form a right-handed...; Region: HTH_Hin_like; cl17393
561275010233	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG4584
561275010234	transposase; Provisional; Region: PRK06526
561275010235	IstB-like ATP binding protein; Region: IstB_IS21; pfam01695
561275010236	Walker B motif; other site
561275010237	Transposase, Mutator family; Region: Transposase_mut; pfam00872
561275010238	MULE transposase domain; Region: MULE; pfam10551
561275010239	Protein involved in cell division [Cell division and chromosome partitioning]; Region: Fic; COG2184
561275010240	Fic/DOC family; Region: Fic; cl00960
561275010241	VbhA antitoxin and related proteins; Region: VbhA_like; cd11586
561275010242	DNA polymerase III subunit delta'; Validated; Region: PRK07940
561275010243	DNA polymerase III subunit delta'; Validated; Region: PRK08485
561275010244	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
561275010245	dimerization interface [polypeptide binding]; other site
561275010246	Adenylate cyclase, family 3 (some proteins contain HAMP domain) [Signal transduction mechanisms]; Region: CyaA; COG2114
561275010247	cyclase homology domain; Region: CHD; cd07302
561275010248	nucleotidyl binding site; other site
561275010249	metal binding site [ion binding]; metal-binding site
561275010250	dimer interface [polypeptide binding]; other site
561275010251	DNA topoisomerase I subunit omega; Validated; Region: PRK07561
561275010252	TOPRIM_TopoIA_TopoI: The topoisomerase-primase (TORPIM) domain found in members of the type IA family of DNA topoisomerases (Topo IA) similar to Escherichia coli DNA topoisomerase I.   Type IA DNA topoisomerases remove (relax) negative supercoils in the...; Region: TOPRIM_TopoIA_TopoI; cd03363
561275010253	active site
561275010254	interdomain interaction site; other site
561275010255	putative metal-binding site [ion binding]; other site
561275010256	nucleotide binding site [chemical binding]; other site
561275010257	Bacterial DNA topoisomeraes I ATP-binding domain; Region: TOP1Bc; smart00436
561275010258	domain I; other site
561275010259	phosphate binding site [ion binding]; other site
561275010260	DNA Topoisomerase, subtype IA; DNA-binding, ATP-binding and catalytic domain of bacterial DNA topoisomerases I and III, and eukaryotic DNA topoisomerase III and eubacterial and archael reverse gyrases. Topoisomerases clevage single or double stranded DNA...; Region: TOP1Ac; cd00186
561275010261	domain II; other site
561275010262	domain III; other site
561275010263	nucleotide binding site [chemical binding]; other site
561275010264	DNA binding groove [nucleotide binding]
561275010265	catalytic site [active]
561275010266	domain IV; other site
561275010267	Topoisomerase C-terminal repeat; Region: Toprim_C_rpt; pfam13368
561275010268	Topoisomerase C-terminal repeat; Region: Toprim_C_rpt; pfam13368
561275010269	Topoisomerase C-terminal repeat; Region: Toprim_C_rpt; pfam13368
561275010270	Cold-Shock Protein (CSP) contains an S1-like cold-shock domain (CSD) that is found in eukaryotes, prokaryotes, and archaea.  CSP's include the major cold-shock proteins CspA and CspB in bacteria and the eukaryotic gene regulatory factor Y-box...; Region: CSP_CDS; cd04458
561275010271	DNA-binding site [nucleotide binding]; DNA binding site
561275010272	RNA-binding motif; other site
561275010273	helicase/secretion neighborhood putative DEAH-box helicase; Region: DECH_helic; TIGR03817
561275010274	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
561275010275	ATP binding site [chemical binding]; other site
561275010276	putative Mg++ binding site [ion binding]; other site
561275010277	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
561275010278	nucleotide binding region [chemical binding]; other site
561275010279	Domain of unknown function (DUF1998); Region: DUF1998; pfam09369
561275010280	PE family; Region: PE; pfam00934
561275010281	Protein of unknown function (DUF4244); Region: DUF4244; pfam14029
561275010282	Flp pilus assembly protein TadB [Intracellular trafficking and secretion]; Region: TadB; COG4965
561275010283	Flp pilus assembly protein, ATPase CpaF [Intracellular trafficking and secretion]; Region: CpaF; COG4962
561275010284	Type IV secretory pathway component VirB11, and related ATPases. The homohexamer, VirB11 is one of eleven Vir proteins, which are required for T-pilus biogenesis and virulence in the transfer of T-DNA from the Ti (tumor-inducing) plasmid of bacterial to...; Region: VirB11-like_ATPase; cd01130
561275010285	Walker A motif; other site
561275010286	hexamer interface [polypeptide binding]; other site
561275010287	ATP binding site [chemical binding]; other site
561275010288	Walker B motif; other site
561275010289	helicase/secretion neighborhood CpaE-like protein; Region: CpaE_hom_Actino; TIGR03815
561275010290	Phosphoserine phosphatase [Amino acid transport and metabolism]; Region: SerB; COG0560
561275010291	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
561275010292	motif II; other site
561275010293	ATPase components of various ABC-type transport systems, contain duplicated ATPase [General function prediction only]; Region: COG1123
561275010294	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
561275010295	Walker A/P-loop; other site
561275010296	ATP binding site [chemical binding]; other site
561275010297	Q-loop/lid; other site
561275010298	ABC transporter signature motif; other site
561275010299	Walker B; other site
561275010300	D-loop; other site
561275010301	H-loop/switch region; other site
561275010302	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
561275010303	Walker A/P-loop; other site
561275010304	ATP binding site [chemical binding]; other site
561275010305	Q-loop/lid; other site
561275010306	ABC transporter signature motif; other site
561275010307	Walker B; other site
561275010308	D-loop; other site
561275010309	H-loop/switch region; other site
561275010310	Oligopeptide/dipeptide transporter, C-terminal region; Region: oligo_HPY; cl07097
561275010311	nickel ABC transporter, permease subunit NikC; Region: nickel_nikC; TIGR02790
561275010312	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
561275010313	ABC-ATPase subunit interface; other site
561275010314	ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppB; COG0601
561275010315	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
561275010316	dimer interface [polypeptide binding]; other site
561275010317	conserved gate region; other site
561275010318	ABC-ATPase subunit interface; other site
561275010319	ABC-type oligopeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: OppA; COG4166
561275010320	The substrate-binding domain of an ABC-type nickel/oligopeptide-like import system contains the type 2 periplasmic binding fold; Region: PBP2_NikA_DppA_OppA_like; cd00995
561275010321	Nonfunctional due to frameshift (Rv3667). 1bp:C deletion in BCG Tokyo at 627:C of Mycobacterium tuberculosis H37Rv Mycobacterium bovis, and BCG Pasteur.; acetate--CoA ligase (EC_number 6.2.1.1)
561275010322	Protein of unknown function (DUF1469); Region: DUF1469; pfam07332
561275010323	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
561275010324	Trypsin-like peptidase domain; Region: Trypsin_2; pfam13365
561275010325	Coenzyme A pyrophosphatase (CoAse), a member of the Nudix hydrolase superfamily, functions to catalyze the elimination of oxidized inactive CoA, which can inhibit CoA-utilizing enzymes. The need of CoAses mainly arises under conditions of oxidative...; Region: CoAse; cd03426
561275010326	putative active site [active]
561275010327	putative CoA binding site [chemical binding]; other site
561275010328	nudix motif; other site
561275010329	metal binding site [ion binding]; metal-binding site
561275010330	TlpA-like family; composed of  TlpA, ResA, DsbE and similar proteins. TlpA, ResA and DsbE are bacterial protein disulfide reductases with important roles in cytochrome maturation. They are membrane-anchored proteins with a soluble TRX domain containing a...; Region: TlpA_like_family; cd02966
561275010331	Thioredoxin-like; Region: Thioredoxin_8; pfam13905
561275010332	catalytic residues [active]
561275010333	Predicted EndoIII-related endonuclease [DNA replication, recombination, and repair]; Region: Nth; COG0177
561275010334	endonuclease III; includes endonuclease III (DNA-(apurinic or apyrimidinic site) lyase), alkylbase DNA glycosidases (Alka-family) and other DNA glycosidases; Region: ENDO3c; cd00056
561275010335	minor groove reading motif; other site
561275010336	helix-hairpin-helix signature motif; other site
561275010337	substrate binding pocket [chemical binding]; other site
561275010338	active site
561275010339	iron-sulpphur binding domain in DNA-(apurinic or apyrimidinic site) lyase (subfamily of ENDO3); Region: FES; smart00525
561275010340	cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases [Signal transduction mechanisms]; Region: Crp; COG0664
561275010341	effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038
561275010342	ligand binding site [chemical binding]; other site
561275010343	flexible hinge region; other site
561275010344	helix_turn_helix, cAMP Regulatory protein C-terminus; DNA binding domain of prokaryotic regulatory proteins belonging to the catabolite activator protein family; Region: HTH_CRP; cd00092
561275010345	putative switch regulator; other site
561275010346	non-specific DNA interactions [nucleotide binding]; other site
561275010347	DNA binding site [nucleotide binding]
561275010348	sequence specific DNA binding site [nucleotide binding]; other site
561275010349	putative cAMP binding site [chemical binding]; other site
561275010350	Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849
561275010351	This group of proteins belong to a large family of YjgF/YER057c/UK114-like proteins present in bacteria, archaea, and eukaryotes with no definitive function.  The conserved domain is similar in structure to chorismate mutase but there is no sequence...; Region: YjgF_YER057c_UK114_like_1; cd02199
561275010352	homotrimer interaction site [polypeptide binding]; other site
561275010353	putative active site [active]
561275010354	Domain of unknown function (DUF4177); Region: DUF4177; pfam13783
561275010355	Predicted ATPase involved in chromosome partitioning [Cell division and chromosome partitioning]; Region: ArsA; COG0003
561275010356	ArsA ATPase functionas as an efflux pump located on the inner membrane of the cell. This ATP-driven oxyanion pump catalyzes the extrusion of arsenite, antimonite and arsenate. Maintenance of a low intracellular concentration of oxyanion produces...; Region: ArsA; cd02035
561275010357	P loop; other site
561275010358	Nucleotide binding site [chemical binding]; other site
561275010359	DTAP/Switch II; other site
561275010360	Predicted ATPase involved in chromosome partitioning [Cell division and chromosome partitioning]; Region: ArsA; COG0003
561275010361	ArsA ATPase functionas as an efflux pump located on the inner membrane of the cell. This ATP-driven oxyanion pump catalyzes the extrusion of arsenite, antimonite and arsenate. Maintenance of a low intracellular concentration of oxyanion produces...; Region: ArsA; cd02035
561275010362	DTAP/Switch II; other site
561275010363	Switch I; other site
561275010364	ArsA ATPase functionas as an efflux pump located on the inner membrane of the cell. This ATP-driven oxyanion pump catalyzes the extrusion of arsenite, antimonite and arsenate. Maintenance of a low intracellular concentration of oxyanion produces...; Region: ArsA; cd02035
561275010365	Transcription factor WhiB; Region: Whib; pfam02467
561275010366	Membrane carboxypeptidase (penicillin-binding protein) [Cell envelope biogenesis, outer membrane]; Region: MrcB; COG0744
561275010367	Transglycosylase; Region: Transgly; pfam00912
561275010368	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; cl17760
561275010369	PASTA domain of bacterial serine/threonine kinase pknB-like proteins. PknB is a member of a group of related transmembrane sensor kinases present in many gram positive bacteria, which has been shown to regulate cell shape in Mycobacterium tubercolosis; Region: PASTA_pknB; cd06577
561275010370	phosphodiesterase YaeI; Provisional; Region: PRK11340
561275010371	Bacillus subtilis YkuE and related proteins, C-terminal metallophosphatase domain; Region: MPP_YkuE_C; cd07385
561275010372	putative active site [active]
561275010373	putative metal binding site [ion binding]; other site
561275010374	Cysteine synthase [Amino acid transport and metabolism]; Region: CysK; COG0031
561275010375	Tryptophan synthase beta superfamily (fold type II); this family of pyridoxal phosphate (PLP)-dependent enzymes catalyzes beta-replacement and beta-elimination reactions. This CD corresponds to aminocyclopropane-1-carboxylate deaminase (ACCD), tryptophan...; Region: Trp-synth-beta_II; cl00342
561275010376	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
561275010377	catalytic residue [active]
561275010378	Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124
561275010379	Cytochrome P450; Region: p450; cl12078
561275010380	Sulphate Transporter and Anti-Sigma factor antagonist) domain of anti-anti-sigma factors, key regulators of anti-sigma factors by phosphorylation; Region: STAS_anti-anti-sigma_factors; cd07043
561275010381	anti sigma factor interaction site; other site
561275010382	regulatory phosphorylation site [posttranslational modification]; other site
561275010383	Uncharacterized conserved protein [Function unknown]; Region: COG1610
561275010384	Domain of unknown function (DUF4129); Region: DUF4129; pfam13559
561275010385	Domain of unknown function (DUF4350); Region: DUF4350; pfam14258
561275010386	MoxR-like ATPases [General function prediction only]; Region: COG0714
561275010387	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
561275010388	Walker A motif; other site
561275010389	ATP binding site [chemical binding]; other site
561275010390	Walker B motif; other site
561275010391	arginine finger; other site
561275010392	Uncharacterized conserved protein (some members contain a von Willebrand factor type A (vWA) domain) [General function prediction only]; Region: COG1721
561275010393	Protein of unknown function DUF58; Region: DUF58; pfam01882
561275010394	Uncharacterized membrane protein [Function unknown]; Region: SpoIIM; COG1300
561275010395	Predicted membrane protein/domain [Function unknown]; Region: COG1714
561275010396	glycerol kinase; Provisional; Region: glpK; PRK00047
561275010397	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cl17037
561275010398	nucleotide binding site [chemical binding]; other site
561275010399	Mycobacterium tuberculosis PIN domain family; Region: Mtu_PIN_fam; TIGR00028
561275010400	Glutamate-cysteine ligase family 2(GCS2); Region: GCS2; cl00954
561275010401	Methyltransferase domain; Region: Methyltransf_23; pfam13489
561275010402	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275010403	S-adenosylmethionine binding site [chemical binding]; other site
561275010404	Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes. PLP combines with an alpha-amino acid to form a compound called a Schiff base or aldimine intermediate, which depending on the reaction, is the...; Region: AAT_I; cl00321
561275010405	Selenocysteine lyase/Cysteine desulfurase [Posttranslational modification, protein turnover, chaperones]; Region: csdA; COG0520
561275010406	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
561275010407	catalytic residue [active]
561275010408	Uncharacterized conserved protein [Function unknown]; Region: COG4301
561275010409	Uncharacterized conserved protein (DUF2260); Region: DUF2260; pfam10017
561275010410	ergothioneine biosynthesis protein EgtC; Region: TIGR03442
561275010411	Glutamine amidotransferases class-II (Gn-AT)_YafJ-type.  YafJ is a glutamine amidotransferase-like protein of unknown function found in prokaryotes, eukaryotes and archaea.  YafJ has a conserved structural fold similar to those of other class II...; Region: YafJ; cd01908
561275010412	putative active site [active]
561275010413	putative dimer interface [polypeptide binding]; other site
561275010414	ergothioneine biosynthesis protein EgtB; Region: egtB_TIGR03440
561275010415	Formylglycine-generating sulfatase enzyme; Region: FGE-sulfatase; pfam03781
561275010416	Gamma-glutamylcysteine synthetase [Coenzyme metabolism]; Region: GshA; COG3572
561275010417	PknH-like extracellular domain; Region: PknH_C; pfam14032
561275010418	Domain of unknown function (DUF4185); Region: DUF4185; pfam13810
561275010419	aspartate-semialdehyde dehydrogenase; Provisional; Region: PRK14874
561275010420	Semialdehyde dehydrogenase, NAD binding domain; Region: Semialdhyde_dh; smart00859
561275010421	aspartate kinase; Reviewed; Region: PRK06635
561275010422	AAK_AKii-LysC-BS: Amino Acid Kinase Superfamily (AAK), AKii; this CD includes the N-terminal catalytic aspartokinase (AK) domain of the lysine-sensitive aspartokinase isoenzyme AKII of Bacillus subtilis 168, and the lysine plus threonine-sensitive...; Region: AAK_AKii-LysC-BS; cd04261
561275010423	putative nucleotide binding site [chemical binding]; other site
561275010424	putative catalytic residues [active]
561275010425	putative Mg ion binding site [ion binding]; other site
561275010426	putative aspartate binding site [chemical binding]; other site
561275010427	ACT domains of the lysine-sensitive aspartokinase isoenzyme AKII of Bacillus subtilis (BS) strain 168 and related proteins; Region: ACT_AKii-LysC-BS-like_1; cd04913
561275010428	putative allosteric regulatory site; other site
561275010429	ACT domains of the lysine-sensitive, aspartokinase (AK) isoenzyme AKII of Bacillus subtilis (BS) strain 168 and related domains; Region: ACT_AKii-LysC-BS-like_2; cd04936
561275010430	putative allosteric regulatory residue; other site
561275010431	2-isopropylmalate synthase; Validated; Region: PRK03739
561275010432	Mycobacterium tuberculosis LeuA3 and related proteins, N-terminal catalytic TIM barrel domain; Region: DRE_TIM_LeuA; cd07942
561275010433	active site
561275010434	catalytic residues [active]
561275010435	metal binding site [ion binding]; metal-binding site
561275010436	LeuA allosteric (dimerisation) domain; Region: LeuA_dimer; smart00917
561275010437	S-RD13 (VNTR4155), 684 bp. Region of difference S-RD13, repeated region in leuA composed of tandem repeat of 57bp (tcgcgagcccggcgcagccgggcgaagcgggtcggcacgcatcggaccc cgtgacga). 12 copies have been found in Mycobacterium bovis BCG Pasteur (position 4128585..4129268, 684bp) and 11 copies have been found in BCG Tokyo (position 4125835..4126461, 627bp) compared to 2 copies in Mycobacterium tuberculosis strain H37Rv (position 4155469..4155582, 114bp) and 5 copies in Mycobacterium bovis AF2122/97 (position 4092817..4093101,285bp).
561275010438	DNA polymerase III subunit epsilon; Provisional; Region: PRK06063
561275010439	DEDDh 3'-5' exonuclease domain family; Region: DEDDh; cd06127
561275010440	active site
561275010441	catalytic site [active]
561275010442	substrate binding site [chemical binding]; other site
561275010443	UDP-N-acetylmuramyl tripeptide synthase [Cell envelope biogenesis, outer membrane]; Region: MurE; COG0769
561275010444	Domain of unknown function (DUF1727); Region: DUF1727; pfam08353
561275010445	Type 1 glutamine amidotransferase (GATase1) domain found in Cobyric Acid Synthase (CobQ); Region: GATase1_CobQ; cd01750
561275010446	catalytic triad [active]
561275010447	Superfamily of nucleases including Short Patch Repair (Vsr) Endonucleases, archaeal Holliday junction resolvases, MutH methy-directed DNA mismatch-repair endonucleases, and catalytic domains of many restriction endonucleases, such as EcoRI, BamHI, and...; Region: Restriction_endonuclease_like; cl00277
561275010448	putative active site [active]
561275010449	recombination protein RecR; Reviewed; Region: recR; PRK00076
561275010450	RecR protein; Region: RecR; pfam02132
561275010451	TOPRIM_recR: topoisomerase-primase (TOPRIM) nucleotidyl transferase/hydrolase domain of the type found in Escherichia coli RecR.  RecR participates in the RecFOR pathway of homologous recombinational repair in prokaryotes. This pathway provides a...; Region: TOPRIM_recR; cd01025
561275010452	putative active site [active]
561275010453	putative metal-binding site [ion binding]; other site
561275010454	tetramer interface [polypeptide binding]; other site
561275010455	hypothetical protein; Validated; Region: PRK00153
561275010456	N-acetylmuramoyl-L-alanine amidase [Cell envelope biogenesis, outer membrane]; Region: AmiC; COG0860
561275010457	N-acetylmuramoyl-L-alanine amidase or MurNAc-LAA (also known as peptidoglycan aminohydrolase, NAMLA amidase, NAMLAA, Amidase 3, and peptidoglycan amidase; EC 3.5.1.28) is an autolysin that hydrolyzes the amide bond between N-acetylmuramoyl and L-amino...; Region: MurNAc-LAA; cd02696
561275010458	active site
561275010459	metal binding site [ion binding]; metal-binding site
561275010460	Polyketide cyclase / dehydrase and lipid transport; Region: Polyketide_cyc2; pfam10604
561275010461	hydrophobic ligand binding site; other site
561275010462	FAD/FMN-containing dehydrogenases [Energy production and conversion]; Region: GlcD; COG0277
561275010463	FAD binding domain; Region: FAD_binding_4; pfam01565
561275010464	Mycolic acid cyclopropane synthetase; Region: CMAS; pfam02353
561275010465	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275010466	S-adenosylmethionine binding site [chemical binding]; other site
561275010467	DNA polymerase III subunits gamma and tau; Provisional; Region: PRK14952
561275010468	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
561275010469	Walker A motif; other site
561275010470	ATP binding site [chemical binding]; other site
561275010471	Walker B motif; other site
561275010472	arginine finger; other site
561275010473	DNA polymerase III subunits gamma and tau domain III; Region: DNA_pol3_gamma3; pfam12169
561275010474	Alanine-glyoxylate amino-transferase; Region: Aminotran_MocR; pfam12897
561275010475	Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes. PLP combines with an alpha-amino acid to form a compound called a Schiff base or aldimine intermediate, which depending on the reaction, is the...; Region: AAT_I; cl00321
561275010476	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
561275010477	catalytic residue [active]
561275010478	Cutinase; Region: Cutinase; pfam01083
561275010479	hopanoid-associated sugar epimerase; Region: HpnA; TIGR03466
561275010480	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
561275010481	NAD(P) binding site [chemical binding]; other site
561275010482	active site
561275010483	Threonine dehydrogenase and related Zn-dependent dehydrogenases [Amino acid transport and metabolism / General function prediction only]; Region: Tdh; COG1063
561275010484	Alcohol dehydrogenases of the MDR family; Region: Zn_ADH8; cd08262
561275010485	putative NAD(P) binding site [chemical binding]; other site
561275010486	catalytic Zn binding site [ion binding]; other site
561275010487	Uncharacterized conserved protein [Function unknown]; Region: COG3349
561275010488	Streptococcal 67 kDa myosin-cross-reactive antigen like family; Region: Strep_67kDa_ant; cl17487
561275010489	drug resistance transporter, EmrB/QacA subfamily; Region: efflux_EmrB; TIGR00711
561275010490	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
561275010491	putative substrate translocation pore; other site
561275010492	cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases [Signal transduction mechanisms]; Region: Crp; COG0664
561275010493	effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038
561275010494	ligand binding site [chemical binding]; other site
561275010495	Predicted esterase of the alpha-beta hydrolase superfamily [General function prediction only]; Region: RssA; COG1752
561275010496	Patatin-like phospholipase domain containing protein 6, protein 7, and fungal NTE1; Region: Pat_PNPLA6_PNPLA7_NTE1_like; cd07205
561275010497	active site
561275010498	nucleophile elbow; other site
561275010499	Predicted Fe-S oxidoreductases [General function prediction only]; Region: COG1964
561275010500	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
561275010501	FeS/SAM binding site; other site
561275010502	Methyltransferase domain; Region: Methyltransf_31; pfam13847
561275010503	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275010504	S-adenosylmethionine binding site [chemical binding]; other site
561275010505	LigD_Pol_like_2: Polymerase (Pol) domain of bacterial LigD proteins similar to Pseudomonas aeruginosa (Pae) LigD, subgroup 2. The LigD Pol domain belongs to the archaeal/eukaryal primase (AEP) superfamily. In prokaryotes, LigD along with Ku is required...; Region: LigD_Pol_like_2; cd04865
561275010506	nucleotide binding site [chemical binding]; other site
561275010507	ATP-dependent DNA ligase; Reviewed; Region: ligC; PRK08224
561275010508	Adenylation domain of Mycobacterium tuberculosis LigC-like ATP-dependent DNA ligases; Region: Adenylation_DNA_ligase_LigC; cd07905
561275010509	active site
561275010510	DNA binding site [nucleotide binding]
561275010511	The Oligonucleotide/oligosaccharide binding (OB)-fold domain of ATP-dependent DNA ligase LigC is a DNA-binding module that is part of the catalytic core unit; Region: OBF_DNA_ligase_LigC; cd07970
561275010512	DNA binding site [nucleotide binding]
561275010513	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4402
561275010514	Members of the Nudix hydrolase superfamily catalyze the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+, for their activity and contain a highly...; Region: Nudix_Hydrolase_5; cd04662
561275010515	nudix motif; other site
561275010516	acyltransferase, WS/DGAT/MGAT; Region: acyl_WS_DGAT; TIGR02946
561275010517	Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007
561275010518	Uncharacterized conserved protein [Function unknown]; Region: COG1839
561275010519	Arabinose-binding domain of AraC transcription regulator, N-term; Region: Arabinose_bd; pfam12625
561275010520	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
561275010521	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
561275010522	Uncharacterized conserved protein [Function unknown]; Region: COG2966
561275010523	Protein of unknown function (DUF1212); Region: DUF1212; pfam06738
561275010524	Uncharacterized conserved protein [Function unknown]; Region: COG3610
561275010526	N-RD25, 1166 bp. Region of difference N-RD25, deleted region in Mycobacterium bovis BCG Pasteur (position 4163162..4163163), Mycobacterium bovis AF2122/97 (position 4127054..4127055), and BCG Tokyo (position 4160355..4160356), compared to Mycobacterium tuberculosis H37Rv (position: 4189595..4190760). Removes gene Rv3739c(PPE67) and truncates Rv3738c(PPE66)
561275010527	acyltransferase, WS/DGAT/MGAT; Region: acyl_WS_DGAT; TIGR02946
561275010528	Wax ester synthase-like Acyl-CoA acyltransferase domain; Region: WES_acyltransf; pfam03007
561275010529	Predicted flavoprotein involved in K+ transport [Inorganic ion transport and metabolism]; Region: TrkA; COG2072
561275010530	Predicted flavoprotein involved in K+ transport [Inorganic ion transport and metabolism]; Region: TrkA; COG2072
561275010531	Malate:quinone oxidoreductase (Mqo); Region: Mqo; cl17341
561275010532	heavy metal translocating P-type ATPase; Region: ATPase-IB_hvy; TIGR01525
561275010533	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
561275010534	Soluble P-type ATPase [General function prediction only]; Region: COG4087
561275010535	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
561275010536	dimerization interface [polypeptide binding]; other site
561275010537	putative DNA binding site [nucleotide binding]; other site
561275010538	putative Zn2+ binding site [ion binding]; other site
561275010539	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3651
561275010540	DNA binding domain, excisionase family; Region: excise; TIGR01764
561275010541	DNA breaking-rejoining enzymes, C-terminal catalytic domain. The DNA breaking-rejoining enzyme superfamily includes type IB topoisomerases and tyrosine recombinases that share the same fold in their catalytic domain containing six conserved active site...; Region: DNA_BRE_C; cl00213
561275010542	active site
561275010543	Int/Topo IB signature motif; other site
561275010544	Nucleoside deaminases include adenosine, guanine and cytosine deaminases. These enzymes are Zn dependent and catalyze the deamination of nucleosides. The zinc ion in the active site plays a central role in the proposed catalytic mechanism, activating a...; Region: nucleoside_deaminase; cd01285
561275010545	nucleoside/Zn binding site; other site
561275010546	dimer interface [polypeptide binding]; other site
561275010547	catalytic motif [active]
561275010548	putative tRNA adenosine deaminase-associated protein; Region: tRNA_deam_assoc; TIGR03941
561275010549	prephenate dehydrogenase; Validated; Region: PRK06545
561275010550	prephenate dehydrogenase; Validated; Region: PRK08507
561275010551	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3554
561275010552	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
561275010553	ABC-ATPase subunit interface; other site
561275010554	ABC-type proline/glycine betaine transport systems, permease component [Amino acid transport and metabolism]; Region: OpuBB; COG1174
561275010555	ABC-type proline/glycine betaine transport systems, ATPase components [Amino acid transport and metabolism]; Region: OpuBA; COG1125
561275010556	ATP-binding cassette domain of the osmoprotectant transporter; Region: ABC_OpuCA_Osmoprotection; cd03295
561275010557	Walker A/P-loop; other site
561275010558	ATP binding site [chemical binding]; other site
561275010559	Q-loop/lid; other site
561275010560	ABC transporter signature motif; other site
561275010561	Walker B; other site
561275010562	D-loop; other site
561275010563	H-loop/switch region; other site
561275010564	Periplasmic glycine betaine/choline-binding (lipo)protein of an ABC-type transport system (osmoprotectant binding protein) [Cell envelope biogenesis, outer membrane]; Region: OpuBC; COG1732
561275010565	Uncharacterized integral membrane protein [Function unknown]; Region: COG5416
561275010566	Acyl-CoA dehydrogenase (ACAD) 10 and 11, N-terminal domain, and similar proteins. This subfamily is part of a larger superfamily that includes the catalytic domains of other kinases, such as the typical serine/threonine/tyrosine protein kinases (PKs); Region: ACAD10_11_like; cd05154
561275010567	putative active site [active]
561275010568	putative substrate binding site [chemical binding]; other site
561275010569	ATP binding site [chemical binding]; other site
561275010570	Alkyl sulfatase and related hydrolases [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG2015
561275010571	Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849
561275010572	Mycobacterium 19 kDa lipoprotein antigen; Region: Myco_19_kDa; pfam05481
561275010573	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
561275010574	HAMP (Histidine kinases, Adenylyl cyclases, Methyl binding proteins, Phosphatases) domain; Region: HAMP; smart00304
561275010575	dimerization interface [polypeptide binding]; other site
561275010576	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
561275010577	dimer interface [polypeptide binding]; other site
561275010578	phosphorylation site [posttranslational modification]
561275010579	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
561275010580	ATP binding site [chemical binding]; other site
561275010581	Mg2+ binding site [ion binding]; other site
561275010582	G-X-G motif; other site
561275010583	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
561275010584	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
561275010585	active site
561275010586	phosphorylation site [posttranslational modification]
561275010587	intermolecular recognition site; other site
561275010588	dimerization interface [polypeptide binding]; other site
561275010589	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
561275010590	DNA binding site [nucleotide binding]
561275010591	Photosystem II reaction centre W protein (PsbW); Region: PsbW; cl06243
561275010592	O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315
561275010593	methyltransferase, TIGR00027 family; Region: mthyl_TIGR00027
561275010594	SnoaL-like domain; Region: SnoaL_2; pfam12680
561275010595	Histidinol-phosphate/aromatic aminotransferase and cobyric acid decarboxylase [Amino acid transport and metabolism]; Region: HisC; COG0079
561275010596	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
561275010597	pyridoxal 5'-phosphate binding site [chemical binding]; other site
561275010598	homodimer interface [polypeptide binding]; other site
561275010599	catalytic residue [active]
561275010600	uncharacterized Actinobacterial protein TIGR03083; Region: TIGR03083
561275010601	TIGR03086 family protein; Region: TIGR03086
561275010602	uncharacterized Actinobacterial protein TIGR03083; Region: TIGR03083
561275010603	enoyl-CoA hydratase; Provisional; Region: PRK06142
561275010604	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
561275010605	substrate binding site [chemical binding]; other site
561275010606	oxyanion hole (OAH) forming residues; other site
561275010607	trimer interface [polypeptide binding]; other site
561275010608	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
561275010609	Beta-lactamase; Region: Beta-lactamase; pfam00144
561275010610	potential protein location (hypothetical protein JTY_3840 [Mycobacterium bovis BCG str. Tokyo 172]) that overlaps RNA (tRNA-S)
561275010611	putative NAD(P)H quinone oxidoreductase, PIG3 family; Region: quinone_pig3; TIGR02824
561275010612	PIG3 p53-inducible quinone oxidoreductase; Region: p53_inducible_oxidoreductase; cd05276
561275010613	NAD(P) binding site [chemical binding]; other site
561275010614	Selenocysteine lyase/Cysteine desulfurase [Posttranslational modification, protein turnover, chaperones]; Region: csdA; COG0520
561275010615	cysteine desulfurase family protein, VC1184 subfamily; Region: am_tr_V_VC1184; TIGR01976
561275010616	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
561275010617	catalytic residue [active]
561275010618	Protein of unknown function (DUF2587); Region: DUF2587; pfam10759
561275010619	ABC-type polysaccharide/polyol phosphate transport system, ATPase component [Carbohydrate transport and metabolism / Cell envelope biogenesis, outer membrane]; Region: TagH; COG1134
561275010620	ATP-binding cassette component of polysaccharide transport system; Region: ABC_KpsT_Wzt; cd03220
561275010621	Walker A/P-loop; other site
561275010622	ATP binding site [chemical binding]; other site
561275010623	Q-loop/lid; other site
561275010624	ABC transporter signature motif; other site
561275010625	Walker B; other site
561275010626	D-loop; other site
561275010627	H-loop/switch region; other site
561275010628	Predicted glycosyltransferases [General function prediction only]; Region: COG1216
561275010629	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394
561275010630	active site
561275010631	ABC-type polysaccharide/polyol phosphate export systems, permease component [Carbohydrate transport and metabolism / Cell envelope biogenesis, outer membrane]; Region: TagG; COG1682
561275010632	ABC-2 type transporter; Region: ABC2_membrane; pfam01061
561275010633	Nucleoside-diphosphate-sugar epimerases [Cell envelope biogenesis, outer membrane / Carbohydrate transport and metabolism]; Region: WcaG; COG0451
561275010634	Arna decarboxylase_like, extended (e) SDRs; Region: Arna_like_SDR_e; cd05257
561275010635	NAD binding site [chemical binding]; other site
561275010636	substrate binding site [chemical binding]; other site
561275010637	active site
561275010638	Glycosyltransferases involved in cell wall biogenesis [Cell envelope biogenesis, outer membrane]; Region: WcaA; COG0463
561275010639	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394
561275010640	active site
561275010641	Membrane proteins related to metalloendopeptidases [Cell envelope biogenesis, outer membrane]; Region: NlpD; COG0739
561275010642	Peptidase family M23; Region: Peptidase_M23; pfam01551
561275010643	O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315
561275010644	methyltransferase, TIGR00027 family; Region: mthyl_TIGR00027
561275010645	nucleoside diphosphate kinase regulator; Provisional; Region: PRK05892
561275010646	Transcription elongation factor, GreA/GreB, C-term; Region: GreA_GreB; pfam01272
561275010647	Predicted membrane protein [Function unknown]; Region: COG2246
561275010648	GtrA-like protein; Region: GtrA; pfam04138
561275010649	FAD/FMN-containing dehydrogenases [Energy production and conversion]; Region: GlcD; COG0277
561275010650	FAD binding domain; Region: FAD_binding_4; pfam01565
561275010651	D-arabinono-1,4-lactone oxidase; Region: ALO; pfam04030
561275010652	short chain dehydrogenase; Provisional; Region: PRK07904
561275010653	Short-chain dehydrogenases of various substrate specificities [General function prediction only]; Region: DltE; COG0300
561275010654	NAD(P) binding site [chemical binding]; other site
561275010655	active site
561275010656	Arabinofuranosyltransferase N terminal; Region: AftA_N; pfam12250
561275010657	Arabinofuranosyltransferase A C terminal; Region: AftA_C; pfam12249
561275010658	Mycobacterial cell wall arabinan synthesis protein; Region: Arabinose_trans; pfam04602
561275010659	Mycobacterial cell wall arabinan synthesis protein; Region: Arabinose_trans; pfam04602
561275010660	Mycobacterial cell wall arabinan synthesis protein; Region: Arabinose_trans; pfam04602
561275010661	Metal-dependent hydrolases of the beta-lactamase superfamily III [General function prediction only]; Region: ElaC; COG1234
561275010662	Proteins involved in DNA damage response, similar to the AidB gene product; Region: AidB; cd01154
561275010663	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
561275010664	FAD binding site [chemical binding]; other site
561275010665	substrate binding site [chemical binding]; other site
561275010666	catalytic residues [active]
561275010667	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3464
561275010668	Transposase; Region: DDE_Tnp_ISL3; pfam01610
561275010669	Acetyl-CoA carboxylase, carboxyltransferase component (subunits alpha and beta) [Lipid metabolism]; Region: COG4799
561275010670	malonate decarboxylase subunit beta; Reviewed; Region: PRK07189; cl17682
561275010671	Acetyl-CoA carboxylase alpha subunit [Lipid metabolism]; Region: AccA; cl17345
561275010672	Phosphopantetheine attachment site; Region: PKS_PP; smart00823
561275010673	polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833
561275010674	Beta-ketoacyl synthase; Region: PKS_KS; smart00825
561275010675	active site
561275010676	malonyl CoA-acyl carrier protein transacylase; Region: fabD; TIGR00128
561275010677	Acyl transferase domain in polyketide synthase (PKS) enzymes; Region: PKS_AT; smart00827
561275010678	Phosphopantetheine attachment site; Region: PKS_PP; smart00823
561275010679	Thioesterase domains of type I polyketide synthases or non-ribosomal peptide synthetases [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3319
561275010680	long-chain-fatty-acid--CoA ligase; Validated; Region: PRK07769
561275010681	Fatty acyl-AMP ligase (FAAL); Region: FAAL; cd05931
561275010682	acyl-activating enzyme (AAE) consensus motif; other site
561275010683	active site
561275010684	Cutinase; Region: Cutinase; pfam01083
561275010685	Predicted esterase [General function prediction only]; Region: COG0627
561275010686	Putative esterase; Region: Esterase; pfam00756
561275010687	phosphoribose diphosphate:decaprenyl-phosphate phosphoribosyltransferase; Provisional; Region: PRK12324
561275010688	PAP2_like proteins, a super-family of histidine phosphatases and vanadium haloperoxidases, includes type 2 phosphatidic acid phosphatase or lipid phosphate phosphatase (LPP), Glucose-6-phosphatase, Phosphatidylglycerophosphatase B and bacterial acid...; Region: PAP2_like; cd01610
561275010689	active site
561275010690	Predicted glycosyltransferases [General function prediction only]; Region: COG1216
561275010691	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394
561275010692	active site
561275010693	UDP-galactopyranose mutase [Cell envelope biogenesis, outer membrane]; Region: Glf; COG0562
561275010694	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
561275010695	UDP-galactopyranose mutase; Region: GLF; pfam03275
561275010696	Uncharacterized protein potentially involved in peptidoglycan biosynthesis [Cell envelope biogenesis, outer membrane]; Region: COG5479
561275010697	Peptidoglycan recognition proteins (PGRPs) are pattern recognition receptors that bind, and in certain cases, hydrolyze peptidoglycans (PGNs) of bacterial cell walls. PGRPs have been divided into three classes: short PGRPs (PGRP-S), that are small (20...; Region: PGRP; cd06583
561275010698	amidase catalytic site [active]
561275010699	Zn binding residues [ion binding]; other site
561275010700	substrate binding site [chemical binding]; other site
561275010701	LGFP repeat; Region: LGFP; pfam08310
561275010702	PE family; Region: PE; pfam00934
561275010703	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
561275010704	haloacid dehalogenase-like hydrolase; Region: Hydrolase_3; pfam08282
561275010705	active site
561275010706	motif I; other site
561275010707	motif II; other site
561275010708	haloacid dehalogenase-like hydrolase; Region: HAD; cl17202
561275010709	1-acyl-sn-glycerol-3-phosphate acyltransferase [Lipid metabolism]; Region: PlsC; COG0204
561275010710	Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: AGPAT-like; Region: LPLAT_AGPAT-like; cd07989
561275010711	putative acyl-acceptor binding pocket; other site
561275010712	1-acyl-sn-glycerol-3-phosphate acyltransferase [Lipid metabolism]; Region: PlsC; COG0204
561275010713	Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: AGPAT-like; Region: LPLAT_AGPAT-like; cd07989
561275010714	putative acyl-acceptor binding pocket; other site
561275010715	1-acyl-sn-glycerol-3-phosphate acyltransferase [Lipid metabolism]; Region: PlsC; COG0204
561275010716	Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: AGPAT-like; Region: LPLAT_AGPAT-like; cd07989
561275010717	putative acyl-acceptor binding pocket; other site
561275010718	Aminoglycoside 3'-phosphotransferase (APH). The APH subfamily is part of a larger superfamily that includes the catalytic domains of other kinases, such as the typical serine/threonine/tyrosine protein kinases (PKs), RIO kinases, actin-fragmin...; Region: APH; cd05150
561275010719	Phosphotransferase enzyme family; Region: APH; pfam01636
561275010720	active site
561275010721	ATP binding site [chemical binding]; other site
561275010722	antibiotic binding site [chemical binding]; other site
561275010723	Predicted Zn-dependent hydrolases of the beta-lactamase fold [General function prediction only]; Region: COG2220
561275010724	Metallo-beta-lactamase superfamily; Region: Lactamase_B; cl00446
561275010725	Rieske domain; a [2Fe-2S] cluster binding domain commonly found in Rieske non-heme iron oxygenase (RO) systems such as naphthalene and biphenyl dioxygenases, as well as in plant/cyanobacterial chloroplast b6f and mitochondrial cytochrome bc(1) complexes; Region: Rieske; cl00938
561275010726	iron-sulfur cluster [ion binding]; other site
561275010727	[2Fe-2S] cluster binding site [ion binding]; other site
561275010728	Condensation domain; Region: Condensation; pfam00668
561275010729	Protein of unknown function (DUF2910); Region: DUF2910; pfam11139
561275010730	PE-PPE domain; Region: PE-PPE; pfam08237
561275010731	Predicted drug exporters of the RND superfamily [General function prediction only]; Region: COG2409
561275010732	Condensation domain; Region: Condensation; pfam00668
561275010733	Polyketide synthase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3321
561275010734	polyketide synthases (PKSs) polymerize simple fatty acids into a large variety of different products, called polyketides, by successive decarboxylating Claisen condensations. PKSs can be divided into 2 groups, modular type I PKSs consisting of one or...; Region: PKS; cd00833
561275010735	active site
561275010736	Acyl transferase domain; Region: Acyl_transf_1; cl08282
561275010737	Dehydratase domain in polyketide synthase (PKS) enzymes; Region: PKS_DH; smart00826
561275010738	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
561275010739	enoyl reductase of polyketide synthase; Region: enoyl_red; cd05195
561275010740	Enoylreductase; Region: PKS_ER; smart00829
561275010741	NAD(P) binding site [chemical binding]; other site
561275010742	beta-ketoacyl reductase (KR) domain of fatty acid synthase (FAS), subgroup 2, complex (x); Region: KR_2_FAS_SDR_x; cd08955
561275010743	KR domain; Region: KR; pfam08659
561275010744	putative NADP binding site [chemical binding]; other site
561275010745	active site
561275010746	Phosphopantetheine attachment site; Region: PKS_PP; smart00823
561275010747	acyl-CoA synthetase; Validated; Region: PRK05850
561275010748	Fatty acyl-AMP ligase (FAAL); Region: FAAL; cd05931
561275010749	acyl-activating enzyme (AAE) consensus motif; other site
561275010750	active site
561275010751	Helix-turn-helix domain; Region: HTH_OrfB_IS605; pfam12323
561275010752	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG0675
561275010753	Probable transposase; Region: OrfB_IS605; pfam01385
561275010754	Predicted site-specific integrase-resolvase [DNA replication, recombination, and repair]; Region: COG2452
561275010755	Serine Recombinase family, catalytic domain; a DNA binding domain may be present either N- or C-terminal to the catalytic domain. These enzymes perform site-specific recombination of DNA molecules by a concerted, four-strand cleavage and rejoining...; Region: Ser_Recombinase; cl02788
561275010756	catalytic residues [active]
561275010757	catalytic nucleophile [active]
561275010758	Phytoene dehydrogenase and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG1233
561275010759	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
561275010760	mycofactocin system transcriptional regulator; Region: mycofact_TetR; TIGR03968
561275010761	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275010762	Protein of unknown function (DUF2834); Region: DUF2834; pfam11196
561275010763	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
561275010764	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cl17173
561275010765	Cupin domain; Region: Cupin_2; cl17218
561275010766	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
561275010767	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
561275010768	seryl-tRNA synthetase; Provisional; Region: PRK05431
561275010769	Seryl-tRNA synthetase N-terminal domain; Region: Seryl_tRNA_N; pfam02403
561275010770	Seryl-tRNA synthetase (SerRS) class II core catalytic domain. SerRS is responsible for the attachment of serine to the 3' OH group of ribose of the appropriate tRNA. This domain It is primarily responsible for ATP-dependent formation of the enzyme...; Region: SerRS_core; cd00770
561275010771	dimer interface [polypeptide binding]; other site
561275010772	active site
561275010773	motif 1; other site
561275010774	motif 2; other site
561275010775	motif 3; other site
561275010776	Septum formation; Region: Septum_form; pfam13845
561275010777	Septum formation; Region: Septum_form; pfam13845
561275010778	Minimal MMP-like domain found in Acidothermus cellulolyticus hypothetical protein ACEL2062 and similar protein; Region: MMP_ACEL2062; cd12952
561275010779	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
561275010780	catalytic core [active]
561275010781	prephenate dehydratase; Provisional; Region: PRK11898
561275010782	Prephenate dehydratase; Region: PDT; pfam00800
561275010783	C-terminal ACT domain of the bifunctional chorismate mutase-prephenate dehydratase (CM-PDT) enzyme and the prephenate dehydratase (PDT) enzyme; Region: ACT_CM-PDT; cd04905
561275010784	putative L-Phe binding site [chemical binding]; other site
561275010785	Transcriptional regulator [Transcription]; Region: LytR; COG1316
561275010786	nonheme-containing ferritins; Region: Nonheme_Ferritin; cd01055
561275010787	Ferritin-like domain; Region: Ferritin; pfam00210
561275010788	ferroxidase diiron center [ion binding]; other site
561275010789	Glycerophosphodiester phosphodiesterase domain of uncharacterized bacterial glycerophosphodiester phosphodiesterases; Region: GDPD_like_2; cd08582
561275010790	Glycerophosphoryl diester phosphodiesterase family; Region: GDPD; pfam03009
561275010791	putative active site [active]
561275010792	catalytic site [active]
561275010793	putative metal binding site [ion binding]; other site
561275010794	Domain of unknown function (DUF4328); Region: DUF4328; pfam14219
561275010795	Transposase; Region: DEDD_Tnp_IS110; pfam01548
561275010796	Superoxide dismutase [Inorganic ion transport and metabolism]; Region: SodA; COG0605
561275010797	Iron/manganese superoxide dismutases, alpha-hairpin domain; Region: Sod_Fe_N; pfam00081
561275010798	Iron/manganese superoxide dismutases, C-terminal domain; Region: Sod_Fe_C; pfam02777
561275010799	Predicted membrane protein [Function unknown]; Region: COG2119
561275010800	Uncharacterized protein family UPF0016; Region: UPF0016; pfam01169
561275010801	Uncharacterized protein family UPF0016; Region: UPF0016; pfam01169
561275010802	Fimbrial protein; Region: Fimbrial; cl01416
561275010803	ribonuclease activity regulator protein RraA; Provisional; Region: PRK09372
561275010804	Predicted flavoprotein involved in K+ transport [Inorganic ion transport and metabolism]; Region: TrkA; COG2072
561275010805	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox_3; pfam13738
561275010806	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
561275010807	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
561275010808	hypothetical protein; Provisional; Region: PRK07945
561275010809	RelA- and SpoT-like ppGpp Synthetases and Hydrolases, catalytic domain; Region: Rel-Spo_like; cl11966
561275010810	Polymerase and Histidinol Phosphatase domain of bacterial polymerase X; Region: PHP_PolX; cd07436
561275010811	active site
561275010812	glutamate synthase subunit beta; Reviewed; Region: gltD; PRK12810
561275010813	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
561275010814	glutamate synthase subunit alpha; Provisional; Region: gltB; PRK11750
561275010815	Glutamine amidotransferases class-II (Gn-AT), glutamate synthase (GltS)-type. GltS is a homodimer that synthesizes L-glutamate from 2-oxoglutarate and L-glutamine, an important step in ammonia assimilation in bacteria, cyanobacteria and plants. The...; Region: GltS; cd00713
561275010816	active site
561275010817	dimer interface [polypeptide binding]; other site
561275010818	Glutamate synthase central domain; Region: Glu_syn_central; pfam04898
561275010819	Glutamate synthase (GltS) FMN-binding domain.  GltS is a complex iron-sulfur flavoprotein that catalyzes the reductive synthesis of L-glutamate from 2-oxoglutarate and L-glutamine via intramolecular channelling of ammonia, a reaction in the plant, yeast...; Region: GltS_FMN; cd02808
561275010820	active site
561275010821	FMN binding site [chemical binding]; other site
561275010822	substrate binding site [chemical binding]; other site
561275010823	3Fe-4S cluster binding site [ion binding]; other site
561275010824	gltb_C. This domain is found at the C-terminus of the large subunit (gltB) of glutamate synthase (GltS). GltS encodes a complex iron-sulfur flavoprotein that catalyzes the synthesis of L-glutamate from L-glutamine and 2-oxoglutarate. It requires the...; Region: gltB_C; cd00982
561275010825	domain interface; other site
561275010826	Antiactivator of flagellar biosynthesis FleN, an ATPase [Cell motility]; Region: flhG; COG0455
561275010827	FOG: FHA domain [Signal transduction mechanisms]; Region: COG1716
561275010828	Protein of unknown function (DUF2580); Region: DUF2580; pfam10824
561275010829	EspG family; Region: ESX-1_EspG; pfam14011
561275010830	type VII secretion AAA-ATPase EccA; Region: T7SS_EccA; TIGR03922
561275010831	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
561275010832	Walker A motif; other site
561275010833	ATP binding site [chemical binding]; other site
561275010834	Walker B motif; other site
561275010835	arginine finger; other site
561275010836	Protein of unknown function (DUF690); Region: DUF690; pfam05108
561275010837	type VII secretion protein EccCa; Region: T7SS_EccC_a; TIGR03924
561275010838	FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580
561275010839	FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580
561275010840	FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580
561275010841	RD1, 9457 bp. Region of difference RD1, deleted region in Mycobacterium bovis BCG Pasteur (position 4322714..4322715) and BCG Tokyo (position 4319903..4319904) compared to Mycobacterium tuberculosis H37Rv (position: 4350266-4359722) and Mycobacterium bovis AF2122/97 (position 4286586..4296087). Removes genes Rv3872-Rv3879c
561275010842	YbaB/EbfC DNA-binding family; Region: YbaB_DNA_bd; pfam02575
561275010843	type VII secretion protein EccE; Region: T7SS_EccE; TIGR03923
561275010844	Peptidase domain in the S8 and S53 families; Region: Peptidases_S8_S53; cl10459
561275010845	type VII secretion-associated serine protease mycosin; Region: T7SS_mycosin; TIGR03921
561275010846	active site
561275010847	catalytic residues [active]
561275010848	type VII secretion AAA-ATPase EccA; Region: T7SS_EccA; TIGR03922
561275010849	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
561275010850	Walker A motif; other site
561275010851	ATP binding site [chemical binding]; other site
561275010852	Walker B motif; other site
561275010853	arginine finger; other site
561275010854	type VII secretion protein EccE; Region: T7SS_EccE; TIGR03923
561275010855	Peptidase domain in the S8 and S53 families; Region: Peptidases_S8_S53; cl10459
561275010856	catalytic residues [active]
561275010857	Peptidase domain in the S8 and S53 families; Region: Peptidases_S8_S53; cl10459
561275010858	active site
561275010859	catalytic residues [active]
561275010860	type VII secretion integral membrane protein EccD; Region: T7SS_EccD; TIGR03920
561275010861	In Mycobacterium bovis, a deletion of 2406 bp (RDpan) leads to the loss of the NH2 part of Rv3887c, the entire Rv3888c and the COOH part of Rv3889c compared to Mycobacterium tuberculosis strain H37Rv, Mycobacterium bovis BCG Pasteur, and BCG Tokyo. Differs from Mb3917c by 1aa D346G in BCG Pasteur and BCG Tokyo.
561275010862	Antiactivator of flagellar biosynthesis FleN, an ATPase [Cell motility]; Region: flhG; COG0455
561275010863	EspG family; Region: ESX-1_EspG; pfam14011
561275010864	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4842
561275010865	Proteins of 100 residues with WXG; Region: WXG100; pfam06013
561275010866	PPE family; Region: PPE; pfam00823
561275010867	potential frameshift: common BLAST hit: gi|15843525|ref|NP_338562.1| FtsK/SpoIIIE family protein
561275010868	type VII secretion protein EccCb; Region: T7SS_EccC_b; TIGR03925
561275010869	FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580
561275010870	FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580
561275010871	type VII secretion protein EccCa; Region: T7SS_EccC_a; TIGR03924
561275010872	FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580
561275010873	Protein of unknown function (DUF690); Region: DUF690; pfam05108
561275010874	lysozyme_like domain.  This contains several members including Soluble Lytic Transglycosylases (SLT), Goose Egg-White Lysozymes (GEWL), Hen Egg-White Lysozymes (HEWL), chitinases, bacteriophage lambda lysozymes, endolysins, autolysins, and chitosanases; Region: lysozyme_like; cl00222
561275010875	catalytic residue [active]
561275010877	Protein of unknown function (DUF4237); Region: DUF4237; pfam14021
561275010878	Proteins of 100 residues with WXG; Region: WXG100; cl02005
561275010879	tRNA adenylyltransferase; Region: tRNA_CCA_actino; TIGR02692
561275010880	Nucleotidyltransferase (NT) domain of ClassII CCA-adding enzymes; Region: NT_ClassII-CCAase; cd05398
561275010881	active site
561275010882	NTP binding site [chemical binding]; other site
561275010883	metal binding triad [ion binding]; metal-binding site
561275010884	Probable RNA and SrmB- binding site of polymerase A; Region: PolyA_pol_RNAbd; pfam12627
561275010885	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
561275010886	Zn2+ binding site [ion binding]; other site
561275010887	Mg2+ binding site [ion binding]; other site
561275010888	tRNA nucleotidyltransferase domain 2 putative; Region: tRNA_NucTran2_2; pfam13735
561275010889	Diadenosine hexaphosphate (Ap6A) hydrolase is a member of the Nudix hydrolase superfamily. Ap6A hydrolase specifically hydrolyzes diadenosine polyphosphates, but not ATP or diadenosine triphosphate, and it generates ATP as the product. Ap6A, the most...; Region: Ap6A_hydrolase; cd03673
561275010890	active site
561275010891	Ap6A binding site [chemical binding]; other site
561275010892	nudix motif; other site
561275010893	metal binding site [ion binding]; metal-binding site
561275010894	Uncharacterized membrane protein, putative virulence factor [General function prediction only]; Region: MviN; COG0728
561275010895	MurJ/MviN, a subfamily of the multidrug and toxic compound extrusion (MATE)-like proteins; Region: MATE_MurJ_like; cd13123
561275010896	RNA polymerase sigma factor SigM; Reviewed; Region: PRK09643
561275010897	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
561275010898	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
561275010899	DNA binding residues [nucleotide binding]
561275010901	thioredoxin-disulfide reductase; Region: TRX_reduct; TIGR01292
561275010902	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
561275010903	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
561275010904	TRX family; composed of two groups: Group I, which includes proteins that exclusively encode a TRX domain; and Group II, which are composed of fusion proteins of TRX and additional domains. Group I TRX is a small ancient protein that alter the redox...; Region: TRX_family; cd02947
561275010905	Thioredoxin-like; Region: Thioredoxin_8; pfam13905
561275010906	catalytic residues [active]
561275010907	Putative peptidoglycan-binding domain-containing protein [Cell envelope biogenesis, outer membrane]; Region: COG3409
561275010908	Putative peptidoglycan binding domain; Region: PG_binding_1; pfam01471
561275010909	Putative peptidoglycan binding domain; Region: PG_binding_1; pfam01471
561275010910	N-acetylmuramoyl-L-alanine amidase [Cell envelope biogenesis, outer membrane]; Region: AmiC; COG0860
561275010911	N-acetylmuramoyl-L-alanine amidase or MurNAc-LAA (also known as peptidoglycan aminohydrolase, NAMLA amidase, NAMLAA, Amidase 3, and peptidoglycan amidase; EC 3.5.1.28) is an autolysin that hydrolyzes the amide bond between N-acetylmuramoyl and L-amino...; Region: MurNAc-LAA; cd02696
561275010912	active site
561275010913	metal binding site [ion binding]; metal-binding site
561275010914	ParB/RepB/Spo0J family partition protein; Region: parB_part; TIGR00180
561275010915	ParB-like nuclease domain; Region: ParB; smart00470
561275010916	ATPases involved in chromosome partitioning [Cell division and chromosome partitioning]; Region: Soj; COG1192
561275010917	ParA and ParB of Caulobacter crescentus belong to a conserved family of bacterial proteins implicated in chromosome segregation. ParB binds to DNA sequences adjacent to the origin of replication and localizes to opposite cell poles shortly following the...; Region: ParA; cd02042
561275010918	P-loop; other site
561275010919	Magnesium ion binding site [ion binding]; other site
561275010920	ParA and ParB of Caulobacter crescentus belong to a conserved family of bacterial proteins implicated in chromosome segregation. ParB binds to DNA sequences adjacent to the origin of replication and localizes to opposite cell poles shortly following the...; Region: ParA; cd02042
561275010921	Magnesium ion binding site [ion binding]; other site
561275010922	rRNA small subunit methyltransferase G; Region: GidB; pfam02527
561275010923	16S rRNA methyltransferase GidB; Reviewed; Region: gidB; PRK00107
561275010924	Predicted RNA-binding protein [General function prediction only]; Region: Jag; COG1847
561275010925	jag_K homology RNA-binding domain. The KH domain is found in proteins homologous to the Bacillus subtilis protein Jag, which is associated with SpoIIIJ and is necessary for the third stage of sporulation.  The KH motif is a beta-alpha-alpha-beta-beta...; Region: jag_KH; cd02414
561275010926	G-X-X-G motif; other site
561275010927	R3H domain found in proteins homologous to Bacillus subtilus Jag, which is associated with SpoIIIJ. SpoIIIJ is necessary for the third stage of sporulation. The name of the R3H domain comes from the characteristic spacing of the most conserved arginine...; Region: R3H_jag; cd02644
561275010928	RxxxH motif; other site
561275010929	putative inner membrane protein translocase component YidC; Provisional; Region: PRK03449
561275010930	Uncharacterized conserved protein [Function unknown]; Region: COG0759
561275010931	ribonuclease P; Reviewed; Region: rnpA; PRK00588
561275010932	50S ribosomal protein L34; Reviewed; Region: rpmH; PRK00399