-- dump date   	20111121_013420
-- class       	Genbank::repeat_region
-- table       	repeat_region_note
-- id	note
362242000001	18 bp direct repeat 1, identical to sequence ggtgctgctggggcggtg, repeated at 5332..5349 and 5395..5410.
362242000002	18 bp direct repeat 2, identical to sequence, ggtgctgctggggcggtg, repeated at 5314..5331 and 5395..5410.
362242000003	18 bp direct repeat 3, identical to sequence ggtgctgctggggcggtg, repeated at 5314..5331 and 5332..5349
362242000004	5 bp direct repeat, TGGCG, at the left end of IS2606
362242000005	IS2606-1, len: 1438 nt. Insertion sequence IS2606.
362242000006	5 bp direct repeat, TGGCG, at the right end of IS2606.
362242000007	27 bp direct repeat 1, identical to sequence, gctatgacctatggtcccgatttgggg, repeated at 20434..20460.
362242000008	27 bp direct repeat 2, identical to sequence, gctatgacctatggtcccgatttgggg, repeated at 20407..20433.
362242000009	8 bp direct repeat, GACCAGGC, at the right end of IS2606
362242000010	IS2606-2, len: 1438 nt. Insertion sequence IS2606.
362242000011	8 bp direct repeat, GACCAGGC, at the left end of IS2606.
362242000012	IS2404-1, len: 1366 nt. Insertion sequence IS2404.
362242000013	IS2606-3, len: 1438 nt. Insertion sequence IS2606.
362242000014	8 bp direct repeat, CTGGTCCG, at the left end of IS2606.
362242000015	IS2606-4, len: 1438 nt. Insertion sequence IS2606.
362242000016	8 bp direct repeat, CTGGTCCG, at the right end of IS2606
362242000017	4 bp direct repeat, TCGG, at the left end of IS2404
362242000018	IS2404-2, len: 1366 nt. Insertion sequence IS2404.
362242000019	4 bp direct repeat, TCGG, at the right end of IS2404
362242000020	7 bp direct repeat, TCTGGCA, at the left end of IS2606.
362242000021	IS2606-5, len: 1438 nt. Insertion sequence IS2606.
362242000022	7 bp direct repeat, TCTGGCA, at the right end of IS2606.
362242000023	5 bp direct repeat, TTCTA, at the left end of IS2606.
362242000024	IS2606-6, len: 1438 nt. Insertion sequence IS2606.
362242000025	5 bp direct repeat, TTCTA, at the right end of IS2606
362242000026	4 bp direct repeat, GGGT, at the left end of IS2404.
362242000027	IS2404-3, len: 1366 nt. Insertion sequence IS2404.
362242000028	4 bp direct repeat, GGGT, at the right end of IS2404
362242000029	4 bp direct repeat, AGGC, at the left end of IS2606
362242000030	IS2606-7, len: 1439 nt. Insertion sequence IS2606.
362242000031	4 bp direct repeat, AGGC, at the right end of IS2606
362242000032	4 bp direct repeat, CAAG, at the left end of IS2404
362242000033	IS2404-4, len: 1366 nt. Insertion sequence IS2404.
362242000034	4 bp direct repeat, CAAG, at the right end of IS2404
362242000035	8 bp imperfect direct repeat, CTGACCAC, at the left end of IS2606.
362242000036	IS2606-8, len: 1438 nt. Insertion sequence IS2606.
362242000037	8 bp imperfect direct repeat, CTCACCAC, at the right end of IS2606
362242000056	found by blastn similarity
362242000057	found by blastn similarity
362242000059	found by blastn similarity
362242000061	found by blastn similarity
362242000062	found by blastn similarity
362242000063	found by blastn similarity
362242000064	found by blastn similarity
362242000065	found by blastn similarity
362242000066	found by blastn similarity
362242000067	found by blastn similarity
362242000068	found by blastn similarity
362242000069	found by blastn similarity
362242000070	found by blastn similarity
362242000071	found by blastn similarity
362242000072	found by blastn similarity
362242000073	found by blastn similarity
362242000074	found by blastn similarity
362242000075	found by blastn similarity
362242000076	found by blastn similarity
362242000077	found by blastn similarity
362242000079	found by blastn similarity