-- dump date   	20140619_155356
-- class       	Genbank::repeat_region
-- table       	repeat_region_note
-- id	note
362242000001	18 bp direct repeat 1, identical to sequence ggtgctgctggggcggtg, repeated at 5332..5349 and 5395..5410.
362242000002	18 bp direct repeat 2, identical to sequence, ggtgctgctggggcggtg, repeated at 5314..5331 and 5395..5410.
362242000003	18 bp direct repeat 3, identical to sequence ggtgctgctggggcggtg, repeated at 5314..5331 and 5332..5349
362242000004	5 bp direct repeat, TGGCG, at the left end of IS2606
362242000005	5 bp direct repeat, TGGCG, at the right end of IS2606.
362242000006	27 bp direct repeat 1, identical to sequence, gctatgacctatggtcccgatttgggg, repeated at 20434..20460.
362242000007	27 bp direct repeat 2, identical to sequence, gctatgacctatggtcccgatttgggg, repeated at 20407..20433.
362242000008	8 bp direct repeat, GACCAGGC, at the right end of IS2606
362242000009	8 bp direct repeat, GACCAGGC, at the left end of IS2606.
362242000010	8 bp direct repeat, CTGGTCCG, at the left end of IS2606.
362242000011	8 bp direct repeat, CTGGTCCG, at the right end of IS2606
362242000012	4 bp direct repeat, TCGG, at the left end of IS2404
362242000013	4 bp direct repeat, TCGG, at the right end of IS2404
362242000014	7 bp direct repeat, TCTGGCA, at the left end of IS2606.
362242000015	7 bp direct repeat, TCTGGCA, at the right end of IS2606.
362242000016	5 bp direct repeat, TTCTA, at the left end of IS2606.
362242000017	5 bp direct repeat, TTCTA, at the right end of IS2606
362242000018	4 bp direct repeat, GGGT, at the left end of IS2404.
362242000019	4 bp direct repeat, GGGT, at the right end of IS2404
362242000020	4 bp direct repeat, AGGC, at the left end of IS2606
362242000021	4 bp direct repeat, AGGC, at the right end of IS2606
362242000022	4 bp direct repeat, CAAG, at the left end of IS2404
362242000023	4 bp direct repeat, CAAG, at the right end of IS2404
362242000024	8 bp imperfect direct repeat, CTGACCAC, at the left end of IS2606.
362242000025	8 bp imperfect direct repeat, CTCACCAC, at the right end of IS2606