-- dump date   	20140620_013344
-- class       	Genbank::misc_feature
-- table       	misc_feature_note
-- id	note
160488000001	ParB/RepB/Spo0J family partition protein; Region: parB_part; TIGR00180
160488000002	ParB-like nuclease domain; Region: ParBc; pfam02195
160488000003	ATPases involved in chromosome partitioning [Cell division and chromosome partitioning]; Region: Soj; COG1192
160488000004	The Fer4_NifH superfamily contains a variety of proteins which share a common ATP-binding domain. Functionally, proteins in this superfamily use the energy from hydrolysis of NTP to transfer electron or ion; Region: Fer4_NifH; cd01983
160488000005	ParA and ParB of Caulobacter crescentus belong to a conserved family of bacterial proteins implicated in chromosome segregation. ParB binds to DNA sequences adjacent to the origin of replication and localizes to opposite cell poles shortly following the...; Region: ParA; cd02042
160488000006	Magnesium ion binding site [ion binding]; other site
160488000007	rRNA small subunit methyltransferase G; Region: GidB; pfam02527
160488000008	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488000009	S-adenosylmethionine binding site [chemical binding]; other site
160488000010	tRNA uridine 5-carboxymethylaminomethyl modification enzyme GidA; Validated; Region: PRK05192
160488000011	tRNA:m(5)U-54 methyltransferase; Region: gid_trmFO; TIGR00137
160488000012	NAD(FAD)-utilizing enzyme possibly involved in translation [Translation, ribosomal structure and biogenesis]; Region: Gid; COG1206
160488000013	GidA associated domain 3; Region: GIDA_assoc_3; pfam13932
160488000014	tRNA modification GTPase TrmE; Reviewed; Region: trmE; PRK05291
160488000015	GTP-binding protein TrmE N-terminus; Region: TrmE_N; pfam10396
160488000016	trmE is a tRNA modification GTPase; Region: trmE; cd04164
160488000017	G1 box; other site
160488000018	GTP/Mg2+ binding site [chemical binding]; other site
160488000019	Switch I region; other site
160488000020	G2 box; other site
160488000021	Switch II region; other site
160488000022	G3 box; other site
160488000023	G4 box; other site
160488000024	G5 box; other site
160488000025	Catalytic cysteine-containing C-terminus of GTPase, MnmE; Region: GTPase_Cys_C; pfam12631
160488000026	membrane protein insertase; Provisional; Region: PRK01318
160488000027	membrane protein insertase, YidC/Oxa1 family, C-terminal domain; Region: yidC_oxa1_cterm; TIGR03592
160488000028	hypothetical protein; Provisional; Region: PRK14371
160488000029	ribonuclease P; Reviewed; Region: rnpA; PRK00396
160488000030	50S ribosomal protein L34; Reviewed; Region: rpmH; PRK00399
160488000031	DnaA N-terminal domain; Region: DnaA_N; pfam11638
160488000032	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488000033	ATPases associated with a variety of cellular activities; Region: AAA; smart00382
160488000034	Walker A motif; other site
160488000035	ATP binding site [chemical binding]; other site
160488000036	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cl17189
160488000037	Walker B motif; other site
160488000038	arginine finger; other site
160488000039	C-terminal domain of bacterial DnaA proteins. The DNA-binding C-terminal domain of DnaA contains a helix-turn-helix motif that specifically interacts with the DnaA box, a 9-mer motif that occurs repetitively in the replication origin oriC. Multiple...; Region: Bac_DnaA_C; cd06571
160488000040	DnaA box-binding interface [nucleotide binding]; other site
160488000041	DNA polymerase III subunit beta; Validated; Region: PRK05643
160488000042	Beta clamp domain.  The beta subunit (processivity factor) of DNA polymerase III holoenzyme, refered to as the beta clamp, forms a ring shaped dimer that encircles dsDNA (sliding clamp) in bacteria.  The beta-clamp is structurally similar to the trimeric...; Region: beta_clamp; cd00140
160488000043	putative DNA binding surface [nucleotide binding]; other site
160488000044	dimer interface [polypeptide binding]; other site
160488000045	beta-clamp/clamp loader binding surface; other site
160488000046	beta-clamp/translesion DNA polymerase binding surface; other site
160488000047	recombination protein F; Reviewed; Region: recF; PRK00064
160488000048	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488000049	Walker A/P-loop; other site
160488000050	ATP binding site [chemical binding]; other site
160488000051	Q-loop/lid; other site
160488000052	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488000053	ABC transporter signature motif; other site
160488000054	Walker B; other site
160488000055	D-loop; other site
160488000056	H-loop/switch region; other site
160488000057	DNA gyrase subunit B; Provisional; Region: gyrB; PRK14939
160488000058	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488000059	Mg2+ binding site [ion binding]; other site
160488000060	G-X-G motif; other site
160488000061	TopoIIA_Trans_DNA_gyrase: Transducer domain, having a ribosomal S5 domain 2-like fold, of the type found in proteins of the type IIA family of DNA topoisomerases similar to the B subunits of E. coli DNA gyrase and E. coli Topoisomerase IV which are; Region: TopoII_Trans_DNA_gyrase; cd00822
160488000062	anchoring element; other site
160488000063	dimer interface [polypeptide binding]; other site
160488000064	ATP binding site [chemical binding]; other site
160488000065	TOPRIM_TopoIIA_GyrB: topoisomerase-primase (TOPRIM) nucleotidyl transferase/hydrolase domain of the type found in proteins of the type IIA family of DNA topoisomerases similar to the Escherichia coli GyrB subunit. TopoIIA enzymes cut both strands of the...; Region: TOPRIM_TopoIIA_GyrB; cd03366
160488000066	active site
160488000067	putative metal-binding site [ion binding]; other site
160488000068	DNA gyrase B subunit, carboxyl terminus; Region: DNA_gyraseB_C; pfam00986
160488000069	Integrase core domain; Region: rve; pfam00665
160488000070	Bacterial TniB protein; Region: TniB; pfam05621
160488000071	ATPases associated with a variety of cellular activities; Region: AAA; smart00382
160488000072	TniQ; Region: TniQ; pfam06527
160488000073	TIGR04255 family protein; Region: sporadTIGR04255
160488000074	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cl17200
160488000075	putative metal dependent hydrolase; Provisional; Region: PRK11598
160488000076	Domain of unknown function (DUF1705); Region: DUF1705; pfam08019
160488000077	Sulfatase; Region: Sulfatase; pfam00884
160488000078	Co/Zn/Cd efflux system component [Inorganic ion transport and metabolism]; Region: CzcD; COG1230
160488000079	Predicted Co/Zn/Cd cation transporters [Inorganic ion transport and metabolism]; Region: MMT1; COG0053
160488000080	hypothetical protein; Provisional; Region: PRK09272
160488000081	Protein of unknown function (DUF2790); Region: DUF2790; pfam10976
160488000082	heavy metal response regulator; Region: cztR_silR_copR; TIGR01387
160488000083	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488000084	active site
160488000085	phosphorylation site [posttranslational modification]
160488000086	intermolecular recognition site; other site
160488000087	dimerization interface [polypeptide binding]; other site
160488000088	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
160488000089	DNA binding site [nucleotide binding]
160488000090	heavy metal sensor kinase; Region: cztS_silS_copS; TIGR01386
160488000091	HAMP domain; Region: HAMP; pfam00672
160488000092	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488000093	dimer interface [polypeptide binding]; other site
160488000094	phosphorylation site [posttranslational modification]
160488000095	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488000096	ATP binding site [chemical binding]; other site
160488000097	Mg2+ binding site [ion binding]; other site
160488000098	G-X-G motif; other site
160488000099	4-amino-4-deoxy-L-arabinose transferase and related glycosyltransferases of PMT family [Cell envelope biogenesis, outer membrane]; Region: ArnT; COG1807
160488000100	Dolichyl-phosphate-mannose-protein mannosyltransferase; Region: PMT_2; cl17364
160488000101	undecaprenyl phosphate 4-deoxy-4-formamido-L-arabinose transferase; Provisional; Region: PRK10714
160488000102	Bacterial DPM1_like enzymes are related to eukaryotic DPM1; Region: DPM1_like_bac; cd04187
160488000103	Ligand binding site; other site
160488000104	Putative Catalytic site; other site
160488000105	DXD motif; other site
160488000106	Membrane protein of unknown function; Region: DUF360; pfam04020
160488000107	Predicted membrane protein [Function unknown]; Region: COG2246
160488000108	GtrA-like protein; Region: GtrA; pfam04138
160488000109	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488000110	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488000111	LysR substrate binding domain; Region: LysR_substrate; pfam03466
160488000112	Phosphate-selective porin [Inorganic ion transport and metabolism]; Region: OprP; COG3746
160488000113	Phosphate-selective porin O and P; Region: Porin_O_P; pfam07396
160488000114	heavy metal translocating P-type ATPase; Region: ATPase-IB_hvy; TIGR01525
160488000115	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
160488000116	Soluble P-type ATPase [General function prediction only]; Region: COG4087
160488000117	Protein of unknown function (DUF2790); Region: DUF2790; pfam10976
160488000118	heavy metal efflux pump, CzcA family; Region: 2A0601; TIGR00914
160488000119	Membrane Fusion Protein cluster 2 (function with RND porters); Region: 8a0102; TIGR00999
160488000120	HlyD family secretion protein; Region: HlyD_3; pfam13437
160488000121	Outer membrane protein [Cell envelope biogenesis, outer membrane / Intracellular trafficking and secretion]; Region: TolC; COG1538
160488000122	outer membrane porin, OprD family; Region: OprD; pfam03573
160488000123	heavy metal response regulator; Region: cztR_silR_copR; TIGR01387
160488000124	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488000125	active site
160488000126	phosphorylation site [posttranslational modification]
160488000127	intermolecular recognition site; other site
160488000128	dimerization interface [polypeptide binding]; other site
160488000129	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
160488000130	DNA binding site [nucleotide binding]
160488000131	Domain of unknown function (DUF3315); Region: DUF3315; pfam11776
160488000132	PAS fold; Region: PAS_4; pfam08448
160488000133	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488000134	ATPases associated with a variety of cellular activities; Region: AAA; smart00382
160488000135	Walker A motif; other site
160488000136	ATP binding site [chemical binding]; other site
160488000137	Walker B motif; other site
160488000138	arginine finger; other site
160488000139	Bacterial regulatory protein, Fis family; Region: HTH_8; pfam02954
160488000140	Zn-dependent hydrolases, including glyoxylases [General function prediction only]; Region: GloB; COG0491
160488000141	Uncharacterized NAD(FAD)-dependent dehydrogenases [General function prediction only]; Region: HcaD; COG0446
160488000142	Sulfite exporter TauE/SafE; Region: TauE; pfam01925
160488000143	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488000144	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488000145	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
160488000146	dimerization interface [polypeptide binding]; other site
160488000147	choline dehydrogenase; Validated; Region: PRK02106
160488000148	GMC oxidoreductase; Region: GMC_oxred_C; pfam05199
160488000149	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488000150	putative substrate translocation pore; other site
160488000151	1-acyl-sn-glycerol-3-phosphate acyltransferase [Lipid metabolism]; Region: PlsC; COG0204
160488000152	Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: AGPAT-like; Region: LPLAT_AGPAT-like; cd07989
160488000153	putative acyl-acceptor binding pocket; other site
160488000154	D,D-heptose 1,7-bisphosphate phosphatase; Validated; Region: PRK08942
160488000155	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
160488000156	active site
160488000157	motif I; other site
160488000158	motif II; other site
160488000159	glycyl-tRNA synthetase subunit beta; Validated; Region: glyS; PRK01233
160488000160	Anticodon-binding domain of class Ia aminoacyl tRNA synthetases and similar domains; Region: Anticodon_Ia_like; cl12020
160488000161	Class II Glycyl-tRNA synthetase (GlyRS) alpha subunit core catalytic domain. GlyRS functions as a homodimer in eukaryotes, archaea and some bacteria and as a heterotetramer in the remainder of prokaryotes and in arabidopsis. It is responsible for the...; Region: GlyRS_alpha_core; cd00733
160488000162	dimer interface [polypeptide binding]; other site
160488000163	motif 1; other site
160488000164	active site
160488000165	motif 2; other site
160488000166	motif 3; other site
160488000167	Methyladenine glycosylase; Region: Adenine_glyco; pfam03352
160488000168	Bacterial lipid A biosynthesis acyltransferase; Region: Lip_A_acyltrans; pfam03279
160488000169	Lysophospholipid acyltransferases (LPLATs) of glycerophospholipid biosynthesis; Region: LPLAT; cl17185
160488000170	Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: LABLAT-like; Region: LPLAT_LABLAT-like; cd07984
160488000171	putative acyl-acceptor binding pocket; other site
160488000172	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
160488000173	TPR motif; other site
160488000174	TPR repeat; Region: TPR_11; pfam13414
160488000175	binding surface
160488000176	K+ potassium transporter; Region: K_trans; cl15781
160488000177	potassium transporter peripheral membrane component; Reviewed; Region: trkA; PRK09496
160488000178	TrkA-N domain; Region: TrkA_N; pfam02254
160488000179	TrkA-C domain; Region: TrkA_C; pfam02080
160488000180	TrkA-N domain; Region: TrkA_N; pfam02254
160488000181	TrkA-C domain; Region: TrkA_C; pfam02080
160488000182	16S rRNA methyltransferase B; Provisional; Region: PRK10901
160488000183	RNA binding domain of NusB (N protein-Utilization Substance B) and Sun (also known as RrmB or Fmu) proteins. This family includes two orthologous groups exemplified by the transcription termination factor NusB and the N-terminal domain of the...; Region: NusB_Sun; cl00223
160488000184	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488000185	S-adenosylmethionine binding site [chemical binding]; other site
160488000186	methionyl-tRNA formyltransferase; Reviewed; Region: fmt; PRK00005
160488000187	Methionyl-tRNA formyltransferase, N-terminal hydrolase domain; Region: FMT_core_Met-tRNA-FMT_N; cd08646
160488000188	putative active site [active]
160488000189	substrate binding site [chemical binding]; other site
160488000190	putative cosubstrate binding site; other site
160488000191	catalytic site [active]
160488000192	C-terminal domain of Formyltransferase and other enzymes; Region: Met_tRNA_FMT_C; cd08704
160488000193	substrate binding site [chemical binding]; other site
160488000194	Polypeptide or peptide deformylase; a family of metalloenzymes that catalyzes the removal of the N-terminal formyl group in a growing polypeptide chain following translation initiation during protein synthesis in prokaryotes. These enzymes utilize Fe(II)...; Region: Pep_deformylase; cd00487
160488000195	active site
160488000196	catalytic residues [active]
160488000197	metal binding site [ion binding]; metal-binding site
160488000198	DNA protecting protein DprA; Region: dprA; TIGR00732
160488000199	DNA recombination-mediator protein A; Region: DNA_processg_A; pfam02481
160488000200	Putative translation factor (SUA5) [Translation, ribosomal structure and biogenesis]; Region: SUA5; COG0009
160488000201	Protein of unknown function (DUF3077); Region: DUF3077; pfam11275
160488000202	quinone oxidoreductase, NADPH-dependent; Provisional; Region: PRK10754
160488000203	Quinone oxidoreductase (QOR); Region: QOR2; cd05286
160488000204	NADP binding site [chemical binding]; other site
160488000205	dimer interface [polypeptide binding]; other site
160488000206	coproporphyrinogen III oxidase; Provisional; Region: PRK05330
160488000207	Coproporphyrinogen III oxidase; Region: Coprogen_oxidas; pfam01218
160488000208	shikimate 5-dehydrogenase; Reviewed; Region: aroE; PRK00258
160488000209	Shikimate dehydrogenase substrate binding domain; Region: Shikimate_dh_N; pfam08501
160488000210	NAD(P) binding domain of Shikimate dehydrogenase; Region: NAD_bind_Shikimate_DH; cd01065
160488000211	shikimate binding site; other site
160488000212	NAD(P) binding site [chemical binding]; other site
160488000213	Sulfate transporter N-terminal domain with GLY motif; Region: Sulfate_tra_GLY; pfam13792
160488000214	Sulfate permease and related transporters (MFS superfamily) [Inorganic ion transport and metabolism]; Region: SUL1; COG0659
160488000215	Sulfate transporter family; Region: Sulfate_transp; pfam00916
160488000216	Sulphate Transporter and Anti-Sigma factor antagonist domain of SulP-like sulfate transporters, plays a role in the function and regulation of the transport activity, proposed general NTP binding function; Region: STAS_SulP_like_sulfate_transporter; cd07042
160488000217	choline ABC transporter, periplasmic binding protein; Region: ABC_choline_bnd; TIGR03414
160488000218	ABC-type proline/glycine betaine transport systems, periplasmic components [Amino acid transport and metabolism]; Region: ProX; COG2113
160488000219	Sulfatase; Region: Sulfatase; cl17466
160488000220	choline-sulfatase; Region: chol_sulfatase; TIGR03417
160488000221	Choline sulfatase enzyme C terminal; Region: Choline_sulf_C; pfam12411
160488000222	putative choline sulfate-utilization transcription factor; Region: chol_sulf_TF; TIGR03418
160488000223	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488000224	The C-terminal substrate domain of LysR-type GcdR, TrPI, HvR and beta-lactamase regulators, and that of other closely related homologs; contains the type 2 periplasmic binding fold; Region: PBP2_GcdR_TrpI_HvrB_AmpR_like; cd08432
160488000225	dimerization interface [polypeptide binding]; other site
160488000226	substrate binding pocket [chemical binding]; other site
160488000227	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
160488000228	NADH(P)-binding; Region: NAD_binding_10; pfam13460
160488000229	NAD(P) binding site [chemical binding]; other site
160488000230	active site
160488000231	Dopa 4,5-dioxygenase family; Region: DOPA_dioxygen; pfam08883
160488000232	tryptophan synthase alpha subunit; Provisional; Region: trpA; CHL00200
160488000233	Ttryptophan synthase (TRPS) alpha subunit (TSA). TPRS is a bifunctional tetrameric enzyme (2 alpha and 2 beta subunits) that catalyzes the last two steps of L-tryptophan biosynthesis. Alpha and beta subunit catalyze two distinct reactions which are both...; Region: Tryptophan_synthase_alpha; cd04724
160488000234	substrate binding site [chemical binding]; other site
160488000235	active site
160488000236	catalytic residues [active]
160488000237	heterodimer interface [polypeptide binding]; other site
160488000238	tryptophan synthase, beta subunit; Region: trpB; TIGR00263
160488000239	Tryptophan synthase-beta:  Trptophan synthase is a bifunctional enzyme that catalyses the last two steps in the biosynthesis of L-tryptophan via its alpha and beta reactions. In the alpha reaction, indole 3-glycerol phosphate is cleaved reversibly to...; Region: Trp-synth_B; cd06446
160488000240	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488000241	catalytic residue [active]
160488000242	DNA-binding transcriptional activator GcvA; Provisional; Region: PRK11139
160488000243	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488000244	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
160488000245	dimerization interface [polypeptide binding]; other site
160488000246	Bacterial protein of unknown function (DUF883); Region: DUF883; pfam05957
160488000247	Dodecin; Region: Dodecin; pfam07311
160488000248	Protein of unknown function (DUF1161); Region: DUF1161; pfam06649
160488000249	luciferase family oxidoreductase, group 1; Region: oxido_grp_1; TIGR03558
160488000250	Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cl07892
160488000251	Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cd00347
160488000252	peroxiredoxin, OsmC subfamily; Region: osmo_induc_OsmC; TIGR03562
160488000253	Protein of unknown function (DUF1161); Region: DUF1161; pfam06649
160488000254	Predicted aminopeptidase (DUF2265); Region: DUF2265; pfam10023
160488000255	Predicted phosphatases [General function prediction only]; Region: Gph; COG0546
160488000256	Eukaryotic phosphomannomutase; Region: PMM; cl17107
160488000257	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
160488000258	motif II; other site
160488000259	Carbonic anhydrases/acetyltransferases, isoleucine patch superfamily [General function prediction only]; Region: PaaY; COG0663
160488000260	Gamma carbonic anhydrase-like: This family is composed of gamma carbonic anhydrase (CA), Ferripyochelin Binding Protein (FBP), E. coli paaY protein, and similar proteins. CAs are zinc-containing enzymes that catalyze the reversible hydration of carbon...; Region: LbH_gamma_CA_like; cd04645
160488000261	trimer interface [polypeptide binding]; other site
160488000262	putative metal binding site [ion binding]; other site
160488000263	Zn-dependent oligopeptidases [Amino acid transport and metabolism]; Region: Dcp; COG0339
160488000264	Peptidase family M3 dipeptidyl carboxypeptidase (DCP); Region: M3A_DCP; cd06456
160488000265	active site
160488000266	Zn binding site [ion binding]; other site
160488000267	Probable metal-binding protein (DUF2387); Region: DUF2387; pfam09526
160488000268	Peptidase Gluzincin family (thermolysin-like proteinases, TLPs) includes peptidases M1, M2, M3, M4, M13, M32 and M36 (fungalysins); Region: GluZincin; cl14813
160488000269	DNA repair photolyase [DNA replication, recombination, and repair]; Region: SplB; COG1533
160488000270	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
160488000271	FeS/SAM binding site; other site
160488000272	Carbonic anhydrases (CA) are zinc-containing enzymes that catalyze the reversible hydration of carbon dioxide in a two-step mechanism in which the nucleophilic attack of a zinc-bound hydroxide ion on carbon dioxide is followed by the regeneration of an...; Region: beta_CA_cladeB; cd00884
160488000273	active site clefts [active]
160488000274	zinc binding site [ion binding]; other site
160488000275	dimer interface [polypeptide binding]; other site
160488000276	Sulfate permease and related transporters (MFS superfamily) [Inorganic ion transport and metabolism]; Region: SUL1; COG0659
160488000277	Sulfate transporter N-terminal domain with GLY motif; Region: Sulfate_tra_GLY; pfam13792
160488000278	Sulfate transporter family; Region: Sulfate_transp; pfam00916
160488000279	Sulphate Transporter and Anti-Sigma factor antagonist domain found in the C-terminal region of sulphate transporters as well as in bacterial and archaeal proteins involved in the regulation of sigma factors; Region: STAS; cl00604
160488000280	Heme/copper-type cytochrome/quinol oxidases, subunit 2 [Energy production and conversion]; Region: CyoA; COG1622
160488000281	Cytochrome C oxidase subunit II, transmembrane domain; Region: COX2_TM; pfam02790
160488000282	Cytochrome C oxidase subunit II, periplasmic domain; Region: COX2; pfam00116
160488000283	Cytochrome c, mono- and diheme variants [Energy production and conversion]; Region: CccA; COG2010
160488000284	Cytochrome C oxidase, cbb3-type, subunit III; Region: Cytochrome_CBB3; pfam13442
160488000285	Heme/copper-type cytochrome/quinol oxidases, subunit 1 [Energy production and conversion]; Region: CyoB; COG0843
160488000286	Cytochrome C oxidase subunit I.  Cytochrome c oxidase (CcO), the terminal oxidase in the respiratory chains of eukaryotes and most bacteria, is a multi-chain transmembrane protein located in the inner membrane of mitochondria and the cell membrane of...; Region: Cyt_c_Oxidase_I; cd01663
160488000287	Subunit I/III interface [polypeptide binding]; other site
160488000288	D-pathway; other site
160488000289	Subunit I/VIIc interface [polypeptide binding]; other site
160488000290	Subunit I/IV interface [polypeptide binding]; other site
160488000291	Subunit I/II interface [polypeptide binding]; other site
160488000292	Low-spin heme (heme a) binding site [chemical binding]; other site
160488000293	Subunit I/VIIa interface [polypeptide binding]; other site
160488000294	Subunit I/VIa interface [polypeptide binding]; other site
160488000295	Dimer interface; other site
160488000296	Putative water exit pathway; other site
160488000297	Binuclear center (heme a3/CuB) [ion binding]; other site
160488000298	K-pathway; other site
160488000299	Subunit I/Vb interface [polypeptide binding]; other site
160488000300	Putative proton exit pathway; other site
160488000301	Subunit I/VIb interface; other site
160488000302	Subunit I/VIc interface [polypeptide binding]; other site
160488000303	Electron transfer pathway; other site
160488000304	Subunit I/VIIIb interface [polypeptide binding]; other site
160488000305	Subunit I/VIIb interface [polypeptide binding]; other site
160488000306	cytochrome C oxidase assembly protein; Provisional; Region: PRK05089
160488000307	Cytochrome c oxidase subunit III.  Cytochrome c oxidase (CcO), the terminal oxidase in the respiratory chains of eukaryotes and most bacteria, is a multi-chain transmembrane protein located in the inner membrane of mitochondria and the cell membrane of...; Region: Cyt_c_Oxidase_III; cd01665
160488000308	Subunit III/VIIa interface [polypeptide binding]; other site
160488000309	Phospholipid binding site [chemical binding]; other site
160488000310	Subunit I/III interface [polypeptide binding]; other site
160488000311	Subunit III/VIb interface [polypeptide binding]; other site
160488000312	Subunit III/VIa interface; other site
160488000313	Subunit III/Vb interface [polypeptide binding]; other site
160488000314	SURF1 superfamily. Surf1/Shy1 has been implicated in the posttranslational steps of the biogenesis of the mitochondrially-encoded Cox1 subunit of cytochrome c oxidase (complex IV). Cytochrome c oxidase (complex IV), the terminal electron-transferring...; Region: SURF1; cd06662
160488000315	Uncharacterized protein required for cytochrome oxidase assembly [Posttranslational modification, protein turnover, chaperones]; Region: CtaA; COG1612
160488000316	Cytochrome oxidase assembly protein; Region: COX15-CtaA; pfam02628
160488000317	protoheme IX farnesyltransferase; Provisional; Region: PRK04375
160488000318	UbiA prenyltransferase family; Region: UbiA; pfam01040
160488000319	SCO (an acronym for Synthesis of Cytochrome c Oxidase) family; composed of proteins similar to Sco1, a membrane-anchored protein possessing a soluble domain with a TRX fold. Members of this family are required for the proper assembly of cytochrome c...; Region: SCO; cd02968
160488000320	Thioredoxin-like; Region: Thioredoxin_8; pfam13905
160488000321	Cu(I) binding site [ion binding]; other site
160488000322	ABC-type metal ion transport system, periplasmic component/surface antigen [Inorganic ion transport and metabolism]; Region: NlpA; COG1464
160488000323	NLPA lipoprotein; Region: Lipoprotein_9; pfam03180
160488000324	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488000325	dimer interface [polypeptide binding]; other site
160488000326	conserved gate region; other site
160488000327	ABC-ATPase subunit interface; other site
160488000328	DL-methionine transporter ATP-binding subunit; Provisional; Region: metN; PRK11153
160488000329	ATP-binding cassette domain of methionine transporter; Region: ABC_MetN_methionine_transporter; cd03258
160488000330	Walker A/P-loop; other site
160488000331	ATP binding site [chemical binding]; other site
160488000332	Q-loop/lid; other site
160488000333	ABC transporter signature motif; other site
160488000334	Walker B; other site
160488000335	D-loop; other site
160488000336	H-loop/switch region; other site
160488000337	This domain is found at the C-terminus of ABC transporter proteins involved in D-methionine transport as well as a number of ferredoxin-like proteins; Region: NIL; smart00930
160488000338	hydroperoxidase II; Provisional; Region: katE; PRK11249
160488000339	Clade 2 of the heme-binding enzyme catalase; Region: catalase_clade_2; cd08155
160488000340	tetramer interface [polypeptide binding]; other site
160488000341	heme binding pocket [chemical binding]; other site
160488000342	Type 1 glutamine amidotransferase (GATase1)-like domain found in at the C-terminal of several large catalases; Region: GATase1_catalase; cd03132
160488000343	domain interactions; other site
160488000344	ABC-type Mn2+/Zn2+ transport systems, permease components [Inorganic ion transport and metabolism]; Region: ZnuB; COG1108
160488000345	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cl00462
160488000346	ABC-ATPase subunit  interface; other site
160488000347	dimer interface [polypeptide binding]; other site
160488000348	putative PBP binding regions; other site
160488000349	high-affinity zinc transporter ATPase; Reviewed; Region: znuC; PRK09544
160488000350	ATP-binding cassette domain of the metal-type transporters; Region: ABC_Metallic_Cations; cd03235
160488000351	Ferric uptake regulator(Fur) and related metalloregulatory proteins; typically iron-dependent, DNA-binding repressors and activators; Region: Fur_like; cd07153
160488000352	metal binding site 2 [ion binding]; metal-binding site
160488000353	putative DNA binding helix; other site
160488000354	metal binding site 1 [ion binding]; metal-binding site
160488000355	dimer interface [polypeptide binding]; other site
160488000356	structural Zn2+ binding site [ion binding]; other site
160488000357	ABC-type Zn2+ transport system, periplasmic component/surface adhesin [Inorganic ion transport and metabolism]; Region: ZnuA; COG4531
160488000358	Zinc binding protein ZnuA. These proteins have been shown to function as initial receptors in the ABC uptake of Zn2+.  They belong to the TroA superfamily of periplasmic metal binding proteins that share a distinct fold and ligand binding mechanism; Region: ZnuA; cd01019
160488000359	metal binding site [ion binding]; metal-binding site
160488000360	Putative homoserine kinase type II (protein kinase fold) [General function prediction only]; Region: COG2334
160488000361	Homoserine Kinase, type II. Homoserine kinase is part of a larger superfamily that includes the catalytic domains of other kinases, such as the typical serine/threonine/tyrosine protein kinases (PKs), RIO kinases, actin-fragmin kinase (AFK), and...; Region: HomoserineK_II; cd05153
160488000362	putative active site [active]
160488000363	putative substrate binding site [chemical binding]; other site
160488000364	ATP binding site [chemical binding]; other site
160488000365	Protein of unknown function (DUF2782); Region: DUF2782; pfam11191
160488000366	DNA polymerase I; Provisional; Region: PRK05755
160488000367	PIN domain of the 5'-3' exonuclease of Taq DNA polymerase I and homologs; Region: PIN_53EXO; cd09859
160488000368	active site
160488000369	metal binding site 1 [ion binding]; metal-binding site
160488000370	putative 5' ssDNA interaction site; other site
160488000371	metal binding site 3; metal-binding site
160488000372	metal binding site 2 [ion binding]; metal-binding site
160488000373	H3TH domain of the 5'-3' exonuclease of Taq DNA polymerase I and homologs; Region: H3TH_53EXO; cd09898
160488000374	putative DNA binding site [nucleotide binding]; other site
160488000375	putative metal binding site [ion binding]; other site
160488000376	DEDDy 3'-5' exonuclease domain of Escherichia coli DNA polymerase I and similar bacterial family-A DNA polymerases; Region: DNA_polA_I_Ecoli_like_exo; cd06139
160488000377	active site
160488000378	catalytic site [active]
160488000379	substrate binding site [chemical binding]; other site
160488000380	Polymerase I functions primarily to fill DNA gaps that arise during DNA repair, recombination and replication; Region: DNA_pol_A_pol_I_C; cd08637
160488000381	active site
160488000382	DNA binding site [nucleotide binding]
160488000383	catalytic site [active]
160488000384	YihA (EngB) GTPase family; Region: YihA_EngB; cd01876
160488000385	G1 box; other site
160488000386	GTP/Mg2+ binding site [chemical binding]; other site
160488000387	Switch I region; other site
160488000388	G2 box; other site
160488000389	G3 box; other site
160488000390	Switch II region; other site
160488000391	G4 box; other site
160488000392	G5 box; other site
160488000393	Cytochrome c5 [Energy production and conversion]; Region: CycB; COG3245
160488000394	Cytochrome c553 [Energy production and conversion]; Region: COG2863
160488000395	Cytochrome c; Region: Cytochrom_C; cl11414
160488000396	DsbA family, DsbA subfamily; DsbA is a monomeric thiol disulfide oxidoreductase protein containing a redox active CXXC motif imbedded in a TRX fold. It is involved in the oxidative protein folding pathway in prokaryotes, and is the strongest thiol...; Region: DsbA_DsbA; cd03019
160488000397	catalytic residues [active]
160488000398	hinge region; other site
160488000399	alpha helical domain; other site
160488000400	Exonuclease-Endonuclease-Phosphatase (EEP) domain superfamily; Region: EEP; cl00490
160488000401	putative catalytic site [active]
160488000402	putative metal binding site [ion binding]; other site
160488000403	putative phosphate binding site [ion binding]; other site
160488000404	putative catalytic site [active]
160488000405	putative phosphate binding site [ion binding]; other site
160488000406	putative metal binding site [ion binding]; other site
160488000407	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
160488000408	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488000409	metal binding site [ion binding]; metal-binding site
160488000410	active site
160488000411	I-site; other site
160488000412	N-acetyl-anhydromuramyl-L-alanine amidase [Cell envelope biogenesis, outer membrane]; Region: ampD; COG3023
160488000413	Peptidoglycan recognition proteins (PGRPs) are pattern recognition receptors that bind, and in certain cases, hydrolyze peptidoglycans (PGNs) of bacterial cell walls. PGRPs have been divided into three classes: short PGRPs (PGRP-S), that are small (20...; Region: PGRP; cd06583
160488000414	amidase catalytic site [active]
160488000415	Zn binding residues [ion binding]; other site
160488000416	substrate binding site [chemical binding]; other site
160488000417	Putative peptidoglycan binding domain; Region: PG_binding_1; pfam01471
160488000418	Predicted signal transduction protein containing sensor and EAL domains [Signal transduction mechanisms]; Region: COG4943
160488000419	CSS motif domain associated with EAL; Region: CSS-motif; pfam12792
160488000420	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
160488000421	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
160488000422	dimerization interface [polypeptide binding]; other site
160488000423	phosphate regulon sensor kinase PhoR; Region: phoR_proteo; TIGR02966
160488000424	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488000425	dimer interface [polypeptide binding]; other site
160488000426	phosphorylation site [posttranslational modification]
160488000427	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488000428	ATP binding site [chemical binding]; other site
160488000429	Mg2+ binding site [ion binding]; other site
160488000430	G-X-G motif; other site
160488000431	Response regulator containing CheY-like receiver, AAA-type ATPase, and DNA-binding domains [Signal transduction mechanisms]; Region: AtoC; COG2204
160488000432	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488000433	active site
160488000434	phosphorylation site [posttranslational modification]
160488000435	intermolecular recognition site; other site
160488000436	dimerization interface [polypeptide binding]; other site
160488000437	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488000438	Walker A motif; other site
160488000439	ATP binding site [chemical binding]; other site
160488000440	Walker B motif; other site
160488000441	arginine finger; other site
160488000442	Bacterial regulatory protein, Fis family; Region: HTH_8; pfam02954
160488000443	BON domain; Region: BON; pfam04972
160488000444	BON domain; Region: BON; pfam04972
160488000445	BON domain; Region: BON; pfam04972
160488000446	Inhibitor of vertebrate lysozyme (Ivy); Region: Ivy; pfam08816
160488000447	glutamate/aspartate:proton symporter; Provisional; Region: gltP; PRK11283
160488000448	Na+/H+-dicarboxylate symporters [Energy production and conversion]; Region: GltP; COG1301
160488000449	Uncharacterized membrane protein, required for spore maturation in B.subtilis. [General function prediction only]; Region: SpmA; COG2715
160488000450	Uncharacterized membrane protein [Function unknown]; Region: SpmB; COG0700
160488000451	Protein of unknown function (DUF330); Region: DUF330; cl01135
160488000452	ABC-type transport system involved in resistance to organic solvents, periplasmic component [Secondary metabolites biosynthesis, transport, and catabolism]; Region: Ttg2C; COG1463
160488000453	mce related protein; Region: MCE; pfam02470
160488000454	ABC-type transport system involved in resistance to organic solvents, ATPase component [Secondary metabolites biosynthesis, transport, and catabolism]; Region: Ttg2A; COG1127
160488000455	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488000456	Walker A/P-loop; other site
160488000457	ATP binding site [chemical binding]; other site
160488000458	Q-loop/lid; other site
160488000459	ABC transporter signature motif; other site
160488000460	Walker B; other site
160488000461	D-loop; other site
160488000462	H-loop/switch region; other site
160488000463	ABC-type transport system involved in resistance to organic solvents, permease component [Secondary metabolites biosynthesis, transport, and catabolism]; Region: Ttg2B; COG0767
160488000464	Permease; Region: Permease; pfam02405
160488000465	Protein of unknown function (DUF2914); Region: DUF2914; pfam11141
160488000466	Predicted Zn-dependent peptidases [General function prediction only]; Region: PqqL; COG0612
160488000467	Insulinase (Peptidase family M16); Region: Peptidase_M16; pfam00675
160488000468	Peptidase M16 inactive domain; Region: Peptidase_M16_C; pfam05193
160488000469	Na+/phosphate symporter [Inorganic ion transport and metabolism]; Region: NptA; COG1283
160488000470	Na+/Pi-cotransporter; Region: Na_Pi_cotrans; pfam02690
160488000471	Membrane protein TerC, possibly involved in tellurium resistance [Inorganic ion transport and metabolism]; Region: TerC; COG0861
160488000472	H+/citrate symporter [Energy production and conversion]; Region: CitM; COG2851
160488000473	Citrate transporter; Region: CitMHS; pfam03600
160488000474	Uncharacterized conserved protein [Function unknown]; Region: COG3791
160488000475	Domain of unknown function (DUF4105); Region: DUF4105; pfam13387
160488000476	Protein of unknown function (DUF2388); Region: DUF2388; pfam09498
160488000477	Protein of unknown function (DUF2388); Region: DUF2388; pfam09498
160488000478	Protein of unknown function (DUF2388); Region: DUF2388; pfam09498
160488000479	succinate CoA transferase; Region: YgfH_subfam; TIGR03458
160488000480	Acetyl-CoA hydrolase/transferase N-terminal domain; Region: AcetylCoA_hydro; pfam02550
160488000481	Acetyl-CoA hydrolase/transferase C-terminal domain; Region: AcetylCoA_hyd_C; pfam13336
160488000482	NAD/NADP transhydrogenase beta subunit [Energy production and conversion]; Region: PntB; COG1282
160488000483	NAD(P) transhydrogenase beta subunit; Region: PNTB; pfam02233
160488000484	DNA-binding transcriptional activator GcvA; Provisional; Region: PRK11139
160488000485	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488000486	The C-terminal substrate binding domain of LysR-type transcriptional regulators GcdR-like, contains the type 2 periplasmic binding fold; Region: PBP2_GcdR_like; cd08481
160488000487	dimerization interface [polypeptide binding]; other site
160488000488	substrate binding pocket [chemical binding]; other site
160488000489	Glutaryl-CoA dehydrogenase; Region: GCD; cd01151
160488000490	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
160488000491	FAD binding site [chemical binding]; other site
160488000492	substrate binding pocket [chemical binding]; other site
160488000493	catalytic base [active]
160488000494	Predicted acyl-CoA transferases/carnitine dehydratase [Energy production and conversion]; Region: CaiB; COG1804
160488000495	CoA-transferase family III; Region: CoA_transf_3; pfam02515
160488000496	Secretin and TonB N terminus short domain; Region: STN; smart00965
160488000497	ferrichrome outer membrane transporter; Provisional; Region: PRK10044
160488000498	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
160488000499	N-terminal plug; other site
160488000500	ligand-binding site [chemical binding]; other site
160488000501	Fe2+-dicitrate sensor, membrane component [Inorganic ion transport and metabolism / Signal transduction mechanisms]; Region: FecR; COG3712
160488000502	FecR protein; Region: FecR; pfam04773
160488000503	RNA polymerase sigma factor FecI; Provisional; Region: PRK09651
160488000504	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
160488000505	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
160488000506	DNA binding residues [nucleotide binding]
160488000507	phosphonate utilization associated transcriptional regulator; Region: phnR_burk; TIGR03338
160488000508	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488000509	DNA-binding site [nucleotide binding]; DNA binding site
160488000510	FCD domain; Region: FCD; pfam07729
160488000511	Predicted transglutaminase-like cysteine proteinase [General    function prediction only]; Region: COG3672
160488000512	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
160488000513	dimerization interface [polypeptide binding]; other site
160488000514	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
160488000515	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488000516	metal binding site [ion binding]; metal-binding site
160488000517	active site
160488000518	I-site; other site
160488000519	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
160488000520	type I secretion membrane fusion protein, HlyD family; Region: type_I_hlyD; TIGR01843
160488000521	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
160488000522	HlyD family secretion protein; Region: HlyD_3; pfam13437
160488000523	type I secretion system ATPase, LssB family; Region: type_I_sec_LssB; TIGR03375
160488000524	Peptidase family C39 mostly contains bacteriocin-processing endopeptidases from bacteria. The cysteine peptidases in family C39 cleave the "double-glycine" leader peptides from the precursors of various bacteriocins (mostly non-lantibiotic); Region: Peptidase_C39_like; cl00296
160488000525	putative active site [active]
160488000526	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
160488000527	ATP-binding cassette domain of bacteriocin exporters, subfamily C; Region: ABCC_bacteriocin_exporters; cd03245
160488000528	Walker A/P-loop; other site
160488000529	ATP binding site [chemical binding]; other site
160488000530	Q-loop/lid; other site
160488000531	ABC transporter signature motif; other site
160488000532	Walker B; other site
160488000533	D-loop; other site
160488000534	H-loop/switch region; other site
160488000535	Calx-beta domain; Region: Calx-beta; cl02522
160488000536	Von Willebrand factor type A (vWA) domain was originally found in the blood coagulation protein von Willebrand factor (vWF). Typically, the vWA domain is made up of approximately 200 amino acid residues folded into a classic a/b para-rossmann type of...; Region: vWFA; cd00198
160488000537	metal ion-dependent adhesion site (MIDAS); other site
160488000538	type I secretion C-terminal target domain (VC_A0849 subclass); Region: T1SS_VCA0849; TIGR03661
160488000539	Probable taurine catabolism dioxygenase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: TauD; COG2175
160488000540	Clavaminic acid synthetase (CAS) -like;  CAS is a trifunctional Fe(II)/ 2-oxoglutarate (2OG) oxygenase carrying out three reactions in the biosynthesis of clavulanic acid, an inhibitor of class A serine beta-lactamases. In general, Fe(II)-2OG oxygenases...; Region: CAS_like; cl00184
160488000541	ABC-type nitrate/sulfonate/bicarbonate transport systems, periplasmic components [Inorganic ion transport and metabolism]; Region: TauA; COG0715
160488000542	NMT1-like family; Region: NMT1_2; pfam13379
160488000543	ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component [Inorganic ion transport and metabolism]; Region: TauB; COG1116
160488000544	ATP-binding cassette domain of the nitrate and sulfonate transporters; Region: ABC_NrtD_SsuB_transporters; cd03293
160488000545	Walker A/P-loop; other site
160488000546	ATP binding site [chemical binding]; other site
160488000547	Q-loop/lid; other site
160488000548	ABC transporter signature motif; other site
160488000549	Walker B; other site
160488000550	D-loop; other site
160488000551	H-loop/switch region; other site
160488000552	ABC-type nitrate/sulfonate/bicarbonate transport system, permease component [Inorganic ion transport and metabolism]; Region: TauC; COG0600
160488000553	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488000554	putative PBP binding loops; other site
160488000555	ABC-ATPase subunit interface; other site
160488000556	Arginine repressor, DNA binding domain; Region: Arg_repressor; pfam01316
160488000557	WYL domain; Region: WYL; pfam13280
160488000558	FOG: TPR repeat, SEL1 subfamily [General function prediction only]; Region: COG0790
160488000559	Sel1-like repeats; Region: SEL1; smart00671
160488000560	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
160488000561	Winged helix DNA-binding domain; Region: HTH_27; pfam13463
160488000562	Fusaric acid resistance protein family; Region: FUSC; pfam04632
160488000563	Fusaric acid resistance protein-like; Region: FUSC_2; pfam13515
160488000564	Protein of unknown function (DUF1656); Region: DUF1656; pfam07869
160488000565	efflux pump membrane protein (multidrug resistance protein A); Region: 8a0101; TIGR00998
160488000566	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
160488000567	HlyD family secretion protein; Region: HlyD_3; pfam13437
160488000568	Outer membrane protein [Cell envelope biogenesis, outer membrane / Intracellular trafficking and secretion]; Region: TolC; COG1538
160488000569	Cytochrome c, mono- and diheme variants [Energy production and conversion]; Region: CccA; COG2010
160488000570	Cytochrome c; Region: Cytochrom_C; pfam00034
160488000571	High-affinity Fe2+/Pb2+ permease [Inorganic ion transport and metabolism]; Region: FTR1; COG0672
160488000572	TIGR02647 family protein; Region: DNA
160488000573	Glutathione S-transferase [Posttranslational modification, protein turnover, chaperones]; Region: Gst; COG0625
160488000574	Glutathione S-transferase (GST) family, N-terminal domain; a large, diverse group of cytosolic dimeric proteins involved in cellular detoxification by catalyzing the conjugation of  glutathione (GSH) with a wide range of endogenous and xenobiotic...; Region: GST_N_family; cd00570
160488000575	C-terminal domain interface [polypeptide binding]; other site
160488000576	GSH binding site (G-site) [chemical binding]; other site
160488000577	dimer interface [polypeptide binding]; other site
160488000578	C-terminal, alpha helical domain of an unknown subfamily 9 of Glutathione S-transferases; Region: GST_C_9; cd10424
160488000579	putative N-terminal domain interface [polypeptide binding]; other site
160488000580	argininosuccinate lyase; Provisional; Region: PRK00855
160488000581	Argininosuccinate lyase (argininosuccinase, ASAL); Region: Argininosuccinate_lyase; cd01359
160488000582	active sites [active]
160488000583	tetramer interface [polypeptide binding]; other site
160488000584	Response regulator of the LytR/AlgR family [Transcription / Signal transduction mechanisms]; Region: LytT; COG3279
160488000585	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488000586	active site
160488000587	phosphorylation site [posttranslational modification]
160488000588	intermolecular recognition site; other site
160488000589	dimerization interface [polypeptide binding]; other site
160488000590	LytTr DNA-binding domain; Region: LytTR; pfam04397
160488000591	porphobilinogen deaminase; Reviewed; Region: hemC; PRK00072
160488000592	Hydroxymethylbilane synthase (HMBS), also known as porphobilinogen deaminase (PBGD), is an intermediate enzyme in the biosynthetic pathway of tetrapyrrolic ring systems, such as heme, chlorophylls, and vitamin B12. HMBS catalyzes the conversion of...; Region: HMBS; cd00494
160488000593	domain interfaces; other site
160488000594	active site
160488000595	uroporphyrinogen-III synthase; Validated; Region: PRK05752
160488000596	Uroporphyrinogen-III synthase (HemD) catalyzes the asymmetrical cyclization of tetrapyrrole (linear) to uroporphyrinogen-III, the fourth step in the biosynthesis of heme. This ubiquitous enzyme is present in eukaryotes, bacteria and archaea. Mutations in...; Region: HemD; cd06578
160488000597	active site
160488000598	putative uroporphyrinogen III C-methyltransferase; Provisional; Region: PRK10920
160488000599	heme biosynthesis-associated TPR protein; Region: TPR_hemY_coli; TIGR00540
160488000600	HemY protein N-terminus; Region: HemY_N; pfam07219
160488000601	Disulfide bond formation protein DsbB; Region: DsbB; pfam02600
160488000602	anti-RNA polymerase sigma 70 factor; Provisional; Region: PRK11718
160488000603	FKBP-type peptidyl-prolyl cis-trans isomerases 1 [Posttranslational modification, protein turnover, chaperones]; Region: FkpA; COG0545
160488000604	Domain amino terminal to FKBP-type peptidyl-prolyl isomerase; Region: FKBP_N; pfam01346
160488000605	FKBP-type peptidyl-prolyl cis-trans isomerase; Region: FKBP_C; pfam00254
160488000606	Protein of unknown function (DUF2390); Region: DUF2390; pfam09523
160488000607	putative ABC transporter ATP-binding protein; Provisional; Region: PRK10636
160488000608	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488000609	Walker A/P-loop; other site
160488000610	ATP binding site [chemical binding]; other site
160488000611	Q-loop/lid; other site
160488000612	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
160488000613	ABC transporter signature motif; other site
160488000614	Walker B; other site
160488000615	D-loop; other site
160488000616	ABC transporter; Region: ABC_tran_2; pfam12848
160488000617	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
160488000618	Small-conductance mechanosensitive channel [Cell envelope biogenesis, outer membrane]; Region: MscS; COG0668
160488000619	Mechanosensitive ion channel; Region: MS_channel; pfam00924
160488000620	LysE type translocator; Region: LysE; cl00565
160488000621	Membrane protease subunits, stomatin/prohibitin homologs [Posttranslational modification, protein turnover, chaperones]; Region: HflC; COG0330
160488000622	Band_7_stomatin_like: A subgroup of the band 7 domain of flotillin (reggie) like proteins similar to stomatin and podicin (two lipid raft-associated integral membrane proteins). Individual proteins of this band 7 domain family may cluster to form...; Region: Band_7_stomatin_like; cd03403
160488000623	Membrane-bound serine protease (ClpP class) [Posttranslational modification, protein turnover, chaperones]; Region: NfeD; COG1030
160488000624	Nodulation formation efficiency D (NfeD) is a membrane-bound ClpP-class protease; Region: Clp_protease_NfeD_1; cd07020
160488000625	dimer interface [polypeptide binding]; other site
160488000626	active site residues [active]
160488000627	NfeD-like C-terminal, partner-binding; Region: NfeD; pfam01957
160488000628	YbaK-like.  The YbaK family of deacylase domains includes the INS amino acid-editing domain of  the bacterial class II prolyl tRNA synthetase (ProRS), and it's trans-acting homologs, YbaK, ProX, and PrdX. The primary function of INS is to hydrolyze...; Region: YbaK_like; cd04332
160488000629	putative deacylase active site [active]
160488000630	FOG: CBS domain [General function prediction only]; Region: COG0517
160488000631	The CBS domain, named after human CBS, is a small domain originally identified in cystathionine beta-synthase and is subsequently found in a wide range of different proteins. CBS domains usually occur in tandem repeats. They associate to form a so-called...; Region: CBS_pair_10; cd04623
160488000632	hypothetical protein; Provisional; Region: PRK06156
160488000633	M20 Peptidase Xaa-His dipeptidase (PepV) degrades hydrophobic dipeptides; Region: M20_PepV; cd03888
160488000634	active site
160488000635	metal binding site [ion binding]; metal-binding site
160488000636	Transcriptional regulators [Transcription]; Region: PhnF; COG2188
160488000637	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488000638	DNA-binding site [nucleotide binding]; DNA binding site
160488000639	UTRA domain; Region: UTRA; pfam07702
160488000640	putative oxidoreductase; Provisional; Region: PRK08275
160488000641	L-aspartate oxidase; Provisional; Region: PRK06175
160488000642	Fumarate reductase flavoprotein C-term; Region: Succ_DH_flav_C; pfam02910
160488000643	4Fe-4S dicluster domain; Region: Fer4_7; pfam12838
160488000644	ABC-type nitrate/sulfonate/bicarbonate transport systems, periplasmic components [Inorganic ion transport and metabolism]; Region: TauA; COG0715
160488000645	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488000646	substrate binding pocket [chemical binding]; other site
160488000647	membrane-bound complex binding site; other site
160488000648	ABC-type nitrate/sulfonate/bicarbonate transport system, permease component [Inorganic ion transport and metabolism]; Region: TauC; COG0600
160488000649	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488000650	dimer interface [polypeptide binding]; other site
160488000651	conserved gate region; other site
160488000652	putative PBP binding loops; other site
160488000653	ABC-ATPase subunit interface; other site
160488000654	ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component [Inorganic ion transport and metabolism]; Region: TauB; COG1116
160488000655	ATP-binding cassette domain of the nitrate and sulfonate transporters; Region: ABC_NrtD_SsuB_transporters; cd03293
160488000656	Walker A/P-loop; other site
160488000657	ATP binding site [chemical binding]; other site
160488000658	Q-loop/lid; other site
160488000659	ABC transporter signature motif; other site
160488000660	Walker B; other site
160488000661	D-loop; other site
160488000662	H-loop/switch region; other site
160488000663	HEAT repeats; Region: HEAT_2; pfam13646
160488000664	E-Z type HEAT repeats; Region: EZ_HEAT; smart00567
160488000665	Protein of unknown function (DUF971); Region: DUF971; pfam06155
160488000666	succinate-semialdehyde dehydrogenase I; Provisional; Region: gabD; PRK11241
160488000667	Mitochondrial succinate-semialdehyde dehydrogenase and ALDH family members 5A1 and 5F1-like; Region: ALDH_F5_SSADH_GabD; cd07103
160488000668	tetramerization interface [polypeptide binding]; other site
160488000669	NAD(P) binding site [chemical binding]; other site
160488000670	catalytic residues [active]
160488000671	4-aminobutyrate aminotransferase; Validated; Region: PRK08088
160488000672	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
160488000673	inhibitor-cofactor binding pocket; inhibition site
160488000674	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488000675	catalytic residue [active]
160488000676	FOG: CheY-like receiver [Signal transduction mechanisms]; Region: CheY; COG0784
160488000677	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488000678	active site
160488000679	phosphorylation site [posttranslational modification]
160488000680	intermolecular recognition site; other site
160488000681	dimerization interface [polypeptide binding]; other site
160488000682	HDOD domain; Region: HDOD; pfam08668
160488000683	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488000684	PAS fold; Region: PAS_3; pfam08447
160488000685	putative active site [active]
160488000686	heme pocket [chemical binding]; other site
160488000687	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
160488000688	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488000689	metal binding site [ion binding]; metal-binding site
160488000690	active site
160488000691	I-site; other site
160488000692	Fatty acid desaturase; Region: FA_desaturase; pfam00487
160488000693	The Delta9 Fatty Acid Desaturase (Delta9-FADS)-like CD includes the delta-9 and delta-11 acyl CoA desaturases found in various eukaryotes including vertebrates, insects, higher plants, and fungi. The delta-9 acyl-lipid desaturases are found in a wide...; Region: Delta9-FADS-like; cd03505
160488000694	Di-iron ligands [ion binding]; other site
160488000695	The Delta9 Fatty Acid Desaturase (Delta9-FADS)-like CD includes the delta-9 and delta-11 acyl CoA desaturases found in various eukaryotes including vertebrates, insects, higher plants, and fungi. The delta-9 acyl-lipid desaturases are found in a wide...; Region: Delta9-FADS-like; cd03505
160488000696	Transposase; Region: DDE_Tnp_ISL3; pfam01610
160488000697	RNase II stability modulator; Provisional; Region: PRK10060
160488000698	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488000699	putative active site [active]
160488000700	heme pocket [chemical binding]; other site
160488000701	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488000702	metal binding site [ion binding]; metal-binding site
160488000703	active site
160488000704	I-site; other site
160488000705	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
160488000706	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488000707	dimer interface [polypeptide binding]; other site
160488000708	conserved gate region; other site
160488000709	putative PBP binding loops; other site
160488000710	ABC-ATPase subunit interface; other site
160488000711	DL-methionine transporter ATP-binding subunit; Provisional; Region: metN; PRK11153
160488000712	ATP-binding cassette domain of methionine transporter; Region: ABC_MetN_methionine_transporter; cd03258
160488000713	Walker A/P-loop; other site
160488000714	ATP binding site [chemical binding]; other site
160488000715	Q-loop/lid; other site
160488000716	ABC transporter signature motif; other site
160488000717	Walker B; other site
160488000718	D-loop; other site
160488000719	H-loop/switch region; other site
160488000720	This domain is found at the C-terminus of ABC transporter proteins involved in D-methionine transport as well as a number of ferredoxin-like proteins; Region: NIL; smart00930
160488000721	NLPA lipoprotein; Region: Lipoprotein_9; pfam03180
160488000722	FMN-dependent oxidoreductase, nitrilotriacetate monooxygenase family; Region: FMN_nitrolo; TIGR03860
160488000723	nitrilotriacetate monoxygenase oxidizes nitrilotriacetate utilizing reduced flavin mononucleotide (FMNH2) and oxygen. The FMNH2 is provided by an NADH:flavin mononucleotide (FMN) oxidorductase that uses NADH to reduce FMN to FMNH2; Region: Nitrilotriacetate_monoxgenase; cd01095
160488000724	active site
160488000725	non-prolyl cis peptide bond; other site
160488000726	sulfur acquisition oxidoreductase, SfnB family; Region: sulfur_SfnB; TIGR04022
160488000727	Dibenzothiophene (DBT) desulfurization enzyme C; Region: DszC; cd01163
160488000728	Flavin binding site [chemical binding]; other site
160488000729	sulfur acquisition oxidoreductase, SfnB family; Region: sulfur_SfnB; TIGR04022
160488000730	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
160488000731	active site
160488000732	putative amino-acid ABC transporter ATP-binding protein YecC; Provisional; Region: PRK11264
160488000733	ATP-binding cassette domain of the histidine and glutamine transporters; Region: ABC_HisP_GlnQ; cd03262
160488000734	Walker A/P-loop; other site
160488000735	ATP binding site [chemical binding]; other site
160488000736	Q-loop/lid; other site
160488000737	ABC transporter signature motif; other site
160488000738	Walker B; other site
160488000739	D-loop; other site
160488000740	H-loop/switch region; other site
160488000741	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488000742	dimer interface [polypeptide binding]; other site
160488000743	conserved gate region; other site
160488000744	putative PBP binding loops; other site
160488000745	ABC-ATPase subunit interface; other site
160488000746	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
160488000747	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488000748	substrate binding pocket [chemical binding]; other site
160488000749	membrane-bound complex binding site; other site
160488000750	hinge residues; other site
160488000751	serine O-acetyltransferase; Region: cysE; TIGR01172
160488000752	Serine acetyltransferase (SAT): SAT catalyzes the CoA-dependent acetylation of the side chain hydroxyl group of L-serine to form O-acetylserine, as the first step of a two-step biosynthetic pathway in bacteria and plants leading to the formation of...; Region: LbH_SAT; cd03354
160488000753	trimer interface [polypeptide binding]; other site
160488000754	active site
160488000755	substrate binding site [chemical binding]; other site
160488000756	CoA binding site [chemical binding]; other site
160488000757	BCCT family transporter; Region: BCCT; cl00569
160488000758	Probable taurine catabolism dioxygenase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: TauD; COG2175
160488000759	taurine dioxygenase; Reviewed; Region: tauD; PRK09553
160488000760	ABC-type nitrate/sulfonate/bicarbonate transport system, permease component [Inorganic ion transport and metabolism]; Region: TauC; COG0600
160488000761	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488000762	dimer interface [polypeptide binding]; other site
160488000763	conserved gate region; other site
160488000764	putative PBP binding loops; other site
160488000765	ABC-ATPase subunit interface; other site
160488000766	taurine transporter ATP-binding subunit; Provisional; Region: tauB; PRK11248
160488000767	ATP-binding cassette domain of the nitrate and sulfonate transporters; Region: ABC_NrtD_SsuB_transporters; cd03293
160488000768	Walker A/P-loop; other site
160488000769	ATP binding site [chemical binding]; other site
160488000770	Q-loop/lid; other site
160488000771	ABC transporter signature motif; other site
160488000772	Walker B; other site
160488000773	D-loop; other site
160488000774	H-loop/switch region; other site
160488000775	taurine ABC transporter, periplasmic binding protein; Region: taurine_ABC_bnd; TIGR01729
160488000776	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488000777	substrate binding pocket [chemical binding]; other site
160488000778	membrane-bound complex binding site; other site
160488000779	hinge residues; other site
160488000780	outer membrane porin, OprD family; Region: OprD; pfam03573
160488000781	Peroxiredoxin [Posttranslational modification, protein turnover, chaperones]; Region: AhpC; COG0450
160488000782	Peroxiredoxin (PRX) family, 1-cys PRX subfamily; composed of PRXs containing only one conserved cysteine, which serves as the peroxidatic cysteine. They are homodimeric thiol-specific antioxidant (TSA) proteins that confer a protective role in cells by...; Region: PRX_1cys; cd03016
160488000783	dimer interface [polypeptide binding]; other site
160488000784	decamer (pentamer of dimers) interface [polypeptide binding]; other site
160488000785	catalytic triad [active]
160488000786	NAD(P)H-dependent FMN reductase; Provisional; Region: PRK10569
160488000787	NADPH-dependent FMN reductase; Region: FMN_red; pfam03358
160488000788	ABC transporter, substrate-binding protein, aliphatic sulfonates family; Region: SsuA_fam; TIGR01728
160488000789	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488000790	substrate binding pocket [chemical binding]; other site
160488000791	membrane-bound complex binding site; other site
160488000792	hinge residues; other site
160488000793	alkanesulfonate monooxygenase; Provisional; Region: PRK00719
160488000794	Alkanesulfonate monoxygenase is the monoxygenase of a two-component system that catalyzes the conversion of alkanesulfonates to the corresponding aldehyde and sulfite. Alkanesulfonate monoxygenase (SsuD) has an absolute requirement for reduced flavin...; Region: Alkanesulfonate_monoxygenase; cd01094
160488000795	active site
160488000796	dimer interface [polypeptide binding]; other site
160488000797	non-prolyl cis peptide bond; other site
160488000798	insertion regions; other site
160488000799	ABC-type nitrate/sulfonate/bicarbonate transport system, permease component [Inorganic ion transport and metabolism]; Region: TauC; COG0600
160488000800	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488000801	dimer interface [polypeptide binding]; other site
160488000802	conserved gate region; other site
160488000803	putative PBP binding loops; other site
160488000804	ABC-ATPase subunit interface; other site
160488000805	aliphatic sulfonates transport ATP-binding subunit; Provisional; Region: ssuB; PRK11247
160488000806	ATP-binding cassette domain of the nitrate and sulfonate transporters; Region: ABC_NrtD_SsuB_transporters; cd03293
160488000807	Walker A/P-loop; other site
160488000808	ATP binding site [chemical binding]; other site
160488000809	Q-loop/lid; other site
160488000810	ABC transporter signature motif; other site
160488000811	Walker B; other site
160488000812	D-loop; other site
160488000813	H-loop/switch region; other site
160488000814	Molybdopterin-binding protein [Coenzyme metabolism]; Region: MopI; COG3585
160488000815	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
160488000816	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
160488000817	glutamate--cysteine ligase; Provisional; Region: PRK02107
160488000818	PaaI_thioesterase is a tetrameric acyl-CoA thioesterase with a hot dog fold and one of several proteins responsible for phenylacetic acid (PA) degradation in bacteria.  Although orthologs of PaaI exist in archaea and eukaryotes, their function has not...; Region: PaaI_thioesterase; cd03443
160488000819	Thioesterase-like superfamily; Region: 4HBT_3; pfam13622
160488000820	CoenzymeA binding site [chemical binding]; other site
160488000821	subunit interaction site [polypeptide binding]; other site
160488000822	PHB binding site; other site
160488000823	Transcriptional accessory protein [Transcription]; Region: Tex; COG2183
160488000824	Tex-like protein N-terminal domain; Region: Tex_N; pfam09371
160488000825	Likely ribonuclease with RNase H fold; Region: YqgFc; smart00732
160488000826	S1_Tex: The C-terminal S1 domain of a transcription accessory factor called Tex, which has been characterized in Bordetella pertussis and Pseudomonas aeruginosa. The tex gene is essential in Bortella pertusis and is named for its role in toxin expression; Region: S1_Tex; cd05685
160488000827	RNA binding site [nucleotide binding]; other site
160488000828	osmolarity response regulator; Provisional; Region: ompR; PRK09468
160488000829	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488000830	active site
160488000831	phosphorylation site [posttranslational modification]
160488000832	intermolecular recognition site; other site
160488000833	dimerization interface [polypeptide binding]; other site
160488000834	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
160488000835	DNA binding site [nucleotide binding]
160488000836	osmolarity sensor protein; Provisional; Region: envZ; PRK09467
160488000837	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
160488000838	dimerization interface [polypeptide binding]; other site
160488000839	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488000840	ATP binding site [chemical binding]; other site
160488000841	Mg2+ binding site [ion binding]; other site
160488000842	G-X-G motif; other site
160488000843	ribosomal protein S6 modification protein; Provisional; Region: PRK10446
160488000844	RimK-like ATP-grasp domain; Region: RimK; pfam08443
160488000845	Uncharacterized protein conserved in archaea [Posttranslational modification, protein turnover, chaperones]; Region: COG4067
160488000846	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
160488000847	RNA binding surface [nucleotide binding]; other site
160488000848	PAP2_like proteins, a super-family of histidine phosphatases and vanadium haloperoxidases, includes type 2 phosphatidic acid phosphatase or lipid phosphate phosphatase (LPP), Glucose-6-phosphatase, Phosphatidylglycerophosphatase B and bacterial acid...; Region: PAP2_like; cd01610
160488000849	Membrane-associated phospholipid phosphatase [Lipid metabolism]; Region: PgpB; COG0671
160488000850	active site
160488000851	Hsp33-like chaperonin; Reviewed; Region: hslO; PRK00114
160488000852	Heat shock protein 33 (Hsp33):  Cytosolic protein that acts as a molecular chaperone under oxidative conditions.  In normal (reducing) cytosolic conditions, four conserved Cys residues are coordinated by a Zn ion. Under oxidative stress (such as heat...; Region: Hsp33; cd00498
160488000853	dimerization interface [polypeptide binding]; other site
160488000854	domain crossover interface; other site
160488000855	redox-dependent activation switch; other site
160488000856	4-hydroxybenzoyl-CoA thioesterase (4HBT). Catalyzes the final step in the 4-chlorobenzoate degradation pathway in which 4-chlorobenzoate is converted to 4-hydroxybenzoate in certain soil-dwelling bacteria. 4HBT forms a homotetramer with four active sites; Region: 4HBT; cd00586
160488000857	active site
160488000858	oxidoreductase alpha (molybdopterin) subunit; Region: Fdhalpha-like; TIGR01701
160488000859	The MopB_ydeP CD includes a group of related uncharacterized bacterial molybdopterin-binding oxidoreductase-like domains with a putative molybdopterin cofactor binding site. These members belong to the molybdopterin_binding (MopB) superfamily of proteins; Region: MopB_ydeP; cd02767
160488000860	putative molybdopterin cofactor binding site [chemical binding]; other site
160488000861	The MopB_CT_ydeP CD includes a group of related uncharacterized bacterial molybdopterin-binding oxidoreductase-like domains with a putative molybdopterin cofactor binding site. This CD is of the conserved molybdopterin_binding C-terminal (MopB_CT) region...; Region: MopB_CT_ydeP; cd02787
160488000862	putative molybdopterin cofactor binding site; other site
160488000863	FdhD/NarQ family; Region: FdhD-NarQ; cl00659
160488000864	LysM domain/BON superfamily protein; Provisional; Region: PRK11198
160488000865	BON domain; Region: BON; pfam04972
160488000866	Lysine Motif is a small domain involved in binding peptidoglycan; Region: LysM; cd00118
160488000867	haloacid dehalogenase superfamily, subfamily IA, variant 3 with third motif having DD or ED; Region: HAD-SF-IA-v3; TIGR01509
160488000868	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
160488000869	motif II; other site
160488000870	adenosine nucleotide hydrolase NudE; Provisional; Region: nudE; PRK11762
160488000871	ADP-ribose pyrophosphatase (ADPRase) catalyzes the hydrolysis of ADP-ribose and a variety of additional ADP-sugar conjugates to AMP and ribose-5-phosphate. Like other members of the Nudix hydrolase superfamily, it requires a divalent cation, such as Mg2+; Region: ADPRase_NUDT5; cd03424
160488000872	dimer interface [polypeptide binding]; other site
160488000873	ADP-ribose binding site [chemical binding]; other site
160488000874	active site
160488000875	nudix motif; other site
160488000876	metal binding site [ion binding]; metal-binding site
160488000877	CysQ, a 3'-Phosphoadenosine-5'-phosphosulfate (PAPS) 3'-phosphatase, is a bacterial member of the inositol monophosphatase family. It has been proposed that CysQ helps control intracellular levels of PAPS, which is an intermediate in...; Region: CysQ; cd01638
160488000878	Archaeal fructose-1,6-bisphosphatase and related enzymes of inositol monophosphatase family [Carbohydrate transport and metabolism]; Region: SuhB; COG0483
160488000879	active site
160488000880	thioesterase domain, putative; Region: yiiD_Cterm; TIGR02447
160488000881	Response regulator containing CheY-like receiver, AAA-type ATPase, and DNA-binding domains [Signal transduction mechanisms]; Region: AtoC; COG2204
160488000882	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488000883	active site
160488000884	phosphorylation site [posttranslational modification]
160488000885	intermolecular recognition site; other site
160488000886	dimerization interface [polypeptide binding]; other site
160488000887	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488000888	Walker A motif; other site
160488000889	ATP binding site [chemical binding]; other site
160488000890	Walker B motif; other site
160488000891	arginine finger; other site
160488000892	Bacterial regulatory protein, Fis family; Region: HTH_8; pfam02954
160488000893	Signal transduction histidine kinase regulating C4-dicarboxylate transport system [Signal transduction mechanisms]; Region: COG4191
160488000894	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488000895	dimer interface [polypeptide binding]; other site
160488000896	phosphorylation site [posttranslational modification]
160488000897	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488000898	ATP binding site [chemical binding]; other site
160488000899	G-X-G motif; other site
160488000900	dTDP-4-dehydrorhamnose 3,5-epimerase; Region: rmlC; TIGR01221
160488000901	agmatine deiminase; Provisional; Region: PRK13551
160488000902	agmatine deiminase; Region: agmatine_aguA; TIGR03380
160488000903	TonB-dependent siderophore receptor; Region: TonB-siderophor; TIGR01783
160488000904	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
160488000905	N-terminal plug; other site
160488000906	ligand-binding site [chemical binding]; other site
160488000907	outer membrane porin, OprD family; Region: OprD; pfam03573
160488000908	Glutamate synthase domain 2 [Amino acid transport and metabolism]; Region: GltB; COG0069
160488000909	Glutamate synthase (GltS) FMN-binding domain.  GltS is a complex iron-sulfur flavoprotein that catalyzes the reductive synthesis of L-glutamate from 2-oxoglutarate and L-glutamine via intramolecular channelling of ammonia, a reaction in the plant, yeast...; Region: GltS_FMN; cd02808
160488000910	active site
160488000911	FMN binding site [chemical binding]; other site
160488000912	substrate binding site [chemical binding]; other site
160488000913	3Fe-4S cluster binding site [ion binding]; other site
160488000914	osmolarity sensor protein; Provisional; Region: envZ; PRK09467
160488000915	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488000916	ATP binding site [chemical binding]; other site
160488000917	Mg2+ binding site [ion binding]; other site
160488000918	G-X-G motif; other site
160488000919	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
160488000920	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488000921	active site
160488000922	phosphorylation site [posttranslational modification]
160488000923	intermolecular recognition site; other site
160488000924	dimerization interface [polypeptide binding]; other site
160488000925	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
160488000926	DNA binding site [nucleotide binding]
160488000927	Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid [Inorganic ion transport and metabolism]; Region: FhuE; COG4773
160488000928	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
160488000929	N-terminal plug; other site
160488000930	ligand-binding site [chemical binding]; other site
160488000931	Protein of unknown function (DUF3079); Region: DUF3079; pfam11278
160488000932	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
160488000933	non-specific DNA binding site [nucleotide binding]; other site
160488000934	salt bridge; other site
160488000935	sequence-specific DNA binding site [nucleotide binding]; other site
160488000936	Phage derived protein Gp49-like (DUF891); Region: Gp49; cl01470
160488000937	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
160488000938	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
160488000939	non-specific DNA binding site [nucleotide binding]; other site
160488000940	sequence-specific DNA binding site [nucleotide binding]; other site
160488000941	salt bridge; other site
160488000942	Protein of unknown function (DUF3077); Region: DUF3077; pfam11275
160488000943	Methyltransferase domain; Region: Methyltransf_32; pfam13679
160488000944	ABC-type arginine transport system, permease component [Amino acid transport and metabolism]; Region: ArtQ; COG4215
160488000945	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488000946	dimer interface [polypeptide binding]; other site
160488000947	conserved gate region; other site
160488000948	putative PBP binding loops; other site
160488000949	ABC-ATPase subunit interface; other site
160488000950	ABC-type arginine transport system, permease component [Amino acid transport and metabolism]; Region: ArtQ; COG4215
160488000951	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488000952	dimer interface [polypeptide binding]; other site
160488000953	conserved gate region; other site
160488000954	putative PBP binding loops; other site
160488000955	ABC-ATPase subunit interface; other site
160488000956	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
160488000957	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488000958	substrate binding pocket [chemical binding]; other site
160488000959	membrane-bound complex binding site; other site
160488000960	hinge residues; other site
160488000961	ABC-type histidine transport system, ATPase component [Amino acid transport and metabolism]; Region: HisP; COG4598
160488000962	ATP-binding cassette domain of the histidine and glutamine transporters; Region: ABC_HisP_GlnQ; cd03262
160488000963	Walker A/P-loop; other site
160488000964	ATP binding site [chemical binding]; other site
160488000965	Q-loop/lid; other site
160488000966	ABC transporter signature motif; other site
160488000967	Walker B; other site
160488000968	D-loop; other site
160488000969	H-loop/switch region; other site
160488000970	gamma-aminobutyrate permease; Region: GABAperm; TIGR01773
160488000971	oxidative damage protection protein; Provisional; Region: PRK05408
160488000972	adenine DNA glycosylase; Provisional; Region: PRK10880
160488000973	endonuclease III; includes endonuclease III (DNA-(apurinic or apyrimidinic site) lyase), alkylbase DNA glycosidases (Alka-family) and other DNA glycosidases; Region: ENDO3c; cd00056
160488000974	minor groove reading motif; other site
160488000975	helix-hairpin-helix signature motif; other site
160488000976	substrate binding pocket [chemical binding]; other site
160488000977	active site
160488000978	Iron-sulfur binding domain of endonuclease III; Region: EndIII_4Fe-2S; pfam10576
160488000979	DNA glycosylase (MutY in bacteria and hMYH in humans) is responsible for repairing misread  A*oxoG residues to C*G by removing the inappropriately paired adenine base from the DNA backbone. It belongs to the Nudix hydrolase superfamily and is important...; Region: DNA_Glycosylase_C; cd03431
160488000980	DNA binding and oxoG recognition site [nucleotide binding]
160488000981	Uncharacterized protein involved in outer membrane biogenesis [Cell envelope biogenesis, outer membrane]; Region: AsmA; COG2982
160488000982	AsmA-like C-terminal region; Region: AsmA_2; pfam13502
160488000983	oxalate/formate antiporter; Region: oxa_formateAnti; TIGR04259
160488000984	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488000985	Imidazoleglycerol-phosphate dehydratase; Region: IGPD; cd07914
160488000986	putative active site pocket [active]
160488000987	4-fold oligomerization interface [polypeptide binding]; other site
160488000988	metal binding residues [ion binding]; metal-binding site
160488000989	3-fold/trimer interface [polypeptide binding]; other site
160488000990	imidazole glycerol phosphate synthase subunit HisH; Provisional; Region: hisH; PRK13146
160488000991	Type 1 glutamine amidotransferase (GATase1) domain found in imidazole glycerol phosphate synthase (IGPS); Region: GATase1_IGP_Synthase; cd01748
160488000992	putative active site [active]
160488000993	oxyanion strand; other site
160488000994	catalytic triad [active]
160488000995	Uncharacterized conserved protein (DUF2164); Region: DUF2164; pfam09932
160488000996	HisA.  Phosphoribosylformimino-5-aminoimidazole carboxamide ribonucleotide (ProFAR) isomerase catalyzes the fourth step in histidine biosynthesis, an isomerisation of the aminoaldose moiety of ProFAR to the aminoketose of PRFAR (N-(5'-phospho-D-1...; Region: HisA; cd04732
160488000997	Histidine biosynthesis protein; Region: His_biosynth; pfam00977
160488000998	catalytic residues [active]
160488000999	The cyclase subunit of imidazoleglycerol phosphate synthase (HisF). Imidazole glycerol phosphate synthase (IGPS) catalyzes the fifth step of histidine biosynthesis, the formation of the imidazole ring. IGPS converts N1-(5'-phosphoribulosyl)...; Region: HisF; cd04731
160488001000	Histidine biosynthesis protein; Region: His_biosynth; pfam00977
160488001001	substrate binding site [chemical binding]; other site
160488001002	glutamase interaction surface [polypeptide binding]; other site
160488001003	choline ABC transporter, ATP-binding protein; Region: ABC_choXWV_ATP; TIGR03415
160488001004	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488001005	Walker A/P-loop; other site
160488001006	ATP binding site [chemical binding]; other site
160488001007	Q-loop/lid; other site
160488001008	ABC transporter signature motif; other site
160488001009	Walker B; other site
160488001010	D-loop; other site
160488001011	H-loop/switch region; other site
160488001012	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488001013	dimer interface [polypeptide binding]; other site
160488001014	conserved gate region; other site
160488001015	putative PBP binding loops; other site
160488001016	ABC-ATPase subunit interface; other site
160488001017	choline ABC transporter, periplasmic binding protein; Region: ABC_choline_bnd; TIGR03414
160488001018	ABC-type proline/glycine betaine transport systems, periplasmic components [Amino acid transport and metabolism]; Region: ProX; COG2113
160488001019	L-serine dehydratase, iron-sulfur-dependent, single chain form; Region: sda_mono; TIGR00720
160488001020	Serine dehydratase beta chain; Region: SDH_beta; pfam03315
160488001021	Serine dehydratase alpha chain; Region: SDH_alpha; pfam03313
160488001022	Transcriptional regulator containing an amidase domain and an AraC-type DNA-binding HTH domain [Transcription]; Region: COG4977
160488001023	AraC transcriptional regulators having an N-terminal Type 1 glutamine amidotransferase (GATase1)-like domain; Region: GATase1_AraC_ArgR_like; cd03136
160488001024	conserved cys residue [active]
160488001025	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488001026	Zinc-dependent metalloprotease. This super-family of metalloproteases contains two major branches, the astacin-like proteases and the adamalysin/reprolysin-like proteases. Both branches have wide phylogenetic distribution, and contain sub-families, which...; Region: ZnMc; cl00064
160488001027	4-hydroxybenzoyl-CoA thioesterase (4HBT). Catalyzes the final step in the 4-chlorobenzoate degradation pathway in which 4-chlorobenzoate is converted to 4-hydroxybenzoate in certain soil-dwelling bacteria. 4HBT forms a homotetramer with four active sites; Region: 4HBT; cd00586
160488001028	active site
160488001029	3-hydroxybutyryl-CoA dehydrogenase; Validated; Region: PRK07066
160488001030	3-hydroxyacyl-CoA dehydrogenase, NAD binding domain; Region: 3HCDH_N; pfam02737
160488001031	3-hydroxyacyl-CoA dehydrogenase, C-terminal domain; Region: 3HCDH; pfam00725
160488001032	Uncharacterized conserved protein [Function unknown]; Region: COG3246
160488001033	ABC-type proline/glycine betaine transport systems, periplasmic components [Amino acid transport and metabolism]; Region: ProX; COG2113
160488001034	choline ABC transporter, periplasmic binding protein; Region: ABC_choline_bnd; TIGR03414
160488001035	Transcriptional regulator containing an amidase domain and an AraC-type DNA-binding HTH domain [Transcription]; Region: COG4977
160488001036	AraC transcriptional regulators having an N-terminal Type 1 glutamine amidotransferase (GATase1)-like domain; Region: GATase1_AraC_ArgR_like; cd03136
160488001037	conserved cys residue [active]
160488001038	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488001039	Protein of unknown function (DUF1311); Region: DUF1311; pfam07007
160488001040	Zn-dependent dipeptidase, microsomal dipeptidase homolog [Amino acid transport and metabolism]; Region: COG2355
160488001041	Membrane dipeptidase (Peptidase family M19); Region: Peptidase_M19; pfam01244
160488001042	active site
160488001043	V4R domain; Region: V4R; cl15268
160488001044	mycofactocin system FadH/OYE family oxidoreductase 2; Region: mycofact_OYE_2; TIGR03997
160488001045	Old yellow enzyme (OYE)-related FMN binding domain, group 3. Each monomer of OYE contains FMN as a non-covalently bound cofactor, uses NADPH as a reducing agent with oxygens, quinones, and alpha,beta-unsaturated aldehydes and ketones, and can act as...; Region: OYE_like_3_FMN; cd04734
160488001046	putative active site [active]
160488001047	putative FMN binding site [chemical binding]; other site
160488001048	putative substrate binding site [chemical binding]; other site
160488001049	putative catalytic residue [active]
160488001050	Domain of unknown function (DUF3483); Region: DUF3483; pfam11982
160488001051	Fe-S oxidoreductase [Energy production and conversion]; Region: GlpC; COG0247
160488001052	Cysteine-rich domain; Region: CCG; pfam02754
160488001053	Cysteine-rich domain; Region: CCG; pfam02754
160488001054	Adenine nucleotide alpha hydrolases superfamily including N type ATP PPases, ATP sulphurylases Universal Stress Response protein and electron transfer flavoprotein (ETF). The domain forms a apha/beta/apha fold which  binds to Adenosine nucleotide; Region: AANH_like; cl00292
160488001055	Ligand Binding Site [chemical binding]; other site
160488001056	Electron transfer flavoprotein, alpha subunit [Energy production and conversion]; Region: FixB; COG2025
160488001057	Electron transfer flavoprotein FAD-binding domain; Region: ETF_alpha; pfam00766
160488001058	Electron transfer flavoprotein, beta subunit [Energy production and conversion]; Region: FixA; COG2086
160488001059	Ligand Binding Site [chemical binding]; other site
160488001060	Electron transfer flavoprotein domain; Region: ETF; pfam01012
160488001061	RHS repeat-associated core domain; Region: Rhs_assc_core; TIGR03696
160488001062	Phenylpropionate dioxygenase and related ring-hydroxylating dioxygenases, large terminal subunit [Inorganic ion transport and metabolism / General function prediction only]; Region: HcaE; COG4638
160488001063	Rieske non-heme iron oxygenase (RO) family, N-terminal Rieske domain of the oxygenase alpha subunit; The RO family comprise a large class of aromatic ring-hydroxylating dioxygenases found predominantly in microorganisms. These enzymes enable...; Region: Rieske_RO_Alpha_N; cd03469
160488001064	[2Fe-2S] cluster binding site [ion binding]; other site
160488001065	C-terminal catalytic domain of GbcA (glycine betaine catabolism A) from Pseudomonas aeruginosa PAO1 and related aromatic ring hydroxylating dioxygenases; Region: RHO_alpha_C_GbcA-like; cd08884
160488001066	putative alpha subunit interface [polypeptide binding]; other site
160488001067	putative active site [active]
160488001068	putative substrate binding site [chemical binding]; other site
160488001069	Fe binding site [ion binding]; other site
160488001070	Flavodoxin reductases (ferredoxin-NADPH reductases) family 1 [Energy production and conversion]; Region: Hmp; COG1018
160488001071	Iron-sulfur binding ferredoxin reductase (FNR) proteins combine the FAD and NAD(P) binding regions of FNR with an iron-sulfur binding cluster domain. Ferredoxin-NADP+ (oxido)reductase is an FAD-containing enzyme that catalyzes the reversible electron...; Region: FNR_iron_sulfur_binding_1; cd06215
160488001072	FAD binding pocket [chemical binding]; other site
160488001073	FAD binding motif [chemical binding]; other site
160488001074	phosphate binding motif [ion binding]; other site
160488001075	beta-alpha-beta structure motif; other site
160488001076	NAD binding pocket [chemical binding]; other site
160488001077	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
160488001078	catalytic loop [active]
160488001079	iron binding site [ion binding]; other site
160488001080	Four helix bundle sensory module for signal transduction; Region: 4HB_MCP_1; pfam12729
160488001081	Methyl-accepting chemotaxis protein [Cell motility and secretion / Signal transduction mechanisms]; Region: Tar; COG0840
160488001082	HAMP domain; Region: HAMP; pfam00672
160488001083	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
160488001084	dimer interface [polypeptide binding]; other site
160488001085	putative CheW interface [polypeptide binding]; other site
160488001086	Cell division protein ZapA; Region: ZapA; pfam05164
160488001087	Cache domain; Region: Cache_1; pfam02743
160488001088	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
160488001089	dimerization interface [polypeptide binding]; other site
160488001090	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
160488001091	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
160488001092	dimer interface [polypeptide binding]; other site
160488001093	putative CheW interface [polypeptide binding]; other site
160488001094	Threonine aldolase [Amino acid transport and metabolism]; Region: GLY1; COG2008
160488001095	Low-specificity threonine aldolase (TA). This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I).  TA catalyzes the conversion of L-threonine or L-allo-threonine to glycine and acetaldehyde in a...; Region: TA_like; cd06502
160488001096	tetramer interface [polypeptide binding]; other site
160488001097	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488001098	catalytic residue [active]
160488001099	serine hydroxymethyltransferase; Reviewed; Region: PRK13034
160488001100	Serine-glycine hydroxymethyltransferase (SHMT). This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). SHMT carries out interconversion of serine and glycine; it catalyzes the transfer of hydroxymethyl...; Region: SHMT; cd00378
160488001101	dimer interface [polypeptide binding]; other site
160488001102	active site
160488001103	glycine-pyridoxal phosphate binding site [chemical binding]; other site
160488001104	folate binding site [chemical binding]; other site
160488001105	sarcosine oxidase, beta subunit family, heterotetrameric form; Region: soxB; TIGR01373
160488001106	putative aminophosphonate oxidoreductase; Region: Phn_aa_oxid; TIGR03329
160488001107	Sarcosine oxidase, delta subunit family; Region: SoxD; pfam04267
160488001108	sarcosine oxidase, alpha subunit family, heterotetrameric form; Region: soxA; TIGR01372
160488001109	2Fe-2S iron-sulfur cluster binding domain; Region: Fer2_4; pfam13510
160488001110	Glycine cleavage T-protein C-terminal barrel domain; Region: GCV_T_C; pfam08669
160488001111	Sarcosine oxidase, gamma subunit family; Region: SoxG; pfam04268
160488001112	formyltetrahydrofolate deformylase; Reviewed; Region: PRK13011
160488001113	N-terminal ACT domain of formyltetrahydrofolate deformylase (F4HF-DF; formyltetrahydrofolate hydrolase); Region: ACT_F4HF-DF; cd04875
160488001114	Formyltetrahydrofolate deformylase (Formyl-FH4 hydrolase), C-terminal hydrolase domain; Region: FMT_core_Formyl-FH4-Hydrolase_C; cd08648
160488001115	putative active site [active]
160488001116	putative substrate binding site [chemical binding]; other site
160488001117	putative cosubstrate binding site; other site
160488001118	catalytic site [active]
160488001119	formaldehyde dehydrogenase, glutathione-independent; Region: fdhA_non_GSH; TIGR02819
160488001120	Pseudomonas putida aldehyde-dismutating formaldehyde dehydrogenase (PFDH); Region: PFDH_like; cd08282
160488001121	NAD binding site [chemical binding]; other site
160488001122	catalytic Zn binding site [ion binding]; other site
160488001123	structural Zn binding site [ion binding]; other site
160488001124	RHS repeat-associated core domain; Region: Rhs_assc_core; TIGR03696
160488001125	Protein of unknown function VcgC/VcgE (DUF2780); Region: DUF2780; pfam11075
160488001126	RHS repeat-associated core domain; Region: Rhs_assc_core; TIGR03696
160488001127	1-acyl-sn-glycerol-3-phosphate acyltransferase [Lipid metabolism]; Region: PlsC; COG0204
160488001128	Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: LCLAT1-like; Region: LPLAT_LCLAT1-like; cd07990
160488001129	putative acyl-acceptor binding pocket; other site
160488001130	Uncharacterized protein conserved in archaea [Posttranslational modification, protein turnover, chaperones]; Region: COG4067
160488001131	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3547
160488001132	Transposase; Region: DEDD_Tnp_IS110; pfam01548
160488001133	Transposase IS116/IS110/IS902 family; Region: Transposase_20; pfam02371
160488001134	putative glutathione S-transferase; Provisional; Region: PRK10357
160488001135	GST_N family, unknown subfamily 3; composed of uncharacterized bacterial proteins with similarity to GSTs. GSTs are cytosolic dimeric proteins involved in cellular detoxification by catalyzing the conjugation of glutathione (GSH) with a wide range of...; Region: GST_N_3; cd03049
160488001136	putative C-terminal domain interface [polypeptide binding]; other site
160488001137	putative GSH binding site (G-site) [chemical binding]; other site
160488001138	putative dimer interface [polypeptide binding]; other site
160488001139	C-terminal, alpha helical domain of an unknown subfamily 6 of Glutathione S-transferases; Region: GST_C_6; cd03205
160488001140	dimer interface [polypeptide binding]; other site
160488001141	N-terminal domain interface [polypeptide binding]; other site
160488001142	putative substrate binding pocket (H-site) [chemical binding]; other site
160488001143	methionine sulfoxide reductase A; Provisional; Region: PRK00058
160488001144	FOG: GAF domain [Signal transduction mechanisms]; Region: FhlA; COG2203
160488001145	GAF domain; Region: GAF; pfam01590
160488001146	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488001147	PAS domain; Region: PAS_9; pfam13426
160488001148	putative active site [active]
160488001149	heme pocket [chemical binding]; other site
160488001150	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
160488001151	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488001152	metal binding site [ion binding]; metal-binding site
160488001153	active site
160488001154	I-site; other site
160488001155	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
160488001156	dihydrolipoamide acetyltransferase; Reviewed; Region: PRK11855
160488001157	Lipoyl domain of the dihydrolipoyl acyltransferase component (E2) of 2-oxo acid dehydrogenases. 2-oxo acid dehydrogenase multienzyme complexes, like pyruvate dehydrogenase (PDH), 2-oxoglutarate dehydrogenase (OGDH) and branched-chain 2-oxo acid...; Region: lipoyl_domain; cd06849
160488001158	E3 interaction surface; other site
160488001159	lipoyl attachment site [posttranslational modification]; other site
160488001160	Lipoyl domain of the dihydrolipoyl acyltransferase component (E2) of 2-oxo acid dehydrogenases. 2-oxo acid dehydrogenase multienzyme complexes, like pyruvate dehydrogenase (PDH), 2-oxoglutarate dehydrogenase (OGDH) and branched-chain 2-oxo acid...; Region: lipoyl_domain; cd06849
160488001161	E3 interaction surface; other site
160488001162	lipoyl attachment site [posttranslational modification]; other site
160488001163	e3 binding domain; Region: E3_binding; pfam02817
160488001164	2-oxoacid dehydrogenases acyltransferase (catalytic domain); Region: 2-oxoacid_dh; pfam00198
160488001165	pyruvate dehydrogenase subunit E1; Reviewed; Region: aceE; PRK09405
160488001166	Thiamine pyrophosphate (TPP) family, E1 of E. coli PDC-like subfamily, TPP-binding module; composed of proteins similar to the E1 component of the Escherichia coli pyruvate dehydrogenase multienzyme complex (PDC). PDC catalyzes the oxidative...; Region: TPP_E1_EcPDC_like; cd02017
160488001167	dimer interface [polypeptide binding]; other site
160488001168	TPP-binding site [chemical binding]; other site
160488001169	bifunctional glutamine-synthetase adenylyltransferase/deadenyltransferase; Reviewed; Region: PRK11072
160488001170	Nucleotidyltransferase (NT) domain of Escherichia coli adenylyltransferase (GlnE), Escherichia coli uridylyl transferase (GlnD), and similar proteins; Region: NT_GlnE_GlnD_like; cd05401
160488001171	metal binding triad; other site
160488001172	GlnD PII-uridylyltransferase; Region: GlnD_UR_UTase; pfam08335
160488001173	Nucleotidyltransferase (NT) domain of Escherichia coli adenylyltransferase (GlnE), Escherichia coli uridylyl transferase (GlnD), and similar proteins; Region: NT_GlnE_GlnD_like; cd05401
160488001174	metal binding triad; other site
160488001175	GlnD PII-uridylyltransferase; Region: GlnD_UR_UTase; pfam08335
160488001176	ADP-heptose:LPS heptosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaF; COG0859
160488001177	Lipopolysaccharide heptosyltransferase is involved in the biosynthesis of lipooligosaccharide (LOS). Lipopolysaccharide (LPS) is a major component of the outer membrane of gram-negative bacteria. LPS heptosyltransferase transfers heptose molecules from...; Region: GT1_LPS_heptosyltransferase; cd03789
160488001178	putative active site [active]
160488001179	ADP-heptose:LPS heptosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaF; COG0859
160488001180	Lipopolysaccharide heptosyltransferase is involved in the biosynthesis of lipooligosaccharide (LOS). Lipopolysaccharide (LPS) is a major component of the outer membrane of gram-negative bacteria. LPS heptosyltransferase transfers heptose molecules from...; Region: GT1_LPS_heptosyltransferase; cd03789
160488001181	putative active site [active]
160488001182	Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438
160488001183	This family is most closely related to the GT1 family of glycosyltransferases and named after YqgM in Bacillus licheniformis about which little is known. Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to...; Region: GT1_YqgM_like; cd03801
160488001184	lipopolysaccharide core heptose(I) kinase RfaP; Provisional; Region: PRK15123
160488001185	Lipopolysaccharide kinase (Kdo/WaaP) family; Region: Kdo; cl17488
160488001186	Lipopolysaccharide kinase (Kdo/WaaP) family; Region: Kdo; cl17488
160488001187	Aminoglycoside 3'-phosphotransferase (APH) and Choline Kinase (ChoK) family. The APH/ChoK family is part of a larger superfamily that includes the catalytic domains of other kinases, such as the typical serine/threonine/tyrosine protein kinases (PKs)...; Region: APH_ChoK_like; cl17270
160488001188	active site
160488001189	ATP binding site [chemical binding]; other site
160488001190	Lipopolysaccharide kinase (Kdo/WaaP) family; Region: Kdo; cl17488
160488001191	Uncharacterized iron-regulated membrane protein [Function unknown]; Region: PiuB; COG3182
160488001192	PepSY-associated TM helix; Region: PepSY_TM_2; pfam13703
160488001193	Secretin and TonB N terminus short domain; Region: STN; smart00965
160488001194	ferrichrome outer membrane transporter; Provisional; Region: PRK10044
160488001195	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
160488001196	N-terminal plug; other site
160488001197	ligand-binding site [chemical binding]; other site
160488001198	Fe2+-dicitrate sensor, membrane component [Inorganic ion transport and metabolism / Signal transduction mechanisms]; Region: FecR; COG3712
160488001199	FecR protein; Region: FecR; pfam04773
160488001200	RNA polymerase sigma factor; Reviewed; Region: PRK12523
160488001201	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
160488001202	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
160488001203	DNA binding residues [nucleotide binding]
160488001204	DEDDh 3'-5' exonuclease domain family; Region: DEDDh; cd06127
160488001205	active site
160488001206	catalytic site [active]
160488001207	substrate binding site [chemical binding]; other site
160488001208	Predicted signal-transduction protein containing cAMP-binding and CBS domains [Signal transduction mechanisms]; Region: COG2905
160488001209	effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038
160488001210	ligand binding site [chemical binding]; other site
160488001211	flexible hinge region; other site
160488001212	The CBS domain, named after human CBS, is a small domain originally identified in cystathionine beta-synthase and is subsequently found in a wide range of different proteins. CBS domains usually occur in tandem repeats. They associate to form a so-called...; Region: CBS_pair; cl15354
160488001213	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains associated with either the CAP_ED (cAMP receptor protein effector domain) family of transcription factors and the DUF294 domain or the PB1 (Phox and Bem1p) domain; Region: CBS_pair_CAP-ED_DUF294_PBI_assoc2; cd04800
160488001214	Nucleotidyltransferase (NT) domain of Escherichia coli adenylyltransferase (GlnE), Escherichia coli uridylyl transferase (GlnD), and similar proteins; Region: NT_GlnE_GlnD_like; cd05401
160488001215	metal binding triad; other site
160488001216	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488001217	Response regulator receiver domain; Region: Response_reg; pfam00072
160488001218	active site
160488001219	phosphorylation site [posttranslational modification]
160488001220	intermolecular recognition site; other site
160488001221	dimerization interface [polypeptide binding]; other site
160488001222	Malate synthase G (MSG), monomeric enzyme present in some bacteria. In general, malate synthase catalyzes the Claisen condensation of glyoxylate and acetyl-CoA to malyl-CoA , which hydrolyzes to malate and CoA. This reaction is part of the glyoxylate...; Region: malate_synt_G; cd00728
160488001223	active site
160488001224	Glycine cleavage system regulatory protein [Amino acid transport and metabolism]; Region: GcvR; COG2716
160488001225	ACT domain; Region: ACT_6; pfam13740
160488001226	ACT domains that comprise the Glycine Cleavage System Transcriptional Repressor (GcvR) protein, and other related domains; Region: ACT_GcvR_2; cd04869
160488001227	Predicted permeases [General function prediction only]; Region: RarD; COG2962
160488001228	Putative homoserine kinase type II (protein kinase fold) [General function prediction only]; Region: COG2334
160488001229	serine/threonine protein kinase; Provisional; Region: PRK11768
160488001230	DNA-binding transcriptional regulator ModE; Provisional; Region: PRK10676
160488001231	N-terminal domain of molybdenum-binding protein [General function prediction only]; Region: ModE; cl17549
160488001232	TOBE domain; Region: TOBE; cl01440
160488001233	TOBE domain; Region: TOBE; cl01440
160488001234	Predicted amidophosphoribosyltransferases [General function prediction only]; Region: ComFC; COG1040
160488001235	biotin synthase; Provisional; Region: PRK15108
160488001236	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
160488001237	FeS/SAM binding site; other site
160488001238	Biotin and Thiamin Synthesis associated domain; Region: BATS; smart00876
160488001239	pyridoxal phosphate-dependent acyltransferase, putative; Region: gly_Cac_T_rel; TIGR01825
160488001240	KBL_like; this family belongs to the pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD corresponds to serine palmitoyltransferase (SPT), 5-aminolevulinate synthase (ALAS); Region: KBL_like; cd06454
160488001241	substrate-cofactor binding pocket; other site
160488001242	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488001243	catalytic residue [active]
160488001244	pimelyl-[acyl-carrier protein] methyl ester esterase; Region: bioH; TIGR01738
160488001245	biotin biosynthesis protein BioC; Region: BioC; TIGR02072
160488001246	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488001247	S-adenosylmethionine binding site [chemical binding]; other site
160488001248	AAA domain; Region: AAA_26; pfam13500
160488001249	dithiobiotin synthetase; Reviewed; Region: bioD; PRK00090
160488001250	Acyl-CoA dehydrogenase N terminal; Region: AcylCoA_DH_N; pfam12418
160488001251	acyl-CoA dehydrogenase; Provisional; Region: PTZ00456
160488001252	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
160488001253	active site
160488001254	Acetyl-CoA dehydrogenase C-terminal like; Region: Acyl-CoA_dh_C; pfam12806
160488001255	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
160488001256	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488001257	metal binding site [ion binding]; metal-binding site
160488001258	active site
160488001259	I-site; other site
160488001260	Acyl-CoA dehydrogenase N terminal; Region: AcylCoA_DH_N; pfam12418
160488001261	acyl-CoA dehydrogenase; Provisional; Region: PTZ00456
160488001262	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
160488001263	active site
160488001264	Acetyl-CoA dehydrogenase C-terminal like; Region: Acyl-CoA_dh_C; pfam12806
160488001265	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488001266	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488001267	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
160488001268	dimerization interface [polypeptide binding]; other site
160488001269	acetylornithine transaminase protein; Provisional; Region: argD; PRK03715
160488001270	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
160488001271	inhibitor-cofactor binding pocket; inhibition site
160488001272	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488001273	catalytic residue [active]
160488001274	Proteolipid membrane potential modulator; Region: Pmp3; pfam01679
160488001275	Alpha/beta hydrolase family; Region: Abhydrolase_5; pfam12695
160488001276	Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326
160488001277	pyrroloquinoline quinone biosynthesis protein PqqE; Provisional; Region: PRK05301
160488001278	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
160488001279	FeS/SAM binding site; other site
160488001280	radical SAM additional 4Fe4S-binding SPASM domain; Region: rSAM_more_4Fe4S; TIGR04085
160488001281	pyrroloquinoline quinone biosynthesis protein PqqD; Provisional; Region: PRK02079
160488001282	pyrroloquinoline quinone biosynthesis protein PqqC; Provisional; Region: PRK05157
160488001283	pyrroloquinoline quinone biosynthesis protein PqqB; Provisional; Region: PRK05184
160488001284	coenzyme PQQ biosynthesis protein B; Region: PQQ_syn_pqqB; TIGR02108
160488001285	coenzyme PQQ synthesis protein PqqA; Provisional; Region: pqqA; PRK00284
160488001286	coenzyme PQQ biosynthesis probable peptidase PqqF; Region: PQQ_syn_pqqF; TIGR02110
160488001287	Insulinase (Peptidase family M16); Region: Peptidase_M16; pfam00675
160488001288	Peptidase M16 inactive domain; Region: Peptidase_M16_C; pfam05193
160488001289	Peptidase M16 inactive domain; Region: Peptidase_M16_C; pfam05193
160488001290	Predicted amidohydrolase [General function prediction only]; Region: COG0388
160488001291	Pseudomonas sp. MCI3434 R-amidase and related proteins (putative class 13 nitrilases); Region: R-amidase_like; cd07576
160488001292	putative active site [active]
160488001293	catalytic triad [active]
160488001294	putative dimer interface [polypeptide binding]; other site
160488001295	Flavin containing amine oxidoreductase; Region: Amino_oxidase; pfam01593
160488001296	Transcriptional regulators [Transcription]; Region: Lrp; COG1522
160488001297	AsnC-type helix-turn-helix domain; Region: HTH_AsnC-type; pfam13404
160488001298	putative DNA binding site [nucleotide binding]; other site
160488001299	putative Zn2+ binding site [ion binding]; other site
160488001300	AsnC family; Region: AsnC_trans_reg; pfam01037
160488001301	Serine acetyltransferase (SAT): SAT catalyzes the CoA-dependent acetylation of the side chain hydroxyl group of L-serine to form O-acetylserine, as the first step of a two-step biosynthetic pathway in bacteria and plants leading to the formation of...; Region: LbH_SAT; cd03354
160488001302	trimer interface [polypeptide binding]; other site
160488001303	active site
160488001304	substrate binding site [chemical binding]; other site
160488001305	CoA binding site [chemical binding]; other site
160488001306	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
160488001307	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488001308	substrate binding pocket [chemical binding]; other site
160488001309	membrane-bound complex binding site; other site
160488001310	hinge residues; other site
160488001311	FOG: PAS/PAC domain [Signal transduction mechanisms]; Region: AtoS; COG2202
160488001312	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488001313	putative active site [active]
160488001314	heme pocket [chemical binding]; other site
160488001315	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488001316	cyclic-di-GMP phosphodiesterase; Provisional; Region: PRK11359
160488001317	putative active site [active]
160488001318	heme pocket [chemical binding]; other site
160488001319	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488001320	putative active site [active]
160488001321	heme pocket [chemical binding]; other site
160488001322	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488001323	putative active site [active]
160488001324	heme pocket [chemical binding]; other site
160488001325	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488001326	metal binding site [ion binding]; metal-binding site
160488001327	active site
160488001328	I-site; other site
160488001329	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
160488001330	RNA polymerase sigma factor RpoD; Validated; Region: PRK05658
160488001331	Sigma-70 factor, region 1.1; Region: Sigma70_r1_1; pfam03979
160488001332	Sigma-70 factor, region 1.2; Region: Sigma70_r1_2; pfam00140
160488001333	Sigma-70, non-essential region; Region: Sigma70_ner; pfam04546
160488001334	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
160488001335	Sigma-70 region 3; Region: Sigma70_r3; pfam04539
160488001336	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
160488001337	DNA binding residues [nucleotide binding]
160488001338	DNA primase, catalytic core; Region: dnaG; TIGR01391
160488001339	CHC2 zinc finger; Region: zf-CHC2; pfam01807
160488001340	DNA primase catalytic core, N-terminal domain; Region: Toprim_N; pfam08275
160488001341	TOPRIM_DnaG_primases: The topoisomerase-primase (TORPIM) nucleotidyl transferase/hydrolase domain found in the active site regions of proteins similar to Escherichia coli DnaG. Primases synthesize RNA primers for the initiation of DNA replication. DnaG...; Region: TOPRIM_DnaG_primases; cd03364
160488001342	active site
160488001343	metal binding site [ion binding]; metal-binding site
160488001344	interdomain interaction site; other site
160488001345	DnaB-helicase binding domain of primase; Region: DnaB_bind; pfam10410
160488001346	DNA primase DnaG DnaB-binding; Region: DnaG_DnaB_bind; pfam08278
160488001347	30S ribosomal protein S21; Reviewed; Region: rpsU; PRK00270
160488001348	UGMP family protein; Validated; Region: PRK09604
160488001349	tRNA threonylcarbamoyl adenosine modification protein YeaZ; Region: T6A_YeaZ; TIGR03725
160488001350	putative glycerol-3-phosphate acyltransferase PlsY; Provisional; Region: PRK00220
160488001351	Dihydroneopterin aldolase; Region: FolB; smart00905
160488001352	active site
160488001353	7,8-dihydro-6-hydroxymethylpterin-pyrophosphokinase (HPPK). Folate derivatives are essential cofactors in the biosynthesis of purines, pyrimidines, and amino acids as well as formyl-tRNA. Mammalian cells are able to utilize pre-formed folates after...; Region: HPPK; cd00483
160488001354	catalytic center binding site [active]
160488001355	ATP binding site [chemical binding]; other site
160488001356	multifunctional tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase; Reviewed; Region: cca; PRK10885
160488001357	Nucleotidyltransferase (NT) domain of ClassII CCA-adding enzymes; Region: NT_ClassII-CCAase; cd05398
160488001358	active site
160488001359	NTP binding site [chemical binding]; other site
160488001360	metal binding triad [ion binding]; metal-binding site
160488001361	Probable RNA and SrmB- binding site of polymerase A; Region: PolyA_pol_RNAbd; pfam12627
160488001362	SpoVR family protein; Provisional; Region: PRK11767
160488001363	Uncharacterized conserved protein [Function unknown]; Region: SpoVR; COG2719
160488001364	hypothetical protein; Provisional; Region: PRK05325
160488001365	PrkA family serine protein kinase; Provisional; Region: PRK15455
160488001366	PrkA serine protein kinase C-terminal domain; Region: PrkA; pfam06798
160488001367	GlpE sulfurtransferase (ST) and homologs are members of the Rhodanese Homology Domain superfamily. Unlike other rhodanese sulfurtransferases, GlpE is a single domain protein but indications are that it functions as a dimer. The active site contains a...; Region: GlpE_ST; cd01444
160488001368	active site residue [active]
160488001369	diadenosine tetraphosphatase; Reviewed; Region: apaH; PRK00166
160488001370	Escherichia coli ApaH and related proteins, metallophosphatase domain; Region: MPP_ApaH; cd07422
160488001371	active site
160488001372	metal binding site [ion binding]; metal-binding site
160488001373	CO2+/MG2+ efflux protein ApaG; Reviewed; Region: apaG; PRK05461
160488001374	16S ribosomal RNA methyltransferase KsgA/Dim1 family protein; Reviewed; Region: ksgA; PRK00274
160488001375	Dimethyladenosine transferase (rRNA methylation) [Translation, ribosomal structure and biogenesis]; Region: KsgA; COG0030
160488001376	4-hydroxythreonine-4-phosphate dehydrogenase; Reviewed; Region: pdxA; PRK00232
160488001377	4-hydroxythreonine-4-phosphate dehydrogenase; Validated; Region: pdxA; PRK03743
160488001378	peptidyl-prolyl cis-trans isomerase SurA; Provisional; Region: PRK10770
160488001379	SurA N-terminal domain; Region: SurA_N; pfam09312
160488001380	PPIC-type PPIASE domain; Region: Rotamase; pfam00639
160488001381	PPIC-type PPIASE domain; Region: Rotamase; pfam00639
160488001382	Predicted phosphotransferase related to Ser/Thr protein kinases [General function prediction only]; Region: COG3178
160488001383	Phosphotransferase enzyme family; Region: APH; pfam01636
160488001384	Nucleoside-diphosphate-sugar pyrophosphorylase involved in lipopolysaccharide biosynthesis/translation initiation factor 2B, gamma/epsilon subunits (eIF-2Bgamma/eIF-2Bepsilon) [Cell envelope biogenesis, outer membrane / Translation, ribosomal structure...; Region: GCD1; COG1208
160488001385	NTP_transferase_like_1 is a member of the nucleotidyl transferase family; Region: NTP_transferase_like_1; cd06422
160488001386	Substrate binding site; other site
160488001387	metal-binding site
160488001388	Dna-J like membrane chaperone protein; Provisional; Region: djlA; PRK09430
160488001389	N-terminal tellurium resistance protein terB-like domain of heat shock DnaJ-like proteins; Region: terB_like_DjlA; cd07316
160488001390	putative metal binding site [ion binding]; other site
160488001391	DnaJ domain or J-domain.  DnaJ/Hsp40 (heat shock protein 40) proteins are highly conserved and play crucial roles in protein translation, folding, unfolding, translocation, and degradation. They act primarily by stimulating the ATPase activity of Hsp70s; Region: DnaJ; cl02542
160488001392	HSP70 interaction site [polypeptide binding]; other site
160488001393	Protein of unknown function (DUF3530); Region: DUF3530; pfam12048
160488001394	Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697
160488001395	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488001396	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
160488001397	substrate binding pocket [chemical binding]; other site
160488001398	membrane-bound complex binding site; other site
160488001399	hinge residues; other site
160488001400	PAS domain; Region: PAS_9; pfam13426
160488001401	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488001402	putative active site [active]
160488001403	heme pocket [chemical binding]; other site
160488001404	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488001405	PAS fold; Region: PAS_3; pfam08447
160488001406	putative active site [active]
160488001407	heme pocket [chemical binding]; other site
160488001408	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: COG4585
160488001409	Histidine kinase; Region: HisKA_3; pfam07730
160488001410	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488001411	ATP binding site [chemical binding]; other site
160488001412	Mg2+ binding site [ion binding]; other site
160488001413	G-X-G motif; other site
160488001414	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
160488001415	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488001416	active site
160488001417	phosphorylation site [posttranslational modification]
160488001418	intermolecular recognition site; other site
160488001419	dimerization interface [polypeptide binding]; other site
160488001420	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
160488001421	DNA binding residues [nucleotide binding]
160488001422	dimerization interface [polypeptide binding]; other site
160488001423	ABC-type spermidine/putrescine transport systems, ATPase components [Amino acid transport and metabolism]; Region: PotA; COG3842
160488001424	ATP-binding cassette domain of the polyamine transporter; Region: ABC_PotA_N; cd03300
160488001425	Walker A/P-loop; other site
160488001426	ATP binding site [chemical binding]; other site
160488001427	Q-loop/lid; other site
160488001428	ABC transporter signature motif; other site
160488001429	Walker B; other site
160488001430	D-loop; other site
160488001431	H-loop/switch region; other site
160488001432	TOBE domain; Region: TOBE_2; pfam08402
160488001433	Spermidine/putrescine-binding periplasmic protein [Amino acid transport and metabolism]; Region: PotD; COG0687
160488001434	Bacterial extracellular solute-binding protein; Region: SBP_bac_1; cl17199
160488001435	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488001436	dimer interface [polypeptide binding]; other site
160488001437	conserved gate region; other site
160488001438	putative PBP binding loops; other site
160488001439	ABC-ATPase subunit interface; other site
160488001440	ABC-type spermidine/putrescine transport system, permease component II [Amino acid transport and metabolism]; Region: PotC; COG1177
160488001441	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488001442	dimer interface [polypeptide binding]; other site
160488001443	conserved gate region; other site
160488001444	putative PBP binding loops; other site
160488001445	ABC-ATPase subunit interface; other site
160488001446	Ribulose-5-phosphate 3-epimerase (RPE). This enzyme catalyses the interconversion of D-ribulose 5-phosphate (Ru5P) into D-xylulose 5-phosphate, as part of the Calvin cycle (reductive pentose phosphate pathway) in chloroplasts and in the oxidative pentose...; Region: RPE; cd00429
160488001447	ribulose-phosphate 3-epimerase; Region: rpe; TIGR01163
160488001448	substrate binding site [chemical binding]; other site
160488001449	hexamer interface [polypeptide binding]; other site
160488001450	metal binding site [ion binding]; metal-binding site
160488001451	phosphoglycolate phosphatase; Provisional; Region: PRK13223
160488001452	haloacid dehalogenase-like hydrolase; Region: HAD; cl17202
160488001453	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
160488001454	motif II; other site
160488001455	anthranilate synthase component I; Provisional; Region: PRK13565
160488001456	Anthranilate synthase component I, N terminal region; Region: Anth_synt_I_N; pfam04715
160488001457	chorismate binding enzyme; Region: Chorismate_bind; pfam00425
160488001458	Phospholipase/lecithinase/hemolysin [Lipid metabolism / General function prediction only]; Region: COG3240
160488001459	Triacylglycerol lipase-like subfamily of the SGNH hydrolases, a diverse family of lipases and esterases. The tertiary fold of the enzyme is substantially different from that of the alpha/beta hydrolase family and unique among all known hydrolases; its...; Region: Triacylglycerol_lipase_like; cd01847
160488001460	active site
160488001461	catalytic triad [active]
160488001462	oxyanion hole [active]
160488001463	Autotransporter beta-domain; Region: Autotransporter; pfam03797
160488001464	phosphoglycolate phosphatase; Provisional; Region: PRK13223
160488001465	para-aminobenzoate synthase component II; Provisional; Region: PRK08857
160488001466	Type 1 glutamine amidotransferase (GATase1) domain found in Anthranilate synthase; Region: GATase1_Anthranilate_Synthase; cd01743
160488001467	glutamine binding [chemical binding]; other site
160488001468	catalytic triad [active]
160488001469	anthranilate phosphoribosyltransferase; Provisional; Region: trpD; PRK00188
160488001470	Glycosyl transferase family, helical bundle domain; Region: Glycos_trans_3N; pfam02885
160488001471	Glycosyl transferase family, a/b domain; Region: Glycos_transf_3; pfam00591
160488001472	Indole-3-glycerol phosphate synthase (IGPS); an enzyme in the tryptophan biosynthetic pathway, catalyzing the ring closure reaction of 1-(o-carboxyphenylamino)-1-deoxyribulose-5-phosphate (CdRP) to indole-3-glycerol phosphate (IGP), accompanied by the...; Region: IGPS; cd00331
160488001473	active site
160488001474	ribulose/triose binding site [chemical binding]; other site
160488001475	phosphate binding site [ion binding]; other site
160488001476	substrate (anthranilate) binding pocket [chemical binding]; other site
160488001477	product (indole) binding pocket [chemical binding]; other site
160488001478	Lipoate-protein ligase A [Coenzyme metabolism]; Region: LplA; COG0095
160488001479	DNA-binding transcriptional dual regulator Crp; Provisional; Region: PRK11753
160488001480	effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038
160488001481	ligand binding site [chemical binding]; other site
160488001482	flexible hinge region; other site
160488001483	helix_turn_helix, cAMP Regulatory protein C-terminus; DNA binding domain of prokaryotic regulatory proteins belonging to the catabolite activator protein family; Region: HTH_CRP; cd00092
160488001484	putative switch regulator; other site
160488001485	non-specific DNA interactions [nucleotide binding]; other site
160488001486	DNA binding site [nucleotide binding]
160488001487	sequence specific DNA binding site [nucleotide binding]; other site
160488001488	putative cAMP binding site [chemical binding]; other site
160488001489	OsmC-like protein; Region: OsmC; cl00767
160488001490	Demethoxyubiquinone hydroxylase, ferritin-like diiron-binding domain; Region: DMQH; cd01042
160488001491	diiron binding motif [ion binding]; other site
160488001492	Protein Kinase C Interacting protein related (PKCI): PKCI and related proteins belong to the ubiquitous HIT family of hydrolases that act on alpha-phosphates of ribonucleotides. The members of this subgroup have a conserved HxHxHxx motif (x is a...; Region: PKCI_related; cd01276
160488001493	nucleotide binding site/active site [active]
160488001494	HIT family signature motif; other site
160488001495	catalytic residue [active]
160488001496	Short-chain dehydrogenases of various substrate specificities [General function prediction only]; Region: DltE; COG0300
160488001497	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
160488001498	NAD(P) binding site [chemical binding]; other site
160488001499	active site
160488001500	Dioxygenases related to 2-nitropropane dioxygenase [General function prediction only]; Region: COG2070
160488001501	2-Nitropropane dioxygenase (NPD), one of the nitroalkane oxidizing enzyme families, catalyzes oxidative denitrification of nitroalkanes to their corresponding carbonyl compounds and nitrites. NDP is a member of the NAD(P)H-dependent flavin oxidoreductase...; Region: NPD_like; cd04730
160488001502	FMN binding site [chemical binding]; other site
160488001503	substrate binding site [chemical binding]; other site
160488001504	putative catalytic residue [active]
160488001505	Uncharacterized protein family (UPF0093); Region: UPF0093; pfam03653
160488001506	N-acetyl-gamma-glutamyl-phosphate reductase; Validated; Region: argC; PRK00436
160488001507	Semialdehyde dehydrogenase, NAD binding domain; Region: Semialdhyde_dh; smart00859
160488001508	iron-sulfur cluster insertion protein ErpA; Provisional; Region: PRK13623
160488001509	anhydro-N-acetylmuramic acid kinase; Reviewed; Region: anmK; PRK09585
160488001510	Opacity-associated protein A LysM-like domain; Region: OapA; pfam04225
160488001511	Peptidase family M23; Region: Peptidase_M23; pfam01551
160488001512	tyrosyl-tRNA synthetase; Validated; Region: PRK05912
160488001513	catalytic core domain of tyrosinyl-tRNA synthetase; Region: TyrRS_core; cd00805
160488001514	active site
160488001515	HIGH motif; other site
160488001516	dimer interface [polypeptide binding]; other site
160488001517	KMSKS motif; other site
160488001518	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor; Provisional; Region: PRK11886
160488001519	Biotin operon repressor [Transcription]; Region: BirA; COG1654
160488001520	Biotin/lipoate A/B protein ligase family; Region: BPL_LplA_LipB; pfam03099
160488001521	pantothenate kinase; Reviewed; Region: PRK13322
160488001522	elongation factor Tu; Reviewed; Region: PRK00049
160488001523	Elongation Factor Tu (EF-Tu) GTP-binding proteins; Region: EF_Tu; cd01884
160488001524	G1 box; other site
160488001525	GEF interaction site [polypeptide binding]; other site
160488001526	GTP/Mg2+ binding site [chemical binding]; other site
160488001527	Switch I region; other site
160488001528	G2 box; other site
160488001529	G3 box; other site
160488001530	Switch II region; other site
160488001531	G4 box; other site
160488001532	G5 box; other site
160488001533	EFTU_II: Elongation factor Tu domain II. Elongation factors Tu (EF-Tu) are three-domain GTPases with an essential function in the elongation phase of mRNA translation. The GTPase center of EF-Tu is in the N-terminal domain (domain I), also known as the...; Region: EFTU_II; cd03697
160488001534	Domain III of elongation factor (EF) Tu. Ef-Tu consists of three structural domains, designated I, II and III. Domain III adopts a beta barrel structure. Domain III is involved in binding to both charged tRNA and binding to elongation factor Ts (EF-Ts); Region: EFTU_III; cd03707
160488001535	Antibiotic Binding Site [chemical binding]; other site
160488001536	preprotein translocase subunit SecE; Reviewed; Region: secE; PRK05740
160488001537	transcription antitermination protein NusG; Validated; Region: nusG; PRK05609
160488001538	Bacterial N-Utilization Substance G (NusG) N-terminal (NGN) domain, subgroup 1; Region: NGN_Bact_1; cd09891
160488001539	putative homodimer interface [polypeptide binding]; other site
160488001540	NusG contains an NGN domain at its N-terminus and KOW motif at its C-terminus; Region: KOW_NusG; cd06091
160488001541	heterodimer interface [polypeptide binding]; other site
160488001542	homodimer interface [polypeptide binding]; other site
160488001543	50S ribosomal protein L11; Validated; Region: rplK; PRK00140
160488001544	Ribosomal protein L11. Ribosomal protein L11, together with proteins L10 and L7/L12, and 23S rRNA, form the L7/L12 stalk on the surface of the large subunit of the ribosome. The homologous eukaryotic cytoplasmic protein is also called 60S ribosomal...; Region: Ribosomal_L11; cd00349
160488001545	23S rRNA interface [nucleotide binding]; other site
160488001546	L7/L12 interface [polypeptide binding]; other site
160488001547	putative thiostrepton binding site; other site
160488001548	L25 interface [polypeptide binding]; other site
160488001549	Ribosomal protein L1.  The L1 protein, located near the E-site of the ribosome, forms part of the L1 stalk along with 23S rRNA.  In bacteria and archaea, L1 functions both as a ribosomal protein that binds rRNA, and as a translation repressor that binds...; Region: Ribosomal_L1; cd00403
160488001550	mRNA/rRNA interface [nucleotide binding]; other site
160488001551	Ribosomal protein L10 family, L10 subfamily; composed of bacterial 50S ribosomal protein and eukaryotic mitochondrial 39S ribosomal protein, L10. L10 occupies the L7/L12 stalk of the ribosome. The N-terminal domain (NTD) of L10 interacts with L11 protein...; Region: Ribosomal_L10; cd05797
160488001552	23S rRNA interface [nucleotide binding]; other site
160488001553	Interface with L7/L12 ribosomal proteins [polypeptide binding]; other site
160488001554	Ribosomal protein L7/L12. Ribosomal protein L7/L12 refers to the large ribosomal subunit proteins L7 and L12, which are identical except that L7 is acetylated at the N terminus. It is a component of the L7/L12 stalk, which is located at the surface of...; Region: Ribosomal_L7_L12; cd00387
160488001555	core dimer interface [polypeptide binding]; other site
160488001556	peripheral dimer interface [polypeptide binding]; other site
160488001557	L10 interface [polypeptide binding]; other site
160488001558	L11 interface [polypeptide binding]; other site
160488001559	putative EF-Tu interaction site [polypeptide binding]; other site
160488001560	putative EF-G interaction site [polypeptide binding]; other site
160488001561	DNA-directed RNA polymerase subunit beta; Reviewed; Region: rpoB; PRK00405
160488001562	RNA polymerase beta subunit. RNA polymerases catalyse the DNA dependent polymerization of RNA. Prokaryotes contain a single RNA polymerase compared to three in eukaryotes (not including mitochondrial. and chloroplast polymerases). Each RNA polymerase...; Region: RNA_pol_B_RPB2; cl17585
160488001563	RNA polymerase Rpb2, domain 2; Region: RNA_pol_Rpb2_2; pfam04561
160488001564	RNA polymerase beta subunit. RNA polymerases catalyse the DNA dependent polymerization of RNA. Prokaryotes contain a single RNA polymerase compared to three in eukaryotes (not including mitochondrial. and chloroplast polymerases). Each RNA polymerase...; Region: RNA_pol_B_RPB2; cd00653
160488001565	RNA polymerase Rpb2, domain 6; Region: RNA_pol_Rpb2_6; pfam00562
160488001566	RNA polymerase beta subunit. RNA polymerases catalyse the DNA dependent polymerization of RNA. Prokaryotes contain a single RNA polymerase compared to three in eukaryotes (not including mitochondrial. and chloroplast polymerases). Each RNA polymerase...; Region: RNA_pol_B_RPB2; cd00653
160488001567	RPB3 interaction site [polypeptide binding]; other site
160488001568	RPB1 interaction site [polypeptide binding]; other site
160488001569	RPB11 interaction site [polypeptide binding]; other site
160488001570	RPB10 interaction site [polypeptide binding]; other site
160488001571	DNA-directed RNA polymerase, beta' subunit/160 kD subunit [Transcription]; Region: RpoC; COG0086
160488001572	RNA polymerase Rpb1, domain 1; Region: RNA_pol_Rpb1_1; pfam04997
160488001573	RNA polymerase I subunit A N-terminus; Region: RPOLA_N; smart00663
160488001574	RNA polymerase Rpb1, domain 3; Region: RNA_pol_Rpb1_3; pfam04983
160488001575	RNA polymerase Rpb1, domain 4; Region: RNA_pol_Rpb1_4; pfam05000
160488001576	Largest subunit of RNA polymerase (RNAP), C-terminal domain; Region: RNAP_largest_subunit_C; cl11429
160488001577	Rpb1 - Rpb6 interaction site [polypeptide binding]; other site
160488001578	Largest subunit of RNA polymerase (RNAP), C-terminal domain; Region: RNAP_largest_subunit_C; cl11429
160488001579	Largest subunit (beta') of Bacterial DNA-dependent RNA polymerase (RNAP), C-terminal domain; Region: RNAP_beta'_C; cd02655
160488001580	DNA binding site [nucleotide binding]
160488001581	Rpb1 (beta') - Rpb2 (beta) interaction site [polypeptide binding]; other site
160488001582	S12-like family, 30S ribosomal protein S12 subfamily; S12 is located at the interface of the large and small ribosomal subunits of prokaryotes, chloroplasts and mitochondria, where it plays an important role in both tRNA and ribosomal subunit...; Region: Ribosomal_S12; cd03368
160488001583	S17 interaction site [polypeptide binding]; other site
160488001584	S8 interaction site; other site
160488001585	16S rRNA interaction site [nucleotide binding]; other site
160488001586	streptomycin interaction site [chemical binding]; other site
160488001587	23S rRNA interaction site [nucleotide binding]; other site
160488001588	aminoacyl-tRNA interaction site (A-site) [nucleotide binding]; other site
160488001589	30S ribosomal protein S7; Validated; Region: PRK05302
160488001590	elongation factor G; Reviewed; Region: PRK00007
160488001591	Elongation factor G (EF-G) family involved in both the elongation and ribosome recycling phases of protein synthesis; Region: EF-G; cd01886
160488001592	G1 box; other site
160488001593	putative GEF interaction site [polypeptide binding]; other site
160488001594	GTP/Mg2+ binding site [chemical binding]; other site
160488001595	Switch I region; other site
160488001596	G2 box; other site
160488001597	G3 box; other site
160488001598	Switch II region; other site
160488001599	G4 box; other site
160488001600	G5 box; other site
160488001601	EFG_mtEFG_II: this subfamily represents the domain II of elongation factor G (EF-G) in bacteria and, the C-terminus of mitochondrial Elongation factor G1 (mtEFG1) and G2 (mtEFG2)_like proteins found in eukaryotes. During the process of peptide synthesis...; Region: EFG_mtEFG_II; cd04088
160488001602	EFG_mtEFG1_IV: domains similar to domain IV of the bacterial translational elongation factor (EF) EF-G. Included in this group is a domain of mitochondrial Elongation factor G1 (mtEFG1) proteins homologous to domain IV of EF-G. Eukaryotic cells harbor 2...; Region: EFG_mtEFG1_IV; cd01434
160488001603	EFG_mtEFG_C: domains similar to the C-terminal domain of the bacterial translational elongation factor (EF) EF-G.  Included in this group is the C-terminus of mitochondrial Elongation factor G1 (mtEFG1) and G2 (mtEFG2) proteins. Eukaryotic cells harbor 2...; Region: EFG_mtEFG_C; cd03713
160488001604	elongation factor Tu; Reviewed; Region: PRK00049
160488001605	Elongation Factor Tu (EF-Tu) GTP-binding proteins; Region: EF_Tu; cd01884
160488001606	G1 box; other site
160488001607	GEF interaction site [polypeptide binding]; other site
160488001608	GTP/Mg2+ binding site [chemical binding]; other site
160488001609	Switch I region; other site
160488001610	G2 box; other site
160488001611	G3 box; other site
160488001612	Switch II region; other site
160488001613	G4 box; other site
160488001614	G5 box; other site
160488001615	EFTU_II: Elongation factor Tu domain II. Elongation factors Tu (EF-Tu) are three-domain GTPases with an essential function in the elongation phase of mRNA translation. The GTPase center of EF-Tu is in the N-terminal domain (domain I), also known as the...; Region: EFTU_II; cd03697
160488001616	Domain III of elongation factor (EF) Tu. Ef-Tu consists of three structural domains, designated I, II and III. Domain III adopts a beta barrel structure. Domain III is involved in binding to both charged tRNA and binding to elongation factor Ts (EF-Ts); Region: EFTU_III; cd03707
160488001617	Antibiotic Binding Site [chemical binding]; other site
160488001618	30S ribosomal protein S10; Reviewed; Region: rpsJ; PRK00596
160488001619	50S ribosomal protein L3; Validated; Region: rplC; PRK00001
160488001620	50S ribosomal protein L4; Provisional; Region: rplD; PRK05319
160488001621	50S ribosomal protein L23; Reviewed; Region: rplW; PRK05738
160488001622	50S ribosomal protein L2; Validated; Region: rplB; PRK09374
160488001623	Ribosomal Proteins L2, RNA binding domain; Region: Ribosomal_L2; pfam00181
160488001624	Ribosomal Proteins L2, C-terminal domain; Region: Ribosomal_L2_C; pfam03947
160488001625	30S ribosomal protein S19; Reviewed; Region: rpsS; PRK00357
160488001626	Ribosomal protein L22/L17e.  L22 (L17 in eukaryotes) is a core protein of the large ribosomal subunit.  It is the only ribosomal protein that interacts with all six domains of 23S rRNA, and is one of the proteins important for directing the proper...; Region: Ribosomal_L22; cd00336
160488001627	protein-rRNA interface [nucleotide binding]; other site
160488001628	putative translocon binding site; other site
160488001629	30S ribosomal protein S3; Reviewed; Region: rpsC; PRK00310
160488001630	K homology RNA-binding (KH) domain of the prokaryotic 30S small ribosomal subunit protein S3. S3  is part of the head region of the 30S ribosomal subunit and is believed to interact with mRNA as it threads its way from the latch into the channel.  The KH...; Region: 30S_S3_KH; cd02412
160488001631	G-X-X-G motif; other site
160488001632	Ribosomal protein S3, C-terminal domain; Region: Ribosomal_S3_C; pfam00189
160488001633	Ribosomal_L16_L10e: L16 is an essential protein in the large ribosomal subunit of bacteria, mitochondria, and chloroplasts. Large subunits that lack L16 are defective in peptidyl transferase activity, peptidyl-tRNA hydrolysis activity, association with...; Region: Ribosomal_L16_L10e; cd01433
160488001634	23S rRNA interface [nucleotide binding]; other site
160488001635	5S rRNA interface [nucleotide binding]; other site
160488001636	putative antibiotic binding site [chemical binding]; other site
160488001637	L25 interface [polypeptide binding]; other site
160488001638	L27 interface [polypeptide binding]; other site
160488001639	Ribosomal L29 protein/HIP.  L29 is a protein of the large ribosomal Subunit. A homolog, called heparin/heparan sulfate interacting protein (HIP), has also been identified in mammals.  L29 is located on the surface of the large ribosomal subunit, where it...; Region: Ribosomal_L29_HIP; cd00427
160488001640	23S rRNA interface [nucleotide binding]; other site
160488001641	putative translocon interaction site; other site
160488001642	signal recognition particle (SRP54) interaction site; other site
160488001643	L23 interface [polypeptide binding]; other site
160488001644	trigger factor interaction site; other site
160488001645	30S ribosomal protein S17; Reviewed; Region: rpsQ; PRK05610
160488001646	50S ribosomal protein L14; Validated; Region: rplN; PRK05483
160488001647	50S ribosomal protein L24; Reviewed; Region: rplX; PRK00004
160488001648	KOW motif of Ribosomal Protein L26; Region: KOW_RPL26; cd06089
160488001649	RNA binding site [nucleotide binding]; other site
160488001650	50S ribosomal protein L5; Validated; Region: rplE; PRK00010
160488001651	Ribosomal protein L5; Region: Ribosomal_L5; pfam00281
160488001652	ribosomal L5P family C-terminus; Region: Ribosomal_L5_C; pfam00673
160488001653	30S ribosomal protein S14; Reviewed; Region: rpsN; PRK08881
160488001654	30S ribosomal protein S8; Validated; Region: rpsH; PRK00136
160488001655	50S ribosomal protein L6; Validated; Region: rplF; PRK05498
160488001656	Ribosomal protein L6; Region: Ribosomal_L6; pfam00347
160488001657	Ribosomal protein L6; Region: Ribosomal_L6; pfam00347
160488001658	Ribosomal L18/L5e:  L18 (L5e) is a ribosomal protein found in the central protuberance (CP) of the large subunit. L18 binds 5S rRNA and induces a conformational change that stimulates the binding of L5 to 5S rRNA. Association of 5S rRNA with 23S rRNA...; Region: Ribosomal_L18_L5e; cd00432
160488001659	5S rRNA interface [nucleotide binding]; other site
160488001660	23S rRNA interface [nucleotide binding]; other site
160488001661	L5 interface [polypeptide binding]; other site
160488001662	30S ribosomal protein S5; Validated; Region: rpsE; PRK00550
160488001663	Ribosomal protein S5, N-terminal domain; Region: Ribosomal_S5; pfam00333
160488001664	Ribosomal protein S5, C-terminal domain; Region: Ribosomal_S5_C; pfam03719
160488001665	Ribosomal protein L30, which is found in eukaryotes and prokaryotes but not in archaea, is one of the smallest ribosomal proteins with a molecular mass of about 7kDa. L30 binds the 23SrRNA as well as the 5S rRNA and is one of five ribosomal proteins that...; Region: Ribosomal_L30; cd01658
160488001666	23S rRNA binding site [nucleotide binding]; other site
160488001667	50S ribosomal protein L15; Reviewed; Region: rplO; PRK05592
160488001668	preprotein translocase subunit SecY; Reviewed; Region: secY; PRK09204
160488001669	SecY translocase; Region: SecY; pfam00344
160488001670	Ribosomal protein L36; Region: Ribosomal_L36; pfam00444
160488001671	30S ribosomal protein S13; Validated; Region: rpsM; PRK05179
160488001672	30S ribosomal protein S13; Region: bact_S13; TIGR03631
160488001673	30S ribosomal protein S11; Validated; Region: PRK05309
160488001674	30S ribosomal protein S4; Validated; Region: rpsD; PRK05327
160488001675	Ribosomal protein S4/S9 N-terminal domain; Region: Ribosomal_S4; pfam00163
160488001676	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
160488001677	RNA binding surface [nucleotide binding]; other site
160488001678	DNA-directed RNA polymerase subunit alpha; Provisional; Region: PRK05182
160488001679	N-terminal domain of the Alpha subunit of Bacterial RNA polymerase; Region: RNAP_alpha_NTD; cd06928
160488001680	alphaNTD homodimer interface [polypeptide binding]; other site
160488001681	alphaNTD - beta interaction site [polypeptide binding]; other site
160488001682	alphaNTD - beta' interaction site [polypeptide binding]; other site
160488001683	Bacterial RNA polymerase, alpha chain C terminal domain; Region: RNA_pol_A_CTD; pfam03118
160488001684	50S ribosomal protein L17; Validated; Region: rplQ; PRK05591
160488001685	Catalase [Inorganic ion transport and metabolism]; Region: KatE; COG0753
160488001686	Clade 3 of the heme-binding enzyme catalase; Region: catalase_clade_3; cd08156
160488001687	tetramer interface [polypeptide binding]; other site
160488001688	heme binding pocket [chemical binding]; other site
160488001689	NADPH binding site [chemical binding]; other site
160488001690	Bacterioferritin (cytochrome b1) [Inorganic ion transport and metabolism]; Region: Bfr; COG2193
160488001691	Bacterioferritin, ferritin-like diiron-binding domain; Region: Bacterioferritin; cd00907
160488001692	heme binding site [chemical binding]; other site
160488001693	ferroxidase pore; other site
160488001694	ferroxidase diiron center [ion binding]; other site
160488001695	excinuclease ABC subunit A; Reviewed; Region: uvrA; PRK00349
160488001696	ATP-binding cassette domain I of the excision repair protein UvrA; Region: ABC_UvrA_I; cd03270
160488001697	ATP-binding cassette domain I of the excision repair protein UvrA; Region: ABC_UvrA_I; cd03270
160488001698	ATP-binding cassette domain II of the excision repair protein UvrA; Region: ABC_UvrA_II; cd03271
160488001699	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488001700	Major Facilitator Superfamily; Region: MFS_1; pfam07690
160488001701	putative substrate translocation pore; other site
160488001702	Single-stranded DNA-binding protein [DNA replication, recombination, and repair]; Region: Ssb; COG0629
160488001703	SSB_OBF: A subfamily of OB folds similar to the OB fold of ssDNA-binding protein (SSB). SSBs bind with high affinity to ssDNA. They bind to and protect ssDNA intermediates during DNA metabolic pathways. All bacterial and eukaryotic SSBs studied to date...; Region: SSB_OBF; cd04496
160488001704	dimer interface [polypeptide binding]; other site
160488001705	ssDNA binding site [nucleotide binding]; other site
160488001706	tetramer (dimer of dimers) interface [polypeptide binding]; other site
160488001707	Transcriptional regulators containing a DNA-binding HTH domain and an aminotransferase domain (MocR family) and their eukaryotic orthologs [Transcription / Amino acid transport and metabolism]; Region: ARO8; COG1167
160488001708	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488001709	DNA-binding site [nucleotide binding]; DNA binding site
160488001710	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
160488001711	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488001712	homodimer interface [polypeptide binding]; other site
160488001713	catalytic residue [active]
160488001714	hypothetical protein; Provisional; Region: PRK10621
160488001715	Sulfite exporter TauE/SafE; Region: TauE; pfam01925
160488001716	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
160488001717	malonic semialdehyde reductase; Provisional; Region: PRK10538
160488001718	NAD(P) binding site [chemical binding]; other site
160488001719	active site
160488001720	formate dehydrogenase, beta subunit, Fe-S containing; Region: FDH-beta; TIGR01582
160488001721	The HCP family of iron-sulfur proteins includes hybrid cluster protein (HCP), acetyl-CoA synthase (ACS), and carbon monoxide dehydrogenase (CODH), all of which contain [Fe4-S4] metal clusters at their active sites. These proteins have a conserved...; Region: HCP_like; cl14655
160488001722	Formate dehydrogenase N, transmembrane; Region: Form-deh_trans; pfam09163
160488001723	Cytochrome b (N-terminus)/b6/petB:  Cytochrome b is a subunit of cytochrome bc1, an 11-subunit mitochondrial respiratory enzyme. Cytochrome b spans the mitochondrial membrane with 8 transmembrane helices (A-H) in eukaryotes. In plants and cyanobacteria; Region: Cytochrome_b_N; cl00859
160488001724	formate dehydrogenase, gamma subunit; Region: formate-DH-gamm; TIGR01583
160488001725	formate dehydrogenase accessory protein FdhE; Region: FdhE; TIGR01562
160488001726	Protein involved in formate dehydrogenase formation; Region: FdhE; pfam04216
160488001727	selenocysteine synthase; Provisional; Region: PRK04311
160488001728	Selenocysteine synthase N terminal; Region: Se-cys_synth_N; pfam12390
160488001729	Selenocysteine synthase [seryl-tRNASer selenium transferase] [Amino acid transport and metabolism]; Region: SelA; COG1921
160488001730	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
160488001731	catalytic residue [active]
160488001732	selenocysteinyl-tRNA-specific translation factor; Provisional; Region: PRK10512
160488001733	SelB, the dedicated elongation factor for delivery of selenocysteinyl-tRNA to the ribosome; Region: SelB; cd04171
160488001734	G1 box; other site
160488001735	putative GEF interaction site [polypeptide binding]; other site
160488001736	GTP/Mg2+ binding site [chemical binding]; other site
160488001737	Switch I region; other site
160488001738	G2 box; other site
160488001739	G3 box; other site
160488001740	Switch II region; other site
160488001741	G4 box; other site
160488001742	G5 box; other site
160488001743	selB_II: this subfamily represents the domain of elongation factor SelB, homologous to domain II of EF-Tu. SelB may function by replacing EF-Tu. In prokaryotes, the incorporation of selenocysteine as the 21st amino acid, encoded by TGA, requires several...; Region: selB_II; cd03696
160488001744	This family represents the domain of elongation factor SelB, homologous to domain III of EF-Tu. SelB may function by replacing EF-Tu. In prokaryotes, the incorporation of selenocysteine as the 21st amino acid, encoded by TGA, requires several elements:...; Region: selB_III; cd04094
160488001745	Elongation factor SelB, winged helix; Region: SelB-wing_2; pfam09106
160488001746	Elongation factor SelB, winged helix; Region: SelB-wing_3; pfam09107
160488001747	Type I (cytosolic) bacterial L-asparaginase; Region: L-asparaginase_I; cd08963
160488001748	active site
160488001749	homodimer interface [polypeptide binding]; other site
160488001750	Na+/alanine symporter [Amino acid transport and metabolism]; Region: AlsT; COG1115
160488001751	Sodium:alanine symporter family; Region: Na_Ala_symp; cl00548
160488001752	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
160488001753	sequence-specific DNA binding site [nucleotide binding]; other site
160488001754	salt bridge; other site
160488001755	Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697
160488001756	BAAT / Acyl-CoA thioester hydrolase C terminal; Region: BAAT_C; pfam08840
160488001757	RmlD substrate binding domain; Region: RmlD_sub_bind; pfam04321
160488001758	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
160488001759	NAD(P) binding site [chemical binding]; other site
160488001760	active site
160488001761	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
160488001762	Nucleoside-diphosphate-sugar epimerases [Cell envelope biogenesis, outer membrane / Carbohydrate transport and metabolism]; Region: WcaG; COG0451
160488001763	NAD(P) binding site [chemical binding]; other site
160488001764	active site
160488001765	Predicted transcriptional regulators [Transcription]; Region: COG1733
160488001766	HxlR-like helix-turn-helix; Region: HxlR; pfam01638
160488001767	Arabinose efflux permease [Carbohydrate transport and metabolism]; Region: AraJ; COG2814
160488001768	OmpW family; Region: OmpW; cl17427
160488001769	Protein of unknown function (DUF3299); Region: DUF3299; pfam11736
160488001770	MacB-like periplasmic core domain; Region: MacB_PCD; pfam12704
160488001771	ABC-type antimicrobial peptide transport system, permease component [Defense mechanisms]; Region: SalY; COG0577
160488001772	FtsX-like permease family; Region: FtsX; pfam02687
160488001773	cell division ATP-binding protein FtsE; Region: FtsE; TIGR02673
160488001774	ATP-binding cassette domain of the transporters involved in export of lipoprotein and macrolide, and cell division protein; Region: ABC_MJ0796_LolCDE_FtsE; cd03255
160488001775	Walker A/P-loop; other site
160488001776	ATP binding site [chemical binding]; other site
160488001777	Q-loop/lid; other site
160488001778	ABC transporter signature motif; other site
160488001779	Walker B; other site
160488001780	D-loop; other site
160488001781	H-loop/switch region; other site
160488001782	Protein of unknown function (DUF2796); Region: DUF2796; pfam10986
160488001783	Thioredoxin domain-containing protein [Posttranslational modification, protein turnover, chaperones]; Region: COG3118
160488001784	ybbN protein family; ybbN is a hypothetical protein containing a redox-inactive TRX-like domain. Its gene has been sequenced from several gammaproteobacteria and actinobacteria; Region: ybbN; cd02956
160488001785	Type III secretion system lipoprotein chaperone (YscW); Region: YscW; cl15825
160488001786	transcriptional regulator NrdR; Validated; Region: nrdR; PRK00464
160488001787	ATP cone domain; Region: ATP-cone; pfam03477
160488001788	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase; Provisional; Region: ribD; PRK10786
160488001789	Riboflavin-specific deaminase. Riboflavin biosynthesis protein RibD (Diaminohydroxyphosphoribosylaminopyrimidine deaminase) catalyzes the deamination of 2,5-diamino-6-ribosylamino-4(3H)-pyrimidinone 5'-phosphate, which is an intermediate step in the...; Region: Riboflavin_deaminase-reductase; cd01284
160488001790	catalytic motif [active]
160488001791	Zn binding site [ion binding]; other site
160488001792	RibD C-terminal domain; Region: RibD_C; cl17279
160488001793	riboflavin synthase subunit alpha; Provisional; Region: PRK09289
160488001794	Lumazine binding domain; Region: Lum_binding; pfam00677
160488001795	Lumazine binding domain; Region: Lum_binding; pfam00677
160488001796	bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II-like protein; Provisional; Region: PRK14019
160488001797	3,4-dihydroxy-2-butanone 4-phosphate synthase; Region: DHBP_synthase; pfam00926
160488001798	GTP cyclohydrolase II; Region: GTP_cyclohydro2; pfam00925
160488001799	lumazine synthase (6,7-dimethyl-8-ribityllumazine synthase, LS), catalyzes the penultimate step in the biosynthesis of riboflavin (vitamin B2); type-I; Region: Lumazine_synthase-I; cd09209
160488001800	homopentamer interface [polypeptide binding]; other site
160488001801	active site
160488001802	transcription antitermination protein NusB; Reviewed; Region: nusB; PRK00202
160488001803	putative RNA binding site [nucleotide binding]; other site
160488001804	thiamine monophosphate kinase; Provisional; Region: PRK05731
160488001805	ThiL (Thiamine-monophosphate kinase) plays a dual role in de novo biosynthesis and in salvage of exogenous thiamine. Thiamine salvage occurs in two steps, with thiamine kinase catalyzing the formation of thiamine phosphate, and ThiL catalyzing the...; Region: ThiL; cd02194
160488001806	ATP binding site [chemical binding]; other site
160488001807	dimerization interface [polypeptide binding]; other site
160488001808	Phosphatidylglycerophosphatase A; a bacterial membrane-associated enzyme involved in lipid metabolism; Region: PgpA; cd06971
160488001809	tetramer interfaces [polypeptide binding]; other site
160488001810	binuclear metal-binding site [ion binding]; other site
160488001811	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
160488001812	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cl17432
160488001813	membrane-bound complex binding site; other site
160488001814	hinge residues; other site
160488001815	GTP cyclohydrolase II (RibA).  GTP cyclohydrolase II catalyzes the conversion of GTP to 2,5-diamino-6-ribosylamino-4(3H)-pyrimidinone 5' phosphate, formate, pyrophosphate (APy), and GMP in the biosynthetic pathway of riboflavin. Riboflavin is the...; Region: GTP_cyclohydro2; cd00641
160488001816	dimerization interface [polypeptide binding]; other site
160488001817	active site
160488001818	vitamin B12-transporter protein BtuF; Provisional; Region: PRK03379
160488001819	Cobalamin binding protein BtuF.  These proteins have been shown to function as initial receptors in ABC transport of vitamin B12 (cobalamin) in eubacterial and some archaeal species.  They belong to the TroA superfamily of helical backbone metal receptor...; Region: BtuF; cd01144
160488001820	cobalamin binding residues [chemical binding]; other site
160488001821	putative BtuC binding residues; other site
160488001822	dimer interface [polypeptide binding]; other site
160488001823	Outer membrane cobalamin receptor protein [Coenzyme metabolism]; Region: BtuB; COG4206
160488001824	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
160488001825	N-terminal plug; other site
160488001826	ligand-binding site [chemical binding]; other site
160488001827	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3547
160488001828	Transposase; Region: DEDD_Tnp_IS110; pfam01548
160488001829	Transposase IS116/IS110/IS902 family; Region: Transposase_20; pfam02371
160488001830	1-deoxy-D-xylulose-5-phosphate synthase; Provisional; Region: PRK05444
160488001831	Thiamine pyrophosphate (TPP) family, DXS subfamily, TPP-binding module; 1-Deoxy-D-xylulose-5-phosphate synthase (DXS) is a regulatory enzyme of the mevalonate-independent pathway involved in terpenoid biosynthesis. Terpeniods are plant natural products...; Region: TPP_DXS; cd02007
160488001832	TPP-binding site; other site
160488001833	Pyrimidine (PYR) binding domain of 1-deoxy-D-xylulose-5-phosphate synthase (DXS), transketolase (TK), and related proteins; Region: TPP_PYR_DXS_TK_like; cd07033
160488001834	PYR/PP interface [polypeptide binding]; other site
160488001835	dimer interface [polypeptide binding]; other site
160488001836	TPP binding site [chemical binding]; other site
160488001837	Transketolase, C-terminal domain; Region: Transketolase_C; pfam02780
160488001838	Geranylgeranyl pyrophosphate synthase [Coenzyme metabolism]; Region: IspA; COG0142
160488001839	Trans-Isoprenyl Diphosphate Synthases, head-to-tail; Region: Trans_IPPS_HT; cd00685
160488001840	substrate binding pocket [chemical binding]; other site
160488001841	chain length determination region; other site
160488001842	substrate-Mg2+ binding site; other site
160488001843	catalytic residues [active]
160488001844	aspartate-rich region 1; other site
160488001845	active site lid residues [active]
160488001846	aspartate-rich region 2; other site
160488001847	exodeoxyribonuclease VII small subunit; Provisional; Region: PRK00977
160488001848	3,4-dihydroxy-2-butanone 4-phosphate synthase; Provisional; Region: ribB; PRK03353
160488001849	3,4-dihydroxy-2-butanone 4-phosphate synthase [Coenzyme metabolism]; Region: RibB; COG0108
160488001850	Zeta toxin; Region: Zeta_toxin; pfam06414
160488001851	Predicted hydrolase of the alpha/beta superfamily [General function prediction only]; Region: COG2819
160488001852	Putative esterase; Region: Esterase; pfam00756
160488001853	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
160488001854	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488001855	phosphorylation site [posttranslational modification]
160488001856	dimer interface [polypeptide binding]; other site
160488001857	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488001858	ATP binding site [chemical binding]; other site
160488001859	Mg2+ binding site [ion binding]; other site
160488001860	G-X-G motif; other site
160488001861	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
160488001862	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488001863	active site
160488001864	phosphorylation site [posttranslational modification]
160488001865	intermolecular recognition site; other site
160488001866	dimerization interface [polypeptide binding]; other site
160488001867	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
160488001868	DNA binding site [nucleotide binding]
160488001869	Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid [Inorganic ion transport and metabolism]; Region: FhuE; COG4773
160488001870	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
160488001871	N-terminal plug; other site
160488001872	ligand-binding site [chemical binding]; other site
160488001873	Hemerythrin-like domain; Region: Hr-like; cd12108
160488001874	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
160488001875	non-specific DNA binding site [nucleotide binding]; other site
160488001876	salt bridge; other site
160488001877	sequence-specific DNA binding site [nucleotide binding]; other site
160488001878	Inorganic pyrophosphatase. These enzymes hydrolyze inorganic pyrophosphate (PPi) to two molecules of orthophosphates (Pi). The reaction requires bivalent cations. The enzymes in general exist as homooligomers; Region: pyrophosphatase; cd00412
160488001879	dimer interface [polypeptide binding]; other site
160488001880	substrate binding site [chemical binding]; other site
160488001881	metal binding sites [ion binding]; metal-binding site
160488001882	Phosphoenolpyruvate:glucose-phosphotransferase regulator; Region: MtfA; pfam06167
160488001883	Uncharacterized membrane-associated protein [Function unknown]; Region: DedA; COG0586
160488001884	SNARE associated Golgi protein; Region: SNARE_assoc; cl00429
160488001885	Acetyltransferases [General function prediction only]; Region: RimI; COG0456
160488001886	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
160488001887	Coenzyme A binding pocket [chemical binding]; other site
160488001888	ethanolamine ammonia-lyase small subunit; Provisional; Region: PRK05465
160488001889	ethanolamine ammonia lyase large subunit; Provisional; Region: PRK15067
160488001890	Ethanolamine ammonia lyase large subunit (EutB); Region: EutB; pfam06751
160488001891	ethanolamine permease; Region: 2A0305; TIGR00908
160488001892	NAD(P)+-dependent aldehyde dehydrogenase superfamily; Region: ALDH-SF; cl11961
160488001893	Aldehyde dehydrogenase family; Region: Aldedh; pfam00171
160488001894	NAD(P) binding site [chemical binding]; other site
160488001895	catalytic residues [active]
160488001896	Transcriptional activator of acetoin/glycerol metabolism [Secondary metabolites biosynthesis, transport, and catabolism / Transcription]; Region: AcoR; COG3284
160488001897	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488001898	Walker A motif; other site
160488001899	ATP binding site [chemical binding]; other site
160488001900	Walker B motif; other site
160488001901	arginine finger; other site
160488001902	Bacterial regulatory protein, Fis family; Region: HTH_8; pfam02954
160488001903	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase; Region: mpl; TIGR01081
160488001904	Mur ligase family, catalytic domain; Region: Mur_ligase; pfam01225
160488001905	Mur ligase middle domain; Region: Mur_ligase_M; pfam08245
160488001906	Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875
160488001907	aromatic acid decarboxylase; Validated; Region: PRK05920
160488001908	Flavoprotein; Region: Flavoprotein; pfam02441
160488001909	Protein of unknown function (DUF1375); Region: DUF1375; cl11456
160488001910	CC3(TIP30)-like, atypical (a) SDRs; Region: CC3_like_SDR_a; cd05250
160488001911	Predicted nucleoside-diphosphate-sugar epimerases [Cell envelope biogenesis, outer membrane / Carbohydrate transport and metabolism]; Region: COG0702
160488001912	NAD binding site [chemical binding]; other site
160488001913	active site
160488001914	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4642
160488001915	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4642
160488001916	Peptidase C13 family; Region: Peptidase_C13; pfam01650
160488001917	(2R,3R)-2,3-butanediol dehydrogenase; Region: butanediol_DH_like; cd08233
160488001918	Threonine dehydrogenase and related Zn-dependent dehydrogenases [Amino acid transport and metabolism / General function prediction only]; Region: Tdh; COG1063
160488001919	putative NAD(P) binding site [chemical binding]; other site
160488001920	catalytic Zn binding site [ion binding]; other site
160488001921	acetoin dehydrogenase E2 subunit dihydrolipoyllysine-residue acetyltransferase; Provisional; Region: PRK14875
160488001922	Lipoyl domain of the dihydrolipoyl acyltransferase component (E2) of 2-oxo acid dehydrogenases. 2-oxo acid dehydrogenase multienzyme complexes, like pyruvate dehydrogenase (PDH), 2-oxoglutarate dehydrogenase (OGDH) and branched-chain 2-oxo acid...; Region: lipoyl_domain; cd06849
160488001923	E3 interaction surface; other site
160488001924	lipoyl attachment site [posttranslational modification]; other site
160488001925	Pyruvate/2-oxoglutarate dehydrogenase complex, dehydrogenase (E1) component, eukaryotic type, beta subunit [Energy production and conversion]; Region: AcoB; COG0022
160488001926	Pyrimidine (PYR) binding domain of the beta subunits of the E1 components of human pyruvate dehydrogenase complex (E1- PDHc) and related proteins; Region: TPP_PYR_E1-PDHc-beta_like; cd07036
160488001927	alpha subunit interface [polypeptide binding]; other site
160488001928	TPP binding site [chemical binding]; other site
160488001929	heterodimer interface [polypeptide binding]; other site
160488001930	Transketolase, C-terminal domain; Region: Transketolase_C; pfam02780
160488001931	pyruvate dehydrogenase E1 component, alpha subunit; Region: PDH_E1_alph_y; TIGR03182
160488001932	Thiamine pyrophosphate (TPP) family, E1 of PDC_ADC_BCADC subfamily, TPP-binding module; composed of proteins similar to the E1 components of the human pyruvate dehydrogenase complex (PDC), the acetoin dehydrogenase complex (ADC) and the branched chain...; Region: TPP_E1_PDC_ADC_BCADC; cd02000
160488001933	tetramer interface [polypeptide binding]; other site
160488001934	TPP-binding site [chemical binding]; other site
160488001935	heterodimer interface [polypeptide binding]; other site
160488001936	phosphorylation loop region [posttranslational modification]
160488001937	Predicted inorganic polyphosphate/ATP-NAD kinase [General function prediction only]; Region: COG3199
160488001938	Transcriptional activator of acetoin/glycerol metabolism [Secondary metabolites biosynthesis, transport, and catabolism / Transcription]; Region: AcoR; COG3284
160488001939	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488001940	Walker A motif; other site
160488001941	ATP binding site [chemical binding]; other site
160488001942	Walker B motif; other site
160488001943	arginine finger; other site
160488001944	Bacterial regulatory protein, Fis family; Region: HTH_8; pfam02954
160488001945	acetyl-CoA carboxylase biotin carboxylase subunit; Validated; Region: PRK08591
160488001946	Carbamoyl-phosphate synthase L chain, N-terminal domain; Region: CPSase_L_chain; pfam00289
160488001947	Carbamoyl-phosphate synthase L chain, ATP binding domain; Region: CPSase_L_D2; pfam02786
160488001948	Biotin carboxylase C-terminal domain; Region: Biotin_carb_C; smart00878
160488001949	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit; Validated; Region: PRK06302
160488001950	The biotinyl-domain or biotin carboxyl carrier protein (BCCP) domain is present in all biotin-dependent enzymes, such as acetyl-CoA carboxylase, pyruvate carboxylase, propionyl-CoA carboxylase, methylcrotonyl-CoA carboxylase, geranyl-CoA carboxylase; Region: biotinyl_domain; cd06850
160488001951	carboxyltransferase (CT) interaction site; other site
160488001952	biotinylation site [posttranslational modification]; other site
160488001953	Dehydroquinase (DHQase), type II. Dehydroquinase (or 3-dehydroquinate dehydratase) catalyzes the reversible dehydration of 3-dehydroquinate to form 3-dehydroshikimate. This reaction is part of two metabolic pathways: the biosynthetic shikimate pathway...; Region: DHQase_II; cd00466
160488001954	Dehydroquinase class II; Region: DHquinase_II; pfam01220
160488001955	active site
160488001956	trimer interface [polypeptide binding]; other site
160488001957	dimer interface [polypeptide binding]; other site
160488001958	thiol:disulfide interchange protein precursor; Provisional; Region: dipZ; PRK00293
160488001959	Disulphide bond corrector protein DsbC; Region: DsbC; pfam11412
160488001960	Cytochrome C biogenesis protein transmembrane region; Region: DsbD; cl15788
160488001961	DsbD gamma family; DsbD gamma is the C-terminal periplasmic domain of the bacterial protein DsbD. It contains a CXXC motif in a TRX fold and shuttles the reducing potential from the membrane domain (DsbD beta) to the N-terminal periplasmic domain (DsbD...; Region: DsbDgamma; cd02953
160488001962	DsbD alpha interface [polypeptide binding]; other site
160488001963	catalytic residues [active]
160488001964	Methyl-accepting chemotaxis protein [Cell motility and secretion / Signal transduction mechanisms]; Region: Tar; COG0840
160488001965	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
160488001966	dimer interface [polypeptide binding]; other site
160488001967	putative CheW interface [polypeptide binding]; other site
160488001968	Response regulator containing a CheY-like receiver domain and a GGDEF domain [Signal transduction mechanisms]; Region: PleD; COG3706
160488001969	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cl17736
160488001970	active site
160488001971	phosphorylation site [posttranslational modification]
160488001972	intermolecular recognition site; other site
160488001973	dimerization interface [polypeptide binding]; other site
160488001974	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488001975	active site
160488001976	phosphorylation site [posttranslational modification]
160488001977	intermolecular recognition site; other site
160488001978	dimerization interface [polypeptide binding]; other site
160488001979	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488001980	metal binding site [ion binding]; metal-binding site
160488001981	active site
160488001982	I-site; other site
160488001983	Uncharacterized protein conserved in bacteria (DUF2333); Region: DUF2333; pfam10095
160488001984	Nudix hydrolase is a superfamily of enzymes found in all three kingdoms of life, and it catalyzes the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+...; Region: Nudix_Hydrolase; cl00447
160488001985	Nudix hydrolase is a superfamily of enzymes found in all three kingdoms of life, and it catalyzes the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+...; Region: Nudix_Hydrolase; cl00447
160488001986	nudix motif; other site
160488001987	translation initiation factor Sui1; Validated; Region: PRK06824
160488001988	Homologs of eIF1/SUI1 including Escherichia coli YciH; Region: YciH_like; cd11567
160488001989	putative rRNA binding site [nucleotide binding]; other site
160488001990	arginine decarboxylase; Provisional; Region: PRK05354
160488001991	Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzyme Arginine Decarboxylase; Region: PLPDE_III_ADC; cd06830
160488001992	dimer interface [polypeptide binding]; other site
160488001993	active site
160488001994	pyridoxal 5'-phosphate (PLP) binding site [chemical binding]; other site
160488001995	catalytic residues [active]
160488001996	Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzymes; Region: PLPDE_III; cl00261
160488001997	Transposase IS200 like; Region: Y1_Tnp; pfam01797
160488001998	DNA-damage-inducible SOS response protein; Provisional; Region: PRK10367
160488001999	DinF and similar proteins, a subfamily of the multidrug and toxic compound extrusion (MATE)-like proteins; Region: MATE_DinF_like; cd13136
160488002000	Large extracellular alpha-helical protein [General function prediction only]; Region: COG2373
160488002001	MG2 domain; Region: A2M_N; pfam01835
160488002002	Oligogalacturonate-specific porin protein (KdgM); Region: KdgM; cl11629
160488002003	Alpha-2-macroglobulin family; Region: A2M; pfam00207
160488002004	Proteins similar to alpha2-macroglobulin (alpha (2)-M).  Alpha (2)-M is a major carrier protein in serum. It is a broadly specific proteinase inhibitor.  The structural thioester of alpha (2)-M, is involved in the immobilization and entrapment of...; Region: A2M_like; cd02891
160488002005	surface patch; other site
160488002006	thioester region; other site
160488002007	specificity defining residues; other site
160488002008	penicillin-binding protein 1C; Provisional; Region: PRK11240
160488002009	Transglycosylase; Region: Transgly; pfam00912
160488002010	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; cl17760
160488002011	Penicillin-Binding Protein C-terminus Family; Region: BiPBP_C; pfam06832
160488002012	Hemolysin activation/secretion protein [Intracellular trafficking and secretion]; Region: FhaC; COG2831
160488002013	POTRA domain, ShlB-type; Region: POTRA_2; pfam08479
160488002014	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
160488002015	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488002016	active site
160488002017	phosphorylation site [posttranslational modification]
160488002018	intermolecular recognition site; other site
160488002019	dimerization interface [polypeptide binding]; other site
160488002020	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
160488002021	DNA binding residues [nucleotide binding]
160488002022	dimerization interface [polypeptide binding]; other site
160488002023	Type IV leader peptidase family; Region: Peptidase_A24; pfam01478
160488002024	Domain of unknown function (DUF4136); Region: DUF4136; pfam13590
160488002025	Domain of unknown function (DUF4136); Region: DUF4136; pfam13590
160488002026	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488002027	S-adenosylmethionine binding site [chemical binding]; other site
160488002028	Nucleoside Triphosphate Pyrophosphohydrolase (EC 3.6.1.8) MazG-like domain found in mouse RS21-C6 protein and its homologs; Region: NTP-PPase_RS21-C6_like; cd11537
160488002029	homodimer interface [polypeptide binding]; other site
160488002030	chemical substrate binding site [chemical binding]; other site
160488002031	oligomer interface [polypeptide binding]; other site
160488002032	metal binding site [ion binding]; metal-binding site
160488002033	The hotdog fold was initially identified in the E. coli FabA (beta-hydroxydecanoyl-acyl carrier protein (ACP)-dehydratase) structure and subsequently in 4HBT (4-hydroxybenzoyl-CoA thioesterase) from Pseudomonas. A number of other seemingly unrelated...; Region: hot_dog; cl00509
160488002034	active site 2 [active]
160488002035	active site 1 [active]
160488002036	3-ketoacyl-(acyl-carrier-protein) reductase; Provisional; Region: fabG; PRK08261
160488002037	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
160488002038	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
160488002039	NAD(P) binding site [chemical binding]; other site
160488002040	active site
160488002041	acetyl-CoA acetyltransferase; Provisional; Region: PRK09268
160488002042	Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751
160488002043	dimer interface [polypeptide binding]; other site
160488002044	active site
160488002045	AraC-like ligand binding domain; Region: AraC_binding; pfam02311
160488002046	AraC-type DNA-binding domain-containing proteins [Transcription]; Region: AraC; COG2207
160488002047	Cache domain; Region: Cache_1; pfam02743
160488002048	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
160488002049	dimerization interface [polypeptide binding]; other site
160488002050	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
160488002051	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
160488002052	dimer interface [polypeptide binding]; other site
160488002053	putative CheW interface [polypeptide binding]; other site
160488002054	Cu(I)-responsive transcriptional regulator; Region: CueR; TIGR02044
160488002055	Helix-Turn-Helix DNA binding domain of CueR-like transcription regulators; Region: HTH_CueR; cd01108
160488002056	DNA binding residues [nucleotide binding]
160488002057	dimer interface [polypeptide binding]; other site
160488002058	copper binding site [ion binding]; other site
160488002059	Cation transport ATPase [Inorganic ion transport and metabolism]; Region: ZntA; COG2217
160488002060	Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371
160488002061	metal-binding site [ion binding]
160488002062	Cation transport ATPase [Inorganic ion transport and metabolism]; Region: ZntA; COG2217
160488002063	Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371
160488002064	metal-binding site [ion binding]
160488002065	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
160488002066	Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371
160488002067	metal-binding site [ion binding]
160488002068	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488002069	bicyclomycin/multidrug efflux system; Provisional; Region: PRK11102
160488002070	putative substrate translocation pore; other site
160488002071	Adenosine deaminase [Nucleotide transport and metabolism]; Region: Add; COG1816
160488002072	Adenosine deaminase (ADA) is a monomeric zinc dependent enzyme which catalyzes the irreversible hydrolytic deamination of both adenosine, as well as desoxyadenosine, to ammonia and inosine or desoxyinosine, respectively. ADA plays an important role in...; Region: ADA; cd01320
160488002073	active site
160488002074	purine riboside binding site [chemical binding]; other site
160488002075	short chain dehydrogenase; Provisional; Region: PRK08177
160488002076	C factor cell-cell signaling protein; Provisional; Region: PRK09009
160488002077	NAD(P) binding site [chemical binding]; other site
160488002078	active site
160488002079	Uncharacterized conserved protein [Function unknown]; Region: COG1739
160488002080	Uncharacterized protein family UPF0029; Region: UPF0029; pfam01205
160488002081	Domain of unknown function (DUF1949); Region: DUF1949; pfam09186
160488002082	pyrimidine utilization regulatory protein R; Region: RutR; TIGR03613
160488002083	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
160488002084	YcdC-like protein, C-terminal region; Region: TetR_C_3; pfam08362
160488002085	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488002086	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488002087	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
160488002088	dimerization interface [polypeptide binding]; other site
160488002089	beta alanine--pyruvate transaminase; Provisional; Region: PRK09221
160488002090	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
160488002091	inhibitor-cofactor binding pocket; inhibition site
160488002092	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488002093	catalytic residue [active]
160488002094	Methylmalonate semialdehyde dehydrogenase and ALDH family members 6A1 and 6B2; Region: ALDH_F6_MMSDH; cd07085
160488002095	methylmalonic acid semialdehyde dehydrogenase; Region: MMSDH; TIGR01722
160488002096	tetrameric interface [polypeptide binding]; other site
160488002097	NAD binding site [chemical binding]; other site
160488002098	catalytic residues [active]
160488002099	Paraquat-inducible protein B [General function prediction only]; Region: PqiB; COG3008
160488002100	mce related protein; Region: MCE; pfam02470
160488002101	mce related protein; Region: MCE; pfam02470
160488002102	mce related protein; Region: MCE; pfam02470
160488002103	mce related protein; Region: MCE; pfam02470
160488002104	mce related protein; Region: MCE; pfam02470
160488002105	mce related protein; Region: MCE; pfam02470
160488002106	30S ribosomal protein S20; Reviewed; Region: rpsT; PRK00239
160488002107	Uncharacterized membrane protein, putative virulence factor [General function prediction only]; Region: MviN; COG0728
160488002108	MurJ/MviN, a subfamily of the multidrug and toxic compound extrusion (MATE)-like proteins; Region: MATE_MurJ_like; cd13123
160488002109	bifunctional riboflavin kinase/FMN adenylyltransferase; Reviewed; Region: PRK05627
160488002110	FAD synthetase, N-terminal domain of the bifunctional enzyme; Region: FAD_synthetase_N; cd02064
160488002111	active site
160488002112	Riboflavin kinase; Region: Flavokinase; pfam01687
160488002113	isoleucyl-tRNA synthetase; Reviewed; Region: ileS; PRK05743
160488002114	nucleotidyl transferase superfamily; Region: nt_trans; cl00015
160488002115	active site
160488002116	HIGH motif; other site
160488002117	nucleotide binding site [chemical binding]; other site
160488002118	Leucyl-tRNA synthetase, Domain 2; Region: tRNA-synt_1_2; pfam13603
160488002119	catalytic core domain of isoleucyl-tRNA synthetases; Region: IleRS_core; cd00818
160488002120	active site
160488002121	KMSKS motif; other site
160488002122	Anticodon-binding domain of bacterial and eukaryotic mitochondrial isoleucyl tRNA synthetases; Region: Anticodon_Ia_Ile_BEm; cd07960
160488002123	tRNA binding surface [nucleotide binding]; other site
160488002124	anticodon binding site; other site
160488002125	Zinc finger found in FPG and IleRS; Region: zf-FPG_IleRS; pfam06827
160488002126	lipoprotein signal peptidase; Reviewed; Region: lspA; PRK00376
160488002127	FKBP-type peptidyl-prolyl cis-trans isomerase; Provisional; Region: PRK15095
160488002128	FKBP-type peptidyl-prolyl cis-trans isomerase; Region: FKBP_C; pfam00254
160488002129	4-hydroxy-3-methylbut-2-enyl diphosphate reductase; Reviewed; Region: ispH; PRK01045
160488002130	4-Hydroxy-3-methylbut-2-enyl diphosphate reductase IspH [Lipid metabolism]; Region: lytB; COG0761
160488002131	Type II transport protein GspH; Region: GspH; pfam12019
160488002132	Tfp pilus assembly protein PilW [Cell motility and secretion / Intracellular trafficking and secretion]; Region: PilW; COG4966
160488002133	Tfp pilus assembly protein PilE [Cell motility and secretion / Intracellular trafficking and secretion]; Region: PilE; COG4968
160488002134	prepilin-type N-terminal cleavage/methylation domain; Region: IV_pilin_GFxxxE; TIGR02532
160488002135	glycine oxidase ThiO; Region: thiamin_ThiO; TIGR02352
160488002136	putative aminophosphonate oxidoreductase; Region: Phn_aa_oxid; TIGR03329
160488002137	putative amidase; Provisional; Region: PRK06169
160488002138	Amidase; Region: Amidase; pfam01425
160488002139	allantoate amidohydrolase; Reviewed; Region: PRK12893
160488002140	M20 Peptidase beta-alanine synthase, an amidohydrolase; Region: M20_bAS; cd03884
160488002141	active site
160488002142	metal binding site [ion binding]; metal-binding site
160488002143	dimer interface [polypeptide binding]; other site
160488002144	ABC-type branched-chain amino acid transport systems, ATPase component [Amino acid transport and metabolism]; Region: LivF; COG0410
160488002145	ATP-binding cassette domain of branched-chain amino acid transporter; Region: ABC_TM1139_LivF_branched; cd03224
160488002146	Walker A/P-loop; other site
160488002147	ATP binding site [chemical binding]; other site
160488002148	Q-loop/lid; other site
160488002149	ABC transporter signature motif; other site
160488002150	Walker B; other site
160488002151	D-loop; other site
160488002152	H-loop/switch region; other site
160488002153	ABC-type branched-chain amino acid transport systems, ATPase component [Amino acid transport and metabolism]; Region: LivG; COG0411
160488002154	ATP-binding cassette component of branched chain amino acids transport system; Region: ABC_Mj1267_LivG_branched; cd03219
160488002155	Walker A/P-loop; other site
160488002156	ATP binding site [chemical binding]; other site
160488002157	Q-loop/lid; other site
160488002158	ABC transporter signature motif; other site
160488002159	Walker B; other site
160488002160	D-loop; other site
160488002161	H-loop/switch region; other site
160488002162	ABC-type branched-chain amino acid transport system, permease component [Amino acid transport and metabolism]; Region: LivM; COG4177
160488002163	Transmembrane subunit (TM) of Escherichia coli LivM and related proteins. LivM is one of two TMs of the E. coli LIV-1/LS transporter, a Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporter involved in the uptake of...; Region: TM_PBP1_LivM_like; cd06581
160488002164	TM-ABC transporter signature motif; other site
160488002165	Transmembrane subunit (TM) of Escherichia coli LivH and related proteins. LivH is one of two TMs of the E. coli LIV-1/LS transporter, a Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporter involved in the uptake of...; Region: TM_PBP1_LivH_like; cd06582
160488002166	TM-ABC transporter signature motif; other site
160488002167	Periplasmic solute-binding domain of active transport proteins that belong to the type I periplasmic binding fold protein family; Region: PBP1_SBP_like_1; cd06327
160488002168	Periplasmic binding protein; Region: Peripla_BP_6; pfam13458
160488002169	putative ligand binding site [chemical binding]; other site
160488002170	Transcriptional regulators [Transcription]; Region: FadR; COG2186
160488002171	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488002172	DNA-binding site [nucleotide binding]; DNA binding site
160488002173	This entry represents the C-terminal ligand binding domain of many members of the GntR family; Region: FCD; smart00895
160488002174	outer membrane assembly lipoprotein YfiO; Region: OM_YfiO; TIGR03302
160488002175	Multicopper polyphenol oxidase (laccase) [Secondary metabolites biosynthesis, transport and catabolism]; Region: yfiH; COG1496
160488002176	Multi-copper polyphenol oxidoreductase laccase; Region: Cu-oxidase_4; cl00650
160488002177	ATP-dependent chaperone ClpB; Region: chaperone_ClpB; TIGR03346
160488002178	Clp amino terminal domain; Region: Clp_N; pfam02861
160488002179	Clp amino terminal domain; Region: Clp_N; pfam02861
160488002180	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488002181	Walker A motif; other site
160488002182	ATP binding site [chemical binding]; other site
160488002183	Walker B motif; other site
160488002184	arginine finger; other site
160488002185	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488002186	Walker A motif; other site
160488002187	ATP binding site [chemical binding]; other site
160488002188	Walker B motif; other site
160488002189	arginine finger; other site
160488002190	C-terminal, D2-small domain, of ClpB protein; Region: ClpB_D2-small; pfam10431
160488002191	NADH dehydrogenase, FAD-containing subunit [Energy production and conversion]; Region: Ndh; COG1252
160488002192	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
160488002193	Protein of unknown function (DUF3094); Region: DUF3094; pfam11293
160488002194	Protein of unknown function (DUF1780); Region: DUF1780; pfam08682
160488002195	Predicted membrane protein [Function unknown]; Region: COG3235
160488002196	Cobalt uptake substrate-specific transmembrane region; Region: CbiM; pfam01891
160488002197	DNA gyrase inhibitor; Reviewed; Region: PRK00418
160488002198	Dephospho-CoA kinase [Coenzyme metabolism]; Region: CoaE; COG0237
160488002199	Dephospho-coenzyme A kinase (DPCK, EC 2.7.1.24) catalyzes the phosphorylation of dephosphocoenzyme A (dCoA) to yield CoA, which is the final step in CoA biosynthesis; Region: DPCK; cd02022
160488002200	CoA-binding site [chemical binding]; other site
160488002201	ATP-binding [chemical binding]; other site
160488002202	Type II secretory pathway, prepilin signal peptidase PulO and related peptidases [Cell motility and secretion / Posttranslational modification, protein turnover, chaperones / Intracellular trafficking and secretion]; Region: PulO; COG1989
160488002203	Bacterial Peptidase A24 N-terminal domain; Region: DiS_P_DiS; pfam06750
160488002204	Type IV leader peptidase family; Region: Peptidase_A24; pfam01478
160488002205	Type II secretory pathway, component PulF [Cell motility and secretion / Intracellular trafficking and secretion]; Region: PulF; COG1459
160488002206	Type II secretion system (T2SS), protein F; Region: T2SF; pfam00482
160488002207	Type II secretion system (T2SS), protein F; Region: T2SF; pfam00482
160488002208	Tfp pilus assembly protein, major pilin PilA [Cell motility and secretion / Intracellular trafficking and secretion]; Region: PilA; COG4969
160488002209	Type IV pilin N-term methylation site GFxxxE; Region: N_methyl_2; pfam13544
160488002210	Pilin (bacterial filament); Region: Pilin; pfam00114
160488002211	INTRON01; Group II intron; Group II intron most similar to the Group II intron from Pseudomonas alcaligenes.
160488002212	RT_G2_intron: Reverse transcriptases (RTs) with group II intron origin. RT transcribes DNA using RNA as template. Proteins in this subfamily are found in bacterial and mitochondrial group II introns. Their most probable ancestor was a retrotransposable...; Region: RT_G2_intron; cd01651
160488002213	Reverse transcriptase (RNA-dependent DNA polymerase); Region: RVT_1; pfam00078
160488002214	putative active site [active]
160488002215	putative NTP binding site [chemical binding]; other site
160488002216	putative nucleic acid binding site [nucleotide binding]; other site
160488002217	Group II intron, maturase-specific domain; Region: GIIM; pfam08388
160488002218	Cold-Shock Protein (CSP) contains an S1-like cold-shock domain (CSD) that is found in eukaryotes, prokaryotes, and archaea.  CSP's include the major cold-shock proteins CspA and CspB in bacteria and the eukaryotic gene regulatory factor Y-box...; Region: CSP_CDS; cd04458
160488002219	DNA-binding site [nucleotide binding]; DNA binding site
160488002220	RNA-binding motif; other site
160488002221	Transposase C of IS166 homeodomain; Region: LZ_Tnp_IS66; pfam13007
160488002222	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3436
160488002223	putative Helix-turn-helix domain of transposase IS66; Region: HTH_Tnp_IS66; pfam13005
160488002224	Transposase IS66 family; Region: DDE_Tnp_IS66; pfam03050
160488002225	IS66 C-terminal element; Region: DDE_Tnp_IS66_C; pfam13817
160488002226	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3436
160488002227	IS66 Orf2 like protein; Region: TnpB_IS66; pfam05717
160488002228	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488002229	AAA domain; Region: AAA_21; pfam13304
160488002230	Walker A/P-loop; other site
160488002231	ATP binding site [chemical binding]; other site
160488002232	Q-loop/lid; other site
160488002233	ABC transporter signature motif; other site
160488002234	Homeodomain-like domain; Region: HTH_23; cl17451
160488002235	Uncharacterized BCR, YitT family COG1284; Region: DUF161; pfam02588
160488002236	Uncharacterized conserved protein [Function unknown]; Region: COG1284
160488002237	Uncharacterized BCR, YitT family COG1284; Region: DUF161; pfam02588
160488002238	PAAR motif; Region: PAAR_motif; pfam05488
160488002239	Uncharacterized conserved protein [Function unknown]; Region: COG3791
160488002240	Members of the Nudix hydrolase superfamily catalyze the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belong to this superfamily requires a divalent cation, such as Mg2+ or Mn2+ for their activity and contain a highly...; Region: Nudix_Hydrolase_6; cd04663
160488002241	nudix motif; other site
160488002242	IS66 C-terminal element; Region: DDE_Tnp_IS66_C; pfam13817
160488002243	Acetyltransferase (GNAT) domain; Region: Acetyltransf_10; pfam13673
160488002244	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
160488002245	Coenzyme A binding pocket [chemical binding]; other site
160488002246	GntP family permease; Region: GntP_permease; pfam02447
160488002247	fructuronate transporter; Provisional; Region: PRK10034; cl15264
160488002248	L-lactate dehydrogenase-like malate dehydrogenase proteins; Region: LDH-like_MDH; cd01339
160488002249	L-lactate dehydrogenase; Region: L-LDH-NAD; TIGR01771
160488002250	NAD(P) binding site [chemical binding]; other site
160488002251	dimer interface [polypeptide binding]; other site
160488002252	tetramer (dimer of dimers) interface [polypeptide binding]; other site
160488002253	substrate binding site [chemical binding]; other site
160488002254	Protein of unknown function (DUF796); Region: DUF796; pfam05638
160488002255	ABC-type arginine transport system, permease component [Amino acid transport and metabolism]; Region: ArtQ; COG4215
160488002256	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488002257	dimer interface [polypeptide binding]; other site
160488002258	conserved gate region; other site
160488002259	putative PBP binding loops; other site
160488002260	ABC-ATPase subunit interface; other site
160488002261	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
160488002262	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488002263	substrate binding pocket [chemical binding]; other site
160488002264	membrane-bound complex binding site; other site
160488002265	hinge residues; other site
160488002266	Homocysteine/selenocysteine methylase (S-methylmethionine-dependent) [Amino acid transport and metabolism]; Region: MHT1; COG2040
160488002267	Homocysteine S-methyltransferase; Region: S-methyl_trans; pfam02574
160488002268	cystathionine gamma-synthase; Provisional; Region: PRK08249
160488002269	CGS_like: Cystathionine gamma-synthase is a PLP dependent enzyme and catalyzes the committed step of methionine biosynthesis. This pathway is unique to microorganisms and plants, rendering the enzyme an attractive target for the development of...; Region: CGS_like; cd00614
160488002270	homodimer interface [polypeptide binding]; other site
160488002271	substrate-cofactor binding pocket; other site
160488002272	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488002273	catalytic residue [active]
160488002274	S-methylmethionine transporter; Provisional; Region: PRK11387
160488002275	Tryptophan/tyrosine permease family; Region: Trp_Tyr_perm; cl17316
160488002276	DNA-binding transcriptional activator GcvA; Provisional; Region: PRK11139
160488002277	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488002278	The C-terminal substrate domain of LysR-type GcdR, TrPI, HvR and beta-lactamase regulators, and that of other closely related homologs; contains the type 2 periplasmic binding fold; Region: PBP2_GcdR_TrpI_HvrB_AmpR_like; cd08432
160488002279	dimerization interface [polypeptide binding]; other site
160488002280	substrate binding pocket [chemical binding]; other site
160488002281	Threonine synthase [Amino acid transport and metabolism]; Region: ThrC; COG0498
160488002282	Threonine synthase catalyzes the final step of threonine biosynthesis. The conversion of O-phosphohomoserine into threonine and inorganic phosphate is pyridoxal 5'-phosphate dependent. The Thr-synth_1 CD includes members from higher plants; Region: Thr-synth_2; cd01560
160488002283	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488002284	catalytic residue [active]
160488002285	Transcriptional regulators [Transcription]; Region: Lrp; COG1522
160488002286	AsnC-type helix-turn-helix domain; Region: HTH_AsnC-type; pfam13404
160488002287	AsnC family; Region: AsnC_trans_reg; pfam01037
160488002288	homoserine dehydrogenase; Provisional; Region: PRK06270
160488002289	Homoserine dehydrogenase; Region: Homoserine_dh; pfam00742
160488002290	Uncharacterized ALDH (y4uC) with similarity to Tortula ruralis aldehyde dehydrogenase ALDH21A1; Region: ALDH_y4uC; cd07149
160488002291	Aldehyde dehydrogenase family; Region: Aldedh; pfam00171
160488002292	NAD(P) binding site [chemical binding]; other site
160488002293	catalytic residues [active]
160488002294	This group of proteins belong to a large family of YjgF/YER057c/UK114-like proteins present in bacteria, archaea, and eukaryotes with no definitive function.  The conserved domain is similar in structure to chorismate mutase but there is no sequence...; Region: YjgF_YER057c_UK114_like_2; cd06150
160488002295	homotrimer interaction site [polypeptide binding]; other site
160488002296	putative active site [active]
160488002297	RNA polymerase sigma factor FecI; Provisional; Region: PRK09651
160488002298	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
160488002299	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
160488002300	DNA binding residues [nucleotide binding]
160488002301	Fe2+-dicitrate sensor, membrane component [Inorganic ion transport and metabolism / Signal transduction mechanisms]; Region: FecR; COG3712
160488002302	FecR protein; Region: FecR; pfam04773
160488002303	Secretin and TonB N terminus short domain; Region: STN; smart00965
160488002304	Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid [Inorganic ion transport and metabolism]; Region: FhuE; COG4773
160488002305	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
160488002306	N-terminal plug; other site
160488002307	ligand-binding site [chemical binding]; other site
160488002308	Arsenite efflux pump ACR3 and related permeases [Inorganic ion transport and metabolism]; Region: ACR3; COG0798
160488002309	Sodium Bile acid symporter family; Region: SBF; cl17470
160488002310	serine hydroxymethyltransferase; Reviewed; Region: glyA; PRK00011
160488002311	Serine-glycine hydroxymethyltransferase (SHMT). This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). SHMT carries out interconversion of serine and glycine; it catalyzes the transfer of hydroxymethyl...; Region: SHMT; cd00378
160488002312	dimer interface [polypeptide binding]; other site
160488002313	active site
160488002314	glycine-pyridoxal phosphate binding site [chemical binding]; other site
160488002315	folate binding site [chemical binding]; other site
160488002316	cyclic-di-GMP phosphodiesterase; Provisional; Region: PRK11359
160488002317	Motif C-terminal to PAS motifs (likely to contribute to PAS structural domain); Region: PAC; smart00086
160488002318	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488002319	putative active site [active]
160488002320	heme pocket [chemical binding]; other site
160488002321	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488002322	putative active site [active]
160488002323	heme pocket [chemical binding]; other site
160488002324	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488002325	metal binding site [ion binding]; metal-binding site
160488002326	active site
160488002327	I-site; other site
160488002328	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
160488002329	putative ABC transporter ATP-binding protein; Reviewed; Region: PRK11819
160488002330	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488002331	Walker A/P-loop; other site
160488002332	ATP binding site [chemical binding]; other site
160488002333	Q-loop/lid; other site
160488002334	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
160488002335	ABC transporter signature motif; other site
160488002336	Walker B; other site
160488002337	D-loop; other site
160488002338	ABC transporter; Region: ABC_tran_2; pfam12848
160488002339	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
160488002340	glutamate dehydrogenase; Provisional; Region: PRK09414
160488002341	Glu/Leu/Phe/Val dehydrogenase, dimerisation domain; Region: ELFV_dehydrog_N; pfam02812
160488002342	NAD(P) binding domain of glutamate dehydrogenase, subgroup 2; Region: NAD_bind_2_Glu_DH; cd05313
160488002343	NAD(P) binding site [chemical binding]; other site
160488002344	transcription elongation factor regulatory protein; Validated; Region: PRK06342
160488002345	Transcription elongation factor, GreA/GreB, C-term; Region: GreA_GreB; pfam01272
160488002346	Domain of unknown function (DUF4105); Region: DUF4105; pfam13387
160488002347	Protein of unknown function (DUF3015); Region: DUF3015; pfam11220
160488002348	AAA domain; Region: AAA_32; pfam13654
160488002349	lon-related putative ATP-dependent protease; Region: lon_rel; TIGR00764
160488002350	Lon protease (S16) C-terminal proteolytic domain; Region: Lon_C; pfam05362
160488002351	hypothetical protein; Provisional; Region: PRK05208
160488002352	FKBP-type peptidyl-prolyl cis-trans isomerases 1 [Posttranslational modification, protein turnover, chaperones]; Region: FkpA; COG0545
160488002353	Domain amino terminal to FKBP-type peptidyl-prolyl isomerase; Region: FKBP_N; pfam01346
160488002354	FKBP-type peptidyl-prolyl cis-trans isomerase; Region: FKBP_C; pfam00254
160488002355	Uncharacterized Zn-ribbon-containing protein involved in phosphonate metabolism [Inorganic ion transport and metabolism]; Region: PhnA; COG2824
160488002356	PhnA Zinc-Ribbon; Region: PhnA_Zn_Ribbon; pfam08274
160488002357	PhnA protein; Region: PhnA; pfam03831
160488002358	Geranylgeranyl pyrophosphate synthase [Coenzyme metabolism]; Region: IspA; COG0142
160488002359	Trans-Isoprenyl Diphosphate Synthases, head-to-tail; Region: Trans_IPPS_HT; cd00685
160488002360	substrate binding pocket [chemical binding]; other site
160488002361	chain length determination region; other site
160488002362	substrate-Mg2+ binding site; other site
160488002363	catalytic residues [active]
160488002364	aspartate-rich region 1; other site
160488002365	active site lid residues [active]
160488002366	aspartate-rich region 2; other site
160488002367	50S ribosomal protein L21; Validated; Region: rplU; PRK05573
160488002368	50S ribosomal protein L27; Validated; Region: rpmA; PRK05435
160488002369	GTPase CgtA; Reviewed; Region: obgE; PRK12298
160488002370	GTP1/OBG; Region: GTP1_OBG; pfam01018
160488002371	Obg GTPase; Region: Obg; cd01898
160488002372	G1 box; other site
160488002373	GTP/Mg2+ binding site [chemical binding]; other site
160488002374	Switch I region; other site
160488002375	G2 box; other site
160488002376	G3 box; other site
160488002377	Switch II region; other site
160488002378	G4 box; other site
160488002379	G5 box; other site
160488002380	gamma-glutamyl kinase; Provisional; Region: PRK05429
160488002381	AAK_G5K_ProB: Glutamate-5-kinase (G5K) catalyzes glutamate-dependent ATP cleavage; G5K transfers the terminal phosphoryl group of ATP to the gamma-carboxyl group of glutamate, in the first and controlling step of proline (and, in mammals, ornithine)...; Region: AAK_G5K_ProB; cd04242
160488002382	nucleotide binding site [chemical binding]; other site
160488002383	homotetrameric interface [polypeptide binding]; other site
160488002384	putative phosphate binding site [ion binding]; other site
160488002385	putative allosteric binding site; other site
160488002386	PUA domain; Region: PUA; pfam01472
160488002387	hypothetical protein; Provisional; Region: PRK10756
160488002388	CreA protein; Region: CreA; pfam05981
160488002389	chromosome segregation protein SMC, primarily archaeal type; Region: SMC_prok_A; TIGR02169
160488002390	chromosome segregation protein SMC, common bacterial type; Region: SMC_prok_B; TIGR02168
160488002391	Domain of unknown function (DUF4194); Region: DUF4194; pfam13835
160488002392	ribosomal-protein-alanine acetyltransferase; Region: rimI; TIGR01575
160488002393	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
160488002394	Coenzyme A binding pocket [chemical binding]; other site
160488002395	DNA-binding transcriptional activator GcvA; Provisional; Region: PRK11139
160488002396	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488002397	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
160488002398	dimerization interface [polypeptide binding]; other site
160488002399	Putative threonine efflux protein [Amino acid transport and metabolism]; Region: RhtB; COG1280
160488002400	Fe2+-dicitrate sensor, membrane component [Inorganic ion transport and metabolism / Signal transduction mechanisms]; Region: FecR; COG3712
160488002401	FecR protein; Region: FecR; pfam04773
160488002402	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488002403	putative substrate translocation pore; other site
160488002404	Major Facilitator Superfamily; Region: MFS_1; pfam07690
160488002405	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488002406	Major Facilitator Superfamily; Region: MFS_1; pfam07690
160488002407	putative substrate translocation pore; other site
160488002408	fec operon regulator FecR; Reviewed; Region: PRK09774
160488002409	FecR protein; Region: FecR; pfam04773
160488002410	RNA polymerase sigma factor; Provisional; Region: PRK12528
160488002411	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
160488002412	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
160488002413	DNA binding residues [nucleotide binding]
160488002414	endonuclease III; includes endonuclease III (DNA-(apurinic or apyrimidinic site) lyase), alkylbase DNA glycosidases (Alka-family) and other DNA glycosidases; Region: ENDO3c; cd00056
160488002415	endonuclease III; Region: ENDO3c; smart00478
160488002416	minor groove reading motif; other site
160488002417	helix-hairpin-helix signature motif; other site
160488002418	substrate binding pocket [chemical binding]; other site
160488002419	active site
160488002420	bifunctional DNA-binding transcriptional dual regulator/O6-methylguanine-DNA methyltransferase; Provisional; Region: PRK15435
160488002421	Metal binding domain of Ada; Region: Ada_Zn_binding; pfam02805
160488002422	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488002423	6-O-methylguanine DNA methyltransferase, ribonuclease-like domain; Region: Methyltransf_1N; pfam02870
160488002424	The DNA repair protein O6-alkylguanine-DNA alkyltransferase (ATase; also known as AGT, AGAT and MGMT) reverses O6-alkylation DNA damage by transferring O6-alkyl adducts to an active site cysteine irreversibly, without inducing DNA strand breaks. ATases...; Region: ATase; cd06445
160488002425	DNA binding site [nucleotide binding]
160488002426	active site
160488002427	Small-conductance mechanosensitive channel [Cell envelope biogenesis, outer membrane]; Region: COG3264
160488002428	Protein of unknown function (DUF3772); Region: DUF3772; pfam12607
160488002429	Mechanosensitive ion channel; Region: MS_channel; pfam00924
160488002430	Aldehyde dehydrogenase family; Region: Aldedh; pfam00171
160488002431	Arabidopsis betaine aldehyde dehydrogenase 1 and 2, ALDH family 10A8 and 10A9-like; Region: ALDH_F10_BADH; cd07110
160488002432	NAD(P) binding site [chemical binding]; other site
160488002433	catalytic residues [active]
160488002434	catalytic residues [active]
160488002435	Purine-cytosine permease and related proteins [Nucleotide transport and metabolism]; Region: CodB; COG1457
160488002436	Permease for cytosine/purines, uracil, thiamine, allantoin; Region: Transp_cyt_pur; pfam02133
160488002437	Na binding site [ion binding]; other site
160488002438	Ketosteroid isomerase homolog [Function unknown]; Region: COG4319
160488002439	SnoaL-like domain; Region: SnoaL_3; pfam13474
160488002440	Isochorismatase family; Region: Isochorismatase; pfam00857
160488002441	YcaC related amidohydrolases; E.coli YcaC is an homooctameric hydrolase with unknown specificity. Despite its weak sequence similarity, it is structurally related to other amidohydrolases and shares conserved active site residues with them; Region: YcaC_related; cd01012
160488002442	catalytic triad [active]
160488002443	dimer interface [polypeptide binding]; other site
160488002444	conserved cis-peptide bond; other site
160488002445	polyphosphate kinase 2, PA0141 family; Region: PPK2_P_aer; TIGR03707
160488002446	Kef-type K+ transport systems, membrane components [Inorganic ion transport and metabolism]; Region: KefB; COG0475
160488002447	Sodium/hydrogen exchanger family; Region: Na_H_Exchanger; pfam00999
160488002448	Predicted permease, member of the PurR regulon [General function prediction only]; Region: yhhT; cl00465
160488002449	Outer membrane protein [Cell envelope biogenesis, outer membrane / Intracellular trafficking and secretion]; Region: TolC; COG1538
160488002450	multidrug resistance protein MdtN; Provisional; Region: PRK10476
160488002451	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
160488002452	HlyD family secretion protein; Region: HlyD_3; pfam13437
160488002453	Sulfate permease and related transporters (MFS superfamily) [Inorganic ion transport and metabolism]; Region: SUL1; COG0659
160488002454	Sulfate transporter N-terminal domain with GLY motif; Region: Sulfate_tra_GLY; pfam13792
160488002455	Sulfate transporter family; Region: Sulfate_transp; pfam00916
160488002456	Sulphate Transporter and Anti-Sigma factor antagonist domain of SulP-like sulfate transporters, plays a role in the function and regulation of the transport activity, proposed general NTP binding function; Region: STAS_SulP_like_sulfate_transporter; cd07042
160488002457	GTP-binding protein YchF; Reviewed; Region: PRK09601
160488002458	YchF GTPase; Region: YchF; cd01900
160488002459	G1 box; other site
160488002460	GTP/Mg2+ binding site [chemical binding]; other site
160488002461	Switch I region; other site
160488002462	G2 box; other site
160488002463	Switch II region; other site
160488002464	G3 box; other site
160488002465	G4 box; other site
160488002466	G5 box; other site
160488002467	TGS_YchF_C: This subfamily represents TGS domain-containing YchF GTP-binding protein, a universally conserved GTPase whose function is unknown. The N-terminal domain of the YchF protein belongs to the Obg-like family of GTPases, and some members of the...; Region: TGS_YchF_C; cd04867
160488002468	Peptidyl-tRNA hydrolase (PTH) is a monomeric protein that cleaves the ester bond linking the nascent peptide and tRNA when peptidyl-tRNA is released prematurely from the ribosome. This ensures the recycling of peptidyl-tRNAs into tRNAs produced through...; Region: PTH; cd00462
160488002469	putative active site [active]
160488002470	catalytic residue [active]
160488002471	50S ribosomal protein L25/general stress protein Ctc; Reviewed; Region: PRK05618
160488002472	Ribosomal L25/TL5/CTC N-terminal 5S rRNA binding domain; Region: Ribosomal_L25_TL5_CTC; cd00495
160488002473	5S rRNA interface [nucleotide binding]; other site
160488002474	CTC domain interface [polypeptide binding]; other site
160488002475	L16 interface [polypeptide binding]; other site
160488002476	ribose-phosphate pyrophosphokinase; Provisional; Region: PRK01259
160488002477	N-terminal domain of ribose phosphate pyrophosphokinase; Region: Pribosyltran_N; pfam13793
160488002478	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
160488002479	active site
160488002480	4-diphosphocytidyl-2-C-methyl-D-erythritol kinase; Provisional; Region: ipk; PRK00343
160488002481	outer membrane lipoprotein LolB; Provisional; Region: lolB; PRK00022
160488002482	Outer membrane lipoprotein LolB; Region: LolB; pfam03550
160488002483	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
160488002484	TPR motif; other site
160488002485	binding surface
160488002486	TPR repeat; Region: TPR_11; pfam13414
160488002487	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
160488002488	binding surface
160488002489	TPR motif; other site
160488002490	Phosphocholine cytidylyltransferases catalyze the synthesis of CDP-choline; Region: PC_cytidylyltransferase; cd02523
160488002491	active site
160488002492	metal-binding site
160488002493	Peptidase C26; Region: Peptidase_C26; pfam07722
160488002494	Subgroup of proteins having the Type 1 glutamine amidotransferase (GATase1) domain; Region: GATase1_2; cd01745
160488002495	catalytic triad [active]
160488002496	PEP-utilising enzyme, mobile domain; Region: PEP-utilizers; pfam00391
160488002497	Pyruvate phosphate dikinase, PEP/pyruvate binding domain; Region: PPDK_N; pfam01326
160488002498	ATP-grasp domain; Region: ATP-grasp_4; pfam13535
160488002499	CDP-alcohol phosphatidyltransferase; Region: CDP-OH_P_transf; pfam01066
160488002500	CDP-diacylglycerol--serine O-phosphatidyltransferase; Region: pssA; TIGR00473
160488002501	glutamyl-tRNA reductase; Reviewed; Region: hemA; PRK00045
160488002502	NADP-binding domain of glutamyl-tRNA reductase; Region: NAD_bind_Glutamyl_tRNA_reduct; cd05213
160488002503	tRNA; other site
160488002504	putative tRNA binding site [nucleotide binding]; other site
160488002505	putative NADP binding site [chemical binding]; other site
160488002506	Glutamyl-tRNAGlu reductase, dimerisation domain; Region: GlutR_dimer; pfam00745
160488002507	peptide chain release factor 1; Validated; Region: prfA; PRK00591
160488002508	This domain is found in peptide chain release factors; Region: PCRF; smart00937
160488002509	RF-1 domain; Region: RF-1; pfam00472
160488002510	protein-(glutamine-N5) methyltransferase, release factor-specific; Region: RF_mod_PrmC; TIGR03534
160488002511	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488002512	molybdopterin biosynthesis protein MoeB; Provisional; Region: PRK05690
160488002513	ThiF_MoeB_HesA. Family of E1-like enzymes involved in molybdopterin and thiamine biosynthesis family. The common reaction mechanism catalyzed by MoeB and ThiF, like other E1 enzymes, begins with a nucleophilic attack of the C-terminal carboxylate of MoaD...; Region: ThiF_MoeB_HesA_family; cd00757
160488002514	ATP binding site [chemical binding]; other site
160488002515	substrate interface [chemical binding]; other site
160488002516	glutamate racemase; Provisional; Region: PRK00865
160488002517	Lipid A 3-O-deacylase (PagL); Region: PagL; pfam09411
160488002518	classical (c) SDRs; Region: SDR_c; cd05233
160488002519	NAD(P) binding site [chemical binding]; other site
160488002520	deoxyribodipyrimidine photolyase; Provisional; Region: PRK10674
160488002521	DNA photolyase; Region: DNA_photolyase; pfam00875
160488002522	Helix-Turn-Helix DNA binding domain of the transcription regulators MlrA and CarA; Region: HTH_MlrA-CarA; cd01104
160488002523	DNA binding residues [nucleotide binding]
160488002524	MerR HTH family regulatory protein; Region: MerR_1; pfam13411
160488002525	B12 binding domain; Region: B12-binding_2; cl03653
160488002526	Protein of unknown function (DUF523); Region: DUF523; pfam04463
160488002527	Uncharacterized conserved protein [Function unknown]; Region: COG3272
160488002528	Protein of unknown function (DUF1722); Region: DUF1722; pfam08349
160488002529	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
160488002530	Predicted NAD/FAD-dependent oxidoreductase [General function prediction only]; Region: COG3380
160488002531	Predicted nucleoside-diphosphate sugar epimerase [General function prediction only]; Region: COG1090
160488002532	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
160488002533	NAD(P) binding site [chemical binding]; other site
160488002534	active site
160488002535	ferrochelatase; Reviewed; Region: hemH; PRK00035
160488002536	Ferrochelatase, N-terminal domain: Ferrochelatase (protoheme ferrolyase or HemH) is the terminal enzyme of the heme biosynthetic pathway. It catalyzes the insertion of ferrous iron into the protoporphyrin IX ring yielding protoheme. This enzyme is...; Region: Ferrochelatase_N; cd03411
160488002537	C-terminal domain interface [polypeptide binding]; other site
160488002538	active site
160488002539	Ferrochelatase, C-terminal domain: Ferrochelatase (protoheme ferrolyase or HemH) is the terminal enzyme of the heme biosynthetic pathway. It catalyzes the insertion of ferrous iron into the protoporphyrin IX ring yielding protoheme. This enzyme is...; Region: Ferrochelatase_C; cd00419
160488002540	active site
160488002541	N-terminal domain interface [polypeptide binding]; other site
160488002542	Xanthine/uracil permeases [Nucleotide transport and metabolism]; Region: UraA; COG2233
160488002543	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
160488002544	active site
160488002545	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
160488002546	active site
160488002547	cupin fold metalloprotein, WbuC family; Region: cupin_WbuC; TIGR04366
160488002548	malate:quinone oxidoreductase; Reviewed; Region: PRK13339
160488002549	malate:quinone-oxidoreductase; Region: mal_quin_oxido; TIGR01320
160488002550	Lysophospholipid acyltransferases (LPLATs) of glycerophospholipid biosynthesis; Region: LPLAT; cl17185
160488002551	1-acyl-sn-glycerol-3-phosphate acyltransferase [Lipid metabolism]; Region: PlsC; COG0204
160488002552	putative acyl-acceptor binding pocket; other site
160488002553	Cysteine-rich CPXCG; Region: Cys_rich_CPXG; pfam14255
160488002554	Uncharacterized conserved protein [Function unknown]; Region: COG2135
160488002555	Peptidase family M48; Region: Peptidase_M48; pfam01435
160488002556	Predicted membrane protein [Function unknown]; Region: COG2119
160488002557	Uncharacterized protein family UPF0016; Region: UPF0016; pfam01169
160488002558	Uncharacterized protein family UPF0016; Region: UPF0016; pfam01169
160488002559	Methyltransferase small domain N-terminal; Region: MTS_N; pfam08468
160488002560	16S RNA G1207 methylase RsmC [Translation, ribosomal structure and biogenesis]; Region: RsmC; COG2813
160488002561	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488002562	S-adenosylmethionine binding site [chemical binding]; other site
160488002563	glycerate dehydrogenase; Provisional; Region: PRK06487
160488002564	Putative D-isomer specific 2-hydroxyacid dehydrogenases; Region: 2-Hacid_dh_4; cd12162
160488002565	putative ligand binding site [chemical binding]; other site
160488002566	putative NAD binding site [chemical binding]; other site
160488002567	catalytic site [active]
160488002568	long-chain-fatty-acid--CoA ligase; Validated; Region: PRK06187
160488002569	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
160488002570	acyl-activating enzyme (AAE) consensus motif; other site
160488002571	AMP binding site [chemical binding]; other site
160488002572	active site
160488002573	CoA binding site [chemical binding]; other site
160488002574	Protein of unknown function (DUF1302); Region: DUF1302; pfam06980
160488002575	Protein of unknown function (DUF1329); Region: DUF1329; pfam07044
160488002576	ATP-dependent transcriptional regulator [Transcription]; Region: MalT; COG2909
160488002577	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
160488002578	DNA binding residues [nucleotide binding]
160488002579	dimerization interface [polypeptide binding]; other site
160488002580	chemotaxis regulatory protein CheY; Provisional; Region: PRK10610
160488002581	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488002582	active site
160488002583	phosphorylation site [posttranslational modification]
160488002584	intermolecular recognition site; other site
160488002585	dimerization interface [polypeptide binding]; other site
160488002586	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
160488002587	binding surface
160488002588	TPR motif; other site
160488002589	TPR repeat; Region: TPR_11; pfam13414
160488002590	TPR repeat; Region: TPR_11; pfam13414
160488002591	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
160488002592	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488002593	ATP binding site [chemical binding]; other site
160488002594	Mg2+ binding site [ion binding]; other site
160488002595	G-X-G motif; other site
160488002596	Antidote-toxin recognition MazE; Region: Antitoxin-MazE; cl00877
160488002597	toxin ChpB; Provisional; Region: PRK09812
160488002598	Zn-dependent hydrolases, including glyoxylases [General function prediction only]; Region: GloB; COG0491
160488002599	Outer membrane protein and related peptidoglycan-associated (lipo)proteins [Cell envelope biogenesis, outer membrane]; Region: OmpA; COG2885
160488002600	Peptidoglycan binding domains similar to the C-terminal domain of outer-membrane protein OmpA; Region: OmpA_C-like; cd07185
160488002601	ligand binding site [chemical binding]; other site
160488002602	phosphate acetyltransferase; Reviewed; Region: PRK05632
160488002603	The Fer4_NifH superfamily contains a variety of proteins which share a common ATP-binding domain. Functionally, proteins in this superfamily use the energy from hydrolysis of NTP to transfer electron or ion; Region: Fer4_NifH; cl17203
160488002604	DRTGG domain; Region: DRTGG; pfam07085
160488002605	Phosphotransacetylase [Energy production and conversion]; Region: Pta; COG0280
160488002606	Protein of unknown function (DUF3565); Region: DUF3565; pfam12088
160488002607	FKBP-type peptidyl-prolyl cis-trans isomerases 2 [Posttranslational modification, protein turnover, chaperones]; Region: SlpA; COG1047
160488002608	FKBP-type peptidyl-prolyl cis-trans isomerase; Region: FKBP_C; pfam00254
160488002609	Glutathione (GSH) peroxidase family; tetrameric selenoenzymes that catalyze the reduction of a variety of hydroperoxides including lipid peroxidases, using GSH as a specific electron donor substrate. GSH peroxidase contains one selenocysteine residue per...; Region: GSH_Peroxidase; cd00340
160488002610	catalytic residues [active]
160488002611	dimer interface [polypeptide binding]; other site
160488002612	Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438
160488002613	This family is most closely related to the GT1 family of glycosyltransferases. Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. The acceptor molecule can...; Region: GT1_like_2; cd03814
160488002614	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488002615	PAS domain; Region: PAS_9; pfam13426
160488002616	putative active site [active]
160488002617	heme pocket [chemical binding]; other site
160488002618	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488002619	PAS domain; Region: PAS_9; pfam13426
160488002620	putative active site [active]
160488002621	heme pocket [chemical binding]; other site
160488002622	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
160488002623	dimer interface [polypeptide binding]; other site
160488002624	putative CheW interface [polypeptide binding]; other site
160488002625	GAD-like domain; Region: GAD-like; pfam08887
160488002626	Domain of unknown function (DUF1851); Region: DUF1851; pfam08906
160488002627	GAD-like domain; Region: GAD-like; pfam08887
160488002628	Domain of unknown function (DUF1851); Region: DUF1851; pfam08906
160488002629	putative sulfate transport protein CysZ; Validated; Region: PRK04949
160488002630	thioredoxin reductase; Provisional; Region: PRK10262
160488002631	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
160488002632	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
160488002633	nicotinate-nucleotide pyrophosphorylase; Provisional; Region: PRK05742
160488002634	Quinolinate phosphoribosyl transferase (QAPRTase or QPRTase), also called nicotinate-nucleotide pyrophosphorylase, is involved in the de novo synthesis of NAD in both prokaryotes and eukaryotes. It catalyses the reaction of quinolinic acid (QA) with...; Region: QPRTase; cd01572
160488002635	dimerization interface [polypeptide binding]; other site
160488002636	active site
160488002637	Protein of unknown function (DUF1631); Region: DUF1631; pfam07793
160488002638	N-acetyl-anhydromuramyl-L-alanine amidase [Cell envelope biogenesis, outer membrane]; Region: ampD; COG3023
160488002639	Peptidoglycan recognition proteins (PGRPs) are pattern recognition receptors that bind, and in certain cases, hydrolyze peptidoglycans (PGNs) of bacterial cell walls. PGRPs have been divided into three classes: short PGRPs (PGRP-S), that are small (20...; Region: PGRP; cd06583
160488002640	amidase catalytic site [active]
160488002641	Zn binding residues [ion binding]; other site
160488002642	substrate binding site [chemical binding]; other site
160488002643	Membrane protein required for beta-lactamase induction [Defense mechanisms]; Region: AmpE; cl17896
160488002644	TatD like proteins;  E.coli TatD is a cytoplasmic protein, shown to have magnesium dependent DNase activity; Region: TatD_DNAse; cd01310
160488002645	active site
160488002646	DNA-binding transcriptional regulator FruR; Provisional; Region: PRK11303
160488002647	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
160488002648	DNA binding site [nucleotide binding]
160488002649	domain linker motif; other site
160488002650	Type 1 periplasmic binding fold superfamily; Region: Periplasmic_Binding_Protein_Type_1; cl10011
160488002651	bifunctional PTS system fructose-specific transporter subunit IIA/HPr protein; Provisional; Region: PRK11109
160488002652	PTS_IIA, PTS system, fructose/mannitol specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This...; Region: PTS_IIA_fru; cd00211
160488002653	active site
160488002654	phosphorylation site [posttranslational modification]
160488002655	Phosphoenolpyruvate-dependent sugar phosphotransferase system, EIIA 2; Region: PTS_EIIA_2; pfam00359
160488002656	Histidine-containing phosphocarrier protein (HPr)-like proteins. HPr is a central component of the bacterial phosphoenolpyruvate sugar phosphotransferase system (PTS). The PTS catalyses the phosphorylation of sugar substrates during their translocation...; Region: PTS-HPr_like; cd00367
160488002657	dimerization domain swap beta strand [polypeptide binding]; other site
160488002658	regulatory protein interface [polypeptide binding]; other site
160488002659	active site
160488002660	regulatory phosphorylation site [posttranslational modification]; other site
160488002661	Phosphoenolpyruvate-protein kinase (PTS system EI component in bacteria) [Carbohydrate transport and metabolism]; Region: PtsA; COG1080
160488002662	PEP-utilising enzyme, N-terminal; Region: PEP-utilisers_N; pfam05524
160488002663	PEP-utilising enzyme, mobile domain; Region: PEP-utilizers; pfam00391
160488002664	PEP-utilising enzyme, TIM barrel domain; Region: PEP-utilizers_C; pfam02896
160488002665	Fructose-1-phosphate kinase and related fructose-6-phosphate kinase (PfkB) [Carbohydrate transport and metabolism]; Region: FruK; COG1105
160488002666	1-phosphofructokinase (FruK), minor 6-phosphofructokinase (pfkB) and related sugar kinases. FruK plays an important role in the predominant pathway for fructose utilisation.This group also contains tagatose-6-phophate kinase, an enzyme of the tagatose...; Region: FruK_PfkB_like; cd01164
160488002667	putative substrate binding site [chemical binding]; other site
160488002668	putative ATP binding site [chemical binding]; other site
160488002669	PTS_IIB_fructose: subunit IIB of enzyme II (EII) of the fructose-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS). In this system, EII (also referred to as FruAB) is a fructose-specific permease made up of two proteins (FruA and...; Region: PTS_IIB_fructose; cd05569
160488002670	active site
160488002671	P-loop; other site
160488002672	phosphorylation site [posttranslational modification]
160488002673	PTS system fructose-specific transporter subunits IIBC; Provisional; Region: PRK10712
160488002674	PTS_IIB_fructose: subunit IIB of enzyme II (EII) of the fructose-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS). In this system, EII (also referred to as FruAB) is a fructose-specific permease made up of two proteins (FruA and...; Region: PTS_IIB_fructose; cd05569
160488002675	active site
160488002676	P-loop; other site
160488002677	phosphorylation site [posttranslational modification]
160488002678	Phosphotransferase system, fructose-specific IIC component [Carbohydrate transport and metabolism]; Region: FruA; cl17425
160488002679	Protein of unknown function (DUF3820); Region: DUF3820; pfam12843
160488002680	Domain of unknown function (DUF2383); Region: DUF2383; cl17556
160488002681	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
160488002682	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488002683	metal binding site [ion binding]; metal-binding site
160488002684	active site
160488002685	I-site; other site
160488002686	outer membrane porin, OprD family; Region: OprD; pfam03573
160488002687	Flagellin N-methylase; Region: FliB; pfam03692
160488002688	Chemotaxis signal transduction protein [Cell motility and secretion / Signal transduction mechanisms]; Region: CheW; COG0835
160488002689	Response regulator receiver domain; Region: Response_reg; pfam00072
160488002690	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488002691	active site
160488002692	phosphorylation site [posttranslational modification]
160488002693	intermolecular recognition site; other site
160488002694	dimerization interface [polypeptide binding]; other site
160488002695	type I secretion membrane fusion protein, HlyD family; Region: type_I_hlyD; TIGR01843
160488002696	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
160488002697	HlyD family secretion protein; Region: HlyD_3; pfam13437
160488002698	type I secretion system ATPase, LssB family; Region: type_I_sec_LssB; TIGR03375
160488002699	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
160488002700	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488002701	Walker A/P-loop; other site
160488002702	ATP binding site [chemical binding]; other site
160488002703	Q-loop/lid; other site
160488002704	ABC transporter signature motif; other site
160488002705	Walker B; other site
160488002706	D-loop; other site
160488002707	H-loop/switch region; other site
160488002708	type I secretion outer membrane protein, TolC family; Region: type_I_sec_TolC; TIGR01844
160488002709	flagellar hook-associated protein FlgK; Validated; Region: flgK; PRK05683
160488002710	anaerobic nitric oxide reductase transcription regulator; Provisional; Region: PRK05022
160488002711	GAF domain; Region: GAF; pfam01590
160488002712	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488002713	Walker A motif; other site
160488002714	ATP binding site [chemical binding]; other site
160488002715	Walker B motif; other site
160488002716	arginine finger; other site
160488002717	Bacterial regulatory protein, Fis family; Region: HTH_8; cl17420
160488002718	bifunctional nitric oxide dioxygenase/dihydropteridine reductase 2; Provisional; Region: PRK13289
160488002719	Globins are heme proteins, which bind and transport oxygen. This family summarizes a diverse set of homologous protein domains, including: (1) tetrameric vertebrate hemoglobins, which are the major protein component of erythrocytes and transport oxygen...; Region: globin; cd01040
160488002720	heme-binding site [chemical binding]; other site
160488002721	FAD_NAD(P)H binding domain of flavohemoglobin. Flavohemoglobins have a globin domain containing a B-type heme fused with a ferredoxin reductase-like FAD/NAD-binding domain. Flavohemoglobins detoxify nitric oxide (NO) via an NO dioxygenase reaction. The...; Region: flavohem_like_fad_nad_binding; cd06184
160488002722	FAD binding pocket [chemical binding]; other site
160488002723	FAD binding motif [chemical binding]; other site
160488002724	phosphate binding motif [ion binding]; other site
160488002725	beta-alpha-beta structure motif; other site
160488002726	NAD binding pocket [chemical binding]; other site
160488002727	Heme binding  pocket [chemical binding]; other site
160488002728	disulfide bond formation protein B; Provisional; Region: PRK02110
160488002729	cytochrome o ubiquinol oxidase subunit II; Provisional; Region: PRK10525
160488002730	Cytochrome C oxidase subunit II, periplasmic domain; Region: COX2; pfam00116
160488002731	COX Aromatic Rich Motif; Region: COX_ARM; pfam06481
160488002732	Heme/copper-type cytochrome/quinol oxidases, subunit 1 [Energy production and conversion]; Region: CyoB; COG0843
160488002733	Ubiquinol oxidase subunit I.  Ubiquinol oxidase, the terminal oxidase in the respiratory chains of aerobic bacteria, is a multi-chain transmembrane protein located in the cell membrane.  It catalyzes the reduction of O2 and simultaneously pumps protons...; Region: Ubiquinol_Oxidase_I; cd01662
160488002734	D-pathway; other site
160488002735	Putative ubiquinol binding site [chemical binding]; other site
160488002736	Low-spin heme (heme b) binding site [chemical binding]; other site
160488002737	Putative water exit pathway; other site
160488002738	Binuclear center (heme o3/CuB) [ion binding]; other site
160488002739	K-pathway; other site
160488002740	Putative proton exit pathway; other site
160488002741	Ubiquinol oxidase subunit III subfamily. Ubiquinol oxidase, the terminal oxidase in the respiratory chains of aerobic bacteria, is a multi-chain transmembrane protein located in the cell membrane.  It catalyzes the reduction of O2 and simultaneously...; Region: Ubiquinol_oxidase_III; cd02863
160488002742	Subunit I/III interface [polypeptide binding]; other site
160488002743	Subunit III/IV interface [polypeptide binding]; other site
160488002744	cytochrome o ubiquinol oxidase subunit IV; Region: CyoD; TIGR02847
160488002745	protoheme IX farnesyltransferase; Provisional; Region: PRK13362
160488002746	UbiA prenyltransferase family; Region: UbiA; pfam01040
160488002747	aminotransferase; Validated; Region: PRK08175
160488002748	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
160488002749	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488002750	homodimer interface [polypeptide binding]; other site
160488002751	catalytic residue [active]
160488002752	Predicted Fe-S-cluster oxidoreductase [General function prediction only]; Region: COG0727
160488002753	Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302
160488002754	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
160488002755	Protein of unknown function (DUF1311); Region: DUF1311; pfam07007
160488002756	tRNA 2-selenouridine synthase; Provisional; Region: PRK11784
160488002757	Member of the Rhodanese Homology Domain superfamily. This CD includes several putative ATP /GTP binding proteins including E. coli YbbB; Region: RHOD_YbbB; cd01520
160488002758	active site residue [active]
160488002759	selenophosphate synthetase; Provisional; Region: PRK00943
160488002760	Selenophosphate synthetase  (SelD) catalyzes the conversion of selenium to selenophosphate which is required by a number of bacterial, archaeal and eukaryotic organisms for synthesis of Secys-tRNA, the precursor of selenocysteine in selenoenzymes. The...; Region: SelD; cd02195
160488002761	dimerization interface [polypeptide binding]; other site
160488002762	putative ATP binding site [chemical binding]; other site
160488002763	phosphate/phosphite/phosphonate ABC transporters, periplasmic binding protein; Region: 3A0109s03R; TIGR01098
160488002764	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488002765	substrate binding pocket [chemical binding]; other site
160488002766	membrane-bound complex binding site; other site
160488002767	hinge residues; other site
160488002768	ABC-type phosphate/phosphonate transport system, ATPase component [Inorganic ion transport and metabolism]; Region: COG3638
160488002769	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488002770	Walker A/P-loop; other site
160488002771	ATP binding site [chemical binding]; other site
160488002772	Q-loop/lid; other site
160488002773	ABC transporter signature motif; other site
160488002774	Walker B; other site
160488002775	D-loop; other site
160488002776	H-loop/switch region; other site
160488002777	ABC-type phosphate/phosphonate transport system, permease component [Inorganic ion transport and metabolism]; Region: COG3639
160488002778	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488002779	dimer interface [polypeptide binding]; other site
160488002780	conserved gate region; other site
160488002781	putative PBP binding loops; other site
160488002782	ABC-ATPase subunit interface; other site
160488002783	phosphonate ABC transporter, permease protein PhnE; Region: PhnE; TIGR01097
160488002784	Bestrophin, RFP-TM, chloride channel; Region: Bestrophin; pfam01062
160488002785	probable addiction module antidote protein; Region: dnstrm_HI1420; TIGR02684
160488002786	Acetyltransferases, including N-acetylases of ribosomal proteins [Translation, ribosomal structure and biogenesis]; Region: RimL; COG1670
160488002787	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
160488002788	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
160488002789	Coenzyme A binding pocket [chemical binding]; other site
160488002790	Trypsin-like peptidase domain; Region: Trypsin_2; pfam13365
160488002791	S-adenosylmethionine:tRNA ribosyltransferase-isomerase; Provisional; Region: queA; PRK00147
160488002792	S-adenosylmethionine:tRNA ribosyltransferase-isomerase; Region: queA; TIGR00113
160488002793	queuine tRNA-ribosyltransferase; Provisional; Region: tgt; PRK00112
160488002794	Queuine/archaeosine tRNA-ribosyltransferase [Translation, ribosomal structure and biogenesis]; Region: Tgt; COG0343
160488002795	preprotein translocase subunit YajC; Validated; Region: yajC; PRK05585
160488002796	SecD export protein N-terminal TM region; Region: SecD-TM1; pfam13721
160488002797	preprotein translocase subunit SecD; Reviewed; Region: secD; PRK05812
160488002798	SecD/SecF GG Motif; Region: Sec_GG; pfam07549
160488002799	protein-export membrane protein, SecD/SecF family; Region: 2A0604s01; TIGR00916
160488002800	preprotein translocase subunit SecF; Reviewed; Region: secF; PRK13022
160488002801	SecD/SecF GG Motif; Region: Sec_GG; pfam07549
160488002802	Protein export membrane protein; Region: SecD_SecF; pfam02355
160488002803	hypothetical protein; Provisional; Region: PRK11280
160488002804	Archaeal fructose-1,6-bisphosphatase and related enzymes of inositol monophosphatase family [Carbohydrate transport and metabolism]; Region: SuhB; COG0483
160488002805	IMPase, inositol monophosphatase and related domains. A family of Mg++ dependent phosphatases, inhibited by lithium, many of which may act on inositol monophosphate substrate. They dephosphorylate inositol phosphate to generate inositol, which may be...; Region: IMPase; cd01639
160488002806	active site
160488002807	dimerization interface [polypeptide binding]; other site
160488002808	tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ; Provisional; Region: PRK15114
160488002809	SpoU rRNA Methylase family; Region: SpoU_methylase; cl17307
160488002810	Serine acetyltransferase, N-terminal; Region: SATase_N; cl05762
160488002811	serine O-acetyltransferase; Region: cysE; TIGR01172
160488002812	Serine acetyltransferase (SAT): SAT catalyzes the CoA-dependent acetylation of the side chain hydroxyl group of L-serine to form O-acetylserine, as the first step of a two-step biosynthetic pathway in bacteria and plants leading to the formation of...; Region: LbH_SAT; cd03354
160488002813	trimer interface [polypeptide binding]; other site
160488002814	active site
160488002815	substrate binding site [chemical binding]; other site
160488002816	CoA binding site [chemical binding]; other site
160488002817	iron-sulfur cluster assembly transcription factor IscR; Region: IscR; TIGR02010
160488002818	Rrf2 family protein; Region: rrf2_super; TIGR00738
160488002819	cysteine desulfurase; Provisional; Region: PRK14012
160488002820	cysteine desulfurase NifS; Region: FeS_nifS; TIGR03402
160488002821	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
160488002822	catalytic residue [active]
160488002823	NifU homolog involved in Fe-S cluster formation [Energy production and conversion]; Region: IscU; COG0822
160488002824	Iron-sulfur cluster scaffold-like proteins; Region: IscU_like; cd06664
160488002825	trimerization site [polypeptide binding]; other site
160488002826	active site
160488002827	iron-sulfur cluster assembly protein IscA; Region: IscA; TIGR02011
160488002828	co-chaperone HscB; Provisional; Region: hscB; PRK00294
160488002829	DnaJ domain or J-domain.  DnaJ/Hsp40 (heat shock protein 40) proteins are highly conserved and play crucial roles in protein translation, folding, unfolding, translocation, and degradation. They act primarily by stimulating the ATPase activity of Hsp70s; Region: DnaJ; cd06257
160488002830	HSP70 interaction site [polypeptide binding]; other site
160488002831	HSCB C-terminal oligomerisation domain; Region: HSCB_C; pfam07743
160488002832	chaperone protein HscA; Provisional; Region: hscA; PRK05183
160488002833	Nucleotide-binding domain of HscA and similar proteins; Region: HscA_like_NBD; cd10236
160488002834	nucleotide binding site [chemical binding]; other site
160488002835	putative NEF/HSP70 interaction site [polypeptide binding]; other site
160488002836	SBD interface [polypeptide binding]; other site
160488002837	Ferredoxin [Energy production and conversion]; Region: Fdx; COG0633
160488002838	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
160488002839	catalytic loop [active]
160488002840	iron binding site [ion binding]; other site
160488002841	FeS assembly protein IscX; Region: iscX_yfhJ; TIGR03412
160488002842	Nucleoside diphosphate kinase Group I (NDPk_I)-like: NDP kinase domains are present in a large family of structurally and functionally conserved proteins from bacteria to humans that generally catalyze the transfer of gamma-phosphates of a nucleoside...; Region: NDPk_I; cd04413
160488002843	active site
160488002844	multimer interface [polypeptide binding]; other site
160488002845	ribosomal RNA large subunit methyltransferase N; Provisional; Region: PRK11194
160488002846	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
160488002847	FeS/SAM binding site; other site
160488002848	type IV pilus biogenesis/stability protein PilW; Region: type_IV_pilW; TIGR02521
160488002849	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
160488002850	TPR motif; other site
160488002851	binding surface
160488002852	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
160488002853	binding surface
160488002854	TPR motif; other site
160488002855	Predicted transcriptional regulator contains Xre-like HTH domain [Function unknown]; Region: COG1426
160488002856	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
160488002857	non-specific DNA binding site [nucleotide binding]; other site
160488002858	salt bridge; other site
160488002859	sequence-specific DNA binding site [nucleotide binding]; other site
160488002860	Domain of unknown function (DUF4115); Region: DUF4115; pfam13464
160488002861	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase; Reviewed; Region: ispG; PRK00366
160488002862	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase; Validated; Region: PRK00694
160488002863	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase; Validated; Region: PRK00694
160488002864	histidyl-tRNA synthetase; Reviewed; Region: hisS; PRK00037
160488002865	Class II Histidinyl-tRNA synthetase (HisRS)-like catalytic core domain. HisRS is a homodimer. It is responsible for the attachment of histidine to the 3' OH group of ribose of the appropriate tRNA. This domain is primarily responsible for...; Region: HisRS-like_core; cd00773
160488002866	dimer interface [polypeptide binding]; other site
160488002867	motif 1; other site
160488002868	active site
160488002869	motif 2; other site
160488002870	motif 3; other site
160488002871	HisRS Histidyl-anticodon binding domain. HisRS belongs to class II aminoacyl-tRNA synthetases (aaRS). This alignment contains the anticodon binding domain, which is responsible for specificity in tRNA-binding, so that the activated amino acid is...; Region: HisRS_anticodon; cd00859
160488002872	anticodon binding site; other site
160488002873	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2976
160488002874	Uncharacterized protein conserved in bacteria (DUF2133); Region: DUF2133; pfam09976
160488002875	outer membrane assembly lipoprotein YfgL; Region: assembly_YfgL; TIGR03300
160488002876	PQQ-dependent dehydrogenases and related proteins; Region: PQQ_DH_like; cl11493
160488002877	Trp docking motif [polypeptide binding]; other site
160488002878	active site
160488002879	GTP-binding protein Der; Reviewed; Region: PRK00093
160488002880	EngA1 GTPase contains the first domain of EngA; Region: EngA1; cd01894
160488002881	G1 box; other site
160488002882	GTP/Mg2+ binding site [chemical binding]; other site
160488002883	Switch I region; other site
160488002884	G2 box; other site
160488002885	Switch II region; other site
160488002886	G3 box; other site
160488002887	G4 box; other site
160488002888	G5 box; other site
160488002889	EngA2 GTPase contains the second domain of EngA; Region: EngA2; cd01895
160488002890	G1 box; other site
160488002891	GTP/Mg2+ binding site [chemical binding]; other site
160488002892	Switch I region; other site
160488002893	G2 box; other site
160488002894	G3 box; other site
160488002895	Switch II region; other site
160488002896	G4 box; other site
160488002897	G5 box; other site
160488002898	methionine aminotransferase; Validated; Region: PRK09082
160488002899	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
160488002900	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488002901	homodimer interface [polypeptide binding]; other site
160488002902	catalytic residue [active]
160488002903	C-N hydrolase family amidase; Provisional; Region: PRK10438
160488002904	Xanthomonas campestris XC1258 and related proteins, members of the nitrilase superfamily (putative class 13 nitrilases); Region: Xc-1258_like; cd07575
160488002905	putative active site [active]
160488002906	catalytic triad [active]
160488002907	dimer interface [polypeptide binding]; other site
160488002908	multimer interface [polypeptide binding]; other site
160488002909	Uncharacterized iron-regulated membrane protein [Function unknown]; Region: PiuB; COG3182
160488002910	PepSY-associated TM helix; Region: PepSY_TM_1; pfam13172
160488002911	PepSY-associated TM helix; Region: PepSY_TM_2; pfam13703
160488002912	Sulfite reductase, alpha subunit (flavoprotein) [Inorganic ion transport and metabolism]; Region: CysJ; COG0369
160488002913	Flavodoxin; Region: Flavodoxin_1; pfam00258
160488002914	Cytochrome p450- like alpha subunits of E. coli sulfite reductase (SiR) multimerize with beta subunits to catalyze the NADPH dependent reduction of sulfite to sulfide. Beta subunits have an Fe4S4 cluster and a siroheme, while the alpha subunits (cysJ...; Region: SiR_like1; cd06200
160488002915	FAD binding pocket [chemical binding]; other site
160488002916	FAD binding motif [chemical binding]; other site
160488002917	catalytic residues [active]
160488002918	NAD binding pocket [chemical binding]; other site
160488002919	phosphate binding motif [ion binding]; other site
160488002920	beta-alpha-beta structure motif; other site
160488002921	Outer membrane receptor for monomeric catechols [Inorganic ion transport and metabolism]; Region: Fiu; COG4774
160488002922	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
160488002923	N-terminal plug; other site
160488002924	ligand-binding site [chemical binding]; other site
160488002925	Fe(II)-dependent oxygenase superfamily protein; Provisional; Region: PRK05467
160488002926	FOG: TPR repeat, SEL1 subfamily [General function prediction only]; Region: COG0790
160488002927	Sel1 repeat; Region: Sel1; cl02723
160488002928	Sel1-like repeats; Region: SEL1; smart00671
160488002929	Sel1-like repeats; Region: SEL1; smart00671
160488002930	Sel1 repeat; Region: Sel1; cl02723
160488002931	Diaminopimelate decarboxylase [Amino acid transport and metabolism]; Region: LysA; COG0019
160488002932	Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzyme Ornithine Decarboxylase; Region: PLPDE_III_ODC; cd00622
160488002933	dimer interface [polypeptide binding]; other site
160488002934	active site
160488002935	pyridoxal 5'-phosphate (PLP) binding site [chemical binding]; other site
160488002936	catalytic residues [active]
160488002937	substrate binding site [chemical binding]; other site
160488002938	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
160488002939	RNA polymerase sigma factor; Reviewed; Region: PRK12527
160488002940	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
160488002941	DNA binding residues [nucleotide binding]
160488002942	Fe2+-dicitrate sensor, membrane component [Inorganic ion transport and metabolism / Signal transduction mechanisms]; Region: FecR; COG3712
160488002943	FecR protein; Region: FecR; pfam04773
160488002944	Outer membrane receptor for Fe3+-dicitrate [Inorganic ion transport and metabolism]; Region: FecA; COG4772
160488002945	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
160488002946	N-terminal plug; other site
160488002947	ligand-binding site [chemical binding]; other site
160488002948	ABC-type proline/glycine betaine transport systems, ATPase components [Amino acid transport and metabolism]; Region: OpuBA; COG1125
160488002949	ATP-binding cassette domain of the osmoprotectant transporter; Region: ABC_OpuCA_Osmoprotection; cd03295
160488002950	Walker A/P-loop; other site
160488002951	ATP binding site [chemical binding]; other site
160488002952	Q-loop/lid; other site
160488002953	ABC transporter signature motif; other site
160488002954	Walker B; other site
160488002955	D-loop; other site
160488002956	H-loop/switch region; other site
160488002957	The CBS domain, named after human CBS, is a small domain originally identified in cystathionine beta-synthase and is subsequently found in a wide range of different proteins. CBS domains usually occur in tandem repeats. They associate to form a so-called...; Region: CBS_pair; cl15354
160488002958	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488002959	dimer interface [polypeptide binding]; other site
160488002960	conserved gate region; other site
160488002961	ABC-ATPase subunit interface; other site
160488002962	Substrate binding domain of ABC-type glycine betaine transport system; Region: OpuAC; pfam04069
160488002963	ABC-type proline/glycine betaine transport systems, periplasmic components [Amino acid transport and metabolism]; Region: ProX; cl17891
160488002964	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488002965	dimer interface [polypeptide binding]; other site
160488002966	conserved gate region; other site
160488002967	putative PBP binding loops; other site
160488002968	ABC-ATPase subunit interface; other site
160488002969	peptide chain release factor 3; Provisional; Region: prfC; PRK00741
160488002970	Release Factor 3 (RF3) protein involved in the terminal step of translocation in bacteria; Region: RF3; cd04169
160488002971	G1 box; other site
160488002972	putative GEF interaction site [polypeptide binding]; other site
160488002973	GTP/Mg2+ binding site [chemical binding]; other site
160488002974	Switch I region; other site
160488002975	G2 box; other site
160488002976	G3 box; other site
160488002977	Switch II region; other site
160488002978	G4 box; other site
160488002979	G5 box; other site
160488002980	RF3_II: this subfamily represents the domain II of bacterial Release Factor 3 (RF3). Termination of protein synthesis by the ribosome requires two release factor (RF) classes. The class II RF3 is a GTPase that removes class I RFs (RF1 or RF2) from the...; Region: RF3_II; cd03689
160488002981	putrescine transporter subunit: periplasmic-binding component of ABC superfamily; Provisional; Region: PRK10682
160488002982	Bacterial extracellular solute-binding protein; Region: SBP_bac_1; cl17199
160488002983	Predicted enzyme of the cupin superfamily [General function prediction only]; Region: COG3450
160488002984	putative aminophosphonate oxidoreductase; Region: Phn_aa_oxid; TIGR03329
160488002985	Glycine/D-amino acid oxidases (deaminating) [Amino acid transport and metabolism]; Region: DadA; COG0665
160488002986	SnoaL-like domain; Region: SnoaL_2; pfam12680
160488002987	Helix-turn-helix domain; Region: HTH_18; pfam12833
160488002988	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488002989	dipeptide transporter ATP-binding subunit; Provisional; Region: dppF; PRK11308
160488002990	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
160488002991	Walker A/P-loop; other site
160488002992	ATP binding site [chemical binding]; other site
160488002993	Q-loop/lid; other site
160488002994	ABC transporter signature motif; other site
160488002995	Walker B; other site
160488002996	D-loop; other site
160488002997	H-loop/switch region; other site
160488002998	oligopeptide/dipeptide ABC transporter, ATP-binding protein, C-terminal domain; Region: oligo_HPY; TIGR01727
160488002999	dipeptide transporter ATP-binding subunit; Provisional; Region: dppD; PRK11022
160488003000	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
160488003001	Walker A/P-loop; other site
160488003002	ATP binding site [chemical binding]; other site
160488003003	Q-loop/lid; other site
160488003004	ABC transporter signature motif; other site
160488003005	Walker B; other site
160488003006	D-loop; other site
160488003007	H-loop/switch region; other site
160488003008	Oligopeptide/dipeptide transporter, C-terminal region; Region: oligo_HPY; cl07097
160488003009	dipeptide transporter; Provisional; Region: PRK10913
160488003010	N-terminal TM domain of oligopeptide transport permease C; Region: OppC_N; pfam12911
160488003011	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488003012	putative PBP binding loops; other site
160488003013	dimer interface [polypeptide binding]; other site
160488003014	ABC-ATPase subunit interface; other site
160488003015	ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppB; COG0601
160488003016	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488003017	dimer interface [polypeptide binding]; other site
160488003018	conserved gate region; other site
160488003019	putative PBP binding loops; other site
160488003020	ABC-ATPase subunit interface; other site
160488003021	ABC-type dipeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: DdpA; COG0747
160488003022	The substrate-binding component of an ABC-type dipeptide import system contains the type 2 periplasmic binding fold; Region: PBP2_DppA_like; cd08493
160488003023	peptide binding site [polypeptide binding]; other site
160488003024	outer membrane porin, OprD family; Region: OprD; pfam03573
160488003025	ABC-type dipeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: DdpA; COG0747
160488003026	The substrate-binding component of an ABC-type dipeptide import system contains the type 2 periplasmic binding fold; Region: PBP2_DppA_like; cd08493
160488003027	peptide binding site [polypeptide binding]; other site
160488003028	The substrate-binding component of an ABC-type dipeptide import system contains the type 2 periplasmic binding fold; Region: PBP2_DppA_like; cd08493
160488003029	ABC-type dipeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: DdpA; COG0747
160488003030	peptide binding site [polypeptide binding]; other site
160488003031	Protein of unknown function (DUF541); Region: SIMPL; cl01077
160488003032	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
160488003033	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488003034	ATP binding site [chemical binding]; other site
160488003035	G-X-G motif; other site
160488003036	Response regulator consisting of a CheY-like receiver domain and a Fis-type HTH domain [Signal transduction mechanisms / Transcription]; Region: COG4567
160488003037	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488003038	active site
160488003039	phosphorylation site [posttranslational modification]
160488003040	intermolecular recognition site; other site
160488003041	dimerization interface [polypeptide binding]; other site
160488003042	Bacterial regulatory protein, Fis family; Region: HTH_8; pfam02954
160488003043	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
160488003044	Beta-lactamase; Region: Beta-lactamase; pfam00144
160488003045	YceI-like domain; Region: YceI; pfam04264
160488003046	Catalytic domain, repeat 1, of bacterial cardiolipin synthase and similar proteins; Region: PLDc_CLS_1; cd09110
160488003047	PLD-like domain; Region: PLDc_2; pfam13091
160488003048	putative active site [active]
160488003049	catalytic site [active]
160488003050	Catalytic domain, repeat 2, of Escherichia coli cardiolipin synthase ybhO and similar proteins; Region: PLDc_ybhO_like_2; cd09159
160488003051	PLD-like domain; Region: PLDc_2; pfam13091
160488003052	putative active site [active]
160488003053	catalytic site [active]
160488003054	intracellular protease, PfpI family; Region: PfpI; TIGR01382
160488003055	Type 1 glutamine amidotransferase (GATase1)-like domain found in a subgroup of proteins similar to PfpI from Pyrococcus furiosus; Region: GATase1_PfpI_1; cd03169
160488003056	conserved cys residue [active]
160488003057	conserved hypothetical protein, steroid delta-isomerase-related; Region: TIGR02096
160488003058	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
160488003059	Coenzyme A binding pocket [chemical binding]; other site
160488003060	Predicted amidohydrolase [General function prediction only]; Region: COG0388
160488003061	Uncharacterized subgroup of the nitrilase superfamily; some members of this subgroup have an N-terminal RimI domain (class 12 nitrilases); Region: nitrilase_Rim1_like; cd07574
160488003062	putative active site [active]
160488003063	catalytic triad [active]
160488003064	putative dimer interface [polypeptide binding]; other site
160488003065	putative fumarate hydratase; Provisional; Region: PRK15392
160488003066	Fumarate hydratase (Fumerase); Region: Fumerase; pfam05681
160488003067	Fumarase C-terminus; Region: Fumerase_C; pfam05683
160488003068	hypothetical protein; Provisional; Region: PRK05713
160488003069	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
160488003070	catalytic loop [active]
160488003071	iron binding site [ion binding]; other site
160488003072	Iron-sulfur binding ferredoxin reductase (FNR) proteins combine the FAD and NAD(P) binding regions of FNR with an N-terminal Iron-Sulfur binding cluster domain. Ferredoxin-NADP+ (oxido)reductase is an FAD-containing enzyme that catalyzes the reversible...; Region: FNR_N-term_Iron_sulfur_binding; cd06194
160488003073	FAD binding pocket [chemical binding]; other site
160488003074	FAD binding motif [chemical binding]; other site
160488003075	phosphate binding motif [ion binding]; other site
160488003076	beta-alpha-beta structure motif; other site
160488003077	NAD binding pocket [chemical binding]; other site
160488003078	PAP2_like_6 proteins. PAP2 is a super-family of phosphatases and haloperoxidases. This subgroup, which mainly contains bacterial proteins, lacks functional characterization and may act as a membrane-associated lipid phosphatase; Region: PAP2_like_6; cd03396
160488003079	active site
160488003080	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
160488003081	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488003082	active site
160488003083	phosphorylation site [posttranslational modification]
160488003084	intermolecular recognition site; other site
160488003085	dimerization interface [polypeptide binding]; other site
160488003086	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
160488003087	DNA binding site [nucleotide binding]
160488003088	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
160488003089	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cl01054
160488003090	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488003091	dimer interface [polypeptide binding]; other site
160488003092	phosphorylation site [posttranslational modification]
160488003093	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488003094	ATP binding site [chemical binding]; other site
160488003095	Mg2+ binding site [ion binding]; other site
160488003096	G-X-G motif; other site
160488003097	Methyltransferase domain; Region: Methyltransf_23; pfam13489
160488003098	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488003099	S-adenosylmethionine binding site [chemical binding]; other site
160488003100	Lipopolysaccharide kinase (Kdo/WaaP) family; Region: Kdo; cl17488
160488003101	multidrug efflux protein; Reviewed; Region: PRK09579
160488003102	RND family efflux transporter, MFP subunit; Region: RND_mfp; TIGR01730
160488003103	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
160488003104	HlyD family secretion protein; Region: HlyD_3; pfam13437
160488003105	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3490
160488003106	Imelysin; Region: Peptidase_M75; cl09159
160488003107	Predicted thiol oxidoreductase [Energy production and conversion]; Region: COG3488
160488003108	Protein of unknown function (DUF1111); Region: DUF1111; pfam06537
160488003109	Imelysin; Region: Peptidase_M75; cl09159
160488003110	biofilm formation regulator HmsP; Provisional; Region: PRK11829
160488003111	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488003112	metal binding site [ion binding]; metal-binding site
160488003113	active site
160488003114	I-site; other site
160488003115	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
160488003116	superoxide dismutase; Provisional; Region: PRK10543
160488003117	Iron/manganese superoxide dismutases, alpha-hairpin domain; Region: Sod_Fe_N; pfam00081
160488003118	Iron/manganese superoxide dismutases, C-terminal domain; Region: Sod_Fe_C; pfam02777
160488003119	Lysine efflux permease [General function prediction only]; Region: COG1279
160488003120	chromosome replication initiation inhibitor protein; Validated; Region: PRK03635
160488003121	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488003122	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
160488003123	dimerization interface [polypeptide binding]; other site
160488003124	Nucleoside-diphosphate-sugar epimerases [Cell envelope biogenesis, outer membrane / Carbohydrate transport and metabolism]; Region: WcaG; COG0451
160488003125	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
160488003126	NAD(P) binding site [chemical binding]; other site
160488003127	active site
160488003128	SH3 domain protein; Region: SH3_and_anchor; TIGR04211
160488003129	NADH:flavin oxidoreductases, Old Yellow Enzyme family [Energy production and conversion]; Region: NemA; COG1902
160488003130	Old yellow enzyme (OYE)-like FMN binding domain. OYE was the first flavin-dependent enzyme identified, however its true physiological role remains elusive to this day. Each monomer of OYE contains FMN as a non-covalently bound cofactor, uses NADPH as a...; Region: OYE_like_FMN; cd02933
160488003131	FMN binding site [chemical binding]; other site
160488003132	active site
160488003133	substrate binding site [chemical binding]; other site
160488003134	catalytic residue [active]
160488003135	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
160488003136	dimerization interface [polypeptide binding]; other site
160488003137	putative DNA binding site [nucleotide binding]; other site
160488003138	putative Zn2+ binding site [ion binding]; other site
160488003139	Protein of unknown function, DUF479; Region: DUF479; cl01203
160488003140	1-acyl-sn-glycerol-3-phosphate acyltransferase [Lipid metabolism]; Region: PlsC; COG0204
160488003141	Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: AGPAT-like; Region: LPLAT_AGPAT-like; cd07989
160488003142	putative acyl-acceptor binding pocket; other site
160488003143	Acetyltransferase (GNAT) domain; Region: Acetyltransf_5; cl17496
160488003144	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
160488003145	Predicted permeases [General function prediction only]; Region: COG0679
160488003146	aromatic amino acid transporter; Provisional; Region: PRK10238
160488003147	K+-dependent Na+/Ca+ exchanger related-protein; Region: TIGR00367
160488003148	Sodium/calcium exchanger protein; Region: Na_Ca_ex; pfam01699
160488003149	Sodium/calcium exchanger protein; Region: Na_Ca_ex; pfam01699
160488003150	Lipoproteins [Cell envelope biogenesis, outer membrane]; Region: RlpA; COG0797
160488003151	Rare lipoprotein A (RlpA)-like double-psi beta-barrel; Region: DPBB_1; pfam03330
160488003152	aspartyl/glutamyl-tRNA amidotransferase subunit B; Validated; Region: gatB; PRK05477
160488003153	GatB/GatE catalytic domain; Region: GatB_N; pfam02934
160488003154	GatB domain; Region: GatB_Yqey; smart00845
160488003155	Asp-tRNAAsn/Glu-tRNAGln amidotransferase A subunit and related amidases [Translation, ribosomal structure and biogenesis]; Region: GatA; COG0154
160488003156	aspartyl/glutamyl-tRNA amidotransferase subunit A; Reviewed; Region: gatA; PRK00012
160488003157	aspartyl/glutamyl-tRNA amidotransferase subunit C; Reviewed; Region: gatC; PRK00034
160488003158	rod shape-determining protein MreB; Provisional; Region: PRK13927
160488003159	MreB and similar proteins; Region: MreB_like; cd10225
160488003160	nucleotide binding site [chemical binding]; other site
160488003161	Mg binding site [ion binding]; other site
160488003162	putative protofilament interaction site [polypeptide binding]; other site
160488003163	RodZ interaction site [polypeptide binding]; other site
160488003164	rod shape-determining protein MreC; Provisional; Region: PRK13922
160488003165	rod shape-determining protein MreC; Region: MreC; pfam04085
160488003166	rod shape-determining protein MreD; Region: MreD; cl01087
160488003167	Maf-like protein; Region: Maf; pfam02545
160488003168	Nucleotide binding protein Maf. Maf has been implicated in inhibition of septum formation in eukaryotes, bacteria and archaea, but homologs in B.subtilis and S.cerevisiae are nonessential for cell division. Maf has been predicted to be a nucleotide- or...; Region: Maf; cd00555
160488003169	active site
160488003170	dimer interface [polypeptide binding]; other site
160488003171	ribonuclease G; Provisional; Region: PRK11712
160488003172	S1_RNase_E: RNase E and RNase G, S1-like RNA-binding domain. RNase E is an essential endoribonuclease in the processing and degradation of RNA. In addition to its role in mRNA degradation, RNase E has also been implicated in the processing of rRNA, and...; Region: S1_RNase_E; cd04453
160488003173	homodimer interface [polypeptide binding]; other site
160488003174	oligonucleotide binding site [chemical binding]; other site
160488003175	TIGR02099 family protein; Region: TIGR02099
160488003176	AsmA-like C-terminal region; Region: AsmA_2; pfam13502
160488003177	nitrilase; Region: PLN02798
160488003178	Nit1, Nit 2, and related proteins, and the Nit1-like domain of NitFhit (class 10 nitrilases); Region: nit; cd07572
160488003179	putative active site [active]
160488003180	catalytic triad [active]
160488003181	dimer interface [polypeptide binding]; other site
160488003182	protease TldD; Provisional; Region: tldD; PRK10735
160488003183	hypothetical protein; Provisional; Region: PRK05255
160488003184	peptidase PmbA; Provisional; Region: PRK11040
160488003185	fumarate hydratase; Reviewed; Region: fumC; PRK00485
160488003186	Class II fumarases; Region: Fumarase_classII; cd01362
160488003187	active site
160488003188	tetramer interface [polypeptide binding]; other site
160488003189	Protein of unknown function (DUF2753); Region: DUF2753; pfam10952
160488003190	Superoxide dismutase [Inorganic ion transport and metabolism]; Region: SodA; COG0605
160488003191	Iron/manganese superoxide dismutases, alpha-hairpin domain; Region: Sod_Fe_N; pfam00081
160488003192	Iron/manganese superoxide dismutases, C-terminal domain; Region: Sod_Fe_C; pfam02777
160488003193	Predicted divalent heavy-metal cations transporter [Inorganic ion transport and metabolism]; Region: COG0428
160488003194	Histidine-containing phosphocarrier protein (HPr)-like proteins. HPr is a central component of the bacterial phosphoenolpyruvate sugar phosphotransferase system (PTS). The PTS catalyses the phosphorylation of sugar substrates during their translocation...; Region: PTS-HPr_like; cd00367
160488003195	dimerization domain swap beta strand [polypeptide binding]; other site
160488003196	regulatory protein interface [polypeptide binding]; other site
160488003197	active site
160488003198	regulatory phosphorylation site [posttranslational modification]; other site
160488003199	glmZ(sRNA)-inactivating NTPase; Provisional; Region: PRK05416
160488003200	AAA domain; Region: AAA_18; pfam13238
160488003201	PTS_IIA, PTS system, fructose/mannitol specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This...; Region: PTS_IIA_fru; cd00211
160488003202	active site
160488003203	phosphorylation site [posttranslational modification]
160488003204	RaiA ("ribosome-associated inhibitor A", also known as Protein Y (PY), YfiA, and SpotY,  is a stress-response protein that binds the ribosomal subunit interface and arrests translation by interfering with aminoacyl-tRNA binding to the ribosomal...; Region: RaiA; cd00552
160488003205	30S subunit binding site; other site
160488003206	RNA polymerase factor sigma-54; Reviewed; Region: PRK05932
160488003207	Sigma-54 factor, Activator interacting domain (AID); Region: Sigma54_AID; pfam00309
160488003208	Sigma-54 factor, core binding domain; Region: Sigma54_CBD; pfam04963
160488003209	Sigma-54, DNA binding domain; Region: Sigma54_DBD; pfam04552
160488003210	ABC-type (unclassified) transport system, ATPase component [General function prediction only]; Region: YhbG; COG1137
160488003211	ATP-binding cassette component of YhbG transport system; Region: ABC_YhbG; cd03218
160488003212	Walker A/P-loop; other site
160488003213	ATP binding site [chemical binding]; other site
160488003214	Q-loop/lid; other site
160488003215	ABC transporter signature motif; other site
160488003216	Walker B; other site
160488003217	D-loop; other site
160488003218	H-loop/switch region; other site
160488003219	lipopolysaccharide transport periplasmic protein LptA; Region: outer_YhbN_LptA; TIGR03002
160488003220	OstA-like protein; Region: OstA; pfam03968
160488003221	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3117
160488003222	Lipopolysaccharide-assembly, LptC-related; Region: LptC; pfam06835
160488003223	HAD-superfamily hydrolase, subfamily IIIA; Region: HAD-SF-IIIA; TIGR01662
160488003224	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
160488003225	active site
160488003226	motif I; other site
160488003227	motif II; other site
160488003228	D-arabinose 5-phosphate isomerase; Provisional; Region: PRK10892
160488003229	KpsF-like protein. KpsF is an arabinose-5-phosphate isomerase which contains SIS (Sugar ISomerase) domains. SIS domains are found in many phosphosugar isomerases and phosphosugar binding proteins. KpsF catalyzes the reversible reaction of ribulose...; Region: SIS_Kpsf; cd05014
160488003230	putative active site [active]
160488003231	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains associated with KpsF/GutQ domains in the API [A5P (D-arabinose 5-phosphate) isomerase] protein.  These APIs catalyze the conversion of the pentose pathway...; Region: CBS_pair_KpsF_GutQ_assoc; cd04604
160488003232	putative ABC transporter ATP-binding protein YrbF; Provisional; Region: PRK11831
160488003233	ATP-binding cassette transport system involved in resistant to organic solvents; Region: ABC_Org_Solvent_Resistant; cd03261
160488003234	Walker A/P-loop; other site
160488003235	ATP binding site [chemical binding]; other site
160488003236	Q-loop/lid; other site
160488003237	ABC transporter signature motif; other site
160488003238	Walker B; other site
160488003239	D-loop; other site
160488003240	H-loop/switch region; other site
160488003241	ABC-type transport system involved in resistance to organic solvents, permease component [Secondary metabolites biosynthesis, transport, and catabolism]; Region: Ttg2B; COG0767
160488003242	Permease; Region: Permease; cl00510
160488003243	ABC-type transport system involved in resistance to organic solvents, periplasmic component [Secondary metabolites biosynthesis, transport, and catabolism]; Region: Ttg2C; COG1463
160488003244	mce related protein; Region: MCE; pfam02470
160488003245	Toluene tolerance, Ttg2; Region: Tol_Tol_Ttg2; pfam05494
160488003246	Sulphate Transporter and Anti-Sigma factor antagonist) domain of anti-anti-sigma factors, key regulators of anti-sigma factors by phosphorylation; Region: STAS_anti-anti-sigma_factors; cd07043
160488003247	anti sigma factor interaction site; other site
160488003248	regulatory phosphorylation site [posttranslational modification]; other site
160488003249	Predicted transcriptional regulator, BolA superfamily [Transcription]; Region: COG5007
160488003250	UDP-N-acetylglucosamine 1-carboxyvinyltransferase; Region: murA; TIGR01072
160488003251	UDP-N-acetylglucosamine enolpyruvyl transferase catalyzes enolpyruvyl transfer as part of the first step in the biosynthesis of peptidoglycan, a component of the bacterial cell wall. The reaction is phosphoenolpyruvate + UDP-N-acetyl-D-glucosamine =...; Region: UdpNAET; cd01555
160488003252	hinge; other site
160488003253	active site
160488003254	ATP phosphoribosyltransferase [Amino acid transport and metabolism]; Region: HisG; COG0040
160488003255	ATP phosphoribosyltransferase catalytic subunit; Reviewed; Region: hisG; PRK01686
160488003256	Histidinol dehydrogenase [Amino acid transport and metabolism]; Region: HisD; COG0141
160488003257	Histidinol dehydrogenase, HisD, E.C 1.1.1.23. Histidinol dehydrogenase catalyzes the last two steps in the L-histidine biosynthesis pathway, which is conserved in bacteria, archaea, fungi, and plants. These last two steps are (i) the NAD-dependent...; Region: Histidinol_dh; cd06572
160488003258	NAD binding site [chemical binding]; other site
160488003259	dimerization interface [polypeptide binding]; other site
160488003260	product binding site; other site
160488003261	substrate binding site [chemical binding]; other site
160488003262	zinc binding site [ion binding]; other site
160488003263	catalytic residues [active]
160488003264	Histidinol-phosphate/aromatic aminotransferase and cobyric acid decarboxylase [Amino acid transport and metabolism]; Region: HisC; COG0079
160488003265	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
160488003266	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488003267	homodimer interface [polypeptide binding]; other site
160488003268	catalytic residue [active]
160488003269	Uncharacterized conserved protein [Function unknown]; Region: COG3379
160488003270	Type I phosphodiesterase / nucleotide pyrophosphatase; Region: Phosphodiest; pfam01663
160488003271	Transcriptional regulators [Transcription]; Region: FadR; COG2186
160488003272	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488003273	DNA-binding site [nucleotide binding]; DNA binding site
160488003274	FCD domain; Region: FCD; pfam07729
160488003275	cyanate transporter; Region: CynX; TIGR00896
160488003276	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488003277	SnoaL-like domain; Region: SnoaL_2; pfam12680
160488003278	The GIY-YIG domain of uncharacterized protein family UPF0213 related to structure-specific endonuclease SLX1; Region: GIY-YIG_UPF0213; cd10456
160488003279	GIY-YIG motif/motif A; other site
160488003280	putative active site [active]
160488003281	putative metal binding site [ion binding]; other site
160488003282	Nucleoid-associated protein [General function prediction only]; Region: COG3081
160488003283	nucleoid-associated protein NdpA; Validated; Region: PRK00378
160488003284	Integration host factor (IHF) and HU are small heterodimeric members of the DNABII protein family that bind and bend DNA, functioning as architectural factors in many cellular processes including transcription, site-specific recombination, and...; Region: HU_IHF; cd00591
160488003285	IHF - DNA interface [nucleotide binding]; other site
160488003286	IHF dimer interface [polypeptide binding]; other site
160488003287	Protein of unknown function (DUF890); Region: Methyltransf_10; pfam05971
160488003288	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488003289	S-adenosylmethionine binding site [chemical binding]; other site
160488003290	valyl-tRNA synthetase; Reviewed; Region: valS; PRK05729
160488003291	catalytic core domain of valyl-tRNA synthetases; Region: ValRS_core; cd00817
160488003292	HIGH motif; other site
160488003293	Leucyl-tRNA synthetase, Domain 2; Region: tRNA-synt_1_2; pfam13603
160488003294	catalytic core domain of valyl-tRNA synthetases; Region: ValRS_core; cd00817
160488003295	active site
160488003296	KMSKS motif; other site
160488003297	Anticodon-binding domain of valyl tRNA synthetases; Region: Anticodon_Ia_Val; cd07962
160488003298	tRNA binding surface [nucleotide binding]; other site
160488003299	anticodon binding site; other site
160488003300	Valyl tRNA synthetase tRNA binding arm; Region: Val_tRNA-synt_C; pfam10458
160488003301	DNA polymerase III subunit chi; Validated; Region: PRK05728
160488003302	multifunctional aminopeptidase A; Provisional; Region: PRK00913
160488003303	Cytosol aminopeptidase family, N-terminal and catalytic domains.  Family M17 contains zinc- and manganese-dependent exopeptidases ( EC  3.4.11.1), including leucine aminopeptidase. They catalyze removal of amino acids from the N-terminus of a protein and...; Region: Peptidase_M17; cd00433
160488003304	interface (dimer of trimers) [polypeptide binding]; other site
160488003305	Substrate-binding/catalytic site; other site
160488003306	Zn-binding sites [ion binding]; other site
160488003307	Predicted permeases [General function prediction only]; Region: COG0795; cl12074
160488003308	Predicted permease YjgP/YjgQ family; Region: YjgP_YjgQ; pfam03739
160488003309	Predicted permeases [General function prediction only]; Region: COG0795; cl12074
160488003310	Predicted permease YjgP/YjgQ family; Region: YjgP_YjgQ; pfam03739
160488003311	RDD family; Region: RDD; pfam06271
160488003312	Cold-Shock Protein (CSP) contains an S1-like cold-shock domain (CSD) that is found in eukaryotes, prokaryotes, and archaea.  CSP's include the major cold-shock proteins CspA and CspB in bacteria and the eukaryotic gene regulatory factor Y-box...; Region: CSP_CDS; cd04458
160488003313	DNA-binding site [nucleotide binding]; DNA binding site
160488003314	RNA-binding motif; other site
160488003315	glycine cleavage system aminomethyltransferase T; Provisional; Region: gcvT; PRK13579
160488003316	Glycine cleavage T-protein C-terminal barrel domain; Region: GCV_T_C; pfam08669
160488003317	L-serine dehydratase, iron-sulfur-dependent, single chain form; Region: sda_mono; TIGR00720
160488003318	Serine dehydratase beta chain; Region: SDH_beta; pfam03315
160488003319	Serine dehydratase alpha chain; Region: SDH_alpha; pfam03313
160488003320	glycine dehydrogenase; Provisional; Region: PRK05367
160488003321	Glycine cleavage system P-protein, alpha- and beta-subunits. This family consists of Glycine cleavage system P-proteins EC:1.4.4.2 from bacterial, mammalian and plant sources. The P protein is part of the glycine decarboxylase multienzyme complex EC:2.1; Region: GDC-P; cd00613
160488003322	tetramer interface [polypeptide binding]; other site
160488003323	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488003324	catalytic residue [active]
160488003325	Glycine cleavage system P-protein, alpha- and beta-subunits. This family consists of Glycine cleavage system P-proteins EC:1.4.4.2 from bacterial, mammalian and plant sources. The P protein is part of the glycine decarboxylase multienzyme complex EC:2.1; Region: GDC-P; cd00613
160488003326	tetramer interface [polypeptide binding]; other site
160488003327	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488003328	catalytic residue [active]
160488003329	glycine cleavage system protein H; Provisional; Region: PRK13380
160488003330	Glycine cleavage H-protein. Glycine cleavage H-proteins are part of the glycine cleavage system (GCS) found in bacteria, archea and the mitochondria of eukaryotes. GCS is a multienzyme complex consisting of 4 different components (P-, H-, T- and...; Region: GCS_H; cd06848
160488003331	lipoyl attachment site [posttranslational modification]; other site
160488003332	Predicted membrane protein [Function unknown]; Region: COG2259
160488003333	Uncharacterized protein conserved in bacteria (DUF2063); Region: DUF2063; pfam09836
160488003334	hypothetical protein; Provisional; Region: PRK05409
160488003335	Predicted integral membrane protein (DUF2282); Region: DUF2282; pfam10048
160488003336	RNA polymerase sigma factor; Provisional; Region: PRK12536
160488003337	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
160488003338	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
160488003339	DNA binding residues [nucleotide binding]
160488003340	Protein of unknown function (DUF1109); Region: DUF1109; pfam06532
160488003341	sodium--glutamate symport carrier (gltS); Region: gltS; TIGR00210
160488003342	Transcriptional regulator of aromatic amino acids metabolism [Transcription / Amino acid transport and metabolism]; Region: TyrR; COG3283
160488003343	N-terminal ACT domain of the TyrR protein; Region: ACT_TyrR; cd04877
160488003344	putative aromatic amino acid binding site; other site
160488003345	PAS domain; Region: PAS; smart00091
160488003346	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488003347	Walker A motif; other site
160488003348	ATP binding site [chemical binding]; other site
160488003349	Walker B motif; other site
160488003350	arginine finger; other site
160488003351	carbamate kinase-like carbamoyl phosphate synthetase; Reviewed; Region: PRK12454
160488003352	AAK_CK: Carbamate kinase (CK) catalyzes both the ATP-phosphorylation of carbamate and carbamoyl phosphate (CP) utilization with the production of ATP from ADP and CP. Both CK (this CD) and nonhomologous CP synthetase synthesize carbamoyl phosphate, an...; Region: AAK_CK; cd04235
160488003353	putative substrate binding site [chemical binding]; other site
160488003354	nucleotide binding site [chemical binding]; other site
160488003355	nucleotide binding site [chemical binding]; other site
160488003356	homodimer interface [polypeptide binding]; other site
160488003357	ornithine carbamoyltransferase; Validated; Region: PRK02102
160488003358	Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding domain; Region: OTCace_N; pfam02729
160488003359	Aspartate/ornithine carbamoyltransferase, Asp/Orn binding domain; Region: OTCace; pfam00185
160488003360	arginine deiminase; Provisional; Region: PRK01388
160488003361	arginine-ornithine antiporter; Region: arg_ornith_anti; TIGR03810
160488003362	arginine-ornithine antiporter; Region: arg_ornith_anti; TIGR03810
160488003363	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2832
160488003364	Heme oxygenase catalyzes the rate limiting step in the degradation of heme to bilirubin, it is essential for recycling of iron from heme. Heme is used as a substrate and cofactor for its own degradation to biliverdin, iron, and carbon monoxide. This...; Region: HemeO; cd00232
160488003365	heme binding pocket [chemical binding]; other site
160488003366	heme ligand [chemical binding]; other site
160488003367	TonB-dependent hemoglobin/transferrin/lactoferrin receptor family protein; Region: TonB-hemlactrns; TIGR01786
160488003368	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
160488003369	N-terminal plug; other site
160488003370	ligand-binding site [chemical binding]; other site
160488003371	Fe2+-dicitrate sensor, membrane component [Inorganic ion transport and metabolism / Signal transduction mechanisms]; Region: FecR; COG3712
160488003372	FecR protein; Region: FecR; pfam04773
160488003373	RNA polymerase sigma factor, sigma-70 family; Region: sigma70-ECF; TIGR02937
160488003374	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
160488003375	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
160488003376	DNA binding residues [nucleotide binding]
160488003377	Glyceraldehyde-3-phosphate dehydrogenase/erythrose-4-phosphate dehydrogenase [Carbohydrate transport and metabolism]; Region: GapA; COG0057
160488003378	Glyceraldehyde 3-phosphate dehydrogenase, NAD binding domain; Region: Gp_dh_N; smart00846
160488003379	Glyceraldehyde 3-phosphate dehydrogenase, C-terminal domain; Region: Gp_dh_C; pfam02800
160488003380	phosphogluconate dehydratase; Validated; Region: PRK09054
160488003381	6-phosphogluconate dehydratase; Region: edd; TIGR01196
160488003382	glucokinase; Provisional; Region: glk; PRK00292
160488003383	glucokinase, proteobacterial type; Region: glk; TIGR00749
160488003384	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
160488003385	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488003386	active site
160488003387	phosphorylation site [posttranslational modification]
160488003388	intermolecular recognition site; other site
160488003389	dimerization interface [polypeptide binding]; other site
160488003390	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
160488003391	DNA binding site [nucleotide binding]
160488003392	osmolarity sensor protein; Provisional; Region: envZ; PRK09467
160488003393	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488003394	ATP binding site [chemical binding]; other site
160488003395	Mg2+ binding site [ion binding]; other site
160488003396	G-X-G motif; other site
160488003397	N-acylglucosamine 2-epimerase (GlcNAc 2-epimerase); Region: GlcNAc_2-epim; pfam07221
160488003398	putative active cleft [active]
160488003399	ABC-type sugar transport system, periplasmic component [Carbohydrate transport and metabolism]; Region: UgpB; COG1653
160488003400	Bacterial extracellular solute-binding protein; Region: SBP_bac_1; pfam01547
160488003401	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488003402	dimer interface [polypeptide binding]; other site
160488003403	conserved gate region; other site
160488003404	putative PBP binding loops; other site
160488003405	ABC-ATPase subunit interface; other site
160488003406	ABC-type sugar transport system, permease component [Carbohydrate transport and metabolism]; Region: UgpE; COG0395
160488003407	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488003408	dimer interface [polypeptide binding]; other site
160488003409	conserved gate region; other site
160488003410	putative PBP binding loops; other site
160488003411	ABC-ATPase subunit interface; other site
160488003412	glycerol-3-phosphate transporter ATP-binding subunit; Provisional; Region: ugpC; PRK11650
160488003413	The N-terminal ATPase domain of the maltose transporter, MalK; Region: ABC_MalK_N; cd03301
160488003414	Walker A/P-loop; other site
160488003415	ATP binding site [chemical binding]; other site
160488003416	Q-loop/lid; other site
160488003417	ABC transporter signature motif; other site
160488003418	Walker B; other site
160488003419	D-loop; other site
160488003420	H-loop/switch region; other site
160488003421	TOBE domain; Region: TOBE_2; pfam08402
160488003422	Carbohydrate-selective porin [Cell envelope biogenesis, outer membrane]; Region: OprB; COG3659
160488003423	D-hexose-6-phosphate epimerase-like; Region: D-hex-6-P-epi_like; cd09020
160488003424	active site
160488003425	phosphate binding residues; other site
160488003426	catalytic residues [active]
160488003427	DNA-binding transcriptional regulator HexR; Provisional; Region: PRK11302
160488003428	Helix-turn-helix domain, rpiR family; Region: HTH_6; pfam01418
160488003429	RpiR-like protein. RpiR contains a SIS (Sugar ISomerase) domain, which is found in many phosphosugar isomerases and phosphosugar binding proteins. In E. coli, rpiR negatively regulates the expression of rpiB gene. Both rpiB and rpiA are ribose phosphate...; Region: SIS_RpiR; cd05013
160488003430	putative active site [active]
160488003431	glucose-6-phosphate 1-dehydrogenase; Validated; Region: PRK05722
160488003432	Glucose-6-phosphate dehydrogenase, NAD binding domain; Region: G6PD_N; pfam00479
160488003433	Glucose-6-phosphate dehydrogenase, C-terminal domain; Region: G6PD_C; pfam02781
160488003434	6-phosphogluconolactonase/Glucosamine-6-phosphate isomerase/deaminase [Carbohydrate transport and metabolism]; Region: NagB; COG0363
160488003435	6PGL: 6-Phosphogluconolactonase (6PGL) subfamily; 6PGL catalyzes the second step of the oxidative phase of the pentose phosphate pathway, the hydrolyzation of 6-phosphoglucono-1,5-lactone (delta form) to 6-phosphogluconate. 6PGL is thought to guard...; Region: 6PGL; cd01400
160488003436	putative active site [active]
160488003437	keto-hydroxyglutarate-aldolase/keto-deoxy- phosphogluconate aldolase; Provisional; Region: PRK05718
160488003438	KDPG and KHG aldolase; Region: KDPG_aldolase; cd00452
160488003439	active site
160488003440	intersubunit interface [polypeptide binding]; other site
160488003441	catalytic residue [active]
160488003442	2-isopropylmalate synthase; Validated; Region: PRK03739
160488003443	Mycobacterium tuberculosis LeuA3 and related proteins, N-terminal catalytic TIM barrel domain; Region: DRE_TIM_LeuA; cd07942
160488003444	active site
160488003445	catalytic residues [active]
160488003446	metal binding site [ion binding]; metal-binding site
160488003447	LeuA allosteric (dimerisation) domain; Region: LeuA_dimer; smart00917
160488003448	Membrane proteins related to metalloendopeptidases [Cell envelope biogenesis, outer membrane]; Region: NlpD; COG0739
160488003449	Glypican; Region: Glypican; pfam01153
160488003450	Peptidase family M23; Region: Peptidase_M23; pfam01551
160488003451	exodeoxyribonuclease VII large subunit; Reviewed; Region: xseA; PRK00286
160488003452	ExoVII_LU_OBF: A subfamily of OB folds corresponding to the N-terminal OB-fold domain of Escherichia coli exodeoxyribonuclease VII (ExoVII) large subunit. E. coli ExoVII is composed of two non-identical subunits. E. coli ExoVII is a...; Region: ExoVII_LU_OBF; cd04489
160488003453	generic binding surface II; other site
160488003454	generic binding surface I; other site
160488003455	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488003456	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488003457	The C-terminal substrate binding domain of LysR-type transcriptional regulators involved in the catabolism of aromatic compounds and that of other related regulators, contains type 2 periplasmic binding fold; Region: PBP2_LTTR_aromatics_like; cd08414
160488003458	dimerization interface [polypeptide binding]; other site
160488003459	substrate binding pocket [chemical binding]; other site
160488003460	Sulfite exporter TauE/SafE; Region: TauE; pfam01925
160488003461	inosine 5'-monophosphate dehydrogenase; Reviewed; Region: PRK05567
160488003462	TIM barrel proteins share a structurally conserved phosphate binding motif and in general share an eight beta/alpha closed barrel structure. Specific for this family is the conserved phosphate binding site at the edges of strands 7 and 8. The phosphate...; Region: TIM_phosphate_binding; cl17186
160488003463	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains in the inosine 5' monophosphate dehydrogenase (IMPDH) protein.  IMPDH is an essential enzyme that catalyzes the first step unique to GTP synthesis, playing a...; Region: CBS_pair_IMPDH; cd04601
160488003464	IMPDH: The catalytic domain of the inosine monophosphate dehydrogenase. IMPDH catalyzes the NAD-dependent oxidation of inosine 5'-monophosphate (IMP) to xanthosine 5' monophosphate (XMP). It is a rate-limiting step in the de novo synthesis of...; Region: IMPDH; cd00381
160488003465	active site
160488003466	GMP synthase; Reviewed; Region: guaA; PRK00074
160488003467	Type 1 glutamine amidotransferase (GATase1) domain found in GMP synthetase; Region: GATase1_GMP_Synthase; cd01742
160488003468	AMP/PPi binding site [chemical binding]; other site
160488003469	candidate oxyanion hole; other site
160488003470	catalytic triad [active]
160488003471	potential glutamine specificity residues [chemical binding]; other site
160488003472	The C-terminal domain of GMP synthetase. It contains two subdomains; the ATP pyrophosphatase domain which closes to the N-termial and the dimerization domain at C-terminal end. The ATP-PPase is a twisted, five-stranded parallel beta-sheet sandwiched...; Region: GMP_synthase_C; cd01997
160488003473	ATP Binding subdomain [chemical binding]; other site
160488003474	Ligand Binding sites [chemical binding]; other site
160488003475	Dimerization subdomain; other site
160488003476	Sulfatase; Region: Sulfatase; cl17466
160488003477	Putative multicopper oxidases [Secondary metabolites biosynthesis, transport, and catabolism]; Region: SufI; COG2132
160488003478	Multicopper oxidase; Region: Cu-oxidase_3; pfam07732
160488003479	Multicopper oxidase; Region: Cu-oxidase_2; pfam07731
160488003480	Nucleoside deaminases include adenosine, guanine and cytosine deaminases. These enzymes are Zn dependent and catalyze the deamination of nucleosides. The zinc ion in the active site plays a central role in the proposed catalytic mechanism, activating a...; Region: nucleoside_deaminase; cd01285
160488003481	nucleoside/Zn binding site; other site
160488003482	dimer interface [polypeptide binding]; other site
160488003483	catalytic motif [active]
160488003484	membrane-bound lytic transglycosylase F; Provisional; Region: PRK10859
160488003485	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488003486	substrate binding pocket [chemical binding]; other site
160488003487	membrane-bound complex binding site; other site
160488003488	hinge residues; other site
160488003489	Lytic Transglycosylase (LT)  and Goose Egg White Lysozyme (GEWL) domain. Members include the soluble and insoluble membrane-bound LTs in bacteria, the LTs in bacteriophage lambda, as well as, the eukaryotic "goose-type" lysozymes (GEWL).  LTs...; Region: LT_GEWL; cd00254
160488003490	N-acetyl-D-glucosamine binding site [chemical binding]; other site
160488003491	catalytic residue [active]
160488003492	phosphoribosylformylglycinamidine synthase; Provisional; Region: PRK05297
160488003493	PurL subunit of the formylglycinamide ribonucleotide amidotransferase (FGAR-AT), first repeat. FGAR-AT catalyzes the ATP-dependent conversion of formylglycinamide ribonucleotide (FGAR) and glutamine to formylglycinamidine ribonucleotide (FGAM), ADP; Region: PurL_repeat1; cd02203
160488003494	dimerization interface [polypeptide binding]; other site
160488003495	ATP binding site [chemical binding]; other site
160488003496	PurL subunit of the formylglycinamide ribonucleotide amidotransferase (FGAR-AT), second repeat. FGAR-AT catalyzes the ATP-dependent conversion of formylglycinamide ribonucleotide (FGAR) and glutamine to formylglycinamidine ribonucleotide (FGAM), ADP; Region: PurL_repeat2; cd02204
160488003497	dimerization interface [polypeptide binding]; other site
160488003498	ATP binding site [chemical binding]; other site
160488003499	Type 1 glutamine amidotransferase (GATase1)-like domain found in Formylglycinamide ribonucleotide amidotransferase; Region: GATase1_FGAR_AT; cd01740
160488003500	putative active site [active]
160488003501	catalytic triad [active]
160488003502	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3323
160488003503	Sec-independent protein translocase protein (TatC); Region: TatC; cl00521
160488003504	mttA/Hcf106 family; Region: MttA_Hcf106; cl00788
160488003505	mttA/Hcf106 family; Region: MttA_Hcf106; cl00788
160488003506	Type II secretion system (T2SS), protein K; Region: T2SK; pfam03934
160488003507	Predicted phosphatase [General function prediction only]; Region: PhoX; COG3211
160488003508	metallophosphatase superfamily, metallophosphatase domain; Region: MPP_superfamily; cl13995
160488003509	active site
160488003510	metal binding site [ion binding]; metal-binding site
160488003511	Type IV pilus biogenesis; Region: Pilus_PilP; pfam11356
160488003512	type II secretion system protein D; Region: type_II_gspD; TIGR02517
160488003513	Bacterial type II/III secretion system short domain; Region: Secretin_N; pfam03958
160488003514	Bacterial type II/III secretion system short domain; Region: Secretin_N; pfam03958
160488003515	Bacterial type II and III secretion system protein; Region: Secretin; pfam00263
160488003516	type II secretion system protein E; Region: type_II_gspE; TIGR02533
160488003517	PulE/GspE The type II secretory pathway is the main terminal branch of the general secretory pathway (GSP). It is responsible for the export the majority of Gram-negative bacterial exoenzymes and toxins. PulE is a cytoplasmic protein of the GSP, which...; Region: PulE-GspE; cd01129
160488003518	Walker A motif; other site
160488003519	ATP binding site [chemical binding]; other site
160488003520	Walker B motif; other site
160488003521	type II secretion system protein F; Region: GspF; TIGR02120
160488003522	Type II secretion system (T2SS), protein F; Region: T2SF; pfam00482
160488003523	Type II secretion system (T2SS), protein F; Region: T2SF; pfam00482
160488003524	Type IV pilin N-term methylation site GFxxxE; Region: N_methyl_2; pfam13544
160488003525	type II secretion system protein G; Region: typeII_sec_gspG; TIGR01710
160488003526	Type II secretion system (T2SS), protein G; Region: T2SG; pfam08334
160488003527	type II secretion system protein H; Region: typeII_sec_gspH; TIGR01708
160488003528	prepilin-type N-terminal cleavage/methylation domain; Region: IV_pilin_GFxxxE; TIGR02532
160488003529	Type II secretion system (T2SS), protein I; Region: T2SI; pfam02501
160488003530	Type IV pilin N-term methylation site GFxxxE; Region: N_methyl_2; pfam13544
160488003531	Type II secretion system (T2SS), protein J; Region: T2SJ; pfam11612
160488003532	Type II secretion system (T2SS), protein L; Region: T2SL; pfam05134
160488003533	type II secretion system protein L; Region: typeII_sec_gspL; TIGR01709
160488003534	GspL periplasmic domain; Region: GspL_C; pfam12693
160488003535	Type II secretion system (T2SS), protein N; Region: T2SN; pfam01203
160488003536	Siderophore-interacting protein [Inorganic ion transport and metabolism]; Region: ViuB; COG2375
160488003537	Siderophore interacting proteins share the domain structure of the ferredoxin reductase like family. Siderophores are produced in various bacteria (and some plants) to extract iron from hosts. Binding constants are high, so iron can be pilfered from...; Region: siderophore_interacting; cd06193
160488003538	FAD binding pocket [chemical binding]; other site
160488003539	FAD binding motif [chemical binding]; other site
160488003540	phosphate binding motif [ion binding]; other site
160488003541	NAD binding pocket [chemical binding]; other site
160488003542	Predicted transcriptional regulators [Transcription]; Region: COG1695
160488003543	Transcriptional regulator PadR-like family; Region: PadR; pfam03551
160488003544	Membrane carboxypeptidase (penicillin-binding protein) [Cell envelope biogenesis, outer membrane]; Region: MrcB; COG0744
160488003545	Transglycosylase; Region: Transgly; pfam00912
160488003546	Gamma-aminobutyrate permease and related permeases [Amino acid transport and metabolism]; Region: AnsP; COG1113
160488003547	Spore germination protein; Region: Spore_permease; cl17796
160488003548	Glutamate synthase domain 2 [Amino acid transport and metabolism]; Region: GltB; COG0069
160488003549	Glutamate synthase (GltS) FMN-binding domain.  GltS is a complex iron-sulfur flavoprotein that catalyzes the reductive synthesis of L-glutamate from 2-oxoglutarate and L-glutamine via intramolecular channelling of ammonia, a reaction in the plant, yeast...; Region: GltS_FMN; cd02808
160488003550	active site
160488003551	FMN binding site [chemical binding]; other site
160488003552	substrate binding site [chemical binding]; other site
160488003553	3Fe-4S cluster binding site [ion binding]; other site
160488003554	Lhr-like helicases [General function prediction only]; Region: Lhr; COG1201
160488003555	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
160488003556	ATP binding site [chemical binding]; other site
160488003557	putative Mg++ binding site [ion binding]; other site
160488003558	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
160488003559	nucleotide binding region [chemical binding]; other site
160488003560	ATP-binding site [chemical binding]; other site
160488003561	DEAD/H associated; Region: DEAD_assoc; pfam08494
160488003562	Members of the Nudix hydrolase superfamily catalyze the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+, for their activity and contain a highly...; Region: Nudix_Hydrolase_31; cd04690
160488003563	nudix motif; other site
160488003564	DNA-binding transcriptional regulator MetR; Provisional; Region: PRK15421
160488003565	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488003566	The C-terminal substrate binding domain of LysR-type transcriptional regulator metR, which regulates the expression of methionine biosynthetic genes, contains type 2 periplasmic binding fold; Region: PBP2_MetR; cd08441
160488003567	putative dimerization interface [polypeptide binding]; other site
160488003568	3-oxoadipate enol-lactonase; Region: protocat_pcaD; TIGR02427
160488003569	homoserine O-acetyltransferase; Provisional; Region: metX; cl17114
160488003570	GlpM protein; Region: GlpM; pfam06942
160488003571	Response regulator containing CheY-like receiver, AAA-type ATPase, and DNA-binding domains [Signal transduction mechanisms]; Region: AtoC; COG2204
160488003572	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488003573	active site
160488003574	phosphorylation site [posttranslational modification]
160488003575	intermolecular recognition site; other site
160488003576	dimerization interface [polypeptide binding]; other site
160488003577	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488003578	Walker A motif; other site
160488003579	ATP binding site [chemical binding]; other site
160488003580	Walker B motif; other site
160488003581	arginine finger; other site
160488003582	Bacterial regulatory protein, Fis family; Region: HTH_8; pfam02954
160488003583	Signal transduction histidine kinase regulating C4-dicarboxylate transport system [Signal transduction mechanisms]; Region: COG4191
160488003584	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488003585	dimer interface [polypeptide binding]; other site
160488003586	phosphorylation site [posttranslational modification]
160488003587	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488003588	Mg2+ binding site [ion binding]; other site
160488003589	G-X-G motif; other site
160488003590	ABC-type polar amino acid transport system, ATPase component [Amino acid transport and metabolism]; Region: GlnQ; COG1126
160488003591	ATP-binding cassette domain of the histidine and glutamine transporters; Region: ABC_HisP_GlnQ; cd03262
160488003592	Walker A/P-loop; other site
160488003593	ATP binding site [chemical binding]; other site
160488003594	Q-loop/lid; other site
160488003595	ABC transporter signature motif; other site
160488003596	Walker B; other site
160488003597	D-loop; other site
160488003598	H-loop/switch region; other site
160488003599	ABC-type arginine transport system, permease component [Amino acid transport and metabolism]; Region: ArtQ; COG4215
160488003600	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488003601	dimer interface [polypeptide binding]; other site
160488003602	conserved gate region; other site
160488003603	putative PBP binding loops; other site
160488003604	ABC-ATPase subunit interface; other site
160488003605	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488003606	dimer interface [polypeptide binding]; other site
160488003607	conserved gate region; other site
160488003608	putative PBP binding loops; other site
160488003609	ABC-ATPase subunit interface; other site
160488003610	glutamate and aspartate transporter subunit; Provisional; Region: PRK10797
160488003611	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488003612	substrate binding pocket [chemical binding]; other site
160488003613	membrane-bound complex binding site; other site
160488003614	hinge residues; other site
160488003615	Leucine-rich repeats (LRRs), ribonuclease inhibitor (RI)-like subfamily. LRRs are 20-29 residue sequence motifs present in many proteins that participate in protein-protein interactions and have different functions and cellular locations. LRRs correspond...; Region: LRR_RI; cl15309
160488003616	Leucine rich repeat; Region: LRR_8; pfam13855
160488003617	glycerol-3-phosphate dehydrogenase; Reviewed; Region: glpD; PRK12266
160488003618	DNA-binding transcriptional repressor GlpR; Provisional; Region: PRK10906
160488003619	DeoR-like helix-turn-helix domain; Region: HTH_DeoR; pfam08220
160488003620	DeoR C terminal sensor domain; Region: DeoRC; pfam00455
160488003621	glycerol kinase; Provisional; Region: glpK; PRK00047
160488003622	Escherichia coli glycerol kinase-like proteins; belongs to the FGGY family of carbohydrate kinases; Region: FGGY_EcGK_like; cd07786
160488003623	N- and C-terminal domain interface [polypeptide binding]; other site
160488003624	active site
160488003625	MgATP binding site [chemical binding]; other site
160488003626	catalytic site [active]
160488003627	metal binding site [ion binding]; metal-binding site
160488003628	glycerol binding site [chemical binding]; other site
160488003629	homotetramer interface [polypeptide binding]; other site
160488003630	homodimer interface [polypeptide binding]; other site
160488003631	protein IIAGlc interface [polypeptide binding]; other site
160488003632	Major intrinsic protein (MIP) superfamily. Members of the MIP superfamily function as membrane channels that selectively transport water, small neutral molecules, and ions out of and between cells. The channel proteins share a common fold: the N-terminal...; Region: MIP; cd00333
160488003633	amphipathic channel; other site
160488003634	Asn-Pro-Ala signature motifs; other site
160488003635	This CD includes cysteinyl-tRNA(Pro) deacylases from Haemophilus influenzae and Escherichia coli and other related bacterial proteins. These trans-acting, single-domain proteins are homologs of ProX and also the cis-acting prolyl-tRNA synthetase (ProRS)...; Region: YbaK_deacylase; cd00002
160488003636	putative deacylase active site [active]
160488003637	ABC-type spermidine/putrescine transport systems, ATPase components [Amino acid transport and metabolism]; Region: PotA; COG3842
160488003638	ATP-binding cassette domain of the carbohydrate and solute transporters-like; Region: ABC_Carb_Solutes_like; cd03259
160488003639	Walker A/P-loop; other site
160488003640	ATP binding site [chemical binding]; other site
160488003641	Q-loop/lid; other site
160488003642	ABC transporter signature motif; other site
160488003643	Walker B; other site
160488003644	D-loop; other site
160488003645	H-loop/switch region; other site
160488003646	TOBE domain; Region: TOBE_2; pfam08402
160488003647	ornithine carbamoyltransferase; Provisional; Region: PRK00779
160488003648	Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding domain; Region: OTCace_N; pfam02729
160488003649	Aspartate/ornithine carbamoyltransferase, Asp/Orn binding domain; Region: OTCace; pfam00185
160488003650	Anaerobic dehydrogenases, typically selenocysteine-containing [Energy production and conversion]; Region: BisC; COG0243
160488003651	The MopB_1 CD includes a group of related uncharacterized bacterial molybdopterin-binding oxidoreductase-like domains with a putative N-terminal iron-sulfur [4Fe-4S] cluster binding site and molybdopterin cofactor binding site. These members belong to...; Region: MopB_1; cd02762
160488003652	putative [Fe4-S4] binding site [ion binding]; other site
160488003653	putative molybdopterin cofactor binding site [chemical binding]; other site
160488003654	The MopB_CT_1 CD includes a group of related uncharacterized bacterial molybdopterin-binding oxidoreductase-like domains with a putative N-terminal iron-sulfur [4Fe-4S] cluster binding site and molybdopterin cofactor binding site. This CD is of the...; Region: MopB_CT_1; cd02782
160488003655	putative molybdopterin cofactor binding site; other site
160488003656	Glutaredoxin (GRX) family, PKC-interacting cousin of TRX (PICOT)-like subfamily; composed of PICOT and GRX-PICOT-like proteins. The non-PICOT members of this family contain only the GRX-like domain, whereas PICOT contains an N-terminal TRX-like domain...; Region: GRX_PICOT_like; cd03028
160488003657	putative GSH binding site [chemical binding]; other site
160488003658	catalytic residues [active]
160488003659	Bacterioferritin (cytochrome b1) [Inorganic ion transport and metabolism]; Region: Bfr; COG2193
160488003660	Bacterioferritin, ferritin-like diiron-binding domain; Region: Bacterioferritin; cd00907
160488003661	heme binding site [chemical binding]; other site
160488003662	ferroxidase pore; other site
160488003663	ferroxidase diiron center [ion binding]; other site
160488003664	Bacterioferritin-associated ferredoxin [Inorganic ion transport and metabolism]; Region: Bfd; COG2906
160488003665	peroxidase; Provisional; Region: PRK15000
160488003666	Peroxiredoxin (PRX) family, Typical 2-Cys PRX subfamily; PRXs are thiol-specific antioxidant (TSA) proteins, which confer a protective role in cells through its peroxidase activity by reducing hydrogen peroxide, peroxynitrite, and organic hydroperoxides; Region: PRX_Typ2cys; cd03015
160488003667	dimer interface [polypeptide binding]; other site
160488003668	decamer (pentamer of dimers) interface [polypeptide binding]; other site
160488003669	catalytic triad [active]
160488003670	peroxidatic and resolving cysteines [active]
160488003671	DNA polymerase III, epsilon subunit and related 3'-5' exonucleases [DNA replication, recombination, and repair]; Region: DnaQ; COG0847
160488003672	DEDDh 3'-5' exonuclease domain of RNase T; Region: RNaseT; cd06134
160488003673	dimer interface [polypeptide binding]; other site
160488003674	catalytic site [active]
160488003675	putative active site [active]
160488003676	putative substrate binding site [chemical binding]; other site
160488003677	Dihydroorotase (DHOase) catalyzes the reversible interconversion of carbamoyl aspartate to dihydroorotate, a key reaction in the pyrimidine biosynthesis. In contrast to the large polyfunctional CAD proteins of higher organisms, this group of DHOases is...; Region: DHOase; cd01294
160488003678	active site
160488003679	substrate binding pocket [chemical binding]; other site
160488003680	dimer interface [polypeptide binding]; other site
160488003681	Outer membrane protein and related peptidoglycan-associated (lipo)proteins [Cell envelope biogenesis, outer membrane]; Region: OmpA; COG2885
160488003682	Peptidoglycan binding domains similar to the C-terminal domain of outer-membrane protein OmpA; Region: OmpA_C-like; cd07185
160488003683	ligand binding site [chemical binding]; other site
160488003684	argininosuccinate synthase; Provisional; Region: PRK13820
160488003685	Argininosuccinate synthase. The Argininosuccinate synthase is a urea cycle enzyme that catalyzes the penultimate step in arginine biosynthesis: the ATP-dependent ligation of citrulline to aspartate to form argininosuccinate, AMP and pyrophosphate .  In...; Region: Argininosuccinate_Synthase; cd01999
160488003686	ANP binding site [chemical binding]; other site
160488003687	Substrate Binding Site II [chemical binding]; other site
160488003688	Substrate Binding Site I [chemical binding]; other site
160488003689	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
160488003690	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488003691	active site
160488003692	phosphorylation site [posttranslational modification]
160488003693	intermolecular recognition site; other site
160488003694	dimerization interface [polypeptide binding]; other site
160488003695	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
160488003696	DNA binding residues [nucleotide binding]
160488003697	dimerization interface [polypeptide binding]; other site
160488003698	Predicted EndoIII-related endonuclease [DNA replication, recombination, and repair]; Region: Nth; COG0177
160488003699	endonuclease III; includes endonuclease III (DNA-(apurinic or apyrimidinic site) lyase), alkylbase DNA glycosidases (Alka-family) and other DNA glycosidases; Region: ENDO3c; cd00056
160488003700	minor groove reading motif; other site
160488003701	helix-hairpin-helix signature motif; other site
160488003702	substrate binding pocket [chemical binding]; other site
160488003703	active site
160488003704	iron-sulpphur binding domain in DNA-(apurinic or apyrimidinic site) lyase (subfamily of ENDO3); Region: FES; smart00525
160488003705	electron transport complex, RnfABCDGE type, G subunit; Region: rnfG; TIGR01947
160488003706	NQR2, RnfD, RnfE family; Region: NQR2_RnfD_RnfE; cl00779
160488003707	Rnf-Nqr subunit, membrane protein; Region: Rnf-Nqr; cl00597
160488003708	methionyl-tRNA synthetase; Reviewed; Region: metG; PRK00133
160488003709	catalytic core domain of methioninyl-tRNA synthetases; Region: MetRS_core; cd00814
160488003710	active site
160488003711	HIGH motif; other site
160488003712	KMSKS motif; other site
160488003713	Anticodon-binding domain of methionyl tRNA synthetases; Region: Anticodon_Ia_Met; cd07957
160488003714	tRNA binding surface [nucleotide binding]; other site
160488003715	anticodon binding site; other site
160488003716	tRNA-binding-domain-containing Escherichia coli methionyl-tRNA synthetase (EcMetRS)-like proteins.  This family includes EcMetRS and Aquifex aeolicus Trbp111 (AaTrbp111). This domain has general tRNA binding properties.  MetRS aminoacylates methionine...; Region: tRNA_bind_EcMetRS_like; cd02800
160488003717	dimer interface [polypeptide binding]; other site
160488003718	putative tRNA-binding site [nucleotide binding]; other site
160488003719	antiporter inner membrane protein; Provisional; Region: PRK11670
160488003720	Domain of unknown function DUF59; Region: DUF59; pfam01883
160488003721	MRP (Multiple Resistance and pH adaptation) is a homologue of the Fer4_NifH superfamily. Like the other members of the superfamily, MRP contains a ATP-binding domain at the N-termini. It is found in bacteria as a membrane-spanning protein and functions...; Region: MRP-like; cd02037
160488003722	Walker A motif; other site
160488003723	Cold-Shock Protein (CSP) contains an S1-like cold-shock domain (CSD) that is found in eukaryotes, prokaryotes, and archaea.  CSP's include the major cold-shock proteins CspA and CspB in bacteria and the eukaryotic gene regulatory factor Y-box...; Region: CSP_CDS; cd04458
160488003724	DNA-binding site [nucleotide binding]; DNA binding site
160488003725	RNA-binding motif; other site
160488003726	Trimeric dUTP diphosphatases; Region: trimeric_dUTPase; cd07557
160488003727	trimer interface [polypeptide binding]; other site
160488003728	active site
160488003729	Calcineurin-like phosphoesterase; Region: Metallophos; pfam00149
160488003730	Pyrococcus furiosus PF1019 and related proteins, metallophosphatase domain; Region: MPP_PF1019; cd07391
160488003731	putative active site [active]
160488003732	putative metal binding site [ion binding]; other site
160488003733	DEXH box helicase, DNA ligase-associated; Region: DEXH_lig_assoc; TIGR04121
160488003734	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
160488003735	ATP binding site [chemical binding]; other site
160488003736	putative Mg++ binding site [ion binding]; other site
160488003737	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
160488003738	nucleotide binding region [chemical binding]; other site
160488003739	ATP-binding site [chemical binding]; other site
160488003740	DEAD/H associated; Region: DEAD_assoc; pfam08494
160488003741	Peptidase M14 Succinylglutamate desuccinylase (ASTE)/aspartoacylase (ASPA)-like subfamily; subgroup includes Pseudomonas aeruginosa AotO; Region: M14_PaAOTO_like; cd06250
160488003742	Succinylglutamate desuccinylase / Aspartoacylase family; Region: AstE_AspA; pfam04952
160488003743	active site
160488003744	Zn binding site [ion binding]; other site
160488003745	ATP-dependent DNA ligase; Validated; Region: PRK09247
160488003746	Adenylation domain of putative bacterial ATP-dependent DNA ligases; Region: Adenylation_DNA_ligase_Bac1; cd07897
160488003747	active site
160488003748	DNA binding site [nucleotide binding]
160488003749	The Oligonucleotide/oligosaccharide binding (OB)-fold domain of archaeal and bacterial ATP-dependent DNA ligases is a DNA-binding module that is part of the catalytic core unit; Region: OBF_DNA_ligase_Arch_LigB; cd07972
160488003750	DNA binding site [nucleotide binding]
160488003751	putative exonuclease, DNA ligase-associated; Region: Xnuc_lig_assoc; TIGR04122
160488003752	Metallo-beta-lactamase superfamily; Region: Lactamase_B; cl00446
160488003753	Penicillin amidase; Region: Penicil_amidase; pfam01804
160488003754	Penicillin G acylase (PGA) belongs to a family of beta-lactam acylases that includes cephalosporin acylase (CA) and aculeacin A acylase. PGA and CA are crucial for the production of backbone chemicals like 6-aminopenicillanic acid and...; Region: Ntn_PGA_like; cd03747
160488003755	active site
160488003756	Transcriptional regulators containing a DNA-binding HTH domain and an aminotransferase domain (MocR family) and their eukaryotic orthologs [Transcription / Amino acid transport and metabolism]; Region: ARO8; COG1167
160488003757	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488003758	DNA-binding site [nucleotide binding]; DNA binding site
160488003759	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
160488003760	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488003761	homodimer interface [polypeptide binding]; other site
160488003762	catalytic residue [active]
160488003763	serine O-acetyltransferase; Region: cysE; TIGR01172
160488003764	Serine acetyltransferase (SAT): SAT catalyzes the CoA-dependent acetylation of the side chain hydroxyl group of L-serine to form O-acetylserine, as the first step of a two-step biosynthetic pathway in bacteria and plants leading to the formation of...; Region: LbH_SAT; cd03354
160488003765	trimer interface [polypeptide binding]; other site
160488003766	active site
160488003767	substrate binding site [chemical binding]; other site
160488003768	CoA binding site [chemical binding]; other site
160488003769	Predicted metal-dependent hydrolases related to alanyl-tRNA synthetase HxxxH domain [General function prediction only]; Region: COG2872
160488003770	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488003771	Major Facilitator Superfamily; Region: MFS_1; pfam07690
160488003772	putative substrate translocation pore; other site
160488003773	Cysteine synthase [Amino acid transport and metabolism]; Region: CysK; COG0031
160488003774	Tryptophan synthase beta superfamily (fold type II); this family of pyridoxal phosphate (PLP)-dependent enzymes catalyzes beta-replacement and beta-elimination reactions. This CD corresponds to aminocyclopropane-1-carboxylate deaminase (ACCD), tryptophan...; Region: Trp-synth-beta_II; cl00342
160488003775	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
160488003776	catalytic residue [active]
160488003777	SEC-C motif; Region: SEC-C; pfam02810
160488003778	Late embryogenesis abundant protein; Region: LEA_2; pfam03168
160488003779	Site-specific recombinases, DNA invertase Pin homologs [DNA replication, recombination, and repair]; Region: PinR; COG1961
160488003780	Serine Recombinase family, catalytic domain; a DNA binding domain may be present either N- or C-terminal to the catalytic domain. These enzymes perform site-specific recombination of DNA molecules by a concerted, four-strand cleavage and rejoining...; Region: Ser_Recombinase; cd00338
160488003781	catalytic residues [active]
160488003782	catalytic nucleophile [active]
160488003783	Site-specific recombinases, DNA invertase Pin homologs [DNA replication, recombination, and repair]; Region: PinR; COG1961
160488003784	Serine Recombinase family, catalytic domain; a DNA binding domain may be present either N- or C-terminal to the catalytic domain. These enzymes perform site-specific recombination of DNA molecules by a concerted, four-strand cleavage and rejoining...; Region: Ser_Recombinase; cd00338
160488003785	catalytic residues [active]
160488003786	catalytic nucleophile [active]
160488003787	Recombinase; Region: Recombinase; pfam07508
160488003788	Recombinase zinc beta ribbon domain; Region: Zn_ribbon_recom; pfam13408
160488003789	hypothetical protein; Provisional; Region: PRK00183
160488003790	SEC-C motif; Region: SEC-C; pfam02810
160488003791	Outer membrane protein and related peptidoglycan-associated (lipo)proteins [Cell envelope biogenesis, outer membrane]; Region: OmpA; COG2885
160488003792	Peptidoglycan binding domains similar to the C-terminal domain of outer-membrane protein OmpA; Region: OmpA_C-like; cd07185
160488003793	ligand binding site [chemical binding]; other site
160488003794	Outer membrane protein and related peptidoglycan-associated (lipo)proteins [Cell envelope biogenesis, outer membrane]; Region: OmpA; COG2885
160488003795	Peptidoglycan binding domains similar to the C-terminal domain of outer-membrane protein OmpA; Region: OmpA_C-like; cd07185
160488003796	ligand binding site [chemical binding]; other site
160488003797	Protein of unknown function (DUF1145); Region: DUF1145; pfam06611
160488003798	Predicted integral membrane protein [Function unknown]; Region: COG5615
160488003799	ATP-dependent DNA helicase DinG; Provisional; Region: dinG; PRK11747
160488003800	Helicase C-terminal domain; Region: Helicase_C_2; pfam13307
160488003801	Beta-galactosidase; Region: Glyco_hydro_42; pfam02449
160488003802	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
160488003803	Beta-lactamase; Region: Beta-lactamase; pfam00144
160488003804	Outer membrane protein and related peptidoglycan-associated (lipo)proteins [Cell envelope biogenesis, outer membrane]; Region: OmpA; COG2885
160488003805	Peptidoglycan binding domains similar to the C-terminal domain of outer-membrane protein OmpA; Region: OmpA_C-like; cd07185
160488003806	ligand binding site [chemical binding]; other site
160488003807	pyridoxamine 5'-phosphate oxidase; Provisional; Region: PRK05679
160488003808	Pyridoxamine 5'-phosphate oxidase; Region: Pyridox_oxidase; pfam01243
160488003809	Pyridoxine 5'-phosphate oxidase C-terminal dimerisation region; Region: PNPOx_C; pfam10590
160488003810	Outer membrane lipoprotein [Cell envelope biogenesis, outer membrane]; Region: SlyB; COG3133
160488003811	pH-dependent sodium/proton antiporter; Reviewed; Region: nhaA; PRK09560
160488003812	Transposase; Region: DEDD_Tnp_IS110; pfam01548
160488003813	Transposase IS116/IS110/IS902 family; Region: Transposase_20; pfam02371
160488003814	Uncharacterized FAD-dependent dehydrogenases [General function prediction only]; Region: COG2509
160488003815	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
160488003816	Predicted membrane protein [Function unknown]; Region: COG3650
160488003817	ABC-type branched-chain amino acid transport systems, ATPase component [Amino acid transport and metabolism]; Region: LivF; COG0410
160488003818	ATP-binding cassette domain of branched-chain amino acid transporter; Region: ABC_TM1139_LivF_branched; cd03224
160488003819	Walker A/P-loop; other site
160488003820	ATP binding site [chemical binding]; other site
160488003821	Q-loop/lid; other site
160488003822	ABC transporter signature motif; other site
160488003823	Walker B; other site
160488003824	D-loop; other site
160488003825	H-loop/switch region; other site
160488003826	leucine/isoleucine/valine transporter ATP-binding subunit; Provisional; Region: livG; PRK11300
160488003827	ATP-binding cassette component of branched chain amino acids transport system; Region: ABC_Mj1267_LivG_branched; cd03219
160488003828	Walker A/P-loop; other site
160488003829	ATP binding site [chemical binding]; other site
160488003830	Q-loop/lid; other site
160488003831	ABC transporter signature motif; other site
160488003832	Walker B; other site
160488003833	D-loop; other site
160488003834	H-loop/switch region; other site
160488003835	leucine/isoleucine/valine transporter permease subunit; Provisional; Region: livM; PRK11301
160488003836	Domain of unknown function (DUF3382); Region: DUF3382; pfam11862
160488003837	Transmembrane subunit (TM) of Escherichia coli LivM and related proteins. LivM is one of two TMs of the E. coli LIV-1/LS transporter, a Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporter involved in the uptake of...; Region: TM_PBP1_LivM_like; cd06581
160488003838	TM-ABC transporter signature motif; other site
160488003839	Branched-chain amino acid transport system / permease component; Region: BPD_transp_2; pfam02653
160488003840	Transmembrane subunit (TM) of Escherichia coli LivH and related proteins. LivH is one of two TMs of the E. coli LIV-1/LS transporter, a Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporter involved in the uptake of...; Region: TM_PBP1_LivH_like; cd06582
160488003841	TM-ABC transporter signature motif; other site
160488003842	ABC-type branched-chain amino acid transport systems, periplasmic component [Amino acid transport and metabolism]; Region: LivK; COG0683
160488003843	Type I periplasmic ligand-binding domain of ABC (Atpase Binding Cassette)-type active transport systems that are involved in the transport of all three branched chain aliphatic amino acids (leucine, isoleucine and valine); Region: PBP1_ABC_LIVBP_like; cd06342
160488003844	dimerization interface [polypeptide binding]; other site
160488003845	ligand binding site [chemical binding]; other site
160488003846	Protein of unknown function (DUF2288); Region: DUF2288; pfam10052
160488003847	3-hydroxyisobutyrate dehydrogenase and related beta-hydroxyacid dehydrogenases [Lipid metabolism]; Region: MmsB; COG2084
160488003848	6-phosphogluconate dehydrogenase-like protein; Reviewed; Region: PRK09599
160488003849	MHYT domain (predicted integral membrane sensor domain) [Signal transduction mechanisms]; Region: COG3300
160488003850	Bacterial signalling protein N terminal repeat; Region: MHYT; pfam03707
160488003851	Bacterial signalling protein N terminal repeat; Region: MHYT; pfam03707
160488003852	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
160488003853	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488003854	metal binding site [ion binding]; metal-binding site
160488003855	active site
160488003856	I-site; other site
160488003857	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
160488003858	ATP-dependent helicase HepA; Validated; Region: PRK04914
160488003859	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
160488003860	ATP binding site [chemical binding]; other site
160488003861	putative Mg++ binding site [ion binding]; other site
160488003862	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
160488003863	nucleotide binding region [chemical binding]; other site
160488003864	ATP-binding site [chemical binding]; other site
160488003865	Fusaric acid resistance protein family; Region: FUSC; pfam04632
160488003866	Fusaric acid resistance protein-like; Region: FUSC_2; pfam13515
160488003867	Multidrug resistance efflux pump [Defense mechanisms]; Region: EmrA; COG1566
160488003868	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
160488003869	HlyD family secretion protein; Region: HlyD_3; pfam13437
160488003870	Protein of unknown function (DUF2025); Region: DUF2025; pfam09634
160488003871	CHASE4 domain; Region: CHASE4; pfam05228
160488003872	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488003873	PAS domain; Region: PAS_9; pfam13426
160488003874	putative active site [active]
160488003875	heme pocket [chemical binding]; other site
160488003876	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
160488003877	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488003878	metal binding site [ion binding]; metal-binding site
160488003879	active site
160488003880	I-site; other site
160488003881	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
160488003882	diguanylate cyclase AdrA; Provisional; Region: adrA; PRK10245
160488003883	MASE2 domain; Region: MASE2; pfam05230
160488003884	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488003885	metal binding site [ion binding]; metal-binding site
160488003886	active site
160488003887	I-site; other site
160488003888	Formate/nitrite transporter; Region: Form_Nir_trans; pfam01226
160488003889	acetolactate synthase; Reviewed; Region: PRK08322
160488003890	Pyrimidine (PYR) binding domain of POX and related proteins; Region: TPP_PYR_POX_like; cd07035
160488003891	PYR/PP interface [polypeptide binding]; other site
160488003892	dimer interface [polypeptide binding]; other site
160488003893	TPP binding site [chemical binding]; other site
160488003894	Thiamine pyrophosphate enzyme, central domain; Region: TPP_enzyme_M; pfam00205
160488003895	Thiamine pyrophosphate (TPP) family, Acetolactate synthase (ALS) subfamily, TPP-binding module; composed of proteins similar to Klebsiella pneumoniae ALS, a catabolic enzyme required for butanediol fermentation. ALS catalyzes the conversion of 2...; Region: TPP_ALS; cd02010
160488003896	TPP-binding site [chemical binding]; other site
160488003897	dimer interface [polypeptide binding]; other site
160488003898	Type II (periplasmic) bacterial L-asparaginase; Region: L-asparaginase_II; cd08964
160488003899	active site
160488003900	homotetramer interface [polypeptide binding]; other site
160488003901	homodimer interface [polypeptide binding]; other site
160488003902	Uncharacterized protein family (UPF0149); Region: UPF0149; cl01173
160488003903	Glutathione S-transferase [Posttranslational modification, protein turnover, chaperones]; Region: Gst; COG0625
160488003904	GST_N family, unknown subfamily 4; composed of uncharacterized bacterial proteins with similarity to GSTs. GSTs are cytosolic dimeric proteins involved in cellular detoxification by catalyzing the conjugation of glutathione (GSH) with a wide range of...; Region: GST_N_4; cd03056
160488003905	putative C-terminal domain interface [polypeptide binding]; other site
160488003906	putative GSH binding site (G-site) [chemical binding]; other site
160488003907	putative dimer interface [polypeptide binding]; other site
160488003908	C-terminal, alpha helical domain of an unknown subfamily 7 of Glutathione S-transferases; Region: GST_C_7; cd03206
160488003909	putative N-terminal domain interface [polypeptide binding]; other site
160488003910	putative dimer interface [polypeptide binding]; other site
160488003911	putative substrate binding pocket (H-site) [chemical binding]; other site
160488003912	Pyridoxine 5'-phosphate (PNP) oxidase-like proteins; Region: PNPOx_like; cl00381
160488003913	Pyridoxine 5'-phosphate (PNP) oxidase-like proteins; Region: PNPOx_like; cl00381
160488003914	Flavodoxin reductases (ferredoxin-NADPH reductases) family 1 [Energy production and conversion]; Region: Hmp; COG1018
160488003915	FAD_NAD(P)H binding domain of flavohemoglobin. Flavohemoglobins have a globin domain containing a B-type heme fused with a ferredoxin reductase-like FAD/NAD-binding domain. Flavohemoglobins detoxify nitric oxide (NO) via an NO dioxygenase reaction. The...; Region: flavohem_like_fad_nad_binding; cd06184
160488003916	FAD binding pocket [chemical binding]; other site
160488003917	FAD binding motif [chemical binding]; other site
160488003918	phosphate binding motif [ion binding]; other site
160488003919	beta-alpha-beta structure motif; other site
160488003920	NAD binding pocket [chemical binding]; other site
160488003921	Heme binding  pocket [chemical binding]; other site
160488003922	Ferredoxin [Energy production and conversion]; Region: Fdx; COG0633
160488003923	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
160488003924	catalytic loop [active]
160488003925	iron binding site [ion binding]; other site
160488003926	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488003927	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488003928	The C-terminal substrate binding domain of an uncharacterized LysR-type transcriptional regulator CrgA-like, contains the type 2 periplasmic binding fold; Region: PBP2_CrgA_like_2; cd08471
160488003929	putative effector binding pocket; other site
160488003930	putative dimerization interface [polypeptide binding]; other site
160488003931	aldose 1-epimerase, similar to Escherichia coli YphB; Region: Aldose_epim_Ec_YphB; cd09021
160488003932	active site
160488003933	catalytic residues [active]
160488003934	DctM-like transporters; Region: DctM; pfam06808
160488003935	TRAP-type C4-dicarboxylate transport system, large permease component [Carbohydrate transport and metabolism]; Region: DctQ; COG1593
160488003936	TRAP-type C4-dicarboxylate transport system, small permease component [Carbohydrate transport and metabolism]; Region: DctM; COG3090
160488003937	TRAP-type C4-dicarboxylate transport system, periplasmic component [Carbohydrate transport and metabolism]; Region: DctP; COG1638
160488003938	Bacterial extracellular solute-binding protein, family 7; Region: SBP_bac_7; pfam03480
160488003939	SMP-30/Gluconolaconase/LRE-like region; Region: SGL; pfam08450
160488003940	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
160488003941	Nucleoside-diphosphate-sugar epimerases [Cell envelope biogenesis, outer membrane / Carbohydrate transport and metabolism]; Region: WcaG; COG0451
160488003942	extended (e) SDRs; Region: SDR_e; cd08946
160488003943	active site
160488003944	active site
160488003945	substrate binding site [chemical binding]; other site
160488003946	outer membrane porin, OprD family; Region: OprD; pfam03573
160488003947	BRO family, N-terminal domain; Region: Bro-N; cl10591
160488003948	BRO family, N-terminal domain; Region: Bro-N; cl10591
160488003949	Ribonucleotide Reductase, R2/beta subunit, ferritin-like diiron-binding domain; Region: RNRR2; cd01049
160488003950	dimer interface [polypeptide binding]; other site
160488003951	putative radical transfer pathway; other site
160488003952	diiron center [ion binding]; other site
160488003953	tyrosyl radical; other site
160488003954	ribonucleotide-diphosphate reductase subunit alpha; Validated; Region: PRK07207
160488003955	ATP cone domain; Region: ATP-cone; pfam03477
160488003956	ATP cone domain; Region: ATP-cone; pfam03477
160488003957	Class I ribonucleotide reductase; Region: RNR_I; cd01679
160488003958	active site
160488003959	dimer interface [polypeptide binding]; other site
160488003960	catalytic residues [active]
160488003961	effector binding site; other site
160488003962	R2 peptide binding site; other site
160488003963	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
160488003964	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488003965	active site
160488003966	phosphorylation site [posttranslational modification]
160488003967	intermolecular recognition site; other site
160488003968	dimerization interface [polypeptide binding]; other site
160488003969	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
160488003970	DNA binding site [nucleotide binding]
160488003971	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
160488003972	dimerization interface [polypeptide binding]; other site
160488003973	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488003974	dimer interface [polypeptide binding]; other site
160488003975	phosphorylation site [posttranslational modification]
160488003976	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488003977	ATP binding site [chemical binding]; other site
160488003978	Mg2+ binding site [ion binding]; other site
160488003979	G-X-G motif; other site
160488003980	Phosphopantetheinyl transferase component of siderophore synthetase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: EntD; COG2977
160488003981	4'-phosphopantetheinyl transferase superfamily; Region: ACPS; pfam01648
160488003982	Dienelactone hydrolase and related enzymes [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG0412
160488003983	Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326
160488003984	Outer membrane protein beta-barrel domain; Region: OMP_b-brl; pfam13505
160488003985	DNA-binding transcriptional regulator PhoP; Provisional; Region: PRK10816
160488003986	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488003987	active site
160488003988	phosphorylation site [posttranslational modification]
160488003989	intermolecular recognition site; other site
160488003990	dimerization interface [polypeptide binding]; other site
160488003991	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
160488003992	DNA binding site [nucleotide binding]
160488003993	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488003994	dimer interface [polypeptide binding]; other site
160488003995	phosphorylation site [posttranslational modification]
160488003996	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488003997	ATP binding site [chemical binding]; other site
160488003998	Mg2+ binding site [ion binding]; other site
160488003999	G-X-G motif; other site
160488004000	C4-dicarboxylate transporter DctA; Reviewed; Region: PRK01663
160488004001	Na+/H+-dicarboxylate symporters [Energy production and conversion]; Region: GltP; COG1301
160488004002	Escherichia coli YaeB and related proteins; Region: UPF0066; cd09281
160488004003	homodimer interaction site [polypeptide binding]; other site
160488004004	cofactor binding site; other site
160488004005	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4807
160488004006	Protein of unknown function (DUF1456); Region: DUF1456; pfam07308
160488004007	Protein of unknown function (DUF1456); Region: DUF1456; pfam07308
160488004008	16S rRNA uridine-516 pseudouridylate synthase and related pseudouridylate synthases [Translation, ribosomal structure and biogenesis]; Region: RsuA; COG1187
160488004009	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
160488004010	RNA binding surface [nucleotide binding]; other site
160488004011	Pseudouridine synthase, a subgroup of the RsuA family; Region: PSSA_1; cd02555
160488004012	active site
160488004013	Acetyltransferase (GNAT) domain; Region: Acetyltransf_10; pfam13673
160488004014	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
160488004015	Coenzyme A binding pocket [chemical binding]; other site
160488004016	ribosomal protein S12 methylthiotransferase; Provisional; Region: rimO; PRK14862
160488004017	Uncharacterized protein family UPF0004; Region: UPF0004; pfam00919
160488004018	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
160488004019	FeS/SAM binding site; other site
160488004020	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
160488004021	non-specific DNA binding site [nucleotide binding]; other site
160488004022	salt bridge; other site
160488004023	sequence-specific DNA binding site [nucleotide binding]; other site
160488004024	Protein of unknown function (DUF1044); Region: DUF1044; cl01955
160488004025	K+ transporter [Inorganic ion transport and metabolism]; Region: Kup; COG3158
160488004026	Type IV secretory pathway, VirJ component [Intracellular trafficking and secretion]; Region: VirJ; COG3946
160488004027	Bacterial virulence protein (VirJ); Region: VirJ; pfam06057
160488004028	Predicted integral membrane protein [Function unknown]; Region: COG0392
160488004029	Uncharacterized conserved protein [Function unknown]; Region: COG2898
160488004030	Uncharacterized conserved protein (DUF2156); Region: DUF2156; pfam09924
160488004031	DNA Polymerase IV/Kappa; Region: PolY_Pol_IV_kappa; cd03586
160488004032	active site
160488004033	DNA polymerase IV; Validated; Region: PRK02406
160488004034	DNA binding site [nucleotide binding]
160488004035	prolyl-tRNA synthetase; Provisional; Region: PRK09194
160488004036	Prolyl-tRNA synthetase (ProRS) class II core catalytic domain. ProRS is a homodimer. It is responsible for the attachment of proline to the 3' OH group of ribose of the appropriate tRNA. This domain is primarily responsible for ATP-dependent...; Region: ProRS_core_prok; cd00779
160488004037	dimer interface [polypeptide binding]; other site
160488004038	motif 1; other site
160488004039	active site
160488004040	motif 2; other site
160488004041	INS is an amino acid-editing domain inserted (INS) into the bacterial class II prolyl-tRNA synthetase (ProRS) however, this CD is not exclusively bacterial. It is also found at the N-terminus of the eukaryotic/archaea-like ProRS's of yeasts and...; Region: ProRS-INS; cd04334
160488004042	putative deacylase active site [active]
160488004043	Class II tRNA amino-acyl synthetase-like catalytic core domain. Class II amino acyl-tRNA synthetases (aaRS) share a common fold and generally attach an amino acid to the 3' OH of ribose of the appropriate tRNA.   PheRS is an exception in that it...; Region: class_II_aaRS-like_core; cl00268
160488004044	active site
160488004045	motif 3; other site
160488004046	ProRS Prolyl-anticodon binding domain, short version found predominantly in bacteria. ProRS belongs to class II aminoacyl-tRNA synthetases (aaRS). This alignment contains the anticodon binding domain, which is responsible for specificity in tRNA-binding; Region: ProRS_anticodon_short; cd00861
160488004047	anticodon binding site; other site
160488004048	outer membrane porin, OprD family; Region: OprD; pfam03573
160488004049	HIT family: HIT (Histidine triad) proteins, named for a motif related to the sequence HxHxH/Qxx (x, a hydrophobic amino acid), are a superfamily of nucleotide hydrolases and transferases, which act on the alpha-phosphate of ribonucleotides. On the basis...; Region: HIT_like; cl00228
160488004050	nucleotide binding site/active site [active]
160488004051	HIT family signature motif; other site
160488004052	catalytic residue [active]
160488004053	hypothetical protein; Provisional; Region: PRK00295
160488004054	Cold-Shock Protein (CSP) contains an S1-like cold-shock domain (CSD) that is found in eukaryotes, prokaryotes, and archaea.  CSP's include the major cold-shock proteins CspA and CspB in bacteria and the eukaryotic gene regulatory factor Y-box...; Region: CSP_CDS; cd04458
160488004055	DNA-binding site [nucleotide binding]; DNA binding site
160488004056	RNA-binding motif; other site
160488004057	DNA-binding ferritin-like protein (oxidative damage protectant) [Inorganic ion transport and metabolism]; Region: Dps; COG0783
160488004058	DPS protein, ferritin-like diiron-binding domain; Region: DPS; cd01043
160488004059	dimerization interface [polypeptide binding]; other site
160488004060	DPS ferroxidase diiron center [ion binding]; other site
160488004061	ion pore; other site
160488004062	Ribbon-helix-helix domain; Region: RHH_4; pfam13467
160488004063	putative regulatory protein, FmdB family; Region: CxxC_CxxC_SSSS; TIGR02605
160488004064	aspartyl-tRNA synthetase; Validated; Region: aspS; PRK00476
160488004065	EcAspRS_like_N: N-terminal, anticodon recognition domain of the type found in Escherichia coli aspartyl-tRNA synthetase (AspRS), the human mitochondrial (mt) AspRS-2, the discriminating (D) Thermus thermophilus AspRS-1, and the nondiscriminating (ND)...; Region: EcAspRS_like_N; cd04317
160488004066	dimer interface [polypeptide binding]; other site
160488004067	anticodon binding site; other site
160488004068	Asp tRNA synthetase (aspRS) class II core domain. Class II assignment is based upon its structure and the presence of three characteristic sequence motifs. AspRS is a homodimer, which attaches a specific amino acid to the 3' OH group of ribose of...; Region: AspRS_core; cd00777
160488004069	homodimer interface [polypeptide binding]; other site
160488004070	motif 1; other site
160488004071	active site
160488004072	motif 2; other site
160488004073	GAD domain; Region: GAD; pfam02938
160488004074	Class II tRNA amino-acyl synthetase-like catalytic core domain. Class II amino acyl-tRNA synthetases (aaRS) share a common fold and generally attach an amino acid to the 3' OH of ribose of the appropriate tRNA.   PheRS is an exception in that it...; Region: class_II_aaRS-like_core; cl00268
160488004075	active site
160488004076	motif 3; other site
160488004077	hypothetical protein; Validated; Region: PRK00110
160488004078	Holliday junction resolvases (HJRs) are endonucleases that specifically resolve Holliday junction DNA intermediates during homologous recombination. HJR's occur in archaea, bacteria, and in the mitochondria of certain fungi, however this CD...; Region: RuvC_resolvase; cd00529
160488004079	active site
160488004080	putative DNA-binding cleft [nucleotide binding]; other site
160488004081	dimer interface [polypeptide binding]; other site
160488004082	Holliday junction DNA helicase RuvA; Reviewed; Region: ruvA; PRK00116
160488004083	RuvA N terminal domain; Region: RuvA_N; pfam01330
160488004084	Holliday junction DNA helicase RuvB; Reviewed; Region: ruvB; PRK00080
160488004085	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488004086	Walker A motif; other site
160488004087	ATP binding site [chemical binding]; other site
160488004088	Walker B motif; other site
160488004089	arginine finger; other site
160488004090	Holliday junction DNA helicase ruvB C-terminus; Region: RuvB_C; pfam05491
160488004091	4-hydroxybenzoyl-CoA thioesterase (4HBT). Catalyzes the final step in the 4-chlorobenzoate degradation pathway in which 4-chlorobenzoate is converted to 4-hydroxybenzoate in certain soil-dwelling bacteria. 4HBT forms a homotetramer with four active sites; Region: 4HBT; cd00586
160488004092	active site
160488004093	TolQ protein; Region: tolQ; TIGR02796
160488004094	Biopolymer transport protein [Intracellular trafficking and secretion]; Region: ExbD; COG0848
160488004095	TolR protein; Region: tolR; TIGR02801
160488004096	TolA protein; Region: tolA_full; TIGR02794
160488004097	TolA protein; Region: tolA_full; TIGR02794
160488004098	TonB family C-terminal domain; Region: tonB_Cterm; TIGR01352
160488004099	translocation protein TolB; Provisional; Region: tolB; PRK00178
160488004100	TolB amino-terminal domain; Region: TolB_N; pfam04052
160488004101	WD40-like Beta Propeller Repeat; Region: PD40; pfam07676
160488004102	WD40-like Beta Propeller Repeat; Region: PD40; pfam07676
160488004103	WD40-like Beta Propeller Repeat; Region: PD40; pfam07676
160488004104	Outer membrane protein and related peptidoglycan-associated (lipo)proteins [Cell envelope biogenesis, outer membrane]; Region: OmpA; COG2885
160488004105	Peptidoglycan binding domains similar to the C-terminal domain of outer-membrane protein OmpA; Region: OmpA_C-like; cd07185
160488004106	ligand binding site [chemical binding]; other site
160488004107	tol-pal system protein YbgF; Region: tol_pal_ybgF; TIGR02795
160488004108	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cl02429
160488004109	binding surface
160488004110	TPR motif; other site
160488004111	putative 7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE, gammaproteobacterial type; Region: rSAM_QueE_gams; TIGR04349
160488004112	putative 7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE; Region: rSAM_QueE_Ecoli; TIGR04322
160488004113	ExsB is a transcription regulator related protein. It is a subfamily of a Adenosine nucleotide binding superfamily of proteins. This protein family is represented by a single member in nearly every completed large (> 1000 genes) prokaryotic genome. In...; Region: ExsB; cd01995
160488004114	Ligand Binding Site [chemical binding]; other site
160488004115	Cation efflux family; Region: Cation_efflux; cl00316
160488004116	Cache domain; Region: Cache_1; pfam02743
160488004117	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
160488004118	dimerization interface [polypeptide binding]; other site
160488004119	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
160488004120	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
160488004121	dimer interface [polypeptide binding]; other site
160488004122	putative CheW interface [polypeptide binding]; other site
160488004123	Amino acid transporters [Amino acid transport and metabolism]; Region: PotE; COG0531
160488004124	Bacterial protein of unknown function (DUF945); Region: DUF945; pfam06097
160488004125	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG5339
160488004126	quinolinate synthetase; Provisional; Region: PRK09375
160488004127	Putative Zn-dependent protease, contains TPR repeats [General function prediction only]; Region: COG4783
160488004128	Peptidase family M48; Region: Peptidase_M48; cl12018
160488004129	SirA, YedF, and YeeD. Two-layered alpha/beta sandwich domain.  SirA (also known as UvrY,  and YhhP) belongs to a family of bacterial two-component response regulators that controls secondary metabolism and virulence. The other member of this...; Region: SirA_YedF_YeeD; cd00291
160488004130	CPxP  motif; other site
160488004131	Predicted permease, member of the PurR regulon [General function prediction only]; Region: yhhT; COG0628
160488004132	Domain of unknown function DUF20; Region: UPF0118; pfam01594
160488004133	Peroxiredoxin [Posttranslational modification, protein turnover, chaperones]; Region: AhpC; COG0450
160488004134	Peroxiredoxin (PRX) family, Bacterioferritin comigratory protein (BCP) subfamily; composed of thioredoxin-dependent thiol peroxidases, widely expressed in pathogenic bacteria, that protect cells against toxicity from reactive oxygen species by reducing...; Region: PRX_BCP; cd03017
160488004135	catalytic triad [active]
160488004136	Glycine cleavage system regulatory protein [Amino acid transport and metabolism]; Region: GcvR; COG2716
160488004137	ACT domains that comprise the Glycine Cleavage System Transcriptional Repressor (GcvR) protein, and other related domains; Region: ACT_GcvR_1; cd04893
160488004138	ACT domains that comprise the Glycine Cleavage System Transcriptional Repressor (GcvR) protein, and other related domains; Region: ACT_GcvR_2; cd04869
160488004139	dihydrodipicolinate synthase; Region: dapA; TIGR00674
160488004140	Dihydrodipicolinate synthase (DHDPS); Region: DHDPS; cd00950
160488004141	dimer interface [polypeptide binding]; other site
160488004142	active site
160488004143	catalytic residue [active]
160488004144	Uncharacterized lipoprotein [Cell envelope biogenesis, outer membrane]; Region: NlpB; COG3317
160488004145	Metal-dependent hydrolases of the beta-lactamase superfamily I [General function prediction only]; Region: PhnP; COG1235
160488004146	phosphoribosylaminoimidazole-succinocarboxamide synthase; Reviewed; Region: PRK09362
160488004147	bacterial and archaeal 5-aminoimidazole-4-(N-succinylcarboxamide) ribonucleotide (SAICAR) synthase; Region: SAICAR_synt_PurC; cd01415
160488004148	ATP binding site [chemical binding]; other site
160488004149	active site
160488004150	substrate binding site [chemical binding]; other site
160488004151	Predicted transcriptional regulator [Transcription]; Region: COG3636; cl17681
160488004152	Protein of unknown function (DUF3077); Region: DUF3077; pfam11275
160488004153	Bacterial SH3 domain; Region: SH3_3; pfam08239
160488004154	Putative threonine efflux protein [Amino acid transport and metabolism]; Region: RhtB; COG1280
160488004155	Protein of unknown function (DUF4223); Region: DUF4223; pfam13978
160488004156	INTRON02; Group II intron; Group II intron most similar to the Group II intron from Pseudomonas alcaligenes.
160488004157	RT_G2_intron: Reverse transcriptases (RTs) with group II intron origin. RT transcribes DNA using RNA as template. Proteins in this subfamily are found in bacterial and mitochondrial group II introns. Their most probable ancestor was a retrotransposable...; Region: RT_G2_intron; cd01651
160488004158	Reverse transcriptase (RNA-dependent DNA polymerase); Region: RVT_1; pfam00078
160488004159	putative active site [active]
160488004160	putative NTP binding site [chemical binding]; other site
160488004161	putative nucleic acid binding site [nucleotide binding]; other site
160488004162	Group II intron, maturase-specific domain; Region: GIIM; pfam08388
160488004163	malate:quinone oxidoreductase; Validated; Region: PRK05257
160488004164	malate:quinone-oxidoreductase; Region: mal_quin_oxido; TIGR01320
160488004165	INTRON03; Group II intron; Group II intron most similar to the Group II intron from Pseudomonas alcaligenes.
160488004166	RT_G2_intron: Reverse transcriptases (RTs) with group II intron origin. RT transcribes DNA using RNA as template. Proteins in this subfamily are found in bacterial and mitochondrial group II introns. Their most probable ancestor was a retrotransposable...; Region: RT_G2_intron; cd01651
160488004167	Reverse transcriptase (RNA-dependent DNA polymerase); Region: RVT_1; pfam00078
160488004168	putative active site [active]
160488004169	putative NTP binding site [chemical binding]; other site
160488004170	putative nucleic acid binding site [nucleotide binding]; other site
160488004171	Group II intron, maturase-specific domain; Region: GIIM; pfam08388
160488004172	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
160488004173	dimerization interface [polypeptide binding]; other site
160488004174	putative DNA binding site [nucleotide binding]; other site
160488004175	putative Zn2+ binding site [ion binding]; other site
160488004176	NADH:flavin oxidoreductases, Old Yellow Enzyme family [Energy production and conversion]; Region: NemA; COG1902
160488004177	Old yellow enzyme (OYE) YqjM-like FMN binding domain. YqjM is involved in the oxidative stress response of Bacillus subtilis.  Like the other OYE members, each monomer of YqjM contains FMN as a non-covalently bound cofactor and uses NADPH as a reducing...; Region: OYE_YqiM_FMN; cd02932
160488004178	active site
160488004179	FMN binding site [chemical binding]; other site
160488004180	substrate binding site [chemical binding]; other site
160488004181	homotetramer interface [polypeptide binding]; other site
160488004182	catalytic residue [active]
160488004183	D-amino acid dehydrogenase small subunit; Provisional; Region: PRK12409
160488004184	hydroxyglutarate oxidase; Provisional; Region: PRK11728
160488004185	NAD-dependent aldehyde dehydrogenases [Energy production and conversion]; Region: PutA; COG1012
160488004186	Alpha-Ketoglutaric Semialdehyde Dehydrogenase; Region: ALDH_KGSADH; cd07129
160488004187	dimer interface [polypeptide binding]; other site
160488004188	NADP binding site [chemical binding]; other site
160488004189	catalytic residues [active]
160488004190	Dihydrodipicolinate synthase/N-acetylneuraminate lyase [Amino acid transport and metabolism / Cell envelope biogenesis, outer membrane]; Region: DapA; COG0329
160488004191	Dihydrodipicolinate synthase family; Region: DHDPS-like; cd00408
160488004192	inhibitor site; inhibition site
160488004193	active site
160488004194	dimer interface [polypeptide binding]; other site
160488004195	catalytic residue [active]
160488004196	hydroxyproline-2-epimerase; Provisional; Region: PRK13970
160488004197	hydroxyproline-2-epimerase; Provisional; Region: PRK13971
160488004198	Amino acid transporters [Amino acid transport and metabolism]; Region: PotE; COG0531
160488004199	Transposase; Region: DEDD_Tnp_IS110; pfam01548
160488004200	Transposase IS116/IS110/IS902 family; Region: Transposase_20; pfam02371
160488004201	bifunctional glyoxylate/hydroxypyruvate reductase B; Provisional; Region: PRK15409
160488004202	D-glycerate dehydrogenase/hydroxypyruvate reductase (GDH); Region: GDH; cd05301
160488004203	dimerization interface [polypeptide binding]; other site
160488004204	ligand binding site [chemical binding]; other site
160488004205	NADP binding site [chemical binding]; other site
160488004206	catalytic site [active]
160488004207	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488004208	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488004209	The C-terminal substrate binding domain of LysR-type transcriptional regulator CrgA and its related homologs, contains the type 2 periplasmic binding domain; Region: PBP2_CrgA_like; cd08422
160488004210	putative effector binding pocket; other site
160488004211	dimerization interface [polypeptide binding]; other site
160488004212	efflux transporter, outer membrane factor (OMF) lipoprotein, NodT family; Region: outer_NodT; TIGR01845
160488004213	Fusaric acid resistance protein family; Region: FUSC; pfam04632
160488004214	Fusaric acid resistance protein-like; Region: FUSC_2; pfam13515
160488004215	Protein of unknown function (DUF1656); Region: DUF1656; pfam07869
160488004216	Multidrug resistance efflux pump [Defense mechanisms]; Region: EmrA; COG1566
160488004217	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
160488004218	HlyD family secretion protein; Region: HlyD_3; pfam13437
160488004219	Toxin with endonuclease activity YhaV; Region: Toxin_YhaV; pfam11663
160488004220	putative regulator PrlF; Provisional; Region: PRK09974
160488004221	Regulators of stationary/sporulation gene expression [Transcription]; Region: AbrB; COG2002
160488004222	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
160488004223	Ligand Binding Site [chemical binding]; other site
160488004224	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488004225	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488004226	The C-terminal substrate binding domain of an uncharacterized LysR-type transcriptional regulator similar to DntR, which is involved in the catabolism of dinitrotoluene; contains the type 2 periplasmic binding fold; Region: PBP2_DntR_like_1; cd08460
160488004227	putative substrate binding pocket [chemical binding]; other site
160488004228	putative dimerization interface [polypeptide binding]; other site
160488004229	drug resistance transporter, EmrB/QacA subfamily; Region: efflux_EmrB; TIGR00711
160488004230	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488004231	efflux pump membrane protein (multidrug resistance protein A); Region: 8a0101; TIGR00998
160488004232	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
160488004233	HlyD family secretion protein; Region: HlyD_3; pfam13437
160488004234	efflux transporter, outer membrane factor (OMF) lipoprotein, NodT family; Region: outer_NodT; TIGR01845
160488004235	short chain dehydrogenase; Provisional; Region: PRK05693
160488004236	17beta hydroxysteroid dehydrogenase-like, classical (c) SDRs; Region: 17beta-HSD-like_SDR_c; cd05374
160488004237	NADP binding site [chemical binding]; other site
160488004238	active site
160488004239	steroid binding site; other site
160488004240	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase; Region: GMP_PMI; TIGR01479
160488004241	GDP-M1P_Guanylyltransferase catalyzes the formation of GDP-Mannose; Region: GDP-M1P_Guanylyltransferase; cd02509
160488004242	Substrate binding site; other site
160488004243	Mannose-6-phosphate isomerase; Region: MannoseP_isomer; pfam01050
160488004244	Alginate O-acetyl transferase AlgF; Region: AlgF; pfam11182
160488004245	Predicted membrane protein involved in D-alanine export [Cell envelope biogenesis, outer membrane]; Region: DltB; COG1696
160488004246	Alginate Lyase A1-III; enzymatically depolymerizes alginate, a complex copolymer of beta-D-mannuronate and alpha-L-guluronate, by cleaving the beta-(1,4) glycosidic bond; Region: AlgLyase; cd00244
160488004247	active site
160488004248	Right handed beta helix region; Region: Beta_helix; pfam13229
160488004249	parallel beta-helix repeat (two copies); Region: para_beta_helix; TIGR03804
160488004250	FOG: TPR repeat, SEL1 subfamily [General function prediction only]; Region: COG0790
160488004251	Sel1-like repeats; Region: SEL1; smart00671
160488004252	PilZ domain; Region: PilZ; pfam07238
160488004253	HlyD family secretion protein; Region: HlyD_3; pfam13437
160488004254	Glycosyltransferase like family 2; Region: Glyco_tranf_2_3; pfam13641
160488004255	Glycosyl transferase family group 2; Region: Glyco_trans_2_3; pfam13632
160488004256	Predicted UDP-glucose 6-dehydrogenase [Cell envelope biogenesis, outer membrane]; Region: Ugd; COG1004
160488004257	NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus; Region: NAD_Gly3P_dh_N; pfam01210
160488004258	UDP-glucose/GDP-mannose dehydrogenase family, central domain; Region: UDPG_MGDP_dh; pfam00984
160488004259	UDP binding domain; Region: UDPG_MGDP_dh_C; smart00984
160488004260	hypothetical protein; Validated; Region: PRK02101
160488004261	Catalytic NodB homology domain of rhizobial NodB-like proteins; Region: CE4_NodB_like_6s_7s; cd10917
160488004262	NodB motif; other site
160488004263	active site
160488004264	catalytic site [active]
160488004265	metal binding site [ion binding]; metal-binding site
160488004266	NYN ribonuclease and ATPase of PhoH family domains [General    function prediction only]; Region: COG1875
160488004267	PIN domain of bacterial Smg6-like homologs with PhoH-like ATPase domains; Region: PIN_PhoHL-ATPase; cd09883
160488004268	putative active site [active]
160488004269	PhoH-like protein; Region: PhoH; pfam02562
160488004270	MoaC family, prokaryotic and eukaryotic. Members of this family are involved in molybdenum cofactor (Moco) biosynthesis, an essential cofactor of a diverse group of redox enzymes. MoaC, a small hexameric protein, converts, together with MoaA, a guanosine...; Region: MoaC_PE; cd01420
160488004271	trimer interface [polypeptide binding]; other site
160488004272	dimer interface [polypeptide binding]; other site
160488004273	putative active site [active]
160488004274	Ubiquitin domain of MoaD-like proteins; Region: MoaD; cd00754
160488004275	MoaE interaction surface [polypeptide binding]; other site
160488004276	MoeB interaction surface [polypeptide binding]; other site
160488004277	thiocarboxylated glycine; other site
160488004278	MoaE family. Members of this family are involved in biosynthesis of the molybdenum cofactor (Moco), an essential cofactor for a diverse group of redox enzymes. Moco biosynthesis is an evolutionarily conserved pathway present in eubacteria, archaea and...; Region: MoaE; cd00756
160488004279	MoaD interaction [polypeptide binding]; other site
160488004280	active site residues [active]
160488004281	ATP-dependent RNA helicase RhlB; Provisional; Region: PRK04837
160488004282	DEAD-box helicases. A diverse family of proteins involved in ATP-dependent RNA unwinding, needed in a variety of cellular processes including splicing, ribosome biogenesis and RNA degradation. The name derives from the sequence of the Walker  B motif; Region: DEADc; cd00268
160488004283	ATP binding site [chemical binding]; other site
160488004284	Mg++ binding site [ion binding]; other site
160488004285	motif III; other site
160488004286	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
160488004287	nucleotide binding region [chemical binding]; other site
160488004288	ATP-binding site [chemical binding]; other site
160488004289	Phospholipase/Carboxylesterase; Region: Abhydrolase_2; pfam02230
160488004290	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488004291	Bacterial periplasmic substrate-binding proteins; Region: PBPb; smart00062
160488004292	substrate binding pocket [chemical binding]; other site
160488004293	membrane-bound complex binding site; other site
160488004294	hinge residues; other site
160488004295	ABC-type amino acid transport system, permease component [Amino acid transport and metabolism]; Region: BatB; COG4597
160488004296	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488004297	conserved gate region; other site
160488004298	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488004299	dimer interface [polypeptide binding]; other site
160488004300	ABC-ATPase subunit interface; other site
160488004301	putative PBP binding loops; other site
160488004302	ABC-type arginine transport system, permease component [Amino acid transport and metabolism]; Region: ArtQ; COG4215
160488004303	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488004304	dimer interface [polypeptide binding]; other site
160488004305	conserved gate region; other site
160488004306	putative PBP binding loops; other site
160488004307	ABC-ATPase subunit interface; other site
160488004308	ABC-type polar amino acid transport system, ATPase component [Amino acid transport and metabolism]; Region: GlnQ; COG1126
160488004309	ATP-binding cassette domain of the histidine and glutamine transporters; Region: ABC_HisP_GlnQ; cd03262
160488004310	Walker A/P-loop; other site
160488004311	ATP binding site [chemical binding]; other site
160488004312	Q-loop/lid; other site
160488004313	ABC transporter signature motif; other site
160488004314	Walker B; other site
160488004315	D-loop; other site
160488004316	H-loop/switch region; other site
160488004317	serine endoprotease; Provisional; Region: PRK10898
160488004318	Trypsin-like peptidase domain; Region: Trypsin_2; pfam13365
160488004319	PDZ domain of tryspin-like serine proteases, such as DegP/HtrA, which are oligomeric proteins involved in heat-shock response, chaperone function, and apoptosis. May be responsible for substrate recognition and/or binding, as most PDZ domains bind...; Region: PDZ_serine_protease; cd00987
160488004320	protein binding site [polypeptide binding]; other site
160488004321	Uncharacterized conserved protein [Function unknown]; Region: COG0327
160488004322	NIF3 (NGG1p interacting factor 3); Region: NIF3; cl15371
160488004323	sulfate adenylyltransferase, small subunit; Region: CysD; TIGR02039
160488004324	This domain is found in phosphoadenosine phosphosulphate (PAPS) reductase enzymes or PAPS sulphotransferase. PAPS reductase is part of the adenine nucleotide alpha hydrolases superfamily also including N type ATP PPases and ATP sulphurylases. A highly...; Region: PAPS_reductase; cd01713
160488004325	Active Sites [active]
160488004326	bifunctional sulfate adenylyltransferase subunit 1/adenylylsulfate kinase protein; Provisional; Region: PRK05506
160488004327	CysN, together with protein CysD, forms the ATP sulfurylase (ATPS) complex; Region: CysN_ATPS; cd04166
160488004328	CysD dimerization site [polypeptide binding]; other site
160488004329	G1 box; other site
160488004330	putative GEF interaction site [polypeptide binding]; other site
160488004331	GTP/Mg2+ binding site [chemical binding]; other site
160488004332	Switch I region; other site
160488004333	G2 box; other site
160488004334	G3 box; other site
160488004335	Switch II region; other site
160488004336	G4 box; other site
160488004337	G5 box; other site
160488004338	CysN_NodQ_II: This subfamily represents the domain II of the large subunit of ATP sulfurylase (ATPS): CysN or the N-terminal portion of NodQ, found mainly in proteobacteria and homologous to the domain II of EF-Tu. Escherichia coli ATPS consists of CysN...; Region: CysN_NodQ_II; cd03695
160488004339	TCysN_NoDQ_II: This subfamily represents the domain II of the large subunit of ATP sulfurylase (ATPS): CysN or the N-terminal portion of NodQ, found mainly in proteobacteria and homologous to the domain II of EF-Tu. Escherichia coli ATPS consists of CysN...; Region: CysN_NoDQ_III; cd04095
160488004340	Adenosine 5'-phosphosulfate kinase (APSK) catalyzes the phosphorylation of adenosine 5'-phosphosulfate to form 3'-phosphoadenosine 5'-phosphosulfate (PAPS). The end-product PAPS is a biologically "activated" sulfate form...; Region: APSK; cd02027
160488004341	ligand-binding site [chemical binding]; other site
160488004342	Colicin immunity protein / pyocin immunity protein; Region: Colicin_Pyocin; pfam01320
160488004343	PYOCIN02; bacteriocin; Pyocin S-like; Region consisting of two ORFs having similarity to S1 and S2-type pyocins from Pseudomonas aeruginosa.
160488004344	S-type Pyocin; Region: Pyocin_S; pfam06958
160488004345	HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085
160488004346	active site
160488004347	Transcriptional regulators [Transcription]; Region: Lrp; COG1522
160488004348	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
160488004349	putative DNA binding site [nucleotide binding]; other site
160488004350	putative Zn2+ binding site [ion binding]; other site
160488004351	AsnC family; Region: AsnC_trans_reg; pfam01037
160488004352	methionine gamma-lyase; Provisional; Region: PRK07503
160488004353	CGS_like: Cystathionine gamma-synthase is a PLP dependent enzyme and catalyzes the committed step of methionine biosynthesis. This pathway is unique to microorganisms and plants, rendering the enzyme an attractive target for the development of...; Region: CGS_like; cd00614
160488004354	homodimer interface [polypeptide binding]; other site
160488004355	substrate-cofactor binding pocket; other site
160488004356	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488004357	catalytic residue [active]
160488004358	Protein of unknown function (DUF1043); Region: DUF1043; cl11473
160488004359	Alpha/beta hydrolase family; Region: Abhydrolase_5; pfam12695
160488004360	tryptophanyl-tRNA synthetase; Reviewed; Region: PRK12284
160488004361	catalytic core domain of tryptophanyl-tRNA synthetase; Region: TrpRS_core; cd00806
160488004362	active site
160488004363	HIGH motif; other site
160488004364	dimer interface [polypeptide binding]; other site
160488004365	KMSKS motif; other site
160488004366	Predicted ATPase [General function prediction only]; Region: COG1485
160488004367	AraC transcriptional regulators having a Type 1 glutamine amidotransferase (GATase1)-like domain; Region: GATase1_AraC_2; cd03138
160488004368	conserved cys residue [active]
160488004369	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
160488004370	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488004371	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660
160488004372	Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248
160488004373	active site
160488004374	catalytic tetrad [active]
160488004375	Ribosomal protein L13.  Protein L13, a large ribosomal subunit protein, is one of five proteins required for an early folding intermediate of 23S rRNA in the assembly of the large subunit. L13 is situated on the bottom of the large subunit, near the...; Region: Ribosomal_L13; cd00392
160488004376	23S rRNA interface [nucleotide binding]; other site
160488004377	L3 interface [polypeptide binding]; other site
160488004378	30S ribosomal protein S9; Reviewed; Region: rpsI; PRK00132
160488004379	ubiquinol-cytochrome c reductase, iron-sulfur subunit; Region: Rieske_proteo; TIGR01416
160488004380	Iron-sulfur protein (ISP) component of the bc(1) complex family, Rieske domain; The Rieske domain is a [2Fe-2S] cluster binding domain involved in electron transfer. The bc(1) complex is a multisubunit enzyme found in many different organisms including...; Region: Rieske_cytochrome_bc1; cd03470
160488004381	[2Fe-2S] cluster binding site [ion binding]; other site
160488004382	Cytochrome b subunit of the bc complex [Energy production and conversion]; Region: QcrB; COG1290
160488004383	Cytochrome b (N-terminus)/b6/petB:  Cytochrome b is a subunit of cytochrome bc1, an 11-subunit mitochondrial respiratory enzyme. Cytochrome b spans the mitochondrial membrane with 8 transmembrane helices (A-H) in eukaryotes. In plants and cyanobacteria; Region: Cytochrome_b_N; cd00284
160488004384	Qi binding site; other site
160488004385	intrachain domain interface; other site
160488004386	interchain domain interface [polypeptide binding]; other site
160488004387	heme bH binding site [chemical binding]; other site
160488004388	heme bL binding site [chemical binding]; other site
160488004389	Qo binding site; other site
160488004390	interchain domain interface [polypeptide binding]; other site
160488004391	intrachain domain interface; other site
160488004392	Qi binding site; other site
160488004393	Cytochrome b(C-terminal)/b6/petD; Region: Cytochrom_B_C; pfam00032
160488004394	Qo binding site; other site
160488004395	Cytochrome c1 [Energy production and conversion]; Region: CYT1; COG2857
160488004396	GST_N family, Stringent starvation protein A (SspA) subfamily; SspA is a RNA polymerase (RNAP)-associated protein required for the lytic development of phage P1 and for stationary phase-induced acid tolerance of E. coli. It is implicated in survival...; Region: GST_N_SspA; cd03059
160488004397	stringent starvation protein A; Provisional; Region: sspA; PRK09481
160488004398	C-terminal domain interface [polypeptide binding]; other site
160488004399	putative GSH binding site (G-site) [chemical binding]; other site
160488004400	dimer interface [polypeptide binding]; other site
160488004401	C-terminal, alpha helical domain of Stringent starvation protein A; Region: GST_C_SspA; cd03186
160488004402	dimer interface [polypeptide binding]; other site
160488004403	N-terminal domain interface [polypeptide binding]; other site
160488004404	ClpXP protease specificity-enhancing factor; Provisional; Region: PRK11798
160488004405	Predicted periplasmic or secreted lipoprotein [General function prediction only]; Region: OsmY; COG2823
160488004406	BON domain; Region: BON; pfam04972
160488004407	BON domain; Region: BON; pfam04972
160488004408	Phosphoheptose isomerase is a member of the SIS (Sugar ISomerase) superfamily. Phosphoheptose isomerase catalyzes the isomerization of sedoheptulose 7-phosphate into D-glycero-D-mannoheptose 7-phosphate. This is the first step of the biosynthesis of...; Region: SIS_GmhA; cd05006
160488004409	dimer interface [polypeptide binding]; other site
160488004410	active site
160488004411	hypothetical protein; Reviewed; Region: PRK12497
160488004412	LppC putative lipoprotein; Region: LppC; pfam04348
160488004413	Periplasmic binding component of lipoprotein LppC, an immunodominant antigen; Region: PBP1_YraM_LppC_lipoprotein_like; cd06339
160488004414	putative ligand binding site [chemical binding]; other site
160488004415	Predicted methyltransferases [General function prediction only]; Region: COG0313
160488004416	Ribosomal RNA small subunit methyltransferase I, also known as rRNA (cytidine-2'-O-)-methyltransferase RsmI; Region: RsmI; cd11648
160488004417	putative SAM binding site [chemical binding]; other site
160488004418	putative homodimer interface [polypeptide binding]; other site
160488004419	cell division protein MraZ; Reviewed; Region: PRK00326
160488004420	MraZ protein; Region: MraZ; pfam02381
160488004421	MraZ protein; Region: MraZ; pfam02381
160488004422	16S rRNA m(4)C1402 methyltranserfase; Provisional; Region: PRK00050
160488004423	MraW methylase family; Region: Methyltransf_5; cl17771
160488004424	Cell division protein FtsL; Region: FtsL; pfam04999
160488004425	Cell division protein FtsI/penicillin-binding protein 2 [Cell envelope biogenesis, outer membrane]; Region: FtsI; COG0768
160488004426	Penicillin-binding Protein dimerisation domain; Region: PBP_dimer; pfam03717
160488004427	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; pfam00905
160488004428	UDP-N-acetylmuramoylalanyl-D-glutamate--2, 6-diaminopimelate ligase; Provisional; Region: murE; PRK00139
160488004429	Mur ligase family, catalytic domain; Region: Mur_ligase; pfam01225
160488004430	Mur ligase middle domain; Region: Mur_ligase_M; pfam08245
160488004431	Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875
160488004432	Mur ligase family, catalytic domain; Region: Mur_ligase; pfam01225
160488004433	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase; Region: murF; TIGR01143
160488004434	Mur ligase middle domain; Region: Mur_ligase_M; pfam08245
160488004435	Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875
160488004436	phospho-N-acetylmuramoyl-pentapeptide-transferase; Provisional; Region: mraY; PRK00108
160488004437	Phospho-N-acetylmuramoyl-pentapeptide-transferase (mraY) is an enzyme responsible for the formation of the first lipid intermediate in the synthesis of bacterial cell wall peptidoglycan. It catalyzes the formation of...; Region: GT_MraY; cd06852
160488004438	Mg++ binding site [ion binding]; other site
160488004439	putative catalytic motif [active]
160488004440	putative substrate binding site [chemical binding]; other site
160488004441	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate synthetase; Provisional; Region: murD; PRK03803
160488004442	Mur ligase middle domain; Region: Mur_ligase_M; pfam08245
160488004443	cell division protein FtsW; Region: ftsW; TIGR02614
160488004444	undecaprenyldiphospho-muramoylpentapeptide beta-N- acetylglucosaminyltransferase; Provisional; Region: murG; PRK00726
160488004445	MurG is an N-acetylglucosaminyltransferase, the last enzyme involved in the intracellular phase of peptidoglycan biosynthesis. It transfers N-acetyl-D-glucosamine (GlcNAc) from UDP-GlcNAc to the C4 hydroxyl of a lipid-linked N-acetylmuramoyl pentapeptide...; Region: GT1_MurG; cd03785
160488004446	active site
160488004447	homodimer interface [polypeptide binding]; other site
160488004448	UDP-N-acetylmuramate--L-alanine ligase; Provisional; Region: murC; PRK00421
160488004449	Mur ligase family, catalytic domain; Region: Mur_ligase; pfam01225
160488004450	Mur ligase middle domain; Region: Mur_ligase_M; pfam08245
160488004451	Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875
160488004452	D-alanine--D-alanine ligase; Reviewed; Region: ddl; PRK01372
160488004453	D-ala D-ala ligase N-terminus; Region: Dala_Dala_lig_N; pfam01820
160488004454	ATP-grasp domain; Region: ATP-grasp_4; cl17255
160488004455	Cell division septal protein [Cell envelope biogenesis, outer membrane]; Region: FtsQ; COG1589
160488004456	POTRA domain, FtsQ-type; Region: POTRA_1; pfam08478
160488004457	Cell division protein FtsQ; Region: FtsQ; pfam03799
160488004458	cell division protein FtsA; Region: ftsA; TIGR01174
160488004459	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cd00012
160488004460	nucleotide binding site [chemical binding]; other site
160488004461	Cell division protein FtsA; Region: FtsA; pfam14450
160488004462	cell division protein FtsZ; Validated; Region: PRK09330
160488004463	FtsZ is a GTPase that is similar to the eukaryotic tubulins and is essential for cell division in prokaryotes.  FtsZ is capable of polymerizing in a GTP-driven process into structures similar to those formed by tubulin. FtsZ forms a ring-shaped septum at...; Region: FtsZ_type1; cd02201
160488004464	nucleotide binding site [chemical binding]; other site
160488004465	SulA interaction site; other site
160488004466	UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase; Reviewed; Region: lpxC; PRK13186
160488004467	UDP-3-O-acyl N-acetylglycosamine deacetylase; Region: LpxC; pfam03331
160488004468	Protein of unknown function (DUF721); Region: DUF721; pfam05258
160488004469	preprotein translocase subunit SecA; Reviewed; Region: secA; PRK13103
160488004470	DEAD/DEAH box helicase; Region: DEAD; pfam00270
160488004471	SecA preprotein cross-linking domain; Region: SecA_PP_bind; smart00958
160488004472	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cl17351
160488004473	nucleotide binding region [chemical binding]; other site
160488004474	ATP-binding site [chemical binding]; other site
160488004475	SEC-C motif; Region: SEC-C; pfam02810
160488004476	Ornithine acetyltransferase (OAT) family; also referred to as ArgJ. OAT catalyzes the first and fifth steps in arginine biosynthesis, coupling acetylation of glutamate with deacetylation of N-acetylornithine, which allows recycling of the acetyl group in...; Region: OAT; cd02152
160488004477	heterotetramer interface [polypeptide binding]; other site
160488004478	active site pocket [active]
160488004479	cleavage site
160488004480	GST_N family, unknown subfamily 1; composed of uncharacterized proteins, predominantly from bacteria, with similarity to GSTs. GSTs are cytosolic dimeric proteins involved in cellular detoxification by catalyzing the conjugation of glutathione (GSH) with...; Region: GST_N_1; cd03043
160488004481	Glutathione S-transferase [Posttranslational modification, protein turnover, chaperones]; Region: Gst; COG0625
160488004482	putative C-terminal domain interface [polypeptide binding]; other site
160488004483	putative GSH binding site (G-site) [chemical binding]; other site
160488004484	putative dimer interface [polypeptide binding]; other site
160488004485	C-terminal, alpha helical domain of an unknown subfamily 3 of Glutathione S-transferases; Region: GST_C_3; cd03194
160488004486	putative substrate binding pocket (H-site) [chemical binding]; other site
160488004487	putative N-terminal domain interface [polypeptide binding]; other site
160488004488	hypothetical protein; Provisional; Region: PRK08999
160488004489	The MutT pyrophosphohydrolase is a prototypical Nudix hydrolase that catalyzes the hydrolysis of nucleoside and deoxynucleoside triphosphates (NTPs and dNTPs) by substitution at a beta-phosphorus to yield a nucleotide monophosphate (NMP) and inorganic...; Region: MutT_pyrophosphohydrolase; cd03425
160488004490	active site
160488004491	8-oxo-dGMP binding site [chemical binding]; other site
160488004492	nudix motif; other site
160488004493	metal binding site [ion binding]; metal-binding site
160488004494	Thiamine monophosphate synthase (TMP synthase)/TenI. TMP synthase catalyzes an important step in the thiamine biosynthesis pathway, the substitution of the pyrophosphate of 2-methyl-4-amino-5- hydroxymethylpyrimidine pyrophosphate by 4-methyl-5-; Region: TMP_TenI; cd00564
160488004495	thiamine phosphate binding site [chemical binding]; other site
160488004496	active site
160488004497	pyrophosphate binding site [ion binding]; other site
160488004498	cob(I)alamin adenosyltransferase [Coenzyme transport and    metabolism]; Region: COG2096
160488004499	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
160488004500	dimerization interface [polypeptide binding]; other site
160488004501	PAS domain; Region: PAS; smart00091
160488004502	Signal transduction histidine kinase, nitrogen specific [Signal transduction mechanisms]; Region: NtrB; COG3852
160488004503	putative active site [active]
160488004504	heme pocket [chemical binding]; other site
160488004505	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488004506	dimer interface [polypeptide binding]; other site
160488004507	phosphorylation site [posttranslational modification]
160488004508	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488004509	ATP binding site [chemical binding]; other site
160488004510	Mg2+ binding site [ion binding]; other site
160488004511	G-X-G motif; other site
160488004512	2-dehydropantoate 2-reductase; Provisional; Region: PRK05708
160488004513	Ketopantoate reductase PanE/ApbA; Region: ApbA; pfam02558
160488004514	Ketopantoate reductase PanE/ApbA C terminal; Region: ApbA_C; pfam08546
160488004515	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG1666
160488004516	Proteins similar to Escherichia coli YajQ; Region: YajQ_like; cd11740
160488004517	Small-conductance mechanosensitive channel [Cell envelope biogenesis, outer membrane]; Region: MscS; COG0668
160488004518	Mechanosensitive ion channel; Region: MS_channel; pfam00924
160488004519	Major Facilitator Superfamily; Region: MFS_1; pfam07690
160488004520	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488004521	muropeptide transporter; Validated; Region: ampG; cl17669
160488004522	muropeptide transporter; Validated; Region: ampG; cl17669
160488004523	The DNA repair protein O6-alkylguanine-DNA alkyltransferase (ATase; also known as AGT, AGAT and MGMT) reverses O6-alkylation DNA damage by transferring O6-alkyl adducts to an active site cysteine irreversibly, without inducing DNA strand breaks. ATases...; Region: ATase; cd06445
160488004524	DNA binding site [nucleotide binding]
160488004525	active site
160488004526	Protein of unknown function, DUF481; Region: DUF481; pfam04338
160488004527	Pyridoxamine 5'-phosphate oxidase; Region: Pyrid_oxidase_2; pfam13883
160488004528	Putative heme iron utilization protein [Inorganic ion transport and metabolism]; Region: HugZ; COG0748
160488004529	Protein of unknown function (DUF2470); Region: DUF2470; pfam10615
160488004530	phage T7 F exclusion suppressor FxsA; Reviewed; Region: fxsA; PRK11463
160488004531	Chaperonin 10 Kd subunit (cpn10 or GroES); Cpn10 cooperates with chaperonin 60 (cpn60 or GroEL), an ATPase, to assist the folding and assembly of proteins and is found in eubacterial cytosol, as well as in the matrix of mitochondria and chloroplasts. It...; Region: cpn10; cd00320
160488004532	oligomerisation interface [polypeptide binding]; other site
160488004533	mobile loop; other site
160488004534	roof hairpin; other site
160488004535	chaperonin GroEL; Reviewed; Region: groEL; PRK12849
160488004536	GroEL_like type I chaperonin. Chaperonins are involved in productive folding of proteins. They share a common general morphology, a double toroid of 2 stacked rings, each composed of 7-9 subunits. The symmetry of type I is seven-fold and they are found...; Region: GroEL; cd03344
160488004537	ring oligomerisation interface [polypeptide binding]; other site
160488004538	ATP/Mg binding site [chemical binding]; other site
160488004539	stacking interactions; other site
160488004540	hinge regions; other site
160488004541	pyruvate kinase; Provisional; Region: PRK05826
160488004542	Pyruvate kinase (PK):  Large allosteric enzyme that regulates glycolysis through binding of the substrate, phosphoenolpyruvate, and one or more allosteric effectors. Like other allosteric enzymes, PK has a high substrate affinity R state and a low...; Region: Pyruvate_Kinase; cl17342
160488004543	domain interfaces; other site
160488004544	active site
160488004545	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG1729
160488004546	PilZ domain; Region: PilZ; pfam07238
160488004547	exonuclease I; Provisional; Region: sbcB; PRK11779
160488004548	N-terminal DEDDh 3'-5' exonuclease domain of Escherichia coli exonuclease I and similar proteins; Region: ExoI_N; cd06138
160488004549	active site
160488004550	catalytic site [active]
160488004551	substrate binding site [chemical binding]; other site
160488004552	Exonuclease C-terminal; Region: Exonuc_X-T_C; pfam08411
160488004553	formyltetrahydrofolate deformylase; Reviewed; Region: purU; PRK06027
160488004554	N-terminal ACT domain of formyltetrahydrofolate deformylase (F4HF-DF; formyltetrahydrofolate hydrolase); Region: ACT_F4HF-DF; cd04875
160488004555	Formyltetrahydrofolate deformylase (Formyl-FH4 hydrolase), C-terminal hydrolase domain; Region: FMT_core_Formyl-FH4-Hydrolase_C; cd08648
160488004556	putative active site [active]
160488004557	putative substrate binding site [chemical binding]; other site
160488004558	putative cosubstrate binding site; other site
160488004559	catalytic site [active]
160488004560	Uncharacterized protein family (UPF0104); Region: UPF0104; pfam03706
160488004561	Putative catalytic domain of uncharacterized bacterial proteins from the carbohydrate esterase 4 superfamily; Region: CE4_u10; cd11374
160488004562	Predicted deacetylase [General function prediction only]; Region: COG3233
160488004563	putative active site [active]
160488004564	putative Zn binding site [ion binding]; other site
160488004565	Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438
160488004566	This family is most closely related to the GT1 family of glycosyltransferases. Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. The acceptor molecule can...; Region: GT1_like_2; cd03814
160488004567	Cache domain; Region: Cache_1; pfam02743
160488004568	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
160488004569	dimerization interface [polypeptide binding]; other site
160488004570	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
160488004571	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
160488004572	dimer interface [polypeptide binding]; other site
160488004573	putative CheW interface [polypeptide binding]; other site
160488004574	Bacterial protein of unknown function (DUF853); Region: DUF853; pfam05872
160488004575	Phosphate/sulphate permeases [Inorganic ion transport and metabolism]; Region: PitA; COG0306
160488004576	Phosphate/sulphate permeases [Inorganic ion transport and metabolism]; Region: PitA; COG0306
160488004577	beta-ketoadipate pathway transcriptional regulators, PcaR/PcaU/PobR family; Region: pcaR_pcaU; TIGR02431
160488004578	helix_turn_helix isocitrate lyase regulation; Region: HTH_ICLR; smart00346
160488004579	Bacterial transcriptional regulator; Region: IclR; pfam01614
160488004580	benzoate transport; Region: 2A0115; TIGR00895
160488004581	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488004582	putative substrate translocation pore; other site
160488004583	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488004584	beta-ketoadipyl CoA thiolase; Validated; Region: PRK09050
160488004585	Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751
160488004586	dimer interface [polypeptide binding]; other site
160488004587	active site
160488004588	alpha-ketoglutarate transporter; Provisional; Region: PRK10406
160488004589	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488004590	putative substrate translocation pore; other site
160488004591	3-carboxy-cis,cis-muconate cycloisomerase; Provisional; Region: PRK09053
160488004592	prokaryotic 3-carboxy-cis,cis-muconate cycloisomerase (CMLE)_like; Region: pCLME; cd01597
160488004593	tetramer interface [polypeptide binding]; other site
160488004594	active site
160488004595	3-oxoadipate enol-lactonase; Region: protocat_pcaD; TIGR02427
160488004596	4-carboxymuconolactone decarboxylase; Region: decarb_PcaC; TIGR02425
160488004597	Predicted membrane protein [Function unknown]; Region: COG4539
160488004598	outer membrane porin, OprD family; Region: OprD; pfam03573
160488004599	efflux transporter, outer membrane factor (OMF) lipoprotein, NodT family; Region: outer_NodT; TIGR01845
160488004600	The (Largely Gram-negative Bacterial) Hydrophobe/Amphiphile Efflux-1 (HAE1) Family; Region: 2A0602; TIGR00915
160488004601	Protein export membrane protein; Region: SecD_SecF; cl14618
160488004602	Protein export membrane protein; Region: SecD_SecF; cl14618
160488004603	RND family efflux transporter, MFP subunit; Region: RND_mfp; TIGR01730
160488004604	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
160488004605	HlyD family secretion protein; Region: HlyD_3; pfam13437
160488004606	DNA-binding transcriptional repressor AcrR; Provisional; Region: PRK10668
160488004607	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
160488004608	MAATS-type transcriptional repressor, C-terminal region; Region: TetR_C_2; pfam08361
160488004609	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488004610	putative substrate translocation pore; other site
160488004611	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488004612	Members of the ICL/PEPM enzyme family catalyze either P-C or C-C bond formation/cleavage. Known members are phosphoenolpyruvate mutase (PEPM), phosphonopyruvate hydrolase (PPH), carboxyPEP mutase (CPEP mutase), oxaloacetate hydrolase (OAH), isocitrate...; Region: ICL_PEPM; cd00377
160488004613	Phosphoenolpyruvate phosphomutase; Region: PEP_mutase; pfam13714
160488004614	tetramer interface [polypeptide binding]; other site
160488004615	active site
160488004616	Mg2+/Mn2+ binding site [ion binding]; other site
160488004617	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488004618	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488004619	The C-terminal substrate binding domain of LysR-type transcriptional regulator CrgA and its related homologs, contains the type 2 periplasmic binding domain; Region: PBP2_CrgA_like; cd08422
160488004620	putative effector binding pocket; other site
160488004621	dimerization interface [polypeptide binding]; other site
160488004622	biliverdin IX beta reductase (BVR-B, aka flavin reductase)-like proteins; atypical (a) SDRs; Region: BVR-B_like_SDR_a; cd05244
160488004623	NADH(P)-binding; Region: NAD_binding_10; pfam13460
160488004624	NAD binding site [chemical binding]; other site
160488004625	substrate binding site [chemical binding]; other site
160488004626	putative active site [active]
160488004627	DNA-binding transcriptional activator GcvA; Provisional; Region: PRK11139
160488004628	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488004629	The C-terminal substrate domain of LysR-type GcdR, TrPI, HvR and beta-lactamase regulators, and that of other closely related homologs; contains the type 2 periplasmic binding fold; Region: PBP2_GcdR_TrpI_HvrB_AmpR_like; cd08432
160488004630	substrate binding pocket [chemical binding]; other site
160488004631	dimerization interface [polypeptide binding]; other site
160488004632	hypothetical protein; Provisional; Region: PRK07524
160488004633	Pyrimidine (PYR) binding domain of POX and related proteins; Region: TPP_PYR_POX_like; cd07035
160488004634	PYR/PP interface [polypeptide binding]; other site
160488004635	dimer interface [polypeptide binding]; other site
160488004636	TPP binding site [chemical binding]; other site
160488004637	Thiamine pyrophosphate enzyme, central domain; Region: TPP_enzyme_M; pfam00205
160488004638	Thiamine pyrophosphate (TPP) enzyme family, TPP-binding module; found in many key metabolic enzymes which use TPP (also known as thiamine diphosphate) as a cofactor. These enzymes include, among others, the E1 components of the pyruvate, the acetoin and...; Region: TPP_enzymes; cd00568
160488004639	TPP-binding site [chemical binding]; other site
160488004640	AraC-type transcriptional regulator N-terminus; Region: AraC_N; pfam06719
160488004641	AraC-type DNA-binding domain-containing proteins [Transcription]; Region: AraC; COG2207
160488004642	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488004643	Antibiotic biosynthesis monooxygenase; Region: ABM; pfam03992
160488004644	Conserved protein/domain typically associated with flavoprotein oxygenases, DIM6/NTAB family [General function prediction only]; Region: COG1853
160488004645	alpha-ketoglutarate transporter; Provisional; Region: PRK10406
160488004646	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488004647	putative substrate translocation pore; other site
160488004648	Response regulator containing CheY-like receiver, AAA-type ATPase, and DNA-binding domains [Signal transduction mechanisms]; Region: AtoC; COG2204
160488004649	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488004650	active site
160488004651	phosphorylation site [posttranslational modification]
160488004652	intermolecular recognition site; other site
160488004653	dimerization interface [polypeptide binding]; other site
160488004654	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488004655	Walker A motif; other site
160488004656	ATP binding site [chemical binding]; other site
160488004657	Walker B motif; other site
160488004658	arginine finger; other site
160488004659	Bacterial regulatory protein, Fis family; Region: HTH_8; pfam02954
160488004660	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488004661	dimer interface [polypeptide binding]; other site
160488004662	phosphorylation site [posttranslational modification]
160488004663	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488004664	ATP binding site [chemical binding]; other site
160488004665	Mg2+ binding site [ion binding]; other site
160488004666	G-X-G motif; other site
160488004667	beta-D-glucoside glucohydrolase; Provisional; Region: PRK15098
160488004668	Glycosyl hydrolase family 3 N terminal domain; Region: Glyco_hydro_3; pfam00933
160488004669	Fibronectin type III-like domain; Region: Fn3-like; pfam14310
160488004670	Repair protein; Region: Repair_PSII; cl01535
160488004671	Sulfate permease and related transporters (MFS superfamily) [Inorganic ion transport and metabolism]; Region: SUL1; COG0659
160488004672	Sulfate transporter N-terminal domain with GLY motif; Region: Sulfate_tra_GLY; pfam13792
160488004673	Sulfate transporter family; Region: Sulfate_transp; pfam00916
160488004674	Sulphate Transporter and Anti-Sigma factor antagonist domain of SulP-like sulfate transporters, plays a role in the function and regulation of the transport activity, proposed general NTP binding function; Region: STAS_SulP_like_sulfate_transporter; cd07042
160488004675	Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697
160488004676	Cysteine-rich CWC; Region: Cys_rich_CWC; pfam14375
160488004677	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
160488004678	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488004679	metal binding site [ion binding]; metal-binding site
160488004680	active site
160488004681	I-site; other site
160488004682	3-hydroxyisobutyryl-CoA hydrolase; Provisional; Region: PRK05617
160488004683	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
160488004684	substrate binding site [chemical binding]; other site
160488004685	oxyanion hole (OAH) forming residues; other site
160488004686	trimer interface [polypeptide binding]; other site
160488004687	2-enoyl-CoA Hydratase C-terminal region; Region: ECH_C; pfam13766
160488004688	Family 1 of Uracil-DNA glycosylase (UDG) enzymes; Region: UDG_F1; cd10027
160488004689	ligand binding site [chemical binding]; other site
160488004690	active site
160488004691	UGI interface [polypeptide binding]; other site
160488004692	catalytic site [active]
160488004693	5'-nucleotidase/2',3'-cyclic phosphodiesterase and related esterases [Nucleotide transport and metabolism]; Region: UshA; COG0737
160488004694	Bacillus subtilis YhcR endonuclease and related proteins, N-terminal metallophosphatase domain; Region: MPP_YhcR_N; cd07412
160488004695	putative active site [active]
160488004696	putative metal binding site [ion binding]; other site
160488004697	5'-nucleotidase, C-terminal domain; Region: 5_nucleotid_C; pfam02872
160488004698	membrane protein AbrB duplication; Region: Gneg_AbrB_dup; TIGR03082
160488004699	Putative ammonia monooxygenase; Region: AmoA; pfam05145
160488004700	membrane protein AbrB duplication; Region: Gneg_AbrB_dup; TIGR03082
160488004701	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3333
160488004702	Tripartite tricarboxylate transporter TctB family; Region: TctB; pfam07331
160488004703	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3181
160488004704	outer membrane porin, OprD family; Region: OprD; pfam03573
160488004705	transcriptional regulatory protein TctD; Provisional; Region: PRK15479
160488004706	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488004707	active site
160488004708	phosphorylation site [posttranslational modification]
160488004709	intermolecular recognition site; other site
160488004710	dimerization interface [polypeptide binding]; other site
160488004711	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
160488004712	DNA binding site [nucleotide binding]
160488004713	Two-component sensor kinase N-terminal; Region: 2CSK_N; pfam08521
160488004714	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
160488004715	dimerization interface [polypeptide binding]; other site
160488004716	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488004717	dimer interface [polypeptide binding]; other site
160488004718	phosphorylation site [posttranslational modification]
160488004719	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488004720	ATP binding site [chemical binding]; other site
160488004721	Mg2+ binding site [ion binding]; other site
160488004722	G-X-G motif; other site
160488004723	HDOD domain; Region: HDOD; pfam08668
160488004724	Predicted aminomethyltransferase related to GcvT [General function prediction only]; Region: COG0354
160488004725	folate-binding protein YgfZ; Region: ygfZ_signature; TIGR03317
160488004726	Uncharacterized conserved protein [Function unknown]; Region: COG2938
160488004727	L-aspartate oxidase; Provisional; Region: PRK09077
160488004728	L-aspartate oxidase; Provisional; Region: PRK06175
160488004729	Fumarate reductase flavoprotein C-term; Region: Succ_DH_flav_C; pfam02910
160488004730	RNA polymerase sigma factor AlgU; Provisional; Region: algU; PRK11923
160488004731	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
160488004732	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
160488004733	DNA binding residues [nucleotide binding]
160488004734	Negative regulator of sigma E activity [Signal transduction mechanisms]; Region: RseA; COG3073
160488004735	Anti sigma-E protein RseA, N-terminal domain; Region: RseA_N; pfam03872
160488004736	Anti sigma-E protein RseA, C-terminal domain; Region: RseA_C; pfam03873
160488004737	anti-sigma E factor; Provisional; Region: rseB; PRK09455
160488004738	MucB/RseB family; Region: MucB_RseB; pfam03888
160488004739	periplasmic serine protease, Do/DeqQ family; Region: degP_htrA_DO; TIGR02037
160488004740	Trypsin-like peptidase domain; Region: Trypsin_2; pfam13365
160488004741	PDZ domain of tryspin-like serine proteases, such as DegP/HtrA, which are oligomeric proteins involved in heat-shock response, chaperone function, and apoptosis. May be responsible for substrate recognition and/or binding, as most PDZ domains bind...; Region: PDZ_serine_protease; cd00987
160488004742	protein binding site [polypeptide binding]; other site
160488004743	PDZ domain of tryspin-like serine proteases, such as DegP/HtrA, which are oligomeric proteins involved in heat-shock response, chaperone function, and apoptosis. May be responsible for substrate recognition and/or binding, as most PDZ domains bind...; Region: PDZ_serine_protease; cd00987
160488004744	protein binding site [polypeptide binding]; other site
160488004745	GTP-binding protein LepA; Provisional; Region: PRK05433
160488004746	LepA also known as Elongation Factor 4 (EF4); Region: LepA; cd01890
160488004747	G1 box; other site
160488004748	putative GEF interaction site [polypeptide binding]; other site
160488004749	GTP/Mg2+ binding site [chemical binding]; other site
160488004750	Switch I region; other site
160488004751	G2 box; other site
160488004752	G3 box; other site
160488004753	Switch II region; other site
160488004754	G4 box; other site
160488004755	G5 box; other site
160488004756	lepA_II: This subfamily represents the domain II of LepA, a GTP-binding protein localized in the cytoplasmic membrane. The N-terminal domain of LepA shares regions of homology to translation factors. In terms of interaction with the ribosome, EF-G, EF-Tu...; Region: lepA_II; cd03699
160488004757	lepA_C: This family represents the C-terminal region of LepA, a GTP-binding protein localized in the cytoplasmic membrane.   LepA is ubiquitous in Bacteria and Eukaryota (e.g. Saccharomyces cerevisiae GUF1p), but is missing from Archaea. LepA exhibits...; Region: lepA_C; cd03709
160488004758	GTP-binding protein LepA C-terminus; Region: LepA_C; pfam06421
160488004759	signal peptidase I; Provisional; Region: PRK10861
160488004760	The S26 Type I signal peptidase (SPase; LepB; leader peptidase B; leader peptidase I; EC 3.4.21.89) family members are essential membrane-bound serine proteases that function to cleave the amino-terminal signal peptide extension from proteins that are...; Region: S26_SPase_I; cd06530
160488004761	Catalytic site [active]
160488004762	The S26 Type I signal peptidase (SPase; LepB; leader peptidase B; leader peptidase I; EC 3.4.21.89) family members are essential membrane-bound serine proteases that function to cleave the amino-terminal signal peptide extension from proteins that are...; Region: S26_SPase_I; cd06530
160488004763	ribonuclease III; Reviewed; Region: rnc; PRK00102
160488004764	RIBOc. Ribonuclease III C terminal domain. This group consists of eukaryotic, bacterial and archeal ribonuclease III (RNAse III) proteins. RNAse III is a double stranded RNA-specific endonuclease. Prokaryotic RNAse III is important in...; Region: RIBOc; cd00593
160488004765	dimerization interface [polypeptide binding]; other site
160488004766	active site
160488004767	metal binding site [ion binding]; metal-binding site
160488004768	Double-stranded RNA binding motif. Binding is not sequence specific but is highly specific for double stranded RNA. Found in a variety of proteins including dsRNA dependent protein kinase PKR, RNA helicases, Drosophila staufen protein, E. coli RNase III; Region: DSRM; cd00048
160488004769	dsRNA binding site [nucleotide binding]; other site
160488004770	GTPase Era; Reviewed; Region: era; PRK00089
160488004771	E. coli Ras-like protein (Era) is a multifunctional GTPase; Region: Era; cd04163
160488004772	G1 box; other site
160488004773	GTP/Mg2+ binding site [chemical binding]; other site
160488004774	Switch I region; other site
160488004775	G2 box; other site
160488004776	Switch II region; other site
160488004777	G3 box; other site
160488004778	G4 box; other site
160488004779	G5 box; other site
160488004780	KH domain; Region: KH_2; pfam07650
160488004781	DNA repair protein RecO; Reviewed; Region: recO; PRK00085
160488004782	Recombination protein O N terminal; Region: RecO_N; pfam11967
160488004783	Recombination protein O C terminal; Region: RecO_C; pfam02565
160488004784	Pyridoxine 5'-phosphate (PNP) synthase domain; pyridoxal 5'-phosphate is the active form of vitamin B6 that acts as an essential, ubiquitous coenzyme in amino acid metabolism. In bacteria, formation of pyridoxine 5'-phosphate is a step in...; Region: PNPsynthase; cd00003
160488004785	active site
160488004786	hydrophilic channel; other site
160488004787	dimerization interface [polypeptide binding]; other site
160488004788	catalytic residues [active]
160488004789	active site lid [active]
160488004790	heavy metal sensor kinase; Region: cztS_silS_copS; TIGR01386
160488004791	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
160488004792	dimerization interface [polypeptide binding]; other site
160488004793	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488004794	dimer interface [polypeptide binding]; other site
160488004795	phosphorylation site [posttranslational modification]
160488004796	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488004797	ATP binding site [chemical binding]; other site
160488004798	Mg2+ binding site [ion binding]; other site
160488004799	G-X-G motif; other site
160488004800	heavy metal response regulator; Region: cztR_silR_copR; TIGR01387
160488004801	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488004802	active site
160488004803	phosphorylation site [posttranslational modification]
160488004804	intermolecular recognition site; other site
160488004805	dimerization interface [polypeptide binding]; other site
160488004806	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
160488004807	DNA binding site [nucleotide binding]
160488004808	Methyltransferase domain; Region: Methyltransf_31; pfam13847
160488004809	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488004810	S-adenosylmethionine binding site [chemical binding]; other site
160488004811	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
160488004812	active site
160488004813	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488004814	S-adenosylmethionine binding site [chemical binding]; other site
160488004815	Chagasin family peptidase inhibitor I42; Region: Inhibitor_I42; pfam09394
160488004816	ATP-dependent Lon protease, bacterial type [Posttranslational modification, protein turnover, chaperones]; Region: Lon; COG0466
160488004817	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488004818	Walker A motif; other site
160488004819	ATP binding site [chemical binding]; other site
160488004820	Walker B motif; other site
160488004821	arginine finger; other site
160488004822	Lon protease (S16) C-terminal proteolytic domain; Region: Lon_C; pfam05362
160488004823	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family; Region: PQQ_membr_DH; TIGR03074
160488004824	Membrane-bound PQQ-dependent glucose dehydrogenase; Region: PQQ_mGDH; cd10280
160488004825	Trp docking motif [polypeptide binding]; other site
160488004826	putative active site [active]
160488004827	Carbohydrate-selective porin [Cell envelope biogenesis, outer membrane]; Region: OprB; COG3659
160488004828	TonB-dependent heme/hemoglobin receptor family protein; Region: TonB-hemin; TIGR01785
160488004829	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
160488004830	N-terminal plug; other site
160488004831	ligand-binding site [chemical binding]; other site
160488004832	Uncharacterized conserved protein (DUF2132); Region: DUF2132; pfam09905
160488004833	haemagglutination activity domain; Region: Haemagg_act; pfam05860
160488004834	Haemagluttinin repeat; Region: Fil_haemagg_2; pfam13332
160488004835	Haemagluttinin repeat; Region: Fil_haemagg_2; pfam13332
160488004836	Haemagluttinin repeat; Region: Fil_haemagg_2; pfam13332
160488004837	Haemagluttinin repeat; Region: Fil_haemagg_2; pfam13332
160488004838	Haemagluttinin repeat; Region: Fil_haemagg_2; pfam13332
160488004839	Hemolysin activation/secretion protein [Intracellular trafficking and secretion]; Region: FhaC; COG2831
160488004840	POTRA domain, ShlB-type; Region: POTRA_2; pfam08479
160488004841	Haemolysin secretion/activation protein ShlB/FhaC/HecB; Region: ShlB; pfam03865
160488004842	L,D-transpeptidase catalytic domain; Region: YkuD; pfam03734
160488004843	NADH pyrophosphatase zinc ribbon domain; Region: zf-NADH-PPase; pfam09297
160488004844	Members of the Nudix hydrolase superfamily catalyze the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+, for their activity and contain a highly...; Region: Nudix_Hydrolase_4; cd04511
160488004845	nudix motif; other site
160488004846	Coenzyme A pyrophosphatase (CoAse), a member of the Nudix hydrolase superfamily, functions to catalyze the elimination of oxidized inactive CoA, which can inhibit CoA-utilizing enzymes. The need of CoAses mainly arises under conditions of oxidative...; Region: CoAse; cd03426
160488004847	putative active site [active]
160488004848	putative CoA binding site [chemical binding]; other site
160488004849	nudix motif; other site
160488004850	metal binding site [ion binding]; metal-binding site
160488004851	Carbonic anhydrases/acetyltransferases, isoleucine patch superfamily [General function prediction only]; Region: PaaY; COG0663
160488004852	Gamma carbonic anhydrase-like: This family is composed of gamma carbonic anhydrase (CA), Ferripyochelin Binding Protein (FBP), E. coli paaY protein, and similar proteins. CAs are zinc-containing enzymes that catalyze the reversible hydration of carbon...; Region: LbH_gamma_CA_like; cd04645
160488004853	trimer interface [polypeptide binding]; other site
160488004854	putative metal binding site [ion binding]; other site
160488004855	Predicted Fe-S protein [General function prediction only]; Region: COG3313
160488004856	Uncharacterized ACR, YhhQ family COG1738; Region: DUF165; pfam02592
160488004857	phosphoribosylglycinamide formyltransferase 2; Validated; Region: purT; PRK09288
160488004858	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
160488004859	ATP-grasp domain; Region: ATP-grasp; pfam02222
160488004860	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488004861	metabolite-proton symporter; Region: 2A0106; TIGR00883
160488004862	putative substrate translocation pore; other site
160488004863	Domain of unknown function DUF21; Region: DUF21; pfam01595
160488004864	FOG: CBS domain [General function prediction only]; Region: COG0517
160488004865	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains associated with the CorC_HlyC domain. CorC_HlyC is a transporter associated domain. This small domain is found in Na+/H+ antiporters, in proteins involved in...; Region: CBS_pair_CorC_HlyC_assoc; cd04590
160488004866	Transporter associated domain; Region: CorC_HlyC; smart01091
160488004867	ABC-type uncharacterized transport system, permease component [General function prediction only]; Region: COG4137
160488004868	signal recognition particle protein; Provisional; Region: PRK10867
160488004869	SRP54-type protein, helical bundle domain; Region: SRP54_N; smart00963
160488004870	The signal recognition particle (SRP) mediates the transport to or across the plasma membrane in bacteria and the endoplasmic reticulum in eukaryotes. SRP recognizes N-terminal sighnal sequences of newly synthesized polypeptides at the ribosome. The...; Region: SRP; cd03115
160488004871	P loop; other site
160488004872	GTP binding site [chemical binding]; other site
160488004873	Signal peptide binding domain; Region: SRP_SPB; pfam02978
160488004874	30S ribosomal protein S16; Reviewed; Region: rpsP; PRK00040
160488004875	16S rRNA-processing protein RimM; Provisional; Region: rimM; PRK00122
160488004876	RimM N-terminal domain; Region: RimM; pfam01782
160488004877	PRC-barrel domain; Region: PRC; pfam05239
160488004878	tRNA (guanine-N(1)-)-methyltransferase; Reviewed; Region: trmD; PRK00026
160488004879	50S ribosomal protein L19; Provisional; Region: rplS; PRK05338
160488004880	Brown fat-inducible thioesterase (BFIT).  Brain acyl-CoA hydrolase (BACH).  These enzymes deacylate long-chain fatty acids by hydrolyzing acyl-CoA thioesters to free fatty acids and CoA-SH. Eukaryotic members of this family are expressed in brain, testis; Region: BFIT_BACH; cd03442
160488004881	NhaP-type Na+/H+ and K+/H+ antiporters [Inorganic ion transport and metabolism]; Region: NhaP; COG0025
160488004882	TrkA-N domain; Region: TrkA_N; pfam02254
160488004883	site-specific tyrosine recombinase XerD; Reviewed; Region: xerD; PRK00283
160488004884	XerD and XerC integrases, DNA breaking-rejoining enzymes, N- and C-terminal domains. XerD-like integrases are involved in the site-specific integration and excision of lysogenic bacteriophage genomes, transposition of conjugative transposons, termination...; Region: INT_XerDC; cd00798
160488004885	active site
160488004886	Int/Topo IB signature motif; other site
160488004887	DsbA family, DsbC and DsbG subfamily; V-shaped homodimeric proteins containing a redox active CXXC motif imbedded in a TRX fold. They function as protein disulfide isomerases and chaperones in the bacterial periplasm to correct non-native disulfide bonds...; Region: DsbA_DsbC_DsbG; cd03020
160488004888	dimerization domain [polypeptide binding]; other site
160488004889	dimer interface [polypeptide binding]; other site
160488004890	catalytic residues [active]
160488004891	homoserine dehydrogenase; Provisional; Region: PRK06349
160488004892	Homoserine dehydrogenase, NAD binding domain; Region: NAD_binding_3; pfam03447
160488004893	Homoserine dehydrogenase; Region: Homoserine_dh; pfam00742
160488004894	ACT_HSDH_Hom CD includes the C-terminal ACT domain of the NAD(P)H-dependent, homoserine dehydrogenase (HSDH) and related domains; Region: ACT_HSDH-Hom; cd04881
160488004895	Threonine synthase [Amino acid transport and metabolism]; Region: ThrC; COG0498
160488004896	Threonine synthase catalyzes the final step of threonine biosynthesis. The conversion of O-phosphohomoserine into threonine and inorganic phosphate is pyridoxal 5'-phosphate dependent. The Thr-synth_1 CD includes members from higher plants; Region: Thr-synth_2; cd01560
160488004897	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488004898	catalytic residue [active]
160488004899	Protein of unknown function (DUF3509); Region: DUF3509; pfam12021
160488004900	conserved hypothetical protein; Region: TIGR02285
160488004901	Predicted acyl-CoA transferases/carnitine dehydratase [Energy production and conversion]; Region: CaiB; COG1804
160488004902	CoA-transferase family III; Region: CoA_transf_3; pfam02515
160488004903	YaeQ protein; Region: YaeQ; pfam07152
160488004904	ssDNA exonuclease RecJ; Provisional; Region: PRK11070
160488004905	DHH family; Region: DHH; pfam01368
160488004906	DHHA1 domain; Region: DHHA1; pfam02272
160488004907	NADH:flavin oxidoreductases, Old Yellow Enzyme family [Energy production and conversion]; Region: NemA; COG1902
160488004908	Old yellow enzyme (OYE) YqjM-like FMN binding domain. YqjM is involved in the oxidative stress response of Bacillus subtilis.  Like the other OYE members, each monomer of YqjM contains FMN as a non-covalently bound cofactor and uses NADPH as a reducing...; Region: OYE_YqiM_FMN; cd02932
160488004909	active site
160488004910	FMN binding site [chemical binding]; other site
160488004911	substrate binding site [chemical binding]; other site
160488004912	homotetramer interface [polypeptide binding]; other site
160488004913	catalytic residue [active]
160488004914	Predicted nuclease of the RNAse H fold, HicB family [General    function prediction only]; Region: HicB; COG4226
160488004915	HicB family; Region: HicB; pfam05534
160488004916	gamma-aminobutyraldehyde dehydrogenase; Provisional; Region: PRK13473
160488004917	Escherichia coli NAD+-dependent gamma-aminobutyraldehyde dehydrogenase YdcW-like; Region: ALDH_ABALDH-YdcW; cd07092
160488004918	tetrameric interface [polypeptide binding]; other site
160488004919	NAD binding site [chemical binding]; other site
160488004920	catalytic residues [active]
160488004921	substrate binding site [chemical binding]; other site
160488004922	ABC-type spermidine/putrescine transport system, permease component II [Amino acid transport and metabolism]; Region: PotC; COG1177
160488004923	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488004924	dimer interface [polypeptide binding]; other site
160488004925	conserved gate region; other site
160488004926	ABC-ATPase subunit interface; other site
160488004927	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488004928	conserved gate region; other site
160488004929	dimer interface [polypeptide binding]; other site
160488004930	putative PBP binding loops; other site
160488004931	ABC-ATPase subunit interface; other site
160488004932	ABC-type spermidine/putrescine transport systems, ATPase components [Amino acid transport and metabolism]; Region: PotA; COG3842
160488004933	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488004934	Walker A/P-loop; other site
160488004935	ATP binding site [chemical binding]; other site
160488004936	Q-loop/lid; other site
160488004937	ABC transporter signature motif; other site
160488004938	Walker B; other site
160488004939	D-loop; other site
160488004940	H-loop/switch region; other site
160488004941	TOBE domain; Region: TOBE_2; pfam08402
160488004942	Bacterial extracellular solute-binding protein; Region: SBP_bac_8; pfam13416
160488004943	Bacterial extracellular solute-binding protein; Region: SBP_bac_1; cl17199
160488004944	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2979
160488004945	tellurium resistance terB-like protein, subgroup 3; Region: terB_like_YebE; cd07178
160488004946	putative metal binding site [ion binding]; other site
160488004947	Four helix bundle sensory module for signal transduction; Region: 4HB_MCP_1; pfam12729
160488004948	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
160488004949	dimerization interface [polypeptide binding]; other site
160488004950	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
160488004951	dimer interface [polypeptide binding]; other site
160488004952	Methyl-accepting chemotaxis protein (MCP) signalling domain; Region: MCPsignal; pfam00015
160488004953	putative CheW interface [polypeptide binding]; other site
160488004954	Chemotaxis signal transduction protein [Cell motility and secretion / Signal transduction mechanisms]; Region: CheW; COG0835
160488004955	CheR methyltransferase, all-alpha domain; Region: CheR_N; pfam03705
160488004956	Methylase of chemotaxis methyl-accepting proteins [Cell motility and secretion / Signal transduction mechanisms]; Region: CheR; COG1352
160488004957	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488004958	S-adenosylmethionine binding site [chemical binding]; other site
160488004959	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cl02429
160488004960	TPR motif; other site
160488004961	CheW-like domain. CheW proteins are part of the chemotaxis signalling mechanism in bacteria. CheW interacts with the methyl accepting chemotaxis proteins (MCPs) and relays signals to CheY, which affects flageller rotation. This family includes CheW and...; Region: CheW_like; cd00588
160488004962	Histidine Phosphotransfer domain, involved in signalling through a two part component systems in which an autophosphorylating histidine protein kinase serves as a phosphoryl donor to a response regulator protein; the response regulator protein is...; Region: HPT; cd00088
160488004963	putative binding surface; other site
160488004964	active site
160488004965	Chemotaxis protein histidine kinase and related kinases [Cell motility and secretion / Signal transduction mechanisms]; Region: CheA; COG0643
160488004966	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488004967	ATP binding site [chemical binding]; other site
160488004968	Mg2+ binding site [ion binding]; other site
160488004969	G-X-G motif; other site
160488004970	CheW-like domain. CheW proteins are part of the chemotaxis signalling mechanism in bacteria. CheW interacts with the methyl accepting chemotaxis proteins (MCPs) and relays signals to CheY, which affects flageller rotation. This family includes CheW and...; Region: CheW_like; cl00256
160488004971	Response regulator receiver domain; Region: Response_reg; pfam00072
160488004972	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488004973	active site
160488004974	phosphorylation site [posttranslational modification]
160488004975	intermolecular recognition site; other site
160488004976	dimerization interface [polypeptide binding]; other site
160488004977	chemotaxis-specific methylesterase; Provisional; Region: PRK12555
160488004978	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488004979	active site
160488004980	phosphorylation site [posttranslational modification]
160488004981	intermolecular recognition site; other site
160488004982	CheB methylesterase; Region: CheB_methylest; pfam01339
160488004983	Response regulator receiver domain; Region: Response_reg; pfam00072
160488004984	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488004985	active site
160488004986	phosphorylation site [posttranslational modification]
160488004987	intermolecular recognition site; other site
160488004988	dimerization interface [polypeptide binding]; other site
160488004989	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
160488004990	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488004991	metal binding site [ion binding]; metal-binding site
160488004992	active site
160488004993	I-site; other site
160488004994	lysyl-tRNA synthetase; Reviewed; Region: lysS; PRK00484
160488004995	LysRS_N: N-terminal, anticodon recognition domain of lysyl-tRNA synthetases (LysRS). These enzymes are homodimeric class 2b aminoacyl-tRNA synthetases (aaRSs). This domain is a beta-barrel domain (OB fold) involved in binding the tRNA anticodon stem-loop; Region: LysRS_N; cd04322
160488004996	dimer interface [polypeptide binding]; other site
160488004997	putative anticodon binding site; other site
160488004998	Lys_tRNA synthetase (LysRS) class II core domain. Class II LysRS is a dimer which attaches a lysine to the 3' OH group of ribose of the appropriate tRNA. Its assignment to class II aaRS is based upon its structure and the presence of three...; Region: LysRS_core; cd00775
160488004999	motif 1; other site
160488005000	active site
160488005001	motif 2; other site
160488005002	motif 3; other site
160488005003	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3226
160488005004	conserved hypothetical protein; Region: QEGLA; TIGR02421
160488005005	Putative lysophospholipase; Region: Hydrolase_4; pfam12146
160488005006	Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326
160488005007	Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697
160488005008	Outer membrane protein and related peptidoglycan-associated (lipo)proteins [Cell envelope biogenesis, outer membrane]; Region: OmpA; COG2885
160488005009	Peptidoglycan binding domains similar to the C-terminal domain of outer-membrane protein OmpA; Region: OmpA_C-like; cd07185
160488005010	ligand binding site [chemical binding]; other site
160488005011	Domain of unknown function (DUF4398); Region: DUF4398; pfam14346
160488005012	phosphoenolpyruvate carboxylase; Reviewed; Region: PRK00009
160488005013	Phosphoenolpyruvate carboxylase [Energy production and conversion]; Region: Ppc; COG2352
160488005014	adenylate kinase; Reviewed; Region: adk; PRK00279
160488005015	Adenylate kinase (ADK) catalyzes the reversible phosphoryl transfer from adenosine triphosphates (ATP) to adenosine monophosphates (AMP) and to yield adenosine diphosphates (ADP). This enzyme is required for the biosynthesis of ADP and is essential for...; Region: ADK; cd01428
160488005016	AMP-binding site [chemical binding]; other site
160488005017	ATP-AMP (Ap5A)-binding site [chemical binding]; other site
160488005018	tRNA threonylcarbamoyl adenosine modification protein YeaZ; Region: T6A_YeaZ; TIGR03725
160488005019	Glycoprotease family; Region: Peptidase_M22; pfam00814
160488005020	Protein of unknown function DUF72; Region: DUF72; cl00777
160488005021	Phosphoenolpyruvate phosphomutase; Region: PEP_mutase; pfam13714
160488005022	Members of the ICL/PEPM enzyme family catalyze either P-C or C-C bond formation/cleavage. Known members are phosphoenolpyruvate mutase (PEPM), phosphonopyruvate hydrolase (PPH), carboxyPEP mutase (CPEP mutase), oxaloacetate hydrolase (OAH), isocitrate...; Region: ICL_PEPM; cd00377
160488005023	tetramer interface [polypeptide binding]; other site
160488005024	active site
160488005025	Mg2+/Mn2+ binding site [ion binding]; other site
160488005026	Extensin-like protein C-terminus; Region: Extensin-like_C; pfam06904
160488005027	Putative SAM-dependent methyltransferase; Region: SAM_MT; cl17517
160488005028	RHS repeat-associated core domain; Region: Rhs_assc_core; TIGR03696
160488005029	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
160488005030	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
160488005031	AefR-like transcriptional repressor, C-terminal region; Region: TetR_C_7; pfam14246
160488005032	RND family efflux transporter, MFP subunit; Region: RND_mfp; TIGR01730
160488005033	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
160488005034	HlyD family secretion protein; Region: HlyD_3; pfam13437
160488005035	Cation/multidrug efflux pump [Defense mechanisms]; Region: AcrB; COG0841
160488005036	Protein of unknown function (DUF4197); Region: DUF4197; pfam13852
160488005037	Type III secretion system lipoprotein chaperone (YscW); Region: YscW; cl15825
160488005038	glycerol-3-phosphate O-acyltransferase; Region: plsB; TIGR03703
160488005039	Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: GPAT-like; Region: LPLAT_DHAPAT-like; cd07993
160488005040	putative acyl-acceptor binding pocket; other site
160488005041	Cold-Shock Protein (CSP) contains an S1-like cold-shock domain (CSD) that is found in eukaryotes, prokaryotes, and archaea.  CSP's include the major cold-shock proteins CspA and CspB in bacteria and the eukaryotic gene regulatory factor Y-box...; Region: CSP_CDS; cd04458
160488005042	DNA-binding site [nucleotide binding]; DNA binding site
160488005043	RNA-binding motif; other site
160488005044	23S rRNA methyltransferase A; Provisional; Region: rrmA; PRK11088
160488005045	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488005046	S-adenosylmethionine binding site [chemical binding]; other site
160488005047	succinyl-diaminopimelate desuccinylase; Reviewed; Region: PRK13009
160488005048	M20 Peptidase proteobacterial DapE encoded N-succinyl-L,L-diaminopimelic acid desuccinylase; Region: M20_DapE_proteobac; cd03891
160488005049	metal binding site [ion binding]; metal-binding site
160488005050	dimer interface [polypeptide binding]; other site
160488005051	Exo-beta-1,3-glucanase [Carbohydrate transport and metabolism]; Region: COG5309
160488005052	PMP-22/EMP/MP20/Claudin family; Region: PMP22_Claudin; cl17758
160488005053	Glycosyltransferase like family 2; Region: Glyco_tranf_2_3; pfam13641
160488005054	NdvC_like  proteins in this family are putative bacterial beta-(1,6)-glucosyltransferase; Region: CESA_NdvC_like; cd06435
160488005055	Ligand binding site; other site
160488005056	DXD motif; other site
160488005057	Dinucleotide-utilizing enzymes involved in molybdopterin and thiamine biosynthesis family 1 [Coenzyme metabolism]; Region: COG1179
160488005058	Family of activating enzymes (E1) of ubiquitin-like proteins related to the E.coli hypothetical protein ygdL. The common reaction mechanism catalyzed by E1-like enzymes begins with a nucleophilic attack of the C-terminal carboxylate of the ubiquitin-like...; Region: YgdL_like; cd00755
160488005059	putative ATP binding site [chemical binding]; other site
160488005060	putative substrate interface [chemical binding]; other site
160488005061	Fe-S metabolism associated domain; Region: SufE; cl00951
160488005062	Selenocysteine lyase/Cysteine desulfurase [Posttranslational modification, protein turnover, chaperones]; Region: csdA; COG0520
160488005063	Cysteine desulfurase (SufS)-like. This family belongs to the pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to cysteine desulfurase (SufS) and selenocysteine lyase. SufS...; Region: SufS_like; cd06453
160488005064	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
160488005065	catalytic residue [active]
160488005066	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase; Region: DapD_gpp; TIGR03536
160488005067	Putative 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate (THDP) N-succinyltransferase (THP succinyltransferase), C-terminal left-handed parallel alpha-helix (LbH) domain: This group is composed of mostly uncharacterized proteins containing an N-terminal...; Region: LbH_THP_succinylT_putative; cd04649
160488005068	putative trimer interface [polypeptide binding]; other site
160488005069	putative CoA binding site [chemical binding]; other site
160488005070	Arsenate Reductase (ArsC) family, Yffb subfamily; Yffb is an uncharacterized bacterial protein encoded by the yffb gene, related to the thioredoxin-fold arsenic reductases, ArsC. The structure of Yffb and the conservation of the catalytic cysteine...; Region: ArsC_Yffb; cd03035
160488005071	ArsC family; Region: ArsC; pfam03960
160488005072	putative catalytic residues [active]
160488005073	PHAGE04; prophage; lysogenic bacteriophage with best hits to bacteriophage D3 from Pseudomonas aeruginosa. attL/R=gtc[ac]caggctttgatgccgta.  att site within the 5-prime end of PP1531.
160488005074	Bacteriophage lambda integrase, N-terminal domain; Region: Phage_integ_N; pfam09003
160488005075	Phage integrase, N-terminal SAM-like domain; Region: Phage_integr_N; pfam02899
160488005076	Lambda integrase, C-terminal catalytic domain. Lambda-type integrases catalyze site-specific integration and excision of temperate bacteriophages and other mobile genetic elements to and from the bacterial host chromosome.  They belong to the superfamily...; Region: INT_Lambda_C; cd00800
160488005077	dimer interface [polypeptide binding]; other site
160488005078	active site
160488005079	Int/Topo IB signature motif; other site
160488005080	Excisionase-like protein; Region: Exc; pfam07825
160488005081	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cl17173
160488005082	type VI secretion ATPase, ClpV1 family; Region: VI_ClpV1; TIGR03345
160488005083	Site-specific DNA methylase [DNA replication, recombination, and repair]; Region: Dcm; COG0270
160488005084	Cytosine-C5 specific DNA methylases; Methyl transfer reactions play an important role in many aspects of biology. Cytosine-specific DNA methylases are found both in prokaryotes and eukaryotes. DNA methylation, or the covalent addition of a methyl group...; Region: Cyt_C5_DNA_methylase; cd00315
160488005085	cofactor binding site; other site
160488005086	DNA binding site [nucleotide binding]
160488005087	substrate interaction site [chemical binding]; other site
160488005088	Transketolase [Carbohydrate transport and metabolism]; Region: TktA; COG0021
160488005089	tellurite resistance protein terB; Region: terB; cd07176
160488005090	putative metal binding site [ion binding]; other site
160488005091	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cl17200
160488005092	sequence-specific DNA binding site [nucleotide binding]; other site
160488005093	salt bridge; other site
160488005094	Predicted transcriptional regulator [Transcription]; Region: COG2932
160488005095	Peptidase S24 LexA-like proteins are involved in the SOS response leading to the repair of single-stranded DNA within the bacterial cell. This family includes: the lambda repressor CI/C2 family and related bacterial prophage repressor proteins; LexA (EC...; Region: S24_LexA-like; cd06529
160488005096	Catalytic site [active]
160488005097	DNA-binding transcriptional regulator DicC; Provisional; Region: PRK09744
160488005098	Bacteriophage replication protein O; Region: Phage_rep_O; cl04545
160488005099	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488005100	ATPases associated with a variety of cellular activities; Region: AAA; smart00382
160488005101	Walker A motif; other site
160488005102	ATP binding site [chemical binding]; other site
160488005103	Walker B motif; other site
160488005104	arginine finger; other site
160488005105	Protein of unknown function (DUF1364); Region: DUF1364; pfam07102
160488005106	VRR-NUC domain; Region: VRR_NUC; pfam08774
160488005107	Bacteriophage P4 integrase. P4-like integrases are found in temperate bacteriophages, integrative plasmids, pathogenicity and symbiosis islands, and other mobile genetic elements.  They share the same fold in their catalytic domain and the overall...; Region: INT_P4; cd00801
160488005108	active site
160488005109	Int/Topo IB signature motif; other site
160488005110	Phage antitermination protein Q; Region: Phage_antitermQ; pfam06530
160488005111	Phage holin family (Lysis protein S); Region: Phage_holin_3; pfam05106
160488005112	HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085
160488005113	active site
160488005114	Phage terminase, small subunit; Region: Terminase_4; cl01525
160488005115	Phage terminase-like protein, large subunit [General function prediction only]; Region: COG4626
160488005116	Phage portal protein; Region: Phage_portal; pfam04860
160488005117	Phage-related protein [Function unknown]; Region: COG4695
160488005118	Caudovirus prohead protease; Region: Peptidase_U35; pfam04586
160488005119	phage major capsid protein, HK97 family; Region: major_cap_HK97; TIGR01554
160488005120	Phage capsid family; Region: Phage_capsid; pfam05065
160488005121	Head-Tail Connector Protein gp6 of Bacteriophage HK97 and similar proteins; Region: gp6; cd08054
160488005122	oligomerization interface [polypeptide binding]; other site
160488005123	Phage head-tail joining protein; Region: Phage_H_T_join; pfam05521
160488005124	Bacteriophage protein of unknown function (DUF646); Region: DUF646; cl12124
160488005125	Protein of unknown function (DUF3168); Region: DUF3168; pfam11367
160488005126	Superinfection immunity protein; Region: Imm_superinfect; pfam14373
160488005127	Short C-terminal domain; Region: SHOCT; pfam09851
160488005128	phage tail tape measure protein, lambda family; Region: tape_meas_lam_C; TIGR01541
160488005129	Lambda phage tail tape-measure protein (Tape_meas_lam_C); Region: Tape_meas_lam_C; pfam09718
160488005130	Domain of unknown function (DUF1833); Region: DUF1833; pfam08875
160488005131	Putative phage tail protein; Region: Phage-tail_3; pfam13550
160488005132	BNR repeat-like domain; Region: BNR_2; pfam13088
160488005133	Sialidases or neuraminidases function to bind and hydrolyze terminal sialic acid residues from various glycoconjugates as well as playing roles in pathogenesis, bacterial nutrition and cellular interactions. They have a six-bladed, beta-propeller fold...; Region: Sialidase; cl17698
160488005134	virion protein; Provisional; Region: V; PHA02564
160488005135	Protein of unknown function (DUF2514); Region: DUF2514; pfam10721
160488005136	Plasmid maintenance system antidote protein [General function prediction only]; Region: VapI; COG3093
160488005137	addiction module antidote protein, HigA family; Region: antidote_HigA; TIGR02607
160488005138	Plasmid maintenance system killer protein; Region: Plasmid_killer; cl01422
160488005139	Na+/H+ antiporter, bacterial form; Region: a_cpa1; TIGR00831
160488005140	succinyldiaminopimelate transaminase; Provisional; Region: PRK09147
160488005141	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
160488005142	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488005143	homodimer interface [polypeptide binding]; other site
160488005144	catalytic residue [active]
160488005145	PII uridylyl-transferase; Provisional; Region: glnD; PRK00275
160488005146	Nucleotidyltransferase (NT) domain of Escherichia coli adenylyltransferase (GlnE), Escherichia coli uridylyl transferase (GlnD), and similar proteins; Region: NT_GlnE_GlnD_like; cd05401
160488005147	metal binding triad; other site
160488005148	GlnD PII-uridylyltransferase; Region: GlnD_UR_UTase; pfam08335
160488005149	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
160488005150	Zn2+ binding site [ion binding]; other site
160488005151	Mg2+ binding site [ion binding]; other site
160488005152	ACT domain family, ACT_UUR-like_1, includes the first of two C-terminal ACT domains of the bacterial signal-transducing uridylyltransferase /uridylyl-removing (UUR) enzyme, GlnD and related domains; Region: ACT_UUR-like_1; cd04900
160488005153	C-terminal ACT domains of the bacterial signal-transducing uridylyltransferase /uridylyl-removing (UUR) enzyme, GlnD and related domains; Region: ACT_ACR-UUR-like_2; cd04899
160488005154	Methionine Aminopeptidase 1. E.C. 3.4.11.18. Also known as methionyl aminopeptidase and Peptidase M. Catalyzes release of N-terminal amino acids, preferentially methionine, from peptides and arylamides; Region: MetAP1; cd01086
160488005155	active site
160488005156	Ribosomal protein S2 (RPS2), involved in formation of the translation initiation complex, where it might contact the messenger RNA and several components of the ribosome. It has been shown that in Escherichia coli RPS2 is essential for the binding of...; Region: RPS2; cd01425
160488005157	rRNA interaction site [nucleotide binding]; other site
160488005158	S8 interaction site; other site
160488005159	putative laminin-1 binding site; other site
160488005160	elongation factor Ts; Provisional; Region: tsf; PRK09377
160488005161	UBA/TS-N domain; Region: UBA; pfam00627
160488005162	Elongation factor TS; Region: EF_TS; pfam00889
160488005163	Elongation factor TS; Region: EF_TS; pfam00889
160488005164	UMP kinase (UMPK)-Ec, the microbial/chloroplast uridine monophosphate kinase (uridylate kinase) enzyme that catalyzes UMP phosphorylation and plays a key role in pyrimidine nucleotide biosynthesis; regulation of this process is via feed-back control and...; Region: AAK_UMPK-PyrH-Ec; cd04254
160488005165	putative nucleotide binding site [chemical binding]; other site
160488005166	uridine monophosphate binding site [chemical binding]; other site
160488005167	homohexameric interface [polypeptide binding]; other site
160488005168	ribosome recycling factor; Reviewed; Region: frr; PRK00083
160488005169	Ribosome recycling factor (RRF). Ribosome recycling factor dissociates the posttermination complex, composed of the ribosome, deacylated tRNA, and mRNA, after termination of translation.  Thus ribosomes are "recycled" and ready for another...; Region: RRF; cd00520
160488005170	hinge region; other site
160488005171	Undecaprenyl pyrophosphate synthase [Lipid metabolism]; Region: UppS; COG0020
160488005172	Cis (Z)-Isoprenyl Diphosphate Synthases (cis-IPPS); homodimers which catalyze the successive 1'-4 condensation of the isopentenyl diphosphate (IPP) molecule to trans,trans-farnesyl diphosphate (FPP) or to cis,trans-FPP to form long-chain polyprenyl...; Region: CIS_IPPS; cd00475
160488005173	catalytic residue [active]
160488005174	putative FPP diphosphate  binding site; other site
160488005175	putative FPP binding hydrophobic cleft; other site
160488005176	dimer interface [polypeptide binding]; other site
160488005177	putative IPP diphosphate binding site; other site
160488005178	CDP-diglyceride synthetase [Lipid metabolism]; Region: CdsA; COG0575
160488005179	CDP-diglyceride synthase; Provisional; Region: cdsA; PRK11624
160488005180	1-deoxy-D-xylulose 5-phosphate reductoisomerase; Provisional; Region: PRK05447
160488005181	1-deoxy-D-xylulose 5-phosphate reductoisomerase; Region: DXP_reductoisom; pfam02670
160488005182	1-deoxy-D-xylulose 5-phosphate reductoisomerase C-terminal; Region: DXP_redisom_C; pfam08436
160488005183	DXP reductoisomerase C-terminal domain; Region: DXPR_C; pfam13288
160488005184	zinc metallopeptidase RseP; Provisional; Region: PRK10779
160488005185	RseP-like Site-2 proteases (S2P), zinc metalloproteases (MEROPS family M50A), cleave transmembrane domains of substrate proteins, regulating intramembrane proteolysis (RIP) of diverse signal transduction mechanisms. In Escherichia coli, the S2P homolog...; Region: S2P-M50_PDZ_RseP-like; cd06163
160488005186	active site
160488005187	PDZ domain of bacterial and plant zinc metalloprotases, presumably membrane-associated or integral membrane proteases, which may be involved in signalling and regulatory mechanisms. May be responsible for substrate recognition and/or binding, as most PDZ...; Region: PDZ_metalloprotease; cd00989
160488005188	protein binding site [polypeptide binding]; other site
160488005189	PDZ domain of bacterial and plant zinc metalloprotases, presumably membrane-associated or integral membrane proteases, which may be involved in signalling and regulatory mechanisms. May be responsible for substrate recognition and/or binding, as most PDZ...; Region: PDZ_metalloprotease; cd00989
160488005190	protein binding site [polypeptide binding]; other site
160488005191	RseP-like Site-2 proteases (S2P), zinc metalloproteases (MEROPS family M50A), cleave transmembrane domains of substrate proteins, regulating intramembrane proteolysis (RIP) of diverse signal transduction mechanisms. In Escherichia coli, the S2P homolog...; Region: S2P-M50_PDZ_RseP-like; cd06163
160488005192	putative substrate binding region [chemical binding]; other site
160488005193	outer membrane protein assembly complex, YaeT protein; Region: OM_YaeT; TIGR03303
160488005194	Surface antigen variable number repeat; Region: Surf_Ag_VNR; pfam07244
160488005195	Surface antigen variable number repeat; Region: Surf_Ag_VNR; pfam07244
160488005196	Surface antigen variable number repeat; Region: Surf_Ag_VNR; pfam07244
160488005197	Surface antigen variable number repeat; Region: Surf_Ag_VNR; pfam07244
160488005198	Surface antigen; Region: Bac_surface_Ag; pfam01103
160488005199	Outer membrane protein (OmpH-like); Region: OmpH; smart00935
160488005200	UDP-3-O-[3-hydroxymyristoyl] glucosamine N-acyltransferase; Provisional; Region: lpxD; PRK00892
160488005201	UDP-3-O-[3-hydroxymyristoyl] glucosamine N-acyltransferase, LpxD; Region: LpxD; pfam04613
160488005202	UDP-3-O-acyl-glucosamine N-acyltransferase (LpxD): The enzyme catalyzes the transfer of 3-hydroxymyristic acid or 3-hydroxy-arachidic acid, depending on the organism, from the acyl carrier protein (ACP) to UDP-3-O-acyl-glucosamine to produce UDP-2; Region: LbH_LpxD; cd03352
160488005203	trimer interface [polypeptide binding]; other site
160488005204	active site
160488005205	UDP-GlcNAc binding site [chemical binding]; other site
160488005206	lipid binding site [chemical binding]; lipid-binding site
160488005207	FabZ is a 17kD beta-hydroxyacyl-acyl carrier protein (ACP) dehydratase that primarily catalyzes the dehydration of beta-hydroxyacyl-ACP to trans-2-acyl-ACP, the third step in the elongation phase of the bacterial/ plastid, type II, fatty-acid...; Region: FabZ; cd01288
160488005208	UDP-N-acetylglucosamine acyltransferase; Provisional; Region: PRK05289
160488005209	UDP-N-acetylglucosamine O-acyltransferase (UDP-GlcNAc acyltransferase): Proteins in this family catalyze the transfer of (R)-3-hydroxymyristic acid from its acyl carrier protein thioester to UDP-GlcNAc. It is the first enzyme in the lipid A biosynthetic...; Region: LbH_UDP-GlcNAc_AT; cd03351
160488005210	active site
160488005211	lipid-A-disaccharide synthase; Reviewed; Region: lpxB; PRK00025
160488005212	ipid-A-disaccharide synthase; Provisional; Region: PRK14089
160488005213	bacterial Ribonuclease HII-like; Region: RNase_HII_bacteria_HII_like; cd07182
160488005214	RNA/DNA hybrid binding site [nucleotide binding]; other site
160488005215	active site
160488005216	DNA polymerase III subunit alpha; Validated; Region: dnaE; PRK05673
160488005217	Polymerase and Histidinol Phosphatase domain of alpha-subunit of bacterial polymerase III DnaE1; Region: PHP_PolIIIA_DnaE1; cd07433
160488005218	putative active site [active]
160488005219	putative PHP Thumb interface [polypeptide binding]; other site
160488005220	DnaE_OBF: A subfamily of OB folds corresponding to the C-terminal OB-fold nucleic acid binding domain of Thermus aquaticus and Escherichia coli type C replicative DNA polymerase III alpha subunit (DnaE). The DNA polymerase holoenzyme of E. coli contains...; Region: DnaE_OBF; cd04485
160488005221	generic binding surface II; other site
160488005222	generic binding surface I; other site
160488005223	acetyl-CoA carboxylase carboxyltransferase alpha subunit; Provisional; Region: accA; CHL00198
160488005224	acetyl-CoA carboxylase carboxyltransferase subunit alpha; Validated; Region: PRK05724
160488005225	N-terminal domain of predicted ATPase of the PP-loop faimly implicated in cell cycle control [Cell division and chromosome partitioning]. This is a subfamily of Adenine nucleotide alpha hydrolases superfamily.Adeninosine nucleotide alpha hydrolases...; Region: PP-ATPase; cd01992
160488005226	Ligand Binding Site [chemical binding]; other site
160488005227	TilS substrate binding domain; Region: TilS; pfam09179
160488005228	TilS substrate C-terminal domain; Region: TilS_C; pfam11734
160488005229	CTP synthetase; Validated; Region: pyrG; PRK05380
160488005230	CTP synthetase (CTPs) is a two-domain protein, which consists of an N-terminal synthetase domain and C-terminal glutaminase domain. The enzymes hydrolyze the amide bond of glutamine to ammonia and glutamate at the glutaminase domains and transfer nascent...; Region: CTGs; cd03113
160488005231	Catalytic site [active]
160488005232	active site
160488005233	UTP binding site [chemical binding]; other site
160488005234	Type 1 glutamine amidotransferase (GATase1) domain found in Cytidine Triphosphate Synthetase; Region: GATase1_CTP_Synthase; cd01746
160488005235	active site
160488005236	putative oxyanion hole; other site
160488005237	catalytic triad [active]
160488005238	2-dehydro-3-deoxyphosphooctonate aldolase; Provisional; Region: PRK05198
160488005239	DAHP synthetase I family; Region: DAHP_synth_1; pfam00793
160488005240	enolase; Provisional; Region: eno; PRK00077
160488005241	Enolase: Enolases are homodimeric enzymes that catalyse the reversible dehydration of 2-phospho-D-glycerate to phosphoenolpyruvate as part of the glycolytic and gluconeogenesis pathways. The reaction is facilitated by the presence of metal ions; Region: enolase; cd03313
160488005242	dimer interface [polypeptide binding]; other site
160488005243	metal binding site [ion binding]; metal-binding site
160488005244	substrate binding pocket [chemical binding]; other site
160488005245	Septum formation initiator [Cell division and chromosome partitioning]; Region: COG2919
160488005246	Septum formation initiator; Region: DivIC; cl17659
160488005247	CDP-ME synthetase is involved in mevalonate-independent isoprenoid production; Region: CDP-ME_synthetase; cd02516
160488005248	substrate binding site; other site
160488005249	dimer interface; other site
160488005250	LysR family transcriptional regulator; Provisional; Region: PRK14997
160488005251	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488005252	The C-terminal substrate binding domain of an uncharacterized LysR-type transcriptional regulator CrgA-like, contains the type 2 periplasmic binding domain; Region: PBP2_CrgA_like_1; cd08470
160488005253	putative effector binding pocket; other site
160488005254	putative dimerization interface [polypeptide binding]; other site
160488005255	class III alcohol dehydrogenases; Region: alcohol_DH_class_III; cd08300
160488005256	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase; Region: adh_III_F_hyde; TIGR02818
160488005257	substrate binding site [chemical binding]; other site
160488005258	catalytic Zn binding site [ion binding]; other site
160488005259	NAD binding site [chemical binding]; other site
160488005260	structural Zn binding site [ion binding]; other site
160488005261	dimer interface [polypeptide binding]; other site
160488005262	S-formylglutathione hydrolase; Region: PLN02442
160488005263	S-formylglutathione hydrolase; Region: fghA_ester_D; TIGR02821
160488005264	MECDP_synthase (2-C-methyl-D-erythritol-2,4-cyclodiphosphate synthase), encoded by the ispF gene, catalyzes the formation of 2-C-methyl-D-erythritol 2,4-cyclodiphosphate (MEC) in the non-mevalonate deoxyxylulose (DOXP) pathway for isoprenoid biosynthesis; Region: MECDP_synthase; cd00554
160488005265	homotrimer interaction site [polypeptide binding]; other site
160488005266	zinc binding site [ion binding]; other site
160488005267	CDP-binding sites; other site
160488005268	tRNA pseudouridine synthase D; Reviewed; Region: truD; PRK00984
160488005269	Pseudouridine synthase, similar to Escherichia coli TruD; Region: PseudoU_synth_EcTruD; cd02575
160488005270	Permutation of conserved domain; other site
160488005271	active site
160488005272	Pseudouridine synthases catalyze the isomerization of specific uridines in an RNA molecule to pseudouridines (5-ribosyluracil, psi); Region: PseudoU_synth; cl00130
160488005273	5'(3')-nucleotidase/polyphosphatase; Provisional; Region: surE; PRK00346
160488005274	protein-L-isoaspartate O-methyltransferase; Reviewed; Region: pcm; PRK00312
160488005275	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488005276	S-adenosylmethionine binding site [chemical binding]; other site
160488005277	Lysine Motif is a small domain involved in binding peptidoglycan; Region: LysM; cd00118
160488005278	Peptidase family M23; Region: Peptidase_M23; pfam01551
160488005279	RNA polymerase sigma factor RpoS; Validated; Region: PRK05657
160488005280	Sigma-70 factor, region 1.2; Region: Sigma70_r1_2; pfam00140
160488005281	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
160488005282	Sigma-70 region 3; Region: Sigma70_r3; pfam04539
160488005283	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
160488005284	DNA binding residues [nucleotide binding]
160488005285	INTRON04; Group II intron; Group II intron most similar to the Group II intron from Pseudomonas alcaligenes.
160488005286	RT_G2_intron: Reverse transcriptases (RTs) with group II intron origin. RT transcribes DNA using RNA as template. Proteins in this subfamily are found in bacterial and mitochondrial group II introns. Their most probable ancestor was a retrotransposable...; Region: RT_G2_intron; cd01651
160488005287	Reverse transcriptase (RNA-dependent DNA polymerase); Region: RVT_1; pfam00078
160488005288	putative active site [active]
160488005289	putative NTP binding site [chemical binding]; other site
160488005290	putative nucleic acid binding site [nucleotide binding]; other site
160488005291	Group II intron, maturase-specific domain; Region: GIIM; pfam08388
160488005292	4Fe-4S dicluster domain; Region: Fer4_7; pfam12838
160488005293	Domain of unknown function (DUF3470); Region: DUF3470; pfam11953
160488005294	DNA mismatch repair protein MutS; Provisional; Region: PRK05399
160488005295	MutS domain I; Region: MutS_I; pfam01624
160488005296	MutS domain II; Region: MutS_II; pfam05188
160488005297	MutS domain III; Region: MutS_III; pfam05192
160488005298	ATP-binding cassette domain of MutS1 homolog; Region: ABC_MutS1; cd03284
160488005299	Walker A/P-loop; other site
160488005300	ATP binding site [chemical binding]; other site
160488005301	Q-loop/lid; other site
160488005302	ABC transporter signature motif; other site
160488005303	Walker B; other site
160488005304	D-loop; other site
160488005305	H-loop/switch region; other site
160488005306	Uncharacterized protein (competence- and mitomycin-induced) [General function prediction only]; Region: CinA; COG1546
160488005307	recombinase A; Provisional; Region: recA; PRK09354
160488005308	RecA is a  bacterial enzyme which has roles in homologous recombination, DNA repair, and the induction of the SOS response.  RecA couples ATP hydrolysis to DNA strand exchange; Region: recA; cd00983
160488005309	hexamer interface [polypeptide binding]; other site
160488005310	Walker A motif; other site
160488005311	ATP binding site [chemical binding]; other site
160488005312	Walker B motif; other site
160488005313	recombination regulator RecX; Reviewed; Region: recX; PRK00117
160488005314	Predicted Rossmann fold nucleotide-binding protein [General function prediction only]; Region: COG1611
160488005315	Domain of unknown function (DUF4146); Region: DUF4146; pfam13652
160488005316	Uncharacterized conserved protein [Function unknown]; Region: COG3148
160488005317	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
160488005318	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488005319	active site
160488005320	phosphorylation site [posttranslational modification]
160488005321	intermolecular recognition site; other site
160488005322	dimerization interface [polypeptide binding]; other site
160488005323	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
160488005324	DNA binding residues [nucleotide binding]
160488005325	dimerization interface [polypeptide binding]; other site
160488005326	Diacylglycerol kinase [Cell envelope biogenesis, outer membrane]; Region: DgkA; COG0818
160488005327	putative DNA-binding transcriptional regulator; Provisional; Region: PRK10837
160488005328	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488005329	C-terminal substrate binding domain of LysR-type transcriptional regulator CysL, which activates the transcription of the cysJI operon encoding sulfite reductase, contains the type 2 periplasmic binding fold; Region: PBP2_CysL_like; cd08420
160488005330	putative dimerization interface [polypeptide binding]; other site
160488005331	Flavodoxin reductases (ferredoxin-NADPH reductases) family 1 [Energy production and conversion]; Region: Hmp; COG1018
160488005332	Ferredoxin-NADP+ (oxido)reductase is an FAD-containing enzyme that catalyzes the reversible electron transfer between NADP(H) and electron carrier proteins such as ferredoxin and flavodoxin. Isoforms of these flavoproteins (i.e. having a non-covalently...; Region: FNR1; cd06195
160488005333	FAD binding pocket [chemical binding]; other site
160488005334	FAD binding motif [chemical binding]; other site
160488005335	phosphate binding motif [ion binding]; other site
160488005336	beta-alpha-beta structure motif; other site
160488005337	NAD binding pocket [chemical binding]; other site
160488005338	hypothetical protein; Provisional; Region: PRK04860
160488005339	SprT homologues; Region: SprT; cl01182
160488005340	Protein of unknown function (DUF1282); Region: DUF1282; pfam06930
160488005341	tRNA 2-thiocytidine biosynthesis protein TtcA; Provisional; Region: PRK10696
160488005342	This is a subfamily of Adenine nucleotide alpha hydrolases superfamily.Adeninosine nucleotide alpha hydrolases superfamily  includes N type ATP PPases and ATP sulphurylases. It forms a apha/beta/apha fold which  binds to Adenosine group.  This subfamily; Region: Alpha_ANH_like_II; cd01993
160488005343	Ligand Binding Site [chemical binding]; other site
160488005344	3-methyladenine DNA glycosylase [DNA replication, recombination, and repair]; Region: Tag; COG2818
160488005345	Predicted membrane protein [Function unknown]; Region: COG3308
160488005346	Flavodoxin-like fold; Region: Flavodoxin_2; cl00438
160488005347	NADPH-dependent FMN reductase; Region: FMN_red; pfam03358
160488005348	Arsenate Reductase (ArsC) family, ArsC subfamily; arsenic reductases similar to that encoded by arsC on the R733 plasmid of Escherichia coli. E. coli ArsC catalyzes the reduction of arsenate [As(V)] to arsenite [As(III)], the first step in the...; Region: ArsC_ArsC; cd03034
160488005349	ArsC family; Region: ArsC; pfam03960
160488005350	catalytic residues [active]
160488005351	TlpA-like family; composed of  TlpA, ResA, DsbE and similar proteins. TlpA, ResA and DsbE are bacterial protein disulfide reductases with important roles in cytochrome maturation. They are membrane-anchored proteins with a soluble TRX domain containing a...; Region: TlpA_like_family; cd02966
160488005352	Thioredoxin-like; Region: Thioredoxin_8; pfam13905
160488005353	catalytic residues [active]
160488005354	Heat shock protein [Posttranslational modification, protein turnover, chaperones]; Region: HslJ; COG3187
160488005355	Lactate dehydrogenase and related dehydrogenases [Energy production and conversion / Coenzyme metabolism / General function prediction only]; Region: LdhA; COG1052
160488005356	D-Lactate and related Dehydrogenases, NAD-binding and catalytic domains; Region: LDH_like_2; cd12183
160488005357	putative ligand binding site [chemical binding]; other site
160488005358	putative NAD binding site [chemical binding]; other site
160488005359	catalytic site [active]
160488005360	hybrid sensory histidine kinase BarA; Provisional; Region: PRK11107
160488005361	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
160488005362	dimerization interface [polypeptide binding]; other site
160488005363	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488005364	dimer interface [polypeptide binding]; other site
160488005365	phosphorylation site [posttranslational modification]
160488005366	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488005367	ATP binding site [chemical binding]; other site
160488005368	Mg2+ binding site [ion binding]; other site
160488005369	G-X-G motif; other site
160488005370	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488005371	active site
160488005372	phosphorylation site [posttranslational modification]
160488005373	intermolecular recognition site; other site
160488005374	dimerization interface [polypeptide binding]; other site
160488005375	Histidine Phosphotransfer domain, involved in signalling through a two part component systems in which an autophosphorylating histidine protein kinase serves as a phosphoryl donor to a response regulator protein; the response regulator protein is...; Region: HPT; cd00088
160488005376	putative binding surface; other site
160488005377	active site
160488005378	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
160488005379	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488005380	active site
160488005381	phosphorylation site [posttranslational modification]
160488005382	intermolecular recognition site; other site
160488005383	dimerization interface [polypeptide binding]; other site
160488005384	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
160488005385	DNA binding site [nucleotide binding]
160488005386	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
160488005387	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
160488005388	dimerization interface [polypeptide binding]; other site
160488005389	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488005390	dimer interface [polypeptide binding]; other site
160488005391	phosphorylation site [posttranslational modification]
160488005392	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488005393	ATP binding site [chemical binding]; other site
160488005394	Mg2+ binding site [ion binding]; other site
160488005395	G-X-G motif; other site
160488005396	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3547
160488005397	Transposase; Region: DEDD_Tnp_IS110; pfam01548
160488005398	Transposase IS116/IS110/IS902 family; Region: Transposase_20; pfam02371
160488005399	cysteine synthase B; Region: cysM; TIGR01138
160488005400	CBS_like: This subgroup includes Cystathionine beta-synthase (CBS) and Cysteine synthase. CBS is a unique heme-containing enzyme that catalyzes a pyridoxal 5'-phosphate (PLP)-dependent condensation of serine and homocysteine to give cystathionine; Region: CBS_like; cd01561
160488005401	dimer interface [polypeptide binding]; other site
160488005402	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488005403	catalytic residue [active]
160488005404	23S rRNA m(5)U1939 methyltransferase; Reviewed; Region: rumA; PRK13168
160488005405	TRAM domain; Region: TRAM; pfam01938
160488005406	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488005407	S-adenosylmethionine binding site [chemical binding]; other site
160488005408	Guanosine polyphosphate pyrophosphohydrolases/synthetases [Signal transduction mechanisms / Transcription]; Region: SpoT; COG0317
160488005409	HD domain; Region: HD_4; pfam13328
160488005410	Nucleotidyltransferase (NT) domain of RelA- and SpoT-like ppGpp synthetases and hydrolases; Region: NT_Rel-Spo_like; cd05399
160488005411	synthetase active site [active]
160488005412	NTP binding site [chemical binding]; other site
160488005413	metal binding site [ion binding]; metal-binding site
160488005414	TGS_RelA_SpoT: The RelA (SpoT) protein, also referred to as ppGpp hydrolase/synthetase, is a ribosome-associated protein that is activated during amino acid starvation and thought to mediate the stringent response. RelA contains a TGS domain, named after...; Region: TGS_RelA_SpoT; cd01668
160488005415	ACT  domain found C-terminal of the RelA/SpoT domains; Region: ACT_RelA-SpoT; cd04876
160488005416	nucleoside triphosphate pyrophosphohydrolase; Reviewed; Region: mazG; PRK09562
160488005417	Nucleoside Triphosphate Pyrophosphohydrolase (EC 3.6.1.8) N-terminal tandem-domain of MazG proteins from Escherichia coli and bacterial homologs; Region: NTP-PPase_MazG_Nterm; cd11528
160488005418	homodimer interface [polypeptide binding]; other site
160488005419	metal binding site [ion binding]; metal-binding site
160488005420	Nucleoside Triphosphate Pyrophosphohydrolase (EC 3.6.1.8) C-terminal tandem-domain of MazG proteins from Escherichia coli and bacterial homologs' Region: NTP-PPase_MazG_Cterm; cd11529
160488005421	homodimer interface [polypeptide binding]; other site
160488005422	active site
160488005423	putative chemical substrate binding site [chemical binding]; other site
160488005424	metal binding site [ion binding]; metal-binding site
160488005425	Uncharacterized protein conserved in bacteria (DUF2058); Region: DUF2058; pfam09831
160488005426	Membrane bound FAD containing D-sorbitol dehydrogenase; Region: FAD-SLDH; pfam12318
160488005427	Choline dehydrogenase and related flavoproteins [Amino acid transport and metabolism]; Region: BetA; COG2303
160488005428	putative FAD-binding dehydrogenase; Reviewed; Region: PRK12834
160488005429	GMC oxidoreductase; Region: GMC_oxred_C; pfam05199
160488005430	Protein of unknown function (DUF3108); Region: DUF3108; pfam11306
160488005431	phosphoribosylglycinamide formyltransferase; Reviewed; Region: purN; PRK05647
160488005432	Phosphoribosylglycinamide formyltransferase (GAR transformylase, GART); Region: FMT_core_GART; cd08645
160488005433	active site
160488005434	substrate binding site [chemical binding]; other site
160488005435	cosubstrate binding site; other site
160488005436	catalytic site [active]
160488005437	phosphoribosylaminoimidazole synthetase; Provisional; Region: PRK05385
160488005438	PurM (Aminoimidazole Ribonucleotide [AIR] synthetase), one of eleven enzymes required for purine biosynthesis, catalyzes the conversion of formylglycinamide ribonucleotide (FGAM) and ATP to AIR, ADP, and Pi, the fifth step in de novo purine biosynthesis; Region: PurM; cd02196
160488005439	dimerization interface [polypeptide binding]; other site
160488005440	putative ATP binding site [chemical binding]; other site
160488005441	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3249
160488005442	Uncharacterized protein conserved in bacteria (DUF2066); Region: DUF2066; pfam09839
160488005443	Domain of unknown function DUF20; Region: UPF0118; pfam01594
160488005444	Predicted permease, member of the PurR regulon [General function prediction only]; Region: yhhT; COG0628
160488005445	ATPase involved in DNA replication initiation [DNA replication, recombination, and repair]; Region: DnaA; COG0593
160488005446	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488005447	Walker A motif; other site
160488005448	ATP binding site [chemical binding]; other site
160488005449	Walker B motif; other site
160488005450	arginine finger; other site
160488005451	Cell wall-associated hydrolases (invasion-associated proteins) [Cell envelope biogenesis, outer membrane]; Region: Spr; COG0791
160488005452	NlpC/P60 family; Region: NLPC_P60; pfam00877
160488005453	Cell wall-associated hydrolases (invasion-associated proteins) [Cell envelope biogenesis, outer membrane]; Region: Spr; COG0791
160488005454	NlpC/P60 family; Region: NLPC_P60; pfam00877
160488005455	Cob(I)alamin adenosyltransferase N terminal; Region: Co_AT_N; pfam12557
160488005456	ATP:corrinoid adenosyltransferase [Coenzyme metabolism]; Region: BtuR; COG2109
160488005457	ATP:corrinoid adenosyltransferase BtuR/CobO/CobP. This family consists of the BtuR, CobO, CobP proteins all of which are Cob(I)alamin (vitamin B12) adenosyltransferase, which is involved in cobalamin (vitamin B12) biosynthesis. This enzyme is a homodimer; Region: CobA_CobO_BtuR; cd00561
160488005458	Walker A motif; other site
160488005459	homodimer interface [polypeptide binding]; other site
160488005460	ATP binding site [chemical binding]; other site
160488005461	hydroxycobalamin binding site [chemical binding]; other site
160488005462	Walker B motif; other site
160488005463	cobyrinic acid a,c-diamide synthase; Validated; Region: PRK01077
160488005464	The Fer4_NifH superfamily contains a variety of proteins which share a common ATP-binding domain. Functionally, proteins in this superfamily use the energy from hydrolysis of NTP to transfer electron or ion; Region: Fer4_NifH; cl17203
160488005465	Type 1 glutamine amidotransferase (GATase1) domain found in Cobyrinic Acid a,c-Diamide Synthase; Region: GATase1_CobB; cd03130
160488005466	catalytic triad [active]
160488005467	Subfamily of the nitroreductase family that includes BluB protein in Rhodobacter capsulatus is involved in the conversion of cobinamide to cobalamin in Cobalamin (vitamin B12) biosynthesis. Nitroreductases typically reduce their substrates by using NAD(P)...; Region: BluB; cd02145
160488005468	putative FMN binding site [chemical binding]; other site
160488005469	cobalamin biosynthesis protein; Provisional; Region: cobD; PRK01209
160488005470	threonine-phosphate decarboxylase; Reviewed; Region: PRK05664
160488005471	L-threonine-O-3-phosphate decarboxylase; Region: L_thr_O3P_dcar; TIGR01140
160488005472	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
160488005473	catalytic residue [active]
160488005474	cobyric acid synthase; Provisional; Region: PRK00784
160488005475	Dethiobiotin synthetase [Coenzyme metabolism]; Region: BioD; COG0132
160488005476	Type 1 glutamine amidotransferase (GATase1) domain found in Cobyric Acid Synthase (CobQ); Region: GATase1_CobQ; cd01750
160488005477	catalytic triad [active]
160488005478	Adenosylcobinamide kinase / adenosylcobinamide phosphate guanyltransferase (CobU). CobU is bifunctional cobalbumin biosynthesis enzymes which display adenosylcobinamide kinase and adenosylcobinamide phosphate guanyltransferase activity. This enzyme is a...; Region: CobU; cd00544
160488005479	homotrimer interface [polypeptide binding]; other site
160488005480	Walker A motif; other site
160488005481	GTP binding site [chemical binding]; other site
160488005482	Phosphoribosyltransferase; Region: DBI_PRT; pfam02277
160488005483	Nicotinate-nucleotide-dimethylbenzimidazole phosphoribosyltransferase (DMB-PRT), also called CobT; Region: DMB-PRT_CobT; cd02439
160488005484	putative dimer interface [polypeptide binding]; other site
160488005485	active site pocket [active]
160488005486	putative cataytic base [active]
160488005487	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
160488005488	catalytic core [active]
160488005489	cobalamin synthase; Reviewed; Region: cobS; PRK00235
160488005490	Cellulase (glycosyl hydrolase family 5); Region: Cellulase; pfam00150
160488005491	Transcriptional regulators [Transcription]; Region: MarR; COG1846
160488005492	MarR family; Region: MarR_2; pfam12802
160488005493	oxalate/formate antiporter family transporter; Region: 2A0111; TIGR00890
160488005494	Glutathione (GSH) peroxidase family; tetrameric selenoenzymes that catalyze the reduction of a variety of hydroperoxides including lipid peroxidases, using GSH as a specific electron donor substrate. GSH peroxidase contains one selenocysteine residue per...; Region: GSH_Peroxidase; cd00340
160488005495	catalytic residues [active]
160488005496	dimer interface [polypeptide binding]; other site
160488005497	Protein of unknown function (DUF2798); Region: DUF2798; pfam11391
160488005498	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488005499	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488005500	The C-terminal substrate binding domain of LysR-type transcriptional regulator CrgA and its related homologs, contains the type 2 periplasmic binding domain; Region: PBP2_CrgA_like; cd08422
160488005501	putative effector binding pocket; other site
160488005502	dimerization interface [polypeptide binding]; other site
160488005503	Long-chain fatty acid transport protein [Lipid metabolism]; Region: FadL; COG2067
160488005504	Predicted nuclease of restriction endonuclease-like fold, RmuC family [General function prediction only]; Region: COG1322
160488005505	RmuC family; Region: RmuC; pfam02646
160488005506	Na+/proline symporter [Amino acid transport and metabolism / General function prediction only]; Region: PutP; COG0591
160488005507	Na binding site [ion binding]; other site
160488005508	PAS domain; Region: PAS; smart00091
160488005509	PAS fold; Region: PAS_7; pfam12860
160488005510	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
160488005511	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488005512	dimer interface [polypeptide binding]; other site
160488005513	phosphorylation site [posttranslational modification]
160488005514	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488005515	ATP binding site [chemical binding]; other site
160488005516	Mg2+ binding site [ion binding]; other site
160488005517	G-X-G motif; other site
160488005518	FOG: CheY-like receiver [Signal transduction mechanisms]; Region: CheY; COG0784
160488005519	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488005520	active site
160488005521	phosphorylation site [posttranslational modification]
160488005522	intermolecular recognition site; other site
160488005523	dimerization interface [polypeptide binding]; other site
160488005524	Major Facilitator Superfamily; Region: MFS_1; pfam07690
160488005525	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488005526	putative substrate translocation pore; other site
160488005527	Transcriptional regulators [Transcription]; Region: PhnF; COG2188
160488005528	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488005529	DNA-binding site [nucleotide binding]; DNA binding site
160488005530	UTRA domain; Region: UTRA; pfam07702
160488005531	benzoate transport; Region: 2A0115; TIGR00895
160488005532	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488005533	putative substrate translocation pore; other site
160488005534	Predicted metal-dependent hydrolase of the TIM-barrel fold [General function prediction only]; Region: COG3618
160488005535	Superfamily of metallo-dependent hydrolases (also called amidohydrolase superfamily) is a large group of proteins that show conservation in their 3-dimensional fold (TIM barrel) and in details of their active site. The vast majority of the members have a...; Region: metallo-dependent_hydrolases; cl00281
160488005536	active site
160488005537	H+ Antiporter protein; Region: 2A0121; TIGR00900
160488005538	1-acyl-sn-glycerol-3-phosphate acyltransferase [Lipid metabolism]; Region: PlsC; COG0204
160488005539	Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: AGPAT-like; Region: LPLAT_AGPAT-like; cd07989
160488005540	putative acyl-acceptor binding pocket; other site
160488005541	Small Multidrug Resistance protein; Region: Multi_Drug_Res; cl00910
160488005542	recombination associated protein; Reviewed; Region: rdgC; PRK00321
160488005543	Nitrate reductases, NapA (Nitrate-R-NapA), NasA, and NarB catalyze the reduction of nitrate to nitrite. Monomeric Nas is located in the cytoplasm and participates in nitrogen assimilation. Dimeric Nap is located in the periplasm and is coupled to quinol...; Region: MopB_Nitrate-R-NapA-like; cd02754
160488005544	formate dehydrogenase, alpha subunit, archaeal-type; Region: Fdh-alpha; TIGR01591
160488005545	[4Fe-4S] binding site [ion binding]; other site
160488005546	molybdopterin cofactor binding site; other site
160488005547	Nitrate reductases, NapA (Nitrate-R-NapA), NasA, and NarB catalyze the reduction of nitrate to nitrite. Monomeric Nas is located in the cytoplasm and participates in nitrogen assimilation. Dimeric Nap is located in the periplasm and is coupled to quinol...; Region: MopB_CT_Nitrate-R-NapA-like; cd02791
160488005548	molybdopterin cofactor binding site; other site
160488005549	Sulfite reductase, alpha subunit (flavoprotein) [Inorganic ion transport and metabolism]; Region: CysJ; COG0369
160488005550	Flavodoxin; Region: Flavodoxin_1; pfam00258
160488005551	Cytochrome p450- like alpha subunits of E. coli sulfite reductase (SiR) multimerize with beta subunits to catalyze the NADPH dependent reduction of sulfite to sulfide. Beta subunits have an Fe4S4 cluster and a siroheme, while the alpha subunits (cysJ...; Region: SiR; cd06199
160488005552	FAD binding pocket [chemical binding]; other site
160488005553	FAD binding motif [chemical binding]; other site
160488005554	catalytic residues [active]
160488005555	NAD binding pocket [chemical binding]; other site
160488005556	phosphate binding motif [ion binding]; other site
160488005557	beta-alpha-beta structure motif; other site
160488005558	nitrite reductase subunit NirD; Provisional; Region: PRK14989
160488005559	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
160488005560	Nitrite/Sulfite reductase ferredoxin-like half domain; Region: NIR_SIR_ferr; pfam03460
160488005561	Assimilatory nitrite reductase (NirD) family, Rieske domain; Assimilatory nitrate and nitrite reductases convert nitrate through nitrite to ammonium. Members include bacterial and fungal proteins. The bacterial NirD contains a single Rieske domain while...; Region: Rieske_NirD; cd03529
160488005562	Lactate dehydrogenase and related dehydrogenases [Energy production and conversion / Coenzyme metabolism / General function prediction only]; Region: LdhA; COG1052
160488005563	Hydroxy(phenyl)pyruvate Reductase, D-isomer-specific 2-hydroxyacid-related dehydrogenase; Region: HPPR; cd12156
160488005564	putative ligand binding site [chemical binding]; other site
160488005565	NAD binding site [chemical binding]; other site
160488005566	catalytic site [active]
160488005567	3-ketoacyl-(acyl-carrier-protein) reductase; Validated; Region: fabG; PRK05653
160488005568	classical (c) SDRs; Region: SDR_c; cd05233
160488005569	NAD(P) binding site [chemical binding]; other site
160488005570	active site
160488005571	2-keto-4-pentenoate hydratase/2-oxohepta-3-ene-1,7-dioic acid hydratase (catechol pathway) [Secondary metabolites biosynthesis, transport, and catabolism]; Region: MhpD; COG0179
160488005572	Fumarylacetoacetate (FAA) hydrolase family; Region: FAA_hydrolase; pfam01557
160488005573	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488005574	D-galactonate transporter; Region: 2A0114; TIGR00893
160488005575	putative substrate translocation pore; other site
160488005576	AraC-type DNA-binding domain-containing proteins [Transcription]; Region: AraC; COG2207
160488005577	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488005578	pca operon transcription factor PcaQ; Region: TF_pcaQ; TIGR02424
160488005579	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488005580	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
160488005581	dimerization interface [polypeptide binding]; other site
160488005582	Domain amino terminal to FKBP-type peptidyl-prolyl isomerase; Region: FKBP_N; pfam01346
160488005583	FKBP-type peptidyl-prolyl cis-trans isomerases 1 [Posttranslational modification, protein turnover, chaperones]; Region: FkpA; COG0545
160488005584	FKBP-type peptidyl-prolyl cis-trans isomerase; Region: FKBP_C; pfam00254
160488005585	Uncharacterized conserved protein [Function unknown]; Region: COG3339
160488005586	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
160488005587	salt bridge; other site
160488005588	non-specific DNA binding site [nucleotide binding]; other site
160488005589	sequence-specific DNA binding site [nucleotide binding]; other site
160488005590	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
160488005591	The CBS domain, named after human CBS, is a small domain originally identified in cystathionine beta-synthase and is subsequently found in a wide range of different proteins. CBS domains usually occur in tandem repeats. They associate to form a so-called...; Region: CBS_pair; cl15354
160488005592	carboxy-terminal protease; Provisional; Region: PRK11186
160488005593	C-terminal processing peptidase family S41; Region: Peptidase_S41; cl02526
160488005594	PDZ domain of C-terminal processing-, tail-specific-, and tricorn proteases, which function in posttranslational protein processing, maturation, and disassembly or degradation, in Bacteria, Archaea, and plant chloroplasts. May be responsible for...; Region: PDZ_CTP_protease; cd00988
160488005595	protein binding site [polypeptide binding]; other site
160488005596	C-terminal processing peptidase; serine protease family S41; Region: Peptidase_S41_CPP; cd07560
160488005597	Catalytic dyad [active]
160488005598	C-terminal domain of tail specific protease (DUF3340); Region: DUF3340; pfam11818
160488005599	putative NAD(P)H quinone oxidoreductase, PIG3 family; Region: quinone_pig3; TIGR02824
160488005600	PIG3 p53-inducible quinone oxidoreductase; Region: p53_inducible_oxidoreductase; cd05276
160488005601	NAD(P) binding site [chemical binding]; other site
160488005602	Phosphoserine phosphatase [Amino acid transport and metabolism]; Region: SerB; COG0560
160488005603	haloacid dehalogenase-like hydrolase; Region: HAD; cl17202
160488005604	ABC-type spermidine/putrescine transport systems, ATPase components [Amino acid transport and metabolism]; Region: PotA; COG3842
160488005605	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488005606	Walker A/P-loop; other site
160488005607	ATP binding site [chemical binding]; other site
160488005608	Q-loop/lid; other site
160488005609	ABC transporter signature motif; other site
160488005610	Walker B; other site
160488005611	D-loop; other site
160488005612	H-loop/switch region; other site
160488005613	ABC-type spermidine/putrescine transport system, permease component II [Amino acid transport and metabolism]; Region: PotC; COG1177
160488005614	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488005615	dimer interface [polypeptide binding]; other site
160488005616	conserved gate region; other site
160488005617	putative PBP binding loops; other site
160488005618	ABC-ATPase subunit interface; other site
160488005619	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488005620	dimer interface [polypeptide binding]; other site
160488005621	conserved gate region; other site
160488005622	putative PBP binding loops; other site
160488005623	ABC-ATPase subunit interface; other site
160488005624	Uncharacterized proteins of the AP superfamily [General function prediction only]; Region: COG1524
160488005625	Sulfatase; Region: Sulfatase; cl17466
160488005626	ABC-type Fe3+ transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: AfuA; COG1840
160488005627	Bacterial extracellular solute-binding protein; Region: SBP_bac_8; pfam13416
160488005628	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488005629	transcriptional regulator protein; Region: phnR; TIGR03337
160488005630	DNA-binding site [nucleotide binding]; DNA binding site
160488005631	UTRA domain; Region: UTRA; pfam07702
160488005632	Small-conductance mechanosensitive channel [Cell envelope biogenesis, outer membrane]; Region: MscS; COG0668
160488005633	Mechanosensitive ion channel; Region: MS_channel; pfam00924
160488005634	M18 Peptidase Aspartyl aminopeptidase; Region: M18_DAP; cd05658
160488005635	Aminopeptidase I zinc metalloprotease (M18); Region: Peptidase_M18; pfam02127
160488005636	active site
160488005637	metal binding site [ion binding]; metal-binding site
160488005638	cell division topological specificity factor MinE; Reviewed; Region: minE; PRK00296
160488005639	Septum formation inhibitor-activating ATPase [Cell division and chromosome partitioning]; Region: MinD; COG2894
160488005640	Bacterial cell division requires the formation of a septum at mid-cell. The site is determined by the min operon products MinC, MinD and MinE. MinC is a nonspecific inhibitor of the septum protein FtsZ. MinE is the supressor of MinC. MinD plays a pivotal...; Region: MinD; cd02036
160488005641	Switch I; other site
160488005642	Switch II; other site
160488005643	septum formation inhibitor; Reviewed; Region: minC; PRK00339
160488005644	Septum formation inhibitor MinC, N-terminal domain; Region: MinC_N; pfam05209
160488005645	Septum formation inhibitor MinC, C-terminal domain; Region: MinC_C; pfam03775
160488005646	Bacterial lipid A biosynthesis acyltransferase; Region: Lip_A_acyltrans; pfam03279
160488005647	Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: LABLAT-like; Region: LPLAT_LABLAT-like; cd07984
160488005648	putative acyl-acceptor binding pocket; other site
160488005649	Predicted esterase of the alpha-beta hydrolase superfamily [General function prediction only]; Region: RssA; COG1752
160488005650	Hypothetical patatin similar to Z1214 protein of Escherichia coli; Region: Pat_hypo_Ecoli_Z1214_like; cd07209
160488005651	active site
160488005652	nucleophile elbow; other site
160488005653	VacJ like lipoprotein; Region: VacJ; cl01073
160488005654	Exo-beta-1,3-glucanase [Carbohydrate transport and metabolism]; Region: COG5309
160488005655	ABC-type proline/glycine betaine transport systems, periplasmic components [Amino acid transport and metabolism]; Region: ProX; COG2113
160488005656	Substrate binding domain of ABC-type glycine betaine transport system; Region: OpuAC; pfam04069
160488005657	Predicted membrane protein [Function unknown]; Region: COG3162
160488005658	Predicted symporter [General function prediction only]; Region: DhlC; COG4147
160488005659	Uncharacterized bacterial solute carrier 5 subfamily; putative solute-binding domain; Region: SLC5sbd_u4; cd11480
160488005660	Na binding site [ion binding]; other site
160488005661	Protein of unknown function (DUF3309); Region: DUF3309; pfam11752
160488005662	short chain dehydrogenase; Provisional; Region: PRK05650
160488005663	classical (c) SDRs; Region: SDR_c; cd05233
160488005664	NAD(P) binding site [chemical binding]; other site
160488005665	active site
160488005666	Global regulator protein family; Region: CsrA; pfam02599
160488005667	hypothetical protein; Provisional; Region: PRK00304
160488005668	Cellulase M and related proteins [Carbohydrate transport and metabolism]; Region: FrvX; COG1363
160488005669	M42 Peptidase, Endoglucanase-like subfamily; Region: M42_glucanase_like; cd05657
160488005670	putative oligomer interface [polypeptide binding]; other site
160488005671	putative active site [active]
160488005672	metal binding site [ion binding]; metal-binding site
160488005673	GNAT-family acetyltransferase TIGR03103; Region: trio_acet_GNAT
160488005674	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
160488005675	Coenzyme A binding pocket [chemical binding]; other site
160488005676	ATP-grasp domain; Region: ATP-grasp_4; cl17255
160488005677	asparagine synthase family amidotransferase; Region: trio_amidotrans; TIGR03104
160488005678	Glutamine amidotransferases class-II (GATase) asparagine synthase_B type.  Asparagine synthetase B catalyses the ATP-dependent conversion of aspartate to asparagine. This enzyme is a homodimer, with each monomer composed of a  glutaminase domain and a...; Region: AsnB; cd00712
160488005679	active site
160488005680	dimer interface [polypeptide binding]; other site
160488005681	The C-terminal domain of Asparagine Synthase B. This domain is always found associated n-terminal amidotransferase domain. Family members that contain this domain catalyse the conversion of aspartate to asparagine. Asparagine synthetase B  catalyzes the...; Region: Asn_Synthase_B_C; cd01991
160488005682	Ligand Binding Site [chemical binding]; other site
160488005683	Molecular Tunnel; other site
160488005684	bifunctional tRNA (mnm(5)s(2)U34)-methyltransferase/FAD-dependent cmnm(5)s(2)U34 oxidoreductase; Reviewed; Region: mnmC; PRK01747
160488005685	Uncharacterized conserved protein [Function unknown]; Region: COG4121
160488005686	polyphosphate:AMP phosphotransferase; Region: poly_P_AMP_trns; TIGR03708
160488005687	Polyphosphate kinase 2 (PPK2); Region: PPK2; cl11971
160488005688	Polyphosphate kinase 2 (PPK2); Region: PPK2; cl11971
160488005689	Permeases of the drug/metabolite transporter (DMT) superfamily [Carbohydrate transport and metabolism / Amino acid transport and metabolism / General function prediction only]; Region: RhaT; COG0697
160488005690	EamA-like transporter family; Region: EamA; pfam00892
160488005691	EamA-like transporter family; Region: EamA; pfam00892
160488005692	Alginate Lyase A1-III; enzymatically depolymerizes alginate, a complex copolymer of beta-D-mannuronate and alpha-L-guluronate, by cleaving the beta-(1,4) glycosidic bond; Region: AlgLyase; cl00179
160488005693	fumarate hydratase; Provisional; Region: PRK12425
160488005694	Class II fumarases; Region: Fumarase_classII; cd01362
160488005695	active site
160488005696	tetramer interface [polypeptide binding]; other site
160488005697	Uncharacterized protein conserved in bacteria (DUF2059); Region: DUF2059; cl01243
160488005698	BolA-like protein; Region: BolA; pfam01722
160488005699	Predicted sulfurtransferase [General function prediction only]; Region: COG1054
160488005700	Member of the Rhodanese Homology Domain superfamily. This CD includes Escherichia coli YceA, Bacillus subtilis YbfQ, and similar uncharacterized proteins; Region: RHOD_YceA; cd01518
160488005701	active site residue [active]
160488005702	Predicted protein-disulfide isomerase [Posttranslational modification, protein turnover, chaperones]; Region: COG3531
160488005703	DsbA family, FrnE-like subfamily; composed of uncharacterized proteins containing a CXXC motif with similarity to DsbA and FrnE. FrnE is presumed to be a thiol oxidoreductase involved in polyketide biosynthesis, specifically in the production of the...; Region: DsbA_FrnE_like; cd03025
160488005704	catalytic residues [active]
160488005705	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
160488005706	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488005707	ABC-type polar amino acid transport system, ATPase component [Amino acid transport and metabolism]; Region: GlnQ; COG1126
160488005708	Walker A/P-loop; other site
160488005709	ATP binding site [chemical binding]; other site
160488005710	Q-loop/lid; other site
160488005711	ABC transporter signature motif; other site
160488005712	Walker B; other site
160488005713	D-loop; other site
160488005714	H-loop/switch region; other site
160488005715	PAS domain S-box; Region: sensory_box; TIGR00229
160488005716	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488005717	putative active site [active]
160488005718	heme pocket [chemical binding]; other site
160488005719	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
160488005720	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488005721	metal binding site [ion binding]; metal-binding site
160488005722	active site
160488005723	I-site; other site
160488005724	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
160488005725	Pyrroloquinoline quinone (Coenzyme PQQ) biosynthesis protein C [Coenzyme metabolism]; Region: COG5424
160488005726	putative oxoacyl-(acyl carrier protein) reductase; Provisional; Region: PRK08945
160488005727	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
160488005728	NAD(P) binding site [chemical binding]; other site
160488005729	active site
160488005730	phosphoglycolate phosphatase; Provisional; Region: PRK13222
160488005731	haloacid dehalogenase-like hydrolase; Region: HAD; cl17202
160488005732	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
160488005733	motif II; other site
160488005734	bifunctional 3-demethylubiquinone-9 3-methyltransferase/ 2-octaprenyl-6-hydroxy phenol methylase; Provisional; Region: PRK05134
160488005735	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488005736	S-adenosylmethionine binding site [chemical binding]; other site
160488005737	methylthioribose-1-phosphate isomerase; Reviewed; Region: mtnA; PRK05720
160488005738	S-methyl-5-thioribose-1-phosphate isomerase; Region: salvage_mtnA; TIGR00512
160488005739	DNA gyrase subunit A; Validated; Region: PRK05560
160488005740	DNA Topoisomerase, subtype IIA; domain A'; bacterial DNA topoisomerase IV (C subunit, ParC), bacterial DNA gyrases (A subunit, GyrA),mammalian DNA toposiomerases II. DNA topoisomerases are essential enzymes that regulate the conformational changes...; Region: TOP4c; cd00187
160488005741	CAP-like domain; other site
160488005742	active site
160488005743	primary dimer interface [polypeptide binding]; other site
160488005744	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
160488005745	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
160488005746	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
160488005747	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
160488005748	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
160488005749	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
160488005750	Phosphoserine aminotransferase (PSAT) family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major group in this CD corresponds to phosphoserine aminotransferase (PSAT).  PSAT is active as...; Region: PSAT_like; cd00611
160488005751	homodimer interface [polypeptide binding]; other site
160488005752	substrate-cofactor binding pocket; other site
160488005753	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488005754	catalytic residue [active]
160488005755	Chorismate mutase type II; Region: CM_2; cl00693
160488005756	Prephenate dehydratase [Amino acid transport and metabolism]; Region: PheA; COG0077
160488005757	Prephenate dehydratase; Region: PDT; pfam00800
160488005758	C-terminal ACT domain of the bifunctional chorismate mutase-prephenate dehydratase (CM-PDT) enzyme and the prephenate dehydratase (PDT) enzyme; Region: ACT_CM-PDT; cd04905
160488005759	putative L-Phe binding site [chemical binding]; other site
160488005760	bifunctional cyclohexadienyl dehydrogenase/ 3-phosphoshikimate 1-carboxyvinyltransferase; Provisional; Region: PRK14806
160488005761	prephenate dehydrogenase; Validated; Region: PRK08507
160488005762	EPSP synthase domain. 3-phosphoshikimate 1-carboxyvinyltransferase (5-enolpyruvylshikimate-3-phosphate synthase) (EC 2.5.1.19) catalyses the reaction between shikimate-3-phosphate (S3P) and phosphoenolpyruvate (PEP) to form...; Region: EPSP_synthase; cd01556
160488005763	hinge; other site
160488005764	active site
160488005765	cytidylate kinase; Provisional; Region: cmk; PRK00023
160488005766	Cytidine monophosphate kinase (CMPK) catalyzes the reversible phosphorylation of cytidine monophosphate (CMP) to produce cytidine diphosphate (CDP), using ATP as the preferred phosphoryl donor; Region: CMPK; cd02020
160488005767	CMP-binding site; other site
160488005768	The sites determining sugar specificity; other site
160488005769	30S ribosomal protein S1; Reviewed; Region: rpsA; PRK06299
160488005770	S1_RPS1_repeat_ec1_hs1: Ribosomal protein S1 (RPS1) domain. RPS1 is a component of the small ribosomal subunit thought to be involved in the recognition and binding of mRNA's during translation initiation. The bacterial RPS1 domain architecture...; Region: S1_RPS1_repeat_ec1_hs1; cd05687
160488005771	RNA binding site [nucleotide binding]; other site
160488005772	S1_RPS1_repeat_ec2_hs2: Ribosomal protein S1 (RPS1) domain. RPS1 is a component of the small ribosomal subunit thought to be involved in the recognition and binding of mRNA's during translation initiation. The bacterial RPS1 domain architecture...; Region: S1_RPS1_repeat_ec2_hs2; cd04465
160488005773	RNA binding site [nucleotide binding]; other site
160488005774	S1_RPS1_repeat_ec3: Ribosomal protein S1 (RPS1) domain. RPS1 is a component of the small ribosomal subunit thought to be involved in the recognition and binding of mRNA's during translation initiation. The bacterial RPS1 domain architecture consists...; Region: S1_RPS1_repeat_ec3; cd05688
160488005775	RNA binding site [nucleotide binding]; other site
160488005776	S1_like: Ribosomal protein S1-like RNA-binding domain. Found in a wide variety of RNA-associated proteins. Originally identified in S1 ribosomal protein. This superfamily also contains the Cold Shock Domain (CSD), which is a homolog of the S1 domain; Region: S1_like; cl09927
160488005777	RNA binding site [nucleotide binding]; other site
160488005778	S1_like: Ribosomal protein S1-like RNA-binding domain. Found in a wide variety of RNA-associated proteins. Originally identified in S1 ribosomal protein. This superfamily also contains the Cold Shock Domain (CSD), which is a homolog of the S1 domain; Region: S1_like; cl09927
160488005779	RNA binding site [nucleotide binding]; other site
160488005780	S1_RPS1_repeat_ec6: Ribosomal protein S1 (RPS1) domain. RPS1 is a component of the small ribosomal subunit thought to be involved in the recognition and binding of mRNA's during translation initiation. The bacterial RPS1 domain architecture consists...; Region: S1_RPS1_repeat_ec6; cd05691
160488005781	RNA binding site [nucleotide binding]; other site
160488005782	Integration host factor (IHF) and HU are small heterodimeric members of the DNABII protein family that bind and bend DNA, functioning as architectural factors in many cellular processes including transcription, site-specific recombination, and...; Region: HU_IHF; cd00591
160488005783	IHF dimer interface [polypeptide binding]; other site
160488005784	IHF - DNA interface [nucleotide binding]; other site
160488005785	Predicted exonuclease of the beta-lactamase fold involved in RNA processing [Translation, ribosomal structure and biogenesis]; Region: YSH1; COG1236
160488005786	Metallo-beta-lactamase superfamily; Region: Lactamase_B; pfam00753
160488005787	Beta-Casp domain; Region: Beta-Casp; smart01027
160488005788	RNA-metabolising metallo-beta-lactamase; Region: RMMBL; pfam07521
160488005789	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase; Region: GMP_PMI; TIGR01479
160488005790	GDP-M1P_Guanylyltransferase catalyzes the formation of GDP-Mannose; Region: GDP-M1P_Guanylyltransferase; cd02509
160488005791	Substrate binding site; other site
160488005792	Mannose-6-phosphate isomerase; Region: MannoseP_isomer; pfam01050
160488005793	The phosphomannomutase/phosphoglucomutase (PMM/PGM) bifunctional enzyme catalyzes the reversible conversion of 1-phospho to 6-phospho-sugars (e.g. between mannose-1-phosphate and mannose-6-phosphate or glucose-1-phosphate and glucose-6-phosphate) via a...; Region: PMM_PGM; cd03089
160488005794	phosphomannomutase CpsG; Provisional; Region: PRK15414
160488005795	active site
160488005796	substrate binding site [chemical binding]; other site
160488005797	metal binding site [ion binding]; metal-binding site
160488005798	ABC-type polysaccharide/polyol phosphate export systems, permease component [Carbohydrate transport and metabolism / Cell envelope biogenesis, outer membrane]; Region: TagG; COG1682
160488005799	ABC-2 type transporter; Region: ABC2_membrane; pfam01061
160488005800	ABC-type polysaccharide/polyol phosphate transport system, ATPase component [Carbohydrate transport and metabolism / Cell envelope biogenesis, outer membrane]; Region: TagH; COG1134
160488005801	ATP-binding cassette component of polysaccharide transport system; Region: ABC_KpsT_Wzt; cd03220
160488005802	Walker A/P-loop; other site
160488005803	ATP binding site [chemical binding]; other site
160488005804	Q-loop/lid; other site
160488005805	ABC transporter signature motif; other site
160488005806	Walker B; other site
160488005807	D-loop; other site
160488005808	H-loop/switch region; other site
160488005809	C-Terminal domain of O-antigenic polysaccharide transporter protein Wzt and related proteins; Region: Wzt_C-like; cd10147
160488005810	putative carbohydrate binding site [chemical binding]; other site
160488005811	Methyltransferase domain; Region: Methyltransf_23; pfam13489
160488005812	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488005813	S-adenosylmethionine binding site [chemical binding]; other site
160488005814	Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. The acceptor molecule can be a lipid, a protein, a heterocyclic compound, or another carbohydrate...; Region: Glycosyltransferase_GTB_type; cl10013
160488005815	Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438
160488005816	Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. The acceptor molecule can be a lipid, a protein, a heterocyclic compound, or another carbohydrate...; Region: Glycosyltransferase_GTB_type; cl10013
160488005817	Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438
160488005818	This family is most closely related to the GT1 family of glycosyltransferases. mtfB (mannosyltransferase B) in E. coli has been shown to direct the growth of the O9-specific polysaccharide chain. It transfers two mannoses into the position 3 of the...; Region: GT1_mtfB_like; cd03809
160488005819	Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438
160488005820	Predicted acyltransferases [Lipid metabolism]; Region: COG1835
160488005821	dTDP-4-dehydrorhamnose 3,5-epimerase; Region: rmlC; TIGR01221
160488005822	G1P_TT_short is the short form of glucose-1-phosphate thymidylyltransferase; Region: G1P_TT_short; cd02538
160488005823	glucose-1-phosphate thymidylyltransferase, short form; Region: rmlA; TIGR01207
160488005824	substrate binding site; other site
160488005825	tetramer interface; other site
160488005826	dTDP-4-dehydrorhamnose reductase; Provisional; Region: PRK09987
160488005827	dTDP-6-deoxy-L-lyxo-4-hexulose reductase and related proteins, extended (e) SDRs; Region: dTDP_HR_like_SDR_e; cd05254
160488005828	NADP binding site [chemical binding]; other site
160488005829	active site
160488005830	putative substrate binding site [chemical binding]; other site
160488005831	dTDP-D-glucose 4,6-dehydratase [Cell envelope biogenesis, outer membrane]; Region: RfbB; COG1088
160488005832	dTDP-D-glucose 4,6-dehydratase, extended (e) SDRs; Region: dTDP_GD_SDR_e; cd05246
160488005833	NAD binding site [chemical binding]; other site
160488005834	substrate binding site [chemical binding]; other site
160488005835	homodimer interface [polypeptide binding]; other site
160488005836	active site
160488005837	FOG: TPR repeat [General function prediction only]; Region: NrfG; COG0457
160488005838	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
160488005839	binding surface
160488005840	TPR motif; other site
160488005841	Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438
160488005842	Glycosyl transferases group 1; Region: Glyco_trans_1_4; pfam13692
160488005843	Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. The acceptor molecule can be a lipid, a protein, a heterocyclic compound, or another carbohydrate...; Region: Glycosyltransferase_GTB_type; cl10013
160488005844	This family is most closely related to the GT1 family of glycosyltransferases. ExpE7 in Sinorhizobium meliloti has been shown to be involved in the biosynthesis of galactoglucans (exopolysaccharide II); Region: GT1_ExpE7_like; cd03823
160488005845	Glycosyltransferase Family 4; Region: Glyco_transf_4; pfam13439
160488005846	haloacid dehalogenase superfamily, subfamily IA, variant 1 with third motif having Dx(3-4)D or Dx(3-4)E; Region: HAD-SF-IA-v1; TIGR01549
160488005847	CMP-NeuAc_Synthase activates N-acetylneuraminic acid by adding CMP moiety; Region: CMP-NeuAc_Synthase; cd02513
160488005848	ligand binding site; other site
160488005849	tetramer interface; other site
160488005850	4-hydroxy-2-oxovalerate aldolase-like, N-terminal catalytic TIM barrel domain; Region: DRE_TIM_HOA_like; cd07944
160488005851	active site
160488005852	catalytic residues [active]
160488005853	metal binding site [ion binding]; metal-binding site
160488005854	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394
160488005855	Predicted glycosyltransferases [General function prediction only]; Region: COG1216
160488005856	Subfamily of Glycosyltransferase Family GT2 of unknown function; Region: GT_2_like_c; cd04186
160488005857	Probable Catalytic site; other site
160488005858	metal-binding site
160488005859	Cytochrome c biogenesis factor [Posttranslational modification, protein turnover, chaperones]; Region: COG4235
160488005860	Predicted glycosyltransferases [General function prediction only]; Region: COG1216
160488005861	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394
160488005862	active site
160488005863	Domain of unknown function (DUF4214); Region: DUF4214; pfam13946
160488005864	Domain of unknown function (DUF4214); Region: DUF4214; pfam13946
160488005865	type I secretion membrane fusion protein, HlyD family; Region: type_I_hlyD; TIGR01843
160488005866	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
160488005867	HlyD family secretion protein; Region: HlyD_3; pfam13437
160488005868	type I secretion outer membrane protein, TolC family; Region: type_I_sec_TolC; TIGR01844
160488005869	GDP-mannose 4,6 dehydratase, extended (e) SDRs; Region: GDP_MD_SDR_e; cd05260
160488005870	GDP-D-mannose dehydratase [Cell envelope biogenesis, outer membrane]; Region: Gmd; COG1089
160488005871	NADP-binding site; other site
160488005872	homotetramer interface [polypeptide binding]; other site
160488005873	substrate binding site [chemical binding]; other site
160488005874	homodimer interface [polypeptide binding]; other site
160488005875	active site
160488005876	GDP-mannose 4,6 dehydratase, extended (e) SDRs; Region: GDP_MD_SDR_e; cd05260
160488005877	NAD dependent epimerase/dehydratase family; Region: Epimerase; pfam01370
160488005878	NADP-binding site; other site
160488005879	homotetramer interface [polypeptide binding]; other site
160488005880	substrate binding site [chemical binding]; other site
160488005881	homodimer interface [polypeptide binding]; other site
160488005882	active site
160488005883	Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438
160488005884	This family is most closely related to the GT1 family of glycosyltransferases. mtfB (mannosyltransferase B) in E. coli has been shown to direct the growth of the O9-specific polysaccharide chain. It transfers two mannoses into the position 3 of the...; Region: GT1_mtfB_like; cd03809
160488005885	Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438
160488005886	This family is most closely related to the GT1 family of glycosyltransferases. Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. The acceptor molecule can...; Region: GT1_like_4; cd03795
160488005887	putative ADP-binding pocket [chemical binding]; other site
160488005888	UDP-glucose 4 epimerase, subgroup 4, extended (e) SDRs; Region: UDP_G4E_4_SDR_e; cd05232
160488005889	Nucleoside-diphosphate-sugar epimerases [Cell envelope biogenesis, outer membrane / Carbohydrate transport and metabolism]; Region: WcaG; COG0451
160488005890	putative NAD(P) binding site [chemical binding]; other site
160488005891	active site
160488005892	putative substrate binding site [chemical binding]; other site
160488005893	UDP-N-acetylmuramyl pentapeptide phosphotransferase/UDP-N- acetylglucosamine-1-phosphate transferase [Cell envelope biogenesis, outer membrane]; Region: Rfe; COG0472
160488005894	The members of this subfamily catalyze the formation of a phosphodiester bond between a membrane-associated undecaprenyl-phosphate (Und-P) molecule and N-acetylhexosamine 1-phosphate, which is usually donated by a soluble UDP-N-acetylhexosamine precursor; Region: GT_WbpL_WbcO_like; cd06854
160488005895	Mg++ binding site [ion binding]; other site
160488005896	putative catalytic motif [active]
160488005897	putative substrate binding site [chemical binding]; other site
160488005898	Predicted nucleoside-diphosphate sugar epimerases [Cell envelope biogenesis, outer membrane / Carbohydrate transport and metabolism]; Region: COG1086
160488005899	UDP-Glcnac (UDP-linked N-acetylglucosamine) inverting 4,6-dehydratase, extended (e) SDRs; Region: UDP_invert_4-6DH_SDR_e; cd05237
160488005900	NAD(P) binding site [chemical binding]; other site
160488005901	homodimer interface [polypeptide binding]; other site
160488005902	substrate binding site [chemical binding]; other site
160488005903	active site
160488005904	KpsF/GutQ family protein; Region: kpsF; TIGR00393
160488005905	KpsF-like protein. KpsF is an arabinose-5-phosphate isomerase which contains SIS (Sugar ISomerase) domains. SIS domains are found in many phosphosugar isomerases and phosphosugar binding proteins. KpsF catalyzes the reversible reaction of ribulose...; Region: SIS_Kpsf; cd05014
160488005906	putative active site [active]
160488005907	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains associated with KpsF/GutQ domains in the API [A5P (D-arabinose 5-phosphate) isomerase] protein.  These APIs catalyze the conversion of the pentose pathway...; Region: CBS_pair_KpsF_GutQ_assoc; cd04604
160488005908	2-dehydro-3-deoxyphosphooctonate aldolase; Provisional; Region: PRK12457
160488005909	DAHP synthetase I family; Region: DAHP_synth_1; pfam00793
160488005910	glucose-6-phosphate isomerase; Reviewed; Region: pgi; PRK00179
160488005911	Phosphoglucose isomerase (PGI) contains two SIS (Sugar ISomerase) domains. This classification is based on the alignment of the first SIS domain. PGI is a multifunctional enzyme which as an intracellular dimer catalyzes the reversible isomerization of...; Region: SIS_PGI_1; cd05015
160488005912	active site
160488005913	dimer interface [polypeptide binding]; other site
160488005914	Phosphoglucose isomerase (PGI) contains two SIS (Sugar ISomerase) domains. This classification is based on the alignment of the second SIS domain. PGI is a multifunctional enzyme which as an intracellular dimer catalyzes the reversible isomerization of...; Region: SIS_PGI_2; cd05016
160488005915	dimer interface [polypeptide binding]; other site
160488005916	active site
160488005917	UDP-N-acetylglucosamine 2-epimerase [Cell envelope biogenesis, outer membrane]; Region: WecB; COG0381
160488005918	Bacterial members of the UDP-N-Acetylglucosamine (GlcNAc) 2-Epimerase  family are known to catalyze the reversible interconversion of UDP-GlcNAc and UDP-N-acetylmannosamine (UDP-ManNAc). The enzyme serves to produce an activated form of ManNAc residues; Region: GT1_UDP-GlcNAc_2-Epimerase; cd03786
160488005919	active site
160488005920	homodimer interface [polypeptide binding]; other site
160488005921	Helix-hairpin-helix motif; Region: HHH_3; pfam12836
160488005922	Protein of unknown function (DUF2897); Region: DUF2897; pfam11446
160488005923	Orotidine 5'-phosphate decarboxylase (ODCase) is a dimeric enzyme that decarboxylates orotidine 5'-monophosphate (OMP) to form uridine 5'-phosphate (UMP), an essential step in the pyrimidine biosynthetic pathway. In mammals, UMP synthase...; Region: OMP_decarboxylase_like; cd04725
160488005924	active site
160488005925	dimer interface [polypeptide binding]; other site
160488005926	Putative NADP-dependent oxidoreductases [General function prediction only]; Region: COG2130
160488005927	Prostaglandin dehydrogenases; Region: PGDH; cd05288
160488005928	NAD(P) binding site [chemical binding]; other site
160488005929	substrate binding site [chemical binding]; other site
160488005930	dimer interface [polypeptide binding]; other site
160488005931	short chain dehydrogenase; Provisional; Region: PRK06172
160488005932	classical (c) SDRs; Region: SDR_c; cd05233
160488005933	NAD(P) binding site [chemical binding]; other site
160488005934	active site
160488005935	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cl01054
160488005936	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
160488005937	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
160488005938	dimer interface [polypeptide binding]; other site
160488005939	putative CheW interface [polypeptide binding]; other site
160488005940	benzoate transporter; Region: benE; TIGR00843
160488005941	Benzoate membrane transport protein; Region: BenE; pfam03594
160488005942	Glutathione S-transferase [Posttranslational modification, protein turnover, chaperones]; Region: Gst; COG0625
160488005943	GST_N family, unknown subfamily 4; composed of uncharacterized bacterial proteins with similarity to GSTs. GSTs are cytosolic dimeric proteins involved in cellular detoxification by catalyzing the conjugation of glutathione (GSH) with a wide range of...; Region: GST_N_4; cd03056
160488005944	putative C-terminal domain interface [polypeptide binding]; other site
160488005945	putative GSH binding site (G-site) [chemical binding]; other site
160488005946	putative dimer interface [polypeptide binding]; other site
160488005947	C-terminal, alpha helical domain of the Glutathione S-transferase family; Region: GST_C_family; cl02776
160488005948	N-terminal domain interface [polypeptide binding]; other site
160488005949	dimer interface [polypeptide binding]; other site
160488005950	substrate binding pocket (H-site) [chemical binding]; other site
160488005951	Glutathione S-transferase, N-terminal domain; Region: GST_N_3; pfam13417
160488005952	Tunnelling fold (T-fold). The five known T-folds are found in five different enzymes with different functions: dihydroneopterin-triphosphate epimerase (DHNTPE), dihydroneopterin aldolase (DHNA) , GTP cyclohydrolase I (GTPCH-1),  6-pyrovoyl...; Region: TFold; cl00263
160488005953	GTP cyclohydrolase I; Provisional; Region: PLN03044
160488005954	active site
160488005955	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2840
160488005956	Smr domain; Region: Smr; pfam01713
160488005957	Nicotinamidase_ related amidohydrolases.  Cysteine hydrolases of unknown function that share the catalytic triad with other amidohydrolases, like nicotinamidase, which converts nicotinamide to nicotinic acid and ammonia; Region: nicotinamidase_related; cd01014
160488005958	Isochorismatase family; Region: Isochorismatase; pfam00857
160488005959	catalytic triad [active]
160488005960	conserved cis-peptide bond; other site
160488005961	HemK family putative methylases; Region: hemK_fam; TIGR00536
160488005962	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488005963	S-adenosylmethionine binding site [chemical binding]; other site
160488005964	Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697
160488005965	Chorismate synthase [Amino acid transport and metabolism]; Region: AroC; COG0082
160488005966	Chorismase synthase, the enzyme catalyzing the final step of the shikimate pathway; Region: Chorismate_synthase; cd07304
160488005967	Tetramer interface [polypeptide binding]; other site
160488005968	active site
160488005969	FMN-binding site [chemical binding]; other site
160488005970	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488005971	putative substrate translocation pore; other site
160488005972	Uncharacterized conserved protein, contains double-stranded beta-helix domain [Function unknown]; Region: COG1791
160488005973	Cupin domain; Region: Cupin_2; cl17218
160488005974	Protein of unknown function (DUF3509); Region: DUF3509; pfam12021
160488005975	Ankyrin repeats (many copies); Region: Ank_4; pfam13637
160488005976	ankyrin repeats;  ankyrin repeats mediate protein-protein interactions in very diverse families of proteins. The number of ANK repeats in a protein can range from 2 to over 20 (ankyrins, for example). ANK repeats may occur in combinations with other...; Region: ANK; cd00204
160488005977	Ankyrin repeats (3 copies); Region: Ank_2; pfam12796
160488005978	Predicted divalent heavy-metal cations transporter [Inorganic ion transport and metabolism]; Region: COG0428
160488005979	ZIP Zinc transporter; Region: Zip; pfam02535
160488005980	Phosphoglycerol transferase and related proteins, alkaline phosphatase superfamily [Cell envelope biogenesis, outer membrane]; Region: MdoB; COG1368
160488005981	Sulfatase; Region: Sulfatase; pfam00884
160488005982	Protein of unknown function (DUF1260); Region: DUF1260; pfam06877
160488005983	Cytochrome c, mono- and diheme variants [Energy production and conversion]; Region: CccA; COG2010
160488005984	Cytochrome c; Region: Cytochrom_C; pfam00034
160488005985	GMP synthase - Glutamine amidotransferase domain [Nucleotide transport and metabolism]; Region: GuaA; COG0518
160488005986	Subgroup of proteins having the Type 1 glutamine amidotransferase (GATase1) domain; Region: GATase1_1; cd01741
160488005987	catalytic triad [active]
160488005988	Mg2+ and Co2+ transporters [Inorganic ion transport and metabolism]; Region: CorA; COG0598
160488005989	Mycobacterium tuberculosis CorA-like subfamily; Region: MtCorA-like; cd12830
160488005990	oligomer interface [polypeptide binding]; other site
160488005991	metal binding site [ion binding]; metal-binding site
160488005992	metal binding site [ion binding]; metal-binding site
160488005993	putative Cl binding site [ion binding]; other site
160488005994	basic sphincter; other site
160488005995	hydrophobic gate; other site
160488005996	periplasmic entrance; other site
160488005997	1-acyl-sn-glycerol-3-phosphate acyltransferase; Provisional; Region: PRK15018
160488005998	Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: AGPAT-like; Region: LPLAT_AGPAT-like; cd07989
160488005999	putative acyl-acceptor binding pocket; other site
160488006000	Enoyl-CoA hydratase/carnithine racemase [Lipid metabolism]; Region: CaiD; COG1024
160488006001	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
160488006002	substrate binding site [chemical binding]; other site
160488006003	oxyanion hole (OAH) forming residues; other site
160488006004	trimer interface [polypeptide binding]; other site
160488006005	INTRON05; Group II intron; Group II intron most similar to the Group II intron from Pseudomonas alcaligenes.
160488006006	RT_G2_intron: Reverse transcriptases (RTs) with group II intron origin. RT transcribes DNA using RNA as template. Proteins in this subfamily are found in bacterial and mitochondrial group II introns. Their most probable ancestor was a retrotransposable...; Region: RT_G2_intron; cd01651
160488006007	Reverse transcriptase (RNA-dependent DNA polymerase); Region: RVT_1; pfam00078
160488006008	putative active site [active]
160488006009	putative NTP binding site [chemical binding]; other site
160488006010	putative nucleic acid binding site [nucleotide binding]; other site
160488006011	Group II intron, maturase-specific domain; Region: GIIM; pfam08388
160488006012	TonB-dependent siderophore receptor; Region: TonB-siderophor; TIGR01783
160488006013	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
160488006014	N-terminal plug; other site
160488006015	ligand-binding site [chemical binding]; other site
160488006016	Arabinose efflux permease [Carbohydrate transport and metabolism]; Region: AraJ; COG2814
160488006017	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488006018	3-ketoacyl-(acyl-carrier-protein) reductase; Validated; Region: fabG; PRK05557
160488006019	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
160488006020	NAD(P) binding site [chemical binding]; other site
160488006021	active site
160488006022	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488006023	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488006024	The C-terminal substrate binding domain of LysR-type transcriptional regulator CrgA and its related homologs, contains the type 2 periplasmic binding domain; Region: PBP2_CrgA_like; cd08422
160488006025	putative effector binding pocket; other site
160488006026	dimerization interface [polypeptide binding]; other site
160488006027	Transcription elongation factor, GreA/GreB, C-term; Region: GreA_GreB; pfam01272
160488006028	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4394
160488006029	conserved hypothetical protein, PP_1857 family; Region: efp_adjacent_2; TIGR03837
160488006030	elongation factor P; Validated; Region: PRK00529
160488006031	Elongation factor P (EF-P) KOW-like domain; Region: EFP_N; pfam08207
160488006032	S1_EF-P_repeat_1: Translation elongation factor P (EF-P), S1-like RNA-binding domain, repeat 1. EF-P stimulates the peptidyltransferase activity in the prokaryotic 70S ribosome. EF-P enhances the synthesis of certain dipeptides with...; Region: S1_EF-P_repeat_1; cd04470
160488006033	RNA binding site [nucleotide binding]; other site
160488006034	S1_EF-P_repeat_2: Translation elongation factor P (EF-P), S1-like RNA-binding domain, repeat 1. EF-P stimulates the peptidyltransferase activity in the prokaryotic 70S ribosome. EF-P enhances the synthesis of certain dipeptides with...; Region: S1_EF-P_repeat_2; cd05794
160488006035	RNA binding site [nucleotide binding]; other site
160488006036	peroxiredoxin, Ohr subfamily; Region: organ_hyd_perox; TIGR03561
160488006037	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
160488006038	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
160488006039	dimerization interface [polypeptide binding]; other site
160488006040	putative Zn2+ binding site [ion binding]; other site
160488006041	putative DNA binding site [nucleotide binding]; other site
160488006042	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488006043	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488006044	The C-terminal substrate binding domain of LysR-type transcriptional regulator CrgA and its related homologs, contains the type 2 periplasmic binding domain; Region: PBP2_CrgA_like; cd08422
160488006045	putative effector binding pocket; other site
160488006046	dimerization interface [polypeptide binding]; other site
160488006047	Sulfite exporter TauE/SafE; Region: TauE; pfam01925
160488006048	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488006049	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488006050	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
160488006051	dimerization interface [polypeptide binding]; other site
160488006052	Uncharacterized conserved small protein [Function unknown]; Region: COG5457
160488006053	Transposase DDE domain; Region: DDE_Tnp_1; pfam01609
160488006054	Class-II DAHP synthetase family; Region: DAHP_synth_2; pfam01474
160488006055	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488006056	helicase 45; Provisional; Region: PTZ00424
160488006057	DEAD-box helicases. A diverse family of proteins involved in ATP-dependent RNA unwinding, needed in a variety of cellular processes including splicing, ribosome biogenesis and RNA degradation. The name derives from the sequence of the Walker  B motif; Region: DEADc; cd00268
160488006058	ATP binding site [chemical binding]; other site
160488006059	Mg++ binding site [ion binding]; other site
160488006060	motif III; other site
160488006061	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
160488006062	nucleotide binding region [chemical binding]; other site
160488006063	ATP-binding site [chemical binding]; other site
160488006064	DbpA RNA binding domain; Region: DbpA; pfam03880
160488006065	The Class III extradiol dioxygenase, 4,5-DOPA Dioxygenase, catalyzes the incorporation of both atoms of molecular oxygen into 4,5-dihydroxy-phenylalanine; Region: 45_DOPA_Dioxygenase; cd07363
160488006066	Catalytic LigB subunit of aromatic ring-opening dioxygenase; Region: LigB; pfam02900
160488006067	putative active site [active]
160488006068	metal binding site [ion binding]; metal-binding site
160488006069	thiopurine S-methyltransferase; Reviewed; Region: PRK13255
160488006070	heat shock protein HtpX; Provisional; Region: PRK05457
160488006071	aminotransferase AlaT; Validated; Region: PRK09265
160488006072	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
160488006073	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488006074	homodimer interface [polypeptide binding]; other site
160488006075	catalytic residue [active]
160488006076	methionine sulfoxide reductase B; Provisional; Region: PRK00222
160488006077	SelR domain; Region: SelR; pfam01641
160488006078	Glutathione (GSH) peroxidase family; tetrameric selenoenzymes that catalyze the reduction of a variety of hydroperoxides including lipid peroxidases, using GSH as a specific electron donor substrate. GSH peroxidase contains one selenocysteine residue per...; Region: GSH_Peroxidase; cd00340
160488006079	catalytic residues [active]
160488006080	dimer interface [polypeptide binding]; other site
160488006081	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488006082	dimer interface [polypeptide binding]; other site
160488006083	phosphorylation site [posttranslational modification]
160488006084	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488006085	ATP binding site [chemical binding]; other site
160488006086	Mg2+ binding site [ion binding]; other site
160488006087	G-X-G motif; other site
160488006088	FOG: CheY-like receiver [Signal transduction mechanisms]; Region: CheY; COG0784
160488006089	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488006090	active site
160488006091	phosphorylation site [posttranslational modification]
160488006092	intermolecular recognition site; other site
160488006093	dimerization interface [polypeptide binding]; other site
160488006094	Predicted ATPase (AAA+ superfamily) [General function prediction only]; Region: COG2607
160488006095	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488006096	Walker A motif; other site
160488006097	ATP binding site [chemical binding]; other site
160488006098	Walker B motif; other site
160488006099	GAF domain-containing protein [Signal transduction mechanisms]; Region: COG1956
160488006100	GAF domain; Region: GAF_2; pfam13185
160488006101	Tfp pilus assembly protein PilF [Cell motility and secretion / Intracellular trafficking and secretion]; Region: PilF; COG3063
160488006102	Pertactin-like passenger domains (virulence factors), C-terminal, subgroup 1, of autotransporter proteins of the type V secretion system of Gram-negative bacteria. This subgroup includes the passenger domains of Neisseria and Haemophilus IgA1 proteases; Region: PL1_Passenger_AT; cd01343
160488006103	outer membrane autotransporter barrel domain; Region: autotrans_barl; TIGR01414
160488006104	Autotransporter beta-domain; Region: Autotransporter; pfam03797
160488006105	Rhs family protein [Cell envelope biogenesis, outer membrane]; Region: RhsA; COG3209
160488006106	RHS Repeat; Region: RHS_repeat; pfam05593
160488006107	RHS repeat-associated core domain; Region: Rhs_assc_core; TIGR03696
160488006108	P pilus assembly protein, pilin FimA [Cell motility and secretion / Intracellular trafficking and secretion]; Region: FimA; COG3539
160488006109	P pilus assembly protein, porin PapC [Cell motility and secretion / Intracellular trafficking and secretion]; Region: FimD; COG3188
160488006110	PapC N-terminal domain; Region: PapC_N; pfam13954
160488006111	Type VII secretion system (T7SS), usher protein; Region: Usher; pfam00577
160488006112	PapC C-terminal domain; Region: PapC_C; pfam13953
160488006113	fimbrial assembly chaperone SthB; Provisional; Region: PRK15295
160488006114	Gram-negative pili assembly chaperone, N-terminal domain; Region: Pili_assembly_N; pfam00345
160488006115	Gram-negative pili assembly chaperone, C-terminal domain; Region: Pili_assembly_C; pfam02753
160488006116	P pilus assembly protein, pilin FimA [Cell motility and secretion / Intracellular trafficking and secretion]; Region: FimA; COG3539
160488006117	acyl-CoA dehydrogenase; Reviewed; Region: fadE; PRK09463
160488006118	Acyl-CoA dehydrogenase, N-terminal domain; Region: Acyl-CoA_dh_N; pfam02771
160488006119	Acyl-CoA dehydrogenase; Region: ACAD; cd00567
160488006120	active site
160488006121	Domain of unknown function (DUF1974); Region: DUF1974; pfam09317
160488006122	Glutathione S-transferase [Posttranslational modification, protein turnover, chaperones]; Region: Gst; COG0625
160488006123	GST_N family, unknown subfamily 2; composed of uncharacterized bacterial proteins with similarity to GSTs. GSTs are cytosolic dimeric proteins involved in cellular detoxification by catalyzing the conjugation of glutathione (GSH) with a wide range of...; Region: GST_N_2; cd03047
160488006124	putative C-terminal domain interface [polypeptide binding]; other site
160488006125	putative GSH binding site (G-site) [chemical binding]; other site
160488006126	putative dimer interface [polypeptide binding]; other site
160488006127	C-terminal, alpha helical domain of an unknown subfamily 2 of Glutathione S-transferases; Region: GST_C_2; cd03180
160488006128	putative N-terminal domain interface [polypeptide binding]; other site
160488006129	putative dimer interface [polypeptide binding]; other site
160488006130	putative substrate binding pocket (H-site) [chemical binding]; other site
160488006131	ABC-type multidrug transport system, ATPase component [Defense mechanisms]; Region: CcmA; COG1131
160488006132	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488006133	Walker A/P-loop; other site
160488006134	ATP binding site [chemical binding]; other site
160488006135	Q-loop/lid; other site
160488006136	ABC transporter signature motif; other site
160488006137	Walker B; other site
160488006138	D-loop; other site
160488006139	H-loop/switch region; other site
160488006140	inner membrane transport permease; Provisional; Region: PRK15066
160488006141	ABC-type multidrug transport system, permease component [Defense mechanisms]; Region: COG0842
160488006142	Domain of unknown function (DUF4131); Region: DUF4131; pfam13567
160488006143	Predicted membrane metal-binding protein [General function prediction only]; Region: ComEC; COG0658
160488006144	Competence protein; Region: Competence; pfam03772
160488006145	Predicted hydrolase (metallo-beta-lactamase superfamily) [General function prediction only]; Region: ComEC; COG2333
160488006146	Biopolymer transport proteins [Intracellular trafficking and secretion]; Region: TolQ; COG0811
160488006147	Biopolymer transport protein [Intracellular trafficking and secretion]; Region: ExbD; COG0848
160488006148	Biopolymer transport protein ExbD/TolR; Region: ExbD; pfam02472
160488006149	tetraacyldisaccharide 4'-kinase; Provisional; Region: PRK01906
160488006150	tetraacyldisaccharide 4'-kinase; Reviewed; Region: lpxK; PRK00652
160488006151	Uncharacterized conserved protein [Function unknown]; Region: COG2835
160488006152	3-deoxy-manno-octulosonate cytidylyltransferase; Provisional; Region: PRK05450
160488006153	CMP-KDO synthetase catalyzes the activation of KDO which is an essential component of the lipopolysaccharide; Region: CMP-KDO-Synthetase; cd02517
160488006154	Ligand binding site; other site
160488006155	oligomer interface; other site
160488006156	Protein-tyrosine-phosphatase [Signal transduction mechanisms]; Region: Wzb; COG0394
160488006157	Low molecular weight phosphatase family; Region: LMWPc; cd00115
160488006158	active site
160488006159	UDP-N-acetylenolpyruvoylglucosamine reductase; Provisional; Region: murB; PRK00046
160488006160	FAD binding domain; Region: FAD_binding_4; pfam01565
160488006161	UDP-N-acetylenolpyruvoylglucosamine reductase, C-terminal domain; Region: MurB_C; pfam02873
160488006162	Ribonucleases G and E [Translation, ribosomal structure and biogenesis]; Region: CafA; COG1530
160488006163	S1_RNase_E: RNase E and RNase G, S1-like RNA-binding domain. RNase E is an essential endoribonuclease in the processing and degradation of RNA. In addition to its role in mRNA degradation, RNase E has also been implicated in the processing of rRNA, and...; Region: S1_RNase_E; cd04453
160488006164	homodimer interface [polypeptide binding]; other site
160488006165	oligonucleotide binding site [chemical binding]; other site
160488006166	Predicted phosphatases [General function prediction only]; Region: Gph; COG0546
160488006167	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
160488006168	motif II; other site
160488006169	Periplasmic serine proteases (ClpP class) [Posttranslational modification, protein turnover, chaperones / Intracellular trafficking and secretion]; Region: SppA; COG0616
160488006170	Signal peptide peptidase A (SppA), a serine protease, has catalytic Ser-Lys dyad; Region: S49_Sppa_N_C; cd07023
160488006171	tandem repeat interface [polypeptide binding]; other site
160488006172	oligomer interface [polypeptide binding]; other site
160488006173	active site residues [active]
160488006174	Maf-like protein; Region: Maf; pfam02545
160488006175	Nucleotide binding protein Maf. Maf has been implicated in inhibition of septum formation in eukaryotes, bacteria and archaea, but homologs in B.subtilis and S.cerevisiae are nonessential for cell division. Maf has been predicted to be a nucleotide- or...; Region: Maf; cd00555
160488006176	active site
160488006177	dimer interface [polypeptide binding]; other site
160488006178	Uncharacterized ACR, COG1399; Region: DUF177; cl00616
160488006179	50S ribosomal protein L32; Validated; Region: rpmF; PRK01110
160488006180	putative phosphate acyltransferase; Provisional; Region: PRK05331
160488006181	(acyl-carrier-protein) S-malonyltransferase [Lipid metabolism]; Region: FabD; COG0331
160488006182	malonyl CoA-acyl carrier protein transacylase; Region: fabD; TIGR00128
160488006183	3-ketoacyl-(acyl-carrier-protein) reductase; Validated; Region: fabG; PRK05557
160488006184	beta-Keto acyl carrier protein reductase (BKR), involved in Type II FAS, classical (c) SDRs; Region: BKR_SDR_c; cd05333
160488006185	NAD(P) binding site [chemical binding]; other site
160488006186	homotetramer interface [polypeptide binding]; other site
160488006187	homodimer interface [polypeptide binding]; other site
160488006188	active site
160488006189	acyl carrier protein; Provisional; Region: acpP; PRK00982
160488006190	3-oxoacyl-(acyl carrier protein) synthase II; Reviewed; Region: PRK07314
160488006191	Beta-ketoacyl-acyl carrier protein (ACP) synthase (KAS), type I and II. KASs are responsible for the elongation steps in fatty acid biosynthesis. KASIII catalyses the initial condensation and KAS I and II catalyze further elongation steps by Claisen...; Region: KAS_I_II; cd00834
160488006192	dimer interface [polypeptide binding]; other site
160488006193	active site
160488006194	Branched-chain amino acid aminotransferase/4-amino-4-deoxychorismate lyase [Amino acid transport and metabolism / Coenzyme metabolism]; Region: IlvE; COG0115
160488006195	ADCL_like: 4-Amino-4-deoxychorismate lyase:  is a member of the fold-type IV of PLP dependent enzymes that converts 4-amino-4-deoxychorismate (ADC) to p-aminobenzoate and pyruvate.  Based on the information available from the crystal structure, most...; Region: ADCL_like; cd01559
160488006196	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488006197	catalytic residue [active]
160488006198	YceG-like family; Region: YceG; pfam02618
160488006199	proteins similar to Escherichia coli yceG; Region: yceG_like; cd08010
160488006200	dimerization interface [polypeptide binding]; other site
160488006201	Protein of unknown function (DUF2726); Region: DUF2726; pfam10881
160488006202	Sybindin-like family; Region: Sybindin; cl17582
160488006203	Sortase and related acyltransferases [Cell envelope biogenesis, outer membrane]; Region: COG1247
160488006204	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
160488006205	Coenzyme A binding pocket [chemical binding]; other site
160488006206	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox_2; pfam07992
160488006207	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox_3; pfam13738
160488006208	Protein tyrosine phosphatases (PTP) catalyze the dephosphorylation of phosphotyrosine peptides; they regulate phosphotyrosine levels in signal transduction pathways. The depth of the active site cleft renders the enzyme specific for phosphorylated Tyr; Region: PTPc; cl00053
160488006209	active site
160488006210	catalytic residues [active]
160488006211	arsenical resistance protein ArsH; Region: resist_ArsH; TIGR02690
160488006212	NADPH-dependent FMN reductase; Region: FMN_red; pfam03358
160488006213	Low molecular weight phosphatase family; Region: LMWPc; cd00115
160488006214	Protein-tyrosine-phosphatase [Signal transduction mechanisms]; Region: Wzb; COG0394
160488006215	active site
160488006216	arsenical pump membrane protein; Provisional; Region: PRK15445
160488006217	Anion permease ArsB.  These permeases have been shown to export arsenate and antimonite in eubacteria and archaea.  A typical ArsB permease contains 8-13 transmembrane helices and can function either independently as a chemiosmotic transporter or as a...; Region: ArsB_permease; cd01118
160488006218	transmembrane helices; other site
160488006219	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
160488006220	dimerization interface [polypeptide binding]; other site
160488006221	putative DNA binding site [nucleotide binding]; other site
160488006222	putative Zn2+ binding site [ion binding]; other site
160488006223	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3666
160488006224	Transposase DDE domain; Region: DDE_Tnp_1; pfam01609
160488006225	Transposase DDE domain; Region: DDE_Tnp_1_6; pfam13751
160488006226	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
160488006227	non-specific DNA binding site [nucleotide binding]; other site
160488006228	salt bridge; other site
160488006229	sequence-specific DNA binding site [nucleotide binding]; other site
160488006230	KAP family P-loop domain; Region: KAP_NTPase; pfam07693
160488006231	Predicted P-loop ATPase [General function prediction only]; Region: COG4928
160488006232	Catalytic domain of type II restriction endonucleases BfiI and NgoFVII, and uncharacterized proteins with a DEAD domain; Region: PLDc_Bfil_DEXD_like; cd09117
160488006233	PLD-like domain; Region: PLDc_2; pfam13091
160488006234	homodimer interface [polypeptide binding]; other site
160488006235	putative active site [active]
160488006236	catalytic site [active]
160488006237	DEAD-like helicases superfamily; Region: DEXDc; smart00487
160488006238	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
160488006239	ATP binding site [chemical binding]; other site
160488006240	putative Mg++ binding site [ion binding]; other site
160488006241	helicase superfamily c-terminal domain; Region: HELICc; smart00490
160488006242	ATP-binding site [chemical binding]; other site
160488006243	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
160488006244	dimerization interface [polypeptide binding]; other site
160488006245	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
160488006246	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
160488006247	dimer interface [polypeptide binding]; other site
160488006248	putative CheW interface [polypeptide binding]; other site
160488006249	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
160488006250	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
160488006251	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488006252	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488006253	The C-terminal substrate binding domain of LysR-type transcriptional regulators that are involved in the catabolism of dinitrotoluene, naphthalene and gamma-hexachlorohexane; contains the type 2 periplasmic binding fold; Region: PBP2_DntR_NahR_LinR_like; cd08459
160488006254	substrate binding pocket [chemical binding]; other site
160488006255	dimerization interface [polypeptide binding]; other site
160488006256	formyltetrahydrofolate deformylase; Reviewed; Region: purU; PRK13010
160488006257	N-terminal ACT domain of formyltetrahydrofolate deformylase (F4HF-DF; formyltetrahydrofolate hydrolase); Region: ACT_F4HF-DF; cd04875
160488006258	Formyltetrahydrofolate deformylase (Formyl-FH4 hydrolase), C-terminal hydrolase domain; Region: FMT_core_Formyl-FH4-Hydrolase_C; cd08648
160488006259	putative active site [active]
160488006260	putative substrate binding site [chemical binding]; other site
160488006261	putative cosubstrate binding site; other site
160488006262	catalytic site [active]
160488006263	Aminomethyltransferase folate-binding domain; Region: GCV_T; pfam01571
160488006264	Glycine cleavage T-protein C-terminal barrel domain; Region: GCV_T_C; pfam08669
160488006265	bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase; Provisional; Region: PRK14188
160488006266	Tetrahydrofolate dehydrogenase/cyclohydrolase, catalytic domain; Region: THF_DHG_CYH; pfam00763
160488006267	NADP binding domain of methylene-tetrahydrofolate dehydrogenase/cyclohydrolase; Region: NAD_bind_m-THF_DH_Cyclohyd; cd01080
160488006268	homodimer interface [polypeptide binding]; other site
160488006269	NADP binding site [chemical binding]; other site
160488006270	substrate binding site [chemical binding]; other site
160488006271	short chain dehydrogenase; Provisional; Region: PRK06172
160488006272	classical (c) SDRs; Region: SDR_c; cd05233
160488006273	NAD(P) binding site [chemical binding]; other site
160488006274	active site
160488006275	Leucyl aminopeptidase (aminopeptidase T) [Amino acid transport and metabolism]; Region: AmpS; COG2309
160488006276	5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase; Region: HpaE; TIGR02299
160488006277	Uncharacterized Candidatus pelagibacter aldehyde dehydrogenase, DhaS-like; Region: ALDH_DhaS; cd07114
160488006278	NAD(P) binding site [chemical binding]; other site
160488006279	catalytic residues [active]
160488006280	choline dehydrogenase; Validated; Region: PRK02106
160488006281	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
160488006282	GMC oxidoreductase; Region: GMC_oxred_C; pfam05199
160488006283	Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124
160488006284	Cytochrome P450; Region: p450; cl12078
160488006285	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
160488006286	3-ketoacyl-(acyl-carrier-protein) reductase; Validated; Region: fabG; PRK05653
160488006287	NAD(P) binding site [chemical binding]; other site
160488006288	active site
160488006289	Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849
160488006290	3-ketoacyl-(acyl-carrier-protein) reductase; Validated; Region: fabG; PRK05653
160488006291	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
160488006292	NAD(P) binding site [chemical binding]; other site
160488006293	active site
160488006294	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
160488006295	Beta-lactamase; Region: Beta-lactamase; pfam00144
160488006296	Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124
160488006297	Cytochrome P450; Region: p450; cl12078
160488006298	Putative MetA-pathway of phenol degradation; Region: Phenol_MetA_deg; cl01768
160488006299	Flavodoxin reductases (ferredoxin-NADPH reductases) family 1 [Energy production and conversion]; Region: Hmp; COG1018
160488006300	Phthalate dioxygenase reductase (PDR) is an FMN-dependent reductase that mediates electron transfer from NADH to FMN to an iron sulfur cluster. PDR has an an N-terminal  ferrredoxin reductase (FNR)-like NAD(H) binding domain and a C-terminal iron-sulfur; Region: PDR_like; cd06185
160488006301	FMN-binding pocket [chemical binding]; other site
160488006302	flavin binding motif; other site
160488006303	phosphate binding motif [ion binding]; other site
160488006304	beta-alpha-beta structure motif; other site
160488006305	NAD binding pocket [chemical binding]; other site
160488006306	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
160488006307	catalytic loop [active]
160488006308	iron binding site [ion binding]; other site
160488006309	Protein of unknown function (DUF2026); Region: DUF2026; pfam09641
160488006310	DNA breaking-rejoining enzymes, intergrase/recombinases, C-terminal catalytic domain. The tyrosine recombinase/integrase family share the same catalytic domain containing six conserved active site residues. The best-studied members of this diverse family...; Region: INT_REC_C; cd01182
160488006311	active site
160488006312	catalytic residues [active]
160488006313	DNA binding site [nucleotide binding]
160488006314	Int/Topo IB signature motif; other site
160488006315	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
160488006316	DNA breaking-rejoining enzymes, intergrase/recombinases, C-terminal catalytic domain. The tyrosine recombinase/integrase family share the same catalytic domain containing six conserved active site residues. The best-studied members of this diverse family...; Region: INT_REC_C; cd01182
160488006317	Integrase [DNA replication, recombination, and repair]; Region: XerC; COG0582
160488006318	active site
160488006319	catalytic residues [active]
160488006320	DNA binding site [nucleotide binding]
160488006321	Int/Topo IB signature motif; other site
160488006322	deoxynucleoside monophosphate kinase; Provisional; Region: 1; PHA02575
160488006323	deoxynucleoside monophosphate kinase; Provisional; Region: 1; PHA02575
160488006324	DNA polymerase III subunit delta'; Validated; Region: PRK05707
160488006325	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488006326	Walker A motif; other site
160488006327	ATP binding site [chemical binding]; other site
160488006328	Walker B motif; other site
160488006329	arginine finger; other site
160488006330	TatD like proteins;  E.coli TatD is a cytoplasmic protein, shown to have magnesium dependent DNase activity; Region: TatD_DNAse; cd01310
160488006331	active site
160488006332	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
160488006333	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
160488006334	WHG domain; Region: WHG; pfam13305
160488006335	molybdenum cofactor biosynthesis protein A; Reviewed; Region: moaA; PRK00164
160488006336	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
160488006337	FeS/SAM binding site; other site
160488006338	Molybdenum Cofactor Synthesis C; Region: Mob_synth_C; pfam06463
160488006339	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3816
160488006340	Protein of unknown function (DUF1285); Region: DUF1285; pfam06938
160488006341	aromatic amino acid aminotransferase; Provisional; Region: PRK09257
160488006342	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
160488006343	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488006344	homodimer interface [polypeptide binding]; other site
160488006345	catalytic residue [active]
160488006346	excinuclease ABC subunit B; Provisional; Region: PRK05298
160488006347	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
160488006348	ATP binding site [chemical binding]; other site
160488006349	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
160488006350	nucleotide binding region [chemical binding]; other site
160488006351	ATP-binding site [chemical binding]; other site
160488006352	Ultra-violet resistance protein B; Region: UvrB; pfam12344
160488006353	UvrB/uvrC motif; Region: UVR; pfam02151
160488006354	drug resistance transporter, EmrB/QacA subfamily; Region: efflux_EmrB; TIGR00711
160488006355	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488006356	putative substrate translocation pore; other site
160488006357	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488006358	Multidrug resistance efflux pump [Defense mechanisms]; Region: EmrA; COG1566
160488006359	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
160488006360	Murein lipoprotein [Cell envelope biogenesis, outer membrane]; Region: COG4238; cl11539
160488006361	HlyD family secretion protein; Region: HlyD_3; pfam13437
160488006362	glutamyl-tRNA synthetase; Reviewed; Region: gltX; PRK01406
160488006363	catalytic core domain of discriminating glutamyl-tRNA synthetase; Region: GluRS_core; cd00808
160488006364	active site
160488006365	HIGH motif; other site
160488006366	catalytic core domain of discriminating glutamyl-tRNA synthetase; Region: GluRS_core; cd00808
160488006367	active site
160488006368	KMSKS motif; other site
160488006369	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
160488006370	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
160488006371	Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697
160488006372	4-hydroxybenzoyl-CoA thioesterase (4HBT). Catalyzes the final step in the 4-chlorobenzoate degradation pathway in which 4-chlorobenzoate is converted to 4-hydroxybenzoate in certain soil-dwelling bacteria. 4HBT forms a homotetramer with four active sites; Region: 4HBT; cd00586
160488006373	active site
160488006374	tRNA-dihydrouridine synthase C; Provisional; Region: PRK10550
160488006375	Dihydrouridine synthase-like (DUS-like) FMN-binding domain. Members of this family catalyze the reduction of the 5,6-double bond of a uridine residue on tRNA. Dihydrouridine modification of tRNA is widely observed in prokaryotes and eukaryotes, and also...; Region: DUS_like_FMN; cd02801
160488006376	FMN binding site [chemical binding]; other site
160488006377	active site
160488006378	catalytic residues [active]
160488006379	substrate binding site [chemical binding]; other site
160488006380	Molecular chaperone (small heat shock protein) [Posttranslational modification, protein turnover, chaperones]; Region: IbpA; COG0071
160488006381	Alpha-crystallin domain (ACD) found in Escherichia coli inclusion body-associated proteins IbpA and IbpB, and similar proteins.  IbpA and IbpB are 16 kDa small heat shock proteins (sHsps). sHsps are molecular chaperones that suppress protein aggregation...; Region: ACD_IbpA-B_like; cd06470
160488006382	putative dimer interface [polypeptide binding]; other site
160488006383	PAS fold; Region: PAS_3; pfam08447
160488006384	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488006385	putative active site [active]
160488006386	heme pocket [chemical binding]; other site
160488006387	FOG: PAS/PAC domain [Signal transduction mechanisms]; Region: AtoS; COG2202
160488006388	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488006389	putative active site [active]
160488006390	heme pocket [chemical binding]; other site
160488006391	Motif C-terminal to PAS motifs (likely to contribute to PAS structural domain); Region: PAC; smart00086
160488006392	PAS domain S-box; Region: sensory_box; TIGR00229
160488006393	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488006394	putative active site [active]
160488006395	heme pocket [chemical binding]; other site
160488006396	PAS domain S-box; Region: sensory_box; TIGR00229
160488006397	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488006398	putative active site [active]
160488006399	heme pocket [chemical binding]; other site
160488006400	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
160488006401	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488006402	metal binding site [ion binding]; metal-binding site
160488006403	active site
160488006404	I-site; other site
160488006405	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
160488006406	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488006407	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488006408	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
160488006409	dimerization interface [polypeptide binding]; other site
160488006410	3-isopropylmalate dehydratase large subunit; Reviewed; Region: PRK00402
160488006411	3-isopropylmalate dehydratase catalyzes the isomerization between 2-isopropylmalate and 3-isopropylmalate; Region: IPMI; cd01583
160488006412	substrate binding site [chemical binding]; other site
160488006413	ligand binding site [chemical binding]; other site
160488006414	isopropylmalate isomerase small subunit; Provisional; Region: leuD; PRK01641
160488006415	Aconatase-like swivel domain of 3-isopropylmalate dehydratase and related uncharacterized proteins. 3-isopropylmalate dehydratase catalyzes the isomerization between 2-isopropylmalate and 3-isopropylmalate, via the formation of 2-isopropylmaleate...; Region: IPMI_Swivel; cd01577
160488006416	substrate binding site [chemical binding]; other site
160488006417	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488006418	S-adenosylmethionine binding site [chemical binding]; other site
160488006419	3-isopropylmalate dehydrogenase; Provisional; Region: PRK00772
160488006420	tartrate dehydrogenase; Region: TTC; TIGR02089
160488006421	aspartate-semialdehyde dehydrogenase; Reviewed; Region: PRK06598
160488006422	Semialdehyde dehydrogenase, NAD binding domain; Region: Semialdhyde_dh; smart00859
160488006423	Transposase DDE domain; Region: DDE_Tnp_1; pfam01609
160488006424	aspartate-semialdehyde dehydrogenase; Reviewed; Region: PRK05671
160488006425	Semialdehyde dehydrogenase, NAD binding domain; Region: Semialdhyde_dh; smart00859
160488006426	Lysine Motif is a small domain involved in binding peptidoglycan; Region: LysM; cd00118
160488006427	FimV C-terminal domain; Region: FimV_Cterm; TIGR03504
160488006428	Phosphoribosylanthranilate isomerase (PRAI) catalyzes the fourth step of the tryptophan biosynthesis, the conversion of N-(5'- phosphoribosyl)-anthranilate (PRA) to 1-(o-carboxyphenylamino)- 1-deoxyribulose 5-phosphate (CdRP). Most PRAIs are...; Region: PRAI; cd00405
160488006429	active site
160488006430	acetyl-CoA carboxylase subunit beta; Validated; Region: PRK05654
160488006431	malonate decarboxylase subunit beta; Reviewed; Region: PRK07189; cl17682
160488006432	Folylpolyglutamate synthase [Coenzyme metabolism]; Region: FolC; COG0285
160488006433	Mur ligase middle domain; Region: Mur_ligase_M; pfam08245
160488006434	Sporulation related domain; Region: SPOR; pfam05036
160488006435	Uncharacterized membrane protein, required for colicin V production [General function prediction only]; Region: CvpA; COG1286
160488006436	Colicin V production protein; Region: Colicin_V; cl00567
160488006437	amidophosphoribosyltransferase; Provisional; Region: PRK09246
160488006438	Glutamine amidotransferases class-II (GN-AT)_GPAT- type. This domain is found at the N-terminus of  glutamine phosphoribosylpyrophosphate (Prpp) amidotransferase (GPATase) . The glutaminase domain catalyzes amide nitrogen transfer from glutamine to the...; Region: GPATase_N; cd00715
160488006439	active site
160488006440	tetramer interface [polypeptide binding]; other site
160488006441	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
160488006442	active site
160488006443	O-succinylhomoserine sulfhydrylase; Validated; Region: PRK08133
160488006444	CGS_like: Cystathionine gamma-synthase is a PLP dependent enzyme and catalyzes the committed step of methionine biosynthesis. This pathway is unique to microorganisms and plants, rendering the enzyme an attractive target for the development of...; Region: CGS_like; cd00614
160488006445	homodimer interface [polypeptide binding]; other site
160488006446	substrate-cofactor binding pocket; other site
160488006447	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488006448	catalytic residue [active]
160488006449	oxidoreductase; Validated; Region: PRK05717
160488006450	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
160488006451	NAD(P) binding site [chemical binding]; other site
160488006452	active site
160488006453	Uncharacterized protein conserved in bacteria (DUF2242); Region: DUF2242; pfam10001
160488006454	Arabinose-binding domain of AraC transcription regulator, N-term; Region: Arabinose_bd; pfam12625
160488006455	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
160488006456	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488006457	Nitrilase superfamily, including nitrile- or amide-hydrolyzing enzymes and amide-condensing enzymes; Region: nitrilase; cl11424
160488006458	active site
160488006459	catalytic triad [active]
160488006460	dimer interface [polypeptide binding]; other site
160488006461	Clostridium P-47 protein; Region: Clostridium_P47; pfam06597
160488006462	Clostridium P-47 protein; Region: Clostridium_P47; pfam06597
160488006463	NADH:flavin oxidoreductases, Old Yellow Enzyme family [Energy production and conversion]; Region: NemA; COG1902
160488006464	2,4-dienoyl-CoA reductase (DCR) FMN-binding domain. DCR in E. coli  is an iron-sulfur flavoenzyme which contains FMN, FAD, and a 4Fe-4S cluster. It is also a monomer, unlike that of its eukaryotic counterparts which form homotetramers and lack the...; Region: DCR_FMN; cd02930
160488006465	active site
160488006466	FMN binding site [chemical binding]; other site
160488006467	2,4-decadienoyl-CoA binding site; other site
160488006468	catalytic residue [active]
160488006469	4Fe-4S cluster binding site [ion binding]; other site
160488006470	Uncharacterized NAD(FAD)-dependent dehydrogenases [General function prediction only]; Region: HcaD; COG0446
160488006471	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
160488006472	Tryptophan synthase beta superfamily (fold type II); this family of pyridoxal phosphate (PLP)-dependent enzymes catalyzes beta-replacement and beta-elimination reactions. This CD corresponds to aminocyclopropane-1-carboxylate deaminase (ACCD), tryptophan...; Region: Trp-synth-beta_II; cl00342
160488006473	Tryptophan synthase beta superfamily (fold type II); this family of pyridoxal phosphate (PLP)-dependent enzymes catalyzes beta-replacement and beta-elimination reactions. This CD corresponds to aminocyclopropane-1-carboxylate deaminase (ACCD), tryptophan...; Region: Trp-synth-beta_II; cl00342
160488006474	Cytochrome B561 [Energy production and conversion]; Region: CybB; COG3038
160488006475	Domain of unknown function (DUF1853); Region: DUF1853; pfam08907
160488006476	inorganic polyphosphate/ATP-NAD kinase; Provisional; Region: ppnK; PRK01231
160488006477	inorganic polyphosphate/ATP-NAD kinase; Provisional; Region: ppnK; PRK02231
160488006478	metallophosphatase superfamily, metallophosphatase domain; Region: MPP_superfamily; cl13995
160488006479	active site
160488006480	metal binding site [ion binding]; metal-binding site
160488006481	rhomboid family protease GlpG; Region: rhombo_GlpG; TIGR04239
160488006482	Rhomboid family; Region: Rhomboid; pfam01694
160488006483	Protein of unknown function (DUF1315); Region: DUF1315; cl01215
160488006484	Protein of unknown function (DUF2797); Region: DUF2797; pfam10977
160488006485	aminopeptidase N; Provisional; Region: pepN; PRK14015
160488006486	Peptidase M1 family containing Aminopeptidase N; Region: M1_APN_1; cd09600
160488006487	active site
160488006488	Zn binding site [ion binding]; other site
160488006489	Uncharacterized protein related to plant photosystem II stability/assembly factor [General function prediction only]; Region: COG4447
160488006490	Predicted exporters of the RND superfamily [General function prediction only]; Region: COG1033
160488006491	Lactonase, 7-bladed beta-propeller; Region: Lactonase; pfam10282
160488006492	3-dehydroquinate synthase (EC 4.6.1.3); Region: DHQS; cl00640
160488006493	Glutathione S-transferase [Posttranslational modification, protein turnover, chaperones]; Region: Gst; COG0625
160488006494	GST_N family, Omega-like subfamily; composed of uncharacterized proteins with similarity to class Omega GSTs. GSTs are cytosolic dimeric proteins involved in cellular detoxification by catalyzing the conjugation of glutathione (GSH) with a wide range of...; Region: GST_N_Omega_like; cd03060
160488006495	putative GSH binding site (G-site) [chemical binding]; other site
160488006496	active site cysteine [active]
160488006497	putative C-terminal domain interface [polypeptide binding]; other site
160488006498	putative dimer interface [polypeptide binding]; other site
160488006499	C-terminal, alpha helical domain of an unknown subfamily 5 of Glutathione S-transferases; Region: GST_C_5; cd03196
160488006500	putative N-terminal domain interface [polypeptide binding]; other site
160488006501	putative dimer interface [polypeptide binding]; other site
160488006502	putative substrate binding pocket (H-site) [chemical binding]; other site
160488006503	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488006504	AAA domain; Region: AAA_23; pfam13476
160488006505	Walker A/P-loop; other site
160488006506	ATP binding site [chemical binding]; other site
160488006507	Q-loop/lid; other site
160488006508	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488006509	ABC transporter signature motif; other site
160488006510	Walker B; other site
160488006511	D-loop; other site
160488006512	H-loop/switch region; other site
160488006513	exonuclease subunit SbcD; Provisional; Region: PRK10966
160488006514	Mre11 nuclease, N-terminal metallophosphatase domain; Region: MPP_Mre11_N; cd00840
160488006515	active site
160488006516	metal binding site [ion binding]; metal-binding site
160488006517	DNA binding site [nucleotide binding]
160488006518	Type 5 capsule protein repressor C-terminal domain; Region: SbcD_C; pfam12320
160488006519	Oxygen tolerance; Region: BatD; pfam13584
160488006520	Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes. PLP combines with an alpha-amino acid to form a compound called a Schiff base or aldimine intermediate, which depending on the reaction, is the...; Region: AAT_I; cl00321
160488006521	von Willebrand factor type A domain; Region: VWA_2; pfam13519
160488006522	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
160488006523	Tetratricopeptide repeat; Region: TPR_16; pfam13432
160488006524	TPR motif; other site
160488006525	binding surface
160488006526	Mg-chelatase subunit ChlD [Coenzyme metabolism]; Region: ChlD; COG1240
160488006527	VWA BatA type: Von Willebrand factor type A (vWA) domain was originally found in the blood coagulation protein von Willebrand factor (vWF). Typically, the vWA domain is made up of approximately 200 amino acid residues folded into a classic a/b...; Region: vWA_BatA_type; cd01467
160488006528	metal ion-dependent adhesion site (MIDAS); other site
160488006529	Domain of unknown function (DUF4381); Region: DUF4381; pfam14316
160488006530	Uncharacterized conserved protein (some members contain a von Willebrand factor type A (vWA) domain) [General function prediction only]; Region: COG1721
160488006531	Protein of unknown function DUF58; Region: DUF58; pfam01882
160488006532	MoxR-like ATPases [General function prediction only]; Region: COG0714
160488006533	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488006534	Walker A motif; other site
160488006535	ATP binding site [chemical binding]; other site
160488006536	Walker B motif; other site
160488006537	arginine finger; other site
160488006538	Uncharacterized conserved protein (DUF2235); Region: DUF2235; cl01480
160488006539	benzoate transporter; Region: benE; TIGR00843
160488006540	Benzoate membrane transport protein; Region: BenE; pfam03594
160488006541	Dihydrodipicolinate synthase/N-acetylneuraminate lyase [Amino acid transport and metabolism / Cell envelope biogenesis, outer membrane]; Region: DapA; COG0329
160488006542	Dihydrodipicolinate synthase family; Region: DHDPS-like; cd00408
160488006543	inhibitor site; inhibition site
160488006544	active site
160488006545	dimer interface [polypeptide binding]; other site
160488006546	catalytic residue [active]
160488006547	class II aldolase/adducin domain protein; Provisional; Region: PRK07090
160488006548	intersubunit interface [polypeptide binding]; other site
160488006549	active site
160488006550	Zn2+ binding site [ion binding]; other site
160488006551	long-chain-fatty-acid--CoA ligase; Validated; Region: PRK06187
160488006552	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
160488006553	Bacterial Bile acid CoA ligases and similar proteins; Region: BACL_like; cd05929
160488006554	acyl-activating enzyme (AAE) consensus motif; other site
160488006555	acyl-activating enzyme (AAE) consensus motif; other site
160488006556	putative AMP binding site [chemical binding]; other site
160488006557	putative active site [active]
160488006558	putative CoA binding site [chemical binding]; other site
160488006559	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
160488006560	Acyl-CoA dehydrogenase, N-terminal domain; Region: Acyl-CoA_dh_N; pfam02771
160488006561	Acyl-CoA dehydrogenase; Region: ACAD; cd00567
160488006562	active site
160488006563	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488006564	D-galactonate transporter; Region: 2A0114; TIGR00893
160488006565	putative substrate translocation pore; other site
160488006566	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488006567	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488006568	The C-teminal substrate binding domain of LysR-like nitrogen assimilation control (NAC) protein, contains the type 2 periplasmic binding fold; Region: PBP2_Nac; cd08433
160488006569	putative dimerization interface [polypeptide binding]; other site
160488006570	Protein of unknown function (DUF1302); Region: DUF1302; pfam06980
160488006571	Protein of unknown function (DUF1329); Region: DUF1329; pfam07044
160488006572	Domain of unknown function (DUF202); Region: DUF202; cl09954
160488006573	Alkyl sulfatase and related hydrolases [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG2015
160488006574	Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849
160488006575	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488006576	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488006577	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
160488006578	dimerization interface [polypeptide binding]; other site
160488006579	3-hydroxyacyl-CoA dehydrogenase [Lipid metabolism]; Region: FadB; COG1250
160488006580	3-hydroxyacyl-CoA dehydrogenase, NAD binding domain; Region: 3HCDH_N; pfam02737
160488006581	3-hydroxyacyl-CoA dehydrogenase, C-terminal domain; Region: 3HCDH; pfam00725
160488006582	3-hydroxyacyl-CoA dehydrogenase, C-terminal domain; Region: 3HCDH; pfam00725
160488006583	acyl-CoA dehydrogenase; Provisional; Region: PTZ00456
160488006584	Acyl-CoA dehydrogenase N terminal; Region: AcylCoA_DH_N; pfam12418
160488006585	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
160488006586	active site
160488006587	Acetyl-CoA dehydrogenase C-terminal like; Region: Acyl-CoA_dh_C; pfam12806
160488006588	Alcohol dehydrogenase, class IV [Energy production and conversion]; Region: EutG; COG1454
160488006589	5-hydroxyvalerate dehydrogenase (HVD) catalyzes the oxidation of 5-hydroxyvalerate to 5-oxovalerate with NAD+ as cofactor; Region: HVD; cd08193
160488006590	putative active site [active]
160488006591	metal binding site [ion binding]; metal-binding site
160488006592	4-hydroxybenzoyl-CoA thioesterase (4HBT). Catalyzes the final step in the 4-chlorobenzoate degradation pathway in which 4-chlorobenzoate is converted to 4-hydroxybenzoate in certain soil-dwelling bacteria. 4HBT forms a homotetramer with four active sites; Region: 4HBT; cd00586
160488006593	active site
160488006594	acetyl-CoA acetyltransferase; Provisional; Region: PRK07108
160488006595	Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751
160488006596	dimer interface [polypeptide binding]; other site
160488006597	active site
160488006598	Predicted phosphatase/phosphohexomutase [General function prediction only]; Region: COG0637
160488006599	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
160488006600	motif II; other site
160488006601	Mannitol-1-phosphate/altronate dehydrogenases [Carbohydrate transport and metabolism]; Region: MtlD; COG0246
160488006602	Mannitol dehydrogenase C-terminal domain; Region: Mannitol_dh_C; pfam08125
160488006603	Protein of unknown function (DUF3144); Region: DUF3144; pfam11342
160488006604	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488006605	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488006606	TThe C-terminal substrate binding domain of an uncharacterized LysR-type transcriptional regulator, contains the type 2 periplasmic binding fold; Region: PBP2_LTTR_like_4; cd08440
160488006607	putative dimerization interface [polypeptide binding]; other site
160488006608	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2828
160488006609	C4-dicarboxylate transporter DctA; Reviewed; Region: PRK01663
160488006610	Na+/H+-dicarboxylate symporters [Energy production and conversion]; Region: GltP; COG1301
160488006611	H+/citrate symporter [Energy production and conversion]; Region: CitM; cl17620
160488006612	Citrate transporter; Region: CitMHS; pfam03600
160488006613	outer membrane porin, OprD family; Region: OprD; pfam03573
160488006614	CsbD-like; Region: CsbD; pfam05532
160488006615	Helix-Turn-Helix DNA binding domain of the SoxR transcription regulator; Region: HTH_SoxR; cd01110
160488006616	redox-sensitive transcriptional activator SoxR; Region: SoxR; TIGR01950
160488006617	DNA binding residues [nucleotide binding]
160488006618	dimer interface [polypeptide binding]; other site
160488006619	[2Fe-2S] cluster binding site [ion binding]; other site
160488006620	RHS repeat-associated core domain; Region: Rhs_assc_core; TIGR03696
160488006621	RND family efflux transporter, MFP subunit; Region: RND_mfp; TIGR01730
160488006622	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
160488006623	HlyD family secretion protein; Region: HlyD_3; pfam13437
160488006624	multidrug efflux protein; Reviewed; Region: PRK09579
160488006625	Transcriptional regulators [Transcription]; Region: PhnF; COG2188
160488006626	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488006627	DNA-binding site [nucleotide binding]; DNA binding site
160488006628	The UbiC transcription regulator-associated (UTRA) domain is a conserved ligand-binding domain; Region: UTRA; smart00866
160488006629	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488006630	drug resistance transporter, EmrB/QacA subfamily; Region: efflux_EmrB; TIGR00711
160488006631	putative substrate translocation pore; other site
160488006632	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488006633	Multidrug resistance efflux pump [Defense mechanisms]; Region: EmrA; COG1566
160488006634	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
160488006635	Multidrug resistance efflux pump [Defense mechanisms]; Region: EmrA; COG1566
160488006636	HlyD family secretion protein; Region: HlyD_3; pfam13437
160488006637	Outer membrane protein [Cell envelope biogenesis, outer membrane / Intracellular trafficking and secretion]; Region: TolC; COG1538
160488006638	AraC-like ligand binding domain; Region: AraC_binding; pfam02311
160488006639	AraC-type DNA-binding domain-containing proteins [Transcription]; Region: AraC; COG2207
160488006640	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488006641	Mannose-6-phosphate isomerase [Carbohydrate transport and metabolism]; Region: {ManC}; COG0662
160488006642	AraC-like ligand binding domain; Region: AraC_binding; pfam02311
160488006643	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
160488006644	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488006645	Acetyltransferase (GNAT) domain; Region: Acetyltransf_10; pfam13673
160488006646	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
160488006647	Coenzyme A binding pocket [chemical binding]; other site
160488006648	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488006649	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488006650	The C-terminal substrate binding domain of an uncharacterized LysR-type transcriptional regulator similar to DntR, which is involved in the catabolism of dinitrotoluene; contains the type 2 periplasmic binding fold; Region: PBP2_DntR_like_2; cd08464
160488006651	putative substrate binding pocket [chemical binding]; other site
160488006652	putative dimerization interface [polypeptide binding]; other site
160488006653	diaminopimelate decarboxylase; Provisional; Region: PRK11165
160488006654	Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzyme Diaminopimelate Decarboxylase; Region: PLPDE_III_DapDC; cd06828
160488006655	active site
160488006656	pyridoxal 5'-phosphate (PLP) binding site [chemical binding]; other site
160488006657	substrate binding site [chemical binding]; other site
160488006658	catalytic residues [active]
160488006659	dimer interface [polypeptide binding]; other site
160488006660	DNA-binding transcriptional regulator LysR; Provisional; Region: PRK11013
160488006661	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488006662	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
160488006663	dimerization interface [polypeptide binding]; other site
160488006664	Bacterial NAD-glutamate dehydrogenase; Region: Bac_GDH; pfam05088
160488006665	PEP synthetase regulatory protein; Provisional; Region: PRK05339
160488006666	phosphoenolpyruvate synthase; Validated; Region: PRK06464
160488006667	Pyruvate phosphate dikinase, PEP/pyruvate binding domain; Region: PPDK_N; pfam01326
160488006668	PEP-utilising enzyme, mobile domain; Region: PEP-utilizers; pfam00391
160488006669	PEP-utilising enzyme, TIM barrel domain; Region: PEP-utilizers_C; pfam02896
160488006670	Putative lysophospholipase; Region: Hydrolase_4; pfam12146
160488006671	Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697
160488006672	ribonuclease activity regulator protein RraA; Provisional; Region: PRK09372
160488006673	CorA-like Mg2+ transporter protein; Region: CorA; pfam01544
160488006674	Salmonella typhimurium Zn2+ transporter ZntB-like subgroup; Region: ZntB-like_1; cd12833
160488006675	Cl binding site [ion binding]; other site
160488006676	oligomer interface [polypeptide binding]; other site
160488006677	RNA polymerase sigma factor SigX; Reviewed; Region: PRK09640
160488006678	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
160488006679	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
160488006680	DNA binding residues [nucleotide binding]
160488006681	Outer membrane protein beta-barrel domain; Region: OMP_b-brl; cl17254
160488006682	Outer membrane protein and related peptidoglycan-associated (lipo)proteins [Cell envelope biogenesis, outer membrane]; Region: OmpA; COG2885
160488006683	Peptidoglycan binding domains similar to the C-terminal domain of outer-membrane protein OmpA; Region: OmpA_C-like; cd07185
160488006684	ligand binding site [chemical binding]; other site
160488006685	Uroporphyrin-III C-methyltransferase (S-Adenosyl-L-methionine:uroporphyrinogen III methyltransferase, SUMT); Region: SUMT; cd11642
160488006686	active site
160488006687	SAM binding site [chemical binding]; other site
160488006688	homodimer interface [polypeptide binding]; other site
160488006689	Serine/threonine protein phosphatase [Signal transduction mechanisms]; Region: PTC1; COG0631
160488006690	active site
160488006691	Protein kinase domain; Region: Pkinase; pfam00069
160488006692	Catalytic domain of Protein Kinases; Region: PKc; cd00180
160488006693	active site
160488006694	ATP binding site [chemical binding]; other site
160488006695	substrate binding site [chemical binding]; other site
160488006696	activation loop (A-loop); other site
160488006697	Nitrate/nitrite transporter [Inorganic ion transport and metabolism]; Region: NarK; COG2223
160488006698	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488006699	putative substrate translocation pore; other site
160488006700	Response regulator with putative antiterminator output domain [Signal transduction mechanisms]; Region: AmiR; COG3707
160488006701	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488006702	active site
160488006703	phosphorylation site [posttranslational modification]
160488006704	intermolecular recognition site; other site
160488006705	dimerization interface [polypeptide binding]; other site
160488006706	ANTAR domain; Region: ANTAR; pfam03861
160488006707	ABC-type nitrate/sulfonate/bicarbonate transport systems, periplasmic components [Inorganic ion transport and metabolism]; Region: TauA; COG0715
160488006708	NMT1-like family; Region: NMT1_2; pfam13379
160488006709	dihydroorotate dehydrogenase 2; Reviewed; Region: PRK05286
160488006710	Dihydroorotate dehydrogenase (DHOD) class 2. DHOD catalyzes the oxidation of (S)-dihydroorotate to orotate. This is the fourth step and the only redox reaction in the de novo biosynthesis of UMP, the precursor of all pyrimidine nucleotides. DHOD requires...; Region: DHOD_2_like; cd04738
160488006711	quinone interaction residues [chemical binding]; other site
160488006712	active site
160488006713	catalytic residues [active]
160488006714	FMN binding site [chemical binding]; other site
160488006715	substrate binding site [chemical binding]; other site
160488006716	23S rRNA m(2)G2445 methyltransferase; Provisional; Region: rlmL; PRK11783
160488006717	THUMP domain associated with S-adenosylmethionine-dependent methyltransferases; Region: THUMP_AdoMetMT; cd11715
160488006718	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cl17173
160488006719	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488006720	S-adenosylmethionine binding site [chemical binding]; other site
160488006721	CHASE domain; Region: CHASE; pfam03924
160488006722	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488006723	PAS domain; Region: PAS_9; pfam13426
160488006724	putative active site [active]
160488006725	heme pocket [chemical binding]; other site
160488006726	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488006727	heme pocket [chemical binding]; other site
160488006728	putative active site [active]
160488006729	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
160488006730	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488006731	metal binding site [ion binding]; metal-binding site
160488006732	active site
160488006733	I-site; other site
160488006734	D-alanyl-D-alanine carboxypeptidase (penicillin-binding protein 4) [Cell envelope biogenesis, outer membrane]; Region: DacB; COG2027
160488006735	hypothetical protein; Provisional; Region: PRK11702
160488006736	hybrid sensory histidine kinase in two-component regulatory system with EvgA; Provisional; Region: PRK09959
160488006737	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488006738	substrate binding pocket [chemical binding]; other site
160488006739	membrane-bound complex binding site; other site
160488006740	hinge residues; other site
160488006741	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488006742	substrate binding pocket [chemical binding]; other site
160488006743	membrane-bound complex binding site; other site
160488006744	hinge residues; other site
160488006745	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488006746	putative active site [active]
160488006747	heme pocket [chemical binding]; other site
160488006748	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488006749	dimer interface [polypeptide binding]; other site
160488006750	phosphorylation site [posttranslational modification]
160488006751	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488006752	ATP binding site [chemical binding]; other site
160488006753	Mg2+ binding site [ion binding]; other site
160488006754	G-X-G motif; other site
160488006755	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488006756	active site
160488006757	phosphorylation site [posttranslational modification]
160488006758	intermolecular recognition site; other site
160488006759	dimerization interface [polypeptide binding]; other site
160488006760	Histidine Phosphotransfer domain, involved in signalling through a two part component systems in which an autophosphorylating histidine protein kinase serves as a phosphoryl donor to a response regulator protein; the response regulator protein is...; Region: HPT; cd00088
160488006761	putative binding surface; other site
160488006762	active site
160488006763	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
160488006764	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488006765	active site
160488006766	phosphorylation site [posttranslational modification]
160488006767	intermolecular recognition site; other site
160488006768	dimerization interface [polypeptide binding]; other site
160488006769	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
160488006770	DNA binding residues [nucleotide binding]
160488006771	dimerization interface [polypeptide binding]; other site
160488006772	deoxyguanosinetriphosphate triphosphohydrolase-like protein; Provisional; Region: PRK01096
160488006773	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; smart00471
160488006774	Predicted membrane protein [Function unknown]; Region: COG5393
160488006775	Uncharacterized conserved protein [Function unknown]; Region: ElaB; COG4575
160488006776	Ammonium Transporter Family; Region: Ammonium_transp; cl03012
160488006777	Glutaredoxin-like domain (DUF836); Region: DUF836; pfam05768
160488006778	Peptidase M15; Region: Peptidase_M15_3; pfam08291
160488006779	PAS domain; Region: PAS_9; pfam13426
160488006780	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488006781	putative active site [active]
160488006782	heme pocket [chemical binding]; other site
160488006783	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
160488006784	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
160488006785	dimer interface [polypeptide binding]; other site
160488006786	putative CheW interface [polypeptide binding]; other site
160488006787	aconitate hydratase; Validated; Region: PRK09277
160488006788	Aconitase catalytic domain; Aconitase catalyzes the reversible isomerization of citrate and isocitrate as part of the TCA cycle; Region: Aconitase; cl00285
160488006789	substrate binding site [chemical binding]; other site
160488006790	ligand binding site [chemical binding]; other site
160488006791	Aconitase A swivel domain. This is the major form of the TCA cycle enzyme aconitate hydratase, also known as aconitase and citrate hydro-lyase. It includes bacterial and archaeal aconitase A, and the eukaryotic cytosolic form of aconitase. This group...; Region: AcnA_IRP_Swivel; cd01580
160488006792	substrate binding site [chemical binding]; other site
160488006793	putative 23S rRNA C2498 ribose 2'-O-ribose methyltransferase; Provisional; Region: PRK11760
160488006794	FtsJ-like methyltransferase; Region: FtsJ; pfam01728
160488006795	Transposase DDE domain; Region: DDE_Tnp_1; pfam01609
160488006796	SirA (also known as UvrY,  and YhhP) belongs to a family of two-component response regulators that controls secondary metabolism and virulence. The other member of this two-component system is a sensor kinase called BarA which phosphorylates SirA.  A...; Region: SirA; cd03423
160488006797	CPxP  motif; other site
160488006798	erythronate-4-phosphate dehydrogenase; Validated; Region: PRK00257
160488006799	D-Erythronate-4-Phosphate Dehydrogenase NAD-binding and catalytic domains; Region: ErythrP_dh; cd12158
160488006800	ligand binding site [chemical binding]; other site
160488006801	NAD binding site [chemical binding]; other site
160488006802	catalytic site [active]
160488006803	homodimer interface [polypeptide binding]; other site
160488006804	ABC transporter, permease/ATP-binding protein; Region: MsbA_rel; TIGR02204
160488006805	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
160488006806	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488006807	Walker A/P-loop; other site
160488006808	ATP binding site [chemical binding]; other site
160488006809	Q-loop/lid; other site
160488006810	ABC transporter signature motif; other site
160488006811	Walker B; other site
160488006812	D-loop; other site
160488006813	H-loop/switch region; other site
160488006814	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
160488006815	dimerization interface [polypeptide binding]; other site
160488006816	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
160488006817	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
160488006818	dimer interface [polypeptide binding]; other site
160488006819	putative CheW interface [polypeptide binding]; other site
160488006820	Bacterial protein of unknown function (DUF903); Region: DUF903; pfam06004
160488006821	MogA_MoaB family. Members of this family are involved in biosynthesis of the molybdenum cofactor (MoCF) an essential cofactor of a diverse group of redox enzymes. MoCF biosynthesis is an evolutionarily conserved pathway present in eubacteria, archaea; Region: MogA_MoaB; cd00886
160488006822	MPT binding site; other site
160488006823	trimer interface [polypeptide binding]; other site
160488006824	Molybdopterin biosynthesis enzyme [Coenzyme metabolism]; Region: MoeA; COG0303
160488006825	MoeA family. Members of this family are involved in biosynthesis of the molybdenum cofactor (MoCF), an essential cofactor of a diverse group of redox enzymes. MoCF biosynthesis is an evolutionarily conserved pathway present in eubacteria, archaea and...; Region: MoeA; cd00887
160488006826	dimer interface [polypeptide binding]; other site
160488006827	putative functional site; other site
160488006828	putative MPT binding site; other site
160488006829	Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438
160488006830	This family is most closely related to the GT1 family of glycosyltransferases and named after YqgM in Bacillus licheniformis about which little is known. Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to...; Region: GT1_YqgM_like; cd03801
160488006831	lipid kinase; Reviewed; Region: PRK13054
160488006832	Diacylglycerol kinase catalytic domain; Region: DAGK_cat; pfam00781
160488006833	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
160488006834	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488006835	active site
160488006836	phosphorylation site [posttranslational modification]
160488006837	intermolecular recognition site; other site
160488006838	dimerization interface [polypeptide binding]; other site
160488006839	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
160488006840	DNA binding residues [nucleotide binding]
160488006841	dimerization interface [polypeptide binding]; other site
160488006842	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: COG4585
160488006843	Histidine kinase; Region: HisKA_3; pfam07730
160488006844	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488006845	ATP binding site [chemical binding]; other site
160488006846	Mg2+ binding site [ion binding]; other site
160488006847	G-X-G motif; other site
160488006848	Chemotaxis signal transduction protein [Cell motility and secretion / Signal transduction mechanisms]; Region: CheW; COG0835
160488006849	FOG: CheY-like receiver [Signal transduction mechanisms]; Region: CheY; COG0784
160488006850	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488006851	active site
160488006852	phosphorylation site [posttranslational modification]
160488006853	intermolecular recognition site; other site
160488006854	dimerization interface [polypeptide binding]; other site
160488006855	Uncharacterized Fe-S protein [General function prediction only]; Region: COG3217
160488006856	MOSC N-terminal beta barrel domain; Region: MOSC_N; pfam03476
160488006857	MOSC domain; Region: MOSC; pfam03473
160488006858	lytic murein transglycosylase; Provisional; Region: PRK11619
160488006859	Lytic Transglycosylase (LT)  and Goose Egg White Lysozyme (GEWL) domain. Members include the soluble and insoluble membrane-bound LTs in bacteria, the LTs in bacteriophage lambda, as well as, the eukaryotic "goose-type" lysozymes (GEWL).  LTs...; Region: LT_GEWL; cd00254
160488006860	N-acetyl-D-glucosamine binding site [chemical binding]; other site
160488006861	catalytic residue [active]
160488006862	ABC transporter ATPase component; Reviewed; Region: PRK11147
160488006863	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
160488006864	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
160488006865	ABC transporter; Region: ABC_tran_2; pfam12848
160488006866	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
160488006867	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
160488006868	Ligand Binding Site [chemical binding]; other site
160488006869	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3547
160488006870	Transposase; Region: DEDD_Tnp_IS110; pfam01548
160488006871	Transposase IS116/IS110/IS902 family; Region: Transposase_20; pfam02371
160488006872	multifunctional fatty acid oxidation complex subunit alpha; Reviewed; Region: fadB; PRK11730
160488006873	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
160488006874	substrate binding site [chemical binding]; other site
160488006875	oxyanion hole (OAH) forming residues; other site
160488006876	trimer interface [polypeptide binding]; other site
160488006877	3-hydroxyacyl-CoA dehydrogenase, NAD binding domain; Region: 3HCDH_N; pfam02737
160488006878	3-hydroxyacyl-CoA dehydrogenase, C-terminal domain; Region: 3HCDH; pfam00725
160488006879	3-ketoacyl-CoA thiolase; Reviewed; Region: fadA; PRK08947
160488006880	Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751
160488006881	dimer interface [polypeptide binding]; other site
160488006882	active site
160488006883	Protein of unknown function (DUF1653); Region: DUF1653; pfam07866
160488006884	DNA topoisomerase I subunit omega; Validated; Region: PRK07561
160488006885	TOPRIM_TopoIA_TopoI: The topoisomerase-primase (TORPIM) domain found in members of the type IA family of DNA topoisomerases (Topo IA) similar to Escherichia coli DNA topoisomerase I.   Type IA DNA topoisomerases remove (relax) negative supercoils in the...; Region: TOPRIM_TopoIA_TopoI; cd03363
160488006886	active site
160488006887	interdomain interaction site; other site
160488006888	putative metal-binding site [ion binding]; other site
160488006889	nucleotide binding site [chemical binding]; other site
160488006890	DNA Topoisomerase, subtype IA; DNA-binding, ATP-binding and catalytic domain of bacterial DNA topoisomerases I and III, and eukaryotic DNA topoisomerase III and eubacterial and archael reverse gyrases. Topoisomerases clevage single or double stranded DNA...; Region: TOP1Ac; cd00186
160488006891	domain I; other site
160488006892	DNA binding groove [nucleotide binding]
160488006893	phosphate binding site [ion binding]; other site
160488006894	domain II; other site
160488006895	domain III; other site
160488006896	nucleotide binding site [chemical binding]; other site
160488006897	catalytic site [active]
160488006898	domain IV; other site
160488006899	Topoisomerase DNA binding C4 zinc finger; Region: zf-C4_Topoisom; pfam01396
160488006900	Topoisomerase DNA binding C4 zinc finger; Region: zf-C4_Topoisom; pfam01396
160488006901	Topoisomerase I zinc-ribbon-like; Region: Topo_Zn_Ribbon; pfam08272
160488006902	Topoisomerase I zinc-ribbon-like; Region: Topo_Zn_Ribbon; pfam08272
160488006903	Cell division inhibitor SulA; Region: SulA; cl01880
160488006904	LexA repressor; Validated; Region: PRK00215
160488006905	LexA DNA binding domain; Region: LexA_DNA_bind; pfam01726
160488006906	Peptidase S24 LexA-like proteins are involved in the SOS response leading to the repair of single-stranded DNA within the bacterial cell. This family includes: the lambda repressor CI/C2 family and related bacterial prophage repressor proteins; LexA (EC...; Region: S24_LexA-like; cd06529
160488006907	Catalytic site [active]
160488006908	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
160488006909	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
160488006910	Protein of unknown function (DUF3179); Region: DUF3179; pfam11376
160488006911	beta-hexosaminidase; Provisional; Region: PRK05337
160488006912	Beta-glucosidase-related glycosidases [Carbohydrate transport and metabolism]; Region: BglX; COG1472
160488006913	SNF2 family N-terminal domain; Region: SNF2_N; pfam00176
160488006914	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
160488006915	ATP binding site [chemical binding]; other site
160488006916	putative Mg++ binding site [ion binding]; other site
160488006917	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
160488006918	nucleotide binding region [chemical binding]; other site
160488006919	ATP-binding site [chemical binding]; other site
160488006920	Protein of unknown function (DUF2803); Region: DUF2803; pfam10972
160488006921	Transcription-repair coupling factor (superfamily II helicase) [DNA replication, recombination, and repair / Transcription]; Region: Mfd; COG1197
160488006922	CarD-like/TRCF domain; Region: CarD_TRCF; smart01058
160488006923	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
160488006924	ATP binding site [chemical binding]; other site
160488006925	putative Mg++ binding site [ion binding]; other site
160488006926	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
160488006927	nucleotide binding region [chemical binding]; other site
160488006928	ATP-binding site [chemical binding]; other site
160488006929	This domain is found in proteins necessary for strand-specific repair in DNA such as TRCF in Escherichia coli; Region: TRCF; smart00982
160488006930	glyceraldehyde-3-phosphate dehydrogenase; Reviewed; Region: PRK08289
160488006931	Glyceraldehyde 3-phosphate dehydrogenase, NAD binding domain; Region: Gp_dh_N; smart00846
160488006932	Glyceraldehyde 3-phosphate dehydrogenase, C-terminal domain; Region: Gp_dh_C; pfam02800
160488006933	Membrane-associated lipoprotein involved in thiamine biosynthesis [Coenzyme metabolism]; Region: ApbE; COG1477
160488006934	ApbE family; Region: ApbE; pfam02424
160488006935	soluble pyridine nucleotide transhydrogenase; Provisional; Region: PRK05249
160488006936	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
160488006937	Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852
160488006938	Glycerophosphoryl diester phosphodiesterase [Energy production and conversion]; Region: UgpQ; COG0584
160488006939	Glycerophosphodiester phosphodiesterase domain as found in prokaryota and eukaryota, and similar proteins; Region: GDPD; cd08556
160488006940	active site
160488006941	catalytic site [active]
160488006942	metal binding site [ion binding]; metal-binding site
160488006943	PilZ domain; Region: PilZ; pfam07238
160488006944	lipoprotein releasing system, transmembrane protein, LolC/E family; Region: lolCE; TIGR02212
160488006945	MacB-like periplasmic core domain; Region: MacB_PCD; pfam12704
160488006946	FtsX-like permease family; Region: FtsX; pfam02687
160488006947	lipoprotein releasing system, ATP-binding protein; Region: LolD_lipo_ex; TIGR02211
160488006948	ATP-binding cassette domain of the transporters involved in export of lipoprotein and macrolide, and cell division protein; Region: ABC_MJ0796_LolCDE_FtsE; cd03255
160488006949	Walker A/P-loop; other site
160488006950	ATP binding site [chemical binding]; other site
160488006951	Q-loop/lid; other site
160488006952	ABC transporter signature motif; other site
160488006953	Walker B; other site
160488006954	D-loop; other site
160488006955	H-loop/switch region; other site
160488006956	lipoprotein releasing system, transmembrane protein, LolC/E family; Region: lolCE; TIGR02212
160488006957	MacB-like periplasmic core domain; Region: MacB_PCD; pfam12704
160488006958	FtsX-like permease family; Region: FtsX; pfam02687
160488006959	heavy metal sensor kinase; Region: cztS_silS_copS; TIGR01386
160488006960	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
160488006961	dimerization interface [polypeptide binding]; other site
160488006962	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488006963	dimer interface [polypeptide binding]; other site
160488006964	phosphorylation site [posttranslational modification]
160488006965	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488006966	ATP binding site [chemical binding]; other site
160488006967	Mg2+ binding site [ion binding]; other site
160488006968	G-X-G motif; other site
160488006969	heavy metal response regulator; Region: cztR_silR_copR; TIGR01387
160488006970	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488006971	active site
160488006972	phosphorylation site [posttranslational modification]
160488006973	intermolecular recognition site; other site
160488006974	dimerization interface [polypeptide binding]; other site
160488006975	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
160488006976	DNA binding site [nucleotide binding]
160488006977	Uncharacterized copper-binding protein [Inorganic ion transport and metabolism]; Region: COG4454
160488006978	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2904
160488006979	7-cyano-7-deazaguanine reductase; Provisional; Region: queF; PRK11792
160488006980	Enzyme related to GTP cyclohydrolase I [General function prediction only]; Region: COG0780
160488006981	Domain of unknown function (DUF4404); Region: DUF4404; pfam14357
160488006982	Haloacid dehalogenase-like hydrolase; Region: HAD_2; pfam13419
160488006983	Surface lipoprotein [Cell envelope biogenesis, outer membrane]; Region: VacJ; COG2853
160488006984	PilZ domain; Region: PilZ; pfam07238
160488006985	Response regulator receiver domain; Region: Response_reg; pfam00072
160488006986	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488006987	active site
160488006988	phosphorylation site [posttranslational modification]
160488006989	intermolecular recognition site; other site
160488006990	Serine phosphatase RsbU, regulator of sigma subunit [Signal transduction mechanisms / Transcription]; Region: RsbU; COG2208
160488006991	dimerization interface [polypeptide binding]; other site
160488006992	Stage II sporulation protein E (SpoIIE); Region: SpoIIE; pfam07228
160488006993	Sulphate Transporter and Anti-Sigma factor antagonist) domain of anti-anti-sigma factors, key regulators of anti-sigma factors by phosphorylation; Region: STAS_anti-anti-sigma_factors; cd07043
160488006994	anti sigma factor interaction site; other site
160488006995	regulatory phosphorylation site [posttranslational modification]; other site
160488006996	metallophosphatase superfamily, metallophosphatase domain; Region: MPP_superfamily; cl13995
160488006997	metal binding site [ion binding]; metal-binding site
160488006998	Bacillus subtilis PhoD and related proteins, metallophosphatase domain; Region: MPP_PhoD; cd07389
160488006999	putative active site [active]
160488007000	putative metal binding site [ion binding]; other site
160488007001	transaldolase-like protein; Provisional; Region: PTZ00411
160488007002	Transaldolases including both TalA and TalB; Region: Transaldolase_TalAB; cd00957
160488007003	active site
160488007004	dimer interface [polypeptide binding]; other site
160488007005	catalytic residue [active]
160488007006	tRNA-dihydrouridine synthase A; Provisional; Region: PRK11815
160488007007	Dihydrouridine synthase-like (DUS-like) FMN-binding domain. Members of this family catalyze the reduction of the 5,6-double bond of a uridine residue on tRNA. Dihydrouridine modification of tRNA is widely observed in prokaryotes and eukaryotes, and also...; Region: DUS_like_FMN; cd02801
160488007008	FMN binding site [chemical binding]; other site
160488007009	active site
160488007010	catalytic residues [active]
160488007011	substrate binding site [chemical binding]; other site
160488007012	DNA breaking-rejoining enzymes, C-terminal catalytic domain. The DNA breaking-rejoining enzyme superfamily includes type IB topoisomerases and tyrosine recombinases that share the same fold in their catalytic domain containing six conserved active site...; Region: DNA_BRE_C; cl00213
160488007013	Chorismate mutase type II; Region: CM_2; smart00830
160488007014	Putative threonine efflux protein [Amino acid transport and metabolism]; Region: RhtB; COG1280
160488007015	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488007016	Helix-turn-helix domain; Region: HTH_18; pfam12833
160488007017	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488007018	DNA gyrase inhibitor [DNA replication, recombination, and repair]; Region: COG3449
160488007019	Uncharacterized conserved protein [Function unknown]; Region: COG3791
160488007020	putative beta-ketoacyl acyl carrier protein [ACP] reductase (BKR)-like, SDR; Region: BKR_like_SDR_like; cd05344
160488007021	oxidoreductase; Provisional; Region: PRK12743
160488007022	putative NAD(P) binding site [chemical binding]; other site
160488007023	putative active site [active]
160488007024	DNA-binding transcriptional activator GcvA; Provisional; Region: PRK11139
160488007025	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488007026	The C-terminal substrate domain of LysR-type GcdR, TrPI, HvR and beta-lactamase regulators, and that of other closely related homologs; contains the type 2 periplasmic binding fold; Region: PBP2_GcdR_TrpI_HvrB_AmpR_like; cd08432
160488007027	dimerization interface [polypeptide binding]; other site
160488007028	substrate binding pocket [chemical binding]; other site
160488007029	DNA-binding transcriptional repressor PuuR; Provisional; Region: PRK09943
160488007030	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
160488007031	non-specific DNA binding site [nucleotide binding]; other site
160488007032	salt bridge; other site
160488007033	sequence-specific DNA binding site [nucleotide binding]; other site
160488007034	Cupin domain; Region: Cupin_2; pfam07883
160488007035	Glutamine synthetase [Amino acid transport and metabolism]; Region: GlnA; COG0174
160488007036	Glutamine synthetase, catalytic domain; Region: Gln-synt_C; pfam00120
160488007037	Peptidase C26; Region: Peptidase_C26; pfam07722
160488007038	Subgroup of proteins having the Type 1 glutamine amidotransferase (GATase1) domain; Region: GATase1_2; cd01745
160488007039	catalytic triad [active]
160488007040	putative aminotransferase; Validated; Region: PRK07480
160488007041	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
160488007042	inhibitor-cofactor binding pocket; inhibition site
160488007043	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488007044	catalytic residue [active]
160488007045	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
160488007046	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
160488007047	non-specific DNA binding site [nucleotide binding]; other site
160488007048	salt bridge; other site
160488007049	sequence-specific DNA binding site [nucleotide binding]; other site
160488007050	Cupin domain; Region: Cupin_2; pfam07883
160488007051	putative kissing complex interaction region; other site
160488007052	putative RNA binding sites [nucleotide binding]; other site
160488007053	Activator of osmoprotectant transporter ProP [Signal transduction mechanisms]; Region: ProQ; COG3109
160488007054	ProQ/FINO family; Region: ProQ; pfam04352
160488007055	formate dehydrogenase subunit gamma; Validated; Region: PRK05988
160488007056	TRX-like [2Fe-2S] Ferredoxin (Fd) family, NADH:ubiquinone oxidoreductase (Nuo) subunit E subfamily, NAD-dependent formate dehydrogenase (FDH) gamma subunit; composed of proteins similar to the gamma subunit of NAD-linked FDH of Ralstonia eutropha, a...; Region: TRX_Fd_NuoE_FDH_gamma; cd03081
160488007057	putative dimer interface [polypeptide binding]; other site
160488007058	[2Fe-2S] cluster binding site [ion binding]; other site
160488007059	TRX-like [2Fe-2S] Ferredoxin (Fd) family, NAD-dependent formate dehydrogenase (FDH) beta subunit; composed of proteins similar to the beta subunit of NAD-linked FDH of Ralstonia eutropha, a soluble enzyme that catalyzes the irreversible oxidation of...; Region: TRX_Fd_FDH_beta; cd03063
160488007060	putative dimer interface [polypeptide binding]; other site
160488007061	NADH:ubiquinone oxidoreductase, NADH-binding (51 kD) subunit [Energy production and conversion]; Region: NuoF; COG1894
160488007062	SLBB domain; Region: SLBB; pfam10531
160488007063	NADH-ubiquinone oxidoreductase-F iron-sulfur binding region; Region: NADH_4Fe-4S; smart00928
160488007064	Uncharacterized anaerobic dehydrogenase [General function prediction only]; Region: COG3383
160488007065	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
160488007066	catalytic loop [active]
160488007067	iron binding site [ion binding]; other site
160488007068	NADH-ubiquinone oxidoreductase-G iron-sulfur binding region; Region: NADH-G_4Fe-4S_3; pfam10588
160488007069	The HCP family of iron-sulfur proteins includes hybrid cluster protein (HCP), acetyl-CoA synthase (ACS), and carbon monoxide dehydrogenase (CODH), all of which contain [Fe4-S4] metal clusters at their active sites. These proteins have a conserved...; Region: HCP_like; cl14655
160488007070	Formate dehydrogenase H (Formate-Dh-H) catalyzes the reversible oxidation of formate to CO2 with the release of a proton and two electrons. It is a component of the anaerobic formate hydrogen lyase complex. The E. coli formate dehydrogenase H (Fdh-H) is...; Region: MopB_Formate-Dh-H; cd02753
160488007071	[4Fe-4S] binding site [ion binding]; other site
160488007072	molybdopterin cofactor binding site; other site
160488007073	This CD includes formate dehydrogenases (Fdh) H and N; nitrate reductases, Nap and Nas; and other related proteins. Formate dehydrogenase H is a component of the anaerobic formate hydrogen lyase complex  and catalyzes the reversible oxidation of formate...; Region: MopB_CT_Fdh-Nap-like; cd00508
160488007074	molybdopterin cofactor binding site; other site
160488007075	NADH-dependant formate dehydrogenase delta subunit FdsD; Region: FdsD; pfam11390
160488007076	universal stress protein UspE; Provisional; Region: PRK11175
160488007077	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
160488007078	Ligand Binding Site [chemical binding]; other site
160488007079	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
160488007080	Ligand Binding Site [chemical binding]; other site
160488007081	MiaE tRNA-modifying nonheme diiron monooxygenase, ferritin-like diiron-binding domain; Region: MiaE; cd07910
160488007082	active site
160488007083	dinuclear metal binding site [ion binding]; other site
160488007084	dimerization interface [polypeptide binding]; other site
160488007085	Bacterial protein of unknown function (DUF883); Region: DUF883; pfam05957
160488007086	Water Stress and Hypersensitive response; Region: WHy; smart00769
160488007087	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
160488007088	RNA polymerase sigma factor; Reviewed; Region: PRK12527
160488007089	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
160488007090	DNA binding residues [nucleotide binding]
160488007091	FecR protein; Region: FecR; pfam04773
160488007092	Secretin and TonB N terminus short domain; Region: STN; smart00965
160488007093	TonB-dependent siderophore receptor; Region: TonB-siderophor; TIGR01783
160488007094	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
160488007095	N-terminal plug; other site
160488007096	ligand-binding site [chemical binding]; other site
160488007097	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488007098	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488007099	LysR substrate binding domain; Region: LysR_substrate; pfam03466
160488007100	dimerization interface [polypeptide binding]; other site
160488007101	putrescine transporter subunit: periplasmic-binding component of ABC superfamily; Provisional; Region: PRK10682
160488007102	Bacterial extracellular solute-binding protein; Region: SBP_bac_1; cl17199
160488007103	Agmatinase-like family includes proclavaminic acid amidinohydrolase; Region: Agmatinase_PAH; cd11592
160488007104	agmatinase; Region: agmatinase; TIGR01230
160488007105	oligomer interface [polypeptide binding]; other site
160488007106	putative active site [active]
160488007107	Mn binding site [ion binding]; other site
160488007108	dehydrogenase, PQQ-dependent, s-GDH family; Region: non_repeat_PQQ; TIGR03606
160488007109	Glucose / Sorbosone dehydrogenase; Region: GSDH; pfam07995
160488007110	Predicted ATPase [General function prediction only]; Region: COG1485
160488007111	DinB family; Region: DinB; cl17821
160488007112	DinB superfamily; Region: DinB_2; pfam12867
160488007113	Alpha/beta hydrolase of unknown function (DUF1057); Region: DUF1057; pfam06342
160488007114	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
160488007115	Predicted membrane protein [Function unknown]; Region: COG1238
160488007116	Protein of unknown function, DUF; Region: DUF411; cl01142
160488007117	Copper resistance protein B precursor (CopB); Region: CopB; pfam05275
160488007118	copper-resistance protein, CopA family; Region: copper_res_A; TIGR01480
160488007119	Multicopper oxidase; Region: Cu-oxidase_3; pfam07732
160488007120	Multicopper oxidase; Region: Cu-oxidase; pfam00394
160488007121	Multicopper oxidase; Region: Cu-oxidase_2; pfam07731
160488007122	putative protease; Provisional; Region: PRK15452
160488007123	Peptidase family U32; Region: Peptidase_U32; pfam01136
160488007124	Predicted permease, member of the PurR regulon [General function prediction only]; Region: yhhT; COG0628
160488007125	Domain of unknown function DUF20; Region: UPF0118; pfam01594
160488007126	phosphonoacetaldehyde hydrolase; Provisional; Region: PRK13478
160488007127	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
160488007128	motif II; other site
160488007129	2-aminoethylphosphonate--pyruvate transaminase; Provisional; Region: PRK13479
160488007130	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
160488007131	catalytic residue [active]
160488007132	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488007133	aminoethylphosphonate catabolism associated LysR family transcriptional regulator; Region: phn_lysR; TIGR03339
160488007134	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
160488007135	dimerization interface [polypeptide binding]; other site
160488007136	Arabinose-binding domain of AraC transcription regulator, N-term; Region: Arabinose_bd; pfam12625
160488007137	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
160488007138	SurA N-terminal domain; Region: SurA_N; pfam09312
160488007139	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488007140	Leucine-rich repeats (LRRs), ribonuclease inhibitor (RI)-like subfamily. LRRs are 20-29 residue sequence motifs present in many proteins that participate in protein-protein interactions and have different functions and cellular locations. LRRs correspond...; Region: LRR_RI; cl15309
160488007141	Leucine rich repeat; Region: LRR_8; pfam13855
160488007142	Acyl-coenzyme A synthetases/AMP-(fatty) acid ligases [Lipid metabolism]; Region: Acs; COG0365
160488007143	Uncharacterized subfamily of medium-chain acyl-CoA synthetase (MACS); Region: MACS_like_2; cd05973
160488007144	active site
160488007145	acyl-activating enzyme (AAE) consensus motif; other site
160488007146	putative CoA binding site [chemical binding]; other site
160488007147	AMP binding site [chemical binding]; other site
160488007148	3-ketoacyl-(acyl-carrier-protein) reductase; Provisional; Region: fabG; PRK08217
160488007149	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
160488007150	NAD(P) binding site [chemical binding]; other site
160488007151	active site
160488007152	acetyl-CoA acetyltransferase; Provisional; Region: PRK06954
160488007153	Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751
160488007154	dimer interface [polypeptide binding]; other site
160488007155	active site
160488007156	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
160488007157	Short chain acyl-CoA dehydrogenases and eukaryotic short/branched chain acyl-CoA dehydrogenases; Region: SCAD_SBCAD; cd01158
160488007158	FAD binding site [chemical binding]; other site
160488007159	homotetramer interface [polypeptide binding]; other site
160488007160	substrate binding pocket [chemical binding]; other site
160488007161	catalytic base [active]
160488007162	enoyl-CoA hydratase; Provisional; Region: PRK05862
160488007163	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
160488007164	substrate binding site [chemical binding]; other site
160488007165	oxyanion hole (OAH) forming residues; other site
160488007166	trimer interface [polypeptide binding]; other site
160488007167	Transposase DDE domain; Region: DDE_Tnp_1; pfam01609
160488007168	RNA polymerase-binding protein DksA; Region: dksA; TIGR02420
160488007169	putative monovalent cation/H+ antiporter subunit G; Reviewed; Region: PRK12671
160488007170	putative monovalent cation/H+ antiporter subunit F; Reviewed; Region: PRK06161
160488007171	putative monovalent cation/H+ antiporter subunit E; Reviewed; Region: PRK08965
160488007172	putative monovalent cation/H+ antiporter subunit D; Reviewed; Region: PRK12666
160488007173	NADH-Ubiquinone/plastoquinone (complex I), various chains; Region: Oxidored_q1; pfam00361
160488007174	putative monovalent cation/H+ antiporter subunit C; Reviewed; Region: PRK09094
160488007175	putative monovalent cation/H+ antiporter subunit A; Reviewed; Region: PRK12648
160488007176	NADH-Ubiquinone oxidoreductase (complex I), chain 5 N-terminus; Region: Oxidored_q1_N; pfam00662
160488007177	NADH-Ubiquinone/plastoquinone (complex I), various chains; Region: Oxidored_q1; pfam00361
160488007178	Multisubunit Na+/H+ antiporter, MnhB subunit [Inorganic ion transport and metabolism]; Region: MnhB; COG2111
160488007179	Domain of unknown function (DUF4040); Region: DUF4040; cl00676
160488007180	monovalent cation:proton antiporter; Region: 2a6301s02; TIGR00943
160488007181	EamA-like transporter family; Region: EamA; pfam00892
160488007182	Carboxylate/Amino Acid/Amine Transporter; Region: 2A78; TIGR00950
160488007183	EamA-like transporter family; Region: EamA; pfam00892
160488007184	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
160488007185	non-specific DNA binding site [nucleotide binding]; other site
160488007186	salt bridge; other site
160488007187	sequence-specific DNA binding site [nucleotide binding]; other site
160488007188	Cupin domain; Region: Cupin_2; pfam07883
160488007189	Isochorismatase family; Region: Isochorismatase; pfam00857
160488007190	Nicotinamidase_ related amidohydrolases.  Cysteine hydrolases of unknown function that share the catalytic triad with other amidohydrolases, like nicotinamidase, which converts nicotinamide to nicotinic acid and ammonia; Region: nicotinamidase_related; cd01014
160488007191	catalytic triad [active]
160488007192	conserved cis-peptide bond; other site
160488007193	Transcriptional regulator containing an amidase domain and an AraC-type DNA-binding HTH domain [Transcription]; Region: COG4977
160488007194	AraC transcriptional regulators having a Type 1 glutamine amidotransferase (GATase1)-like domain; Region: GATase1_AraC_2; cd03138
160488007195	conserved cys residue [active]
160488007196	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488007197	Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697
160488007198	Protein of unknown function (DUF3182); Region: DUF3182; pfam11379
160488007199	Creatinase/Prolidase N-terminal domain; Region: Creatinase_N; pfam01321
160488007200	Xaa-Pro aminopeptidase [Amino acid transport and metabolism]; Region: PepP; COG0006
160488007201	X-Prolyl Aminopeptidase 2. E.C. 3.4.11.9. Also known as X-Pro aminopeptidase, proline aminopeptidase, aminopeptidase P, and aminoacylproline aminopeptidase. Catalyses release of any N-terminal amino acid, including proline, that is linked with proline; Region: APP; cd01085
160488007202	active site
160488007203	threonine and homoserine efflux system; Provisional; Region: PRK10532
160488007204	EamA-like transporter family; Region: EamA; cl17759
160488007205	ABC-type uncharacterized transport system, permease and ATPase components [General function prediction only]; Region: COG4178
160488007206	ABC transporter transmembrane region 2; Region: ABC_membrane_2; cl00549
160488007207	ATP-binding cassette domain of peroxisomal transporter, subfamily D; Region: ABCD_peroxisomal_ALDP; cd03223
160488007208	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488007209	Major Facilitator Superfamily; Region: MFS_1; pfam07690
160488007210	putative substrate translocation pore; other site
160488007211	outer membrane receptor FepA; Provisional; Region: PRK13524
160488007212	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
160488007213	N-terminal plug; other site
160488007214	ligand-binding site [chemical binding]; other site
160488007215	Histidine phosphatase superfamily (branch 1); Region: His_Phos_1; pfam00300
160488007216	Sulfite exporter TauE/SafE; Region: TauE; pfam01925
160488007217	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
160488007218	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
160488007219	non-specific DNA binding site [nucleotide binding]; other site
160488007220	salt bridge; other site
160488007221	sequence-specific DNA binding site [nucleotide binding]; other site
160488007222	Cupin domain; Region: Cupin_2; pfam07883
160488007223	Glycine/D-amino acid oxidases (deaminating) [Amino acid transport and metabolism]; Region: DadA; COG0665
160488007224	hydroxyglutarate oxidase; Provisional; Region: PRK11728
160488007225	YjgF, YER057c, and UK114 belong to a large family of proteins present in bacteria, archaea, and eukaryotes with no definitive function. The conserved domain is similar in structure to chorismate mutase but there is no sequence similarity and no...; Region: YjgF_YER057c_UK114_family; cd00448
160488007226	homotrimer interaction site [polypeptide binding]; other site
160488007227	putative active site [active]
160488007228	Uncharacterized membrane protein [Function unknown]; Region: COG3949
160488007229	Cache domain; Region: Cache_1; pfam02743
160488007230	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
160488007231	dimerization interface [polypeptide binding]; other site
160488007232	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
160488007233	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
160488007234	dimer interface [polypeptide binding]; other site
160488007235	putative CheW interface [polypeptide binding]; other site
160488007236	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488007237	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488007238	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
160488007239	dimerization interface [polypeptide binding]; other site
160488007240	Predicted membrane protein [Function unknown]; Region: COG4125
160488007241	Bacterial Transmembrane Pair family; Region: BTP; pfam05232
160488007242	Bacterial Transmembrane Pair family; Region: BTP; pfam05232
160488007243	Transcriptional regulators [Transcription]; Region: FadR; COG2186
160488007244	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488007245	DNA-binding site [nucleotide binding]; DNA binding site
160488007246	This entry represents the C-terminal ligand binding domain of many members of the GntR family; Region: FCD; smart00895
160488007247	Transcriptional regulators [Transcription]; Region: FadR; COG2186
160488007248	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488007249	DNA-binding site [nucleotide binding]; DNA binding site
160488007250	FCD domain; Region: FCD; pfam07729
160488007251	C4-dicarboxylate transporter DctA; Reviewed; Region: PRK13027
160488007252	Na+/H+-dicarboxylate symporters [Energy production and conversion]; Region: GltP; COG1301
160488007253	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
160488007254	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
160488007255	non-specific DNA binding site [nucleotide binding]; other site
160488007256	salt bridge; other site
160488007257	sequence-specific DNA binding site [nucleotide binding]; other site
160488007258	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488007259	PAS fold; Region: PAS_3; pfam08447
160488007260	putative active site [active]
160488007261	heme pocket [chemical binding]; other site
160488007262	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
160488007263	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
160488007264	dimer interface [polypeptide binding]; other site
160488007265	putative CheW interface [polypeptide binding]; other site
160488007266	PAS domain; Region: PAS_9; pfam13426
160488007267	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488007268	putative active site [active]
160488007269	heme pocket [chemical binding]; other site
160488007270	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
160488007271	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488007272	metal binding site [ion binding]; metal-binding site
160488007273	active site
160488007274	I-site; other site
160488007275	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
160488007276	Transcriptional activator of acetoin/glycerol metabolism [Secondary metabolites biosynthesis, transport, and catabolism / Transcription]; Region: AcoR; COG3284
160488007277	GAF domain; Region: GAF; pfam01590
160488007278	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488007279	Walker A motif; other site
160488007280	ATP binding site [chemical binding]; other site
160488007281	Walker B motif; other site
160488007282	arginine finger; other site
160488007283	Bacterial regulatory protein, Fis family; Region: HTH_8; pfam02954
160488007284	ABC-type sugar transport systems, ATPase components [Carbohydrate transport and metabolism]; Region: MalK; COG3839
160488007285	ATP-binding cassette domain of the carbohydrate and solute transporters-like; Region: ABC_Carb_Solutes_like; cd03259
160488007286	Walker A/P-loop; other site
160488007287	ATP binding site [chemical binding]; other site
160488007288	Q-loop/lid; other site
160488007289	ABC transporter signature motif; other site
160488007290	Walker B; other site
160488007291	D-loop; other site
160488007292	H-loop/switch region; other site
160488007293	ABC-type sugar transport systems, ATPase components [Carbohydrate transport and metabolism]; Region: MalK; COG3839
160488007294	ATP-binding cassette domain of the carbohydrate and solute transporters-like; Region: ABC_Carb_Solutes_like; cd03259
160488007295	Walker A/P-loop; other site
160488007296	ATP binding site [chemical binding]; other site
160488007297	Q-loop/lid; other site
160488007298	ABC transporter signature motif; other site
160488007299	Walker B; other site
160488007300	D-loop; other site
160488007301	H-loop/switch region; other site
160488007302	TOBE domain; Region: TOBE_2; pfam08402
160488007303	ABC-type polysaccharide transport system, permease component [Carbohydrate transport and metabolism]; Region: LplB; COG4209
160488007304	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488007305	dimer interface [polypeptide binding]; other site
160488007306	conserved gate region; other site
160488007307	putative PBP binding loops; other site
160488007308	ABC-ATPase subunit interface; other site
160488007309	ABC-type sugar transport system, permease component [Carbohydrate transport and metabolism]; Region: UgpE; COG0395
160488007310	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488007311	dimer interface [polypeptide binding]; other site
160488007312	conserved gate region; other site
160488007313	putative PBP binding loops; other site
160488007314	ABC-ATPase subunit interface; other site
160488007315	ABC-type sugar transport system, periplasmic component [Carbohydrate transport and metabolism]; Region: UgpB; COG1653
160488007316	bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase; Provisional; Region: PRK10792
160488007317	Tetrahydrofolate dehydrogenase/cyclohydrolase, catalytic domain; Region: THF_DHG_CYH; pfam00763
160488007318	NADP binding domain of methylene-tetrahydrofolate dehydrogenase/cyclohydrolase; Region: NAD_bind_m-THF_DH_Cyclohyd; cd01080
160488007319	homodimer interface [polypeptide binding]; other site
160488007320	NADP binding site [chemical binding]; other site
160488007321	substrate binding site [chemical binding]; other site
160488007322	PHAGE03; prophage; lysogenic bacteriophage that has the majority of hits to bacteriophage T7/phiYeO3-12 proteins.  insertion into tRNA-Leu-1. attL/R=gatttaggttccagcggcgcaagctgtaagagttcgagtctcttcgtccgc acca.
160488007323	T3/T7-like RNA polymerase; Region: PHA00452
160488007324	single-stranded DNA-binding protein; Region: PHA00458
160488007325	Phage endonuclease I; Region: Phage_endo_I; pfam05367
160488007326	Peptidoglycan recognition proteins (PGRPs) are pattern recognition receptors that bind, and in certain cases, hydrolyze peptidoglycans (PGNs) of bacterial cell walls. PGRPs have been divided into three classes: short PGRPs (PGRP-S), that are small (20...; Region: PGRP; cd06583
160488007327	amidase catalytic site [active]
160488007328	Zn binding residues [ion binding]; other site
160488007329	substrate binding site [chemical binding]; other site
160488007330	Zinc-binding domain of primase-helicase; Region: Prim_Zn_Ribbon; pfam08273
160488007331	TOPRIM_primases: The topoisomerase-primase (TORPIM) nucleotidyl transferase/hydrolase domain found in the active site regions of bacterial DnaG-type primases and their homologs. Primases synthesize RNA primers for the initiation of DNA replication. DnaG...; Region: TOPRIM_primases; cd01029
160488007332	active site
160488007333	metal binding site [ion binding]; metal-binding site
160488007334	interdomain interaction site; other site
160488007335	GP4d_helicase is a homohexameric 5'-3' helicases. Helicases couple NTP hydrolysis to the unwinding of nucleic acid duplexes into their component strands; Region: GP4d_helicase; cd01122
160488007336	AAA domain; Region: AAA_25; pfam13481
160488007337	Walker A motif; other site
160488007338	NTP binding site [chemical binding]; other site
160488007339	Walker B motif; other site
160488007340	DNA binding loops [nucleotide binding]
160488007341	RelA- and SpoT-like ppGpp Synthetases and Hydrolases, catalytic domain; Region: Rel-Spo_like; cl11966
160488007342	metal binding triad [ion binding]; metal-binding site
160488007343	Polymerase I functions primarily to fill DNA gaps that arise during DNA repair, recombination and replication; Region: DNA_pol_A_pol_I_B; cd08643
160488007344	active site
160488007345	DNA binding site [nucleotide binding]
160488007346	catalytic site [active]
160488007347	PIN (PilT N terminus) domain: Superfamily; Region: PIN_SF; cl14812
160488007348	putative active site [active]
160488007349	H3TH domain of the 5'-3' exonuclease of Taq DNA polymerase I and homologs; Region: H3TH_53EXO; cd09898
160488007350	putative DNA binding site [nucleotide binding]; other site
160488007351	putative metal binding site [ion binding]; other site
160488007352	hypothetical protein; Region: PHA00670
160488007353	Bacteriophage head to tail connecting protein; Region: Head-tail_con; pfam12236
160488007354	Phage T7 capsid assembly protein; Region: Phage_T7_Capsid; cl14192
160488007355	major capsid protein; Region: PHA00201
160488007356	tail tubular protein A; Region: PHA00428
160488007357	Soluble lytic murein transglycosylase and related regulatory proteins (some contain LysM/invasin domains) [Cell envelope biogenesis, outer membrane]; Region: MltE; COG0741
160488007358	Lytic Transglycosylase (LT)  and Goose Egg White Lysozyme (GEWL) domain. Members include the soluble and insoluble membrane-bound LTs in bacteria, the LTs in bacteriophage lambda, as well as, the eukaryotic "goose-type" lysozymes (GEWL).  LTs...; Region: LT_GEWL; cd00254
160488007359	N-acetyl-D-glucosamine binding site [chemical binding]; other site
160488007360	catalytic residue [active]
160488007361	Phage T7 tail fibre protein; Region: Phage_T7_tail; pfam03906
160488007362	Haemolysin XhlA; Region: XhlA; pfam10779
160488007363	Antirestriction protein (ArdA); Region: ArdA; pfam07275
160488007364	Transcriptional regulators [Transcription]; Region: MarR; COG1846
160488007365	Phage HP1 integrase, C-terminal catalytic domain. Bacteriophage HP1 and related integrases are found in eubacteria, plasmids and temperate bacteriophages of the P2 family.  They belong to the DNA breaking-rejoining enzyme superfamily, which includes...; Region: HP1_INT_C; cd00797
160488007366	dimer interface [polypeptide binding]; other site
160488007367	active site
160488007368	catalytic residues [active]
160488007369	Int/Topo IB signature motif; other site
160488007370	trigger factor; Provisional; Region: tig; PRK01490
160488007371	FKBP-type peptidyl-prolyl cis-trans isomerase; Region: FKBP_C; pfam00254
160488007372	Bacterial trigger factor protein (TF) C-terminus; Region: Trigger_C; pfam05698
160488007373	Protease subunit of ATP-dependent Clp proteases [Posttranslational modification, protein turnover, chaperones / Intracellular trafficking and secretion]; Region: ClpP; COG0740
160488007374	Caseinolytic protease (ClpP) is an ATP-dependent, highly conserved serine protease; Region: S14_ClpP_2; cd07017
160488007375	oligomer interface [polypeptide binding]; other site
160488007376	active site residues [active]
160488007377	ATP-dependent protease ATP-binding subunit ClpX; Provisional; Region: clpX; PRK05342
160488007378	ClpX C4-type zinc finger; Region: zf-C4_ClpX; pfam06689
160488007379	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488007380	Walker A motif; other site
160488007381	ATP binding site [chemical binding]; other site
160488007382	Walker B motif; other site
160488007383	C-terminal, D2-small domain, of ClpB protein; Region: ClpB_D2-small; smart01086
160488007384	ATP-dependent Lon protease, bacterial type [Posttranslational modification, protein turnover, chaperones]; Region: Lon; COG0466
160488007385	Found in ATP-dependent protease La (LON); Region: LON; smart00464
160488007386	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488007387	Walker A motif; other site
160488007388	ATP binding site [chemical binding]; other site
160488007389	Walker B motif; other site
160488007390	arginine finger; other site
160488007391	Lon protease (S16) C-terminal proteolytic domain; Region: Lon_C; pfam05362
160488007392	Integration host factor (IHF) and HU are small heterodimeric members of the DNABII protein family that bind and bend DNA, functioning as architectural factors in many cellular processes including transcription, site-specific recombination, and...; Region: HU_IHF; cd00591
160488007393	IHF dimer interface [polypeptide binding]; other site
160488007394	IHF - DNA interface [nucleotide binding]; other site
160488007395	periplasmic folding chaperone; Provisional; Region: PRK10788
160488007396	SurA N-terminal domain; Region: SurA_N_3; pfam13624
160488007397	PPIC-type PPIASE domain; Region: Rotamase; pfam00639
160488007398	hypothetical protein; Provisional; Region: PRK10279
160488007399	Patatins and Phospholipases; Region: Patatin_and_cPLA2; cl11396
160488007400	active site
160488007401	nucleophile elbow; other site
160488007402	The CHAD domain is an alpha-helical domain functionally associated with some members of the adenylate cyclase family; Region: CHAD; smart00880
160488007403	Acyl-CoA thioesterase [Lipid metabolism]; Region: TesB; COG1946
160488007404	Thioesterase II (TEII) is thought to regenerate misprimed nonribosomal peptide synthetases (NRPSs) as well as modular polyketide synthases (PKSs) by hydrolyzing acetyl groups bound to the peptidyl carrier protein (PCP) and acyl carrier protein (ACP)...; Region: Thioesterase_II_repeat2; cd03445
160488007405	active site
160488007406	The hotdog fold was initially identified in the E. coli FabA (beta-hydroxydecanoyl-acyl carrier protein (ACP)-dehydratase) structure and subsequently in 4HBT (4-hydroxybenzoyl-CoA thioesterase) from Pseudomonas. A number of other seemingly unrelated...; Region: hot_dog; cl00509
160488007407	active site 2 [active]
160488007408	active site 1 [active]
160488007409	Terminase small subunit; Region: Terminase_2; cl01513
160488007410	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
160488007411	dimerization interface [polypeptide binding]; other site
160488007412	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
160488007413	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
160488007414	dimer interface [polypeptide binding]; other site
160488007415	putative CheW interface [polypeptide binding]; other site
160488007416	TatD like proteins;  E.coli TatD is a cytoplasmic protein, shown to have magnesium dependent DNase activity; Region: TatD_DNAse; cd01310
160488007417	active site
160488007418	membrane-bound lytic transglycosylase F; Provisional; Region: PRK10859
160488007419	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488007420	substrate binding pocket [chemical binding]; other site
160488007421	membrane-bound complex binding site; other site
160488007422	hinge residues; other site
160488007423	Lytic Transglycosylase (LT)  and Goose Egg White Lysozyme (GEWL) domain. Members include the soluble and insoluble membrane-bound LTs in bacteria, the LTs in bacteriophage lambda, as well as, the eukaryotic "goose-type" lysozymes (GEWL).  LTs...; Region: LT_GEWL; cd00254
160488007424	N-acetyl-D-glucosamine binding site [chemical binding]; other site
160488007425	catalytic residue [active]
160488007426	Predicted membrane protein [Function unknown]; Region: COG2259
160488007427	transcription elongation factor GreB; Reviewed; Region: greB; PRK01885
160488007428	Transcription elongation factor, N-terminal; Region: GreA_GreB_N; pfam03449
160488007429	Transcription elongation factor, GreA/GreB, C-term; Region: GreA_GreB; pfam01272
160488007430	Predicted ABC-type transport system involved in lysophospholipase L1 biosynthesis, permease component [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3127
160488007431	Predicted ABC-type transport system involved in lysophospholipase L1 biosynthesis, permease component [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3127
160488007432	Predicted ABC-type transport system involved in lysophospholipase L1 biosynthesis, ATPase component [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG4181
160488007433	ATP-binding cassette domain of the transporters involved in export of lipoprotein and macrolide, and cell division protein; Region: ABC_MJ0796_LolCDE_FtsE; cd03255
160488007434	Walker A/P-loop; other site
160488007435	ATP binding site [chemical binding]; other site
160488007436	Q-loop/lid; other site
160488007437	ABC transporter signature motif; other site
160488007438	Walker B; other site
160488007439	D-loop; other site
160488007440	H-loop/switch region; other site
160488007441	Lysophospholipase L1-like subgroup of SGNH-hydrolases. The best characterized member in this family is TesA, an E. coli periplasmic protein with thioesterase, esterase, arylesterase, protease and lysophospholipase activity; Region: Lysophospholipase_L1_like; cd01822
160488007442	active site
160488007443	catalytic triad [active]
160488007444	oxyanion hole [active]
160488007445	switch loop; other site
160488007446	L,D-transpeptidase; Provisional; Region: PRK10260
160488007447	L,D-transpeptidase catalytic domain; Region: YkuD; pfam03734
160488007448	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
160488007449	Coenzyme A binding pocket [chemical binding]; other site
160488007450	phospho-2-dehydro-3-deoxyheptonate aldolase; Provisional; Region: PRK12755
160488007451	DAHP synthetase I family; Region: DAHP_synth_1; pfam00793
160488007452	2-dehydropantoate 2-reductase; Provisional; Region: PRK06249
160488007453	Ketopantoate reductase PanE/ApbA; Region: ApbA; pfam02558
160488007454	Ketopantoate reductase PanE/ApbA C terminal; Region: ApbA_C; pfam08546
160488007455	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
160488007456	Ligand Binding Site [chemical binding]; other site
160488007457	transcriptional regulator CysB; Reviewed; Region: cysB; PRK12681
160488007458	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488007459	The C-terminal substrate domain of LysR-type transcriptional regulators CysB-like contains type 2 periplasmic binding fold; Region: PBP2_CysB_like; cd08413
160488007460	substrate binding site [chemical binding]; other site
160488007461	dimerization interface [polypeptide binding]; other site
160488007462	3'-phosphoadenosine 5'-phosphosulfate sulfotransferase (PAPS reductase)/FAD synthetase and related enzymes [Amino acid transport and metabolism / Coenzyme metabolism]; Region: CysH; COG0175
160488007463	This domain is found in phosphoadenosine phosphosulphate (PAPS) reductase enzymes or PAPS sulphotransferase. PAPS reductase is part of the adenine nucleotide alpha hydrolases superfamily also including N type ATP PPases and ATP sulphurylases. A highly...; Region: PAPS_reductase; cd01713
160488007464	Active Sites [active]
160488007465	Anthranilate synthase component I, N terminal region; Region: Anth_synt_I_N; pfam04715
160488007466	Anthranilate/para-aminobenzoate synthases component I [Amino acid transport and metabolism / Coenzyme metabolism]; Region: TrpE; COG0147
160488007467	chorismate binding enzyme; Region: Chorismate_bind; pfam00425
160488007468	alpha-L-glutamate ligase-related protein; Region: rimK_rel_E_lig; TIGR02291
160488007469	Inactive transglutaminase fused to 7 transmembrane helices; Region: Transglut_i_TM; pfam14400
160488007470	7 transmembrane helices usually fused to an inactive transglutaminase; Region: 7TM_transglut; pfam14402
160488007471	Uncharacterized protein conserved in archaea [Posttranslational modification, protein turnover, chaperones]; Region: COG4067
160488007472	Transcriptional regulators [Transcription]; Region: GntR; COG1802
160488007473	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488007474	DNA-binding site [nucleotide binding]; DNA binding site
160488007475	FCD domain; Region: FCD; pfam07729
160488007476	Phosphoenolpyruvate phosphomutase; Region: PEP_mutase; pfam13714
160488007477	Members of the ICL/PEPM enzyme family catalyze either P-C or C-C bond formation/cleavage. Known members are phosphoenolpyruvate mutase (PEPM), phosphonopyruvate hydrolase (PPH), carboxyPEP mutase (CPEP mutase), oxaloacetate hydrolase (OAH), isocitrate...; Region: ICL_PEPM; cd00377
160488007478	tetramer interface [polypeptide binding]; other site
160488007479	active site
160488007480	Mg2+/Mn2+ binding site [ion binding]; other site
160488007481	Citrate synthase [Energy production and conversion]; Region: GltA; COG0372
160488007482	Escherichia coli (Ec) 2-methylcitrate synthase (2MCS)_like. 2MCS catalyzes the condensation of propionyl-coenzyme A (PrCoA) and oxalacetate (OAA) to form 2-methylcitrate and coenzyme A (CoA) during propionate metabolism. Citrate synthase (CS) catalyzes...; Region: Ec2MCS_like; cd06108
160488007483	dimer interface [polypeptide binding]; other site
160488007484	active site
160488007485	citrylCoA binding site [chemical binding]; other site
160488007486	oxalacetate/citrate binding site [chemical binding]; other site
160488007487	coenzyme A binding site [chemical binding]; other site
160488007488	catalytic triad [active]
160488007489	2-methylisocitrate dehydratase, Fe/S-dependent; Region: 2met_isocit_dHY; TIGR02333
160488007490	Aconitase A catalytic domain; Region: AcnA_IRP; cd01586
160488007491	substrate binding site [chemical binding]; other site
160488007492	ligand binding site [chemical binding]; other site
160488007493	Aconitase swivel domain. Aconitase (aconitate hydratase) catalyzes the reversible isomerization of citrate and isocitrate as part of the TCA cycle. This is the aconitase swivel domain, which undergoes swivelling conformational change in the enzyme...; Region: Aconitase_swivel; cl00215
160488007494	substrate binding site [chemical binding]; other site
160488007495	probable AcnD-accessory protein PrpF; Region: prpF; TIGR02334
160488007496	2-methylcitrate dehydratase; Provisional; Region: prpD; PRK09425
160488007497	2-methylcitrate dehydratase; Region: prpD; TIGR02330
160488007498	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase; Validated; Region: PRK09238
160488007499	Aconitase B swivel domain. Aconitate hydratase B is involved in energy metabolism as part of the TCA cycle. It catalyses the formation of cis-aconitate from citrate. This is the aconitase swivel domain, which undergoes swivelling conformational change in...; Region: AcnB_Swivel; cd01576
160488007500	substrate binding site [chemical binding]; other site
160488007501	Aconitate hydratase B catalyses the formation of cis-aconitate from citrate as part of the TCA cycle; Region: AcnB; cd01581
160488007502	substrate binding site [chemical binding]; other site
160488007503	ligand binding site [chemical binding]; other site
160488007504	Predicted Fe-S protein [General function prediction only]; Region: COG3313
160488007505	6-pyruvoyl tetrahydropterin synthase; Region: PTPS; pfam01242
160488007506	active site
160488007507	Zeta toxin; Region: Zeta_toxin; pfam06414
160488007508	Nucleoside/nucleotide kinase (NK) is a protein superfamily consisting of multiple families of enzymes that share structural similarity and are functionally related to the catalysis of the reversible phosphate group transfer from nucleoside triphosphates...; Region: NK; cl17190
160488007509	Predicted membrane protein [Function unknown]; Region: COG3212
160488007510	Peptidase propeptide and YPEB domain; Region: PepSY; pfam03413
160488007511	Predicted membrane protein [Function unknown]; Region: COG3212
160488007512	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
160488007513	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488007514	active site
160488007515	phosphorylation site [posttranslational modification]
160488007516	intermolecular recognition site; other site
160488007517	dimerization interface [polypeptide binding]; other site
160488007518	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
160488007519	DNA binding site [nucleotide binding]
160488007520	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
160488007521	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488007522	ATP binding site [chemical binding]; other site
160488007523	Mg2+ binding site [ion binding]; other site
160488007524	G-X-G motif; other site
160488007525	CBS-domain-containing membrane protein [Signal transduction mechanisms]; Region: COG3448
160488007526	HPP family; Region: HPP; pfam04982
160488007527	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains associated with the HPP motif domain. These proteins are integral membrane proteins with four transmembrane spanning helices. The function of these proteins is...; Region: CBS_pair_HPP_assoc; cd04600
160488007528	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488007529	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488007530	LysR substrate binding domain; Region: LysR_substrate; pfam03466
160488007531	dimerization interface [polypeptide binding]; other site
160488007532	propionyl-CoA synthetase; Provisional; Region: prpE; PRK10524
160488007533	Propionyl-CoA synthetase (PrpE); Region: PrpE; cd05967
160488007534	acyl-activating enzyme (AAE) consensus motif; other site
160488007535	putative AMP binding site [chemical binding]; other site
160488007536	putative active site [active]
160488007537	putative CoA binding site [chemical binding]; other site
160488007538	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cl17189
160488007539	Predicted ATPase [General function prediction only]; Region: COG1485
160488007540	Walker A motif; other site
160488007541	ATP binding site [chemical binding]; other site
160488007542	Walker B motif; other site
160488007543	arginine finger; other site
160488007544	FOG: CheY-like receiver [Signal transduction mechanisms]; Region: CheY; COG0784
160488007545	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488007546	active site
160488007547	phosphorylation site [posttranslational modification]
160488007548	intermolecular recognition site; other site
160488007549	dimerization interface [polypeptide binding]; other site
160488007550	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488007551	PAS fold; Region: PAS_3; pfam08447
160488007552	putative active site [active]
160488007553	heme pocket [chemical binding]; other site
160488007554	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cl02459
160488007555	Signal transduction histidine kinase, nitrogen specific [Signal transduction mechanisms]; Region: NtrB; COG3852
160488007556	putative active site [active]
160488007557	heme pocket [chemical binding]; other site
160488007558	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488007559	dimer interface [polypeptide binding]; other site
160488007560	phosphorylation site [posttranslational modification]
160488007561	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488007562	ATP binding site [chemical binding]; other site
160488007563	Mg2+ binding site [ion binding]; other site
160488007564	G-X-G motif; other site
160488007565	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488007566	Response regulator receiver domain; Region: Response_reg; pfam00072
160488007567	intermolecular recognition site; other site
160488007568	active site
160488007569	dimerization interface [polypeptide binding]; other site
160488007570	FOG: CheY-like receiver [Signal transduction mechanisms]; Region: CheY; COG0784
160488007571	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488007572	active site
160488007573	phosphorylation site [posttranslational modification]
160488007574	intermolecular recognition site; other site
160488007575	dimerization interface [polypeptide binding]; other site
160488007576	Bacteriophytochrome (light-regulated signal transduction histidine kinase) [Signal transduction mechanisms]; Region: COG4251
160488007577	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488007578	putative active site [active]
160488007579	heme pocket [chemical binding]; other site
160488007580	GAF domain; Region: GAF; pfam01590
160488007581	Phytochrome region; Region: PHY; pfam00360
160488007582	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488007583	dimer interface [polypeptide binding]; other site
160488007584	phosphorylation site [posttranslational modification]
160488007585	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488007586	ATP binding site [chemical binding]; other site
160488007587	Mg2+ binding site [ion binding]; other site
160488007588	G-X-G motif; other site
160488007589	Spore Coat Protein U domain; Region: SCPU; pfam05229
160488007590	Spore Coat Protein U domain; Region: SCPU; pfam05229
160488007591	Spore Coat Protein U domain; Region: SCPU; pfam05229
160488007592	Spore Coat Protein U domain; Region: SCPU; pfam05229
160488007593	P pilus assembly protein, chaperone PapD [Cell motility and secretion / Intracellular trafficking and secretion]; Region: FimC; COG3121
160488007594	Gram-negative pili assembly chaperone, N-terminal domain; Region: Pili_assembly_N; pfam00345
160488007595	Gram-negative pili assembly chaperone, C-terminal domain; Region: Pili_assembly_C; pfam02753
160488007596	PapC N-terminal domain; Region: PapC_N; pfam13954
160488007597	P pilus assembly protein, porin PapC [Cell motility and secretion / Intracellular trafficking and secretion]; Region: FimD; COG3188
160488007598	Type VII secretion system (T7SS), usher protein; Region: Usher; pfam00577
160488007599	PapC C-terminal domain; Region: PapC_C; pfam13953
160488007600	Spore Coat Protein U domain; Region: SCPU; pfam05229
160488007601	Spore Coat Protein U domain; Region: SCPU; pfam05229
160488007602	Predicted carboxypeptidase [Amino acid transport and metabolism]; Region: COG2866
160488007603	M14 family of metallocarboxypeptidases and related proteins; Region: Peptidase_M14_like; cl11393
160488007604	active site
160488007605	Zn binding site [ion binding]; other site
160488007606	Cupin domain; Region: Cupin_2; cl17218
160488007607	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488007608	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
160488007609	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488007610	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488007611	Major Facilitator Superfamily; Region: MFS_1; pfam07690
160488007612	putative substrate translocation pore; other site
160488007613	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488007614	Major Facilitator Superfamily; Region: MFS_1; pfam07690
160488007615	putative substrate translocation pore; other site
160488007616	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660
160488007617	Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248
160488007618	active site
160488007619	catalytic tetrad [active]
160488007620	Leucine rich repeat; Region: LRR_8; pfam13855
160488007621	Bacterial protein of unknown function (DUF934); Region: DUF934; pfam06073
160488007622	Sulfite reductase, beta subunit (hemoprotein) [Inorganic ion transport and metabolism]; Region: CysI; COG0155
160488007623	Nitrite/Sulfite reductase ferredoxin-like half domain; Region: NIR_SIR_ferr; pfam03460
160488007624	Nitrite/Sulfite reductase ferredoxin-like half domain; Region: NIR_SIR_ferr; pfam03460
160488007625	Periplasmic sugar-binding domain of uncharacterized ABC-type transport systems; Region: PBP1_ABC_sugar_binding_like_13; cd06324
160488007626	Periplasmic binding protein domain; Region: Peripla_BP_4; pfam13407
160488007627	putative ligand binding site [chemical binding]; other site
160488007628	Protein of unknown function (DUF2970); Region: DUF2970; pfam11174
160488007629	B12-dependent methionine synthase; Provisional; Region: metH; PRK09490
160488007630	Methionine synthase I (cobalamin-dependent), methyltransferase domain [Amino acid transport and metabolism]; Region: MetH; COG0646
160488007631	MeTr subgroup of pterin binding enzymes. This family includes cobalamin-dependent methyltransferases such as methyltetrahydrofolate, corrinoid iron-sulfur protein methyltransferase (MeTr) and methionine synthase (MetH).  Cobalamin-dependent...; Region: MeTr; cd00740
160488007632	substrate binding pocket [chemical binding]; other site
160488007633	B12 binding domain of methionine synthase. This domain binds methylcobalamin, which it uses as an intermediate methyl carrier from methyltetrahydrofolate (CH3H4folate) to homocysteine (Hcy); Region: methionine_synthase_B12_BD; cd02069
160488007634	B12 binding site [chemical binding]; other site
160488007635	cobalt ligand [ion binding]; other site
160488007636	Vitamin B12 dependent methionine synthase, activation domain; Region: Met_synt_B12; pfam02965
160488007637	Fatty acid cis/trans isomerase (CTI); Region: CTI; pfam06934
160488007638	Predicted acyltransferases [Lipid metabolism]; Region: COG1835
160488007639	Fe-S cluster assembly scaffold protein [Posttranslational modification, protein turnover, chaperones]; Region: sufA; COG0316
160488007640	IscR-regulated protein YhgI; Region: YhgI_GntY; TIGR03341
160488007641	Thioredoxin-like proteins and domains [Posttranslational modification, protein turnover, chaperones]; Region: COG0694
160488007642	Uncharacterized protein SCO1/SenC/PrrC, involved in biogenesis of respiratory and photosynthetic systems [General function prediction only]; Region: COG1999
160488007643	SCO (an acronym for Synthesis of Cytochrome c Oxidase) family; composed of proteins similar to Sco1, a membrane-anchored protein possessing a soluble domain with a TRX fold. Members of this family are required for the proper assembly of cytochrome c...; Region: SCO; cd02968
160488007644	Cu(I) binding site [ion binding]; other site
160488007645	Protein of unknown function (DUF461); Region: DUF461; pfam04314
160488007646	H+ Antiporter protein; Region: 2A0121; TIGR00900
160488007647	AraC-like ligand binding domain; Region: AraC_binding; pfam02311
160488007648	AraC-type DNA-binding domain-containing proteins [Transcription]; Region: AraC; COG2207
160488007649	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488007650	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488007651	Branched-chain amino acid transport protein (AzlD); Region: AzlD; cl00735
160488007652	Predicted branched-chain amino acid permease (azaleucine resistance) [Amino acid transport and metabolism]; Region: AzlC; COG1296
160488007653	FOG: TPR repeat, SEL1 subfamily [General function prediction only]; Region: COG0790
160488007654	Putative threonine efflux protein [Amino acid transport and metabolism]; Region: RhtB; COG1280
160488007655	YqcI/YcgG family; Region: YqcI_YcgG; pfam08892
160488007656	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488007657	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488007658	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
160488007659	dimerization interface [polypeptide binding]; other site
160488007660	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488007661	putative substrate translocation pore; other site
160488007662	Arabinose efflux permease [Carbohydrate transport and metabolism]; Region: AraJ; COG2814
160488007663	DNA polymerase II; Reviewed; Region: PRK05762
160488007664	DEDDy 3'-5' exonuclease domain of Escherichia coli DNA polymerase II and similar bacterial family-B DNA polymerases; Region: DNA_polB_II_exo; cd05784
160488007665	active site
160488007666	catalytic site [active]
160488007667	substrate binding site [chemical binding]; other site
160488007668	DNA polymerase type-II subfamily catalytic domain. Bacteria contain five DNA polymerases (I, II, III, IV and V). DNA polymerase II (Pol II) is a prototype for the B-family of polymerases. The role of Pol II in a variety of cellular activities, such as...; Region: POLBc_Pol_II; cd05537
160488007669	active site
160488007670	metal-binding site
160488007671	Leucine-rich repeats (LRRs), ribonuclease inhibitor (RI)-like subfamily. LRRs are 20-29 residue sequence motifs present in many proteins that participate in protein-protein interactions and have different functions and cellular locations. LRRs correspond...; Region: LRR_RI; cl15309
160488007672	Leucine-rich repeats; other site
160488007673	Leucine rich repeat; Region: LRR_8; pfam13855
160488007674	Leucine-rich repeats (LRRs), ribonuclease inhibitor (RI)-like subfamily. LRRs are 20-29 residue sequence motifs present in many proteins that participate in protein-protein interactions and have different functions and cellular locations. LRRs correspond...; Region: LRR_RI; cl15309
160488007675	Leucine Rich repeats (2 copies); Region: LRR_4; pfam12799
160488007676	Leucine-rich repeats; other site
160488007677	Leucine rich repeat; Region: LRR_8; pfam13855
160488007678	Domain of unknown function (DUF4174); Region: DUF4174; pfam13778
160488007679	EF-hand, calcium binding motif; A diverse superfamily of calcium sensors and calcium signal modulators; most examples in this alignment model have 2 active canonical EF hands. Ca2+ binding induces a conformational change in the EF-hand motif, leading to...; Region: EFh; cd00051
160488007680	EF-hand domain pair; Region: EF_hand_5; pfam13499
160488007681	Ca2+ binding site [ion binding]; other site
160488007682	hypothetical protein; Provisional; Region: PRK05409
160488007683	Uncharacterized protein conserved in bacteria (DUF2063); Region: DUF2063; cl01262
160488007684	DoxX; Region: DoxX; pfam07681
160488007685	Ferric reductase like transmembrane component; Region: Ferric_reduct; pfam01794
160488007686	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
160488007687	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cl00080
160488007688	dimer interface [polypeptide binding]; other site
160488007689	phosphorylation site [posttranslational modification]
160488007690	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488007691	ATP binding site [chemical binding]; other site
160488007692	Mg2+ binding site [ion binding]; other site
160488007693	G-X-G motif; other site
160488007694	osmolarity response regulator; Provisional; Region: ompR; PRK09468
160488007695	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488007696	active site
160488007697	phosphorylation site [posttranslational modification]
160488007698	intermolecular recognition site; other site
160488007699	dimerization interface [polypeptide binding]; other site
160488007700	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
160488007701	DNA binding site [nucleotide binding]
160488007702	Protein of unknown function (DUF2790); Region: DUF2790; pfam10976
160488007703	TlpA-like family, DipZ-like subfamily; composed uncharacterized proteins containing a TlpA-like TRX domain. Some members show domain architectures similar to that of E. coli DipZ protein (also known as DsbD). The only eukaryotic members of the TlpA...; Region: TlpA_like_DipZ_like; cd03012
160488007704	Thioredoxin-like; Region: Thioredoxin_8; pfam13905
160488007705	catalytic residues [active]
160488007706	shikimate 5-dehydrogenase; Reviewed; Region: PRK12549
160488007707	Shikimate dehydrogenase substrate binding domain; Region: Shikimate_dh_N; pfam08501
160488007708	NAD(P) binding domain of Shikimate dehydrogenase; Region: NAD_bind_Shikimate_DH; cd01065
160488007709	shikimate binding site; other site
160488007710	NAD(P) binding site [chemical binding]; other site
160488007711	Dehydroquinase (DHQase), type II. Dehydroquinase (or 3-dehydroquinate dehydratase) catalyzes the reversible dehydration of 3-dehydroquinate to form 3-dehydroshikimate. This reaction is part of two metabolic pathways: the biosynthetic shikimate pathway...; Region: DHQase_II; cd00466
160488007712	Dehydroquinase class II; Region: DHquinase_II; pfam01220
160488007713	trimer interface [polypeptide binding]; other site
160488007714	active site
160488007715	dimer interface [polypeptide binding]; other site
160488007716	Outer membrane protein [Cell envelope biogenesis, outer membrane / Intracellular trafficking and secretion]; Region: TolC; COG1538
160488007717	Membrane Fusion Protein cluster 2 (function with RND porters); Region: 8a0102; TIGR00999
160488007718	HlyD family secretion protein; Region: HlyD_3; pfam13437
160488007719	heavy metal efflux pump, CzcA family; Region: 2A0601; TIGR00914
160488007720	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488007721	metabolite-proton symporter; Region: 2A0106; TIGR00883
160488007722	putative substrate translocation pore; other site
160488007723	ATPases involved in chromosome partitioning [Cell division and chromosome partitioning]; Region: Soj; COG1192
160488007724	ParA and ParB of Caulobacter crescentus belong to a conserved family of bacterial proteins implicated in chromosome segregation. ParB binds to DNA sequences adjacent to the origin of replication and localizes to opposite cell poles shortly following the...; Region: ParA; cd02042
160488007725	P-loop; other site
160488007726	Magnesium ion binding site [ion binding]; other site
160488007727	ParA and ParB of Caulobacter crescentus belong to a conserved family of bacterial proteins implicated in chromosome segregation. ParB binds to DNA sequences adjacent to the origin of replication and localizes to opposite cell poles shortly following the...; Region: ParA; cd02042
160488007728	Magnesium ion binding site [ion binding]; other site
160488007729	Cache domain; Region: Cache_1; pfam02743
160488007730	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
160488007731	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488007732	metal binding site [ion binding]; metal-binding site
160488007733	active site
160488007734	I-site; other site
160488007735	Acetyltransferase (GNAT) domain; Region: Acetyltransf_10; pfam13673
160488007736	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
160488007737	Coenzyme A binding pocket [chemical binding]; other site
160488007738	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
160488007739	ABC-type cobalamin/Fe3+-siderophores transport systems, ATPase components [Inorganic ion transport and metabolism / Coenzyme metabolism]; Region: FepC; COG1120
160488007740	ATP-binding component of iron-siderophores, vitamin B12 and hemin transporters and related proteins; Region: ABC_Iron-Siderophores_B12_Hemin; cd03214
160488007741	Walker A/P-loop; other site
160488007742	ATP binding site [chemical binding]; other site
160488007743	Q-loop/lid; other site
160488007744	ABC transporter signature motif; other site
160488007745	Walker B; other site
160488007746	D-loop; other site
160488007747	H-loop/switch region; other site
160488007748	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
160488007749	iron-hydroxamate transporter permease subunit; Provisional; Region: PRK10577
160488007750	dimer interface [polypeptide binding]; other site
160488007751	putative PBP binding regions; other site
160488007752	ABC-ATPase subunit  interface; other site
160488007753	Metal binding protein TroA_a.  These proteins are predicted to function as initial receptors in ABC transport of metal ions in eubacteria. They belong to the TroA superfamily of helical backbone metal receptor proteins that share a distinct fold and...; Region: TroA_a; cd01148
160488007754	proposed F420-0 ABC transporter, periplasmic F420-0 binding protein; Region: F420-O_ABCperi; TIGR03868
160488007755	putative ligand binding residues [chemical binding]; other site
160488007756	Predicted membrane protein [Function unknown]; Region: COG3503
160488007757	TonB-dependent siderophore receptor; Region: TonB-siderophor; TIGR01783
160488007758	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
160488007759	N-terminal plug; other site
160488007760	ligand-binding site [chemical binding]; other site
160488007761	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
160488007762	Coenzyme A binding pocket [chemical binding]; other site
160488007763	Uncharacterized homolog of gamma-carboxymuconolactone decarboxylase subunit [Function unknown]; Region: COG0599
160488007764	Aspartyl/asparaginyl beta-hydroxylase and related dioxygenases [Posttranslational modification, protein turnover, chaperones]; Region: COG3555
160488007765	2'-5' RNA ligase; Region: 2_5_ligase; TIGR02258
160488007766	LigT like Phosphoesterase; Region: LigT_PEase; pfam02834
160488007767	LigT like Phosphoesterase; Region: LigT_PEase; pfam02834
160488007768	AraC-type transcriptional regulator N-terminus; Region: AraC_N; pfam06719
160488007769	AraC-type DNA-binding domain-containing proteins [Transcription]; Region: AraC; COG2207
160488007770	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488007771	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488007772	Zn-dependent alcohol dehydrogenases [General function prediction only]; Region: AdhP; COG1064
160488007773	Cinnamyl alcohol dehydrogenases (CAD); Region: CAD1; cd05283
160488007774	putative NAD(P) binding site [chemical binding]; other site
160488007775	putative substrate binding site [chemical binding]; other site
160488007776	catalytic Zn binding site [ion binding]; other site
160488007777	structural Zn binding site [ion binding]; other site
160488007778	dimer interface [polypeptide binding]; other site
160488007779	putative arabinose transporter; Provisional; Region: PRK03545
160488007780	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488007781	putative substrate translocation pore; other site
160488007782	Putative threonine efflux protein [Amino acid transport and metabolism]; Region: RhtB; COG1280
160488007783	AraC-like ligand binding domain; Region: AraC_binding; pfam02311
160488007784	AraC-type DNA-binding domain-containing proteins [Transcription]; Region: AraC; COG2207
160488007785	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488007786	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488007787	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488007788	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488007789	The C-terminal substrate binding domain of LysR-type transcriptional regulator CrgA and its related homologs, contains the type 2 periplasmic binding domain; Region: PBP2_CrgA_like; cd08422
160488007790	putative effector binding pocket; other site
160488007791	dimerization interface [polypeptide binding]; other site
160488007792	NAD(P)H:FMN oxidoreductase family. This domain catalyzes the reduction of flavin, nitrocompound, quinones and azo compounds using NADH or NADPH as an electron donor. The enzyme is a homodimer, and each monomer binds a FMN as co-factor. This family...; Region: NfsB_like_nitroreductase; cd02149
160488007793	FMN binding site [chemical binding]; other site
160488007794	dimer interface [polypeptide binding]; other site
160488007795	Protein of unknown function (DUF2384); Region: DUF2384; cl17718
160488007796	Protein of unknown function (DUF2384); Region: DUF2384; cl17718
160488007797	RES domain; Region: RES; pfam08808
160488007798	Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes. PLP combines with an alpha-amino acid to form a compound called a Schiff base or aldimine intermediate, which depending on the reaction, is the...; Region: AAT_I; cl00321
160488007799	cysteine desulfurase NifS; Region: FeS_nifS; TIGR03402
160488007800	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
160488007801	catalytic residue [active]
160488007802	leucine transcriptional activator; Reviewed; Region: leuO; PRK09508
160488007803	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488007804	The C-terminal substrate binding domain of LysR-type transcriptional regulators that involved in the catabolism of nitroaromatic/naphthalene compounds and that of related regulators; contains the type 2 periplasmic binding fold; Region: PBP2_Nitroaromatics_like; cd08417
160488007805	substrate binding pocket [chemical binding]; other site
160488007806	dimerization interface [polypeptide binding]; other site
160488007807	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
160488007808	Acyl-CoA dehydrogenases similar to fadE2; Region: ACAD_FadE2; cd01155
160488007809	FAD binding site [chemical binding]; other site
160488007810	substrate binding site [chemical binding]; other site
160488007811	catalytic base [active]
160488007812	integral membrane protein, TerC family; Region: R_switched_Alx; TIGR03718
160488007813	peroxiredoxin; Region: AhpC; TIGR03137
160488007814	Peroxiredoxin (PRX) family, Typical 2-Cys PRX subfamily; PRXs are thiol-specific antioxidant (TSA) proteins, which confer a protective role in cells through its peroxidase activity by reducing hydrogen peroxide, peroxynitrite, and organic hydroperoxides; Region: PRX_Typ2cys; cd03015
160488007815	dimer interface [polypeptide binding]; other site
160488007816	decamer (pentamer of dimers) interface [polypeptide binding]; other site
160488007817	catalytic triad [active]
160488007818	peroxidatic and resolving cysteines [active]
160488007819	alkyl hydroperoxide reductase subunit F; Provisional; Region: PRK15317
160488007820	Alkyl hydroperoxide reductase F subunit (AhpF) N-terminal domain (NTD) family, N-terminal TRX-fold subdomain; AhpF is a homodimeric flavoenzyme which catalyzes the NADH-dependent reduction of the peroxiredoxin AhpC, which in turn catalyzes the reduction...; Region: AhpF_NTD_N; cd02974
160488007821	catalytic residue [active]
160488007822	TRX-GRX-like family, Alkyl hydroperoxide reductase F subunit (AhpF) N-terminal domain (NTD) subfamily, C-terminal TRX-fold subdomain; AhpF is a homodimeric flavoenzyme which catalyzes the NADH-dependent reduction of the peroxiredoxin AhpC, which then...; Region: AhpF_NTD_C; cd03026
160488007823	catalytic residues [active]
160488007824	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
160488007825	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
160488007826	Protein of unknown function, DUF480; Region: DUF480; pfam04337
160488007827	serine/threonine transporter SstT; Provisional; Region: PRK13628
160488007828	Na+/H+-dicarboxylate symporters [Energy production and conversion]; Region: GltP; COG1301
160488007829	transcriptional activator NhaR; Provisional; Region: nhaR; PRK11062
160488007830	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488007831	The C-terminal substrate binding domain of LysR-type transcriptional activator of the nhaA gene, encoding Na+/H+ antiporter, contains the type 2 periplasmic binding fold; Region: PBP2_NhaR; cd08429
160488007832	putative dimerization interface [polypeptide binding]; other site
160488007833	Membrane protein TerC, possibly involved in tellurium resistance [Inorganic ion transport and metabolism]; Region: TerC; COG0861
160488007834	A sub-family of peptidase family C39. Peptidase family C39 mostly contains bacteriocin-processing endopeptidases from bacteria. The cysteine peptidases in family C39 cleave the "double-glycine" leader peptides from the precursors of various...; Region: Peptidase_C39A; cd02549
160488007835	putative active site [active]
160488007836	putative aminophosphonate oxidoreductase; Region: Phn_aa_oxid; TIGR03329
160488007837	Glycine/D-amino acid oxidases (deaminating) [Amino acid transport and metabolism]; Region: DadA; COG0665
160488007838	Sporulation related domain; Region: SPOR; pfam05036
160488007839	HD domain; Region: HD_4; pfam13328
160488007840	Endonuclease I [DNA replication, recombination, and repair]; Region: EndA; COG2356
160488007841	Protein of unknown function (DUF1654); Region: DUF1654; pfam07867
160488007842	Bacterial L-asparaginases and related enzymes; Region: L-asparaginase_like; cd00411
160488007843	homodimer interface [polypeptide binding]; other site
160488007844	active site
160488007845	Periplasmic sugar-binding domain of active transport systems that are members of the type I periplasmic binding protein (PBP1) superfamily; Region: PBP1_ABC_sugar_binding_like; cd01536
160488007846	Periplasmic binding protein domain; Region: Peripla_BP_4; pfam13407
160488007847	ligand binding site [chemical binding]; other site
160488007848	ABC-type sugar transport system, ATPase component [Carbohydrate transport and metabolism]; Region: MglA; COG1129
160488007849	First domain of the ATP-binding cassette component of monosaccharide transport system; Region: ABC_Carb_Monos_I; cd03216
160488007850	Walker A/P-loop; other site
160488007851	ATP binding site [chemical binding]; other site
160488007852	Q-loop/lid; other site
160488007853	ABC transporter signature motif; other site
160488007854	Walker B; other site
160488007855	D-loop; other site
160488007856	H-loop/switch region; other site
160488007857	Second domain of the ATP-binding cassette component of monosaccharide transport system; Region: ABC_Carb_Monos_II; cd03215
160488007858	Branched-chain amino acid transport system / permease component; Region: BPD_transp_2; pfam02653
160488007859	Transmembrane subunit (TM) of Escherichia coli AraH and related proteins. E. coli AraH is the TM of a Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporter involved in the uptake of the monosaccharide arabinose. This group...; Region: TM_PBP1_transp_AraH_like; cd06579
160488007860	TM-ABC transporter signature motif; other site
160488007861	Transcriptional regulators [Transcription]; Region: PurR; COG1609
160488007862	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
160488007863	DNA binding site [nucleotide binding]
160488007864	domain linker motif; other site
160488007865	Type 1 periplasmic binding fold superfamily; Region: Periplasmic_Binding_Protein_Type_1; cl10011
160488007866	Sugar kinases, ribokinase family [Carbohydrate transport and metabolism]; Region: RbsK; COG0524
160488007867	Ribokinase catalyses the phosphorylation of ribose to ribose-5-phosphate using ATP. This reaction is the first step in the ribose metabolism. It traps ribose within the cell after uptake and also prepares the sugar for use in the synthesis of nucleotides...; Region: ribokinase; cd01174
160488007868	substrate binding site [chemical binding]; other site
160488007869	dimer interface [polypeptide binding]; other site
160488007870	ATP binding site [chemical binding]; other site
160488007871	D-ribose pyranase; Provisional; Region: PRK11797
160488007872	nuc_hydro_IU_UC_XIUA: inosine-uridine preferring, xanthosine-inosine-uridine-adenosine-preferring and, uridine-cytidine preferring nucleoside hydrolases. Nucleoside hydrolases cleave the N-glycosidic bond in nucleosides generating ribose and the...; Region: nuc_hydro_IU_UC_XIUA; cd02651
160488007873	active site
160488007874	tetramer interface [polypeptide binding]; other site
160488007875	Peptidase inhibitor I78 family; Region: Inhibitor_I78; pfam11720
160488007876	Cold-Shock Protein (CSP) contains an S1-like cold-shock domain (CSD) that is found in eukaryotes, prokaryotes, and archaea.  CSP's include the major cold-shock proteins CspA and CspB in bacteria and the eukaryotic gene regulatory factor Y-box...; Region: CSP_CDS; cd04458
160488007877	DNA-binding site [nucleotide binding]; DNA binding site
160488007878	RNA-binding motif; other site
160488007879	threonyl-tRNA synthetase; Reviewed; Region: thrS; PRK00413
160488007880	TGS _ThrRS_N:  ThrRS (threonyl-tRNA Synthetase)  is a class II tRNA synthetase that couples threonine to its cognate tRNA.  In addition to its catalytic and anticodon-binding domains, ThrRS has an N-terminal TGS domain, named after the ThrRS, GTPase, and...; Region: TGS_ThrRS_N; cd01667
160488007881	Threonyl and Alanyl tRNA synthetase second additional domain; Region: tRNA_SAD; pfam07973
160488007882	Threonyl-tRNA synthetase (ThrRS) class II core catalytic domain. ThrRS is a homodimer. It is responsible for the attachment of threonine to the 3' OH group of ribose of the appropriate tRNA. This domain is primarily responsible for ATP-dependent...; Region: ThrRS_core; cd00771
160488007883	active site
160488007884	dimer interface [polypeptide binding]; other site
160488007885	motif 1; other site
160488007886	motif 2; other site
160488007887	motif 3; other site
160488007888	ThrRS Threonyl-anticodon binding domain. ThrRS belongs to class II aminoacyl-tRNA synthetases (aaRS). This alignment contains the anticodon binding domain, which is responsible for specificity in tRNA-binding, so that the activated amino acid is...; Region: ThrRS_anticodon; cd00860
160488007889	anticodon binding site; other site
160488007890	translation initiation factor IF-3; Reviewed; Region: infC; PRK00028
160488007891	Translation initiation factor IF-3, N-terminal domain; Region: IF3_N; pfam05198
160488007892	Translation initiation factor IF-3, C-terminal domain; Region: IF3_C; pfam00707
160488007893	50S ribosomal protein L35; Reviewed; Region: rpmI; PRK00172
160488007894	Ribosomal protein L20; Region: Ribosomal_L20; cd07026
160488007895	23S rRNA binding site [nucleotide binding]; other site
160488007896	L21 binding site [polypeptide binding]; other site
160488007897	L13 binding site [polypeptide binding]; other site
160488007898	phenylalanyl-tRNA synthetase subunit alpha; Validated; Region: pheS; PRK00488
160488007899	Aminoacyl tRNA synthetase class II, N-terminal domain; Region: Phe_tRNA-synt_N; pfam02912
160488007900	Phenylalanyl-tRNA synthetase (PheRS) alpha chain catalytic core domain. PheRS belongs to class II aminoacyl-tRNA synthetases (aaRS) based upon its structure and the presence of three characteristic sequence motifs. This domain is primarily responsible...; Region: PheRS_alpha_core; cd00496
160488007901	dimer interface [polypeptide binding]; other site
160488007902	motif 1; other site
160488007903	active site
160488007904	motif 2; other site
160488007905	motif 3; other site
160488007906	phenylalanyl-tRNA synthetase subunit beta; Reviewed; Region: pheT; PRK00629
160488007907	tRNA-binding-domain-containing prokaryotic phenylalanly tRNA synthetase (PheRS) beta chain.  PheRS aminoacylate phenylalanine transfer RNAs (tRNAphe). PheRSs belong structurally to class II aminoacyl tRNA synthetases (aaRSs) but, as they aminoacylate...; Region: tRNA_bind_bactPheRS; cd02796
160488007908	putative tRNA-binding site [nucleotide binding]; other site
160488007909	B3/4 domain; Region: B3_4; pfam03483
160488007910	tRNA synthetase B5 domain; Region: B5; smart00874
160488007911	Phenylalanyl-tRNA synthetase (PheRS) beta chain core domain. PheRS belongs to class II aminoacyl-tRNA synthetases (aaRS) based upon its structure. While class II aaRSs generally aminoacylate the 3'-OH ribose of the appropriate tRNA,  PheRS is an...; Region: PheRS_beta_core; cd00769
160488007912	dimer interface [polypeptide binding]; other site
160488007913	motif 1; other site
160488007914	motif 3; other site
160488007915	motif 2; other site
160488007916	Ferredoxin-fold anticodon binding domain; Region: FDX-ACB; pfam03147
160488007917	Integration host factor (IHF) and HU are small heterodimeric members of the DNABII protein family that bind and bend DNA, functioning as architectural factors in many cellular processes including transcription, site-specific recombination, and...; Region: HU_IHF; cd00591
160488007918	IHF dimer interface [polypeptide binding]; other site
160488007919	IHF - DNA interface [nucleotide binding]; other site
160488007920	Helix-Turn-Helix DNA binding domain of putative MlrA-like transcription regulators; Region: HTH_MlrA-like_sg2; cd04765
160488007921	MerR HTH family regulatory protein; Region: MerR_1; pfam13411
160488007922	DNA binding residues [nucleotide binding]
160488007923	Protein of unknown function (DUF3296); Region: DUF3296; pfam11726
160488007924	Glutathione S-transferase [Posttranslational modification, protein turnover, chaperones]; Region: Gst; COG0625
160488007925	GST_N family, Saccharomyces cerevisiae GTT1-like subfamily; composed of predominantly uncharacterized proteins with similarity to the S. cerevisiae GST protein, GTT1, and the Schizosaccharomyces pombe GST-III. GSTs are cytosolic dimeric proteins involved...; Region: GST_N_GTT1_like; cd03046
160488007926	putative C-terminal domain interface [polypeptide binding]; other site
160488007927	putative GSH binding site (G-site) [chemical binding]; other site
160488007928	putative dimer interface [polypeptide binding]; other site
160488007929	C-terminal, alpha helical domain of GTT1-like Glutathione S-transferases; Region: GST_C_GTT1_like; cd03189
160488007930	putative N-terminal domain interface [polypeptide binding]; other site
160488007931	putative dimer interface [polypeptide binding]; other site
160488007932	putative substrate binding pocket (H-site) [chemical binding]; other site
160488007933	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
160488007934	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
160488007935	Putative NADP-dependent oxidoreductases [General function prediction only]; Region: COG2130
160488007936	Prostaglandin dehydrogenases; Region: PGDH; cd05288
160488007937	NAD(P) binding site [chemical binding]; other site
160488007938	substrate binding site [chemical binding]; other site
160488007939	dimer interface [polypeptide binding]; other site
160488007940	Aerobic-type carbon monoxide dehydrogenase, small subunit CoxS/CutS homologs [Energy production and conversion]; Region: CoxS; COG2080
160488007941	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
160488007942	catalytic loop [active]
160488007943	iron binding site [ion binding]; other site
160488007944	[2Fe-2S] binding domain; Region: Fer2_2; pfam01799
160488007945	Molybdopterin-binding domain of aldehyde dehydrogenase; Region: Ald_Xan_dh_C2; pfam02738
160488007946	Aerobic-type carbon monoxide dehydrogenase, large subunit CoxL/CutL homologs [Energy production and conversion]; Region: CoxL; COG1529
160488007947	Aldehyde oxidase and xanthine dehydrogenase, a/b hammerhead domain; Region: Ald_Xan_dh_C; smart01008
160488007948	Molybdopterin-binding domain of aldehyde dehydrogenase; Region: Ald_Xan_dh_C2; pfam02738
160488007949	Molybdopterin-binding domain of aldehyde dehydrogenase; Region: Ald_Xan_dh_C2; pfam02738
160488007950	Cytochrome c; Region: Cytochrom_C; pfam00034
160488007951	Cytochrome c, mono- and diheme variants [Energy production and conversion]; Region: CccA; COG2010
160488007952	Cytochrome c; Region: Cytochrom_C; pfam00034
160488007953	Xanthine and CO dehydrogenases maturation factor, XdhC/CoxF family [Posttranslational modification, protein turnover, chaperones]; Region: XdhC; COG1975
160488007954	XdhC and CoxI family; Region: XdhC_CoxI; pfam02625
160488007955	XdhC Rossmann domain; Region: XdhC_C; pfam13478
160488007956	Uncharacterized conserved protein [Function unknown]; Region: COG1359
160488007957	molybdenum cofactor biosynthesis protein A; Reviewed; Region: moaA; PRK00164
160488007958	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
160488007959	FeS/SAM binding site; other site
160488007960	Molybdenum Cofactor Synthesis C; Region: Mob_synth_C; pfam06463
160488007961	GT_2_like_f is a subfamily of the glycosyltransferase family 2 (GT-2) with unknown function; Region: GT_2_like_f; cd04182
160488007962	Ligand binding site; other site
160488007963	metal-binding site
160488007964	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
160488007965	dimerization interface [polypeptide binding]; other site
160488007966	putative DNA binding site [nucleotide binding]; other site
160488007967	putative Zn2+ binding site [ion binding]; other site
160488007968	luciferase-type oxidoreductase, BA3436 family; Region: lucif_BA3436; TIGR03571
160488007969	Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cl07892
160488007970	Old yellow enzyme (OYE)-like FMN binding domain. OYE was the first flavin-dependent enzyme identified, however its true physiological role remains elusive to this day. Each monomer of OYE contains FMN as a non-covalently bound cofactor, uses NADPH as a...; Region: OYE_like_FMN; cd02933
160488007971	NADH:flavin oxidoreductases, Old Yellow Enzyme family [Energy production and conversion]; Region: NemA; COG1902
160488007972	FMN binding site [chemical binding]; other site
160488007973	active site
160488007974	substrate binding site [chemical binding]; other site
160488007975	catalytic residue [active]
160488007976	Uncharacterized Staphylococcus aureus AldA1 (SACOL0154) aldehyde dehydrogenase-like; Region: ALDH_StaphAldA1; cd07117
160488007977	Aldehyde dehydrogenase family; Region: Aldedh; pfam00171
160488007978	NAD(P) binding site [chemical binding]; other site
160488007979	catalytic residues [active]
160488007980	Aldehyde dehydrogenase family; Region: Aldedh; pfam00171
160488007981	Mycobacterium tuberculosis succinate-semialdehyde dehydrogenase 1-like; Region: ALDH_SSADH1_GabD1; cd07100
160488007982	NAD(P) binding site [chemical binding]; other site
160488007983	catalytic residues [active]
160488007984	NADH:flavin oxidoreductases, Old Yellow Enzyme family [Energy production and conversion]; Region: NemA; COG1902
160488007985	Old yellow enzyme (OYE) YqjM-like FMN binding domain. YqjM is involved in the oxidative stress response of Bacillus subtilis.  Like the other OYE members, each monomer of YqjM contains FMN as a non-covalently bound cofactor and uses NADPH as a reducing...; Region: OYE_YqiM_FMN; cd02932
160488007986	active site
160488007987	FMN binding site [chemical binding]; other site
160488007988	substrate binding site [chemical binding]; other site
160488007989	homotetramer interface [polypeptide binding]; other site
160488007990	catalytic residue [active]
160488007991	This family contains NADPH-dependent flavin reductase and oxygen-insensitive nitroreductase. These enzymes are homodimeric flavoproteins that contain one FMN per monomer as a cofactor. Flavin reductase catalyzes the reduction of flavin by using NADPH as...; Region: NfsA_FRP; cd02146
160488007992	dimer interface [polypeptide binding]; other site
160488007993	FMN binding site [chemical binding]; other site
160488007994	NADPH bind site [chemical binding]; other site
160488007995	Type 1 glutamine amidotransferase (GATase1)-like domain found in proteins similar to Escherichia coli Hsp31 protein; Region: GATase1_Hsp31_like; cd03141
160488007996	Putative intracellular protease/amidase [General function prediction only]; Region: ThiJ; COG0693
160488007997	potential catalytic triad [active]
160488007998	conserved cys residue [active]
160488007999	Uncharacterized oxidoreductases, Fe-dependent alcohol dehydrogenase family [Energy production and conversion]; Region: COG1979
160488008000	Butanol dehydrogenase catalyzes the conversion of butyraldehyde to butanol with the cofactor NAD(P)H being oxidized in the process; Region: BDH; cd08187
160488008001	dimer interface [polypeptide binding]; other site
160488008002	active site
160488008003	metal binding site [ion binding]; metal-binding site
160488008004	Mov34/MPN/PAD-1 family; Region: MPN_DUF2466; cd08071
160488008005	MPN+ (JAMM) motif; other site
160488008006	Zinc-binding site [ion binding]; other site
160488008007	putative phage-type endonuclease; Region: phage_rel_nuc; TIGR03033
160488008008	phage/plasmid-like protein TIGR03299; Region: LGT_TIGR03299
160488008009	Antitoxin Phd_YefM, type II toxin-antitoxin system; Region: PhdYeFM_antitox; pfam02604
160488008010	Predicted transcriptional regulator [Transcription]; Region: COG3905
160488008011	Plasmid stabilisation system protein; Region: Plasmid_stabil; pfam05016
160488008012	integrase; Provisional; Region: PRK09692
160488008013	Bacteriophage P4 integrase. P4-like integrases are found in temperate bacteriophages, integrative plasmids, pathogenicity and symbiosis islands, and other mobile genetic elements.  They share the same fold in their catalytic domain and the overall...; Region: INT_P4; cd00801
160488008014	active site
160488008015	Int/Topo IB signature motif; other site
160488008016	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488008017	The C-terminal substrate binding domain of LysR-type transcriptional regulator CrgA and its related homologs, contains the type 2 periplasmic binding domain; Region: PBP2_CrgA_like; cd08422
160488008018	putative effector binding pocket; other site
160488008019	dimerization interface [polypeptide binding]; other site
160488008020	3-ketoacyl-(acyl-carrier-protein) reductase; Validated; Region: fabG; PRK05653
160488008021	classical (c) SDRs; Region: SDR_c; cd05233
160488008022	NAD(P) binding site [chemical binding]; other site
160488008023	active site
160488008024	Uncharacterized protein, 4-oxalocrotonate tautomerase homolog [General function prediction only]; Region: COG1942
160488008025	active site 1 [active]
160488008026	dimer interface [polypeptide binding]; other site
160488008027	hexamer interface [polypeptide binding]; other site
160488008028	active site 2 [active]
160488008029	GAF domain; Region: GAF; pfam01590
160488008030	FOG: GAF domain [Signal transduction mechanisms]; Region: FhlA; COG2203
160488008031	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
160488008032	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488008033	metal binding site [ion binding]; metal-binding site
160488008034	active site
160488008035	I-site; other site
160488008036	Domain of unknown function (DUF3535); Region: DUF3535; pfam12054
160488008037	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
160488008038	NAD(P) binding site [chemical binding]; other site
160488008039	Dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases) [Secondary metabolites biosynthesis, transport, and catabolism / General function prediction only]; Region: FabG; COG1028
160488008040	active site
160488008041	Uncharacterized ACR, COG2135; Region: DUF159; cl03646
160488008042	Protein of unknown function, DUF393; Region: DUF393; pfam04134
160488008043	GTP cyclohydrolase I (GTP-CH-I) catalyzes the conversion of GTP into dihydroneopterin triphosphate.  The enzyme product is the precursor of tetrahydrofolate in eubacteria, fungi, and plants and of the folate analogs in methanogenic bacteria.  In...; Region: GTP_cyclohydro1; cd00642
160488008044	homodecamer interface [polypeptide binding]; other site
160488008045	GTP cyclohydrolase I; Provisional; Region: PLN03044
160488008046	active site
160488008047	putative catalytic site residues [active]
160488008048	zinc binding site [ion binding]; other site
160488008049	GTP-CH-I/GFRP interaction surface; other site
160488008050	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2828
160488008051	hypothetical protein; Provisional; Region: PRK09262
160488008052	Uncharacterized proteins, LmbE homologs [Function unknown]; Region: COG2120
160488008053	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488008054	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488008055	pca operon transcription factor PcaQ; Region: TF_pcaQ; TIGR02424
160488008056	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488008057	The C-terminal substrate binding domain of galactose-binding protein regulator contains the type 2 periplasmic binding fold; Region: PBP2_GbpR; cd08435
160488008058	putative dimerization interface [polypeptide binding]; other site
160488008059	outer membrane porin, OprD family; Region: OprD; pfam03573
160488008060	protocatechuate 4,5-dioxygenase; Provisional; Region: PRK13367
160488008061	The N-terminal domain of the Class III extradiol dioxygenase, Gallate Dioxygenase, which catalyzes the oxidization and subsequent ring-opening of gallate; Region: Gallate_Doxase_N; cd07950
160488008062	putative active site [active]
160488008063	Fe(II) binding site [ion binding]; other site
160488008064	putative dimer interface [polypeptide binding]; other site
160488008065	The C-terminal domain of Gallate Dioxygenase, which catalyzes the oxidization and subsequent ring-opening of gallate; Region: Gallate_dioxygenase_C; cd07923
160488008066	putative dimer interface [polypeptide binding]; other site
160488008067	putative N- and C-terminal domain interface [polypeptide binding]; other site
160488008068	Transposase DDE domain; Region: DDE_Tnp_1; pfam01609
160488008069	Predicted HD superfamily hydrolase [General function prediction only]; Region: COG1418
160488008070	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
160488008071	Zn2+ binding site [ion binding]; other site
160488008072	Mg2+ binding site [ion binding]; other site
160488008073	Predicted ATPase [General function prediction only]; Region: COG4637
160488008074	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488008075	Walker A/P-loop; other site
160488008076	ATP binding site [chemical binding]; other site
160488008077	Domain of unknown function (DUF3315); Region: DUF3315; cl02275
160488008078	O-acetylhomoserine aminocarboxypropyltransferase; Validated; Region: PRK06084
160488008079	CGS_like: Cystathionine gamma-synthase is a PLP dependent enzyme and catalyzes the committed step of methionine biosynthesis. This pathway is unique to microorganisms and plants, rendering the enzyme an attractive target for the development of...; Region: CGS_like; cd00614
160488008080	homodimer interface [polypeptide binding]; other site
160488008081	substrate-cofactor binding pocket; other site
160488008082	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488008083	catalytic residue [active]
160488008084	5'-nucleotidase; Region: 5-nucleotidase; pfam06189
160488008085	Lactate dehydrogenase and related dehydrogenases [Energy production and conversion / Coenzyme metabolism / General function prediction only]; Region: LdhA; COG1052
160488008086	Putative D-3-Phosphoglycerate Dehydrogenases; Region: PGDH_like_1; cd12169
160488008087	dimerization interface [polypeptide binding]; other site
160488008088	NAD binding site [chemical binding]; other site
160488008089	ligand binding site [chemical binding]; other site
160488008090	catalytic site [active]
160488008091	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488008092	The C-terminal substrate binding domain of an uncharacterized LysR-type transcriptional regulator CrgA-like, contains the type 2 periplasmic binding fold; Region: PBP2_CrgA_like_10; cd08480
160488008093	putative effector binding pocket; other site
160488008094	putative dimerization interface [polypeptide binding]; other site
160488008095	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488008096	Major Facilitator Superfamily; Region: MFS_1; pfam07690
160488008097	putative substrate translocation pore; other site
160488008098	Glutathione S-transferase [Posttranslational modification, protein turnover, chaperones]; Region: Gst; COG0625
160488008099	GST_N family, unknown subfamily 2; composed of uncharacterized bacterial proteins with similarity to GSTs. GSTs are cytosolic dimeric proteins involved in cellular detoxification by catalyzing the conjugation of glutathione (GSH) with a wide range of...; Region: GST_N_2; cd03047
160488008100	putative C-terminal domain interface [polypeptide binding]; other site
160488008101	putative GSH binding site (G-site) [chemical binding]; other site
160488008102	putative dimer interface [polypeptide binding]; other site
160488008103	C-terminal, alpha helical domain of an unknown subfamily 2 of Glutathione S-transferases; Region: GST_C_2; cd03180
160488008104	putative N-terminal domain interface [polypeptide binding]; other site
160488008105	putative dimer interface [polypeptide binding]; other site
160488008106	putative substrate binding pocket (H-site) [chemical binding]; other site
160488008107	Protein of unknown function (DUF3077); Region: DUF3077; pfam11275
160488008108	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488008109	pca operon transcription factor PcaQ; Region: TF_pcaQ; TIGR02424
160488008110	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
160488008111	dimerization interface [polypeptide binding]; other site
160488008112	3-ketoacyl-(acyl-carrier-protein) reductase; Validated; Region: fabG; PRK05557
160488008113	putative beta-ketoacyl acyl carrier protein [ACP] reductase (BKR)-like, SDR; Region: BKR_like_SDR_like; cd05344
160488008114	putative NAD(P) binding site [chemical binding]; other site
160488008115	putative active site [active]
160488008116	WYL domain; Region: WYL; pfam13280
160488008117	Transcriptional regulators containing a DNA-binding HTH domain and an aminotransferase domain (MocR family) and their eukaryotic orthologs [Transcription / Amino acid transport and metabolism]; Region: ARO8; COG1167
160488008118	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488008119	DNA-binding site [nucleotide binding]; DNA binding site
160488008120	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
160488008121	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488008122	homodimer interface [polypeptide binding]; other site
160488008123	catalytic residue [active]
160488008124	gamma-aminobutyrate permease; Region: GABAperm; TIGR01773
160488008125	Trans-aconitate methyltransferase [General function prediction only]; Region: Tam; COG4106
160488008126	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488008127	S-adenosylmethionine binding site [chemical binding]; other site
160488008128	Protein of Unknown function (DUF2784); Region: DUF2784; pfam10861
160488008129	aminoethylphosphonate catabolism associated LysR family transcriptional regulator; Region: phn_lysR; TIGR03339
160488008130	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488008131	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
160488008132	dimerization interface [polypeptide binding]; other site
160488008133	Sugar phosphate permease [Carbohydrate transport and metabolism]; Region: UhpC; COG2271
160488008134	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488008135	putative substrate translocation pore; other site
160488008136	putative aminophosphonate oxidoreductase; Region: Phn_aa_oxid; TIGR03329
160488008137	Glycine/D-amino acid oxidases (deaminating) [Amino acid transport and metabolism]; Region: DadA; COG0665
160488008138	hypothetical protein; Provisional; Region: PRK12378
160488008139	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488008140	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488008141	The C-terminal substrate binding domain of LysR-type transcriptional regulators that involved in the catabolism of nitroaromatic/naphthalene compounds and that of related regulators; contains the type 2 periplasmic binding fold; Region: PBP2_Nitroaromatics_like; cd08417
160488008142	substrate binding pocket [chemical binding]; other site
160488008143	dimerization interface [polypeptide binding]; other site
160488008144	tyrosine decarboxylase; Region: PLN02880
160488008145	Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes. PLP combines with an alpha-amino acid to form a compound called a Schiff base or aldimine intermediate, which depending on the reaction, is the...; Region: AAT_I; cl00321
160488008146	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
160488008147	catalytic residue [active]
160488008148	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488008149	metabolite-proton symporter; Region: 2A0106; TIGR00883
160488008150	putative substrate translocation pore; other site
160488008151	Sugar phosphate isomerases/epimerases [Carbohydrate transport and metabolism]; Region: IolE; COG1082
160488008152	4-hydroxyphenylpyruvate dioxygenase; Region: 4HPPD; TIGR01263
160488008153	N-terminal domain of 4-hydroxyphenylpyruvate dioxygenase (HPPD) and hydroxymandelate Synthase (HmaS); Region: HPPD_N_like; cd08342
160488008154	dimer interface [polypeptide binding]; other site
160488008155	C-terminal domain of 4-hydroxyphenylpyruvate dioxygenase (HppD) and hydroxymandelate Synthase (HmaS); Region: HPPD_C_like; cd07250
160488008156	active site
160488008157	Fe binding site [ion binding]; other site
160488008158	Methyltransferase domain; Region: Methyltransf_23; pfam13489
160488008159	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488008160	S-adenosylmethionine binding site [chemical binding]; other site
160488008161	Chromate transport protein ChrA [Inorganic ion transport and metabolism]; Region: ChrA; COG2059
160488008162	chromate transporter, chromate ion transporter (CHR) family; Region: 2A51; TIGR00937
160488008163	Chromate transporter; Region: Chromate_transp; pfam02417
160488008164	PAS domain S-box; Region: sensory_box; TIGR00229
160488008165	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488008166	putative active site [active]
160488008167	heme pocket [chemical binding]; other site
160488008168	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
160488008169	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488008170	metal binding site [ion binding]; metal-binding site
160488008171	active site
160488008172	I-site; other site
160488008173	type I secretion outer membrane protein, TolC family; Region: type_I_sec_TolC; TIGR01844
160488008174	type I secretion membrane fusion protein, HlyD family; Region: type_I_hlyD; TIGR01843
160488008175	Biotinyl_lipoyl_domains are present in biotin-dependent carboxylases/decarboxylases, the dihydrolipoyl acyltransferase component (E2) of 2-oxo acid dehydrogenases, and the H-protein of the glycine cleavage system (GCS). These domains transport CO2, acyl; Region: Biotinyl_lipoyl_domains; cl11404
160488008176	lipoyl-biotinyl attachment site [posttranslational modification]; other site
160488008177	HlyD family secretion protein; Region: HlyD_3; pfam13437
160488008178	ABC-type protease/lipase transport system, ATPase and permease components [General function prediction only]; Region: ArpD; COG4618
160488008179	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
160488008180	ATP-binding cassette domain of PrtD, subfamily C; Region: ABCC_Protease_Secretion; cd03246
160488008181	Walker A/P-loop; other site
160488008182	ATP binding site [chemical binding]; other site
160488008183	Q-loop/lid; other site
160488008184	ABC transporter signature motif; other site
160488008185	Walker B; other site
160488008186	D-loop; other site
160488008187	H-loop/switch region; other site
160488008188	Animal heme peroxidases and related proteins; Region: An_peroxidase_like; cl14561
160488008189	Uncharacterized bacterial family of heme peroxidases; Region: An_peroxidase_bacterial_2; cd09821
160488008190	putative heme binding site [chemical binding]; other site
160488008191	putative substrate binding site [chemical binding]; other site
160488008192	Animal heme peroxidases and related proteins; Region: An_peroxidase_like; cl14561
160488008193	Uncharacterized bacterial family of heme peroxidases; Region: An_peroxidase_bacterial_2; cd09821
160488008194	putative heme binding site [chemical binding]; other site
160488008195	putative substrate binding site [chemical binding]; other site
160488008196	Cysteine hydrolases; This family contains amidohydrolases, like CSHase (N-carbamoylsarcosine amidohydrolase), involved in creatine metabolism and nicotinamidase, converting nicotinamide to nicotinic acid and ammonia in the pyridine nucleotide cycle. It...; Region: cysteine_hydrolases; cd00431
160488008197	Isochorismatase family; Region: Isochorismatase; pfam00857
160488008198	catalytic triad [active]
160488008199	conserved cis-peptide bond; other site
160488008200	The adenylation domain of nonribosomal peptide synthetases (NRPS); Region: A_NRPS; cd05930
160488008201	amino acid adenylation domain; Region: AA-adenyl-dom; TIGR01733
160488008202	acyl-activating enzyme (AAE) consensus motif; other site
160488008203	AMP binding site [chemical binding]; other site
160488008204	Acyltransferase family; Region: Acyl_transf_3; pfam01757
160488008205	Pirin-related protein [General function prediction only]; Region: COG1741
160488008206	Pirin; Region: Pirin; pfam02678
160488008207	Superfamily I DNA and RNA helicases [DNA replication, recombination, and repair]; Region: UvrD; COG0210
160488008208	Family description; Region: UvrD_C_2; pfam13538
160488008209	Leucine-rich repeats (LRRs), ribonuclease inhibitor (RI)-like subfamily. LRRs are 20-29 residue sequence motifs present in many proteins that participate in protein-protein interactions and have different functions and cellular locations. LRRs correspond...; Region: LRR_RI; cl15309
160488008210	Leucine-rich repeats; other site
160488008211	Substrate binding site [chemical binding]; other site
160488008212	Leucine rich repeat; Region: LRR_8; pfam13855
160488008213	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
160488008214	Putative lysophospholipase; Region: Hydrolase_4; pfam12146
160488008215	This conserved domain belongs to a superfamily including the bleomycin resistance protein, glyoxalase I, and type I ring-cleaving dioxygenases; Region: Glo_EDI_BRP_like_2; cd07253
160488008216	dimer interface [polypeptide binding]; other site
160488008217	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
160488008218	metal binding site [ion binding]; metal-binding site
160488008219	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488008220	putative substrate translocation pore; other site
160488008221	Transposase; Region: DEDD_Tnp_IS110; pfam01548
160488008222	Transposase IS116/IS110/IS902 family; Region: Transposase_20; pfam02371
160488008223	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
160488008224	This conserved domain belongs to a superfamily including the bleomycin resistance protein, glyoxalase I, and type I ring-cleaving dioxygenases; Region: Glo_EDI_BRP_like_16; cd07263
160488008225	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488008226	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488008227	The C-terminal substrate-binding domain of putative LysR-type transcriptional regulator PAO1-like, a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_PAO1_like; cd08412
160488008228	putative substrate binding pocket [chemical binding]; other site
160488008229	dimerization interface [polypeptide binding]; other site
160488008230	Paraquat-inducible protein B [General function prediction only]; Region: PqiB; COG3008
160488008231	mce related protein; Region: MCE; pfam02470
160488008232	mce related protein; Region: MCE; pfam02470
160488008233	mce related protein; Region: MCE; pfam02470
160488008234	Domain of unknown function (DUF4404); Region: DUF4404; pfam14357
160488008235	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3009
160488008236	Protein of unknown function (DUF330); Region: DUF330; pfam03886
160488008237	hypothetical protein; Provisional; Region: PRK10649
160488008238	Sulfatase; Region: Sulfatase; pfam00884
160488008239	Protein of unknown function (DUF2986); Region: DUF2986; pfam11661
160488008240	Heme oxygenase catalyzes the rate limiting step in the degradation of heme to bilirubin, it is essential for recycling of iron from heme. Heme is used as a substrate and cofactor for its own degradation to biliverdin, iron, and carbon monoxide. This...; Region: HemeO; cd00232
160488008241	heme binding pocket [chemical binding]; other site
160488008242	heme ligand [chemical binding]; other site
160488008243	Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302
160488008244	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
160488008245	Coenzyme A binding pocket [chemical binding]; other site
160488008246	hydroxydechloroatrazine ethylaminohydrolase; Reviewed; Region: PRK08203
160488008247	TRZ/ATZ family contains enzymes from the atrazine degradation pathway and related hydrolases. Atrazine, a chlorinated herbizide, can be catabolized by a variety of different bacteria. The first three steps of the atrazine dehalogenation pathway are...; Region: ATZ_TRZ_like; cd01298
160488008248	active site
160488008249	putative substrate binding pocket [chemical binding]; other site
160488008250	NAD-dependent aldehyde dehydrogenases [Energy production and conversion]; Region: PutA; COG1012
160488008251	Alpha-Ketoglutaric Semialdehyde Dehydrogenase; Region: ALDH_KGSADH; cd07129
160488008252	dimer interface [polypeptide binding]; other site
160488008253	NADP binding site [chemical binding]; other site
160488008254	catalytic residues [active]
160488008255	Amino acid transporters [Amino acid transport and metabolism]; Region: PotE; COG0531
160488008256	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
160488008257	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
160488008258	DNA binding residues [nucleotide binding]
160488008259	dimerization interface [polypeptide binding]; other site
160488008260	putative aminotransferase; Provisional; Region: PRK12403
160488008261	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
160488008262	inhibitor-cofactor binding pocket; inhibition site
160488008263	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488008264	catalytic residue [active]
160488008265	Aldehyde dehydrogenase family; Region: Aldedh; pfam00171
160488008266	Escherichia coli NADP+-dependent gamma-glutamyl-gamma-aminobutyraldehyde dehydrogenase PuuC-like; Region: ALDH_GABALDH-PuuC; cd07112
160488008267	NAD(P) binding site [chemical binding]; other site
160488008268	catalytic residues [active]
160488008269	TonB-dependent siderophore receptor; Region: TonB-siderophor; TIGR01783
160488008270	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
160488008271	N-terminal plug; other site
160488008272	ligand-binding site [chemical binding]; other site
160488008273	Siderophore binding protein FatB.  These proteins have been shown to function as ABC-type initial receptors in the siderophore-mediated iron uptake in some eubacterial species.  They belong to the TroA superfamily of periplasmic metal binding proteins...; Region: FatB; cd01140
160488008274	Periplasmic binding protein; Region: Peripla_BP_2; pfam01497
160488008275	putative ligand binding residues [chemical binding]; other site
160488008276	ABC-type enterochelin transport system, ATPase component [Inorganic ion transport and metabolism]; Region: CeuD; COG4604
160488008277	ATP-binding component of iron-siderophores, vitamin B12 and hemin transporters and related proteins; Region: ABC_Iron-Siderophores_B12_Hemin; cd03214
160488008278	Walker A/P-loop; other site
160488008279	ATP binding site [chemical binding]; other site
160488008280	Q-loop/lid; other site
160488008281	ABC transporter signature motif; other site
160488008282	Walker B; other site
160488008283	D-loop; other site
160488008284	H-loop/switch region; other site
160488008285	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
160488008286	ABC-ATPase subunit  interface; other site
160488008287	dimer interface [polypeptide binding]; other site
160488008288	putative PBP binding regions; other site
160488008289	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
160488008290	ABC-ATPase subunit  interface; other site
160488008291	dimer interface [polypeptide binding]; other site
160488008292	putative PBP binding regions; other site
160488008293	ABC-type multidrug transport system, ATPase and permease components [Defense mechanisms]; Region: MdlB; COG1132
160488008294	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488008295	Walker A/P-loop; other site
160488008296	ATP binding site [chemical binding]; other site
160488008297	Q-loop/lid; other site
160488008298	ABC transporter signature motif; other site
160488008299	Walker B; other site
160488008300	D-loop; other site
160488008301	H-loop/switch region; other site
160488008302	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488008303	Predicted ATPase involved in cell division [Cell division and chromosome partitioning]; Region: FtsE; COG2884
160488008304	Walker A/P-loop; other site
160488008305	ATP binding site [chemical binding]; other site
160488008306	Q-loop/lid; other site
160488008307	ABC transporter signature motif; other site
160488008308	Walker B; other site
160488008309	D-loop; other site
160488008310	H-loop/switch region; other site
160488008311	tetracycline repressor protein TetR; Provisional; Region: PRK13756
160488008312	Cache domain; Region: Cache_1; pfam02743
160488008313	GAF domain; Region: GAF_2; pfam13185
160488008314	GAF domain; Region: GAF_3; pfam13492
160488008315	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
160488008316	putative FAD-binding dehydrogenase; Reviewed; Region: PRK06134
160488008317	Predicted oxidoreductase [General function prediction only]; Region: COG3573
160488008318	Transcriptional regulator [Transcription]; Region: IclR; COG1414
160488008319	helix_turn_helix isocitrate lyase regulation; Region: HTH_ICLR; smart00346
160488008320	Bacterial transcriptional regulator; Region: IclR; pfam01614
160488008321	Predicted dehydrogenases and related proteins [General function prediction only]; Region: MviM; COG0673
160488008322	Oxidoreductase family, NAD-binding Rossmann fold; Region: GFO_IDH_MocA; pfam01408
160488008323	Xylose isomerase-like TIM barrel; Region: AP_endonuc_2; pfam01261
160488008324	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488008325	D-galactonate transporter; Region: 2A0114; TIGR00893
160488008326	putative substrate translocation pore; other site
160488008327	putative FAD-binding dehydrogenase; Reviewed; Region: PRK06134
160488008328	Predicted oxidoreductase [General function prediction only]; Region: COG3573
160488008329	NIPSNAP; Region: NIPSNAP; pfam07978
160488008330	putative FAD-binding dehydrogenase; Reviewed; Region: PRK12843
160488008331	putative FAD-binding dehydrogenase; Reviewed; Region: PRK12834
160488008332	shikimate 5-dehydrogenase; Region: aroE; TIGR00507
160488008333	Shikimate dehydrogenase substrate binding domain; Region: Shikimate_dh_N; pfam08501
160488008334	NAD(P) binding domain of Shikimate dehydrogenase; Region: NAD_bind_Shikimate_DH; cd01065
160488008335	shikimate binding site; other site
160488008336	NAD(P) binding site [chemical binding]; other site
160488008337	beta-ketoadipate pathway transcriptional regulators, PcaR/PcaU/PobR family; Region: pcaR_pcaU; TIGR02431
160488008338	helix_turn_helix isocitrate lyase regulation; Region: HTH_ICLR; smart00346
160488008339	Bacterial transcriptional regulator; Region: IclR; pfam01614
160488008340	PAAR motif; Region: PAAR_motif; pfam05488
160488008341	Protein of unknown function (DUF3303); Region: DUF3303; pfam11746
160488008342	Domain of unknown function (DUF4123); Region: DUF4123; pfam13503
160488008343	type VI secretion system Vgr family protein; Region: VI_Rhs_Vgr; TIGR03361
160488008344	Phage late control gene D protein (GPD); Region: Phage_GPD; pfam05954
160488008345	Phage-related baseplate assembly protein; Region: Phage_base_V; pfam04717
160488008346	type VI secretion system effector, Hcp1 family; Region: VI_effect_Hcp1; TIGR03344
160488008347	Uncharacterized protein conserved in bacteria (DUF2077); Region: DUF2077; pfam09850
160488008348	type VI secretion protein, VC_A0114 family; Region: VI_chp_4; TIGR03353
160488008349	Bacterial protein of unknown function (DUF876); Region: DUF876; pfam05936
160488008350	Type VI secretion lipoprotein; Region: T6SS-SciN; pfam12790
160488008351	FHA domain; Region: FHA; pfam00498
160488008352	phosphopeptide binding site; other site
160488008353	type VI secretion protein, VC_A0111 family; Region: VI_chp_1; TIGR03347
160488008354	Type VI protein secretion system component VasA [Intracellular trafficking, secretion, and    vesicular transport]; Region: COG3519
160488008355	type VI secretion protein, VC_A0110 family; Region: VI_chp_6; TIGR03359
160488008356	type VI secretion system lysozyme-like protein; Region: VI_zyme; TIGR03357
160488008357	type VI secretion protein, EvpB/VC_A0108 family; Region: VI_chp_2; TIGR03355
160488008358	Protein of unknown function (DUF877); Region: DUF877; pfam05943
160488008359	Protein of unknown function (DUF770); Region: DUF770; pfam05591
160488008360	Protein of unknown function (DUF3121); Region: DUF3121; pfam11319
160488008361	ImpA-related N-terminal; Region: ImpA-rel_N; pfam06812
160488008362	type VI secretion-associated protein, VC_A0119 family; Region: VI_chp_7; TIGR03362
160488008363	type VI secretion protein IcmF; Region: VI_IcmF; TIGR03348
160488008364	Intracellular multiplication and human macrophage-killing; Region: IcmF-related; pfam06761
160488008365	Protein of unknown function (DUF1215); Region: DUF1215; pfam06744
160488008366	ABC-type multidrug transport system, ATPase and permease components [Defense mechanisms]; Region: MdlB; COG1132
160488008367	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
160488008368	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488008369	Walker A/P-loop; other site
160488008370	ATP binding site [chemical binding]; other site
160488008371	Q-loop/lid; other site
160488008372	ABC transporter signature motif; other site
160488008373	Walker B; other site
160488008374	D-loop; other site
160488008375	H-loop/switch region; other site
160488008376	Protein of unknown function (DUF2819); Region: DUF2819; cl17862
160488008377	cellulose synthase operon protein YhjU; Region: cellulose_yhjU; TIGR03368
160488008378	Protein of unknown function (DUF2629); Region: DUF2629; pfam10945
160488008379	YhjQ protein; Region: YhjQ; pfam06564
160488008380	cellulose synthase catalytic subunit; Provisional; Region: bcsA; PRK11498
160488008381	CESA_CelA_like are involved in the elongation of the glucan chain of cellulose; Region: CESA_CelA_like; cd06421
160488008382	DXD motif; other site
160488008383	PilZ domain; Region: PilZ; pfam07238
160488008384	cellulose synthase regulator protein; Provisional; Region: PRK11114
160488008385	endo-1,4-D-glucanase; Provisional; Region: PRK11097
160488008386	cellulose synthase subunit BcsC; Provisional; Region: PRK11447
160488008387	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
160488008388	binding surface
160488008389	TPR motif; other site
160488008390	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
160488008391	binding surface
160488008392	TPR motif; other site
160488008393	Cellulose synthase operon protein C C-terminus (BCSC_C); Region: BCSC_C; pfam05420
160488008394	Dihydrodipicolinate synthase/N-acetylneuraminate lyase [Amino acid transport and metabolism / Cell envelope biogenesis, outer membrane]; Region: DapA; COG0329
160488008395	Dihydrodipicolinate synthase (DHDPS); Region: DHDPS; cd00950
160488008396	dimer interface [polypeptide binding]; other site
160488008397	active site
160488008398	catalytic residue [active]
160488008399	Acetyltransferase (GNAT) domain; Region: Acetyltransf_10; pfam13673
160488008400	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
160488008401	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
160488008402	Coenzyme A binding pocket [chemical binding]; other site
160488008403	CDP-6-deoxy-delta-3,4-glucoseen reductase; Validated; Region: PRK07609
160488008404	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
160488008405	catalytic loop [active]
160488008406	iron binding site [ion binding]; other site
160488008407	NAD(P)H dependent flavin oxidoreductases use flavin as a substrate in mediating electron transfer from iron complexes or iron proteins. Structurally similar to ferredoxin reductases, but with only 15% sequence identity, flavin reductases reduce FAD, FMN; Region: flavin_oxioreductase; cd06189
160488008408	FAD binding pocket [chemical binding]; other site
160488008409	FAD binding motif [chemical binding]; other site
160488008410	phosphate binding motif [ion binding]; other site
160488008411	beta-alpha-beta structure motif; other site
160488008412	NAD binding pocket [chemical binding]; other site
160488008413	A family including aminopeptidase P, aminopeptidase M, and prolidase. Also known as metallopeptidase family M24. This family of enzymes is able to cleave amido-, imido- and amidino-containing bonds. Members exibit relatively narrow substrate specificity...; Region: APP_MetAP; cd01066
160488008414	active site
160488008415	Transcriptional regulators containing a DNA-binding HTH domain and an aminotransferase domain (MocR family) and their eukaryotic orthologs [Transcription / Amino acid transport and metabolism]; Region: ARO8; COG1167
160488008416	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488008417	DNA-binding site [nucleotide binding]; DNA binding site
160488008418	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
160488008419	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488008420	homodimer interface [polypeptide binding]; other site
160488008421	catalytic residue [active]
160488008422	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
160488008423	dimerization interface [polypeptide binding]; other site
160488008424	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
160488008425	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
160488008426	dimer interface [polypeptide binding]; other site
160488008427	putative CheW interface [polypeptide binding]; other site
160488008428	magnesium-transporting ATPase; Provisional; Region: PRK15122
160488008429	Cation transporter/ATPase, N-terminus; Region: Cation_ATPase_N; smart00831
160488008430	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
160488008431	Putative hydrolase of sodium-potassium ATPase alpha subunit; Region: Hydrolase_like2; pfam13246
160488008432	haloacid dehalogenase-like hydrolase; Region: HAD; pfam12710
160488008433	Soluble P-type ATPase [General function prediction only]; Region: COG4087
160488008434	Cation transporting ATPase, C-terminus; Region: Cation_ATPase_C; pfam00689
160488008435	Protein of unknown function (DUF2493); Region: DUF2493; pfam10686
160488008436	Arabinose efflux permease [Carbohydrate transport and metabolism]; Region: AraJ; COG2814
160488008437	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488008438	putative substrate translocation pore; other site
160488008439	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
160488008440	Ligand Binding Site [chemical binding]; other site
160488008441	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
160488008442	Ligand Binding Site [chemical binding]; other site
160488008443	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488008444	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488008445	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
160488008446	dimerization interface [polypeptide binding]; other site
160488008447	Alcohol dehydrogenase, class IV [Energy production and conversion]; Region: EutG; COG1454
160488008448	Iron-containing alcohol dehydrogenases-like, involved in the linear alkylbenzenesulfonate (LAS) degradation pathway; Region: Fe-ADH7; cd08192
160488008449	putative active site [active]
160488008450	metal binding site [ion binding]; metal-binding site
160488008451	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488008452	D-galactonate transporter; Region: 2A0114; TIGR00893
160488008453	putative substrate translocation pore; other site
160488008454	Fumarylacetoacetate (FAA) hydrolase family; Region: FAA_hydrolase; cl11421
160488008455	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
160488008456	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
160488008457	non-specific DNA binding site [nucleotide binding]; other site
160488008458	salt bridge; other site
160488008459	sequence-specific DNA binding site [nucleotide binding]; other site
160488008460	MAPEG family; Region: MAPEG; pfam01124
160488008461	phosphate ABC transporter, phosphate-binding protein; Region: 3a0107s03; TIGR00975
160488008462	phosphate ABC transporter, permease protein PstC; Region: phosphate_pstC; TIGR02138
160488008463	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488008464	dimer interface [polypeptide binding]; other site
160488008465	conserved gate region; other site
160488008466	putative PBP binding loops; other site
160488008467	ABC-ATPase subunit interface; other site
160488008468	phosphate ABC transporter, permease protein PstA; Region: 3a0107s02c; TIGR00974
160488008469	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488008470	dimer interface [polypeptide binding]; other site
160488008471	conserved gate region; other site
160488008472	putative PBP binding loops; other site
160488008473	ABC-ATPase subunit interface; other site
160488008474	phosphate ABC transporter ATP-binding protein; Provisional; Region: PRK14263
160488008475	ATP-binding cassette domain of the phosphate transport system; Region: ABC_PstB_phosphate_transporter; cd03260
160488008476	Walker A/P-loop; other site
160488008477	ATP binding site [chemical binding]; other site
160488008478	Q-loop/lid; other site
160488008479	ABC transporter signature motif; other site
160488008480	Walker B; other site
160488008481	D-loop; other site
160488008482	H-loop/switch region; other site
160488008483	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cl17915
160488008484	active site
160488008485	motif I; other site
160488008486	Haloacid dehalogenase-like hydrolase; Region: HAD_2; pfam13419
160488008487	motif II; other site
160488008488	Gram-negative porin; Region: Porin_4; pfam13609
160488008489	Uncharacterized conserved protein [Function unknown]; Region: COG3287
160488008490	FIST N domain; Region: FIST; pfam08495
160488008491	FIST C domain; Region: FIST_C; pfam10442
160488008492	PAS fold; Region: PAS; pfam00989
160488008493	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cl02459
160488008494	putative active site [active]
160488008495	heme pocket [chemical binding]; other site
160488008496	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
160488008497	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488008498	dimer interface [polypeptide binding]; other site
160488008499	phosphorylation site [posttranslational modification]
160488008500	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488008501	ATP binding site [chemical binding]; other site
160488008502	Mg2+ binding site [ion binding]; other site
160488008503	G-X-G motif; other site
160488008504	FOG: CheY-like receiver [Signal transduction mechanisms]; Region: CheY; COG0784
160488008505	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488008506	active site
160488008507	phosphorylation site [posttranslational modification]
160488008508	intermolecular recognition site; other site
160488008509	dimerization interface [polypeptide binding]; other site
160488008510	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
160488008511	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488008512	active site
160488008513	phosphorylation site [posttranslational modification]
160488008514	intermolecular recognition site; other site
160488008515	dimerization interface [polypeptide binding]; other site
160488008516	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
160488008517	DNA binding residues [nucleotide binding]
160488008518	dimerization interface [polypeptide binding]; other site
160488008519	Rhodanese Homology Domain (RHOD); an alpha beta fold domain found duplicated in the rhodanese protein. The cysteine containing enzymatically active version of the domain is also found in the Cdc25 class of protein phosphatases and a variety of proteins...; Region: RHOD; cd00158
160488008520	active site residue [active]
160488008521	alcohol ABC transporter, permease protein; Region: phenyl_ABC_PedC; TIGR03861
160488008522	ABC-type multidrug transport system, permease component [Defense mechanisms]; Region: COG0842
160488008523	ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system; Region: PQQ_ABC_ATP; TIGR03864
160488008524	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488008525	Walker A/P-loop; other site
160488008526	ATP binding site [chemical binding]; other site
160488008527	Q-loop/lid; other site
160488008528	ABC transporter signature motif; other site
160488008529	Walker B; other site
160488008530	D-loop; other site
160488008531	H-loop/switch region; other site
160488008532	40-residue YVTN family beta-propeller repeat; Region: beta_rpt_yvtn; TIGR02276
160488008533	PQQ-dependent catabolism-associated beta-propeller protein; Region: PQQ_ABC_repeats; TIGR03866
160488008534	40-residue YVTN family beta-propeller repeat; Region: beta_rpt_yvtn; TIGR02276
160488008535	40-residue YVTN family beta-propeller repeat; Region: beta_rpt_yvtn; TIGR02276
160488008536	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
160488008537	dimerization interface [polypeptide binding]; other site
160488008538	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: COG4585
160488008539	Histidine kinase; Region: HisKA_3; pfam07730
160488008540	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488008541	ATP binding site [chemical binding]; other site
160488008542	Mg2+ binding site [ion binding]; other site
160488008543	G-X-G motif; other site
160488008544	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
160488008545	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488008546	active site
160488008547	phosphorylation site [posttranslational modification]
160488008548	intermolecular recognition site; other site
160488008549	dimerization interface [polypeptide binding]; other site
160488008550	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
160488008551	DNA binding residues [nucleotide binding]
160488008552	dimerization interface [polypeptide binding]; other site
160488008553	Pentapeptide repeats (9 copies); Region: Pentapeptide_4; pfam13599
160488008554	Pentapeptide repeats (8 copies); Region: Pentapeptide; pfam00805
160488008555	Pentapeptide repeats (8 copies); Region: Pentapeptide; pfam00805
160488008556	Pentapeptide repeats (8 copies); Region: Pentapeptide; pfam00805
160488008557	Pentapeptide repeats (9 copies); Region: Pentapeptide_4; pfam13599
160488008558	Pentapeptide repeats (8 copies); Region: Pentapeptide; pfam00805
160488008559	PQQ-dependent dehydrogenase, methanol/ethanol family; Region: PQQ_enz_alc_DH; TIGR03075
160488008560	Ethanol dehydrogenase, a bacterial quinoprotein (PQQ-dependent type I alcohol dehydrogenase); Region: PQQ_ADH_I; cd10277
160488008561	dimer interface [polypeptide binding]; other site
160488008562	Trp docking motif [polypeptide binding]; other site
160488008563	active site
160488008564	Cytochrome C oxidase, cbb3-type, subunit III; Region: Cytochrome_CBB3; pfam13442
160488008565	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488008566	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
160488008567	substrate binding pocket [chemical binding]; other site
160488008568	membrane-bound complex binding site; other site
160488008569	hinge residues; other site
160488008570	sulfur oxidation protein SoxY; Provisional; Region: PRK07474
160488008571	Sulfur oxidation protein SoxY; Region: SoxY; pfam13501
160488008572	Sulphur oxidation protein SoxZ; Region: SoxZ; pfam08770
160488008573	Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849
160488008574	PQQ-dependent dehydrogenase, methanol/ethanol family; Region: PQQ_enz_alc_DH; TIGR03075
160488008575	Ethanol dehydrogenase, a bacterial quinoprotein (PQQ-dependent type I alcohol dehydrogenase); Region: PQQ_ADH_I; cd10277
160488008576	dimer interface [polypeptide binding]; other site
160488008577	Trp docking motif [polypeptide binding]; other site
160488008578	active site
160488008579	Ralstonia eutrophus NAD+-dependent acetaldehyde dehydrogenase II and Staphylococcus aureus AldA1 (SACOL0154)-like; Region: ALDH_ACDHII_AcoD-like; cd07559
160488008580	Aldehyde dehydrogenase family; Region: Aldedh; pfam00171
160488008581	NAD(P) binding site [chemical binding]; other site
160488008582	catalytic residues [active]
160488008583	pyrroloquinoline quinone biosynthesis protein PqqD; Provisional; Region: PRK02079
160488008584	Iron-containing alcohol dehydrogenases-like; Region: Fe-ADH4; cd08188
160488008585	Alcohol dehydrogenase, class IV [Energy production and conversion]; Region: EutG; COG1454
160488008586	putative active site [active]
160488008587	metal binding site [ion binding]; metal-binding site
160488008588	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cl02459
160488008589	PAS domain S-box; Region: sensory_box; TIGR00229
160488008590	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
160488008591	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488008592	dimer interface [polypeptide binding]; other site
160488008593	phosphorylation site [posttranslational modification]
160488008594	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488008595	ATP binding site [chemical binding]; other site
160488008596	Mg2+ binding site [ion binding]; other site
160488008597	G-X-G motif; other site
160488008598	FOG: CheY-like receiver [Signal transduction mechanisms]; Region: CheY; COG0784
160488008599	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488008600	active site
160488008601	phosphorylation site [posttranslational modification]
160488008602	intermolecular recognition site; other site
160488008603	dimerization interface [polypeptide binding]; other site
160488008604	Predicted proteasome-type protease [Posttranslational modification, protein turnover, chaperones]; Region: COG3484
160488008605	Bacterial proteasome, beta subunit. The 20S proteasome, multisubunit proteolytic complex, is the central enzyme of nonlysosomal protein degradation in both the cytosol and nucleus. It is composed of 28 subunits arranged as four homoheptameric rings that...; Region: proteasome_beta_bacterial; cd03765
160488008606	Transglutaminase-like enzymes, putative cysteine proteases [Amino acid transport and metabolism]; Region: COG1305
160488008607	Bacterial transglutaminase-like N-terminal region; Region: Bact_transglu_N; pfam08379
160488008608	Transglutaminase-like superfamily; Region: Transglut_core; pfam01841
160488008609	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2307
160488008610	A predicted alpha-helical domain with a conserved ER motif; Region: Alpha-E; pfam04168
160488008611	Uncharacterized conserved protein [Function unknown]; Region: COG2308
160488008612	YjgF, YER057c, and UK114 belong to a large family of proteins present in bacteria, archaea, and eukaryotes with no definitive function. The conserved domain is similar in structure to chorismate mutase but there is no sequence similarity and no...; Region: YjgF_YER057c_UK114_family; cd00448
160488008613	homotrimer interaction site [polypeptide binding]; other site
160488008614	putative active site [active]
160488008615	Protein of unknown function (DUF3726); Region: DUF3726; pfam12525
160488008616	BCCT family transporter; Region: BCCT; pfam02028
160488008617	Zn-dependent dipeptidase, microsomal dipeptidase homolog [Amino acid transport and metabolism]; Region: COG2355
160488008618	Membrane dipeptidase (Peptidase family M19); Region: Peptidase_M19; pfam01244
160488008619	active site
160488008620	Bacillus subtilis NADP+-dependent alpha-ketoglutaric semialdehyde dehydrogenase ycbD-like; Region: ALDH_KGSADH-YcbD; cd07097
160488008621	Aldehyde dehydrogenase family; Region: Aldedh; pfam00171
160488008622	NAD(P) binding site [chemical binding]; other site
160488008623	catalytic residues [active]
160488008624	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488008625	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488008626	TThe C-terminal substrate binding domain of an uncharacterized LysR-type transcriptional regulator, contains the type 2 periplasmic binding fold; Region: PBP2_LTTR_like_4; cd08440
160488008627	putative dimerization interface [polypeptide binding]; other site
160488008628	DNA-binding transcriptional regulator MetR; Provisional; Region: PRK15421
160488008629	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488008630	The C-terminal substrate binding domain of LysR-type transcriptional regulator metR, which regulates the expression of methionine biosynthetic genes, contains type 2 periplasmic binding fold; Region: PBP2_MetR; cd08441
160488008631	putative dimerization interface [polypeptide binding]; other site
160488008632	Flavin reductase like domain; Region: Flavin_Reduct; smart00903
160488008633	methionine synthase; Provisional; Region: PRK01207
160488008634	CIMS - Cobalamine-independent methonine synthase, or MetE, C-terminal domain_like. Many members have been characterized as 5-methyltetrahydropteroyltriglutamate-homocysteine methyltransferases, EC:2.1.1.14, mostly from bacteria and plants. This enzyme...; Region: CIMS_C_terminal_like; cd03311
160488008635	substrate binding site [chemical binding]; other site
160488008636	THF binding site; other site
160488008637	zinc-binding site [ion binding]; other site
160488008638	Domain of unknown function (DUF1852); Region: DUF1852; pfam08908
160488008639	Peroxiredoxin (PRX) family, PRX5-like subfamily; members are similar to the human protein, PRX5, a homodimeric TRX peroxidase, widely expressed in tissues and found cellularly in mitochondria, peroxisomes and the cytosol. The cellular location of PRX5...; Region: PRX5_like; cd03013
160488008640	catalytic triad [active]
160488008641	dimer interface [polypeptide binding]; other site
160488008642	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488008643	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488008644	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
160488008645	dimerization interface [polypeptide binding]; other site
160488008646	Porins form aqueous channels for the diffusion of small hydrophillic molecules across the outer membrane. Individual 16-strand anti-parallel beta-barrels form a central pore, and trimerizes thru mainly hydrophobic interactions at the interface. Trimers...; Region: gram_neg_porins; cd00342
160488008647	trimer interface [polypeptide binding]; other site
160488008648	eyelet of channel; other site
160488008649	Outer membrane protein (porin) [Cell envelope biogenesis, outer membrane]; Region: OmpC; COG3203
160488008650	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488008651	metabolite-proton symporter; Region: 2A0106; TIGR00883
160488008652	putative substrate translocation pore; other site
160488008653	Metal-dependent amidase/aminoacylase/carboxypeptidase [General function prediction only]; Region: AbgB; COG1473
160488008654	M20 Peptidase Aminoacylase 1 subfamily; Region: M20_Acy1_like1; cd05666
160488008655	metal binding site [ion binding]; metal-binding site
160488008656	putative dimer interface [polypeptide binding]; other site
160488008657	Escherichia coli exonuclease III (ExoIII) and Neisseria meningitides NExo-like subfamily of the ExoIII family purinic/apyrimidinic (AP) endonucleases; Region: ExoIII-like_AP-endo; cd09086
160488008658	putative catalytic site [active]
160488008659	putative phosphate binding site [ion binding]; other site
160488008660	active site
160488008661	metal binding site A [ion binding]; metal-binding site
160488008662	DNA binding site [nucleotide binding]
160488008663	putative AP binding site [nucleotide binding]; other site
160488008664	putative metal binding site B [ion binding]; other site
160488008665	Thermostable hemolysin; Region: T_hemolysin; pfam12261
160488008666	Long-chain acyl-CoA synthetases (AMP-forming) [Lipid metabolism]; Region: FAA1; COG1022
160488008667	Uncharacterized subfamily of fatty acid CoA ligase (FACL); Region: FACL_like_3; cd05914
160488008668	acyl-activating enzyme (AAE) consensus motif; other site
160488008669	putative AMP binding site [chemical binding]; other site
160488008670	putative active site [active]
160488008671	putative CoA binding site [chemical binding]; other site
160488008672	Heme oxygenase catalyzes the rate limiting step in the degradation of heme to bilirubin, it is essential for recycling of iron from heme. Heme is used as a substrate and cofactor for its own degradation to biliverdin, iron, and carbon monoxide. This...; Region: HemeO; cd00232
160488008673	heme binding pocket [chemical binding]; other site
160488008674	heme ligand [chemical binding]; other site
160488008675	short chain dehydrogenase; Provisional; Region: PRK09072
160488008676	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
160488008677	NAD(P) binding site [chemical binding]; other site
160488008678	active site
160488008679	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
160488008680	TPR motif; other site
160488008681	binding surface
160488008682	DNA-binding transcriptional regulator BasR; Provisional; Region: PRK10643
160488008683	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488008684	active site
160488008685	phosphorylation site [posttranslational modification]
160488008686	intermolecular recognition site; other site
160488008687	dimerization interface [polypeptide binding]; other site
160488008688	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
160488008689	DNA binding site [nucleotide binding]
160488008690	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488008691	dimer interface [polypeptide binding]; other site
160488008692	phosphorylation site [posttranslational modification]
160488008693	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488008694	ATP binding site [chemical binding]; other site
160488008695	Mg2+ binding site [ion binding]; other site
160488008696	G-X-G motif; other site
160488008697	arsenical resistance protein ArsH; Region: resist_ArsH; TIGR02690
160488008698	NADPH-dependent FMN reductase; Region: FMN_red; pfam03358
160488008699	Low molecular weight phosphatase family; Region: LMWPc; cd00115
160488008700	Protein-tyrosine-phosphatase [Signal transduction mechanisms]; Region: Wzb; COG0394
160488008701	active site
160488008702	arsenical pump membrane protein; Provisional; Region: PRK15445
160488008703	Anion permease ArsB.  These permeases have been shown to export arsenate and antimonite in eubacteria and archaea.  A typical ArsB permease contains 8-13 transmembrane helices and can function either independently as a chemiosmotic transporter or as a...; Region: ArsB_permease; cd01118
160488008704	transmembrane helices; other site
160488008705	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
160488008706	dimerization interface [polypeptide binding]; other site
160488008707	putative DNA binding site [nucleotide binding]; other site
160488008708	putative Zn2+ binding site [ion binding]; other site
160488008709	Hemerythrin-like domain; Region: Hr-like; cd12108
160488008710	short chain dehydrogenase; Provisional; Region: PRK06701
160488008711	classical (c) SDR, subgroup 1; Region: SDR_c1; cd05355
160488008712	NAD binding site [chemical binding]; other site
160488008713	metal binding site [ion binding]; metal-binding site
160488008714	active site
160488008715	A type 1 glutamine amidotransferase (GATase1)-like domain found in PfpI from Pyrococcus furiosus; Region: GATase1_PfpI_like; cd03134
160488008716	intracellular protease, PfpI family; Region: PfpI; TIGR01382
160488008717	proposed catalytic triad [active]
160488008718	conserved cys residue [active]
160488008719	Predicted membrane protein [Function unknown]; Region: COG2323
160488008720	C factor cell-cell signaling protein; Provisional; Region: PRK09009
160488008721	carbonyl reductase sniffer-like, classical (c) SDRs; Region: carb_red_sniffer_like_SDR_c; cd05325
160488008722	NADP binding site [chemical binding]; other site
160488008723	homodimer interface [polypeptide binding]; other site
160488008724	active site
160488008725	Domain of Unknown Function (DUF1543); Region: DUF1543; pfam07566
160488008726	Protein of unknown function (DUF3833); Region: DUF3833; pfam12915
160488008727	Uncharacterized protein related to deoxyribodipyrimidine photolyase [General function prediction only]; Region: COG3046
160488008728	Deoxyribodipyrimidine photo-lyase-related protein; Region: DPRP; pfam04244
160488008729	Protein of unknown function (DUF2878); Region: DUF2878; pfam11086
160488008730	Cyclopropane fatty acid synthase and related methyltransferases [Cell envelope biogenesis, outer membrane]; Region: Cfa; COG2230
160488008731	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488008732	S-adenosylmethionine binding site [chemical binding]; other site
160488008733	Protein of unknown function (DUF1365); Region: DUF1365; pfam07103
160488008734	Predicted NAD/FAD-binding protein [General function prediction only]; Region: COG2907
160488008735	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
160488008736	short chain dehydrogenase; Provisional; Region: PRK07023
160488008737	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
160488008738	NAD(P) binding site [chemical binding]; other site
160488008739	active site
160488008740	SnoaL-like domain; Region: SnoaL_2; pfam12680
160488008741	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488008742	PAS domain; Region: PAS_9; pfam13426
160488008743	putative active site [active]
160488008744	heme pocket [chemical binding]; other site
160488008745	Helix-Turn-Helix DNA binding domain of the transcription regulators MlrA and CarA; Region: HTH_MlrA-CarA; cd01104
160488008746	DNA binding residues [nucleotide binding]
160488008747	MerR HTH family regulatory protein; Region: MerR_1; pfam13411
160488008748	Small-conductance mechanosensitive channel [Cell envelope biogenesis, outer membrane]; Region: MscS; COG0668
160488008749	Mechanosensitive ion channel; Region: MS_channel; pfam00924
160488008750	Protein of unknown function (DUF861); Region: Cupin_3; cl17594
160488008751	Acetyltransferase (GNAT) domain; Region: Acetyltransf_8; pfam13523
160488008752	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
160488008753	Coenzyme A binding pocket [chemical binding]; other site
160488008754	Phosphoribosylpyrophosphate synthetase [Nucleotide transport and metabolism / Amino acid transport and metabolism]; Region: PrsA; COG0462
160488008755	N-terminal domain of ribose phosphate pyrophosphokinase; Region: Pribosyltran_N; pfam13793
160488008756	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
160488008757	active site
160488008758	universal stress protein UspE; Provisional; Region: PRK11175
160488008759	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
160488008760	Ligand Binding Site [chemical binding]; other site
160488008761	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
160488008762	Ligand Binding Site [chemical binding]; other site
160488008763	FMN-dependent oxidoreductase, nitrilotriacetate monooxygenase family; Region: FMN_nitrolo; TIGR03860
160488008764	nitrilotriacetate monoxygenase oxidizes nitrilotriacetate utilizing reduced flavin mononucleotide (FMNH2) and oxygen. The FMNH2 is provided by an NADH:flavin mononucleotide (FMN) oxidorductase that uses NADH to reduce FMN to FMNH2; Region: Nitrilotriacetate_monoxgenase; cd01095
160488008765	active site
160488008766	non-prolyl cis peptide bond; other site
160488008767	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
160488008768	ABC-type branched-chain amino acid transport systems, ATPase component [Amino acid transport and metabolism]; Region: LivG; COG0411
160488008769	ATP-binding cassette component of branched chain amino acids transport system; Region: ABC_Mj1267_LivG_branched; cd03219
160488008770	Walker A/P-loop; other site
160488008771	ATP binding site [chemical binding]; other site
160488008772	Q-loop/lid; other site
160488008773	ABC transporter signature motif; other site
160488008774	Walker B; other site
160488008775	D-loop; other site
160488008776	H-loop/switch region; other site
160488008777	Branched-chain amino acid transport system / permease component; Region: BPD_transp_2; pfam02653
160488008778	Transmembrane subunit (TM) of Escherichia coli LivH and related proteins. LivH is one of two TMs of the E. coli LIV-1/LS transporter, a Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporter involved in the uptake of...; Region: TM_PBP1_LivH_like; cd06582
160488008779	TM-ABC transporter signature motif; other site
160488008780	ABC-type branched-chain amino acid transport system, permease component [Amino acid transport and metabolism]; Region: LivM; COG4177
160488008781	Transmembrane subunit (TM) of Escherichia coli LivM and related proteins. LivM is one of two TMs of the E. coli LIV-1/LS transporter, a Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporter involved in the uptake of...; Region: TM_PBP1_LivM_like; cd06581
160488008782	TM-ABC transporter signature motif; other site
160488008783	Type I periplasmic ligand-binding domain of uncharacterized ABC (ATPase Binding Cassette)-type active transport systems that are predicted to be involved in transport of amino acids, peptides, or inorganic ions; Region: PBP1_ABC_ligand_binding_like_1; cd06334
160488008784	Periplasmic binding protein; Region: Peripla_BP_6; pfam13458
160488008785	putative ligand binding site [chemical binding]; other site
160488008786	Type I periplasmic ligand-binding domain of uncharacterized ABC (ATPase Binding Cassette)-type active transport systems that are predicted to be involved in transport of amino acids, peptides, or inorganic ions; Region: PBP1_ABC_ligand_binding_like_1; cd06334
160488008787	Periplasmic binding protein; Region: Peripla_BP_6; pfam13458
160488008788	putative ligand binding site [chemical binding]; other site
160488008789	ABC-type branched-chain amino acid transport systems, ATPase component [Amino acid transport and metabolism]; Region: LivF; COG0410
160488008790	ATP-binding cassette domain of branched-chain amino acid transporter; Region: ABC_TM1139_LivF_branched; cd03224
160488008791	Walker A/P-loop; other site
160488008792	ATP binding site [chemical binding]; other site
160488008793	Q-loop/lid; other site
160488008794	ABC transporter signature motif; other site
160488008795	Walker B; other site
160488008796	D-loop; other site
160488008797	H-loop/switch region; other site
160488008798	outer membrane porin, OprD family; Region: OprD; pfam03573
160488008799	sulfur acquisition oxidoreductase, SfnB family; Region: sulfur_SfnB; TIGR04022
160488008800	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
160488008801	active site
160488008802	Methylthioribose-binding protein-like of ABC-type transport systems that belong to a family of pentose/hexose sugar-binding proteins of the type I periplasmic binding protein (PBP1) superfamily; Region: PBP1_methylthioribose_binding_like; cd06305
160488008803	Periplasmic binding protein domain; Region: Peripla_BP_4; pfam13407
160488008804	putative ligand binding site [chemical binding]; other site
160488008805	Methylthioribose-binding protein-like of ABC-type transport systems that belong to a family of pentose/hexose sugar-binding proteins of the type I periplasmic binding protein (PBP1) superfamily; Region: PBP1_methylthioribose_binding_like; cd06305
160488008806	Periplasmic binding protein domain; Region: Peripla_BP_4; pfam13407
160488008807	putative ligand binding site [chemical binding]; other site
160488008808	ABC-type sugar transport system, ATPase component [Carbohydrate transport and metabolism]; Region: MglA; COG1129
160488008809	First domain of the ATP-binding cassette component of monosaccharide transport system; Region: ABC_Carb_Monos_I; cd03216
160488008810	Walker A/P-loop; other site
160488008811	ATP binding site [chemical binding]; other site
160488008812	Q-loop/lid; other site
160488008813	ABC transporter signature motif; other site
160488008814	Walker B; other site
160488008815	D-loop; other site
160488008816	H-loop/switch region; other site
160488008817	Second domain of the ATP-binding cassette component of monosaccharide transport system; Region: ABC_Carb_Monos_II; cd03215
160488008818	Transmembrane subunit (TM) of Escherichia coli AraH and related proteins. E. coli AraH is the TM of a Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporter involved in the uptake of the monosaccharide arabinose. This group...; Region: TM_PBP1_transp_AraH_like; cd06579
160488008819	Branched-chain amino acid transport system / permease component; Region: BPD_transp_2; pfam02653
160488008820	TM-ABC transporter signature motif; other site
160488008821	Transmembrane subunit (TM) of Escherichia coli AraH and related proteins. E. coli AraH is the TM of a Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporter involved in the uptake of the monosaccharide arabinose. This group...; Region: TM_PBP1_transp_AraH_like; cd06579
160488008822	Branched-chain amino acid transport system / permease component; Region: BPD_transp_2; pfam02653
160488008823	TM-ABC transporter signature motif; other site
160488008824	sulfur acquisition oxidoreductase, SfnB family; Region: sulfur_SfnB; TIGR04022
160488008825	Dibenzothiophene (DBT) desulfurization enzyme C; Region: DszC; cd01163
160488008826	Flavin binding site [chemical binding]; other site
160488008827	NADPH-dependent FMN reductase; Region: FMN_red; pfam03358
160488008828	FMN reductase, MsuE subfamily; Region: FMN_reduc_MsuE; TIGR03566
160488008829	dimethyl sulfone monooxygenase SfnG; Region: LLM_DMSO2_sfnG; TIGR04021
160488008830	Alkanesulfonate monoxygenase is the monoxygenase of a two-component system that catalyzes the conversion of alkanesulfonates to the corresponding aldehyde and sulfite. Alkanesulfonate monoxygenase (SsuD) has an absolute requirement for reduced flavin...; Region: Alkanesulfonate_monoxygenase; cd01094
160488008831	active site
160488008832	dimer interface [polypeptide binding]; other site
160488008833	non-prolyl cis peptide bond; other site
160488008834	insertion regions; other site
160488008835	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
160488008836	acyl-activating enzyme (AAE) consensus motif; other site
160488008837	CoA binding site [chemical binding]; other site
160488008838	ABC-type branched-chain amino acid transport systems, ATPase component [Amino acid transport and metabolism]; Region: LivG; COG0411
160488008839	ATP-binding cassette component of branched chain amino acids transport system; Region: ABC_Mj1267_LivG_branched; cd03219
160488008840	Walker A/P-loop; other site
160488008841	ATP binding site [chemical binding]; other site
160488008842	Q-loop/lid; other site
160488008843	ABC transporter signature motif; other site
160488008844	Walker B; other site
160488008845	D-loop; other site
160488008846	H-loop/switch region; other site
160488008847	Transmembrane subunit (TM) of Escherichia coli LivH and related proteins. LivH is one of two TMs of the E. coli LIV-1/LS transporter, a Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporter involved in the uptake of...; Region: TM_PBP1_LivH_like; cd06582
160488008848	TM-ABC transporter signature motif; other site
160488008849	ABC-type branched-chain amino acid transport system, permease component [Amino acid transport and metabolism]; Region: LivM; COG4177
160488008850	Transmembrane subunit (TM) of Escherichia coli LivM and related proteins. LivM is one of two TMs of the E. coli LIV-1/LS transporter, a Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporter involved in the uptake of...; Region: TM_PBP1_LivM_like; cd06581
160488008851	TM-ABC transporter signature motif; other site
160488008852	Type I periplasmic ligand-binding domain of uncharacterized ABC (ATPase Binding Cassette)-type active transport systems that are predicted to be involved in transport of amino acids, peptides, or inorganic ions; Region: PBP1_ABC_ligand_binding_like_1; cd06334
160488008853	Periplasmic binding protein; Region: Peripla_BP_6; pfam13458
160488008854	putative ligand binding site [chemical binding]; other site
160488008855	psp operon transcriptional activator PspF; Region: phageshock_pspF; TIGR02974
160488008856	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488008857	Walker A motif; other site
160488008858	ATP binding site [chemical binding]; other site
160488008859	Walker B motif; other site
160488008860	arginine finger; other site
160488008861	sulfur acquisition oxidoreductase, SfnB family; Region: sulfur_SfnB; TIGR04022
160488008862	Dibenzothiophene (DBT) desulfurization enzyme C; Region: DszC; cd01163
160488008863	Flavin binding site [chemical binding]; other site
160488008864	Flavodoxin-like fold; Region: Flavodoxin_2; cl00438
160488008865	ABC-type polar amino acid transport system, ATPase component [Amino acid transport and metabolism]; Region: GlnQ; COG1126
160488008866	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488008867	Walker A/P-loop; other site
160488008868	ATP binding site [chemical binding]; other site
160488008869	Q-loop/lid; other site
160488008870	ABC transporter signature motif; other site
160488008871	Walker B; other site
160488008872	D-loop; other site
160488008873	H-loop/switch region; other site
160488008874	glycine betaine transporter membrane protein; Provisional; Region: PRK10952
160488008875	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488008876	dimer interface [polypeptide binding]; other site
160488008877	conserved gate region; other site
160488008878	ABC-ATPase subunit interface; other site
160488008879	Substrate binding domain of ABC-type glycine betaine transport system; Region: OpuAC; pfam04069
160488008880	ABC-type proline/glycine betaine transport systems, periplasmic components [Amino acid transport and metabolism]; Region: ProX; cl17891
160488008881	Homocysteine S-methyltransferase; Region: S-methyl_trans; pfam02574
160488008882	Homocysteine/selenocysteine methylase (S-methylmethionine-dependent) [Amino acid transport and metabolism]; Region: MHT1; COG2040
160488008883	Acyl carrier protein [Lipid metabolism / Secondary metabolites biosynthesis, transport, and catabolism]; Region: AcpP; COG0236
160488008884	3-oxoacyl-(acyl-carrier-protein) synthase [Lipid metabolism / Secondary metabolites biosynthesis, transport, and catabolism]; Region: FabB; COG0304
160488008885	Beta-ketoacyl-acyl carrier protein (ACP) synthase (KAS), type I and II. KASs are responsible for the elongation steps in fatty acid biosynthesis. KASIII catalyses the initial condensation and KAS I and II catalyze further elongation steps by Claisen...; Region: KAS_I_II; cd00834
160488008886	dimer interface [polypeptide binding]; other site
160488008887	active site
160488008888	Condensing enzymes; Family of enzymes that catalyze a (decarboxylating or non-decarboxylating) Claisen-like condensation reaction. Members are share strong structural similarity, and are involved in the synthesis and degradation of fatty acids, and the...; Region: cond_enzymes; cl09938
160488008889	active site
160488008890	3-oxoacyl-(acyl-carrier-protein) synthase [Lipid metabolism / Secondary metabolites biosynthesis, transport, and catabolism]; Region: FabB; COG0304
160488008891	Beta-ketoacyl-acyl carrier protein (ACP) synthase (KAS), type I and II. KASs are responsible for the elongation steps in fatty acid biosynthesis. KASIII catalyses the initial condensation and KAS I and II catalyze further elongation steps by Claisen...; Region: KAS_I_II; cd00834
160488008892	dimer interface [polypeptide binding]; other site
160488008893	active site
160488008894	"elongating" condensing enzymes are a subclass of decarboxylating condensing enzymes, including beta-ketoacyl [ACP] synthase, type I and II and polyketide synthases.They are characterized by the utlization of acyl carrier protein (ACP)...; Region: elong_cond_enzymes; cd00828
160488008895	active site
160488008896	Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes. PLP combines with an alpha-amino acid to form a compound called a Schiff base or aldimine intermediate, which depending on the reaction, is the...; Region: AAT_I; cl00321
160488008897	Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes. PLP combines with an alpha-amino acid to form a compound called a Schiff base or aldimine intermediate, which depending on the reaction, is the...; Region: AAT_I; cl00321
160488008898	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
160488008899	catalytic residue [active]
160488008900	Predicted dehydrogenase [General function prediction only]; Region: COG5322
160488008901	3-ketoacyl-(acyl-carrier-protein) reductase; Validated; Region: fabG; PRK05557
160488008902	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
160488008903	NAD(P) binding site [chemical binding]; other site
160488008904	active site
160488008905	3-ketoacyl-(acyl-carrier-protein) reductase; Validated; Region: fabG; PRK05653
160488008906	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
160488008907	NAD(P) binding site [chemical binding]; other site
160488008908	active site
160488008909	anti-sigma E factor; Provisional; Region: rseB; PRK09455
160488008910	Predicted exporters of the RND superfamily [General function prediction only]; Region: COG1033
160488008911	Predicted transcriptional regulators [Transcription]; Region: SoxR; COG0789
160488008912	Helix-Turn-Helix DNA binding domain of MerR2-like transcription regulators; Region: HTH_MerR2; cd04769
160488008913	DNA binding residues [nucleotide binding]
160488008914	putative dimer interface [polypeptide binding]; other site
160488008915	Putative NADPH-quinone reductase (modulator of drug activity B) [General function prediction only]; Region: MdaB; COG2249
160488008916	NADPH-dependent FMN reductase; Region: FMN_red; pfam03358
160488008917	Propionate catabolism activator; Region: PrpR_N; pfam06506
160488008918	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488008919	PAS domain; Region: PAS_9; pfam13426
160488008920	putative active site [active]
160488008921	heme pocket [chemical binding]; other site
160488008922	psp operon transcriptional activator PspF; Region: phageshock_pspF; TIGR02974
160488008923	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488008924	Walker A motif; other site
160488008925	ATP binding site [chemical binding]; other site
160488008926	Walker B motif; other site
160488008927	arginine finger; other site
160488008928	Bacterial regulatory protein, Fis family; Region: HTH_8; pfam02954
160488008929	Phosphotransferase enzyme family; Region: APH; pfam01636
160488008930	Acyl-CoA dehydrogenase (ACAD) 10 and 11, N-terminal domain, and similar proteins. This subfamily is part of a larger superfamily that includes the catalytic domains of other kinases, such as the typical serine/threonine/tyrosine protein kinases (PKs); Region: ACAD10_11_like; cd05154
160488008931	putative active site [active]
160488008932	putative substrate binding site [chemical binding]; other site
160488008933	ATP binding site [chemical binding]; other site
160488008934	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
160488008935	Acyl-CoA dehydrogenase, N-terminal domain; Region: Acyl-CoA_dh_N; pfam02771
160488008936	Acyl-CoA dehydrogenase; Region: ACAD; cd00567
160488008937	active site
160488008938	3-ketoacyl-(acyl-carrier-protein) reductase; Validated; Region: fabG; PRK05653
160488008939	classical (c) SDRs; Region: SDR_c; cd05233
160488008940	NAD(P) binding site [chemical binding]; other site
160488008941	active site
160488008942	acyl-CoA synthetase; Validated; Region: PRK08162
160488008943	Fatty acyl-CoA synthetases similar to LC-FACS from Thermus thermophiles and Arabidopsis; Region: ttLC_FACS_AEE21_like; cd12118
160488008944	acyl-activating enzyme (AAE) consensus motif; other site
160488008945	putative active site [active]
160488008946	AMP binding site [chemical binding]; other site
160488008947	putative CoA binding site [chemical binding]; other site
160488008948	Protein of unknown function, DUF485; Region: DUF485; pfam04341
160488008949	Predicted symporter [General function prediction only]; Region: DhlC; COG4147
160488008950	Uncharacterized bacterial solute carrier 5 subfamily; putative solute-binding domain; Region: SLC5sbd_u4; cd11480
160488008951	Na binding site [ion binding]; other site
160488008952	3-hydroxyisobutyrate dehydrogenase and related beta-hydroxyacid dehydrogenases [Lipid metabolism]; Region: MmsB; COG2084
160488008953	aminotransferase; Provisional; Region: PRK06105
160488008954	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
160488008955	inhibitor-cofactor binding pocket; inhibition site
160488008956	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488008957	catalytic residue [active]
160488008958	diaminobutyrate--2-oxoglutarate aminotransferase; Validated; Region: PRK09264
160488008959	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
160488008960	inhibitor-cofactor binding pocket; inhibition site
160488008961	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488008962	catalytic residue [active]
160488008963	gamma-aminobutyraldehyde dehydrogenase; Provisional; Region: PRK13473
160488008964	Escherichia coli NAD+-dependent gamma-aminobutyraldehyde dehydrogenase YdcW-like; Region: ALDH_ABALDH-YdcW; cd07092
160488008965	tetrameric interface [polypeptide binding]; other site
160488008966	NAD binding site [chemical binding]; other site
160488008967	catalytic residues [active]
160488008968	substrate binding site [chemical binding]; other site
160488008969	Amino acid transporters [Amino acid transport and metabolism]; Region: PotE; COG0531
160488008970	Alcohol dehydrogenase, class IV [Energy production and conversion]; Region: EutG; COG1454
160488008971	Dehydroquinate synthase-like (DHQ-like) and iron-containing alcohol dehydrogenases (Fe-ADH); Region: DHQ_Fe-ADH; cl02872
160488008972	active site
160488008973	NAD binding site [chemical binding]; other site
160488008974	metal binding site [ion binding]; metal-binding site
160488008975	3-oxoadipate enol-lactonase; Region: protocat_pcaD; TIGR02427
160488008976	homoserine O-acetyltransferase; Provisional; Region: metX; cl17114
160488008977	Predicted flavoprotein involved in K+ transport [Inorganic ion transport and metabolism]; Region: TrkA; COG2072
160488008978	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox_3; pfam13738
160488008979	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
160488008980	Phytanoyl-CoA dioxygenase (PhyH); Region: PhyH; pfam05721
160488008981	putative aminophosphonate oxidoreductase; Region: Phn_aa_oxid; TIGR03329
160488008982	Glycine/D-amino acid oxidases (deaminating) [Amino acid transport and metabolism]; Region: DadA; COG0665
160488008983	Protein of unknown function (DUF1329); Region: DUF1329; pfam07044
160488008984	Protein of unknown function (DUF1302); Region: DUF1302; pfam06980
160488008985	Predicted exporters of the RND superfamily [General function prediction only]; Region: COG1033
160488008986	Predicted exporters of the RND superfamily [General function prediction only]; Region: COG1033
160488008987	Uncharacterized protein related to plant photosystem II stability/assembly factor [General function prediction only]; Region: COG4447
160488008988	Phytanoyl-CoA dioxygenase (PhyH); Region: PhyH; pfam05721
160488008989	Regulator of polyketide synthase expression [Signal transduction mechanisms / Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG2508
160488008990	PucR C-terminal helix-turn-helix domain; Region: HTH_30; pfam13556
160488008991	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
160488008992	periplasmic multidrug efflux lipoprotein precursor; Reviewed; Region: PRK09578
160488008993	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
160488008994	HlyD family secretion protein; Region: HlyD_3; pfam13437
160488008995	The (Largely Gram-negative Bacterial) Hydrophobe/Amphiphile Efflux-1 (HAE1) Family; Region: 2A0602; TIGR00915
160488008996	Protein export membrane protein; Region: SecD_SecF; cl14618
160488008997	copper/silver efflux system outer membrane protein CusC; Provisional; Region: PRK09837
160488008998	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
160488008999	Winged helix-turn-helix DNA-binding; Region: HTH_24; pfam13412
160488009000	Methyl-accepting chemotaxis protein [Cell motility and secretion / Signal transduction mechanisms]; Region: Tar; COG0840
160488009001	HAMP domain; Region: HAMP; pfam00672
160488009002	dimerization interface [polypeptide binding]; other site
160488009003	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
160488009004	dimer interface [polypeptide binding]; other site
160488009005	putative CheW interface [polypeptide binding]; other site
160488009006	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
160488009007	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
160488009008	Bacterial transcriptional repressor; Region: TetR_C_6; pfam13977
160488009009	DNA breaking-rejoining enzymes, C-terminal catalytic domain. The DNA breaking-rejoining enzyme superfamily includes type IB topoisomerases and tyrosine recombinases that share the same fold in their catalytic domain containing six conserved active site...; Region: DNA_BRE_C; cl00213
160488009010	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488009011	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488009012	The C-terminal substrate binding domain of an uncharacterized LysR-type transcriptional regulator similar to DntR, which is involved in the catabolism of dinitrotoluene; contains the type 2 periplasmic binding fold; Region: PBP2_DntR_like_2; cd08464
160488009013	putative substrate binding pocket [chemical binding]; other site
160488009014	putative dimerization interface [polypeptide binding]; other site
160488009015	Medium chain dehydrogenases/reductase (MDR)/zinc-dependent alcohol dehydrogenase-like family; Region: MDR2; cd08268
160488009016	NADPH:quinone reductase and related Zn-dependent oxidoreductases [Energy production and conversion / General function prediction only]; Region: Qor; COG0604
160488009017	putative NAD(P) binding site [chemical binding]; other site
160488009018	Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes. PLP combines with an alpha-amino acid to form a compound called a Schiff base or aldimine intermediate, which depending on the reaction, is the...; Region: AAT_I; cl00321
160488009019	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
160488009020	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488009021	putative substrate translocation pore; other site
160488009022	Human rTS beta is encoded by the rTS gene which, through alternative RNA splicing, also encodes rTS alpha whose mRNA is complementary to thymidylate synthase mRNA. rTS beta expression is associated with the production of small molecules that appear to...; Region: rTSbeta_L-fuconate_dehydratase; cd03324
160488009023	L-alanine-DL-glutamate epimerase and related enzymes of enolase superfamily [Cell envelope biogenesis, outer membrane / General function prediction only]; Region: COG4948
160488009024	putative active site pocket [active]
160488009025	metal binding site [ion binding]; metal-binding site
160488009026	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488009027	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488009028	The C-terminal substrate binding domain of galactose-binding protein regulator contains the type 2 periplasmic binding fold; Region: PBP2_GbpR; cd08435
160488009029	putative dimerization interface [polypeptide binding]; other site
160488009030	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488009031	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488009032	The C-terminal substrate binding domain of galactose-binding protein regulator contains the type 2 periplasmic binding fold; Region: PBP2_GbpR; cd08435
160488009033	putative dimerization interface [polypeptide binding]; other site
160488009034	Domains similar to fish antifreeze type III protein; Region: SAF_AH_GD; cd11613
160488009035	galactarate dehydratase; Region: galactar-dH20; TIGR03248
160488009036	D-galactarate dehydratase / Altronate hydrolase, C terminus; Region: GD_AH_C; pfam04295
160488009037	Malate/L-lactate dehydrogenase; Region: Ldh_2; cl00900
160488009038	Fumarylacetoacetate (FAA) hydrolase family protein [General function prediction only]; Region: COG3970
160488009039	Fumarylacetoacetate (FAA) hydrolase family; Region: FAA_hydrolase; pfam01557
160488009040	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488009041	D-galactonate transporter; Region: 2A0114; TIGR00893
160488009042	putative substrate translocation pore; other site
160488009043	This model contains proteins with the VRR-NUC domain; Region: VRR_NUC; smart00990
160488009044	DEAD-like helicases superfamily; Region: DEXDc2; smart00488
160488009045	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cl17251
160488009046	DEAD_2; Region: DEAD_2; pfam06733
160488009047	Rad3-related DNA helicases [Transcription / DNA replication, recombination, and repair]; Region: DinG; COG1199
160488009048	Helicase C-terminal domain; Region: Helicase_C_2; pfam13307
160488009049	NnrS protein; Region: NnrS; pfam05940
160488009050	DNA breaking-rejoining enzymes, C-terminal catalytic domain. The DNA breaking-rejoining enzyme superfamily includes type IB topoisomerases and tyrosine recombinases that share the same fold in their catalytic domain containing six conserved active site...; Region: DNA_BRE_C; cl00213
160488009051	active site
160488009052	DNA binding site [nucleotide binding]
160488009053	Int/Topo IB signature motif; other site
160488009054	UreD urease accessory protein; Region: UreD; cl00530
160488009055	Urease gamma-subunit; Urease is a nickel-dependent metalloenzyme that catalyzes the hydrolysis of urea to form ammonia and carbon dioxide. Nickel-dependent ureases are found in bacteria, archaea, fungi and plants. Their primary role is to allow the use...; Region: Urease_gamma; cd00390
160488009056	alpha-gamma subunit interface [polypeptide binding]; other site
160488009057	beta-gamma subunit interface [polypeptide binding]; other site
160488009058	Urease beta-subunit; Urease is a nickel-dependent metalloenzyme that catalyzes the hydrolysis of urea to form ammonia and carbon dioxide. Nickel-dependent ureases are found in bacteria, archaea, fungi and plants. Their primary role is to allow the use of...; Region: Urease_beta; cd00407
160488009059	gamma-beta subunit interface [polypeptide binding]; other site
160488009060	alpha-beta subunit interface [polypeptide binding]; other site
160488009061	urease subunit alpha; Reviewed; Region: ureC; PRK13207
160488009062	Urease alpha-subunit; Urease is a nickel-dependent metalloenzyme that catalyzes the hydrolysis of urea to form ammonia and carbon dioxide. Nickel-dependent ureases are found in bacteria, fungi and plants. Their primary role is to allow the use of...; Region: Urease_alpha; cd00375
160488009063	subunit interactions [polypeptide binding]; other site
160488009064	active site
160488009065	flap region; other site
160488009066	urease accessory protein UreE; Provisional; Region: ureE; PRK13261
160488009067	UreE urease accessory protein. UreE is a metallochaperone assisting the insertion of a Ni2+ ion in the active site of urease, an important step in the in vivo assembly of urease, an enzyme that hydrolyses urea into ammonia and carbamic acid. The...; Region: UreE; cd00571
160488009068	dimer interface [polypeptide binding]; other site
160488009069	catalytic residues [active]
160488009070	HupE / UreJ protein; Region: HupE_UreJ; pfam04955
160488009071	Urease accessory protein UreF [Posttranslational modification, protein turnover, chaperones]; Region: UreF; COG0830
160488009072	UreF; Region: UreF; pfam01730
160488009073	Rat sarcoma (Ras)-like superfamily of small guanosine triphosphatases (GTPases); Region: Ras_like_GTPase; cd00882
160488009074	G1 box; other site
160488009075	GTP/Mg2+ binding site [chemical binding]; other site
160488009076	Switch I region; other site
160488009077	Switch II region; other site
160488009078	G4 box; other site
160488009079	G5 box; other site
160488009080	Bacterial protein of unknown function (DUF899); Region: DUF899; pfam05988
160488009081	Sulfatase; Region: Sulfatase; pfam00884
160488009082	TATA element modulatory factor 1 TATA binding; Region: TMF_TATA_bd; pfam12325
160488009083	Putative MetA-pathway of phenol degradation; Region: Phenol_MetA_deg; cl01768
160488009084	A sub-family of peptidase family C39. Peptidase family C39 mostly contains bacteriocin-processing endopeptidases from bacteria. The cysteine peptidases in family C39 cleave the "double-glycine" leader peptides from the precursors of various...; Region: Peptidase_C39G; cd02423
160488009085	putative active site [active]
160488009086	Predicted ATPase/kinase involved in NAD metabolism [Coenzyme metabolism]; Region: NadR; COG3172
160488009087	AAA domain; Region: AAA_28; pfam13521
160488009088	Nicotinamide mononucleotide transporter; Region: NMN_transporter; pfam04973
160488009089	Cache domain; Region: Cache_2; pfam08269
160488009090	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
160488009091	dimerization interface [polypeptide binding]; other site
160488009092	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
160488009093	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
160488009094	dimer interface [polypeptide binding]; other site
160488009095	putative CheW interface [polypeptide binding]; other site
160488009096	undecaprenyl pyrophosphate phosphatase; Reviewed; Region: PRK00281
160488009097	Predicted membrane protein [Function unknown]; Region: COG3326
160488009098	Uncharacterized protein conserved in bacteria [Function unknown]; Region: MmcQ; COG2315
160488009099	LysR family transcriptional regulator; Provisional; Region: PRK14997
160488009100	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488009101	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
160488009102	dimerization interface [polypeptide binding]; other site
160488009103	azoreductase; Reviewed; Region: PRK00170
160488009104	NADPH-dependent FMN reductase; Region: FMN_red; pfam03358
160488009105	NADH dehydrogenase, FAD-containing subunit [Energy production and conversion]; Region: Ndh; COG1252
160488009106	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
160488009107	DNA-binding transcriptional repressor PuuR; Provisional; Region: PRK09943
160488009108	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
160488009109	non-specific DNA binding site [nucleotide binding]; other site
160488009110	salt bridge; other site
160488009111	sequence-specific DNA binding site [nucleotide binding]; other site
160488009112	Cupin domain; Region: Cupin_2; pfam07883
160488009113	mycofactocin system FadH/OYE family oxidoreductase 2; Region: mycofact_OYE_2; TIGR03997
160488009114	Old yellow enzyme (OYE)-related FMN binding domain, group 3. Each monomer of OYE contains FMN as a non-covalently bound cofactor, uses NADPH as a reducing agent with oxygens, quinones, and alpha,beta-unsaturated aldehydes and ketones, and can act as...; Region: OYE_like_3_FMN; cd04734
160488009115	putative active site [active]
160488009116	putative FMN binding site [chemical binding]; other site
160488009117	putative substrate binding site [chemical binding]; other site
160488009118	putative catalytic residue [active]
160488009119	Bacterial extracellular solute-binding protein; Region: SBP_bac_8; pfam13416
160488009120	ABC-type Fe3+ transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: AfuA; COG1840
160488009121	aldolase II superfamily protein; Provisional; Region: PRK07044
160488009122	intersubunit interface [polypeptide binding]; other site
160488009123	active site
160488009124	Zn2+ binding site [ion binding]; other site
160488009125	O-acetylserine/cysteine export protein; Provisional; Region: PRK11453
160488009126	EamA-like transporter family; Region: EamA; pfam00892
160488009127	Uncharacterized conserved protein [Function unknown]; Region: COG0393
160488009128	beta-lactamase/D-alanine carboxypeptidase; Provisional; Region: ampC; PRK11289
160488009129	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
160488009130	Predicted Na+-dependent transporter [General function prediction only]; Region: COG0385
160488009131	SBF-like CPA transporter family (DUF4137); Region: DUF4137; pfam13593
160488009132	Domain of unknown function (DUF4157); Region: DUF4157; pfam13699
160488009133	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
160488009134	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
160488009135	classical (c) SDR, subgroup  10; Region: SDR_c10; cd05373
160488009136	3-oxoacyl-(acyl-carrier-protein) reductase; Region: 3oxo_ACP_reduc; TIGR01830
160488009137	putative NAD(P) binding site [chemical binding]; other site
160488009138	active site
160488009139	2-hydroxychromene-2-carboxylate isomerase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: NahD; COG3917
160488009140	DsbA family, 2-hydroxychromene-2-carboxylate (HCCA) isomerase subfamily; HCCA isomerase is a glutathione (GSH) dependent enzyme involved in the naphthalene catabolic pathway. It converts HCCA, a hemiketal formed spontaneously after ring cleavage of 1; Region: DsbA_HCCA_Iso; cd03022
160488009141	putative catalytic residue [active]
160488009142	DNA-binding transcriptional repressor PuuR; Provisional; Region: PRK09943
160488009143	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
160488009144	non-specific DNA binding site [nucleotide binding]; other site
160488009145	salt bridge; other site
160488009146	sequence-specific DNA binding site [nucleotide binding]; other site
160488009147	Cupin domain; Region: Cupin_2; pfam07883
160488009148	Major Facilitator Superfamily; Region: MFS_1; pfam07690
160488009149	Cytochrome B561 [Energy production and conversion]; Region: CybB; COG3038
160488009150	Catalase-like heme-binding proteins similar to the uncharacterized srpA; Region: srpA_like; cd08153
160488009151	putative heme binding pocket [chemical binding]; other site
160488009152	DNA-directed RNA polymerase specialized sigma subunit, sigma24 homolog [Transcription]; Region: RpoE; COG1595
160488009153	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
160488009154	DNA binding residues [nucleotide binding]
160488009155	Predicted transmembrane transcriptional regulator (anti-sigma factor) [Transcription]; Region: COG5662
160488009156	Escherichia coli exonuclease III (ExoIII) and Neisseria meningitides NExo-like subfamily of the ExoIII family purinic/apyrimidinic (AP) endonucleases; Region: ExoIII-like_AP-endo; cd09086
160488009157	putative catalytic site [active]
160488009158	putative phosphate binding site [ion binding]; other site
160488009159	active site
160488009160	metal binding site A [ion binding]; metal-binding site
160488009161	DNA binding site [nucleotide binding]
160488009162	putative AP binding site [nucleotide binding]; other site
160488009163	putative metal binding site B [ion binding]; other site
160488009164	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
160488009165	Coenzyme A binding pocket [chemical binding]; other site
160488009166	Outer membrane protein [Cell envelope biogenesis, outer membrane]; Region: COG0729
160488009167	Surface antigen variable number repeat; Region: Surf_Ag_VNR; pfam07244
160488009168	Surface antigen; Region: Bac_surface_Ag; pfam01103
160488009169	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2911
160488009170	Family of unknown function (DUF490); Region: DUF490; pfam04357
160488009171	Family of unknown function (DUF490); Region: DUF490; pfam04357
160488009172	Protein of unknown function (DUF2589); Region: DUF2589; pfam11655
160488009173	Protein of unknown function (DUF2589); Region: DUF2589; pfam11655
160488009174	Mor transcription activator family; Region: Mor; cl02360
160488009175	Ferric uptake regulator(Fur) and related metalloregulatory proteins; typically iron-dependent, DNA-binding repressors and activators; Region: Fur_like; cl17326
160488009176	Penicillin amidase; Region: Penicil_amidase; pfam01804
160488009177	The Ntn hydrolases (N-terminal nucleophile) are a diverse superfamily of of enzymes that are activated autocatalytically via an N-terminally lcated nucleophilic amino acid.  N-terminal nucleophile (NTN-) hydrolase superfamily, which contains a...; Region: Ntn_hydrolase; cl00467
160488009178	Cephalosporin acylase (CA) belongs to a family of beta-lactam acylases that includes penicillin G acylase (PGA) and aculeacin A acylase. PGA and CA are crucial for the production of backbone chemicals like 6-aminopenicillanic acid and...; Region: Ntn_CA; cd01936
160488009179	active site
160488009180	The Ntn hydrolases (N-terminal nucleophile) are a diverse superfamily of of enzymes that are activated autocatalytically via an N-terminally lcated nucleophilic amino acid.  N-terminal nucleophile (NTN-) hydrolase superfamily, which contains a...; Region: Ntn_hydrolase; cl00467
160488009181	Calcineurin-like phosphoesterase; Region: Metallophos; pfam00149
160488009182	Escherichia coli YbbF/LpxH and related proteins, metallophosphatase domain; Region: MPP_YbbF-LpxH; cd07398
160488009183	putative active site [active]
160488009184	putative metal binding site [ion binding]; other site
160488009185	cyclophilin_EcCYP_like: cyclophilin-type A-like peptidylprolyl cis- trans isomerase (PPIase) domain similar to the cytosolic E. coli cyclophilin A and Streptomyces antibioticus SanCyp18. Compared to the archetypal cyclophilin Human cyclophilin A, these...; Region: cyclophilin_EcCYP_like; cd01920
160488009186	substrate binding site [chemical binding]; other site
160488009187	glutaminyl-tRNA synthetase; Provisional; Region: PRK05347
160488009188	nucleotidyl transferase superfamily; Region: nt_trans; cl00015
160488009189	active site
160488009190	HIGH motif; other site
160488009191	nucleotide binding site [chemical binding]; other site
160488009192	catalytic core domain of glutaminyl-tRNA synthetase; Region: GlnRS_core; cd00807
160488009193	KMSKS motif; other site
160488009194	tRNA synthetases class I (E and Q), anti-codon binding domain; Region: tRNA-synt_1c_C; pfam03950
160488009195	cysteinyl-tRNA synthetase; Validated; Region: cysS; PRK00260
160488009196	catalytic core domain of cysteinyl tRNA synthetase; Region: CysRS_core; cd00672
160488009197	active site
160488009198	HIGH motif; other site
160488009199	catalytic core domain of cysteinyl tRNA synthetase; Region: CysRS_core; cd00672
160488009200	KMSKS motif; other site
160488009201	Anticodon-binding domain of cysteinyl tRNA synthetases; Region: Anticodon_Ia_Cys; cd07963
160488009202	tRNA binding surface [nucleotide binding]; other site
160488009203	anticodon binding site; other site
160488009204	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
160488009205	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
160488009206	dimerization interface [polypeptide binding]; other site
160488009207	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488009208	dimer interface [polypeptide binding]; other site
160488009209	phosphorylation site [posttranslational modification]
160488009210	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488009211	ATP binding site [chemical binding]; other site
160488009212	Mg2+ binding site [ion binding]; other site
160488009213	G-X-G motif; other site
160488009214	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
160488009215	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488009216	active site
160488009217	phosphorylation site [posttranslational modification]
160488009218	intermolecular recognition site; other site
160488009219	dimerization interface [polypeptide binding]; other site
160488009220	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
160488009221	DNA binding site [nucleotide binding]
160488009222	DNA-binding transcriptional regulator CsiR; Provisional; Region: PRK11534
160488009223	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488009224	DNA-binding site [nucleotide binding]; DNA binding site
160488009225	This entry represents the C-terminal ligand binding domain of many members of the GntR family; Region: FCD; smart00895
160488009226	carbon starvation induced protein; Validated; Region: PRK02963
160488009227	substrate binding pocket [chemical binding]; other site
160488009228	active site
160488009229	iron coordination sites [ion binding]; other site
160488009230	Predicted dehydrogenase [General function prediction only]; Region: COG0579
160488009231	hydroxyglutarate oxidase; Provisional; Region: PRK11728
160488009232	gamma-aminobutyrate permease; Region: GABAperm; TIGR01773
160488009233	Spore germination protein; Region: Spore_permease; cl17796
160488009234	Serine/threonine protein kinase involved in cell cycle control [Signal transduction mechanisms / Cell division and chromosome partitioning]; Region: RIO1; COG1718
160488009235	RIO kinase family; RIO1, RIO3 and similar proteins, catalytic domain. The RIO kinase catalytic domain family is part of a larger superfamily, that includes the catalytic domains of other kinases such as the typical serine/threonine/tyrosine protein...; Region: RIO1_like; cd05145
160488009236	ATP binding site [chemical binding]; other site
160488009237	Porphobilinogen synthase (PBGS), which is also called delta-aminolevulinic acid dehydratase (ALAD), catalyzes the condensation of two 5-aminolevulinic acid (ALA) molecules to form the pyrrole porphobilinogen (PBG), which is the second step in the...; Region: ALAD_PBGS; cd00384
160488009238	dimer interface [polypeptide binding]; other site
160488009239	active site
160488009240	Schiff base residues; other site
160488009241	proline/glycine betaine transporter; Provisional; Region: PRK10642
160488009242	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488009243	putative substrate translocation pore; other site
160488009244	Osmosensory transporter coiled coil; Region: Osmo_CC; pfam08946
160488009245	Protein of unknown function (DUF1275); Region: DUF1275; cl01453
160488009246	riboflavin synthase subunit alpha; Provisional; Region: PRK13020
160488009247	Lumazine binding domain; Region: Lum_binding; pfam00677
160488009248	Lumazine binding domain; Region: Lum_binding; pfam00677
160488009249	trehalose synthase, Pseudomonas stutzeri type; Region: TreS_stutzeri; TIGR02455
160488009250	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488009251	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488009252	The C-terminal substrate-binding domain of putative LysR-type transcriptional regulator PAO1-like, a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_PAO1_like; cd08412
160488009253	putative substrate binding pocket [chemical binding]; other site
160488009254	dimerization interface [polypeptide binding]; other site
160488009255	hypothetical protein; Provisional; Region: PRK12569
160488009256	Allophanate hydrolase subunit 1; Region: AHS1; smart00796
160488009257	Allophanate hydrolase subunit 1 [Amino acid transport and metabolism]; Region: DUR1; COG2049
160488009258	Allophanate hydrolase subunit 2; Region: AHS2; smart00797
160488009259	probable DNA metabolism protein; Region: SAM_7_link_chp; TIGR03915
160488009260	putative DNA modification/repair radical SAM protein; Region: rSAM_link_UDG; TIGR03916
160488009261	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
160488009262	FeS/SAM binding site; other site
160488009263	malate:quinone oxidoreductase; Validated; Region: PRK05257
160488009264	malate:quinone-oxidoreductase; Region: mal_quin_oxido; TIGR01320
160488009265	Predicted UDP-glucose 6-dehydrogenase [Cell envelope biogenesis, outer membrane]; Region: Ugd; COG1004
160488009266	NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus; Region: NAD_Gly3P_dh_N; pfam01210
160488009267	UDP-glucose/GDP-mannose dehydrogenase family, central domain; Region: UDPG_MGDP_dh; pfam00984
160488009268	UDP binding domain; Region: UDPG_MGDP_dh_C; smart00984
160488009269	Methyltransferase domain; Region: Methyltransf_31; pfam13847
160488009270	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488009271	S-adenosylmethionine binding site [chemical binding]; other site
160488009272	Saccharopine dehydrogenase and related proteins [Amino acid transport and metabolism]; Region: LYS9; COG1748
160488009273	NAD(P) binding domain of amino acid dehydrogenase-like proteins; Region: NAD_bind_amino_acid_DH; cl17226
160488009274	NAD(P) binding pocket [chemical binding]; other site
160488009275	carboxynorspermidine decarboxylase; Region: nspC; TIGR01047
160488009276	Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzyme Carboxynorspermidine Decarboxylase; Region: PLPDE_III_CANSDC; cd06829
160488009277	dimer interface [polypeptide binding]; other site
160488009278	active site
160488009279	pyridoxal 5'-phosphate (PLP) binding site [chemical binding]; other site
160488009280	catalytic residues [active]
160488009281	substrate binding site [chemical binding]; other site
160488009282	Serine dehydratase is a pyridoxal phosphate (PLP)-dependent enzyme which catalyzes the conversion of L- , D-serine, or L-threonine to pyruvate/ketobutyrate and ammonia; Region: L-Ser-dehyd; cd06448
160488009283	Pyridoxal-phosphate dependent enzyme; Region: PALP; pfam00291
160488009284	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488009285	catalytic residue [active]
160488009286	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2964
160488009287	YheO-like PAS domain; Region: PAS_6; pfam08348
160488009288	HTH domain; Region: HTH_22; pfam13309
160488009289	amidase; Validated; Region: PRK06565
160488009290	Amidase; Region: Amidase; cl11426
160488009291	Amidase; Region: Amidase; cl11426
160488009292	putative S-transferase; Provisional; Region: PRK11752
160488009293	GST_N family, Ure2p-like subfamily; composed of the Saccharomyces cerevisiae Ure2p and related GSTs. Ure2p is a regulator for nitrogen catabolism in yeast. It represses the expression of several gene products involved in the use of poor nitrogen sources...; Region: GST_N_Ure2p_like; cd03048
160488009294	C-terminal domain interface [polypeptide binding]; other site
160488009295	GSH binding site (G-site) [chemical binding]; other site
160488009296	dimer interface [polypeptide binding]; other site
160488009297	C-terminal, alpha helical domain of Escherichia coli Yghu Glutathione S-transferases and related uncharacterized proteins; Region: GST_C_YghU_like; cd10292
160488009298	dimer interface [polypeptide binding]; other site
160488009299	N-terminal domain interface [polypeptide binding]; other site
160488009300	active site
160488009301	Alpha/beta hydrolase family; Region: Abhydrolase_5; pfam12695
160488009302	major facilitator superfamily transporter; Provisional; Region: PRK05122
160488009303	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488009304	ABC transporter ATP-binding protein; Provisional; Region: PRK15064
160488009305	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
160488009306	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488009307	Walker A/P-loop; other site
160488009308	ATP binding site [chemical binding]; other site
160488009309	ABC transporter signature motif; other site
160488009310	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
160488009311	Walker B; other site
160488009312	ABC transporter; Region: ABC_tran_2; pfam12848
160488009313	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
160488009314	DNA breaking-rejoining enzymes, C-terminal catalytic domain. The DNA breaking-rejoining enzyme superfamily includes type IB topoisomerases and tyrosine recombinases that share the same fold in their catalytic domain containing six conserved active site...; Region: DNA_BRE_C; cl00213
160488009315	DNA binding site [nucleotide binding]
160488009316	active site
160488009317	Int/Topo IB signature motif; other site
160488009318	OsmC-like protein; Region: OsmC; cl00767
160488009319	Plasmid encoded toxin Txe; Region: Plasmid_Txe; pfam06769
160488009320	Antitoxin Phd_YefM, type II toxin-antitoxin system; Region: PhdYeFM_antitox; cl09153
160488009321	Uncharacterized ACR, COG2135; Region: DUF159; cl03646
160488009322	Response regulator containing a CheY-like receiver domain and an HD-GYP domain [Transcription / Signal transduction mechanisms]; Region: COG3437
160488009323	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488009324	active site
160488009325	phosphorylation site [posttranslational modification]
160488009326	intermolecular recognition site; other site
160488009327	dimerization interface [polypeptide binding]; other site
160488009328	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
160488009329	Zn2+ binding site [ion binding]; other site
160488009330	Mg2+ binding site [ion binding]; other site
160488009331	Di-haem cytochrome c peroxidase; Region: CCP_MauG; pfam03150
160488009332	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
160488009333	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488009334	ATP binding site [chemical binding]; other site
160488009335	Mg2+ binding site [ion binding]; other site
160488009336	G-X-G motif; other site
160488009337	FOG: CheY-like receiver [Signal transduction mechanisms]; Region: CheY; COG0784
160488009338	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488009339	active site
160488009340	phosphorylation site [posttranslational modification]
160488009341	intermolecular recognition site; other site
160488009342	dimerization interface [polypeptide binding]; other site
160488009343	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cl00080
160488009344	dimer interface [polypeptide binding]; other site
160488009345	phosphorylation site [posttranslational modification]
160488009346	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488009347	ATP binding site [chemical binding]; other site
160488009348	Mg2+ binding site [ion binding]; other site
160488009349	G-X-G motif; other site
160488009350	hypothetical protein; Provisional; Region: PRK09256
160488009351	Protein chain release factor B [Translation, ribosomal structure and biogenesis]; Region: PrfB; COG1186
160488009352	Transcriptional regulators containing a DNA-binding HTH domain and an aminotransferase domain (MocR family) and their eukaryotic orthologs [Transcription / Amino acid transport and metabolism]; Region: ARO8; COG1167
160488009353	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488009354	DNA-binding site [nucleotide binding]; DNA binding site
160488009355	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
160488009356	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488009357	homodimer interface [polypeptide binding]; other site
160488009358	catalytic residue [active]
160488009359	Permeases of the drug/metabolite transporter (DMT) superfamily [Carbohydrate transport and metabolism / Amino acid transport and metabolism / General function prediction only]; Region: RhaT; COG0697
160488009360	EamA-like transporter family; Region: EamA; pfam00892
160488009361	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3558
160488009362	Nuclear transport factor 2 (NTF2-like) superfamily. This family includes members of the NTF2 family, Delta-5-3-ketosteroid isomerases, Scytalone Dehydratases, and the beta subunit of Ring hydroxylating dioxygenases. This family is a classic example of...; Region: NTF2_like; cl09109
160488009363	putative transcriptional regulator; Provisional; Region: PRK11640
160488009364	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
160488009365	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488009366	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488009367	The C-terminal substrate binding domain of LysR-type transcriptional regulator CrgA and its related homologs, contains the type 2 periplasmic binding domain; Region: PBP2_CrgA_like; cd08422
160488009368	putative effector binding pocket; other site
160488009369	dimerization interface [polypeptide binding]; other site
160488009370	Arginate lyase and other MDR family members; Region: AL_MDR; cd08252
160488009371	zinc-binding alcohol dehydrogenase family protein; Region: adh_fam_1; TIGR02817
160488009372	putative NAD(P) binding site [chemical binding]; other site
160488009373	dimer interface [polypeptide binding]; other site
160488009374	Uncharacterized conserved protein [Function unknown]; Region: COG1359
160488009375	CorA-like Mg2+ transporter protein; Region: CorA; pfam01544
160488009376	uncharacterized bacterial subfamily of the Escherichia coli CorA-Salmonella typhimurium ZntB family; Region: EcCorA_ZntB-like_u2; cd12827
160488009377	Cl binding site [ion binding]; other site
160488009378	oligomer interface [polypeptide binding]; other site
160488009379	RimK-like ATPgrasp N-terminal domain; Region: RLAN; pfam14401
160488009380	Glutathione synthase/Ribosomal protein S6 modification enzyme (glutaminyl transferase) [Coenzyme metabolism / Translation, ribosomal structure and biogenesis]; Region: RimK; COG0189
160488009381	ATP-grasp domain; Region: ATP-grasp_4; cl17255
160488009382	Acetyltransferases [General function prediction only]; Region: RimI; COG0456
160488009383	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
160488009384	Coenzyme A binding pocket [chemical binding]; other site
160488009385	Peptidase_C39 like family; Region: DUF3335; pfam11814
160488009386	Glutaredoxin (GRX) family, GRX bacterial class 1 and 3 (b_1_3)-like subfamily; composed of bacterial GRXs, approximately 10 kDa in size, and proteins containing a GRX or GRX-like domain. GRX is a glutathione (GSH) dependent reductase, catalyzing the...; Region: GRX_GRXb_1_3_like; cd03418
160488009387	GSH binding site [chemical binding]; other site
160488009388	catalytic residues [active]
160488009389	Carboxymuconolactone decarboxylase family; Region: CMD; pfam02627
160488009390	Cupin; Region: Cupin_6; pfam12852
160488009391	AraC-type DNA-binding domain-containing proteins [Transcription]; Region: AraC; COG2207
160488009392	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488009393	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488009394	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488009395	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488009396	The C-terminal substrate binding domain of LysR-type transcriptional regulator CrgA and its related homologs, contains the type 2 periplasmic binding domain; Region: PBP2_CrgA_like; cd08422
160488009397	putative effector binding pocket; other site
160488009398	dimerization interface [polypeptide binding]; other site
160488009399	Medium chain dehydrogenases/reductase (MDR)/zinc-dependent alcohol dehydrogenase-like family; Region: MDR6; cd08272
160488009400	NADPH:quinone reductase and related Zn-dependent oxidoreductases [Energy production and conversion / General function prediction only]; Region: Qor; COG0604
160488009401	putative NAD(P) binding site [chemical binding]; other site
160488009402	Domain of unknown function (DUF4158); Region: DUF4158; pfam13700
160488009403	Tn3 transposase DDE domain; Region: DDE_Tnp_Tn3; pfam01526
160488009404	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
160488009405	SNARE associated Golgi protein; Region: SNARE_assoc; cl00429
160488009406	High-affinity nickel-transport protein; Region: NicO; cl00964
160488009407	High-affinity nickel-transport protein; Region: NicO; cl00964
160488009408	Alcaligenes xylosoxidans NreA and related domains; this domain family was previously known as part of DUF156; Region: NreA-like_DUF156; cd10154
160488009409	putative homodimer interface [polypeptide binding]; other site
160488009410	putative homotetramer interface [polypeptide binding]; other site
160488009411	putative metal binding site [ion binding]; other site
160488009412	putative homodimer-homodimer interface [polypeptide binding]; other site
160488009413	putative allosteric switch controlling residues; other site
160488009414	Transposase domain (DUF772); Region: DUF772; pfam05598
160488009415	Transposase and inactivated derivatives, IS5 family [DNA replication, recombination, and repair]; Region: COG3039
160488009416	DDE superfamily endonuclease; Region: DDE_4; cl17710
160488009417	Diacylglycerol kinase [Cell envelope biogenesis, outer membrane]; Region: DgkA; COG0818
160488009418	Phosphoglycerol transferase and related proteins, alkaline phosphatase superfamily [Cell envelope biogenesis, outer membrane]; Region: MdoB; COG1368
160488009419	Sulfatase; Region: Sulfatase; pfam00884
160488009420	Transposase; Region: HTH_Tnp_1; pfam01527
160488009421	HTH-like domain; Region: HTH_21; pfam13276
160488009422	Integrase core domain; Region: rve; pfam00665
160488009423	Integrase core domain; Region: rve_3; pfam13683
160488009424	Putative ATP-dependant zinc protease; Region: Zn_protease; cl01682
160488009425	Uncharacterized conserved protein [Function unknown]; Region: COG3339
160488009426	Cre recombinase, C-terminal catalytic domain. Cre-like recombinases belong to the superfamily of DNA breaking-rejoining enzymes, which share the same fold in their catalytic domain and the overall reaction mechanism. The bacteriophage P1 Cre...; Region: INT_Cre; cd00799
160488009427	DNA binding site [nucleotide binding]
160488009428	dimer interface [polypeptide binding]; other site
160488009429	active site
160488009430	Int/Topo IB signature motif; other site
160488009431	Plasmid replication region DNA-binding N-term; Region: KfrA_N; pfam11740
160488009432	Uncharacterized protein family (UPF0157); Region: UPF0157; pfam04229
160488009433	hopanoid-associated sugar epimerase; Region: HpnA; TIGR03466
160488009434	uncharacterized subgroup of aldehyde reductase and flavonoid reductase related proteins, extended (e) SDRs; Region: AR_FR_like_1_SDR_e; cd05228
160488009435	putative NADP binding site [chemical binding]; other site
160488009436	putative substrate binding site [chemical binding]; other site
160488009437	active site
160488009438	Predicted transcriptional regulators [Transcription]; Region: COG1733
160488009439	HxlR-like helix-turn-helix; Region: HxlR; pfam01638
160488009440	NADPH:quinone reductase and related Zn-dependent oxidoreductases [Energy production and conversion / General function prediction only]; Region: Qor; COG0604
160488009441	alcohol dehydrogenase and quinone reductase-like medium chain degydrogenases/reductases; Region: MDR_like_2; cd05289
160488009442	putative NAD(P) binding site [chemical binding]; other site
160488009443	Short-chain dehydrogenases of various substrate specificities [General function prediction only]; Region: DltE; COG0300
160488009444	classical (c) SDRs; Region: SDR_c; cd05233
160488009445	NAD(P) binding site [chemical binding]; other site
160488009446	active site
160488009447	Helix-Turn-Helix DNA binding domain of putative transcription regulators from the MerR superfamily; Region: HTH_MerR-like_sg7; cd04786
160488009448	Predicted transcriptional regulators [Transcription]; Region: SoxR; COG0789
160488009449	DNA binding residues [nucleotide binding]
160488009450	putative dimer interface [polypeptide binding]; other site
160488009451	Type 1 glutamine amidotransferase (GATase1)-like domain found in proteins similar to Escherichia coli Hsp31 protein; Region: GATase1_Hsp31_like; cd03141
160488009452	Putative intracellular protease/amidase [General function prediction only]; Region: ThiJ; COG0693
160488009453	potential catalytic triad [active]
160488009454	conserved cys residue [active]
160488009455	NADH:flavin oxidoreductases, Old Yellow Enzyme family [Energy production and conversion]; Region: NemA; COG1902
160488009456	Old yellow enzyme (OYE)-related FMN binding domain, group 2.  Each monomer of OYE contains FMN as a non-covalently bound cofactor, uses NADPH as a reducing agent with oxygens, quinones, and alpha,beta-unsaturated aldehydes and ketones, and can act as...; Region: OYE_like_2_FMN; cd04733
160488009457	putative active site [active]
160488009458	putative FMN binding site [chemical binding]; other site
160488009459	putative substrate binding site [chemical binding]; other site
160488009460	putative catalytic residue [active]
160488009461	topology modulation protein; Reviewed; Region: PRK08118
160488009462	AAA domain; Region: AAA_17; pfam13207
160488009463	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488009464	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488009465	The C-terminal substrate binding domain of LysR-type transcriptional regulators that are involved in the catabolism of dinitrotoluene, naphthalene and gamma-hexachlorohexane; contains the type 2 periplasmic binding fold; Region: PBP2_DntR_NahR_LinR_like; cd08459
160488009466	substrate binding pocket [chemical binding]; other site
160488009467	dimerization interface [polypeptide binding]; other site
160488009468	2-dehydropantoate 2-reductase; Reviewed; Region: PRK06522
160488009469	Ketopantoate reductase PanE/ApbA; Region: ApbA; pfam02558
160488009470	Ketopantoate reductase PanE/ApbA C terminal; Region: ApbA_C; pfam08546
160488009471	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
160488009472	This domain superfamily is found in a variety of structurally related metalloproteins, including the type I extradiol dioxygenases, glyoxalase I and a group of antibiotic resistance proteins; Region: Glo_EDI_BRP_like; cd06587
160488009473	active site
160488009474	metal binding site [ion binding]; metal-binding site
160488009475	(R)-hydratase [(R)-specific enoyl-CoA hydratase]. Catalyzes the hydration of trans-2-enoyl CoA to (R)-3-hydroxyacyl-CoA as part of the PHA (polyhydroxyalkanoate) biosynthetic pathway.  The structure of the monomer includes a five-strand antiparallel...; Region: R_hydratase_like; cd03441
160488009476	active site
160488009477	catalytic site [active]
160488009478	Predicted acyl-CoA transferases/carnitine dehydratase [Energy production and conversion]; Region: CaiB; COG1804
160488009479	CoA-transferase family III; Region: CoA_transf_3; pfam02515
160488009480	shikimate 5-dehydrogenase; Reviewed; Region: aroE; PRK00258
160488009481	Shikimate dehydrogenase substrate binding domain; Region: Shikimate_dh_N; pfam08501
160488009482	NAD(P) binding domain of Shikimate dehydrogenase; Region: NAD_bind_Shikimate_DH; cd01065
160488009483	shikimate binding site; other site
160488009484	NAD(P) binding site [chemical binding]; other site
160488009485	Dehydroquinase (DHQase), type II. Dehydroquinase (or 3-dehydroquinate dehydratase) catalyzes the reversible dehydration of 3-dehydroquinate to form 3-dehydroshikimate. This reaction is part of two metabolic pathways: the biosynthetic shikimate pathway...; Region: DHQase_II; cd00466
160488009486	Dehydroquinase class II; Region: DHquinase_II; pfam01220
160488009487	trimer interface [polypeptide binding]; other site
160488009488	active site
160488009489	dimer interface [polypeptide binding]; other site
160488009490	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG5343
160488009491	Anti-sigma-K factor rskA; Region: RskA; pfam10099
160488009492	RNA polymerase sigma factor; Provisional; Region: PRK12537
160488009493	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
160488009494	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
160488009495	DNA binding residues [nucleotide binding]
160488009496	Protein of unknown function (DUF3455); Region: DUF3455; pfam11937
160488009497	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
160488009498	lipopolysaccharide core biosynthesis protein; Provisional; Region: PRK09822
160488009499	methylated-DNA--protein-cysteine methyltransferase; Provisional; Region: PRK00901
160488009500	The DNA repair protein O6-alkylguanine-DNA alkyltransferase (ATase; also known as AGT, AGAT and MGMT) reverses O6-alkylation DNA damage by transferring O6-alkyl adducts to an active site cysteine irreversibly, without inducing DNA strand breaks. ATases...; Region: ATase; cd06445
160488009501	DNA binding site [nucleotide binding]
160488009502	active site
160488009503	Predicted amidohydrolase [General function prediction only]; Region: COG0388
160488009504	Nitrilase superfamily, including nitrile- or amide-hydrolyzing enzymes and amide-condensing enzymes; Region: nitrilase; cd07197
160488009505	active site
160488009506	catalytic triad [active]
160488009507	dimer interface [polypeptide binding]; other site
160488009508	PrpA and PrpB, metallophosphatase domain; Region: MPP_PrpA_PrpB; cd07424
160488009509	Calcineurin-like phosphoesterase; Region: Metallophos; pfam00149
160488009510	active site
160488009511	metal binding site [ion binding]; metal-binding site
160488009512	Putative threonine efflux protein [Amino acid transport and metabolism]; Region: RhtB; COG1280
160488009513	AraC-like ligand binding domain; Region: AraC_binding; pfam02311
160488009514	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488009515	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
160488009516	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488009517	Putative threonine efflux protein [Amino acid transport and metabolism]; Region: RhtB; COG1280
160488009518	Putative threonine efflux protein [Amino acid transport and metabolism]; Region: RhtB; COG1280
160488009519	Serine Recombinase family, catalytic domain; a DNA binding domain may be present either N- or C-terminal to the catalytic domain. These enzymes perform site-specific recombination of DNA molecules by a concerted, four-strand cleavage and rejoining...; Region: Ser_Recombinase; cd00338
160488009520	catalytic residues [active]
160488009521	catalytic nucleophile [active]
160488009522	Recombinase zinc beta ribbon domain; Region: Zn_ribbon_recom; pfam13408
160488009523	Site-specific DNA methylase [DNA replication, recombination, and repair]; Region: Dcm; COG0270
160488009524	Cytosine-C5 specific DNA methylases; Methyl transfer reactions play an important role in many aspects of biology. Cytosine-specific DNA methylases are found both in prokaryotes and eukaryotes. DNA methylation, or the covalent addition of a methyl group...; Region: Cyt_C5_DNA_methylase; cd00315
160488009525	cofactor binding site; other site
160488009526	DNA binding site [nucleotide binding]
160488009527	substrate interaction site [chemical binding]; other site
160488009528	Pyocin activator protein PrtN; Region: PyocinActivator; pfam11112
160488009529	PYOCIN01; bacteriocin; Pyocin R2-like; Former prophage region PHAGE02 bearing better BLASTP matches to Pyocin R2 from Pseudomonas aeruginosa and having gene order more conserved with the pyocin than bacteriophage P2
160488009530	Phage antirepressor protein KilAC domain; Region: ANT; cl01462
160488009531	Peptidase S24 LexA-like proteins are involved in the SOS response leading to the repair of single-stranded DNA within the bacterial cell. This family includes: the lambda repressor CI/C2 family and related bacterial prophage repressor proteins; LexA (EC...; Region: S24_LexA-like; cd06529
160488009532	Catalytic site [active]
160488009533	DksA-like zinc finger domain containing protein; Region: PHA00080
160488009534	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4643
160488009535	TOPRIM_primases: The topoisomerase-primase (TORPIM) nucleotidyl transferase/hydrolase domain found in the active site regions of bacterial DnaG-type primases and their homologs. Primases synthesize RNA primers for the initiation of DNA replication. DnaG...; Region: TOPRIM_primases; cd01029
160488009536	active site
160488009537	metal binding site [ion binding]; metal-binding site
160488009538	interdomain interaction site; other site
160488009539	Virulence-associated protein E; Region: VirE; pfam05272
160488009540	Phage terminase large subunit (GpA); Region: Terminase_GpA; pfam05876
160488009541	phage portal protein, lambda family; Region: portal_lambda; TIGR01539
160488009542	Phage portal protein, lambda family; Region: Phage_portal_2; pfam05136
160488009543	ATP-dependent Clp protease proteolytic subunit; Reviewed; Region: PRK12553
160488009544	Caseinolytic protease (ClpP) is an ATP-dependent, highly conserved serine protease; Region: S14_ClpP_1; cd07016
160488009545	oligomer interface [polypeptide binding]; other site
160488009546	active site residues [active]
160488009547	Bacteriophage lambda head decoration protein D; Region: HDPD; pfam02924
160488009548	Phage major capsid protein E; Region: Phage_cap_E; pfam03864
160488009549	ATP-binding sugar transporter from pro-phage; Region: Gifsy-2; cl05094
160488009550	phage baseplate assembly protein V; Region: phage_P2_V; TIGR01644
160488009551	Phage P2 baseplate assembly protein gpV [General function prediction only]; Region: gpV; COG4540
160488009552	Phage baseplate assembly protein W [General function prediction only]; Region: COG3628
160488009553	Baseplate J-like protein; Region: Baseplate_J; cl01294
160488009554	Phage tail protein (Tail_P2_I); Region: Tail_P2_I; pfam09684
160488009555	Phage tail-collar fibre protein; Region: DUF3751; pfam12571
160488009556	Phage tail sheath protein FI [General function prediction only]; Region: COG3497
160488009557	Phage tail tube protein FII; Region: Phage_tube; pfam04985
160488009558	Mu-like prophage FluMu protein gp41; Region: FluMu_gp41; pfam10109
160488009559	Phage-related minor tail protein; Region: PhageMin_Tail; pfam10145
160488009560	Phage P2 GpU; Region: Phage_P2_GpU; pfam06995
160488009561	Phage Tail Protein X; Region: Phage_tail_X; cl02088
160488009562	Phage late control gene D protein (GPD); Region: Phage_GPD; cl15796
160488009563	Predicted chitinase [General function prediction only]; Region: COG3179
160488009564	catalytic residue [active]
160488009565	Pertactin-like passenger domains (virulence factors), C-terminal, subgroup 2, of autotransporter proteins of the type V secretion system of Gram-negative bacteria. This subgroup includes the passenger domains of the nonprotease autotransporters, Ag43; Region: PL2_Passenger_AT; cd01344
160488009566	outer membrane autotransporter barrel domain; Region: autotrans_barl; TIGR01414
160488009567	Autotransporter beta-domain; Region: Autotransporter; smart00869
160488009568	PPIC-type PPIASE domain; Region: Rotamase_2; cl08278
160488009569	acetoacetyl-CoA synthetase; Provisional; Region: PRK03584
160488009570	Acetoacetyl-CoA synthetase (acetoacetate-CoA ligase, AACS); Region: AACS; cd05943
160488009571	acyl-activating enzyme (AAE) consensus motif; other site
160488009572	putative AMP binding site [chemical binding]; other site
160488009573	putative active site [active]
160488009574	putative CoA binding site [chemical binding]; other site
160488009575	ecotin; Provisional; Region: PRK03719
160488009576	secondary substrate binding site; other site
160488009577	primary substrate binding site; other site
160488009578	inhibition loop; other site
160488009579	dimerization interface [polypeptide binding]; other site
160488009580	3-hydroxybutyrate dehydrogenase; Provisional; Region: PRK12429
160488009581	d-3-hydroxybutyrate dehydrogenase (HBDH), classical (c) SDRs; Region: HBDH_SDR_c; cd08940
160488009582	NAD binding site [chemical binding]; other site
160488009583	homotetramer interface [polypeptide binding]; other site
160488009584	homodimer interface [polypeptide binding]; other site
160488009585	substrate binding site [chemical binding]; other site
160488009586	active site
160488009587	H+/gluconate symporter and related permeases [Carbohydrate transport and metabolism / Amino acid transport and metabolism]; Region: GntT; COG2610
160488009588	nitrogen regulation protein NR(I); Region: ntrC; TIGR01818
160488009589	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488009590	Walker B motif; other site
160488009591	arginine finger; other site
160488009592	Bacterial regulatory protein, Fis family; Region: HTH_8; pfam02954
160488009593	ABC-type uncharacterized transport system, permease component [General function prediction only]; Region: COG4239
160488009594	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488009595	dimer interface [polypeptide binding]; other site
160488009596	conserved gate region; other site
160488009597	putative PBP binding loops; other site
160488009598	ABC-ATPase subunit interface; other site
160488009599	ABC-type uncharacterized transport system, permease component [General function prediction only]; Region: COG4174
160488009600	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488009601	dimer interface [polypeptide binding]; other site
160488009602	conserved gate region; other site
160488009603	putative PBP binding loops; other site
160488009604	ABC-ATPase subunit interface; other site
160488009605	ABC-type oligopeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: OppA; COG4166
160488009606	The substrate-binding component of an uncharacterized ABC-type nickel/dipeptide/oligopeptide-like import system contains the type 2 periplasmic binding fold; Region: PBP2_NikA_DppA_OppA_like_14; cd08497
160488009607	PPIC-type PPIASE domain; Region: Rotamase_2; cl08278
160488009608	phospho-2-dehydro-3-deoxyheptonate aldolase; Provisional; Region: PRK12755
160488009609	DAHP synthetase I family; Region: DAHP_synth_1; pfam00793
160488009610	PhosphatidylEthanolamine-Binding Protein (PEBP) domain present in bacteria and archaea; Region: PEBP_bact_arch; cd00865
160488009611	substrate binding site [chemical binding]; other site
160488009612	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488009613	Major Facilitator Superfamily; Region: MFS_1; pfam07690
160488009614	putative substrate translocation pore; other site
160488009615	Predicted permeases [General function prediction only]; Region: COG0679
160488009616	Secretin and TonB N terminus short domain; Region: STN; smart00965
160488009617	TonB-dependent siderophore receptor; Region: TonB-siderophor; TIGR01783
160488009618	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
160488009619	N-terminal plug; other site
160488009620	ligand-binding site [chemical binding]; other site
160488009621	fec operon regulator FecR; Reviewed; Region: PRK09774
160488009622	FecR protein; Region: FecR; pfam04773
160488009623	RNA polymerase sigma factor; Provisional; Region: PRK12528
160488009624	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
160488009625	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
160488009626	DNA binding residues [nucleotide binding]
160488009627	Excinuclease ATPase subunit [DNA replication, recombination, and repair]; Region: UvrA; COG0178
160488009628	ATP-binding cassette domain I of the excision repair protein UvrA; Region: ABC_UvrA_I; cd03270
160488009629	ATP-binding cassette domain I of the excision repair protein UvrA; Region: ABC_UvrA_I; cd03270
160488009630	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488009631	Walker A/P-loop; other site
160488009632	ATP binding site [chemical binding]; other site
160488009633	Q-loop/lid; other site
160488009634	ABC transporter signature motif; other site
160488009635	Walker B; other site
160488009636	D-loop; other site
160488009637	H-loop/switch region; other site
160488009638	type VI secretion-associated protein, ImpA family; Region: VI_chp_8; TIGR03363
160488009639	ImpA-related N-terminal; Region: ImpA-rel_N; pfam06812
160488009640	Protein of unknown function (DUF796); Region: DUF796; pfam05638
160488009641	ImcF-related N-terminal domain; Region: ImcF-related_N; pfam14331
160488009642	Intracellular multiplication and human macrophage-killing; Region: IcmF-related; pfam06761
160488009643	Peptidoglycan binding domains similar to the C-terminal domain of outer-membrane protein OmpA; Region: OmpA_C-like; cd07185
160488009644	ligand binding site [chemical binding]; other site
160488009645	ImcF-related N-terminal domain; Region: ImcF-related_N; pfam14331
160488009646	Intracellular multiplication and human macrophage-killing; Region: IcmF-related; pfam06761
160488009647	Protein of unknown function (DUF1215); Region: DUF1215; pfam06744
160488009648	type IV / VI secretion system protein, DotU family; Region: IV_VI_DotU; TIGR03349
160488009649	type VI secretion protein, VC_A0114 family; Region: VI_chp_4; TIGR03353
160488009650	Bacterial protein of unknown function (DUF876); Region: DUF876; pfam05936
160488009651	type VI secretion lipoprotein, VC_A0113 family; Region: VI_chp_3; TIGR03352
160488009652	type VI secretion ATPase, ClpV1 family; Region: VI_ClpV1; TIGR03345
160488009653	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488009654	Walker A motif; other site
160488009655	ATP binding site [chemical binding]; other site
160488009656	Walker B motif; other site
160488009657	arginine finger; other site
160488009658	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488009659	Walker A motif; other site
160488009660	ATP binding site [chemical binding]; other site
160488009661	Walker B motif; other site
160488009662	C-terminal, D2-small domain, of ClpB protein; Region: ClpB_D2-small; smart01086
160488009663	type VI secretion protein, VC_A0111 family; Region: VI_chp_1; TIGR03347
160488009664	Type VI protein secretion system component VasA [Intracellular trafficking, secretion, and    vesicular transport]; Region: COG3519
160488009665	type VI secretion protein, VC_A0110 family; Region: VI_chp_6; TIGR03359
160488009666	type VI secretion system lysozyme-like protein; Region: VI_zyme; TIGR03357
160488009667	Predicted component of the type VI protein secretion system [Intracellular trafficking, secretion, and    vesicular transport]; Region: COG3517; cl05484
160488009668	Protein of unknown function (DUF877); Region: DUF877; pfam05943
160488009669	Protein of unknown function (DUF770); Region: DUF770; pfam05591
160488009670	ADP-ribosylglycohydrolase; Region: ADP_ribosyl_GH; pfam03747
160488009671	type VI secretion system Vgr family protein; Region: VI_Rhs_Vgr; TIGR03361
160488009672	Phage late control gene D protein (GPD); Region: Phage_GPD; pfam05954
160488009673	Phage-related baseplate assembly protein; Region: Phage_base_V; pfam04717
160488009674	Gp5 C-terminal repeat (3 copies); Region: Gp5_C; pfam06715
160488009675	Uncharacterized protein conserved in bacteria (DUF2345); Region: DUF2345; cl01733
160488009676	Domain of unknown function (DUF1795); Region: DUF1795; pfam08786
160488009677	PAAR motif; Region: PAAR_motif; pfam05488
160488009678	Rhs family protein [Cell envelope biogenesis, outer membrane]; Region: RhsA; COG3209
160488009679	YD repeat (two copies); Region: YD_repeat_2x; TIGR01643
160488009680	RHS Repeat; Region: RHS_repeat; cl11982
160488009681	RHS Repeat; Region: RHS_repeat; pfam05593
160488009682	RHS protein; Region: RHS; pfam03527
160488009683	RHS repeat-associated core domain; Region: Rhs_assc_core; TIGR03696
160488009684	RHS protein; Region: RHS; pfam03527
160488009685	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
160488009686	Predicted phosphatase/phosphohexomutase [General function prediction only]; Region: COG0637
160488009687	motif II; other site
160488009688	IS66 Orf2 like protein; Region: TnpB_IS66; pfam05717
160488009689	Transposase C of IS166 homeodomain; Region: LZ_Tnp_IS66; pfam13007
160488009690	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3436
160488009691	putative Helix-turn-helix domain of transposase IS66; Region: HTH_Tnp_IS66; pfam13005
160488009692	Transposase IS66 family; Region: DDE_Tnp_IS66; pfam03050
160488009693	IS66 C-terminal element; Region: DDE_Tnp_IS66_C; pfam13817
160488009694	lipopolysaccharide core biosynthesis protein; Provisional; Region: PRK09822
160488009695	LexA repressor; Provisional; Region: PRK12423
160488009696	LexA DNA binding domain; Region: LexA_DNA_bind; pfam01726
160488009697	Peptidase S24 LexA-like proteins are involved in the SOS response leading to the repair of single-stranded DNA within the bacterial cell. This family includes: the lambda repressor CI/C2 family and related bacterial prophage repressor proteins; LexA (EC...; Region: S24_LexA-like; cd06529
160488009698	Catalytic site [active]
160488009699	Uncharacterized conserved protein [Function unknown]; Region: COG4544
160488009700	DNA Polymerase Y-family; Region: PolY_like; cd03468
160488009701	active site
160488009702	Nucleotidyltransferase/DNA polymerase involved in DNA repair [DNA replication, recombination, and repair]; Region: DinP; COG0389
160488009703	DNA binding site [nucleotide binding]
160488009704	error-prone DNA polymerase; Validated; Region: dnaE2; PRK05672
160488009705	Polymerase and Histidinol Phosphatase domain of alpha-subunit of bacterial polymerase III at DnaE2 gene; Region: PHP_PolIIIA_DnaE2; cd07434
160488009706	putative active site [active]
160488009707	putative PHP Thumb interface [polypeptide binding]; other site
160488009708	DnaE_OBF: A subfamily of OB folds corresponding to the C-terminal OB-fold nucleic acid binding domain of Thermus aquaticus and Escherichia coli type C replicative DNA polymerase III alpha subunit (DnaE). The DNA polymerase holoenzyme of E. coli contains...; Region: DnaE_OBF; cd04485
160488009709	generic binding surface I; other site
160488009710	generic binding surface II; other site
160488009711	Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248
160488009712	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660
160488009713	active site
160488009714	catalytic tetrad [active]
160488009715	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488009716	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488009717	TThe C-terminal substrate binding domain of an uncharacterized LysR-type transcriptional regulator, contains the type 2 periplasmic binding fold; Region: PBP2_LTTR_like_4; cd08440
160488009718	putative dimerization interface [polypeptide binding]; other site
160488009719	Acyl CoA:acetate/3-ketoacid CoA transferase, alpha subunit [Lipid metabolism]; Region: AtoD; COG1788
160488009720	3-oxoacid CoA-transferase, B subunit; Region: pcaJ_scoB_fam; TIGR02428
160488009721	Short chain fatty acids transporter [Lipid metabolism]; Region: AtoE; COG2031
160488009722	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
160488009723	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
160488009724	non-specific DNA binding site [nucleotide binding]; other site
160488009725	salt bridge; other site
160488009726	sequence-specific DNA binding site [nucleotide binding]; other site
160488009727	Cupin domain; Region: Cupin_2; pfam07883
160488009728	Polysaccharide biosynthesis/export protein; Region: Poly_export; pfam02563
160488009729	putative polysaccharide export protein, PEP-CTERM sytem-associated; Region: pepcterm_export; TIGR03027
160488009730	Chain length determinant protein; Region: Wzz; cl15801
160488009731	polysaccharide chain length determinant protein, PEP-CTERM locus subfamily; Region: pepcterm_ChnLen; TIGR03007
160488009732	exopolysaccharide/PEP-CTERM locus tyrosine autokinase; Region: pepcterm_TyrKin; TIGR03018
160488009733	UDP-glucose 4-epimerase [Cell envelope biogenesis, outer membrane]; Region: GalE; COG1087
160488009734	UDP-glucose 4 epimerase, subgroup 1, extended (e) SDRs; Region: UDP_G4E_1_SDR_e; cd05247
160488009735	NAD binding site [chemical binding]; other site
160488009736	homodimer interface [polypeptide binding]; other site
160488009737	active site
160488009738	substrate binding site [chemical binding]; other site
160488009739	Multidrug and toxic compound extrusion family and similar proteins; Region: MATE_like; cl09326
160488009740	Membrane protein involved in the export of O-antigen and teichoic acid [General function prediction only]; Region: RfbX; COG2244
160488009741	Choline dehydrogenase and related flavoproteins [Amino acid transport and metabolism]; Region: BetA; COG2303
160488009742	GMC oxidoreductase; Region: GMC_oxred_C; pfam05199
160488009743	Maltose O-acyltransferase (MAT)-like: This family is composed of maltose O-acetyltransferase, galactoside O-acetyltransferase (GAT), xenobiotic acyltransferase (XAT) and similar proteins. MAT and GAT catalyze the CoA-dependent acetylation of the...; Region: LbH_MAT_like; cd04647
160488009744	Acetyltransferase (isoleucine patch superfamily) [General function prediction only]; Region: WbbJ; COG0110
160488009745	trimer interface [polypeptide binding]; other site
160488009746	active site
160488009747	substrate binding site [chemical binding]; other site
160488009748	CoA binding site [chemical binding]; other site
160488009749	Subfamily of Glycosyltransferase Family GT2 of unknown function; Region: GT_2_like_c; cd04186
160488009750	Predicted glycosyltransferases [General function prediction only]; Region: COG1216
160488009751	Probable Catalytic site; other site
160488009752	metal-binding site
160488009753	Serine acetyltransferase [Amino acid transport and metabolism]; Region: CysE; COG1045
160488009754	Serine acetyltransferase (SAT): SAT catalyzes the CoA-dependent acetylation of the side chain hydroxyl group of L-serine to form O-acetylserine, as the first step of a two-step biosynthetic pathway in bacteria and plants leading to the formation of...; Region: LbH_SAT; cd03354
160488009755	trimer interface [polypeptide binding]; other site
160488009756	active site
160488009757	substrate binding site [chemical binding]; other site
160488009758	CoA binding site [chemical binding]; other site
160488009759	Glycosyltransferase like family 2; Region: Glyco_tranf_2_3; pfam13641
160488009760	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394
160488009761	active site
160488009762	Protein of unknown function (DUF535); Region: DUF535; pfam04393
160488009763	colanic acid biosynthesis glycosyltransferase WcaL; Provisional; Region: PRK15427
160488009764	This is a family of GT1 glycosyltransferases found specifically in certain bacteria. amsK in Erwinia amylovora, has been reported to be involved in the biosynthesis of amylovoran, a exopolysaccharide acting as a virulence factor; Region: GT1_amsK_like; cd03799
160488009765	putative ADP-binding pocket [chemical binding]; other site
160488009766	Glycosyltransferase like family 2; Region: Glyco_tranf_2_3; pfam13641
160488009767	EpsO protein participates in the methanolan synthesis; Region: EpsO_like; cd06438
160488009768	DXD motif; other site
160488009769	Teichoic acid biosynthesis proteins [Cell envelope biogenesis, outer membrane]; Region: WecG; COG1922
160488009770	The glycosyltransferase WecG/TagA superfamily contains Escherichia coli WecG, Bacillus subtilis TagA and related proteins. E. coli WecG is believed to be a UDP-N-acetyl-D-mannosaminuronic acid transferase, and is involved in enterobacterial common...; Region: Glyco_transf_WecG_TagA; cd06533
160488009771	exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase; Region: EPS_sugtrans; TIGR03025
160488009772	Bacterial sugar transferase; Region: Bac_transf; pfam02397
160488009773	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488009774	DNA-binding transcriptional activator GcvA; Provisional; Region: PRK11139
160488009775	The C-terminal substrate domain of LysR-type GcdR, TrPI, HvR and beta-lactamase regulators, and that of other closely related homologs; contains the type 2 periplasmic binding fold; Region: PBP2_GcdR_TrpI_HvrB_AmpR_like; cd08432
160488009776	dimerization interface [polypeptide binding]; other site
160488009777	substrate binding pocket [chemical binding]; other site
160488009778	L-serine dehydratase, iron-sulfur-dependent, single chain form; Region: sda_mono; TIGR00720
160488009779	Serine dehydratase beta chain; Region: SDH_beta; pfam03315
160488009780	Serine dehydratase alpha chain; Region: SDH_alpha; pfam03313
160488009781	Protein of unknown function (DUF3313); Region: DUF3313; pfam11769
160488009782	putative aminophosphonate oxidoreductase; Region: Phn_aa_oxid; TIGR03329
160488009783	Glycine/D-amino acid oxidases (deaminating) [Amino acid transport and metabolism]; Region: DadA; COG0665
160488009784	putrescine transporter subunit: periplasmic-binding component of ABC superfamily; Provisional; Region: PRK10682
160488009785	Bacterial extracellular solute-binding protein; Region: SBP_bac_1; cl17199
160488009786	Glutamine synthetase [Amino acid transport and metabolism]; Region: GlnA; COG0174
160488009787	Glutamine synthetase, catalytic domain; Region: Gln-synt_C; pfam00120
160488009788	Helix-turn-helix domain; Region: HTH_18; pfam12833
160488009789	AAA domain; Region: AAA_30; pfam13604
160488009790	putative succinate semialdehyde dehydrogenase; Provisional; Region: PRK13968
160488009791	Mycobacterium tuberculosis succinate-semialdehyde dehydrogenase 1-like; Region: ALDH_SSADH1_GabD1; cd07100
160488009792	NAD(P) binding site [chemical binding]; other site
160488009793	catalytic residues [active]
160488009794	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488009795	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488009796	The C-terminal substrate binding domain of LysR-type transcriptional regulators, YofA and SoxR, contains the type 2 periplasmic binding fold; Region: PBP2_YofA_SoxR_like; cd08442
160488009797	putative dimerization interface [polypeptide binding]; other site
160488009798	Lipid A 3-O-deacylase (PagL); Region: PagL; pfam09411
160488009799	TonB-dependent siderophore receptor; Region: TonB-siderophor; TIGR01783
160488009800	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
160488009801	N-terminal plug; other site
160488009802	ligand-binding site [chemical binding]; other site
160488009803	universal stress protein UspE; Provisional; Region: PRK11175
160488009804	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
160488009805	Ligand Binding Site [chemical binding]; other site
160488009806	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
160488009807	Ligand Binding Site [chemical binding]; other site
160488009808	Archaeal fructose-1,6-bisphosphatase and related enzymes of inositol monophosphatase family [Carbohydrate transport and metabolism]; Region: SuhB; COG0483
160488009809	Predominantly bacterial family of Mg++ dependend phosphatases, related to inositol monophosphatases. These enzymes may dephosphorylate fructose-1,6-bisphosphate, inositol monophospate, 3'-phosphoadenosine-5'-phosphate,  or similar substrates; Region: Bacterial_IMPase_like_1; cd01641
160488009810	active site
160488009811	AraC-like ligand binding domain; Region: AraC_binding; pfam02311
160488009812	Helix-turn-helix domain; Region: HTH_18; pfam12833
160488009813	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488009814	RHS repeat-associated core domain; Region: Rhs_assc_core; TIGR03696
160488009815	benzoate 1,2-dioxygenase, large subunit; Region: benzo_1_2_benA; TIGR03229
160488009816	Rieske non-heme iron oxygenase (RO) family, 2-Halobenzoate 1,2-dioxygenase (HBDO) subfamily, N-terminal Rieske domain of the oxygenase alpha subunit; ROs comprise a large class of aromatic ring-hydroxylating dioxygenases that enable microorganisms to...; Region: Rieske_RO_Alpha_HBDO; cd03542
160488009817	C-terminal catalytic domain of the oxygenase alpha subunit of Pseudomonas resinovorans strain CA10 anthranilate 1,2-dioxygenase and related aromatic ring hydroxylating dioxygenases; Region: RHO_alpha_C_AntDO-like; cd08879
160488009818	putative alpha subunit interface [polypeptide binding]; other site
160488009819	putative active site [active]
160488009820	putative substrate binding site [chemical binding]; other site
160488009821	Fe binding site [ion binding]; other site
160488009822	Ring hydroxylating dioxygenase beta subunit. This subunit has a similar structure to NTF-2, Ketosteroid isomerase and scytalone dehydratase.The degradation of aromatic compounds by aerobic bacteria frequently begins with the dihydroxylation of the...; Region: ring_hydroxylating_dioxygenases_beta; cd00667
160488009823	inter-subunit interface; other site
160488009824	anthranilate dioxygenase reductase; Provisional; Region: antC; PRK11872
160488009825	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
160488009826	catalytic loop [active]
160488009827	iron binding site [ion binding]; other site
160488009828	Benzoate dioxygenase reductase (BenDO) FAD/NAD binding domain. Oxygenases oxidize hydrocarbons using dioxygen as the oxidant. As a Class I bacterial dioxygenases, benzoate dioxygenase like proteins combine an [2Fe-2S] cluster containing N-terminal...; Region: BenDO_FAD_NAD; cd06209
160488009829	FAD binding pocket [chemical binding]; other site
160488009830	FAD binding motif [chemical binding]; other site
160488009831	phosphate binding motif [ion binding]; other site
160488009832	beta-alpha-beta structure motif; other site
160488009833	NAD binding pocket [chemical binding]; other site
160488009834	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase; Provisional; Region: benD; PRK12823
160488009835	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase (DHB DH)-like, classical (c) SDR; Region: DHB_DH-like_SDR_c; cd08937
160488009836	putative NAD(P) binding site [chemical binding]; other site
160488009837	active site
160488009838	benzoate transport; Region: 2A0115; TIGR00895
160488009839	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488009840	putative substrate translocation pore; other site
160488009841	catechol 1,2-dioxygenase, proteobacterial; Region: catechol_proteo; TIGR02439
160488009842	Catechol 1,2 dioxygenase (1,2-CTD) catalyzes an intradiol cleavage reaction of catechol to form cis,cis-muconate. 1,2-CTDs is homodimers with one catalytic non-heme ferric ion per monomer. They belong to the aromatic dioxygenase family, a family of...; Region: 1,2-CTD; cd03460
160488009843	dimer interface [polypeptide binding]; other site
160488009844	active site
160488009845	Benzoate membrane transport protein; Region: BenE; pfam03594
160488009846	benzoate transporter; Region: benE; TIGR00843
160488009847	outer membrane porin, OprD family; Region: OprD; pfam03573
160488009848	Predicted membrane-bound metal-dependent hydrolase (DUF457); Region: DUF457; pfam04307
160488009849	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488009850	LysR family transcriptional regulator; Provisional; Region: PRK14997
160488009851	The C-terminal substrate binding domain of LysR-type transcriptional regulator CrgA and its related homologs, contains the type 2 periplasmic binding domain; Region: PBP2_CrgA_like; cd08422
160488009852	putative effector binding pocket; other site
160488009853	dimerization interface [polypeptide binding]; other site
160488009854	luciferase family oxidoreductase, group 1; Region: oxido_grp_1; TIGR03558
160488009855	Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cl07892
160488009856	Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cd00347
160488009857	INTRON06; Group II intron; Group II intron most similar to the Group II intron from Pseudomonas alcaligenes.
160488009858	RT_G2_intron: Reverse transcriptases (RTs) with group II intron origin. RT transcribes DNA using RNA as template. Proteins in this subfamily are found in bacterial and mitochondrial group II introns. Their most probable ancestor was a retrotransposable...; Region: RT_G2_intron; cd01651
160488009859	Reverse transcriptase (RNA-dependent DNA polymerase); Region: RVT_1; pfam00078
160488009860	putative active site [active]
160488009861	putative NTP binding site [chemical binding]; other site
160488009862	putative nucleic acid binding site [nucleotide binding]; other site
160488009863	Group II intron, maturase-specific domain; Region: GIIM; pfam08388
160488009864	NADH:flavin oxidoreductases, Old Yellow Enzyme family [Energy production and conversion]; Region: NemA; COG1902
160488009865	Old yellow enzyme (OYE)-like FMN binding domain. OYE was the first flavin-dependent enzyme identified, however its true physiological role remains elusive to this day. Each monomer of OYE contains FMN as a non-covalently bound cofactor, uses NADPH as a...; Region: OYE_like_FMN; cd02933
160488009866	FMN binding site [chemical binding]; other site
160488009867	active site
160488009868	substrate binding site [chemical binding]; other site
160488009869	catalytic residue [active]
160488009870	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660
160488009871	Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248
160488009872	active site
160488009873	catalytic tetrad [active]
160488009874	AIFL (apoptosis-inducing factor like) family, N-terminal Rieske domain; members of this family show similarity to human AIFL, containing an N-terminal Rieske domain and a C-terminal pyridine nucleotide-disulfide oxidoreductase domain (Pyr_redox). The...; Region: Rieske_AIFL_N; cd03478
160488009875	[2Fe-2S] cluster binding site [ion binding]; other site
160488009876	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox_2; pfam07992
160488009877	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
160488009878	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
160488009879	4-hydroxyphenylacetate permease; Region: HpaX; TIGR02332
160488009880	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488009881	putative substrate translocation pore; other site
160488009882	Sugar diacid utilization regulator [Transcription / Signal transduction mechanisms]; Region: CdaR; COG3835
160488009883	Putative sugar diacid recognition; Region: Diacid_rec; pfam05651
160488009884	PucR C-terminal helix-turn-helix domain; Region: HTH_30; pfam13556
160488009885	Glycerate kinase [Carbohydrate transport and metabolism]; Region: COG1929
160488009886	DNA-binding transcriptional activator XapR; Provisional; Region: PRK09986
160488009887	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488009888	The C-terminal substrate binding domain of LysR-type transcriptional regulators involved in the catabolism of aromatic compounds and that of other related regulators, contains type 2 periplasmic binding fold; Region: PBP2_LTTR_aromatics_like; cd08414
160488009889	dimerization interface [polypeptide binding]; other site
160488009890	substrate binding pocket [chemical binding]; other site
160488009891	SMP-30/Gluconolaconase/LRE-like region; Region: SGL; pfam08450
160488009892	Cre recombinase, C-terminal catalytic domain. Cre-like recombinases belong to the superfamily of DNA breaking-rejoining enzymes, which share the same fold in their catalytic domain and the overall reaction mechanism. The bacteriophage P1 Cre...; Region: INT_Cre; cd00799
160488009893	DNA binding site [nucleotide binding]
160488009894	dimer interface [polypeptide binding]; other site
160488009895	active site
160488009896	Int/Topo IB signature motif; other site
160488009897	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
160488009898	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488009899	metal binding site [ion binding]; metal-binding site
160488009900	active site
160488009901	I-site; other site
160488009902	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
160488009903	Uncharacterized protein SCO1/SenC/PrrC, involved in biogenesis of respiratory and photosynthetic systems [General function prediction only]; Region: COG1999
160488009904	SCO (an acronym for Synthesis of Cytochrome c Oxidase) family; composed of proteins similar to Sco1, a membrane-anchored protein possessing a soluble domain with a TRX fold. Members of this family are required for the proper assembly of cytochrome c...; Region: SCO; cd02968
160488009905	Cu(I) binding site [ion binding]; other site
160488009906	Cytochrome c; Region: Cytochrom_C; pfam00034
160488009907	Multicopper oxidase; Region: Cu-oxidase_3; pfam07732
160488009908	Multicopper oxidase; Region: Cu-oxidase_2; pfam07731
160488009909	TENA/THI-4/PQQC family; Region: TENA_THI-4; cl15243
160488009910	Putative transcription activator [Transcription]; Region: TenA; COG0819
160488009911	cytosine permease; Provisional; Region: codB; PRK11017
160488009912	Na binding site [ion binding]; other site
160488009913	Purine catabolism regulatory protein-like family; Region: PucR; pfam07905
160488009914	PucR C-terminal helix-turn-helix domain; Region: HTH_30; pfam13556
160488009915	cytosine deaminase; Provisional; Region: PRK09230
160488009916	Bacterial cytosine deaminase and related metal-dependent hydrolases. Cytosine deaminases (CDs) catalyze the deamination of cytosine, producing uracil and ammonia. They play an important role in pyrimidine salvage. CDs are present in prokaryotes and fungi; Region: Bact_CD; cd01293
160488009917	active site
160488009918	ornithine cyclodeaminase; Validated; Region: PRK06823
160488009919	ectoine utilization protein EutC; Validated; Region: PRK08291
160488009920	hypothetical protein; Provisional; Region: PRK06815
160488009921	Threonine dehydratase: The first step in amino acid degradation is the removal of nitrogen. Although the nitrogen atoms of most amino acids are transferred to alpha-ketoglutarate before removal, the alpha-amino group of threonine can be directly...; Region: Thr-dehyd; cd01562
160488009922	tetramer interface [polypeptide binding]; other site
160488009923	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488009924	catalytic residue [active]
160488009925	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2964
160488009926	YheO-like PAS domain; Region: PAS_6; pfam08348
160488009927	HTH domain; Region: HTH_22; pfam13309
160488009928	Uncharacterized protein, possibly involved in utilization of glycolate and propanediol [General function prediction only]; Region: GlcG; COG3193
160488009929	Imidazolonepropionase and related amidohydrolases [Secondary metabolites biosynthesis, transport, and catabolism]; Region: HutI; COG1228
160488009930	Superfamily of metallo-dependent hydrolases (also called amidohydrolase superfamily) is a large group of proteins that show conservation in their 3-dimensional fold (TIM barrel) and in details of their active site. The vast majority of the members have a...; Region: metallo-dependent_hydrolases; cl00281
160488009931	Metallo-dependent hydrolases, subgroup A is part of the superfamily of metallo-dependent hydrolases, a large group of proteins that show conservation in their 3-dimensional fold (TIM barrel) and in details of their active site. The vast majority of the...; Region: Met_dep_hydrolase_A; cd01299
160488009932	active site
160488009933	Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326
160488009934	Alpha/beta hydrolase family; Region: Abhydrolase_5; pfam12695
160488009935	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488009936	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488009937	The C-terminal substsrate binding domain of NodD family of LysR-type transcriptional regulators that regulates the expression of nodulation (nod) genes; contains the type 2 periplasmic binding fold; Region: PBP2_NodD; cd08462
160488009938	putative substrate binding pocket [chemical binding]; other site
160488009939	putative dimerization interface [polypeptide binding]; other site
160488009940	C-terminal domain of Burkholderia sp. NF100 MhqB and similar proteins; MhqB is a type I extradiol dioxygenase involved in the catabolism of methylhydroquinone, an intermediate in the degradation of fenitrothion; Region: MhqB_like_C; cd08360
160488009941	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
160488009942	putative active site [active]
160488009943	putative metal binding site [ion binding]; other site
160488009944	Rieske domain; a [2Fe-2S] cluster binding domain commonly found in Rieske non-heme iron oxygenase (RO) systems such as naphthalene and biphenyl dioxygenases, as well as in plant/cyanobacterial chloroplast b6f and mitochondrial cytochrome bc(1) complexes; Region: Rieske; cd03467
160488009945	iron-sulfur cluster [ion binding]; other site
160488009946	[2Fe-2S] cluster binding site [ion binding]; other site
160488009947	hypothetical protein; Provisional; Region: PRK06847
160488009948	ubiquinone biosynthesis hydroxylase family protein; Provisional; Region: PRK07608; cl17314
160488009949	Protein of unknown function (DUF1302); Region: DUF1302; pfam06980
160488009950	Uncharacterized protein related to plant photosystem II stability/assembly factor [General function prediction only]; Region: COG4447
160488009951	Predicted exporters of the RND superfamily [General function prediction only]; Region: COG1033
160488009952	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488009953	Major Facilitator Superfamily; Region: MFS_1; pfam07690
160488009954	Cupin domain; Region: Cupin_2; pfam07883
160488009955	2-keto-4-pentenoate hydratase/2-oxohepta-3-ene-1,7-dioic acid hydratase (catechol pathway) [Secondary metabolites biosynthesis, transport, and catabolism]; Region: MhpD; COG0179
160488009956	Fumarylacetoacetate (FAA) hydrolase family; Region: FAA_hydrolase; pfam01557
160488009957	Nucleoside-diphosphate-sugar epimerases [Cell envelope biogenesis, outer membrane / Carbohydrate transport and metabolism]; Region: WcaG; COG0451
160488009958	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
160488009959	NAD(P) binding site [chemical binding]; other site
160488009960	active site
160488009961	Putative cyclase; Region: Cyclase; pfam04199
160488009962	Flavodoxin reductases (ferredoxin-NADPH reductases) family 1 [Energy production and conversion]; Region: Hmp; COG1018
160488009963	Phthalate dioxygenase reductase (PDR) is an FMN-dependent reductase that mediates electron transfer from NADH to FMN to an iron sulfur cluster. PDR has an an N-terminal  ferrredoxin reductase (FNR)-like NAD(H) binding domain and a C-terminal iron-sulfur; Region: PDR_like; cd06185
160488009964	FMN-binding pocket [chemical binding]; other site
160488009965	flavin binding motif; other site
160488009966	phosphate binding motif [ion binding]; other site
160488009967	beta-alpha-beta structure motif; other site
160488009968	NAD binding pocket [chemical binding]; other site
160488009969	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
160488009970	catalytic loop [active]
160488009971	iron binding site [ion binding]; other site
160488009972	amidohydrolase; Provisional; Region: PRK12393
160488009973	TRZ/ATZ family contains enzymes from the atrazine degradation pathway and related hydrolases. Atrazine, a chlorinated herbizide, can be catabolized by a variety of different bacteria. The first three steps of the atrazine dehalogenation pathway are...; Region: ATZ_TRZ_like; cd01298
160488009974	active site
160488009975	putative substrate binding pocket [chemical binding]; other site
160488009976	ABC-type nitrate/sulfonate/bicarbonate transport system, permease component [Inorganic ion transport and metabolism]; Region: TauC; COG0600
160488009977	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488009978	dimer interface [polypeptide binding]; other site
160488009979	conserved gate region; other site
160488009980	ABC-ATPase subunit interface; other site
160488009981	ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component [Inorganic ion transport and metabolism]; Region: TauB; COG1116
160488009982	ATP-binding cassette domain of the nitrate and sulfonate transporters; Region: ABC_NrtD_SsuB_transporters; cd03293
160488009983	Walker A/P-loop; other site
160488009984	ATP binding site [chemical binding]; other site
160488009985	Q-loop/lid; other site
160488009986	ABC transporter signature motif; other site
160488009987	Walker B; other site
160488009988	D-loop; other site
160488009989	H-loop/switch region; other site
160488009990	Phenylpropionate dioxygenase and related ring-hydroxylating dioxygenases, large terminal subunit [Inorganic ion transport and metabolism / General function prediction only]; Region: HcaE; COG4638
160488009991	Rieske domain; a [2Fe-2S] cluster binding domain commonly found in Rieske non-heme iron oxygenase (RO) systems such as naphthalene and biphenyl dioxygenases, as well as in plant/cyanobacterial chloroplast b6f and mitochondrial cytochrome bc(1) complexes; Region: Rieske; cl00938
160488009992	iron-sulfur cluster [ion binding]; other site
160488009993	[2Fe-2S] cluster binding site [ion binding]; other site
160488009994	START/RHO_alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) ligand-binding domain superfamily; Region: SRPBCC; cl14643
160488009995	hydrophobic ligand binding site; other site
160488009996	ABC-type nitrate/sulfonate/bicarbonate transport systems, periplasmic components [Inorganic ion transport and metabolism]; Region: TauA; COG0715
160488009997	Nucleoside-specific channel-forming protein, Tsx; Region: Channel_Tsx; cl04114
160488009998	Predicted metal-dependent enzyme of the double-stranded beta helix superfamily [General function prediction only]; Region: COG5553
160488009999	ABC-type nitrate/sulfonate/bicarbonate transport systems, periplasmic components [Inorganic ion transport and metabolism]; Region: TauA; COG0715
160488010000	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488010001	substrate binding pocket [chemical binding]; other site
160488010002	membrane-bound complex binding site; other site
160488010003	hinge residues; other site
160488010004	nitrilotriacetate monoxygenase oxidizes nitrilotriacetate utilizing reduced flavin mononucleotide (FMNH2) and oxygen. The FMNH2 is provided by an NADH:flavin mononucleotide (FMN) oxidorductase that uses NADH to reduce FMN to FMNH2; Region: Nitrilotriacetate_monoxgenase; cd01095
160488010005	FMN-dependent oxidoreductase, nitrilotriacetate monooxygenase family; Region: FMN_nitrolo; TIGR03860
160488010006	active site
160488010007	non-prolyl cis peptide bond; other site
160488010008	Alkanesulfonate monoxygenase is the monoxygenase of a two-component system that catalyzes the conversion of alkanesulfonates to the corresponding aldehyde and sulfite. Alkanesulfonate monoxygenase (SsuD) has an absolute requirement for reduced flavin...; Region: Alkanesulfonate_monoxygenase; cd01094
160488010009	active site
160488010010	alkanesulfonate monooxygenase, FMNH(2)-dependent; Region: alk_sulf_monoox; TIGR03565
160488010011	dimer interface [polypeptide binding]; other site
160488010012	non-prolyl cis peptide bond; other site
160488010013	insertion regions; other site
160488010014	ATPase components of various ABC-type transport systems, contain duplicated ATPase [General function prediction only]; Region: COG1123
160488010015	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
160488010016	Walker A/P-loop; other site
160488010017	ATP binding site [chemical binding]; other site
160488010018	Q-loop/lid; other site
160488010019	ABC transporter signature motif; other site
160488010020	Walker B; other site
160488010021	D-loop; other site
160488010022	H-loop/switch region; other site
160488010023	Oligopeptide/dipeptide transporter, C-terminal region; Region: oligo_HPY; cl07097
160488010024	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
160488010025	Walker A/P-loop; other site
160488010026	ATP binding site [chemical binding]; other site
160488010027	Q-loop/lid; other site
160488010028	ABC transporter signature motif; other site
160488010029	Walker B; other site
160488010030	D-loop; other site
160488010031	H-loop/switch region; other site
160488010032	Oligopeptide/dipeptide transporter, C-terminal region; Region: oligo_HPY; cl07097
160488010033	nickel ABC transporter, permease subunit NikC; Region: nickel_nikC; TIGR02790
160488010034	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488010035	dimer interface [polypeptide binding]; other site
160488010036	ABC-ATPase subunit interface; other site
160488010037	putative PBP binding loops; other site
160488010038	ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppB; COG0601
160488010039	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488010040	dimer interface [polypeptide binding]; other site
160488010041	conserved gate region; other site
160488010042	putative PBP binding loops; other site
160488010043	ABC-ATPase subunit interface; other site
160488010044	The substrate-binding component of an uncharacterized ABC-type nickel/dipeptide/oligopeptide-like import system contains the type 2 periplasmic binding fold; Region: PBP2_NikA_DppA_OppA_like_15; cd08492
160488010045	Bacterial extracellular solute-binding proteins, family 5 Middle; Region: SBP_bac_5; pfam00496
160488010046	aldolase II superfamily protein; Provisional; Region: PRK07044
160488010047	active site
160488010048	intersubunit interface [polypeptide binding]; other site
160488010049	Zn2+ binding site [ion binding]; other site
160488010050	Phosphoglycerate dehydrogenase and related dehydrogenases [Amino acid transport and metabolism]; Region: SerA; COG0111
160488010051	Putative D-isomer specific 2-hydroxyacid dehydrogenases, NAD-binding and catalytic domains; Region: 2-Hacid_dh_15; cd12180
160488010052	putative ligand binding site [chemical binding]; other site
160488010053	putative NAD binding site [chemical binding]; other site
160488010054	catalytic site [active]
160488010055	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
160488010056	Acyl-CoA dehydrogenase, N-terminal domain; Region: Acyl-CoA_dh_N; pfam02771
160488010057	Acyl-CoA dehydrogenase; Region: ACAD; cd00567
160488010058	active site
160488010059	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488010060	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488010061	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
160488010062	dimerization interface [polypeptide binding]; other site
160488010063	ABC transporter, substrate-binding protein, aliphatic sulfonates family; Region: SsuA_fam; TIGR01728
160488010064	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488010065	membrane-bound complex binding site; other site
160488010066	ABC transporter, substrate-binding protein, aliphatic sulfonates family; Region: SsuA_fam; TIGR01728
160488010067	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488010068	substrate binding pocket [chemical binding]; other site
160488010069	membrane-bound complex binding site; other site
160488010070	hinge residues; other site
160488010071	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
160488010072	active site
160488010073	Protein of unknown function, DUF399; Region: DUF399; cl01139
160488010074	Erythromycin esterase; Region: Erythro_esteras; pfam05139
160488010075	Sortase and related acyltransferases [Cell envelope biogenesis, outer membrane]; Region: COG1247
160488010076	fumarate/nitrate reduction transcriptional regulator; Provisional; Region: PRK11161
160488010077	effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038
160488010078	ligand binding site [chemical binding]; other site
160488010079	flexible hinge region; other site
160488010080	helix_turn_helix, cAMP Regulatory protein C-terminus; DNA binding domain of prokaryotic regulatory proteins belonging to the catabolite activator protein family; Region: HTH_CRP; cd00092
160488010081	putative switch regulator; other site
160488010082	non-specific DNA interactions [nucleotide binding]; other site
160488010083	DNA binding site [nucleotide binding]
160488010084	sequence specific DNA binding site [nucleotide binding]; other site
160488010085	putative cAMP binding site [chemical binding]; other site
160488010086	Molecular chaperone (small heat shock protein) [Posttranslational modification, protein turnover, chaperones]; Region: IbpA; COG0071
160488010087	Alpha-crystallin domain (ACD) of alpha-crystallin-type small(s) heat shock proteins (Hsps). sHsps are small stress induced proteins with monomeric masses between 12 -43 kDa, whose common feature is the Alpha-crystallin domain  (ACD). sHsps are generally...; Region: ACD_sHsps-like; cd06464
160488010088	putative dimer interface [polypeptide binding]; other site
160488010089	FOG: CBS domain [General function prediction only]; Region: COG0517
160488010090	The CBS domain, named after human CBS, is a small domain originally identified in cystathionine beta-synthase and is subsequently found in a wide range of different proteins. CBS domains usually occur in tandem repeats. They associate to form a so-called...; Region: CBS_pair; cl15354
160488010091	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
160488010092	Ligand Binding Site [chemical binding]; other site
160488010093	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
160488010094	Ligand Binding Site [chemical binding]; other site
160488010095	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
160488010096	active site
160488010097	Plasmid replication region DNA-binding N-term; Region: KfrA_N; pfam11740
160488010098	Domain of unknown function (DUF4142); Region: DUF4142; pfam13628
160488010099	Cache domain; Region: Cache_1; pfam02743
160488010100	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
160488010101	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488010102	metal binding site [ion binding]; metal-binding site
160488010103	active site
160488010104	I-site; other site
160488010105	Acetyltransferase (GNAT) family; Region: Acetyltransf_1; pfam00583
160488010106	Uncharacterized membrane protein [Function unknown]; Region: SapB; COG1285
160488010107	MgtC family; Region: MgtC; pfam02308
160488010108	beta-carotene hydroxylase; Region: PLN02601
160488010109	Predicted Na+-dependent transporter [General function prediction only]; Region: COG0385
160488010110	Sodium Bile acid symporter family; Region: SBF; pfam01758
160488010111	Dyp-type peroxidase family; Region: Dyp_perox; cl01067
160488010112	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660
160488010113	Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248
160488010114	active site
160488010115	catalytic tetrad [active]
160488010116	TLC ATP/ADP transporter; Region: TLC; cl03940
160488010117	Methylase of polypeptide chain release factors [Translation, ribosomal structure and biogenesis]; Region: HemK; COG2890
160488010118	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488010119	S-adenosylmethionine binding site [chemical binding]; other site
160488010120	carboxylate-amine ligase; Provisional; Region: PRK13515
160488010121	carboxylate-amine ligase, YbdK family; Region: gshA_cyan_rel; TIGR02050
160488010122	nucleosidase; Provisional; Region: PRK05634
160488010123	Phosphorylase superfamily; Region: PNP_UDP_1; cl00303
160488010124	Ku protein, prokaryotic; Region: Ku_bact; TIGR02772
160488010125	Ku-core domain, Ku-like subfamily; composed of prokaryotic homologs of the eukaryotic DNA binding protein Ku. The alignment includes the core domain shared by the prokaryotic YkoV-like proteins and the eukaryotic Ku70 and Ku80. The prokaryotic Ku...; Region: KU_like; cd00789
160488010126	putative DNA binding site [nucleotide binding]; other site
160488010127	putative homodimer interface [polypeptide binding]; other site
160488010128	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394
160488010129	active site
160488010130	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cl17173
160488010131	GlcNAc-PI de-N-acetylase; Region: PIG-L; pfam02585
160488010132	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
160488010133	active site
160488010134	ATP-dependent DNA ligase; Reviewed; Region: ligD; PRK05972
160488010135	DNA ligase D, 3'-phosphoesterase domain; Region: LigD_PE_dom; TIGR02777
160488010136	Adenylation domain of Mycobacterium tuberculosis LigD and LigC-like ATP-dependent DNA ligases; Region: Adenylation_DNA_ligase_LigD_LigC; cd07906
160488010137	active site
160488010138	DNA binding site [nucleotide binding]
160488010139	The Oligonucleotide/oligosaccharide binding (OB)-fold domain of ATP-dependent DNA ligase LigD is a DNA-binding module that is part of the catalytic core unit; Region: OBF_DNA_ligase_LigD; cd07971
160488010140	DNA binding site [nucleotide binding]
160488010141	PaeLigD_Pol_like: Polymerase (Pol) domain of bacterial LigD proteins similar to Pseudomonas aeruginosa (Pae) LigD. The LigD Pol domain belongs to the archaeal/eukaryal primase (AEP) superfamily. In prokaryotes, LigD along with Ku is required for...; Region: PaeLigD_Pol_like; cd04862
160488010142	nucleotide binding site [chemical binding]; other site
160488010143	Prokaryotic metallothionein; Region: Metallothio_Pro; pfam02069
160488010144	Predicted integral membrane protein [Function unknown]; Region: COG0392
160488010145	cardiolipin synthase 2; Provisional; Region: PRK11263
160488010146	Catalytic domain, repeat 1, of bacterial cardiolipin synthase and similar proteins; Region: PLDc_CLS_1; cd09110
160488010147	putative active site [active]
160488010148	catalytic site [active]
160488010149	Catalytic domain, repeat 2, of Escherichia coli cardiolipin synthase ybhO and similar proteins; Region: PLDc_ybhO_like_2; cd09159
160488010150	putative active site [active]
160488010151	catalytic site [active]
160488010152	Metal-dependent hydrolase [General function prediction only]; Region: ElsH; COG3568
160488010153	putative catalytic site [active]
160488010154	putative metal binding site [ion binding]; other site
160488010155	putative phosphate binding site [ion binding]; other site
160488010156	Protein of unknown function DUF72; Region: DUF72; pfam01904
160488010157	Caseinolytic protease (ClpP) is an ATP-dependent protease; Region: Clp_protease_like; cl15763
160488010158	active site
160488010159	Members of the Nudix hydrolase superfamily catalyze the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+, for their activity and contain a highly...; Region: Nudix_Hydrolase_10; cd04667
160488010160	nudix motif; other site
160488010161	General stress protein [General function prediction only]; Region: GsiB; COG3729
160488010162	bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase; Provisional; Region: PRK11563
160488010163	N-terminal domain of the monoamine oxidase C dehydratase; Region: ALDH_MaoC-N; cd07128
160488010164	substrate binding site [chemical binding]; other site
160488010165	dimer interface [polypeptide binding]; other site
160488010166	NADP binding site [chemical binding]; other site
160488010167	catalytic residues [active]
160488010168	MaoC_C  The C-terminal hot dog fold of the MaoC (monoamine oxidase C) dehydratase regulatory protein. Orthologs of MaoC include PaaZ [Escherichia coli] and PaaN [Pseudomonas putida], which are putative ring-opening enzymes involved in phenylacetic acid...; Region: MaoC_C; cd03452
160488010169	substrate binding site [chemical binding]; other site
160488010170	outer membrane porin, OprD family; Region: OprD; pfam03573
160488010171	Predicted symporter [General function prediction only]; Region: DhlC; COG4147
160488010172	Uncharacterized bacterial solute carrier 5 subfamily; putative solute-binding domain; Region: SLC5sbd_u4; cd11480
160488010173	Na binding site [ion binding]; other site
160488010174	Protein of unknown function, DUF485; Region: DUF485; pfam04341
160488010175	phenylacetate-CoA oxygenase/reductase, PaaK subunit; Region: PA_CoA_Oxy5; TIGR02160
160488010176	NAD(P) binding domain of ferredoxin reductase like phenylacetic acid (PA) degradation oxidoreductase. PA oxidoreductases of E. coli hydroxylate PA-CoA in the second step of PA degradation. Members of this group typically fuse a ferredoxin reductase-like...; Region: PA_degradation_oxidoreductase_like; cd06214
160488010177	FAD binding pocket [chemical binding]; other site
160488010178	FAD binding motif [chemical binding]; other site
160488010179	phosphate binding motif [ion binding]; other site
160488010180	beta-alpha-beta structure motif; other site
160488010181	NAD(p) ribose binding residues [chemical binding]; other site
160488010182	NAD binding pocket [chemical binding]; other site
160488010183	NAD(P)-pyrophosphate-nicotinamide binding residues [chemical binding]; other site
160488010184	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
160488010185	catalytic loop [active]
160488010186	iron binding site [ion binding]; other site
160488010187	phenylacetate-CoA oxygenase, PaaJ subunit; Region: PA_CoA_Oxy4; TIGR02159
160488010188	Predicted metal-sulfur cluster biosynthetic enzyme [General function prediction only]; Region: PaaD; COG2151
160488010189	Phenylacetic acid catabolic protein; Region: PaaA_PaaC; pfam05138
160488010190	phenylacetate-CoA oxygenase subunit PaaB; Provisional; Region: paaB; PRK13781
160488010191	phenylacetate-CoA oxygenase subunit PaaA; Provisional; Region: paaA; PRK13778
160488010192	phenylacetate-CoA oxygenase, PaaG subunit; Region: PA_CoA_Oxy1; TIGR02156
160488010193	Phenylacetate-CoA ligase (also known as PaaK); Region: PaaK; cd05913
160488010194	phenylacetate-CoA ligase; Region: PA_CoA_ligase; TIGR02155
160488010195	active site
160488010196	AMP binding site [chemical binding]; other site
160488010197	homodimer interface [polypeptide binding]; other site
160488010198	acyl-activating enzyme (AAE) consensus motif; other site
160488010199	CoA binding site [chemical binding]; other site
160488010200	beta-ketoadipyl CoA thiolase; Validated; Region: PRK09050
160488010201	Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751
160488010202	dimer interface [polypeptide binding]; other site
160488010203	active site
160488010204	PaaI_thioesterase is a tetrameric acyl-CoA thioesterase with a hot dog fold and one of several proteins responsible for phenylacetic acid (PA) degradation in bacteria.  Although orthologs of PaaI exist in archaea and eukaryotes, their function has not...; Region: PaaI_thioesterase; cd03443
160488010205	CoenzymeA binding site [chemical binding]; other site
160488010206	subunit interaction site [polypeptide binding]; other site
160488010207	PHB binding site; other site
160488010208	3-hydroxyacyl-CoA dehydrogenase PaaC; Region: PaaC-3OHAcCoADH; TIGR02279
160488010209	3-hydroxyacyl-CoA dehydrogenase, NAD binding domain; Region: 3HCDH_N; pfam02737
160488010210	3-hydroxyacyl-CoA dehydrogenase, C-terminal domain; Region: 3HCDH; pfam00725
160488010211	3-hydroxyacyl-CoA dehydrogenase, C-terminal domain; Region: 3HCDH; pfam00725
160488010212	enoyl-CoA hydratase; Provisional; Region: PRK08140
160488010213	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
160488010214	substrate binding site [chemical binding]; other site
160488010215	oxyanion hole (OAH) forming residues; other site
160488010216	trimer interface [polypeptide binding]; other site
160488010217	enoyl-CoA hydratase-isomerase; Provisional; Region: PRK09674
160488010218	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
160488010219	substrate binding site [chemical binding]; other site
160488010220	oxyanion hole (OAH) forming residues; other site
160488010221	trimer interface [polypeptide binding]; other site
160488010222	phenylacetic acid degradation protein PaaY; Region: PaaY; TIGR02287
160488010223	paaY-like: This group is composed by uncharacterized proteins with similarity to the protein product of the E. coli paaY gene, which is part of the paa gene cluster responsible for phenylacetic acid degradation. Proteins in this group are expected to...; Region: LbH_paaY_like; cd04745
160488010224	putative trimer interface [polypeptide binding]; other site
160488010225	putative metal binding site [ion binding]; other site
160488010226	PaaX-like protein; Region: PaaX; pfam07848
160488010227	phenylacetic acid degradation operon negative regulatory protein PaaX; Region: PaaX_trns_reg; TIGR02277
160488010228	PaaX-like protein C-terminal domain; Region: PaaX_C; pfam08223
160488010229	fumarate/nitrate reduction transcriptional regulator; Provisional; Region: PRK11161
160488010230	effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038
160488010231	ligand binding site [chemical binding]; other site
160488010232	flexible hinge region; other site
160488010233	helix_turn_helix, cAMP Regulatory protein C-terminus; DNA binding domain of prokaryotic regulatory proteins belonging to the catabolite activator protein family; Region: HTH_CRP; cd00092
160488010234	putative switch regulator; other site
160488010235	non-specific DNA interactions [nucleotide binding]; other site
160488010236	DNA binding site [nucleotide binding]
160488010237	sequence specific DNA binding site [nucleotide binding]; other site
160488010238	putative cAMP binding site [chemical binding]; other site
160488010239	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
160488010240	Ligand Binding Site [chemical binding]; other site
160488010241	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
160488010242	Coenzyme A binding pocket [chemical binding]; other site
160488010243	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
160488010244	Ligand Binding Site [chemical binding]; other site
160488010245	Predicted exonuclease of the beta-lactamase fold involved in RNA processing [Translation, ribosomal structure and biogenesis]; Region: YSH1; COG1236
160488010246	Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849
160488010247	Beta-Casp domain; Region: Beta-Casp; smart01027
160488010248	RNA-metabolising metallo-beta-lactamase; Region: RMMBL; pfam07521
160488010249	Ion channel; Region: Ion_trans_2; pfam07885
160488010250	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
160488010251	Ligand Binding Site [chemical binding]; other site
160488010252	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
160488010253	Ligand Binding Site [chemical binding]; other site
160488010254	Predicted transporter component [General function prediction only]; Region: COG2391
160488010255	Predicted transporter component [General function prediction only]; Region: COG2391
160488010256	Sulphur transport; Region: Sulf_transp; pfam04143
160488010257	Uncharacterized protein (competence- and mitomycin-induced) [General function prediction only]; Region: CinA; COG1546
160488010258	Outer membrane protein [Cell envelope biogenesis, outer membrane / Intracellular trafficking and secretion]; Region: TolC; COG1538
160488010259	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
160488010260	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
160488010261	RND family efflux transporter, MFP subunit; Region: RND_mfp; TIGR01730
160488010262	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
160488010263	HlyD family secretion protein; Region: HlyD_3; pfam13437
160488010264	Cation/multidrug efflux pump [Defense mechanisms]; Region: AcrB; COG0841
160488010265	3-oxoacyl-(acyl carrier protein) synthase II; Reviewed; Region: PRK06333
160488010266	Beta-ketoacyl-acyl carrier protein (ACP) synthase (KAS), type I and II. KASs are responsible for the elongation steps in fatty acid biosynthesis. KASIII catalyses the initial condensation and KAS I and II catalyze further elongation steps by Claisen...; Region: KAS_I_II; cd00834
160488010267	dimer interface [polypeptide binding]; other site
160488010268	active site
160488010269	drug resistance transporter, Bcr/CflA subfamily; Region: efflux_Bcr_CflA; TIGR00710
160488010270	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488010271	putative substrate translocation pore; other site
160488010272	Integral membrane protein TerC family; Region: TerC; cl10468
160488010273	Aerobic-type carbon monoxide dehydrogenase, small subunit CoxS/CutS homologs [Energy production and conversion]; Region: CoxS; COG2080
160488010274	[2Fe-2S] binding domain; Region: Fer2_2; pfam01799
160488010275	Aerobic-type carbon monoxide dehydrogenase, middle subunit CoxM/CutM homologs [Energy production and conversion]; Region: CoxM; COG1319
160488010276	CO dehydrogenase flavoprotein C-terminal domain; Region: CO_deh_flav_C; smart01092
160488010277	Aerobic-type carbon monoxide dehydrogenase, large subunit CoxL/CutL homologs [Energy production and conversion]; Region: CoxL; COG1529
160488010278	Aldehyde oxidase and xanthine dehydrogenase, a/b hammerhead domain; Region: Ald_Xan_dh_C; smart01008
160488010279	Molybdopterin-binding domain of aldehyde dehydrogenase; Region: Ald_Xan_dh_C2; pfam02738
160488010280	Kef-type K+ transport systems, membrane components [Inorganic ion transport and metabolism]; Region: KefB; COG0475
160488010281	Sodium/hydrogen exchanger family; Region: Na_H_Exchanger; pfam00999
160488010282	Kef-type K+ transport systems, predicted NAD-binding component [Inorganic ion transport and metabolism]; Region: Kch; COG1226
160488010283	TrkA-N domain; Region: TrkA_N; pfam02254
160488010284	Molecular chaperone (small heat shock protein) [Posttranslational modification, protein turnover, chaperones]; Region: IbpA; COG0071
160488010285	Alpha-crystallin domain (ACD) of alpha-crystallin-type small(s) heat shock proteins (Hsps). sHsps are small stress induced proteins with monomeric masses between 12 -43 kDa, whose common feature is the Alpha-crystallin domain  (ACD). sHsps are generally...; Region: ACD_sHsps-like; cd06464
160488010286	putative dimer interface [polypeptide binding]; other site
160488010287	Molecular chaperone (small heat shock protein) [Posttranslational modification, protein turnover, chaperones]; Region: IbpA; COG0071
160488010288	Alpha-crystallin domain (ACD) of alpha-crystallin-type small(s) heat shock proteins (Hsps). sHsps are small stress induced proteins with monomeric masses between 12 -43 kDa, whose common feature is the Alpha-crystallin domain  (ACD). sHsps are generally...; Region: ACD_sHsps-like; cd06464
160488010289	putative dimer interface [polypeptide binding]; other site
160488010290	Molecular chaperone (small heat shock protein) [Posttranslational modification, protein turnover, chaperones]; Region: IbpA; COG0071
160488010291	Alpha-crystallin domain (ACD) of alpha-crystallin-type small(s) heat shock proteins (Hsps). sHsps are small stress induced proteins with monomeric masses between 12 -43 kDa, whose common feature is the Alpha-crystallin domain  (ACD). sHsps are generally...; Region: ACD_sHsps-like; cd06464
160488010292	putative dimer interface [polypeptide binding]; other site
160488010293	Phosphate-starvation-inducible E; Region: PsiE; pfam06146
160488010294	ATP-binding subunits of Clp protease and DnaK/DnaJ chaperones [Posttranslational modification, protein turnover, chaperones]; Region: clpA; COG0542
160488010295	Clp amino terminal domain; Region: Clp_N; pfam02861
160488010296	Clp amino terminal domain; Region: Clp_N; pfam02861
160488010297	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488010298	Walker A motif; other site
160488010299	ATP binding site [chemical binding]; other site
160488010300	Walker B motif; other site
160488010301	arginine finger; other site
160488010302	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488010303	Walker A motif; other site
160488010304	ATP binding site [chemical binding]; other site
160488010305	Walker B motif; other site
160488010306	C-terminal, D2-small domain, of ClpB protein; Region: ClpB_D2-small; pfam10431
160488010307	FOG: GAF domain [Signal transduction mechanisms]; Region: FhlA; COG2203
160488010308	Domain present in phytochromes and cGMP-specific phosphodiesterases; Region: GAF; smart00065
160488010309	PAS domain S-box; Region: sensory_box; TIGR00229
160488010310	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488010311	putative active site [active]
160488010312	heme pocket [chemical binding]; other site
160488010313	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
160488010314	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488010315	metal binding site [ion binding]; metal-binding site
160488010316	active site
160488010317	I-site; other site
160488010318	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
160488010319	Phosphoribosyl-AMP cyclohydrolase; Region: PRA-CH; cl00344
160488010320	SnoaL-like domain; Region: SnoaL_3; pfam13474
160488010321	Calcium/calmodulin dependent protein kinase II Association; Region: CaMKII_AD; cl17504
160488010322	Porphobilinogen synthase (PBGS), which is also called delta-aminolevulinic acid dehydratase (ALAD), catalyzes the condensation of two 5-aminolevulinic acid (ALA) molecules to form the pyrrole porphobilinogen (PBG), which is the second step in the...; Region: ALAD_PBGS_aspartate_rich; cd04823
160488010323	dimer interface [polypeptide binding]; other site
160488010324	allosteric magnesium binding site [ion binding]; other site
160488010325	active site
160488010326	aspartate-rich active site metal binding site; other site
160488010327	Schiff base residues; other site
160488010328	Putative GTPases (G3E family) [General function prediction only]; Region: COG0523
160488010329	CobW/HypB/UreG, nucleotide-binding domain; Region: cobW; pfam02492
160488010330	putative GTP cyclohydrolase; Provisional; Region: PRK13674
160488010331	TonB-dependent siderophore receptor; Region: TonB-siderophor; TIGR01783
160488010332	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
160488010333	N-terminal plug; other site
160488010334	ligand-binding site [chemical binding]; other site
160488010335	ABC-type Co2+ transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: CbiK; COG5266
160488010336	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
160488010337	This conserved domain belongs to a superfamily including the bleomycin resistance protein, glyoxalase I, and type I ring-cleaving dioxygenases; Region: Glo_EDI_BRP_like_18; cd08357
160488010338	putative metal binding site [ion binding]; other site
160488010339	Predicted membrane protein [Function unknown]; Region: COG4325
160488010340	Predicted membrane protein (DUF2254); Region: DUF2254; pfam10011
160488010341	TonB-dependent siderophore receptor; Region: TonB-siderophor; TIGR01783
160488010342	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
160488010343	N-terminal plug; other site
160488010344	ligand-binding site [chemical binding]; other site
160488010345	PepSY-associated TM helix; Region: PepSY_TM_3; pfam13706
160488010346	PepSY-associated TM helix; Region: PepSY_TM_2; pfam13703
160488010347	Cytochrome c5 [Energy production and conversion]; Region: CycB; COG3245
160488010348	AZL_007950 family protein; Region: AZL_007950_fam; TIGR04061
160488010349	Protein of unknown function (DUF2946); Region: DUF2946; pfam11162
160488010350	Protein of unknown function (DUF2946); Region: DUF2946; pfam11162
160488010351	Cytochrome bd-type quinol oxidase, subunit 2 [Energy production and conversion]; Region: AppB; COG1294
160488010352	Protein of unknown function (DUF2946); Region: DUF2946; pfam11162
160488010353	Outer membrane receptor proteins, mostly Fe transport [Inorganic ion transport and metabolism]; Region: CirA; COG1629
160488010354	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
160488010355	N-terminal plug; other site
160488010356	ligand-binding site [chemical binding]; other site
160488010357	Uncharacterized protein family (UPF0156); Region: RHH_2; cl17383
160488010358	nickel-responsive transcriptional regulator NikR; Region: nikR; TIGR02793
160488010359	NikR C terminal nickel binding domain; Region: NikR_C; pfam08753
160488010360	The substrate-binding component of an ABC-type nickel import system contains the type 2 periplasmic binding fold; Region: PBP2_NikA; cd08489
160488010361	ABC-type dipeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: DdpA; COG0747
160488010362	substrate binding site [chemical binding]; other site
160488010363	nickel transporter permease NikB; Provisional; Region: PRK10352
160488010364	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488010365	dimer interface [polypeptide binding]; other site
160488010366	conserved gate region; other site
160488010367	putative PBP binding loops; other site
160488010368	ABC-ATPase subunit interface; other site
160488010369	nickel ABC transporter, permease subunit NikC; Region: nickel_nikC; TIGR02790
160488010370	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488010371	putative PBP binding loops; other site
160488010372	dimer interface [polypeptide binding]; other site
160488010373	ABC-ATPase subunit interface; other site
160488010374	nickel transporter ATP-binding protein NikD; Provisional; Region: nikD; PRK10418
160488010375	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
160488010376	Walker A/P-loop; other site
160488010377	ATP binding site [chemical binding]; other site
160488010378	Q-loop/lid; other site
160488010379	ABC transporter signature motif; other site
160488010380	Walker B; other site
160488010381	D-loop; other site
160488010382	H-loop/switch region; other site
160488010383	nickel transporter ATP-binding protein NikE; Provisional; Region: nikE; PRK10419
160488010384	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
160488010385	Walker A/P-loop; other site
160488010386	ATP binding site [chemical binding]; other site
160488010387	Q-loop/lid; other site
160488010388	ABC transporter signature motif; other site
160488010389	Walker B; other site
160488010390	D-loop; other site
160488010391	H-loop/switch region; other site
160488010392	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
160488010393	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488010394	metal binding site [ion binding]; metal-binding site
160488010395	active site
160488010396	I-site; other site
160488010397	benzoate transport; Region: 2A0115; TIGR00895
160488010398	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488010399	putative substrate translocation pore; other site
160488010400	Domain of unknown function (DUF4104); Region: DUF4104; pfam13372
160488010401	Arylsulfatase A and related enzymes [Inorganic ion transport and metabolism]; Region: AslA; COG3119
160488010402	Sulfatase; Region: Sulfatase; pfam00884
160488010403	Uncharacterized conserved protein [Function unknown]; Region: COG1262
160488010404	Formylglycine-generating sulfatase enzyme; Region: FGE-sulfatase; pfam03781
160488010405	acyl-CoA dehydrogenase; Provisional; Region: PTZ00456
160488010406	Acyl-CoA dehydrogenase N terminal; Region: AcylCoA_DH_N; pfam12418
160488010407	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
160488010408	active site
160488010409	Acetyl-CoA dehydrogenase C-terminal like; Region: Acyl-CoA_dh_C; pfam12806
160488010410	putative acyltransferase; Provisional; Region: PRK05790
160488010411	Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751
160488010412	dimer interface [polypeptide binding]; other site
160488010413	active site
160488010414	feruloyl-CoA synthase; Reviewed; Region: PRK08180
160488010415	Feruloyl-CoA synthetase (FCS); Region: FCS; cd05921
160488010416	acyl-activating enzyme (AAE) consensus motif; other site
160488010417	putative AMP binding site [chemical binding]; other site
160488010418	putative active site [active]
160488010419	putative CoA binding site [chemical binding]; other site
160488010420	Aldehyde dehydrogenase family; Region: Aldedh; pfam00171
160488010421	Salicylaldehyde dehydrogenase, DoxF-like; Region: ALDH_SaliADH; cd07105
160488010422	NAD(P) binding site [chemical binding]; other site
160488010423	catalytic residues [active]
160488010424	p-hydroxycinnamoyl CoA hydratase/lyase; Validated; Region: PRK09120
160488010425	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
160488010426	substrate binding site [chemical binding]; other site
160488010427	oxyanion hole (OAH) forming residues; other site
160488010428	trimer interface [polypeptide binding]; other site
160488010429	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
160488010430	MarR family; Region: MarR_2; pfam12802
160488010431	mechanosensitive channel MscS; Provisional; Region: PRK10334
160488010432	Mechanosensitive ion channel; Region: MS_channel; pfam00924
160488010433	hypothetical protein; Provisional; Region: PRK06148
160488010434	Aminoglycoside 3'-phosphotransferase (APH) and Choline Kinase (ChoK) family. The APH/ChoK family is part of a larger superfamily that includes the catalytic domains of other kinases, such as the typical serine/threonine/tyrosine protein kinases (PKs)...; Region: APH_ChoK_like; cl17270
160488010435	active site
160488010436	ATP binding site [chemical binding]; other site
160488010437	substrate binding site [chemical binding]; other site
160488010438	Peptidase family M23; Region: Peptidase_M23; pfam01551
160488010439	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
160488010440	inhibitor-cofactor binding pocket; inhibition site
160488010441	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488010442	catalytic residue [active]
160488010443	Transcriptional regulators [Transcription]; Region: Lrp; COG1522
160488010444	Winged helix-turn-helix DNA-binding; Region: HTH_24; pfam13412
160488010445	AsnC family; Region: AsnC_trans_reg; pfam01037
160488010446	Thymidine monophosphate kinase (TMPK), also known as thymidylate kinase, catalyzes the phosphorylation of thymidine monophosphate (TMP) to thymidine diphosphate (TDP) utilizing ATP as its preferred phophoryl donor. TMPK represents the rate-limiting step...; Region: TMPK; cd01672
160488010447	Thymidylate kinase; Region: Thymidylate_kin; pfam02223
160488010448	TMP-binding site; other site
160488010449	ATP-binding site [chemical binding]; other site
160488010450	Bacteriophytochrome (light-regulated signal transduction histidine kinase) [Signal transduction mechanisms]; Region: COG4251
160488010451	GAF domain; Region: GAF; pfam01590
160488010452	Phytochrome region; Region: PHY; pfam00360
160488010453	HWE histidine kinase; Region: HWE_HK; pfam07536
160488010454	FOG: CheY-like receiver [Signal transduction mechanisms]; Region: CheY; COG0784
160488010455	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488010456	active site
160488010457	phosphorylation site [posttranslational modification]
160488010458	intermolecular recognition site; other site
160488010459	dimerization interface [polypeptide binding]; other site
160488010460	acetolactate synthase; Reviewed; Region: PRK08322
160488010461	Pyrimidine (PYR) binding domain of POX and related proteins; Region: TPP_PYR_POX_like; cd07035
160488010462	PYR/PP interface [polypeptide binding]; other site
160488010463	dimer interface [polypeptide binding]; other site
160488010464	TPP binding site [chemical binding]; other site
160488010465	Thiamine pyrophosphate enzyme, central domain; Region: TPP_enzyme_M; pfam00205
160488010466	Thiamine pyrophosphate (TPP) family, Acetolactate synthase (ALS) subfamily, TPP-binding module; composed of proteins similar to Klebsiella pneumoniae ALS, a catabolic enzyme required for butanediol fermentation. ALS catalyzes the conversion of 2...; Region: TPP_ALS; cd02010
160488010467	TPP-binding site [chemical binding]; other site
160488010468	dimer interface [polypeptide binding]; other site
160488010469	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488010470	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488010471	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
160488010472	dimerization interface [polypeptide binding]; other site
160488010473	Predicted hydrolase of the alpha/beta superfamily [General function prediction only]; Region: COG2945
160488010474	Bacterial virulence protein (VirJ); Region: VirJ; pfam06057
160488010475	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488010476	Arabinose efflux permease [Carbohydrate transport and metabolism]; Region: AraJ; COG2814
160488010477	putative substrate translocation pore; other site
160488010478	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488010479	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488010480	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
160488010481	dimerization interface [polypeptide binding]; other site
160488010482	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660
160488010483	Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248
160488010484	active site
160488010485	catalytic tetrad [active]
160488010486	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
160488010487	HAMP domain; Region: HAMP; pfam00672
160488010488	dimerization interface [polypeptide binding]; other site
160488010489	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488010490	dimer interface [polypeptide binding]; other site
160488010491	phosphorylation site [posttranslational modification]
160488010492	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488010493	ATP binding site [chemical binding]; other site
160488010494	Mg2+ binding site [ion binding]; other site
160488010495	G-X-G motif; other site
160488010496	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
160488010497	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488010498	active site
160488010499	phosphorylation site [posttranslational modification]
160488010500	intermolecular recognition site; other site
160488010501	dimerization interface [polypeptide binding]; other site
160488010502	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
160488010503	DNA binding site [nucleotide binding]
160488010504	outer membrane protein assembly complex, YaeT protein; Region: OM_YaeT; TIGR03303
160488010505	Surface antigen variable number repeat; Region: Surf_Ag_VNR; pfam07244
160488010506	Surface antigen variable number repeat; Region: Surf_Ag_VNR; pfam07244
160488010507	Surface antigen variable number repeat; Region: Surf_Ag_VNR; pfam07244
160488010508	Surface antigen variable number repeat; Region: Surf_Ag_VNR; pfam07244
160488010509	Surface antigen; Region: Bac_surface_Ag; pfam01103
160488010510	DNA-specific endonuclease I; Provisional; Region: PRK15137
160488010511	Endonuclease I; Region: Endonuclease_1; pfam04231
160488010512	bifunctional glyoxylate/hydroxypyruvate reductase B; Provisional; Region: PRK15409
160488010513	D-glycerate dehydrogenase/hydroxypyruvate reductase (GDH); Region: GDH; cd05301
160488010514	dimerization interface [polypeptide binding]; other site
160488010515	ligand binding site [chemical binding]; other site
160488010516	NADP binding site [chemical binding]; other site
160488010517	catalytic site [active]
160488010518	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488010519	D-galactonate transporter; Region: 2A0114; TIGR00893
160488010520	putative substrate translocation pore; other site
160488010521	Sugar kinases, ribokinase family [Carbohydrate transport and metabolism]; Region: RbsK; COG0524
160488010522	2-keto-3-deoxygluconate kinase (KdgK) phosphorylates 2-keto-3-deoxygluconate (KDG) to form 2-keto-3-deoxy-6-phosphogluconate (KDGP). KDG is the common intermediate product, that allows organisms to channel D-glucuronate and/or D-galacturinate into the...; Region: KdgK; cd01166
160488010523	substrate binding site [chemical binding]; other site
160488010524	ATP binding site [chemical binding]; other site
160488010525	Xylose isomerase-like TIM barrel; Region: AP_endonuc_2; pfam01261
160488010526	Transcriptional regulators [Transcription]; Region: PurR; COG1609
160488010527	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
160488010528	DNA binding site [nucleotide binding]
160488010529	domain linker motif; other site
160488010530	Ligand-binding domain of DNA transcription repressor RegR and other putative regulators such as KdgR and EndR; Region: PBP1_RegR_EndR_KdgR_like; cd06283
160488010531	putative dimerization interface [polypeptide binding]; other site
160488010532	putative ligand binding site [chemical binding]; other site
160488010533	Transposase; Region: DEDD_Tnp_IS110; pfam01548
160488010534	Transposase IS116/IS110/IS902 family; Region: Transposase_20; pfam02371
160488010535	Cytochrome c; Region: Cytochrom_C; pfam00034
160488010536	Cytochrome c, mono- and diheme variants [Energy production and conversion]; Region: CccA; COG2010
160488010537	Cytochrome c, mono- and diheme variants [Energy production and conversion]; Region: CccA; COG2010
160488010538	Cytochrome C oxidase, cbb3-type, subunit III; Region: Cytochrome_CBB3; pfam13442
160488010539	Choline dehydrogenase and related flavoproteins [Amino acid transport and metabolism]; Region: BetA; COG2303
160488010540	GMC oxidoreductase; Region: GMC_oxred_C; pfam05199
160488010541	Gluconate 2-dehydrogenase subunit 3; Region: Gluconate_2-dh3; pfam13618
160488010542	Uncharacterized protein conserved in bacteria (DUF2077); Region: DUF2077; pfam09850
160488010543	type VI secretion system Vgr family protein; Region: VI_Rhs_Vgr; TIGR03361
160488010544	Phage late control gene D protein (GPD); Region: Phage_GPD; pfam05954
160488010545	Phage-related baseplate assembly protein; Region: Phage_base_V; pfam04717
160488010546	Domain of unknown function (DUF4123); Region: DUF4123; pfam13503
160488010547	outer membrane porin, OprD family; Region: OprD; pfam03573
160488010548	4-hydroxyphenylacetate permease; Region: HpaX; TIGR02332
160488010549	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488010550	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488010551	Carbonic anhydrases/acetyltransferases, isoleucine patch superfamily [General function prediction only]; Region: PaaY; COG0663
160488010552	Gamma carbonic anhydrase-like: This family is composed of gamma carbonic anhydrase (CA), Ferripyochelin Binding Protein (FBP), E. coli paaY protein, and similar proteins. CAs are zinc-containing enzymes that catalyze the reversible hydration of carbon...; Region: LbH_gamma_CA_like; cd04645
160488010553	trimer interface [polypeptide binding]; other site
160488010554	putative metal binding site [ion binding]; other site
160488010555	Predicted acyl-CoA transferases/carnitine dehydratase [Energy production and conversion]; Region: CaiB; COG1804
160488010556	CoA-transferase family III; Region: CoA_transf_3; pfam02515
160488010557	3-hydroxy-3-methylglutaryl-CoA lyase, catalytic TIM barrel domain; Region: DRE_TIM_HMGL; cd07938
160488010558	active site
160488010559	catalytic residues [active]
160488010560	metal binding site [ion binding]; metal-binding site
160488010561	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488010562	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488010563	The C-terminal substrate binding domain of an uncharacterized LysR-type transcriptional regulator, contains the type 2 periplasmic binding fold; Region: PBP2_LTTR_like_1; cd08421
160488010564	putative dimerization interface [polypeptide binding]; other site
160488010565	Curlin associated repeat; Region: Curlin_rpt; pfam07012
160488010566	Curlin associated repeat; Region: Curlin_rpt; pfam07012
160488010567	Curlin associated repeat; Region: Curlin_rpt; pfam07012
160488010568	alpha-ketoglutarate-dependent dioxygenase AlkB; Provisional; Region: PRK15401
160488010569	Protein of unknown function (DUF1652); Region: DUF1652; pfam07865
160488010570	Pirin-related protein [General function prediction only]; Region: COG1741
160488010571	Pirin; Region: Pirin; pfam02678
160488010572	Pirin C-terminal cupin domain; Region: Pirin_C; pfam05726
160488010573	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
160488010574	Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326
160488010575	Putative threonine efflux protein [Amino acid transport and metabolism]; Region: RhtB; COG1280
160488010576	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
160488010577	Coenzyme A binding pocket [chemical binding]; other site
160488010578	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
160488010579	Cobalamin synthesis G C-terminus; Region: CbiG_C; pfam01890
160488010580	Precorrin-4 C11-methyltransferase (CbiF/CobM); Region: Precorrin-4_C11-MT; cd11641
160488010581	active site
160488010582	SAM binding site [chemical binding]; other site
160488010583	homodimer interface [polypeptide binding]; other site
160488010584	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3813
160488010585	Protein of unknown function (DUF1272); Region: DUF1272; pfam06906
160488010586	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
160488010587	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488010588	active site
160488010589	phosphorylation site [posttranslational modification]
160488010590	intermolecular recognition site; other site
160488010591	dimerization interface [polypeptide binding]; other site
160488010592	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
160488010593	DNA binding residues [nucleotide binding]
160488010594	dimerization interface [polypeptide binding]; other site
160488010595	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488010596	Bacterial periplasmic substrate-binding proteins; Region: PBPb; smart00062
160488010597	substrate binding pocket [chemical binding]; other site
160488010598	membrane-bound complex binding site; other site
160488010599	hinge residues; other site
160488010600	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488010601	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
160488010602	substrate binding pocket [chemical binding]; other site
160488010603	membrane-bound complex binding site; other site
160488010604	hinge residues; other site
160488010605	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
160488010606	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488010607	dimer interface [polypeptide binding]; other site
160488010608	phosphorylation site [posttranslational modification]
160488010609	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488010610	ATP binding site [chemical binding]; other site
160488010611	Mg2+ binding site [ion binding]; other site
160488010612	G-X-G motif; other site
160488010613	Response regulator receiver domain; Region: Response_reg; pfam00072
160488010614	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488010615	active site
160488010616	phosphorylation site [posttranslational modification]
160488010617	intermolecular recognition site; other site
160488010618	dimerization interface [polypeptide binding]; other site
160488010619	Histidine Phosphotransfer domain, involved in signalling through a two part component systems in which an autophosphorylating histidine protein kinase serves as a phosphoryl donor to a response regulator protein; the response regulator protein is...; Region: HPT; cd00088
160488010620	putative binding surface; other site
160488010621	active site
160488010622	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488010623	PAS domain; Region: PAS_9; pfam13426
160488010624	putative active site [active]
160488010625	heme pocket [chemical binding]; other site
160488010626	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488010627	PAS domain; Region: PAS_9; pfam13426
160488010628	putative active site [active]
160488010629	heme pocket [chemical binding]; other site
160488010630	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
160488010631	dimer interface [polypeptide binding]; other site
160488010632	putative CheW interface [polypeptide binding]; other site
160488010633	Transcriptional regulators [Transcription]; Region: PurR; COG1609
160488010634	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
160488010635	DNA binding site [nucleotide binding]
160488010636	domain linker motif; other site
160488010637	Ligand-binding domain of DNA transcription repressor GntR specific for gluconate, a member of the LacI-GalR family of bacterial transcription regulators; Region: PBP1_GntR; cd01575
160488010638	putative ligand binding site [chemical binding]; other site
160488010639	putative dimerization interface [polypeptide binding]; other site
160488010640	Gluconate kinase (GntK) catalyzes the phosphoryl transfer from ATP to gluconate. The resulting product gluconate-6-phoshate is an important precursor of gluconate metabolism. GntK acts as a dimmer composed of two identical subunits; Region: GntK; cd02021
160488010641	ATP-binding site [chemical binding]; other site
160488010642	Gluconate-6-phosphate binding site [chemical binding]; other site
160488010643	fructuronate transporter; Provisional; Region: PRK10034; cl15264
160488010644	GntP family permease; Region: GntP_permease; pfam02447
160488010645	Response regulator containing CheY-like receiver, AAA-type ATPase, and DNA-binding domains [Signal transduction mechanisms]; Region: AtoC; COG2204
160488010646	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488010647	active site
160488010648	phosphorylation site [posttranslational modification]
160488010649	intermolecular recognition site; other site
160488010650	dimerization interface [polypeptide binding]; other site
160488010651	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488010652	Walker A motif; other site
160488010653	ATP binding site [chemical binding]; other site
160488010654	Walker B motif; other site
160488010655	Bacterial regulatory protein, Fis family; Region: HTH_8; pfam02954
160488010656	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
160488010657	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488010658	dimer interface [polypeptide binding]; other site
160488010659	phosphorylation site [posttranslational modification]
160488010660	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488010661	ATP binding site [chemical binding]; other site
160488010662	Mg2+ binding site [ion binding]; other site
160488010663	G-X-G motif; other site
160488010664	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
160488010665	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488010666	dimer interface [polypeptide binding]; other site
160488010667	phosphorylation site [posttranslational modification]
160488010668	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488010669	ATP binding site [chemical binding]; other site
160488010670	Mg2+ binding site [ion binding]; other site
160488010671	G-X-G motif; other site
160488010672	Soluble lytic murein transglycosylase and related regulatory proteins (some contain LysM/invasin domains) [Cell envelope biogenesis, outer membrane]; Region: MltE; COG0741
160488010673	Lytic Transglycosylase (LT)  and Goose Egg White Lysozyme (GEWL) domain. Members include the soluble and insoluble membrane-bound LTs in bacteria, the LTs in bacteriophage lambda, as well as, the eukaryotic "goose-type" lysozymes (GEWL).  LTs...; Region: LT_GEWL; cd00254
160488010674	N-acetyl-D-glucosamine binding site [chemical binding]; other site
160488010675	catalytic residue [active]
160488010676	type II secretion system protein G; Region: typeII_sec_gspG; TIGR01710
160488010677	Type II secretion system (T2SS), protein G; Region: T2SG; pfam08334
160488010678	Type II secretory pathway, component PulF [Cell motility and secretion / Intracellular trafficking and secretion]; Region: PulF; COG1459
160488010679	Type II secretion system (T2SS), protein F; Region: T2SF; pfam00482
160488010680	Type II secretion system (T2SS), protein F; Region: T2SF; pfam00482
160488010681	RND family efflux transporter, MFP subunit; Region: RND_mfp; TIGR01730
160488010682	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
160488010683	HlyD family secretion protein; Region: HlyD_3; pfam13437
160488010684	AcrB/AcrD/AcrF family; Region: ACR_tran; pfam00873
160488010685	Outer membrane protein [Cell envelope biogenesis, outer membrane / Intracellular trafficking and secretion]; Region: TolC; COG1538
160488010686	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
160488010687	binding surface
160488010688	TPR motif; other site
160488010689	TPR repeat; Region: TPR_11; pfam13414
160488010690	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
160488010691	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488010692	dimer interface [polypeptide binding]; other site
160488010693	phosphorylation site [posttranslational modification]
160488010694	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488010695	ATP binding site [chemical binding]; other site
160488010696	Mg2+ binding site [ion binding]; other site
160488010697	G-X-G motif; other site
160488010698	Response regulator receiver domain; Region: Response_reg; pfam00072
160488010699	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488010700	active site
160488010701	phosphorylation site [posttranslational modification]
160488010702	intermolecular recognition site; other site
160488010703	dimerization interface [polypeptide binding]; other site
160488010704	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488010705	PAS domain; Region: PAS_9; pfam13426
160488010706	putative active site [active]
160488010707	heme pocket [chemical binding]; other site
160488010708	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488010709	ATP binding site [chemical binding]; other site
160488010710	Mg2+ binding site [ion binding]; other site
160488010711	G-X-G motif; other site
160488010712	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488010713	active site
160488010714	phosphorylation site [posttranslational modification]
160488010715	intermolecular recognition site; other site
160488010716	dimerization interface [polypeptide binding]; other site
160488010717	Putative intracellular protease/amidase [General function prediction only]; Region: ThiJ; COG0693
160488010718	Type 1 glutamine amidotransferase (GATase1)-like domain found in proteins similar to Escherichia coli Hsp31 protein; Region: GATase1_Hsp31_like; cd03141
160488010719	potential catalytic triad [active]
160488010720	conserved cys residue [active]
160488010721	CSS motif domain associated with EAL; Region: CSS-motif; pfam12792
160488010722	4-hydroxyphenylpyruvate dioxygenase; Region: 4HPPD; TIGR01263
160488010723	N-terminal domain of 4-hydroxyphenylpyruvate dioxygenase (HPPD) and hydroxymandelate Synthase (HmaS); Region: HPPD_N_like; cd08342
160488010724	dimer interface [polypeptide binding]; other site
160488010725	C-terminal domain of 4-hydroxyphenylpyruvate dioxygenase (HppD) and hydroxymandelate Synthase (HmaS); Region: HPPD_C_like; cd07250
160488010726	active site
160488010727	Fe binding site [ion binding]; other site
160488010728	CSS motif domain associated with EAL; Region: CSS-motif; pfam12792
160488010729	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
160488010730	Predicted permeases [General function prediction only]; Region: RarD; COG2962
160488010731	Multidrug resistance efflux transporter; Region: EmrE; pfam13536
160488010732	Membrane protein TerC, possibly involved in tellurium resistance [Inorganic ion transport and metabolism]; Region: TerC; COG0861
160488010733	Hemolysins and related proteins containing CBS domains [General function prediction only]; Region: TlyC; COG1253
160488010734	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains associated with the CorC_HlyC domain. CorC_HlyC is a transporter associated domain. This small domain is found in Na+/H+ antiporters, in proteins involved in...; Region: CBS_pair_CorC_HlyC_assoc; cd04590
160488010735	Transporter associated domain; Region: CorC_HlyC; smart01091
160488010736	Putative threonine efflux protein [Amino acid transport and metabolism]; Region: RhtB; COG1280
160488010737	AraC-like ligand binding domain; Region: AraC_binding; pfam02311
160488010738	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488010739	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
160488010740	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488010741	Protein of unknown function (DUF563); Region: DUF563; pfam04577
160488010742	NADP+-dependent non-phosphorylating glyceraldehyde 3-phosphate dehydrogenase and ALDH family 11; Region: ALDH_F11_NP-GAPDH; cd07082
160488010743	Aldehyde dehydrogenase family; Region: Aldedh; pfam00171
160488010744	tetrameric interface [polypeptide binding]; other site
160488010745	activator binding site; other site
160488010746	NADP binding site [chemical binding]; other site
160488010747	substrate binding site [chemical binding]; other site
160488010748	catalytic residues [active]
160488010749	This conserved domain belongs to a superfamily including the bleomycin resistance protein, glyoxalase I, and type I ring-cleaving dioxygenases; Region: Glo_EDI_BRP_like_8; cd07246
160488010750	putative dimer interface [polypeptide binding]; other site
160488010751	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
160488010752	threonine dehydratase; Reviewed; Region: PRK12483
160488010753	Threonine dehydratase: The first step in amino acid degradation is the removal of nitrogen. Although the nitrogen atoms of most amino acids are transferred to alpha-ketoglutarate before removal, the alpha-amino group of threonine can be directly...; Region: Thr-dehyd; cd01562
160488010754	tetramer interface [polypeptide binding]; other site
160488010755	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488010756	catalytic residue [active]
160488010757	First of two tandem C-terminal ACT domains of threonine dehydratase I (ThrD-I; L-threonine hydrolyase); Region: ACT_ThrD-I_1; cd04906
160488010758	putative Ile/Val binding site [chemical binding]; other site
160488010759	Second of two tandem C-terminal ACT domains of threonine dehydratase I (ThrD-I; L-threonine hydrolyase); Region: ACT_ThrD-I_2; cd04907
160488010760	putative Ile/Val binding site [chemical binding]; other site
160488010761	Predicted membrane protein [Function unknown]; Region: COG4125
160488010762	Bacterial Transmembrane Pair family; Region: BTP; pfam05232
160488010763	Bacterial Transmembrane Pair family; Region: BTP; pfam05232
160488010764	bacteriophage N4 adsorption protein B; Provisional; Region: nfrB; PRK11234
160488010765	Glycosyl transferase family group 2; Region: Glyco_trans_2_3; pfam13632
160488010766	Type II secretion system (T2SS), protein E, N-terminal domain; Region: T2SE_Nter; pfam05157
160488010767	bacteriophage N4 receptor, outer membrane subunit; Provisional; Region: PRK09782
160488010768	bacteriophage N4 receptor, outer membrane subunit; Provisional; Region: PRK09782
160488010769	Bacteriophage N adsorption protein A C-term; Region: NfrA_C; pfam13283
160488010770	hypothetical protein; Provisional; Region: PRK09936
160488010771	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
160488010772	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488010773	metal binding site [ion binding]; metal-binding site
160488010774	active site
160488010775	I-site; other site
160488010776	sensor protein RstB; Provisional; Region: PRK10604
160488010777	HAMP domain; Region: HAMP; pfam00672
160488010778	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cl00080
160488010779	dimer interface [polypeptide binding]; other site
160488010780	phosphorylation site [posttranslational modification]
160488010781	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488010782	ATP binding site [chemical binding]; other site
160488010783	Mg2+ binding site [ion binding]; other site
160488010784	G-X-G motif; other site
160488010785	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
160488010786	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488010787	active site
160488010788	phosphorylation site [posttranslational modification]
160488010789	intermolecular recognition site; other site
160488010790	dimerization interface [polypeptide binding]; other site
160488010791	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
160488010792	DNA binding site [nucleotide binding]
160488010793	periplasmic multidrug efflux lipoprotein precursor; Reviewed; Region: PRK09578
160488010794	Lipoyl domain of the dihydrolipoyl acyltransferase component (E2) of 2-oxo acid dehydrogenases. 2-oxo acid dehydrogenase multienzyme complexes, like pyruvate dehydrogenase (PDH), 2-oxoglutarate dehydrogenase (OGDH) and branched-chain 2-oxo acid...; Region: lipoyl_domain; cd06849
160488010795	HlyD family secretion protein; Region: HlyD_3; pfam13437
160488010796	The (Largely Gram-negative Bacterial) Hydrophobe/Amphiphile Efflux-1 (HAE1) Family; Region: 2A0602; TIGR00915
160488010797	Protein export membrane protein; Region: SecD_SecF; cl14618
160488010798	molybdopterin-guanine dinucleotide biosynthesis protein MobA; Reviewed; Region: mobA; PRK00317
160488010799	MobA catalyzes the formation of molybdopterin guanine dinucleotide; Region: MobA; cd02503
160488010800	GTP binding site; other site
160488010801	acyl-CoA synthetase; Provisional; Region: PRK12583
160488010802	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
160488010803	Uncharacterized subfamily of fatty acid CoA ligase (FACL); Region: FACL_like_2; cd05917
160488010804	acyl-activating enzyme (AAE) consensus motif; other site
160488010805	putative AMP binding site [chemical binding]; other site
160488010806	putative active site [active]
160488010807	putative CoA binding site [chemical binding]; other site
160488010808	quinohemoprotein amine dehydrogenase, beta subunit; Region: QH_beta; TIGR03907
160488010809	Quinohemoprotein amine dehydrogenase, gamma subunit; Region: QH-AmDH_gamma; pfam08992
160488010810	quinohemoprotein amine dehydrogenase maturation protein; Region: quino_hemo_SAM; TIGR03906
160488010811	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
160488010812	FeS/SAM binding site; other site
160488010813	radical SAM additional 4Fe4S-binding SPASM domain; Region: rSAM_more_4Fe4S; TIGR04085
160488010814	NAD(P)+-dependent aldehyde dehydrogenase superfamily; Region: ALDH-SF; cl11961
160488010815	Aldehyde dehydrogenase family; Region: Aldedh; pfam00171
160488010816	NAD(P) binding site [chemical binding]; other site
160488010817	catalytic residues [active]
160488010818	Domain of unknown function (DUF4104); Region: DUF4104; pfam13372
160488010819	ABC transporter, permease/ATP-binding protein; Region: MsbA_rel; TIGR02204
160488010820	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
160488010821	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488010822	Walker A/P-loop; other site
160488010823	ATP binding site [chemical binding]; other site
160488010824	Q-loop/lid; other site
160488010825	ABC transporter signature motif; other site
160488010826	Walker B; other site
160488010827	D-loop; other site
160488010828	H-loop/switch region; other site
160488010829	Transcriptional activator of acetoin/glycerol metabolism [Secondary metabolites biosynthesis, transport, and catabolism / Transcription]; Region: AcoR; COG3284
160488010830	GAF domain; Region: GAF; pfam01590
160488010831	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488010832	putative active site [active]
160488010833	heme pocket [chemical binding]; other site
160488010834	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488010835	ATP binding site [chemical binding]; other site
160488010836	Walker A motif; other site
160488010837	Walker B motif; other site
160488010838	arginine finger; other site
160488010839	Bacterial regulatory protein, Fis family; Region: HTH_8; pfam02954
160488010840	RHS repeat-associated core domain; Region: Rhs_assc_core; TIGR03696
160488010841	RHS repeat-associated core domain; Region: Rhs_assc_core; TIGR03696
160488010842	Curli production assembly/transport component CsgG; Region: CsgG; cl17434
160488010843	Type VIII secretion system (T8SS), CsgF protein; Region: CsgF; cl08082
160488010844	curli assembly protein CsgE; Provisional; Region: PRK10386
160488010845	Type II secretory pathway, pseudopilin PulG [Cell motility and secretion / Intracellular trafficking and secretion]; Region: PulG; COG2165
160488010846	Type II secretory pathway, pseudopilin PulG [Cell motility and secretion / Intracellular trafficking and secretion]; Region: PulG; COG2165
160488010847	prepilin-type N-terminal cleavage/methylation domain; Region: IV_pilin_GFxxxE; TIGR02532
160488010848	Type II secretion system (T2SS), protein G; Region: T2SG; pfam08334
160488010849	Type II secretory pathway, pseudopilin PulG [Cell motility and secretion / Intracellular trafficking and secretion]; Region: PulG; COG2165
160488010850	Type II secretion system (T2SS), protein G; Region: T2SG; pfam08334
160488010851	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
160488010852	TPR motif; other site
160488010853	binding surface
160488010854	type IV pilus secretin (or competence protein) PilQ; Region: IV_pilus_PilQ; TIGR02515
160488010855	Secretin and TonB N terminus short domain; Region: STN; smart00965
160488010856	Bacterial type II/III secretion system short domain; Region: Secretin_N; pfam03958
160488010857	Bacterial type II and III secretion system protein; Region: Secretin; pfam00263
160488010858	Fimbrial assembly protein (PilN); Region: PilN; pfam05137
160488010859	Type II secretory pathway, ATPase PulE/Tfp pilus assembly pathway, ATPase PilB [Cell motility and secretion / Intracellular trafficking and secretion]; Region: PulE; COG2804
160488010860	PulE/GspE The type II secretory pathway is the main terminal branch of the general secretory pathway (GSP). It is responsible for the export the majority of Gram-negative bacterial exoenzymes and toxins. PulE is a cytoplasmic protein of the GSP, which...; Region: PulE-GspE; cd01129
160488010861	Walker A motif; other site
160488010862	ATP binding site [chemical binding]; other site
160488010863	Walker B motif; other site
160488010864	Response regulator receiver domain; Region: Response_reg; pfam00072
160488010865	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488010866	active site
160488010867	phosphorylation site [posttranslational modification]
160488010868	intermolecular recognition site; other site
160488010869	dimerization interface [polypeptide binding]; other site
160488010870	SurA N-terminal domain; Region: SurA_N_3; cl07813
160488010871	Periplasmic binding protein; Region: Peripla_BP_6; pfam13458
160488010872	Type 1 periplasmic binding fold superfamily; Region: Periplasmic_Binding_Protein_Type_1; cl10011
160488010873	Uncharacterized protein SCO1/SenC/PrrC, involved in biogenesis of respiratory and photosynthetic systems [General function prediction only]; Region: COG1999
160488010874	SCO (an acronym for Synthesis of Cytochrome c Oxidase) family; composed of proteins similar to Sco1, a membrane-anchored protein possessing a soluble domain with a TRX fold. Members of this family are required for the proper assembly of cytochrome c...; Region: SCO; cd02968
160488010875	Cu(I) binding site [ion binding]; other site
160488010876	Uncharacterized protein SCO1/SenC/PrrC, involved in biogenesis of respiratory and photosynthetic systems [General function prediction only]; Region: COG1999
160488010877	SCO (an acronym for Synthesis of Cytochrome c Oxidase) family; composed of proteins similar to Sco1, a membrane-anchored protein possessing a soluble domain with a TRX fold. Members of this family are required for the proper assembly of cytochrome c...; Region: SCO; cd02968
160488010878	Cu(I) binding site [ion binding]; other site
160488010879	3-hydroxyisobutyryl-CoA hydrolase; Provisional; Region: PRK05617
160488010880	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
160488010881	substrate binding site [chemical binding]; other site
160488010882	oxyanion hole (OAH) forming residues; other site
160488010883	trimer interface [polypeptide binding]; other site
160488010884	2-enoyl-CoA Hydratase C-terminal region; Region: ECH_C; pfam13766
160488010885	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
160488010886	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
160488010887	active site
160488010888	transcriptional regulator; Provisional; Region: PRK10632
160488010889	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488010890	The C-terminal substrate binding domain of LysR-type transcriptional regulator CrgA and its related homologs, contains the type 2 periplasmic binding domain; Region: PBP2_CrgA_like; cd08422
160488010891	putative effector binding pocket; other site
160488010892	dimerization interface [polypeptide binding]; other site
160488010893	Protein of unknown function (DUF2790); Region: DUF2790; pfam10976
160488010894	Predicted SAM-dependent methyltransferase [General function prediction only]; Region: COG2384
160488010895	Family of unknown function (DUF633); Region: DUF633; pfam04816
160488010896	YjgF, YER057c, and UK114 belong to a large family of proteins present in bacteria, archaea, and eukaryotes with no definitive function. The conserved domain is similar in structure to chorismate mutase but there is no sequence similarity and no...; Region: YjgF_YER057c_UK114_family; cd00448
160488010897	homotrimer interaction site [polypeptide binding]; other site
160488010898	putative active site [active]
160488010899	Collagenase and related proteases [Posttranslational modification, protein turnover, chaperones]; Region: COG0826
160488010900	TIM barrel proteins share a structurally conserved phosphate binding motif and in general share an eight beta/alpha closed barrel structure. Specific for this family is the conserved phosphate binding site at the edges of strands 7 and 8. The phosphate...; Region: TIM_phosphate_binding; cl17186
160488010901	Peptidase family U32; Region: Peptidase_U32; pfam01136
160488010902	Collagenase; Region: DUF3656; pfam12392
160488010903	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3547
160488010904	Transposase; Region: DEDD_Tnp_IS110; pfam01548
160488010905	Transposase IS116/IS110/IS902 family; Region: Transposase_20; pfam02371
160488010906	Transposase; Region: HTH_Tnp_1; pfam01527
160488010907	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
160488010908	IS66 Orf2 like protein; Region: TnpB_IS66; pfam05717
160488010909	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3436
160488010910	Transposase C of IS166 homeodomain; Region: LZ_Tnp_IS66; pfam13007
160488010911	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3436
160488010912	putative Helix-turn-helix domain of transposase IS66; Region: HTH_Tnp_IS66; pfam13005
160488010913	Transposase IS66 family; Region: DDE_Tnp_IS66; pfam03050
160488010914	IS66 C-terminal element; Region: DDE_Tnp_IS66_C; pfam13817
160488010915	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3547
160488010916	Transposase; Region: DEDD_Tnp_IS110; pfam01548
160488010917	Transposase IS116/IS110/IS902 family; Region: Transposase_20; pfam02371
160488010918	Response regulator containing CheY-like receiver, AAA-type ATPase, and DNA-binding domains [Signal transduction mechanisms]; Region: AtoC; COG2204
160488010919	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488010920	Walker A motif; other site
160488010921	ATP binding site [chemical binding]; other site
160488010922	Walker B motif; other site
160488010923	arginine finger; other site
160488010924	Bacterial regulatory protein, Fis family; Region: HTH_8; pfam02954
160488010925	Von Willebrand factor type A (vWA) domain was originally found in the blood coagulation protein von Willebrand factor (vWF). Typically, the vWA domain is made up of approximately 200 amino acid residues folded into a classic a/b para-rossmann type of...; Region: vWFA; cl00057
160488010926	metal ion-dependent adhesion site (MIDAS); other site
160488010927	magnesium chelatase ATPase subunit I; Region: BchI-ChlI; TIGR02030
160488010928	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488010929	Walker A motif; other site
160488010930	ATP binding site [chemical binding]; other site
160488010931	Walker B motif; other site
160488010932	arginine finger; other site
160488010933	cobaltochelatase subunit CobN; Reviewed; Region: cobN; PRK05989
160488010934	CobN subunit of cobaltochelatase, bchH and chlH subunits of magnesium chelatases, and similar proteins; Region: CobN_like; cd10150
160488010935	CobN subunit of cobaltochelatase, bchH and chlH subunits of magnesium chelatases, and similar proteins; Region: CobN_like; cd10150
160488010936	cobalamin biosynthesis protein CobW; Region: CobW; TIGR02475
160488010937	CobW/HypB/UreG, nucleotide-binding domain; Region: cobW; pfam02492
160488010938	Cobalamin synthesis protein cobW C-terminal domain; Region: CobW_C; pfam07683
160488010939	Bleomycin binding protein (BLMA) and similar proteins; BLMA confers bleomycin (Bm) resistance by directly binding to Bm; Region: BLMA_like; cd08349
160488010940	dimer interface [polypeptide binding]; other site
160488010941	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
160488010942	ligand binding site [chemical binding]; other site
160488010943	branched-chain amino acid aminotransferase; Provisional; Region: PRK13357
160488010944	BCAT_beta_family: Branched-chain aminotransferase catalyses the transamination of the branched-chain amino acids  leusine, isoleucine and valine to their respective alpha-keto acids, alpha-ketoisocaproate, alpha-keto-beta-methylvalerate and...; Region: BCAT_beta_family; cd01557
160488010945	homodimer interface [polypeptide binding]; other site
160488010946	substrate-cofactor binding pocket; other site
160488010947	catalytic residue [active]
160488010948	Predicted membrane protein [Function unknown]; Region: COG4125
160488010949	Bacterial Transmembrane Pair family; Region: BTP; pfam05232
160488010950	Bacterial Transmembrane Pair family; Region: BTP; pfam05232
160488010951	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488010952	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488010953	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
160488010954	dimerization interface [polypeptide binding]; other site
160488010955	N-methylhydantoinase B/acetone carboxylase, alpha subunit [Amino acid transport and metabolism / Secondary metabolites biosynthesis, transport, and catabolism]; Region: HyuB; COG0146
160488010956	Hydantoinase B/oxoprolinase; Region: Hydantoinase_B; pfam02538
160488010957	N-methylhydantoinase A/acetone carboxylase, beta subunit [Amino acid transport and metabolism / Secondary metabolites biosynthesis, transport, and catabolism]; Region: HyuA; COG0145
160488010958	Hydantoinase/oxoprolinase N-terminal region; Region: Hydant_A_N; pfam05378
160488010959	Hydantoinase/oxoprolinase; Region: Hydantoinase_A; pfam01968
160488010960	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
160488010961	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488010962	Protein of unknown function (DUF2950); Region: DUF2950; pfam11453
160488010963	Protein of unknown function (DUF3300); Region: DUF3300; pfam11737
160488010964	conserved hypothetical protein, proteobacterial; Region: gcw_chp; TIGR02001
160488010965	YjgF, YER057c, and UK114 belong to a large family of proteins present in bacteria, archaea, and eukaryotes with no definitive function. The conserved domain is similar in structure to chorismate mutase but there is no sequence similarity and no...; Region: YjgF_YER057c_UK114_family; cd00448
160488010966	homotrimer interaction site [polypeptide binding]; other site
160488010967	putative active site [active]
160488010968	Phospholipase_D-nuclease N-terminal; Region: PLDc_N; pfam13396
160488010969	Transcriptional regulator containing an amidase domain and an AraC-type DNA-binding HTH domain [Transcription]; Region: COG4977
160488010970	AraC transcriptional regulators having an N-terminal Type 1 glutamine amidotransferase (GATase1)-like domain; Region: GATase1_AraC_ArgR_like; cd03136
160488010971	conserved cys residue [active]
160488010972	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488010973	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
160488010974	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
160488010975	ABC transporter, substrate-binding protein, aliphatic sulfonates family; Region: SsuA_fam; TIGR01728
160488010976	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488010977	substrate binding pocket [chemical binding]; other site
160488010978	membrane-bound complex binding site; other site
160488010979	nitrilotriacetate monoxygenase oxidizes nitrilotriacetate utilizing reduced flavin mononucleotide (FMNH2) and oxygen. The FMNH2 is provided by an NADH:flavin mononucleotide (FMN) oxidorductase that uses NADH to reduce FMN to FMNH2; Region: Nitrilotriacetate_monoxgenase; cd01095
160488010980	FMN-dependent oxidoreductase, nitrilotriacetate monooxygenase family; Region: FMN_nitrolo; TIGR03860
160488010981	active site
160488010982	non-prolyl cis peptide bond; other site
160488010983	hypothetical protein; Provisional; Region: PRK11171
160488010984	Cupin domain; Region: Cupin_2; pfam07883
160488010985	Cupin domain; Region: Cupin_2; pfam07883
160488010986	START/RHO_alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) ligand-binding domain superfamily; Region: SRPBCC; cl14643
160488010987	hydrophobic ligand binding site; other site
160488010988	Transcriptional regulators [Transcription]; Region: Lrp; COG1522
160488010989	AsnC-type helix-turn-helix domain; Region: HTH_AsnC-type; pfam13404
160488010990	putative DNA binding site [nucleotide binding]; other site
160488010991	putative Zn2+ binding site [ion binding]; other site
160488010992	AsnC family; Region: AsnC_trans_reg; pfam01037
160488010993	ornithine cyclodeaminase; Validated; Region: PRK07589
160488010994	ornithine cyclodeaminase; Validated; Region: PRK06823; cl17400
160488010995	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488010996	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488010997	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
160488010998	dimerization interface [polypeptide binding]; other site
160488010999	Gamma-glutamyltransferase [Amino acid transport and metabolism]; Region: Ggt; COG0405
160488011000	Gamma-glutamyltranspeptidase; Region: G_glu_transpept; pfam01019
160488011001	type VI secretion ATPase, ClpV1 family; Region: VI_ClpV1; TIGR03345
160488011002	4-hydroxybenzoate 3-monooxygenase; Validated; Region: PRK08243
160488011003	Medium chain reductase/dehydrogenase (MDR)/zinc-dependent alcohol dehydrogenase-like family; Region: MDR; cl16912
160488011004	NAD(P) binding site [chemical binding]; other site
160488011005	ubiquinone biosynthesis hydroxylase family protein; Provisional; Region: PRK07608; cl17314
160488011006	AraC-like ligand binding domain; Region: AraC_binding; pfam02311
160488011007	AraC-type DNA-binding domain-containing proteins [Transcription]; Region: AraC; COG2207
160488011008	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488011009	Helix-Turn-Helix DNA binding domain of the regulatory protein GnyR; Region: HTH_GnyR; cd04776
160488011010	Predicted transcriptional regulators [Transcription]; Region: SoxR; COG0789
160488011011	DNA binding residues [nucleotide binding]
160488011012	putative dimer interface [polypeptide binding]; other site
160488011013	Isopropylmalate/homocitrate/citramalate synthases [Amino acid transport and metabolism]; Region: LeuA; COG0119
160488011014	3-hydroxy-3-methylglutaryl-CoA lyase, catalytic TIM barrel domain; Region: DRE_TIM_HMGL; cd07938
160488011015	active site
160488011016	catalytic residues [active]
160488011017	metal binding site [ion binding]; metal-binding site
160488011018	MgtC family; Region: MgtC; pfam02308
160488011019	Protein of unknown function (DUF3203); Region: DUF3203; pfam11462
160488011020	cytochrome c oxidase accessory protein FixG; Region: ccoG_rdxA_fixG; TIGR02745
160488011021	4Fe-4S binding domain; Region: Fer4_5; pfam12801
160488011022	Ubp3 associated protein Bre5; Region: Bre5; pfam11614
160488011023	Transcriptional regulators containing a DNA-binding HTH domain and an aminotransferase domain (MocR family) and their eukaryotic orthologs [Transcription / Amino acid transport and metabolism]; Region: ARO8; COG1167
160488011024	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488011025	DNA-binding site [nucleotide binding]; DNA binding site
160488011026	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
160488011027	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488011028	homodimer interface [polypeptide binding]; other site
160488011029	catalytic residue [active]
160488011030	PAS fold; Region: PAS_4; pfam08448
160488011031	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cl00080
160488011032	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
160488011033	dimer interface [polypeptide binding]; other site
160488011034	phosphorylation site [posttranslational modification]
160488011035	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488011036	ATP binding site [chemical binding]; other site
160488011037	Mg2+ binding site [ion binding]; other site
160488011038	G-X-G motif; other site
160488011039	Response regulator receiver domain; Region: Response_reg; pfam00072
160488011040	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488011041	active site
160488011042	phosphorylation site [posttranslational modification]
160488011043	intermolecular recognition site; other site
160488011044	dimerization interface [polypeptide binding]; other site
160488011045	PAS fold; Region: PAS_7; pfam12860
160488011046	PAS domain; Region: PAS_9; pfam13426
160488011047	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488011048	ATP binding site [chemical binding]; other site
160488011049	Mg2+ binding site [ion binding]; other site
160488011050	G-X-G motif; other site
160488011051	Response regulator receiver domain; Region: Response_reg; pfam00072
160488011052	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488011053	active site
160488011054	phosphorylation site [posttranslational modification]
160488011055	intermolecular recognition site; other site
160488011056	dimerization interface [polypeptide binding]; other site
160488011057	short chain dehydrogenase; Provisional; Region: PRK06123
160488011058	classical (c) SDRs; Region: SDR_c; cd05233
160488011059	NAD(P) binding site [chemical binding]; other site
160488011060	active site
160488011061	drug resistance transporter, EmrB/QacA subfamily; Region: efflux_EmrB; TIGR00711
160488011062	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488011063	putative substrate translocation pore; other site
160488011064	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488011065	multidrug efflux system protein EmrA; Provisional; Region: PRK15136
160488011066	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
160488011067	HlyD family secretion protein; Region: HlyD_3; pfam13437
160488011068	MarR family; Region: MarR_2; cl17246
160488011069	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
160488011070	Response regulator [Signal transduction mechanisms]; Region: TtrR; COG4566
160488011071	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488011072	active site
160488011073	phosphorylation site [posttranslational modification]
160488011074	intermolecular recognition site; other site
160488011075	dimerization interface [polypeptide binding]; other site
160488011076	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
160488011077	DNA binding residues [nucleotide binding]
160488011078	dimerization interface [polypeptide binding]; other site
160488011079	PAS domain S-box; Region: sensory_box; TIGR00229
160488011080	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488011081	putative active site [active]
160488011082	heme pocket [chemical binding]; other site
160488011083	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488011084	dimer interface [polypeptide binding]; other site
160488011085	phosphorylation site [posttranslational modification]
160488011086	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488011087	ATP binding site [chemical binding]; other site
160488011088	G-X-G motif; other site
160488011089	acyl-CoA synthetase; Validated; Region: PRK08162
160488011090	Fatty acyl-CoA synthetases similar to LC-FACS from Thermus thermophiles and Arabidopsis; Region: ttLC_FACS_AEE21_like; cd12118
160488011091	acyl-activating enzyme (AAE) consensus motif; other site
160488011092	putative active site [active]
160488011093	AMP binding site [chemical binding]; other site
160488011094	putative CoA binding site [chemical binding]; other site
160488011095	acyl-CoA dehydrogenase; Provisional; Region: PTZ00456
160488011096	Acyl-CoA dehydrogenase N terminal; Region: AcylCoA_DH_N; pfam12418
160488011097	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
160488011098	active site
160488011099	Acetyl-CoA dehydrogenase C-terminal like; Region: Acyl-CoA_dh_C; pfam12806
160488011100	Fe2+-dicitrate sensor, membrane component [Inorganic ion transport and metabolism / Signal transduction mechanisms]; Region: FecR; COG3712
160488011101	FecR protein; Region: FecR; pfam04773
160488011102	Predicted permease [General function prediction only]; Region: COG2056
160488011103	Na+-H+ antiporter family; Region: Na_H_antiport_2; pfam13726
160488011104	C4-dicarboxylate transporter [Energy production and conversion]; Region: DcuC; cl17322
160488011105	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
160488011106	dimerization interface [polypeptide binding]; other site
160488011107	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
160488011108	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
160488011109	dimer interface [polypeptide binding]; other site
160488011110	putative CheW interface [polypeptide binding]; other site
160488011111	ABC-type proline/glycine betaine transport systems, periplasmic components [Amino acid transport and metabolism]; Region: ProX; COG2113
160488011112	Substrate binding domain of ABC-type glycine betaine transport system; Region: OpuAC; pfam04069
160488011113	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488011114	dimer interface [polypeptide binding]; other site
160488011115	conserved gate region; other site
160488011116	ABC-ATPase subunit interface; other site
160488011117	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488011118	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488011119	The C-terminal substrate binding domain of an uncharacterized LysR-type transcriptional regulator, contains the type 2 periplasmic binding fold; Region: PBP2_LTTR_like_2; cd08427
160488011120	putative dimerization interface [polypeptide binding]; other site
160488011121	Predicted permeases [General function prediction only]; Region: COG0679
160488011122	Cell Wall Hydrolase; Region: Hydrolase_2; pfam07486
160488011123	SCP: SCP-like extracellular protein domain, found in eukaryotes and prokaryotes. This family includes plant pathogenesis-related protein 1 (PR-1), which accumulates after infections with pathogens, and may act as an anti-fungal agent or be involved in...; Region: SCP; cl00133
160488011124	Uncharacterized protein with SCP/PR1 domains [Function unknown]; Region: COG2340
160488011125	SCP_bacterial: SCP-like extracellular protein domain, as found in bacteria and archaea. The wider family of SCP containing proteins includes plant pathogenesis-related protein 1 (PR-1), CRISPs, mammalian cysteine-rich secretory proteins, and allergen 5...; Region: SCP_bacterial; cd05379
160488011126	Transcriptional regulator containing an amidase domain and an AraC-type DNA-binding HTH domain [Transcription]; Region: COG4977
160488011127	AraC transcriptional regulators having an N-terminal Type 1 glutamine amidotransferase (GATase1)-like domain; Region: GATase1_AraC_ArgR_like; cd03136
160488011128	conserved cys residue [active]
160488011129	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488011130	LysE type translocator; Region: LysE; cl00565
160488011131	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488011132	Arabinose efflux permease [Carbohydrate transport and metabolism]; Region: AraJ; COG2814
160488011133	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488011134	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488011135	The C-terminal substrate binding domain of LysR-type transcriptional regulator CrgA and its related homologs, contains the type 2 periplasmic binding domain; Region: PBP2_CrgA_like; cd08422
160488011136	putative effector binding pocket; other site
160488011137	dimerization interface [polypeptide binding]; other site
160488011138	Cupin domain; Region: Cupin_2; cl17218
160488011139	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family; Region: PQQ_membr_DH; TIGR03074
160488011140	7TM diverse intracellular signalling; Region: 7TMR-DISM_7TM; pfam07695
160488011141	Membrane-bound PQQ-dependent glucose dehydrogenase; Region: PQQ_mGDH; cd10280
160488011142	Trp docking motif [polypeptide binding]; other site
160488011143	putative active site [active]
160488011144	Carbohydrate-selective porin, OprB family; Region: OprB; pfam04966
160488011145	acetylornithine deacetylase; Provisional; Region: PRK07522
160488011146	M20 Peptidase acetylornithine deacetylase; Region: M20_ArgE; cd03894
160488011147	metal binding site [ion binding]; metal-binding site
160488011148	putative dimer interface [polypeptide binding]; other site
160488011149	Uncharacterized conserved protein [Function unknown]; Region: COG3342
160488011150	Family of unknown function (DUF1028); Region: DUF1028; pfam06267
160488011151	flavin-dependent oxidoreductase, MSMEG_0569 family; Region: MSMEG_0569_nitr; TIGR04046
160488011152	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
160488011153	YjgF, YER057c, and UK114 belong to a large family of proteins present in bacteria, archaea, and eukaryotes with no definitive function. The conserved domain is similar in structure to chorismate mutase but there is no sequence similarity and no...; Region: YjgF_YER057c_UK114_family; cd00448
160488011154	homotrimer interaction site [polypeptide binding]; other site
160488011155	putative active site [active]
160488011156	Secretin and TonB N terminus short domain; Region: STN; smart00965
160488011157	TonB-dependent siderophore receptor; Region: TonB-siderophor; TIGR01783
160488011158	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
160488011159	N-terminal plug; other site
160488011160	ligand-binding site [chemical binding]; other site
160488011161	Fe2+-dicitrate sensor, membrane component [Inorganic ion transport and metabolism / Signal transduction mechanisms]; Region: FecR; COG3712
160488011162	FecR protein; Region: FecR; pfam04773
160488011163	RNA polymerase sigma factor; Provisional; Region: PRK12528
160488011164	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
160488011165	Sigma-70, region 4; Region: Sigma70_r4_2; pfam08281
160488011166	DNA binding residues [nucleotide binding]
160488011167	phosphoglucomutase; Validated; Region: PRK07564
160488011168	This bacterial PGM-like (phosphoglucomutase-like) protein of unknown function belongs to the alpha-D-phosphohexomutase superfamily. The alpha-D-phosphohexomutases include several related enzymes that catalyze a reversible intramolecular phosphoryl...; Region: PGM_like3; cd05801
160488011169	active site
160488011170	substrate binding site [chemical binding]; other site
160488011171	metal binding site [ion binding]; metal-binding site
160488011172	Protein of unknown function (DUF1345); Region: DUF1345; pfam07077
160488011173	Protein of unknown function (DUF1652); Region: DUF1652; pfam07865
160488011174	MHYT domain (predicted integral membrane sensor domain) [Signal transduction mechanisms]; Region: COG3300
160488011175	Bacterial signalling protein N terminal repeat; Region: MHYT; pfam03707
160488011176	Bacterial signalling protein N terminal repeat; Region: MHYT; pfam03707
160488011177	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
160488011178	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488011179	metal binding site [ion binding]; metal-binding site
160488011180	active site
160488011181	I-site; other site
160488011182	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
160488011183	efflux transporter, outer membrane factor (OMF) lipoprotein, NodT family; Region: outer_NodT; TIGR01845
160488011184	multidrug efflux system subunit MdtC; Provisional; Region: PRK10614
160488011185	Protein export membrane protein; Region: SecD_SecF; cl14618
160488011186	RND family efflux transporter, MFP subunit; Region: RND_mfp; TIGR01730
160488011187	Lipoyl domain of the dihydrolipoyl acyltransferase component (E2) of 2-oxo acid dehydrogenases. 2-oxo acid dehydrogenase multienzyme complexes, like pyruvate dehydrogenase (PDH), 2-oxoglutarate dehydrogenase (OGDH) and branched-chain 2-oxo acid...; Region: lipoyl_domain; cd06849
160488011188	HlyD family secretion protein; Region: HlyD_3; pfam13437
160488011189	Transposase; Region: DEDD_Tnp_IS110; pfam01548
160488011190	Transposase IS116/IS110/IS902 family; Region: Transposase_20; pfam02371
160488011191	Peroxiredoxin (PRX) family, Atypical 2-cys PRX subfamily; composed of PRXs containing peroxidatic and resolving cysteines, similar to the homodimeric thiol specific antioxidant (TSA) protein also known as TRX-dependent thiol peroxidase (Tpx). Tpx is a...; Region: PRX_Atyp2cys; cd03014
160488011192	dimer interface [polypeptide binding]; other site
160488011193	catalytic triad [active]
160488011194	peroxidatic and resolving cysteines [active]
160488011195	drug resistance transporter, Bcr/CflA subfamily; Region: efflux_Bcr_CflA; TIGR00710
160488011196	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488011197	putative substrate translocation pore; other site
160488011198	Amino acid permeases [Amino acid transport and metabolism]; Region: SdaC; COG0814
160488011199	serine transporter; Region: stp; TIGR00814
160488011200	aromatic amino acid aminotransferase; Provisional; Region: PRK09257
160488011201	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
160488011202	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488011203	homodimer interface [polypeptide binding]; other site
160488011204	catalytic residue [active]
160488011205	Malate/L-lactate dehydrogenase; Region: Ldh_2; cl00900
160488011206	Transcriptional regulators [Transcription]; Region: RpiR; COG1737
160488011207	Helix-turn-helix domain, rpiR family; Region: HTH_6; pfam01418
160488011208	SIS domain. SIS (Sugar ISomerase) domains are found in many phosphosugar isomerases and phosphosugar binding proteins. SIS domains are also found in proteins that regulate the expression of genes involved in synthesis of phosphosugars; Region: SIS; cl00389
160488011209	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488011210	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
160488011211	substrate binding pocket [chemical binding]; other site
160488011212	membrane-bound complex binding site; other site
160488011213	hinge residues; other site
160488011214	ABC-type arginine transport system, permease component [Amino acid transport and metabolism]; Region: ArtQ; COG4215
160488011215	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488011216	dimer interface [polypeptide binding]; other site
160488011217	conserved gate region; other site
160488011218	putative PBP binding loops; other site
160488011219	ABC-ATPase subunit interface; other site
160488011220	ABC-type arginine transport system, permease component [Amino acid transport and metabolism]; Region: ArtQ; COG4215
160488011221	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cl00427
160488011222	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488011223	dimer interface [polypeptide binding]; other site
160488011224	putative PBP binding loops; other site
160488011225	ABC-ATPase subunit interface; other site
160488011226	Glycine/D-amino acid oxidases (deaminating) [Amino acid transport and metabolism]; Region: DadA; COG0665
160488011227	hydroxyglutarate oxidase; Provisional; Region: PRK11728
160488011228	ABC-type polar amino acid transport system, ATPase component [Amino acid transport and metabolism]; Region: GlnQ; COG1126
160488011229	ATP-binding cassette domain of the histidine and glutamine transporters; Region: ABC_HisP_GlnQ; cd03262
160488011230	Walker A/P-loop; other site
160488011231	ATP binding site [chemical binding]; other site
160488011232	Q-loop/lid; other site
160488011233	ABC transporter signature motif; other site
160488011234	Walker B; other site
160488011235	D-loop; other site
160488011236	H-loop/switch region; other site
160488011237	Peptidase C26; Region: Peptidase_C26; pfam07722
160488011238	Subgroup of proteins having the Type 1 glutamine amidotransferase (GATase1) domain; Region: GATase1_2; cd01745
160488011239	catalytic triad [active]
160488011240	Dihydrodipicolinate synthase/N-acetylneuraminate lyase [Amino acid transport and metabolism / Cell envelope biogenesis, outer membrane]; Region: DapA; COG0329
160488011241	5-dehydro-4-deoxyglucarate dehydratase, also called 5-keto-4-deoxy-glucarate dehydratase (KDGDH); Region: KDGDH; cd00951
160488011242	putative active site [active]
160488011243	catalytic residue [active]
160488011244	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488011245	D-galactonate transporter; Region: 2A0114; TIGR00893
160488011246	putative substrate translocation pore; other site
160488011247	galactarate dehydratase; Region: galactar-dH20; TIGR03248
160488011248	Domains similar to fish antifreeze type III protein; Region: SAF_AH_GD; cd11613
160488011249	D-galactarate dehydratase / Altronate hydrolase, C terminus; Region: GD_AH_C; pfam04295
160488011250	Alpha-Ketoglutaric Semialdehyde Dehydrogenase; Region: ALDH_KGSADH; cd07129
160488011251	NAD-dependent aldehyde dehydrogenases [Energy production and conversion]; Region: PutA; COG1012
160488011252	dimer interface [polypeptide binding]; other site
160488011253	NADP binding site [chemical binding]; other site
160488011254	catalytic residues [active]
160488011255	Transcriptional regulators [Transcription]; Region: FadR; COG2186
160488011256	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488011257	DNA-binding site [nucleotide binding]; DNA binding site
160488011258	This entry represents the C-terminal ligand binding domain of many members of the GntR family; Region: FCD; smart00895
160488011259	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488011260	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488011261	The C-terminal substrate binding domain of LysR-type transcriptional regulator CrgA and its related homologs, contains the type 2 periplasmic binding domain; Region: PBP2_CrgA_like; cd08422
160488011262	putative effector binding pocket; other site
160488011263	dimerization interface [polypeptide binding]; other site
160488011264	quinone oxidoreductase, NADPH-dependent; Provisional; Region: PRK10754
160488011265	Quinone oxidoreductase (QOR); Region: QOR2; cd05286
160488011266	NADP binding site [chemical binding]; other site
160488011267	dimer interface [polypeptide binding]; other site
160488011268	Predicted transporter component [General function prediction only]; Region: COG2391
160488011269	Sulphur transport; Region: Sulf_transp; pfam04143
160488011270	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488011271	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488011272	The C-terminal substrate binding domain of LysR-type transcriptional regulator ToxR regulates the expression of the toxoflavin biosynthesis genes; contains the type 2 periplasmic bindinig fold; Region: PBP2_ToxR; cd08465
160488011273	putative substrate binding pocket [chemical binding]; other site
160488011274	putative dimerization interface [polypeptide binding]; other site
160488011275	Protein of unknown function, DUF606; Region: DUF606; pfam04657
160488011276	DNA alkylation repair enzyme [DNA replication, recombination, and repair]; Region: COG4335
160488011277	Outer membrane receptor for monomeric catechols [Inorganic ion transport and metabolism]; Region: Fiu; COG4774
160488011278	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
160488011279	N-terminal plug; other site
160488011280	ligand-binding site [chemical binding]; other site
160488011281	Glucose/sorbosone dehydrogenases [Carbohydrate transport and metabolism]; Region: COG2133
160488011282	Predicted membrane protein (DUF2231); Region: DUF2231; cl01730
160488011283	Protein of unknown function (DUF3303); Region: DUF3303; pfam11746
160488011284	Protein of unknown function (DUF3303); Region: DUF3303; pfam11746
160488011285	Protein of unknown function (DUF3303); Region: DUF3303; pfam11746
160488011286	YcaO domain protein; Region: TIGR03549
160488011287	OsmC-like protein; Region: OsmC; pfam02566
160488011288	YcaO-like family; Region: YcaO; pfam02624
160488011289	Aerobic-type carbon monoxide dehydrogenase, small subunit CoxS/CutS homologs [Energy production and conversion]; Region: CoxS; COG2080
160488011290	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
160488011291	catalytic loop [active]
160488011292	iron binding site [ion binding]; other site
160488011293	[2Fe-2S] binding domain; Region: Fer2_2; pfam01799
160488011294	Molybdopterin-binding domain of aldehyde dehydrogenase; Region: Ald_Xan_dh_C2; pfam02738
160488011295	Aerobic-type carbon monoxide dehydrogenase, large subunit CoxL/CutL homologs [Energy production and conversion]; Region: CoxL; COG1529
160488011296	Aldehyde oxidase and xanthine dehydrogenase, a/b hammerhead domain; Region: Ald_Xan_dh_C; smart01008
160488011297	Molybdopterin-binding domain of aldehyde dehydrogenase; Region: Ald_Xan_dh_C2; pfam02738
160488011298	Molybdopterin-binding domain of aldehyde dehydrogenase; Region: Ald_Xan_dh_C2; pfam02738
160488011299	Cytochrome c, mono- and diheme variants [Energy production and conversion]; Region: CccA; COG2010
160488011300	Cytochrome c, mono- and diheme variants [Energy production and conversion]; Region: CccA; COG2010
160488011301	Cytochrome c; Region: Cytochrom_C; pfam00034
160488011302	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488011303	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
160488011304	substrate binding pocket [chemical binding]; other site
160488011305	membrane-bound complex binding site; other site
160488011306	hinge residues; other site
160488011307	Putative threonine efflux protein [Amino acid transport and metabolism]; Region: RhtB; COG1280
160488011308	Protein of unknown function (DUF1289); Region: DUF1289; pfam06945
160488011309	BCCT family transporter; Region: BCCT; pfam02028
160488011310	Escherichia coli PhnB and similar proteins; the E. coli phnB gene is found next to an operon involved in the cleavage of carbon-phosphorus bonds in unactivated alkylphosphonates; Region: PhnB_like; cd06588
160488011311	dimer interface [polypeptide binding]; other site
160488011312	outer membrane porin, OprD family; Region: OprD; pfam03573
160488011313	SH3 domain protein; Region: SH3_and_anchor; TIGR04211
160488011314	Bacterial SH3 domain; Region: SH3_3; pfam08239
160488011315	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488011316	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488011317	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
160488011318	dimerization interface [polypeptide binding]; other site
160488011319	N-acetyl-gamma-glutamyl-phosphate reductase; Provisional; Region: PRK11863
160488011320	Semialdehyde dehydrogenase, NAD binding domain; Region: Semialdhyde_dh; smart00859
160488011321	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
160488011322	Coenzyme A binding pocket [chemical binding]; other site
160488011323	ABC-type nitrate/sulfonate/bicarbonate transport system, permease component [Inorganic ion transport and metabolism]; Region: TauC; COG0600
160488011324	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488011325	dimer interface [polypeptide binding]; other site
160488011326	conserved gate region; other site
160488011327	putative PBP binding loops; other site
160488011328	ABC-ATPase subunit interface; other site
160488011329	NMT1-like family; Region: NMT1_2; pfam13379
160488011330	NMT1/THI5 like; Region: NMT1; pfam09084
160488011331	ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component [Inorganic ion transport and metabolism]; Region: TauB; COG1116
160488011332	ATP-binding cassette domain of the nitrate and sulfonate transporters; Region: ABC_NrtD_SsuB_transporters; cd03293
160488011333	Walker A/P-loop; other site
160488011334	ATP binding site [chemical binding]; other site
160488011335	Q-loop/lid; other site
160488011336	ABC transporter signature motif; other site
160488011337	Walker B; other site
160488011338	D-loop; other site
160488011339	H-loop/switch region; other site
160488011340	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
160488011341	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
160488011342	Uncharacterized conserved protein [Function unknown]; Region: COG2128
160488011343	Carboxymuconolactone decarboxylase family; Region: CMD; pfam02627
160488011344	Cupin; Region: Cupin_6; pfam12852
160488011345	AraC-type DNA-binding domain-containing proteins [Transcription]; Region: AraC; COG2207
160488011346	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488011347	Solute carrier families 5 and 6-like; solute binding domain; Region: SLC5-6-like_sbd; cl00456
160488011348	Permease for cytosine/purines, uracil, thiamine, allantoin; Region: Transp_cyt_pur; pfam02133
160488011349	Na binding site [ion binding]; other site
160488011350	Flavin reductase like domain; Region: Flavin_Reduct; smart00903
160488011351	probable oxidoreductase, LLM family; Region: LLM_2I7G; TIGR03858
160488011352	Coenzyme F420-dependent N5,N10-methylene tetrahydromethanopterin reductase and related flavin-dependent oxidoreductases [Energy production and conversion]; Region: COG2141
160488011353	3-oxoadipate enol-lactonase; Region: protocat_pcaD; TIGR02427
160488011354	homoserine O-acetyltransferase; Provisional; Region: metX; cl17114
160488011355	Aldehyde dehydrogenase family; Region: Aldedh; pfam00171
160488011356	Uncharacterized Candidatus pelagibacter aldehyde dehydrogenase, DhaS-like; Region: ALDH_DhaS; cd07114
160488011357	NAD(P) binding site [chemical binding]; other site
160488011358	catalytic residues [active]
160488011359	Flavin reductase like domain; Region: Flavin_Reduct; smart00903
160488011360	Carboxymuconolactone decarboxylase family; Region: CMD; cl00460
160488011361	Transcriptional regulators [Transcription]; Region: GntR; COG1802
160488011362	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488011363	DNA-binding site [nucleotide binding]; DNA binding site
160488011364	FCD domain; Region: FCD; pfam07729
160488011365	Members of the Nudix hydrolase superfamily catalyze the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+, for their activity and contain a highly...; Region: Nudix_Hydrolase_4; cd04511
160488011366	nudix motif; other site
160488011367	PAS fold; Region: PAS_4; pfam08448
160488011368	FOG: GAF domain [Signal transduction mechanisms]; Region: FhlA; COG2203
160488011369	GAF domain; Region: GAF; pfam01590
160488011370	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488011371	dimer interface [polypeptide binding]; other site
160488011372	phosphorylation site [posttranslational modification]
160488011373	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488011374	ATP binding site [chemical binding]; other site
160488011375	Mg2+ binding site [ion binding]; other site
160488011376	G-X-G motif; other site
160488011377	Response regulator receiver domain; Region: Response_reg; pfam00072
160488011378	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488011379	active site
160488011380	phosphorylation site [posttranslational modification]
160488011381	intermolecular recognition site; other site
160488011382	dimerization interface [polypeptide binding]; other site
160488011383	Putative threonine efflux protein [Amino acid transport and metabolism]; Region: RhtB; COG1280
160488011384	Putative threonine efflux protein [Amino acid transport and metabolism]; Region: RhtB; COG1280
160488011385	Transcriptional regulators [Transcription]; Region: Lrp; COG1522
160488011386	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
160488011387	putative DNA binding site [nucleotide binding]; other site
160488011388	putative Zn2+ binding site [ion binding]; other site
160488011389	AsnC family; Region: AsnC_trans_reg; pfam01037
160488011390	Solute carrier families 5 and 6-like; solute binding domain; Region: SLC5-6-like_sbd; cl00456
160488011391	Permease for cytosine/purines, uracil, thiamine, allantoin; Region: Transp_cyt_pur; pfam02133
160488011392	Na binding site [ion binding]; other site
160488011393	outer membrane porin, OprD family; Region: OprD; pfam03573
160488011394	Nitroreductase family. Members of this family utilize FMN as a cofactor and catalyze reduction of a variety of nitroaromatic compounds, including nitrofurans, nitrobenzens, nitrophenol, nitrobenzoate and quinones by using either NADH or NADPH as a source...; Region: Nitroreductase; cd02136
160488011395	putative FMN binding site [chemical binding]; other site
160488011396	benzoate transport; Region: 2A0115; TIGR00895
160488011397	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488011398	putative substrate translocation pore; other site
160488011399	Arabinose-binding domain of AraC transcription regulator, N-term; Region: Arabinose_bd; pfam12625
160488011400	AraC-type DNA-binding domain-containing proteins [Transcription]; Region: AraC; COG2207
160488011401	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488011402	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488011403	aminoethylphosphonate catabolism associated LysR family transcriptional regulator; Region: phn_lysR; TIGR03339
160488011404	C-terminal substrate binding domain of LysR-type transcriptional regulator CysL, which activates the transcription of the cysJI operon encoding sulfite reductase, contains the type 2 periplasmic binding fold; Region: PBP2_CysL_like; cd08420
160488011405	putative dimerization interface [polypeptide binding]; other site
160488011406	Predicted membrane protein [Function unknown]; Region: COG2855
160488011407	Predicted Rossmann fold nucleotide-binding protein [General function prediction only]; Region: COG1611
160488011408	Domain of unknown function (DUF3412); Region: DUF3412; pfam11892
160488011409	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
160488011410	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488011411	metal binding site [ion binding]; metal-binding site
160488011412	active site
160488011413	I-site; other site
160488011414	phosphatidylserine synthase; Provisional; Region: pssA; PRK09428
160488011415	Catalytic domain, repeat 1, of phosphatidylserine synthases from gram-negative bacteria; Region: PLDc_PSS_G_neg_1; cd09134
160488011416	domain interface [polypeptide binding]; other site
160488011417	putative active site [active]
160488011418	catalytic site [active]
160488011419	Catalytic domain, repeat 2, of phosphatidylserine synthases from gram-negative bacteria; Region: PLDc_PSS_G_neg_2; cd09136
160488011420	domain interface [polypeptide binding]; other site
160488011421	putative active site [active]
160488011422	catalytic site [active]
160488011423	Transcriptional regulator containing an amidase domain and an AraC-type DNA-binding HTH domain [Transcription]; Region: COG4977
160488011424	AraC transcriptional regulators having an N-terminal Type 1 glutamine amidotransferase (GATase1)-like domain; Region: GATase1_AraC_ArgR_like; cd03136
160488011425	conserved cys residue [active]
160488011426	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488011427	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488011428	metabolite-proton symporter; Region: 2A0106; TIGR00883
160488011429	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488011430	Xaa-Pro aminopeptidase [Amino acid transport and metabolism]; Region: PepP; COG0006
160488011431	Creatinase/Prolidase N-terminal domain; Region: Creatinase_N; pfam01321
160488011432	Creatine amidinohydrolase. E.C.3.5.3.3. Hydrolyzes creatine to sarcosine and urea; Region: Creatinase; cd01090
160488011433	active site
160488011434	catalase/hydroperoxidase HPI(I); Provisional; Region: PRK15061
160488011435	N-terminal catalytic domain of catalase-peroxidases; Region: catalase_peroxidase_1; cd00649
160488011436	dimer interface [polypeptide binding]; other site
160488011437	active site
160488011438	heme binding site [chemical binding]; other site
160488011439	C-terminal non-catalytic domain of catalase-peroxidases; Region: catalase_peroxidase_2; cd08200
160488011440	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488011441	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488011442	The C-terminal substrate binding domain of an uncharacterized LysR-type transcriptional regulator similar to DntR, which is involved in the catabolism of dinitrotoluene; contains the type 2 periplasmic binding fold; Region: PBP2_DntR_like_2; cd08464
160488011443	putative substrate binding pocket [chemical binding]; other site
160488011444	putative dimerization interface [polypeptide binding]; other site
160488011445	Permeases of the drug/metabolite transporter (DMT) superfamily [Carbohydrate transport and metabolism / Amino acid transport and metabolism / General function prediction only]; Region: RhaT; COG0697
160488011446	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660
160488011447	Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248
160488011448	active site
160488011449	catalytic tetrad [active]
160488011450	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
160488011451	DNA breaking-rejoining enzymes, intergrase/recombinases, C-terminal catalytic domain. The tyrosine recombinase/integrase family share the same catalytic domain containing six conserved active site residues. The best-studied members of this diverse family...; Region: INT_REC_C; cd01182
160488011452	active site
160488011453	catalytic residues [active]
160488011454	DNA binding site [nucleotide binding]
160488011455	Int/Topo IB signature motif; other site
160488011456	DnaQ-like (or DEDD) 3'-5' exonuclease domain superfamily; Region: DnaQ_like_exo; cl10012
160488011457	active site
160488011458	substrate binding site [chemical binding]; other site
160488011459	catalytic site [active]
160488011460	Protein of unknown function (DUF2813); Region: DUF2813; pfam11398
160488011461	AAA domain; Region: AAA_21; pfam13304
160488011462	TOPRIM_OLD: topoisomerase-primase (TOPRIM) nucleotidyl transferase/hydrolase domain of the type found in bacterial and archaeal nucleases of the OLD (overcome lysogenization defect) family.  The bacteriophage P2 OLD protein, which has DNase as well as...; Region: TOPRIM_OLD; cd01026
160488011463	putative active site [active]
160488011464	putative metal-binding site [ion binding]; other site
160488011465	Part of AAA domain; Region: AAA_19; pfam13245
160488011466	Superfamily I DNA and RNA helicases [DNA replication, recombination, and repair]; Region: UvrD; COG0210
160488011467	Family description; Region: UvrD_C_2; pfam13538
160488011468	DNA breaking-rejoining enzymes, C-terminal catalytic domain. The DNA breaking-rejoining enzyme superfamily includes type IB topoisomerases and tyrosine recombinases that share the same fold in their catalytic domain containing six conserved active site...; Region: DNA_BRE_C; cl00213
160488011469	DNA binding site [nucleotide binding]
160488011470	Int/Topo IB signature motif; other site
160488011471	PrpA and PrpB, metallophosphatase domain; Region: MPP_PrpA_PrpB; cd07424
160488011472	active site
160488011473	metal binding site [ion binding]; metal-binding site
160488011474	Protein of unknown function (DUF4011); Region: DUF4011; pfam13195
160488011475	Part of AAA domain; Region: AAA_19; pfam13245
160488011476	Superfamily I DNA and RNA helicases and helicase subunits [DNA replication, recombination, and repair]; Region: COG1112
160488011477	AAA domain; Region: AAA_30; pfam13604
160488011478	AAA domain; Region: AAA_12; pfam13087
160488011479	Superfamily of nucleases including Short Patch Repair (Vsr) Endonucleases, archaeal Holliday junction resolvases, MutH methy-directed DNA mismatch-repair endonucleases, and catalytic domains of many restriction endonucleases, such as EcoRI, BamHI, and...; Region: Restriction_endonuclease_like; cl00277
160488011480	putative active site [active]
160488011481	Protein of unknown function (DUF3320); Region: DUF3320; pfam11784
160488011482	AAA domain; Region: AAA_13; pfam13166
160488011483	ATP-binding cassette domain of multidrug resistance protein-like transporters; Region: ABCC_MRP_Like; cd03228
160488011484	ABC transporter signature motif; other site
160488011485	Walker B; other site
160488011486	D-loop; other site
160488011487	H-loop/switch region; other site
160488011488	Protein of unknown function (DUF3644); Region: DUF3644; pfam12358
160488011489	Restriction endonuclease; Region: Mrr_cat; pfam04471
160488011490	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4924
160488011491	Uncharacterized protein conserved in bacteria N-term (DUF3322); Region: DUF3322; pfam11795
160488011492	Uncharacterized protein conserved in bacteria C-term(DUF2220); Region: DUF2220; pfam09983
160488011493	The Bin/Amphiphysin/Rvs (BAR) domain, a dimerization module that binds membranes and detects membrane curvature; Region: BAR; cl12013
160488011494	Putative exonuclease SbcCD, C subunit; Region: SbcCD_C; pfam13558
160488011495	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4913
160488011496	P-loop containing region of AAA domain; Region: AAA_29; pfam13555
160488011497	Protein of unknown function (DUF3375); Region: DUF3375; pfam11855
160488011498	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2849
160488011499	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
160488011500	salt bridge; other site
160488011501	non-specific DNA binding site [nucleotide binding]; other site
160488011502	sequence-specific DNA binding site [nucleotide binding]; other site
160488011503	ParA and ParB of Caulobacter crescentus belong to a conserved family of bacterial proteins implicated in chromosome segregation. ParB binds to DNA sequences adjacent to the origin of replication and localizes to opposite cell poles shortly following the...; Region: ParA; cd02042
160488011504	CobQ/CobB/MinD/ParA nucleotide binding domain; Region: CbiA; pfam01656
160488011505	P-loop; other site
160488011506	Magnesium ion binding site [ion binding]; other site
160488011507	GAF domain; Region: GAF_2; pfam13185
160488011508	ATP-grasp ribosomal peptide maturase, SAV_5884 family; Region: GRASP_SAV_5884; TIGR04187
160488011509	ATP-grasp domain; Region: ATP-grasp_4; cl17255
160488011510	replication factor-a protein 1 (rpa1); Region: rpa1; TIGR00617
160488011511	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488011512	PAS domain; Region: PAS_9; pfam13426
160488011513	putative active site [active]
160488011514	heme pocket [chemical binding]; other site
160488011515	PAS fold; Region: PAS_4; pfam08448
160488011516	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488011517	putative active site [active]
160488011518	heme pocket [chemical binding]; other site
160488011519	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
160488011520	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488011521	metal binding site [ion binding]; metal-binding site
160488011522	active site
160488011523	I-site; other site
160488011524	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
160488011525	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
160488011526	Coenzyme A binding pocket [chemical binding]; other site
160488011527	catechol 1,2-dioxygenase, proteobacterial; Region: catechol_proteo; TIGR02439
160488011528	Catechol 1,2 dioxygenase (1,2-CTD) catalyzes an intradiol cleavage reaction of catechol to form cis,cis-muconate. 1,2-CTDs is homodimers with one catalytic non-heme ferric ion per monomer. They belong to the aromatic dioxygenase family, a family of...; Region: 1,2-CTD; cd03460
160488011529	dimer interface [polypeptide binding]; other site
160488011530	active site
160488011531	muconolactone delta-isomerase; Region: muco_delta; TIGR03221
160488011532	muconate and chloromuconate cycloisomerases; Region: mucon_cyclo; TIGR02534
160488011533	Muconate Lactonizing Enzyme (MLE), an homooctameric enzyme, catalyses the conversion of cis,cis-muconate (CCM) to muconolactone (ML) in the catechol branch of the beta-ketoadipate pathway. This pathway is used in soil microbes to breakdown lignin-derived...; Region: MLE; cd03318
160488011534	octamer interface [polypeptide binding]; other site
160488011535	active site
160488011536	DNA-binding transcriptional regulator CynR; Provisional; Region: PRK11242
160488011537	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488011538	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
160488011539	dimerization interface [polypeptide binding]; other site
160488011540	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
160488011541	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
160488011542	DNA binding residues [nucleotide binding]
160488011543	dimerization interface [polypeptide binding]; other site
160488011544	hypothetical protein; Provisional; Region: PRK07036
160488011545	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
160488011546	inhibitor-cofactor binding pocket; inhibition site
160488011547	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488011548	catalytic residue [active]
160488011549	putrescine transporter subunit: periplasmic-binding component of ABC superfamily; Provisional; Region: PRK10682
160488011550	Bacterial extracellular solute-binding protein; Region: SBP_bac_1; cl17199
160488011551	Putative NADPH-quinone reductase (modulator of drug activity B) [General function prediction only]; Region: MdaB; COG2249
160488011552	aspartate aminotransferase; Provisional; Region: PRK05764
160488011553	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
160488011554	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488011555	homodimer interface [polypeptide binding]; other site
160488011556	catalytic residue [active]
160488011557	alanine racemase; Reviewed; Region: PRK13340
160488011558	Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzyme, Alanine Racemase 2; Region: PLPDE_III_AR2; cd06826
160488011559	active site
160488011560	pyridoxal 5'-phosphate (PLP) binding site [chemical binding]; other site
160488011561	dimer interface [polypeptide binding]; other site
160488011562	substrate binding site [chemical binding]; other site
160488011563	catalytic residues [active]
160488011564	Acyl-CoA synthetase (NDP forming) [Energy production and conversion]; Region: COG1042
160488011565	CoA binding domain; Region: CoA_binding_2; pfam13380
160488011566	Succinyl-CoA ligase like flavodoxin domain; Region: Succ_CoA_lig; pfam13607
160488011567	ATP-grasp domain; Region: ATP-grasp_5; pfam13549
160488011568	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
160488011569	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
160488011570	active site
160488011571	enoyl-CoA hydratase; Provisional; Region: PRK06688
160488011572	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
160488011573	substrate binding site [chemical binding]; other site
160488011574	oxyanion hole (OAH) forming residues; other site
160488011575	trimer interface [polypeptide binding]; other site
160488011576	S-methylmethionine transporter; Provisional; Region: PRK11387
160488011577	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488011578	dimer interface [polypeptide binding]; other site
160488011579	phosphorylation site [posttranslational modification]
160488011580	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488011581	ATP binding site [chemical binding]; other site
160488011582	Mg2+ binding site [ion binding]; other site
160488011583	G-X-G motif; other site
160488011584	Response regulator receiver domain; Region: Response_reg; pfam00072
160488011585	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488011586	active site
160488011587	phosphorylation site [posttranslational modification]
160488011588	intermolecular recognition site; other site
160488011589	dimerization interface [polypeptide binding]; other site
160488011590	Histidine Phosphotransfer domain, involved in signalling through a two part component systems in which an autophosphorylating histidine protein kinase serves as a phosphoryl donor to a response regulator protein; the response regulator protein is...; Region: HPT; cl00086
160488011591	putative binding surface; other site
160488011592	active site
160488011593	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
160488011594	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488011595	substrate binding pocket [chemical binding]; other site
160488011596	membrane-bound complex binding site; other site
160488011597	hinge residues; other site
160488011598	DNA-binding transcriptional regulator TorR; Provisional; Region: PRK10766
160488011599	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488011600	active site
160488011601	phosphorylation site [posttranslational modification]
160488011602	intermolecular recognition site; other site
160488011603	dimerization interface [polypeptide binding]; other site
160488011604	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
160488011605	DNA binding site [nucleotide binding]
160488011606	transcriptional repressor BetI; Region: betaine_BetI; TIGR03384
160488011607	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
160488011608	Bacterial transcriptional repressor; Region: TetR_C_6; pfam13977
160488011609	enoyl-CoA hydratase; Provisional; Region: PRK06688
160488011610	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
160488011611	substrate binding site [chemical binding]; other site
160488011612	oxyanion hole (OAH) forming residues; other site
160488011613	trimer interface [polypeptide binding]; other site
160488011614	Hydroxyneurosporene synthase (CrtC); Region: CrtC; pfam07143
160488011615	MacB-like periplasmic core domain; Region: MacB_PCD; pfam12704
160488011616	ABC-type antimicrobial peptide transport system, permease component [Defense mechanisms]; Region: SalY; COG0577
160488011617	ABC-type antimicrobial peptide transport system, ATPase component [Defense mechanisms]; Region: SalX; COG1136
160488011618	ATP-binding cassette domain of the transporters involved in export of lipoprotein and macrolide, and cell division protein; Region: ABC_MJ0796_LolCDE_FtsE; cd03255
160488011619	Walker A/P-loop; other site
160488011620	ATP binding site [chemical binding]; other site
160488011621	Q-loop/lid; other site
160488011622	ABC transporter signature motif; other site
160488011623	Walker B; other site
160488011624	D-loop; other site
160488011625	H-loop/switch region; other site
160488011626	Rieske domain; a [2Fe-2S] cluster binding domain commonly found in Rieske non-heme iron oxygenase (RO) systems such as naphthalene and biphenyl dioxygenases, as well as in plant/cyanobacterial chloroplast b6f and mitochondrial cytochrome bc(1) complexes; Region: Rieske; cl00938
160488011627	Phenylpropionate dioxygenase and related ring-hydroxylating dioxygenases, large terminal subunit [Inorganic ion transport and metabolism / General function prediction only]; Region: HcaE; COG4638
160488011628	iron-sulfur cluster [ion binding]; other site
160488011629	[2Fe-2S] cluster binding site [ion binding]; other site
160488011630	C-terminal catalytic domain of the oxygenase alpha subunit of dicamba O-demethylase and related aromatic ring hydroxylating dioxygenases; Region: RHO_alpha_C_DMO-like; cd08878
160488011631	alpha subunit interface [polypeptide binding]; other site
160488011632	active site
160488011633	substrate binding site [chemical binding]; other site
160488011634	Fe binding site [ion binding]; other site
160488011635	Flavodoxin reductases (ferredoxin-NADPH reductases) family 1 [Energy production and conversion]; Region: Hmp; COG1018
160488011636	Phthalate dioxygenase reductase (PDR) is an FMN-dependent reductase that mediates electron transfer from NADH to FMN to an iron sulfur cluster. PDR has an an N-terminal  ferrredoxin reductase (FNR)-like NAD(H) binding domain and a C-terminal iron-sulfur; Region: PDR_like; cd06185
160488011637	FMN-binding pocket [chemical binding]; other site
160488011638	flavin binding motif; other site
160488011639	phosphate binding motif [ion binding]; other site
160488011640	beta-alpha-beta structure motif; other site
160488011641	NAD binding pocket [chemical binding]; other site
160488011642	Ferredoxin [Energy production and conversion]; Region: Fdx; COG0633
160488011643	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
160488011644	catalytic loop [active]
160488011645	iron binding site [ion binding]; other site
160488011646	Transcriptional regulators [Transcription]; Region: FadR; COG2186
160488011647	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488011648	DNA-binding site [nucleotide binding]; DNA binding site
160488011649	FCD domain; Region: FCD; pfam07729
160488011650	benzoate transport; Region: 2A0115; TIGR00895
160488011651	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488011652	penicillin-binding protein 2; Region: pbp2_mrdA; TIGR03423
160488011653	Penicillin-binding Protein dimerisation domain; Region: PBP_dimer; pfam03717
160488011654	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; pfam00905
160488011655	Glutathione S-transferase [Posttranslational modification, protein turnover, chaperones]; Region: Gst; COG0625
160488011656	GST_N family, unknown subfamily 4; composed of uncharacterized bacterial proteins with similarity to GSTs. GSTs are cytosolic dimeric proteins involved in cellular detoxification by catalyzing the conjugation of glutathione (GSH) with a wide range of...; Region: GST_N_4; cd03056
160488011657	putative C-terminal domain interface [polypeptide binding]; other site
160488011658	putative GSH binding site (G-site) [chemical binding]; other site
160488011659	putative dimer interface [polypeptide binding]; other site
160488011660	C-terminal, alpha helical domain of the Glutathione S-transferase family; Region: GST_C_family; cl02776
160488011661	N-terminal domain interface [polypeptide binding]; other site
160488011662	conserverd hypothetical protein; Region: TIGR02448
160488011663	DNA-binding transcriptional regulator GlcC; Provisional; Region: PRK09990
160488011664	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488011665	DNA-binding site [nucleotide binding]; DNA binding site
160488011666	This entry represents the C-terminal ligand binding domain of many members of the GntR family; Region: FCD; smart00895
160488011667	glycolate oxidase subunit GlcD; Provisional; Region: PRK11230
160488011668	FAD binding domain; Region: FAD_binding_4; pfam01565
160488011669	glycolate oxidase FAD binding subunit; Provisional; Region: glcE; PRK11282
160488011670	FAD binding domain; Region: FAD_binding_4; pfam01565
160488011671	glycolate oxidase iron-sulfur subunit; Provisional; Region: glcF; PRK11274
160488011672	The HCP family of iron-sulfur proteins includes hybrid cluster protein (HCP), acetyl-CoA synthase (ACS), and carbon monoxide dehydrogenase (CODH), all of which contain [Fe4-S4] metal clusters at their active sites. These proteins have a conserved...; Region: HCP_like; cl14655
160488011673	Cysteine-rich domain; Region: CCG; pfam02754
160488011674	Cysteine-rich domain; Region: CCG; pfam02754
160488011675	Domain of unknown function (DUF336); Region: DUF336; cl01249
160488011676	Transcriptional regulators containing a DNA-binding HTH domain and an aminotransferase domain (MocR family) and their eukaryotic orthologs [Transcription / Amino acid transport and metabolism]; Region: ARO8; COG1167
160488011677	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488011678	DNA-binding site [nucleotide binding]; DNA binding site
160488011679	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
160488011680	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488011681	homodimer interface [polypeptide binding]; other site
160488011682	catalytic residue [active]
160488011683	putative cyanate transporter; Provisional; Region: cynX; PRK09705
160488011684	Arabinose-binding domain of AraC transcription regulator, N-term; Region: Arabinose_bd; pfam12625
160488011685	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
160488011686	SurA N-terminal domain; Region: SurA_N; pfam09312
160488011687	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488011688	beta-ketothiolase; Provisional; Region: PRK09051
160488011689	Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751
160488011690	dimer interface [polypeptide binding]; other site
160488011691	active site
160488011692	3-hydroxybutyryl-CoA dehydrogenase; Validated; Region: PRK05808
160488011693	3-hydroxyacyl-CoA dehydrogenase, NAD binding domain; Region: 3HCDH_N; pfam02737
160488011694	3-hydroxyacyl-CoA dehydrogenase, C-terminal domain; Region: 3HCDH; pfam00725
160488011695	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
160488011696	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
160488011697	Response regulator receiver domain; Region: Response_reg; pfam00072
160488011698	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488011699	active site
160488011700	phosphorylation site [posttranslational modification]
160488011701	intermolecular recognition site; other site
160488011702	dimerization interface [polypeptide binding]; other site
160488011703	Response regulator receiver domain; Region: Response_reg; pfam00072
160488011704	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488011705	active site
160488011706	phosphorylation site [posttranslational modification]
160488011707	intermolecular recognition site; other site
160488011708	dimerization interface [polypeptide binding]; other site
160488011709	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
160488011710	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488011711	dimer interface [polypeptide binding]; other site
160488011712	phosphorylation site [posttranslational modification]
160488011713	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488011714	ATP binding site [chemical binding]; other site
160488011715	Mg2+ binding site [ion binding]; other site
160488011716	G-X-G motif; other site
160488011717	CheB methylesterase; Region: CheB_methylest; pfam01339
160488011718	CheR methyltransferase, all-alpha domain; Region: CheR_N; pfam03705
160488011719	Methylase of chemotaxis methyl-accepting proteins [Cell motility and secretion / Signal transduction mechanisms]; Region: CheR; COG1352
160488011720	CheR methyltransferase, SAM binding domain; Region: CheR; pfam01739
160488011721	CHASE3 domain; Region: CHASE3; pfam05227
160488011722	GAF domain; Region: GAF; cl17456
160488011723	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488011724	dimer interface [polypeptide binding]; other site
160488011725	phosphorylation site [posttranslational modification]
160488011726	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488011727	ATP binding site [chemical binding]; other site
160488011728	Mg2+ binding site [ion binding]; other site
160488011729	G-X-G motif; other site
160488011730	Response regulator receiver domain; Region: Response_reg; pfam00072
160488011731	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488011732	active site
160488011733	phosphorylation site [posttranslational modification]
160488011734	intermolecular recognition site; other site
160488011735	dimerization interface [polypeptide binding]; other site
160488011736	Response regulator receiver domain; Region: Response_reg; pfam00072
160488011737	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488011738	active site
160488011739	phosphorylation site [posttranslational modification]
160488011740	intermolecular recognition site; other site
160488011741	Response regulator receiver domain; Region: Response_reg; pfam00072
160488011742	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488011743	active site
160488011744	phosphorylation site [posttranslational modification]
160488011745	intermolecular recognition site; other site
160488011746	dimerization interface [polypeptide binding]; other site
160488011747	Response regulator receiver domain; Region: Response_reg; pfam00072
160488011748	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488011749	active site
160488011750	phosphorylation site [posttranslational modification]
160488011751	intermolecular recognition site; other site
160488011752	dimerization interface [polypeptide binding]; other site
160488011753	Precorrin-6A synthase, the cobalamin biosynthesis enzyme CobF; Region: Precorrin-6A-synthase; cd11643
160488011754	active site
160488011755	SAM binding site [chemical binding]; other site
160488011756	homodimer interface [polypeptide binding]; other site
160488011757	outer membrane porin, OprD family; Region: OprD; pfam03573
160488011758	Glyoxalase I catalyzes the isomerization of the hemithioacetal, formed by a 2-oxoaldehyde and glutathione, to S-D-lactoylglutathione; Region: Glyoxalase_I; cd07233
160488011759	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
160488011760	dimer interface [polypeptide binding]; other site
160488011761	active site
160488011762	metal binding site [ion binding]; metal-binding site
160488011763	glutathione binding site [chemical binding]; other site
160488011764	shikimate 5-dehydrogenase; Reviewed; Region: PRK12550
160488011765	Shikimate dehydrogenase substrate binding domain; Region: Shikimate_dh_N; pfam08501
160488011766	NAD(P) binding domain of Shikimate dehydrogenase; Region: NAD_bind_Shikimate_DH; cd01065
160488011767	shikimate binding site; other site
160488011768	NAD(P) binding site [chemical binding]; other site
160488011769	Predicted transcriptional regulator [Transcription]; Region: COG2932
160488011770	Peptidase S24 LexA-like proteins are involved in the SOS response leading to the repair of single-stranded DNA within the bacterial cell. This family includes: the lambda repressor CI/C2 family and related bacterial prophage repressor proteins; LexA (EC...; Region: S24_LexA-like; cd06529
160488011771	Catalytic site [active]
160488011772	Protein of unknown function (DUF1654); Region: DUF1654; pfam07867
160488011773	Alginate lyase; Region: Alginate_lyase2; pfam08787
160488011774	N-methyltryptophan oxidase; Provisional; Region: solA; PRK11259
160488011775	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
160488011776	Predicted permeases [General function prediction only]; Region: RarD; COG2962
160488011777	Methyltransferase domain; Region: Methyltransf_31; pfam13847
160488011778	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488011779	S-adenosylmethionine binding site [chemical binding]; other site
160488011780	pyrroline-5-carboxylate reductase; Reviewed; Region: PRK11880
160488011781	NADP oxidoreductase coenzyme F420-dependent; Region: F420_oxidored; cl17232
160488011782	DNA-binding transcriptional regulator LysR; Provisional; Region: PRK11013
160488011783	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488011784	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
160488011785	dimerization interface [polypeptide binding]; other site
160488011786	Coproporphyrinogen III oxidase and related Fe-S oxidoreductases [Coenzyme metabolism]; Region: HemN; COG0635
160488011787	Phosphopantetheine attachment site; Region: PP-binding; pfam00550
160488011788	Phytanoyl-CoA dioxygenase (PhyH); Region: PhyH; cl17312
160488011789	This group of proteins belong to a large family of YjgF/YER057c/UK114-like proteins present in bacteria, archaea, and eukaryotes with no definitive function.   The conserved domain is similar in structure to chorismate mutase but there is no sequence...; Region: YjgF_YER057c_UK114_like_5; cd06153
160488011790	homotrimer interaction site [polypeptide binding]; other site
160488011791	putative active site [active]
160488011792	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
160488011793	Aminotransferase class I and II; Region: Aminotran_1_2; pfam00155
160488011794	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488011795	homodimer interface [polypeptide binding]; other site
160488011796	catalytic residue [active]
160488011797	Condensing enzymes; Family of enzymes that catalyze a (decarboxylating or non-decarboxylating) Claisen-like condensation reaction. Members are share strong structural similarity, and are involved in the synthesis and degradation of fatty acids, and the...; Region: cond_enzymes; cl09938
160488011798	active site
160488011799	The adenylation domain of nonribosomal peptide synthetases (NRPS); Region: A_NRPS; cd05930
160488011800	amino acid adenylation domain; Region: AA-adenyl-dom; TIGR01733
160488011801	acyl-activating enzyme (AAE) consensus motif; other site
160488011802	AMP binding site [chemical binding]; other site
160488011803	Major Facilitator Superfamily; Region: MFS_1; pfam07690
160488011804	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488011805	putative substrate translocation pore; other site
160488011806	diaminopimelate epimerase; Provisional; Region: PRK13577
160488011807	Diaminopimelate epimerase; Region: DAP_epimerase; pfam01678
160488011808	Diaminopimelate epimerase; Region: DAP_epimerase; pfam01678
160488011809	DNA breaking-rejoining enzymes, C-terminal catalytic domain. The DNA breaking-rejoining enzyme superfamily includes type IB topoisomerases and tyrosine recombinases that share the same fold in their catalytic domain containing six conserved active site...; Region: DNA_BRE_C; cl00213
160488011810	active site
160488011811	DNA binding site [nucleotide binding]
160488011812	Int/Topo IB signature motif; other site
160488011813	Y-family of DNA polymerases; Region: PolY; cl12025
160488011814	Transposase domain (DUF772); Region: DUF772; pfam05598
160488011815	Transposase and inactivated derivatives, IS5 family [DNA replication, recombination, and repair]; Region: COG3039
160488011816	Transposase DDE domain; Region: DDE_Tnp_1_6; pfam13751
160488011817	D-alanyl-D-alanine endopeptidase; Provisional; Region: pbpG; PRK11669
160488011818	D-alanyl-D-alanine carboxypeptidase; Region: Peptidase_S11; pfam00768
160488011819	L-lysine 6-monooxygenase (NADPH-requiring); Region: K_oxygenase; pfam13434
160488011820	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
160488011821	Uncharacterized iron-regulated membrane protein [Function unknown]; Region: PiuB; COG3182
160488011822	PepSY-associated TM helix; Region: PepSY_TM_3; pfam13706
160488011823	Peptidase propeptide and YPEB domain; Region: PepSY; pfam03413
160488011824	PepSY-associated TM helix; Region: PepSY_TM_2; pfam13703
160488011825	Metal binding protein AcdA.  These proteins have been shown to function in the ABC uptake of Zn2+ and Mn2+ and in competence for genetic transformation and adhesion. The AcdA proteins belong to the TroA superfamily of helical backbone metal receptor...; Region: AdcA; cd01017
160488011826	Periplasmic solute binding protein family; Region: SBP_bac_9; pfam01297
160488011827	metal binding site [ion binding]; metal-binding site
160488011828	ABC-type Mn/Zn transport systems, ATPase component [Inorganic ion transport and metabolism]; Region: ZnuC; COG1121
160488011829	ATP-binding cassette domain of the metal-type transporters; Region: ABC_Metallic_Cations; cd03235
160488011830	ABC-type Mn2+/Zn2+ transport systems, permease components [Inorganic ion transport and metabolism]; Region: ZnuB; COG1108
160488011831	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
160488011832	ABC-ATPase subunit  interface; other site
160488011833	dimer interface [polypeptide binding]; other site
160488011834	putative PBP binding regions; other site
160488011835	Periplasmic solute binding protein family; Region: SBP_bac_9; pfam01297
160488011836	Helical backbone metal receptor (TroA-like domain). These proteins have been shown to function in the ABC transport of ferric siderophores and metal ions such as Mn2+, Fe3+, Cu2+ and/or Zn2+.  Their ligand binding site is formed in the interface between...; Region: TroA-like; cl00262
160488011837	Protein of unknown function (DUF1615); Region: DUF1615; pfam07759
160488011838	YcaC related amidohydrolases; E.coli YcaC is an homooctameric hydrolase with unknown specificity. Despite its weak sequence similarity, it is structurally related to other amidohydrolases and shares conserved active site residues with them; Region: YcaC_related; cd01012
160488011839	catalytic triad [active]
160488011840	dimer interface [polypeptide binding]; other site
160488011841	conserved cis-peptide bond; other site
160488011842	Predicted thioesterase involved in non-ribosomal peptide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: GrsT; COG3208
160488011843	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3251
160488011844	LysR family transcriptional regulator; Provisional; Region: PRK14997
160488011845	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488011846	The C-terminal substrate binding domain of LysR-type transcriptional regulator CrgA and its related homologs, contains the type 2 periplasmic binding domain; Region: PBP2_CrgA_like; cd08422
160488011847	putative effector binding pocket; other site
160488011848	dimerization interface [polypeptide binding]; other site
160488011849	alpha/beta hydrolase fold; Region: Abhydrolase_3; pfam07859
160488011850	Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326
160488011851	bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II-like protein; Provisional; Region: PRK12485
160488011852	3,4-dihydroxy-2-butanone 4-phosphate synthase; Region: DHBP_synthase; pfam00926
160488011853	GTP cyclohydrolase II; Region: GTP_cyclohydro2; pfam00925
160488011854	dimerization interface [polypeptide binding]; other site
160488011855	active site
160488011856	Bacterial extracellular solute-binding protein; Region: SBP_bac_1; pfam01547
160488011857	Bacterial extracellular solute-binding protein; Region: SBP_bac_8; pfam13416
160488011858	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488011859	dimer interface [polypeptide binding]; other site
160488011860	conserved gate region; other site
160488011861	putative PBP binding loops; other site
160488011862	ABC-ATPase subunit interface; other site
160488011863	ABC-type spermidine/putrescine transport system, permease component II [Amino acid transport and metabolism]; Region: PotC; COG1177
160488011864	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488011865	dimer interface [polypeptide binding]; other site
160488011866	conserved gate region; other site
160488011867	putative PBP binding loops; other site
160488011868	ABC-ATPase subunit interface; other site
160488011869	ABC-type spermidine/putrescine transport systems, ATPase components [Amino acid transport and metabolism]; Region: PotA; COG3842
160488011870	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488011871	Walker A/P-loop; other site
160488011872	ATP binding site [chemical binding]; other site
160488011873	Q-loop/lid; other site
160488011874	ABC transporter signature motif; other site
160488011875	Walker B; other site
160488011876	D-loop; other site
160488011877	H-loop/switch region; other site
160488011878	TOBE domain; Region: TOBE_2; pfam08402
160488011879	ABC-type phosphate transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: PstS; COG0226
160488011880	Outer membrane protein and related peptidoglycan-associated (lipo)proteins [Cell envelope biogenesis, outer membrane]; Region: OmpA; COG2885
160488011881	Peptidoglycan binding domains similar to the C-terminal domain of outer-membrane protein OmpA; Region: OmpA_C-like; cd07185
160488011882	ligand binding site [chemical binding]; other site
160488011883	glutathione reductase; Validated; Region: PRK06116
160488011884	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
160488011885	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
160488011886	Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852
160488011887	INTRON07; Group II intron; Group II intron most similar to the Group II intron from Pseudomonas alcaligenes.
160488011888	RT_G2_intron: Reverse transcriptases (RTs) with group II intron origin. RT transcribes DNA using RNA as template. Proteins in this subfamily are found in bacterial and mitochondrial group II introns. Their most probable ancestor was a retrotransposable...; Region: RT_G2_intron; cd01651
160488011889	Reverse transcriptase (RNA-dependent DNA polymerase); Region: RVT_1; pfam00078
160488011890	putative active site [active]
160488011891	putative NTP binding site [chemical binding]; other site
160488011892	putative nucleic acid binding site [nucleotide binding]; other site
160488011893	Group II intron, maturase-specific domain; Region: GIIM; pfam08388
160488011894	Prokaryotic UGPase catalyses the synthesis of UDP-glucose; Region: UGPase_prokaryotic; cd02541
160488011895	dTDP-glucose pyrophosphorylase [Cell envelope biogenesis, outer membrane]; Region: RfbA; COG1209
160488011896	active site
160488011897	tetramer interface; other site
160488011898	Cytochrome c [Energy production and conversion]; Region: COG3258
160488011899	Cytochrome c; Region: Cytochrom_C; pfam00034
160488011900	Cytochrome c553 [Energy production and conversion]; Region: COG2863
160488011901	Cytochrome c; Region: Cytochrom_C; cl11414
160488011902	Domain of unknown function (DUF1883); Region: DUF1883; pfam08980
160488011903	Dioxygenases related to 2-nitropropane dioxygenase [General function prediction only]; Region: COG2070
160488011904	2-Nitropropane dioxygenase (NPD), one of the nitroalkane oxidizing enzyme families, catalyzes oxidative denitrification of nitroalkanes to their corresponding carbonyl compounds and nitrites. NDP is a member of the NAD(P)H-dependent flavin oxidoreductase...; Region: NPD_like; cd04730
160488011905	FMN binding site [chemical binding]; other site
160488011906	substrate binding site [chemical binding]; other site
160488011907	putative catalytic residue [active]
160488011908	ABC-type molybdate transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: ModA; COG0725
160488011909	Bacterial extracellular solute-binding protein; Region: SBP_bac_1; cl17199
160488011910	ABC-type sulfate transport system, permease component [Posttranslational modification, protein turnover, chaperones]; Region: CysU; COG0555
160488011911	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488011912	dimer interface [polypeptide binding]; other site
160488011913	conserved gate region; other site
160488011914	putative PBP binding loops; other site
160488011915	ABC-ATPase subunit interface; other site
160488011916	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488011917	ABC-type molybdate transport system, ATPase component [Inorganic ion transport and metabolism]; Region: ModC; COG4148
160488011918	Walker A/P-loop; other site
160488011919	ATP binding site [chemical binding]; other site
160488011920	Q-loop/lid; other site
160488011921	ABC transporter signature motif; other site
160488011922	Walker B; other site
160488011923	D-loop; other site
160488011924	H-loop/switch region; other site
160488011925	TOBE domain; Region: TOBE; cl01440
160488011926	Topoisomerase IB [DNA replication, recombination, and repair]; Region: COG3569
160488011927	DNA topoisomerase IB, C-terminal catalytic domain. Topoisomerase I promotes the relaxation of both positive and negative DNA superhelical tension by introducing a transient single-stranded break in duplex DNA. This function is vital for the processes of...; Region: Topo_IB_C; cd00659
160488011928	active site
160488011929	DNA binding site [nucleotide binding]
160488011930	Int/Topo IB signature motif; other site
160488011931	catalytic residues [active]
160488011932	carbon storage regulator; Provisional; Region: PRK01712
160488011933	Response regulator receiver domain; Region: Response_reg; pfam00072
160488011934	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488011935	active site
160488011936	phosphorylation site [posttranslational modification]
160488011937	intermolecular recognition site; other site
160488011938	dimerization interface [polypeptide binding]; other site
160488011939	circadian clock protein KaiC; Reviewed; Region: PRK09302
160488011940	RecA-like NTPases. This family includes the NTP binding domain of F1 and V1 H+ATPases, DnaB and related helicases as well as bacterial RecA and related eukaryotic and archaeal recombinases. This group also includes bacterial conjugation proteins and...; Region: RecA-like_NTPases; cl17233
160488011941	Walker A motif; other site
160488011942	ATP binding site [chemical binding]; other site
160488011943	Walker B motif; other site
160488011944	RecA-like NTPases. This family includes the NTP binding domain of F1 and V1 H+ATPases, DnaB and related helicases as well as bacterial RecA and related eukaryotic and archaeal recombinases. This group also includes bacterial conjugation proteins and...; Region: RecA-like_NTPases; cl17233
160488011945	RecA-like NTPases. This family includes the NTP binding domain of F1 and V1 H+ATPases, DnaB and related helicases as well as bacterial RecA and related eukaryotic and archaeal recombinases. This group also includes bacterial conjugation proteins and...; Region: RecA-like_NTPases; cl17233
160488011946	Walker A motif; other site
160488011947	Walker A motif; other site
160488011948	ATP binding site [chemical binding]; other site
160488011949	Walker B motif; other site
160488011950	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488011951	PAS domain; Region: PAS_9; pfam13426
160488011952	putative active site [active]
160488011953	heme pocket [chemical binding]; other site
160488011954	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488011955	dimer interface [polypeptide binding]; other site
160488011956	phosphorylation site [posttranslational modification]
160488011957	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488011958	ATP binding site [chemical binding]; other site
160488011959	Mg2+ binding site [ion binding]; other site
160488011960	G-X-G motif; other site
160488011961	Predicted membrane protein [Function unknown]; Region: COG2259
160488011962	Cinnamyl alcohol dehydrogenases (CAD); Region: CAD3; cd08297
160488011963	ethanol-active dehydrogenase/acetaldehyde-active reductase; Provisional; Region: PRK09422
160488011964	NAD binding site [chemical binding]; other site
160488011965	substrate binding site [chemical binding]; other site
160488011966	catalytic Zn binding site [ion binding]; other site
160488011967	tetramer interface [polypeptide binding]; other site
160488011968	structural Zn binding site [ion binding]; other site
160488011969	Helix-Turn-Helix DNA binding domain of transcription regulators from the MerR superfamily; Region: HTH_MerR-SF; cl02600
160488011970	MerR HTH family regulatory protein; Region: MerR_1; pfam13411
160488011971	DNA binding residues [nucleotide binding]
160488011972	Pseudomonas fluorescens MupV-like, extended (e) SDRs; Region: MupV_like_SDR_e; cd05263
160488011973	NAD dependent epimerase/dehydratase family; Region: Epimerase; pfam01370
160488011974	putative NAD(P) binding site [chemical binding]; other site
160488011975	active site
160488011976	putative substrate binding site [chemical binding]; other site
160488011977	L-Aminopeptidase D-amidase/D-esterase (DmpA) family; DmpA catalyzes the release of N-terminal D and L amino acids from peptide susbtrates. DmpA is synthesized as a single polypeptide precursor, which is autocatalytically cleaved to the active...; Region: DmpA; cd02253
160488011978	homodimer interface [polypeptide binding]; other site
160488011979	homotetramer interface [polypeptide binding]; other site
160488011980	active site pocket [active]
160488011981	cleavage site
160488011982	putrescine transporter subunit: periplasmic-binding component of ABC superfamily; Provisional; Region: PRK10682
160488011983	Bacterial extracellular solute-binding protein; Region: SBP_bac_1; cl17199
160488011984	Predicted amidohydrolase [General function prediction only]; Region: COG0388
160488011985	Pseudomonas sp. MCI3434 R-amidase and related proteins (putative class 13 nitrilases); Region: R-amidase_like; cd07576
160488011986	putative active site [active]
160488011987	catalytic triad [active]
160488011988	putative dimer interface [polypeptide binding]; other site
160488011989	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
160488011990	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
160488011991	DNA binding residues [nucleotide binding]
160488011992	dimerization interface [polypeptide binding]; other site
160488011993	PHAGE01; prophage; lysogenic bacteriophage bearing similarity to bacteriophage Mu and Lambda.   insertion into tRNA-Cys-1. attL/R=ctgcggggctttcgaatggtggaggccgaggtcggaatcgaaccggcgtag acggatttgcaatccg.
160488011994	RTX toxins and related Ca2+-binding proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG2931
160488011995	Peptidase M10 serralysin C terminal; Region: Peptidase_M10_C; pfam08548
160488011996	BNR repeat-like domain; Region: BNR_2; pfam13088
160488011997	The lysozyme from bacteriophage lambda hydrolyses the beta-1,4-glycosidic bond between N-acetylmuramic acid (MurNAc) and N-acetylglucosamine (GlcNAc), as do other lysozymes.  But unlike other lysozymes, bacteriophage lambda does not produce a reducing...; Region: bacteriophage_lambda_lysozyme; cd00736
160488011998	N-acetyl-D-glucosamine binding site [chemical binding]; other site
160488011999	catalytic residue [active]
160488012000	Pentraxins are plasma proteins characterized by their pentameric discoid assembly and their Ca2+ dependent ligand binding, such as Serum amyloid P component (SAP) and C-reactive Protein (CRP), which are cytokine-inducible acute-phase proteins implicated...; Region: PTX; cl00102
160488012001	Uncharacterized protein conserved in bacteria (DUF2313); Region: DUF2313; pfam10076
160488012002	Uncharacterized homolog of phage Mu protein gp47 [Function unknown]; Region: XkdT; COG3299
160488012003	Phage protein GP46; Region: GP46; pfam07409
160488012004	Bacteriophage Mu Gp45 protein; Region: Phage_Mu_Gp45; pfam06890
160488012005	Mu-like prophage tail protein gpP [General function prediction only]; Region: COG4379
160488012006	Phage late control gene D protein (GPD); Region: Phage_GPD; pfam05954
160488012007	Mu-like prophage DNA circulation protein [General function prediction only]; Region: COG4228
160488012008	DNA circulation protein N-terminus; Region: DNA_circ_N; pfam07157
160488012009	phage tail tape measure protein, TP901 family, core region; Region: tape_meas_TP901; TIGR01760
160488012010	Mu-like prophage FluMu protein gp41; Region: FluMu_gp41; pfam10109
160488012011	Phage tail tube protein; Region: Tail_tube; pfam10618
160488012012	INTRON08; Group II intron; Group II intron most similar to the Group II intron from Pseudomonas alcaligenes.
160488012013	RT_G2_intron: Reverse transcriptases (RTs) with group II intron origin. RT transcribes DNA using RNA as template. Proteins in this subfamily are found in bacterial and mitochondrial group II introns. Their most probable ancestor was a retrotransposable...; Region: RT_G2_intron; cd01651
160488012014	Reverse transcriptase (RNA-dependent DNA polymerase); Region: RVT_1; pfam00078
160488012015	putative active site [active]
160488012016	putative NTP binding site [chemical binding]; other site
160488012017	putative nucleic acid binding site [nucleotide binding]; other site
160488012018	Group II intron, maturase-specific domain; Region: GIIM; pfam08388
160488012019	Mu-like prophage tail sheath protein gpL [General function prediction only]; Region: COG4386
160488012020	Phage tail sheath protein; Region: Phage_sheath_1; pfam04984
160488012021	Protein of unknown function (DUF2635); Region: DUF2635; pfam10948
160488012022	Phage head-tail joining protein; Region: Phage_H_T_join; cl11461
160488012023	phage major capsid protein, HK97 family; Region: major_cap_HK97; TIGR01554
160488012024	Phage capsid family; Region: Phage_capsid; pfam05065
160488012025	Signal peptide peptidase A (SppA) 36K type, a serine protease, has catalytic Ser-Lys dyad; Region: S49_Sppa_36K_type; cd07022
160488012026	signal peptide peptidase SppA, 36K type; Region: SppA_dom; TIGR00706
160488012027	tandem repeat interface [polypeptide binding]; other site
160488012028	oligomer interface [polypeptide binding]; other site
160488012029	active site residues [active]
160488012030	Phage portal protein; Region: Phage_portal; pfam04860
160488012031	Phage-related protein [Function unknown]; Region: COG4695
160488012032	Phage terminase-like protein, large subunit [General function prediction only]; Region: COG4626
160488012033	Phage terminase, small subunit; Region: Terminase_4; pfam05119
160488012034	HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085
160488012035	active site
160488012036	Phage holin family (Lysis protein S); Region: Phage_holin_3; pfam05106
160488012037	ribonuclease, Rne/Rng family; Region: RNaseEG; TIGR00757
160488012038	Bacteriophage P4 integrase. P4-like integrases are found in temperate bacteriophages, integrative plasmids, pathogenicity and symbiosis islands, and other mobile genetic elements.  They share the same fold in their catalytic domain and the overall...; Region: INT_P4; cd00801
160488012039	Integrase [DNA replication, recombination, and repair]; Region: XerC; COG0582
160488012040	active site
160488012041	Int/Topo IB signature motif; other site
160488012042	VRR-NUC domain; Region: VRR_NUC; pfam08774
160488012043	Protein of unknown function (DUF1364); Region: DUF1364; pfam07102
160488012044	DnaB-like helicase N terminal domain; Region: DnaB; pfam00772
160488012045	phage replicative helicase, DnaB family, HK022 subfamily; Region: phage_DnaB; TIGR03600
160488012046	DnaB helicase C terminal domain. The hexameric helicase DnaB unwinds the DNA duplex at the  chromosome replication fork. Although the mechanism by which DnaB both couples ATP hydrolysis to translocation along DNA and denatures the duplex is unknown, a...; Region: DnaB_C; cd00984
160488012047	Walker A motif; other site
160488012048	ATP binding site [chemical binding]; other site
160488012049	Walker B motif; other site
160488012050	DNA binding loops [nucleotide binding]
160488012051	phage replication protein O, N-terminal domain; Region: phage_O_Nterm; TIGR01610
160488012052	Uncharacterized protein conserved in bacteria, prophage-related [Function unknown]; Region: COG4197
160488012053	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
160488012054	non-specific DNA binding site [nucleotide binding]; other site
160488012055	Predicted transcriptional regulator [Transcription]; Region: COG2932
160488012056	salt bridge; other site
160488012057	sequence-specific DNA binding site [nucleotide binding]; other site
160488012058	Peptidase S24 LexA-like proteins are involved in the SOS response leading to the repair of single-stranded DNA within the bacterial cell. This family includes: the lambda repressor CI/C2 family and related bacterial prophage repressor proteins; LexA (EC...; Region: S24_LexA-like; cd06529
160488012059	Catalytic site [active]
160488012060	HIRAN domain; Region: HIRAN; pfam08797
160488012061	Predicted nuclease of the RNAse H fold, HicB family [General    function prediction only]; Region: HicB; COG4226
160488012062	HicB family; Region: HicB; pfam05534
160488012063	Protein of unknown function (DUF1654); Region: DUF1654; pfam07867
160488012064	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
160488012065	DNA binding residues [nucleotide binding]
160488012066	Transketolase [Carbohydrate transport and metabolism]; Region: TktA; COG0021
160488012067	hypothetical protein; Provisional; Region: PRK04140
160488012068	Site-specific DNA methylase [DNA replication, recombination, and repair]; Region: Dcm; COG0270
160488012069	Cytosine-C5 specific DNA methylases; Methyl transfer reactions play an important role in many aspects of biology. Cytosine-specific DNA methylases are found both in prokaryotes and eukaryotes. DNA methylation, or the covalent addition of a methyl group...; Region: Cyt_C5_DNA_methylase; cd00315
160488012070	cofactor binding site; other site
160488012071	DNA binding site [nucleotide binding]
160488012072	substrate interaction site [chemical binding]; other site
160488012073	Cytosine-C5 specific DNA methylases; Methyl transfer reactions play an important role in many aspects of biology. Cytosine-specific DNA methylases are found both in prokaryotes and eukaryotes. DNA methylation, or the covalent addition of a methyl group...; Region: Cyt_C5_DNA_methylase; cd00315
160488012074	Protein of unknown function (DUF2591); Region: DUF2591; cl11584
160488012075	Domain of unknown function (DUF4224); Region: DUF4224; pfam13986
160488012076	DNA breaking-rejoining enzymes, C-terminal catalytic domain. The DNA breaking-rejoining enzyme superfamily includes type IB topoisomerases and tyrosine recombinases that share the same fold in their catalytic domain containing six conserved active site...; Region: DNA_BRE_C; cl00213
160488012077	Lambda integrase, C-terminal catalytic domain. Lambda-type integrases catalyze site-specific integration and excision of temperate bacteriophages and other mobile genetic elements to and from the bacterial host chromosome.  They belong to the superfamily...; Region: INT_Lambda_C; cd00800
160488012078	dimer interface [polypeptide binding]; other site
160488012079	active site
160488012080	Int/Topo IB signature motif; other site
160488012081	Peptidase family S49 N-terminal; Region: Peptidase_S49_N; pfam08496
160488012082	putative inner membrane peptidase; Provisional; Region: PRK11778
160488012083	Signal peptide peptidase A (SppA), a serine protease, has catalytic Ser-Lys dyad; Region: S49_Sppa_N_C; cd07023
160488012084	tandem repeat interface [polypeptide binding]; other site
160488012085	oligomer interface [polypeptide binding]; other site
160488012086	active site residues [active]
160488012087	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
160488012088	catalytic core [active]
160488012089	SCP-2 sterol transfer family; Region: SCP2; pfam02036
160488012090	Phosphotransferase enzyme family; Region: APH; pfam01636
160488012091	Acyl-CoA dehydrogenase (ACAD) 10 and 11, N-terminal domain, and similar proteins. This subfamily is part of a larger superfamily that includes the catalytic domains of other kinases, such as the typical serine/threonine/tyrosine protein kinases (PKs); Region: ACAD10_11_like; cd05154
160488012092	putative active site [active]
160488012093	putative substrate binding site [chemical binding]; other site
160488012094	ATP binding site [chemical binding]; other site
160488012095	short chain dehydrogenase; Provisional; Region: PRK07035
160488012096	classical (c) SDRs; Region: SDR_c; cd05233
160488012097	NAD(P) binding site [chemical binding]; other site
160488012098	active site
160488012099	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488012100	S-adenosylmethionine binding site [chemical binding]; other site
160488012101	Domain of unknown function (DUF3315); Region: DUF3315; pfam11776
160488012102	Permease SLC13 (solute carrier 13).  The sodium/dicarboxylate cotransporter NaDC-1 has been shown to translocate Krebs cycle intermediates such as succinate, citrate, and alpha-ketoglutarate across plasma membranes rabbit, human, and rat kidney. It is...; Region: SLC13_permease; cd01115
160488012103	transmembrane helices; other site
160488012104	Di- and tricarboxylate transporters [Inorganic ion transport and metabolism]; Region: CitT; COG0471
160488012105	TrkA-C domain; Region: TrkA_C; pfam02080
160488012106	TrkA-C domain; Region: TrkA_C; pfam02080
160488012107	Permease SLC13 (solute carrier 13).  The sodium/dicarboxylate cotransporter NaDC-1 has been shown to translocate Krebs cycle intermediates such as succinate, citrate, and alpha-ketoglutarate across plasma membranes rabbit, human, and rat kidney. It is...; Region: SLC13_permease; cd01115
160488012108	transmembrane helices; other site
160488012109	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
160488012110	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488012111	metal binding site [ion binding]; metal-binding site
160488012112	active site
160488012113	I-site; other site
160488012114	hypothetical protein; Provisional; Region: PRK10621
160488012115	Sulfite exporter TauE/SafE; Region: TauE; pfam01925
160488012116	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488012117	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488012118	The C-terminal substrate binding domain of LysR-type transcriptional regulator CrgA and its related homologs, contains the type 2 periplasmic binding domain; Region: PBP2_CrgA_like; cd08422
160488012119	putative effector binding pocket; other site
160488012120	dimerization interface [polypeptide binding]; other site
160488012121	outer membrane porin, OprD family; Region: OprD; pfam03573
160488012122	4-hydroxyphenylacetate permease; Region: HpaX; TIGR02332
160488012123	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488012124	putative substrate translocation pore; other site
160488012125	Isochorismatase family; Region: Isochorismatase; pfam00857
160488012126	N-carbamoylsarcosine amidohydrolase (CSHase) hydrolyzes N-carbamoylsarcosine to sarcosine, carbon dioxide and ammonia. CSHase is involved in one of the two alternative pathways for creatinine degradation to glycine in microorganisms.This...; Region: CSHase; cd01015
160488012127	catalytic triad [active]
160488012128	substrate binding site [chemical binding]; other site
160488012129	domain interfaces; other site
160488012130	conserved cis-peptide bond; other site
160488012131	Asp/Glu/Hydantoin racemase; Region: Asp_Glu_race; cl00518
160488012132	Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697
160488012133	hypothetical protein; Provisional; Region: PRK06847
160488012134	ubiquinone biosynthesis hydroxylase family protein; Provisional; Region: PRK07608; cl17314
160488012135	Leucyl aminopeptidase (aminopeptidase T) [Amino acid transport and metabolism]; Region: AmpS; COG2309
160488012136	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
160488012137	Winged helix DNA-binding domain; Region: HTH_27; pfam13463
160488012138	Aerobic-type carbon monoxide dehydrogenase, small subunit CoxS/CutS homologs [Energy production and conversion]; Region: CoxS; COG2080
160488012139	2Fe-2S iron-sulfur cluster binding domain; Region: Fer2_3; pfam13085
160488012140	[2Fe-2S] binding domain; Region: Fer2_2; pfam01799
160488012141	Molybdopterin-binding domain of aldehyde dehydrogenase; Region: Ald_Xan_dh_C2; pfam02738
160488012142	Aerobic-type carbon monoxide dehydrogenase, large subunit CoxL/CutL homologs [Energy production and conversion]; Region: CoxL; COG1529
160488012143	Aldehyde oxidase and xanthine dehydrogenase, a/b hammerhead domain; Region: Ald_Xan_dh_C; smart01008
160488012144	Molybdopterin-binding domain of aldehyde dehydrogenase; Region: Ald_Xan_dh_C2; pfam02738
160488012145	Molybdopterin-binding domain of aldehyde dehydrogenase; Region: Ald_Xan_dh_C2; pfam02738
160488012146	Cytochrome c; Region: Cytochrom_C; pfam00034
160488012147	Cytochrome c, mono- and diheme variants [Energy production and conversion]; Region: CccA; COG2010
160488012148	Cytochrome c, mono- and diheme variants [Energy production and conversion]; Region: CccA; COG2010
160488012149	Cytochrome C oxidase, cbb3-type, subunit III; Region: Cytochrome_CBB3; pfam13442
160488012150	pyrimidine utilization regulatory protein R; Region: RutR; TIGR03613
160488012151	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
160488012152	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
160488012153	dimer interface [polypeptide binding]; other site
160488012154	Methyl-accepting chemotaxis protein (MCP) signalling domain; Region: MCPsignal; pfam00015
160488012155	putative CheW interface [polypeptide binding]; other site
160488012156	3-oxoacid CoA-transferase, A subunit; Region: pcaI_scoA_fam; TIGR02429
160488012157	3-oxoacid CoA-transferase, B subunit; Region: pcaJ_scoB_fam; TIGR02428
160488012158	Trk-type K+ transport systems, membrane components [Inorganic ion transport and metabolism]; Region: TrkG; COG0168
160488012159	potassium uptake protein, TrkH family; Region: 2a38; TIGR00933
160488012160	TRAP transporter solute receptor, TAXI family; Region: TRAP_TAXI; TIGR02122
160488012161	TRAP-type uncharacterized transport system, periplasmic component [General function prediction only]; Region: Imp; COG2358
160488012162	TRAP transporter, 4TM/12TM fusion protein; Region: TRAP_fused; TIGR02123
160488012163	DctM-like transporters; Region: DctM; pfam06808
160488012164	Domain of unknown function (DUF1850); Region: DUF1850; pfam08905
160488012165	BCCT family transporter; Region: BCCT; cl00569
160488012166	Na+/H+ antiporter 1; Region: Na_H_antiport_1; cl01133
160488012167	ClC chloride channel family. These protein sequences, closely related to the ClC Eric family, are putative halogen ion (Cl-, Br- and I-) transport proteins found in eubacteria. They belong to the ClC superfamily of chloride ion channels, which share a...; Region: EriC_like; cd01034
160488012168	Chloride channel protein EriC [Inorganic ion transport and metabolism]; Region: EriC; COG0038
160488012169	putative ion selectivity filter; other site
160488012170	putative pore gating glutamate residue; other site
160488012171	putative H+/Cl- coupling transport residue; other site
160488012172	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
160488012173	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
160488012174	Protein of unknown function (DUF1264); Region: DUF1264; pfam06884
160488012175	Transposase C of IS166 homeodomain; Region: LZ_Tnp_IS66; pfam13007
160488012176	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3436
160488012177	putative Helix-turn-helix domain of transposase IS66; Region: HTH_Tnp_IS66; pfam13005
160488012178	Transposase IS66 family; Region: DDE_Tnp_IS66; pfam03050
160488012179	IS66 C-terminal element; Region: DDE_Tnp_IS66_C; pfam13817
160488012180	IS66 Orf2 like protein; Region: TnpB_IS66; pfam05717
160488012181	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3436
160488012182	Transposase; Region: HTH_Tnp_1; pfam01527
160488012183	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
160488012184	Members of the Nudix hydrolase superfamily catalyze the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+, for their activity and contain a highly...; Region: Nudix_Hydrolase_10; cd04667
160488012185	nudix motif; other site
160488012186	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
160488012187	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488012188	dimer interface [polypeptide binding]; other site
160488012189	phosphorylation site [posttranslational modification]
160488012190	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488012191	ATP binding site [chemical binding]; other site
160488012192	Mg2+ binding site [ion binding]; other site
160488012193	G-X-G motif; other site
160488012194	FOG: CheY-like receiver [Signal transduction mechanisms]; Region: CheY; COG0784
160488012195	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488012196	active site
160488012197	phosphorylation site [posttranslational modification]
160488012198	intermolecular recognition site; other site
160488012199	dimerization interface [polypeptide binding]; other site
160488012200	Glutathione-dependent formaldehyde dehydrogenase related proteins, child 1; Region: FDH_like_1; cd08283
160488012201	Threonine dehydrogenase and related Zn-dependent dehydrogenases [Amino acid transport and metabolism / General function prediction only]; Region: Tdh; COG1063
160488012202	NAD binding site [chemical binding]; other site
160488012203	catalytic Zn binding site [ion binding]; other site
160488012204	structural Zn binding site [ion binding]; other site
160488012205	Phospholipase_D-nuclease N-terminal; Region: PLDc_N; pfam13396
160488012206	short chain dehydrogenase; Provisional; Region: PRK06139
160488012207	classical (c) SDR, subgroup 3; Region: SDR_c3; cd05360
160488012208	putative NAD(P) binding site [chemical binding]; other site
160488012209	active site
160488012210	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488012211	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488012212	LysR substrate binding domain; Region: LysR_substrate; pfam03466
160488012213	dimerization interface [polypeptide binding]; other site
160488012214	YjgF, YER057c, and UK114 belong to a large family of proteins present in bacteria, archaea, and eukaryotes with no definitive function. The conserved domain is similar in structure to chorismate mutase but there is no sequence similarity and no...; Region: YjgF_YER057c_UK114_family; cd00448
160488012215	homotrimer interaction site [polypeptide binding]; other site
160488012216	putative active site [active]
160488012217	YcaC related amidohydrolases; E.coli YcaC is an homooctameric hydrolase with unknown specificity. Despite its weak sequence similarity, it is structurally related to other amidohydrolases and shares conserved active site residues with them; Region: YcaC_related; cd01012
160488012218	Isochorismatase family; Region: Isochorismatase; pfam00857
160488012219	catalytic triad [active]
160488012220	dimer interface [polypeptide binding]; other site
160488012221	conserved cis-peptide bond; other site
160488012222	Transposase; Region: HTH_Tnp_1; pfam01527
160488012223	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
160488012224	IS66 Orf2 like protein; Region: TnpB_IS66; pfam05717
160488012225	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3436
160488012226	Transposase C of IS166 homeodomain; Region: LZ_Tnp_IS66; pfam13007
160488012227	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3436
160488012228	putative Helix-turn-helix domain of transposase IS66; Region: HTH_Tnp_IS66; pfam13005
160488012229	Transposase IS66 family; Region: DDE_Tnp_IS66; pfam03050
160488012230	IS66 C-terminal element; Region: DDE_Tnp_IS66_C; pfam13817
160488012231	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488012232	AAA domain; Region: AAA_23; pfam13476
160488012233	Walker A/P-loop; other site
160488012234	ATP binding site [chemical binding]; other site
160488012235	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488012236	Q-loop/lid; other site
160488012237	AAA domain; Region: AAA_21; pfam13304
160488012238	ABC transporter signature motif; other site
160488012239	Walker B; other site
160488012240	D-loop; other site
160488012241	H-loop/switch region; other site
160488012242	lipopolysaccharide core biosynthesis protein; Provisional; Region: PRK09822
160488012243	Transposase C of IS166 homeodomain; Region: LZ_Tnp_IS66; pfam13007
160488012244	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3436
160488012245	putative Helix-turn-helix domain of transposase IS66; Region: HTH_Tnp_IS66; pfam13005
160488012246	Transposase IS66 family; Region: DDE_Tnp_IS66; pfam03050
160488012247	IS66 C-terminal element; Region: DDE_Tnp_IS66_C; pfam13817
160488012248	IS66 Orf2 like protein; Region: TnpB_IS66; pfam05717
160488012249	DNA breaking-rejoining enzymes, C-terminal catalytic domain. The DNA breaking-rejoining enzyme superfamily includes type IB topoisomerases and tyrosine recombinases that share the same fold in their catalytic domain containing six conserved active site...; Region: DNA_BRE_C; cl00213
160488012250	active site
160488012251	DNA binding site [nucleotide binding]
160488012252	Int/Topo IB signature motif; other site
160488012253	Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase; Region: HATPase_c_3; pfam13589
160488012254	ATP binding site [chemical binding]; other site
160488012255	Mg2+ binding site [ion binding]; other site
160488012256	G-X-G motif; other site
160488012257	Site-specific DNA methylase [DNA replication, recombination, and repair]; Region: Dcm; COG0270
160488012258	Cytosine-C5 specific DNA methylases; Methyl transfer reactions play an important role in many aspects of biology. Cytosine-specific DNA methylases are found both in prokaryotes and eukaryotes. DNA methylation, or the covalent addition of a methyl group...; Region: Cyt_C5_DNA_methylase; cd00315
160488012259	cofactor binding site; other site
160488012260	DNA binding site [nucleotide binding]
160488012261	substrate interaction site [chemical binding]; other site
160488012262	Integral membrane protein, interacts with FtsH [General function prediction only]; Region: COG0670
160488012263	YccA-like proteins; Region: YccA_like; cd10433
160488012264	Xanthine/uracil permeases [Nucleotide transport and metabolism]; Region: UraA; COG2233
160488012265	sulfur transfer complex subunit TusD; Validated; Region: PRK00207
160488012266	sulfur relay protein TusC; Validated; Region: PRK00211
160488012267	sulfur relay protein TusB/DsrH; Region: sulf_tusB_dsrH; TIGR03011
160488012268	Dissimilatory sulfite reductase (desulfoviridin), gamma subunit [Inorganic ion transport and metabolism]; Region: DsrC; COG2920
160488012269	sulfur relay protein, TusE/DsrC/DsvC family; Region: dsrC_tusE_dsvC; TIGR03342
160488012270	hypothetical protein; Validated; Region: PRK09071
160488012271	Glycosyl transferase family, helical bundle domain; Region: Glycos_trans_3N; pfam02885
160488012272	Predicted glutathione S-transferase [Posttranslational modification, protein turnover, chaperones]; Region: ECM4; COG0435
160488012273	Glutathione S-transferase, N-terminal domain; Region: GST_N_2; pfam13409
160488012274	C-terminal, alpha helical domain of Class Omega-like Glutathione S-transferases; Region: GST_C_Omega_like; cd03190
160488012275	putative dimer interface [polypeptide binding]; other site
160488012276	N-terminal domain interface [polypeptide binding]; other site
160488012277	putative substrate binding pocket (H-site) [chemical binding]; other site
160488012278	siroheme synthase; Provisional; Region: cysG; PRK10637
160488012279	Putative NAD(P)-binding; Region: NAD_binding_7; pfam13241
160488012280	Sirohaem synthase dimerisation region; Region: CysG_dimeriser; pfam10414
160488012281	Uroporphyrin-III C-methyltransferase (S-Adenosyl-L-methionine:uroporphyrinogen III methyltransferase, SUMT); Region: SUMT; cd11642
160488012282	active site
160488012283	SAM binding site [chemical binding]; other site
160488012284	homodimer interface [polypeptide binding]; other site
160488012285	seryl-tRNA synthetase; Provisional; Region: PRK05431
160488012286	Seryl-tRNA synthetase N-terminal domain; Region: Seryl_tRNA_N; pfam02403
160488012287	Seryl-tRNA synthetase (SerRS) class II core catalytic domain. SerRS is responsible for the attachment of serine to the 3' OH group of ribose of the appropriate tRNA. This domain It is primarily responsible for ATP-dependent formation of the enzyme...; Region: SerRS_core; cd00770
160488012288	dimer interface [polypeptide binding]; other site
160488012289	active site
160488012290	motif 1; other site
160488012291	motif 2; other site
160488012292	motif 3; other site
160488012293	camphor resistance protein CrcB; Provisional; Region: PRK14234
160488012294	recombination factor protein RarA; Reviewed; Region: PRK13342
160488012295	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488012296	Walker A motif; other site
160488012297	ATP binding site [chemical binding]; other site
160488012298	Walker B motif; other site
160488012299	arginine finger; other site
160488012300	MgsA AAA+ ATPase C terminal; Region: MgsA_C; pfam12002
160488012301	lipoprotein chaperone; Reviewed; Region: lolA; PRK00031
160488012302	Outer membrane lipoprotein carrier protein LolA; Region: LolA; pfam03548
160488012303	DNA segregation ATPase FtsK/SpoIIIE and related proteins [Cell division and chromosome partitioning]; Region: FtsK; COG1674
160488012304	Domain of unknown function (DUF4117); Region: DUF4117; pfam13491
160488012305	FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580
160488012306	Ftsk gamma domain; Region: Ftsk_gamma; pfam09397
160488012307	leucyl/phenylalanyl-tRNA--protein transferase; Reviewed; Region: aat; PRK00301
160488012308	arginyl-tRNA-protein transferase; Provisional; Region: PRK01305
160488012309	Arginine-tRNA-protein transferase, N terminus; Region: ATE_N; pfam04376
160488012310	Arginine-tRNA-protein transferase, C terminus; Region: ATE_C; pfam04377
160488012311	S1_IF1: Translation Initiation Factor IF1, S1-like RNA-binding domain. IF1 contains an S1-like RNA-binding domain, which is found in a wide variety of RNA-associated proteins. Translation initiation includes a number of interrelated steps preceding the...; Region: S1_IF1; cd04451
160488012312	rRNA binding site [nucleotide binding]; other site
160488012313	predicted 30S ribosome binding site; other site
160488012314	ATP-dependent Clp protease ATP-binding subunit; Provisional; Region: clpA; PRK11034
160488012315	Clp amino terminal domain; Region: Clp_N; pfam02861
160488012316	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488012317	Walker A motif; other site
160488012318	ATP binding site [chemical binding]; other site
160488012319	Walker B motif; other site
160488012320	arginine finger; other site
160488012321	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488012322	Walker A motif; other site
160488012323	ATP binding site [chemical binding]; other site
160488012324	Walker B motif; other site
160488012325	C-terminal, D2-small domain, of ClpB protein; Region: ClpB_D2-small; smart01086
160488012326	ATP-dependent Clp protease adaptor protein ClpS; Reviewed; Region: clpS; PRK00033
160488012327	Cold-Shock Protein (CSP) contains an S1-like cold-shock domain (CSD) that is found in eukaryotes, prokaryotes, and archaea.  CSP's include the major cold-shock proteins CspA and CspB in bacteria and the eukaryotic gene regulatory factor Y-box...; Region: CSP_CDS; cd04458
160488012328	DNA-binding site [nucleotide binding]; DNA binding site
160488012329	RNA-binding motif; other site
160488012330	isocitrate dehydrogenase; Validated; Region: PRK07362
160488012331	isocitrate dehydrogenase; Reviewed; Region: PRK07006
160488012332	Monomeric isocitrate dehydrogenase [Energy production and conversion]; Region: Icd; COG2838
160488012333	Monomeric isocitrate dehydrogenase; Region: IDH; cl15383
160488012334	Contains a crystal structure of the Nudix hydrolase from Nitrosomonas europaea, which has an unknown function. In general, members of the Nudix hydrolase superfamily catalyze the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes...; Region: Nudix_Hydrolase_2; cd03675
160488012335	nudix motif; other site
160488012336	Predicted tRNA(5-methylaminomethyl-2-thiouridylate) methyltransferase, contains the PP-loop ATPase domain [Translation, ribosomal structure and biogenesis]; Region: TrmU; COG0482
160488012337	tRNA methyl transferase. This family represents tRNA(5-methylaminomethyl-2-thiouridine)-methyltransferase which is involved in the biosynthesis of the modified nucleoside 5-methylaminomethyl-2-thiouridine present in the wobble position of some tRNAs; Region: tRNA_Me_trans; cd01998
160488012338	putative lysogenization regulator; Reviewed; Region: PRK00218
160488012339	adenylosuccinate lyase; Provisional; Region: PRK09285
160488012340	PurB_like adenylosuccinases (adenylsuccinate lyase, ASL); Region: PurB; cd01598
160488012341	tetramer interface [polypeptide binding]; other site
160488012342	active site
160488012343	Uncharacterized conserved protein [Function unknown]; Region: COG2850
160488012344	Cupin domain; Region: Cupin_2; cl17218
160488012345	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
160488012346	Coenzyme A binding pocket [chemical binding]; other site
160488012347	DNA topoisomerase III; Provisional; Region: PRK07726
160488012348	TOPRIM_TopoIA_TopoIII: The topoisomerase-primase (TORPIM) domain found in members of the type IA family of DNA topoisomerases (Topo IA) similar to topoisomerase III. Type IA DNA topoisomerases remove (relax) negative supercoils in the DNA by: cleaving...; Region: TOPRIM_TopoIA_TopoIII; cd03362
160488012349	active site
160488012350	putative interdomain interaction site [polypeptide binding]; other site
160488012351	putative metal-binding site [ion binding]; other site
160488012352	putative nucleotide binding site [chemical binding]; other site
160488012353	DNA Topoisomerase, subtype IA; DNA-binding, ATP-binding and catalytic domain of bacterial DNA topoisomerases I and III, and eukaryotic DNA topoisomerase III and eubacterial and archael reverse gyrases. Topoisomerases clevage single or double stranded DNA...; Region: TOP1Ac; cd00186
160488012354	domain I; other site
160488012355	DNA binding groove [nucleotide binding]
160488012356	phosphate binding site [ion binding]; other site
160488012357	domain II; other site
160488012358	domain III; other site
160488012359	nucleotide binding site [chemical binding]; other site
160488012360	catalytic site [active]
160488012361	domain IV; other site
160488012362	putative aminophosphonate oxidoreductase; Region: Phn_aa_oxid; TIGR03329
160488012363	Glycine/D-amino acid oxidases (deaminating) [Amino acid transport and metabolism]; Region: DadA; COG0665
160488012364	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
160488012365	Putative lysophospholipase; Region: Hydrolase_4; pfam12146
160488012366	Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326
160488012367	RHS repeat-associated core domain; Region: Rhs_assc_core; TIGR03696
160488012368	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3436
160488012369	IS66 Orf2 like protein; Region: TnpB_IS66; pfam05717
160488012370	Transposase C of IS166 homeodomain; Region: LZ_Tnp_IS66; pfam13007
160488012371	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3436
160488012372	putative Helix-turn-helix domain of transposase IS66; Region: HTH_Tnp_IS66; pfam13005
160488012373	Transposase IS66 family; Region: DDE_Tnp_IS66; pfam03050
160488012374	IS66 C-terminal element; Region: DDE_Tnp_IS66_C; pfam13817
160488012375	RHS repeat-associated core domain; Region: Rhs_assc_core; TIGR03696
160488012376	NADH pyrophosphatase; Reviewed; Region: nudC; PRK00241
160488012377	NADH pyrophosphatase-like rudimentary NUDIX domain; Region: NUDIX-like; pfam09296
160488012378	NADH pyrophosphatase zinc ribbon domain; Region: zf-NADH-PPase; pfam09297
160488012379	NADH pyrophosphatase, a member of the Nudix hydrolase superfamily, catalyzes the cleavage of NADH into reduced nicotinamide mononucleotide (NMNH) and AMP. Like other members of the Nudix family, it requires a divalent cation, such as Mg2+ or Mn2+, for...; Region: NADH_pyrophosphatase; cd03429
160488012380	putative NADH binding site [chemical binding]; other site
160488012381	putative active site [active]
160488012382	nudix motif; other site
160488012383	putative metal binding site [ion binding]; other site
160488012384	enoyl-CoA hydratase; Provisional; Region: PRK06142
160488012385	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
160488012386	substrate binding site [chemical binding]; other site
160488012387	oxyanion hole (OAH) forming residues; other site
160488012388	trimer interface [polypeptide binding]; other site
160488012389	sodium/proton antiporter; Reviewed; Region: nhaB; PRK09547
160488012390	Bacterial lipocalin [Cell envelope biogenesis, outer membrane]; Region: Blc; COG3040
160488012391	Lipocalin-like domain; Region: Lipocalin_2; pfam08212
160488012392	Metallo-beta-lactamase superfamily; Region: Lactamase_B; cl00446
160488012393	allantoate amidohydrolase; Reviewed; Region: PRK12893
160488012394	M20 Peptidase beta-alanine synthase, an amidohydrolase; Region: M20_bAS; cd03884
160488012395	active site
160488012396	metal binding site [ion binding]; metal-binding site
160488012397	dimer interface [polypeptide binding]; other site
160488012398	uncharacterized nucleobase-cation-symport-1 (NCS1) transporter subfamily, YbbW-like; solute-binding domain; Region: SLC-NCS1sbd_YbbW-like; cd11485
160488012399	Permease for cytosine/purines, uracil, thiamine, allantoin; Region: Transp_cyt_pur; pfam02133
160488012400	Na binding site [ion binding]; other site
160488012401	putative substrate binding site [chemical binding]; other site
160488012402	dihydropyrimidine dehydrogenase subunit A; Provisional; Region: PRK11749
160488012403	The HCP family of iron-sulfur proteins includes hybrid cluster protein (HCP), acetyl-CoA synthase (ACS), and carbon monoxide dehydrogenase (CODH), all of which contain [Fe4-S4] metal clusters at their active sites. These proteins have a conserved...; Region: HCP_like; cl14655
160488012404	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
160488012405	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
160488012406	dihydropyrimidine dehydrogenase subunit B; Validated; Region: PRK08318
160488012407	Dihydropyrimidine dehydrogenase (DHPD) FMN-binding domain.  DHPD catalyzes the first step in pyrimidine degradation: the NADPH-dependent reduction of uracil and thymine to the corresponding 5,6-dihydropyrimidines. DHPD contains two FAD, two FMN, and...; Region: DHPD_FMN; cd02940
160488012408	homodimer interface [polypeptide binding]; other site
160488012409	active site
160488012410	FMN binding site [chemical binding]; other site
160488012411	substrate binding site [chemical binding]; other site
160488012412	4Fe-4S binding domain; Region: Fer4_6; pfam12837
160488012413	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
160488012414	N-terminal domain of Streptomyces griseus SgaA (suppression of growth disturbance caused by A-factor at a high concentration under high osmolality during early growth phase), and similar domains; Region: SgaA_N_like; cd07247
160488012415	Glucoamylase and related glycosyl hydrolases [Carbohydrate transport and metabolism]; Region: SGA1; COG3387
160488012416	Glycosyl hydrolases family 15; Region: Glyco_hydro_15; pfam00723
160488012417	glucose-6-phosphate 1-dehydrogenase; Provisional; Region: PRK12853
160488012418	Glucose-6-phosphate dehydrogenase, NAD binding domain; Region: G6PD_N; pfam00479
160488012419	Glucose-6-phosphate dehydrogenase, C-terminal domain; Region: G6PD_C; pfam02781
160488012420	6-phosphogluconate dehydrogenase-like protein; Reviewed; Region: PRK09599
160488012421	Predicted 6-phosphogluconate dehydrogenase [Carbohydrate transport and metabolism]; Region: Gnd; COG1023
160488012422	PAAR motif; Region: PAAR_motif; pfam05488
160488012423	Domain of unknown function (DUF1910); Region: DUF1910; pfam08928
160488012424	Domain of unknown function (DUF1911); Region: DUF1911; pfam08929
160488012425	Domain of unknown function (DUF1910); Region: DUF1910; pfam08928
160488012426	Domain of unknown function (DUF1911); Region: DUF1911; pfam08929
160488012427	type VI secretion system Vgr family protein; Region: VI_Rhs_Vgr; TIGR03361
160488012428	Phage late control gene D protein (GPD); Region: Phage_GPD; pfam05954
160488012429	Phage-related baseplate assembly protein; Region: Phage_base_V; pfam04717
160488012430	Uncharacterized protein conserved in bacteria (DUF2345); Region: DUF2345; cl01733
160488012431	glycogen synthase; Provisional; Region: glgA; PRK00654
160488012432	This family is most closely related to the GT1 family of glycosyltransferases. Glycogen synthase catalyzes the formation and elongation of the alpha-1,4-glucose backbone using ADP-glucose, the second and key step of glycogen biosynthesis. This family...; Region: GT1_Glycogen_synthase_DULL1_like; cd03791
160488012433	ADP-binding pocket [chemical binding]; other site
160488012434	homodimer interface [polypeptide binding]; other site
160488012435	N-terminal Early set domain associated with the catalytic domain of Maltooligosyl trehalose trehalohydrolase (also called Glycosyltrehalose trehalohydrolase) and similar proteins; Region: E_set_MTHase_like_N; cd02853
160488012436	malto-oligosyltrehalose trehalohydrolase; Region: trehalose_TreZ; TIGR02402
160488012437	Alpha amylase catalytic domain found in Glycosyltrehalose trehalohydrolase (also called Maltooligosyl trehalose Trehalohydrolase); Region: AmyAc_GTHase; cd11325
160488012438	catalytic site [active]
160488012439	active site
160488012440	Domain of unknown function (DUF3459); Region: DUF3459; pfam11941
160488012441	4-alpha-glucanotransferase; Provisional; Region: malQ; PRK11052
160488012442	4-alpha-glucanotransferase [Carbohydrate transport and metabolism]; Region: MalQ; COG1640
160488012443	maltooligosyl trehalose synthase; Provisional; Region: PRK14511
160488012444	Alpha amylase catalytic domain family; Region: AmyAc_family; cl07893
160488012445	Alpha amylase catalytic domain found in maltooligosyl trehalose synthase (MTSase); Region: AmyAc_MTSase; cd11336
160488012446	active site
160488012447	catalytic site [active]
160488012448	Protein of unknown function (DUF2934); Region: DUF2934; pfam11154
160488012449	glycogen debranching enzyme GlgX; Region: glgX_debranch; TIGR02100
160488012450	N-terminal Early set domain associated with the catalytic domain of Glycogen debranching enzyme and bacterial isoamylase (also called glycogen 6-glucanohydrolase); Region: E_set_GDE_Isoamylase_N; cd02856
160488012451	Alpha amylase catalytic domain found in glycogen debranching enzymes; Region: AmyAc_Glg_debranch; cd11326
160488012452	active site
160488012453	catalytic site [active]
160488012454	Metal-dependent hydrolase [General function prediction only]; Region: ElsH; COG3568
160488012455	putative catalytic site [active]
160488012456	putative metal binding site [ion binding]; other site
160488012457	putative phosphate binding site [ion binding]; other site
160488012458	Autotransporter beta-domain; Region: Autotransporter; pfam03797
160488012459	glycogen branching enzyme; Provisional; Region: PRK05402
160488012460	N-terminal Early set domain associated with the catalytic domain of prokaryotic glycogen branching enzyme; Region: E_set_GBE_prok_N; cd02855
160488012461	Alpha amylase catalytic domain found in the Glycogen branching enzyme (also called 1,4-alpha-glucan branching enzyme); Region: AmyAc_Glg_BE; cd11322
160488012462	active site
160488012463	catalytic site [active]
160488012464	Alpha amylase, C-terminal all-beta domain; Region: Alpha-amylase_C; pfam02806
160488012465	trehalose synthase; Region: treS_nterm; TIGR02456
160488012466	Alpha amylase catalytic domain found in Trehalose synthetase; Region: AmyAc_TreS; cd11334
160488012467	active site
160488012468	catalytic site [active]
160488012469	trehalose synthase-fused probable maltokinase; Region: TreS_Cterm; TIGR02457
160488012470	Uncharacterized protein, probably involved in trehalose biosynthesis [Carbohydrate transport and metabolism]; Region: Ble; COG3281
160488012471	Domain of unknown function (DUF3416); Region: DUF3416; pfam11896
160488012472	Alpha amylase catalytic domain found in GlgE-like proteins; Region: AmyAc_GlgE_like; cd11344
160488012473	Glycosidases [Carbohydrate transport and metabolism]; Region: AmyA; COG0366
160488012474	active site
160488012475	homodimer interface [polypeptide binding]; other site
160488012476	catalytic site [active]
160488012477	acceptor binding site [chemical binding]; other site
160488012478	AMP-binding domain protein; Validated; Region: PRK08315
160488012479	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
160488012480	Uncharacterized subfamily of fatty acid CoA ligase (FACL); Region: FACL_like_2; cd05917
160488012481	acyl-activating enzyme (AAE) consensus motif; other site
160488012482	putative AMP binding site [chemical binding]; other site
160488012483	putative active site [active]
160488012484	putative CoA binding site [chemical binding]; other site
160488012485	isovaleryl-CoA dehydrogenase; Region: PLN02519
160488012486	Isovaleryl-CoA dehydrogenase; Region: IVD; cd01156
160488012487	substrate binding site [chemical binding]; other site
160488012488	FAD binding site [chemical binding]; other site
160488012489	catalytic base [active]
160488012490	3-methylcrotonyl-CoA carboxylase, beta chain; Region: PLN02820
160488012491	malonate decarboxylase subunit beta; Reviewed; Region: PRK07189; cl17682
160488012492	Acetyl-CoA carboxylase alpha subunit [Lipid metabolism]; Region: AccA; cl17345
160488012493	gamma-carboxygeranoyl-CoA hydratase; Validated; Region: PRK05674
160488012494	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
160488012495	substrate binding site [chemical binding]; other site
160488012496	oxyanion hole (OAH) forming residues; other site
160488012497	trimer interface [polypeptide binding]; other site
160488012498	Acetyl/propionyl-CoA carboxylase, alpha subunit [Lipid metabolism]; Region: COG4770
160488012499	Carbamoyl-phosphate synthase L chain, N-terminal domain; Region: CPSase_L_chain; pfam00289
160488012500	Carbamoyl-phosphate synthase L chain, ATP binding domain; Region: CPSase_L_D2; pfam02786
160488012501	Biotin carboxylase C-terminal domain; Region: Biotin_carb_C; smart00878
160488012502	The biotinyl-domain or biotin carboxyl carrier protein (BCCP) domain is present in all biotin-dependent enzymes, such as acetyl-CoA carboxylase, pyruvate carboxylase, propionyl-CoA carboxylase, methylcrotonyl-CoA carboxylase, geranyl-CoA carboxylase; Region: biotinyl_domain; cd06850
160488012503	carboxyltransferase (CT) interaction site; other site
160488012504	biotinylation site [posttranslational modification]; other site
160488012505	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
160488012506	non-specific DNA binding site [nucleotide binding]; other site
160488012507	SOS-response transcriptional repressors (RecA-mediated autopeptidases) [Transcription / Signal transduction mechanisms]; Region: LexA; COG1974
160488012508	salt bridge; other site
160488012509	sequence-specific DNA binding site [nucleotide binding]; other site
160488012510	Peptidase S24 LexA-like proteins are involved in the SOS response leading to the repair of single-stranded DNA within the bacterial cell. This family includes: the lambda repressor CI/C2 family and related bacterial prophage repressor proteins; LexA (EC...; Region: S24_LexA-like; cd06529
160488012511	Catalytic site [active]
160488012512	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cl17257
160488012513	type VI secretion protein IcmF; Region: VI_IcmF; TIGR03348
160488012514	Intracellular multiplication and human macrophage-killing; Region: IcmF-related; pfam06761
160488012515	Protein of unknown function (DUF1215); Region: DUF1215; pfam06744
160488012516	ImpA-related N-terminal; Region: ImpA-rel_N; pfam06812
160488012517	type VI secretion-associated protein, VC_A0119 family; Region: VI_chp_7; TIGR03362
160488012518	type VI secretion-associated protein, VC_A0118 family; Region: VI_minor_1; TIGR03360
160488012519	Protein of unknown function (DUF770); Region: DUF770; pfam05591
160488012520	type VI secretion system lysozyme-like protein; Region: VI_zyme; TIGR03357
160488012521	Type VI protein secretion system component VasA [Intracellular trafficking, secretion, and    vesicular transport]; Region: COG3519
160488012522	type VI secretion protein, VC_A0110 family; Region: VI_chp_6; TIGR03359
160488012523	type VI secretion protein, VC_A0111 family; Region: VI_chp_1; TIGR03347
160488012524	Type VI secretion lipoprotein; Region: T6SS-SciN; pfam12790
160488012525	type VI secretion protein, VC_A0114 family; Region: VI_chp_4; TIGR03353
160488012526	Bacterial protein of unknown function (DUF876); Region: DUF876; pfam05936
160488012527	Uncharacterized protein conserved in bacteria (DUF2077); Region: DUF2077; pfam09850
160488012528	type VI secretion system effector, Hcp1 family; Region: VI_effect_Hcp1; TIGR03344
160488012529	Domain of unknown function (DUF1795); Region: DUF1795; pfam08786
160488012530	PAAR motif; Region: PAAR_motif; pfam05488
160488012531	Rhs family protein [Cell envelope biogenesis, outer membrane]; Region: RhsA; COG3209
160488012532	YD repeat (two copies); Region: YD_repeat_2x; TIGR01643
160488012533	RHS Repeat; Region: RHS_repeat; pfam05593
160488012534	Rhs family protein [Cell envelope biogenesis, outer membrane]; Region: RhsA; COG3209
160488012535	RHS Repeat; Region: RHS_repeat; pfam05593
160488012536	RHS Repeat; Region: RHS_repeat; pfam05593
160488012537	RHS Repeat; Region: RHS_repeat; pfam05593
160488012538	RHS Repeat; Region: RHS_repeat; cl11982
160488012539	RHS Repeat; Region: RHS_repeat; pfam05593
160488012540	RHS Repeat; Region: RHS_repeat; pfam05593
160488012541	RHS protein; Region: RHS; pfam03527
160488012542	RHS repeat-associated core domain; Region: Rhs_assc_core; TIGR03696
160488012543	Transposase C of IS166 homeodomain; Region: LZ_Tnp_IS66; pfam13007
160488012544	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3436
160488012545	putative Helix-turn-helix domain of transposase IS66; Region: HTH_Tnp_IS66; pfam13005
160488012546	Transposase IS66 family; Region: DDE_Tnp_IS66; pfam03050
160488012547	IS66 C-terminal element; Region: DDE_Tnp_IS66_C; pfam13817
160488012548	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3436
160488012549	IS66 Orf2 like protein; Region: TnpB_IS66; pfam05717
160488012550	Protein-disulfide isomerase [Posttranslational modification, protein turnover, chaperones]; Region: DsbG; COG1651
160488012551	DsbA family; consists of DsbA and DsbA-like proteins, including DsbC, DsbG, glutathione (GSH) S-transferase kappa (GSTK), 2-hydroxychromene-2-carboxylate (HCCA) isomerase, an oxidoreductase (FrnE) presumed to be involved in frenolicin biosynthesis, a...; Region: DsbA_family; cd02972
160488012552	catalytic residues [active]
160488012553	CDP-alcohol phosphatidyltransferase; Region: CDP-OH_P_transf; cl00453
160488012554	excinuclease ABC subunit C; Validated; Region: uvrC; PRK00558
160488012555	Catalytic GIY-YIG domain of nucleotide excision repair endonucleases UvrC, Cho, and similar proteins; Region: GIY-YIG_UvrC_Cho; cd10434
160488012556	GIY-YIG motif/motif A; other site
160488012557	active site
160488012558	catalytic site [active]
160488012559	putative DNA binding site [nucleotide binding]; other site
160488012560	metal binding site [ion binding]; metal-binding site
160488012561	UvrB/uvrC motif; Region: UVR; pfam02151
160488012562	UvrC Helix-hairpin-helix N-terminal; Region: UvrC_HhH_N; pfam08459
160488012563	H3TH domains of structure-specific 5' nucleases (or flap endonuclease-1-like) involved in DNA replication, repair, and recombination; Region: H3TH_StructSpec-5'-nucleases; cl14815
160488012564	DNA binding site [nucleotide binding]
160488012565	response regulator; Provisional; Region: PRK09483
160488012566	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488012567	active site
160488012568	phosphorylation site [posttranslational modification]
160488012569	intermolecular recognition site; other site
160488012570	dimerization interface [polypeptide binding]; other site
160488012571	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
160488012572	DNA binding residues [nucleotide binding]
160488012573	dimerization interface [polypeptide binding]; other site
160488012574	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cl17200
160488012575	sequence-specific DNA binding site [nucleotide binding]; other site
160488012576	salt bridge; other site
160488012577	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
160488012578	Acetyltransferases [General function prediction only]; Region: RimI; COG0456
160488012579	Coenzyme A binding pocket [chemical binding]; other site
160488012580	Uncharacterized conserved protein [Function unknown]; Region: COG3189
160488012581	Phosphate/sulphate permeases [Inorganic ion transport and metabolism]; Region: PitA; COG0306
160488012582	Phosphate/sulphate permeases [Inorganic ion transport and metabolism]; Region: PitA; COG0306
160488012583	Glutathione S-transferase [Posttranslational modification, protein turnover, chaperones]; Region: Gst; COG0625
160488012584	GST_N family, Ure2p-like subfamily; composed of the Saccharomyces cerevisiae Ure2p and related GSTs. Ure2p is a regulator for nitrogen catabolism in yeast. It represses the expression of several gene products involved in the use of poor nitrogen sources...; Region: GST_N_Ure2p_like; cd03048
160488012585	C-terminal domain interface [polypeptide binding]; other site
160488012586	GSH binding site (G-site) [chemical binding]; other site
160488012587	dimer interface [polypeptide binding]; other site
160488012588	C-terminal, alpha helical domain of Ure2p and related Glutathione S-transferase-like proteins; Region: GST_C_Ure2p_like; cd03178
160488012589	dimer interface [polypeptide binding]; other site
160488012590	N-terminal domain interface [polypeptide binding]; other site
160488012591	PaaI_thioesterase is a tetrameric acyl-CoA thioesterase with a hot dog fold and one of several proteins responsible for phenylacetic acid (PA) degradation in bacteria.  Although orthologs of PaaI exist in archaea and eukaryotes, their function has not...; Region: PaaI_thioesterase; cd03443
160488012592	CoenzymeA binding site [chemical binding]; other site
160488012593	subunit interaction site [polypeptide binding]; other site
160488012594	PHB binding site; other site
160488012595	gamma-aminobutyrate permease; Region: GABAperm; TIGR01773
160488012596	Spore germination protein; Region: Spore_permease; cl17796
160488012597	DNA-binding transcriptional activator GcvA; Provisional; Region: PRK11139
160488012598	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488012599	The C-terminal substrate binding domain of LysR-type transcriptional regulators GcdR-like, contains the type 2 periplasmic binding fold; Region: PBP2_GcdR_like; cd08481
160488012600	dimerization interface [polypeptide binding]; other site
160488012601	substrate binding pocket [chemical binding]; other site
160488012602	4-aminobutyrate aminotransferase and related aminotransferases [Amino acid transport and metabolism]; Region: GabT; COG0160
160488012603	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
160488012604	inhibitor-cofactor binding pocket; inhibition site
160488012605	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488012606	catalytic residue [active]
160488012607	elongation factor G; Reviewed; Region: PRK00007
160488012608	Elongation factor G (EF-G) family involved in both the elongation and ribosome recycling phases of protein synthesis; Region: EF-G; cd01886
160488012609	G1 box; other site
160488012610	putative GEF interaction site [polypeptide binding]; other site
160488012611	GTP/Mg2+ binding site [chemical binding]; other site
160488012612	Switch I region; other site
160488012613	G2 box; other site
160488012614	G3 box; other site
160488012615	Switch II region; other site
160488012616	G4 box; other site
160488012617	G5 box; other site
160488012618	EFG_mtEFG_II: this subfamily represents the domain II of elongation factor G (EF-G) in bacteria and, the C-terminus of mitochondrial Elongation factor G1 (mtEFG1) and G2 (mtEFG2)_like proteins found in eukaryotes. During the process of peptide synthesis...; Region: EFG_mtEFG_II; cd04088
160488012619	EFG_mtEFG1_IV: domains similar to domain IV of the bacterial translational elongation factor (EF) EF-G. Included in this group is a domain of mitochondrial Elongation factor G1 (mtEFG1) proteins homologous to domain IV of EF-G. Eukaryotic cells harbor 2...; Region: EFG_mtEFG1_IV; cd01434
160488012620	EFG_mtEFG_C: domains similar to the C-terminal domain of the bacterial translational elongation factor (EF) EF-G.  Included in this group is the C-terminus of mitochondrial Elongation factor G1 (mtEFG1) and G2 (mtEFG2) proteins. Eukaryotic cells harbor 2...; Region: EFG_mtEFG_C; cd03713
160488012621	Peptidase domain in the S8 and S53 families; Region: Peptidases_S8_S53; cd00306
160488012622	active site
160488012623	catalytic residues [active]
160488012624	Bacterial type II/III secretion system short domain; Region: Secretin_N; pfam03958
160488012625	Bacterial type II and III secretion system protein; Region: Secretin; pfam00263
160488012626	isocitrate lyase; Provisional; Region: PRK15063
160488012627	Members of the ICL/PEPM enzyme family catalyze either P-C or C-C bond formation/cleavage. Known members are phosphoenolpyruvate mutase (PEPM), phosphonopyruvate hydrolase (PPH), carboxyPEP mutase (CPEP mutase), oxaloacetate hydrolase (OAH), isocitrate...; Region: ICL_PEPM; cd00377
160488012628	tetramer interface [polypeptide binding]; other site
160488012629	active site
160488012630	Mg2+/Mn2+ binding site [ion binding]; other site
160488012631	YhhN-like protein; Region: YhhN; pfam07947
160488012632	NADH:ubiquinone oxidoreductase subunit A; Validated; Region: PRK06602
160488012633	NADH:ubiquinone oxidoreductase 20 kD subunit and related Fe-S oxidoreductases [Energy production and conversion]; Region: NuoB; COG0377
160488012634	bifunctional NADH:ubiquinone oxidoreductase subunit C/D; Provisional; Region: PRK11742
160488012635	NADH (or F420H2) dehydrogenase, subunit C; Region: NuoC_fam; TIGR01961
160488012636	NADH dehydrogenase subunit D; Validated; Region: PRK06075
160488012637	NADH dehydrogenase subunit E; Validated; Region: PRK07539
160488012638	TRX-like [2Fe-2S] Ferredoxin (Fd) family, NADH:ubiquinone oxidoreductase (Nuo) subunit E subfamily; Nuo, also called respiratory chain Complex 1, is the entry point for electrons into the respiratory chains of bacteria and the mitochondria of eukaryotes; Region: TRX_Fd_NuoE; cd03064
160488012639	putative dimer interface [polypeptide binding]; other site
160488012640	[2Fe-2S] cluster binding site [ion binding]; other site
160488012641	NADH dehydrogenase I subunit F; Provisional; Region: PRK11278
160488012642	SLBB domain; Region: SLBB; pfam10531
160488012643	NADH-ubiquinone oxidoreductase-F iron-sulfur binding region; Region: NADH_4Fe-4S; pfam10589
160488012644	NADH dehydrogenase/NADH:ubiquinone oxidoreductase 75 kD subunit (chain G) [Energy production and conversion]; Region: NuoG; COG1034
160488012645	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
160488012646	catalytic loop [active]
160488012647	iron binding site [ion binding]; other site
160488012648	NADH-ubiquinone oxidoreductase-G iron-sulfur binding region; Region: NADH-G_4Fe-4S_3; pfam10588
160488012649	MopB_NDH-1_NuoG2-N7: The second domain of the NuoG subunit (with a [4Fe-4S] cluster, N7) of the NADH-quinone oxidoreductase/NADH dehydrogenase-1 (NDH-1) found in various bacteria. The NDH-1 is the first energy-transducting complex in the respiratory...; Region: MopB_NDH-1_NuoG2-N7; cd02771
160488012650	[4Fe-4S] binding site [ion binding]; other site
160488012651	MopB_CT_NDH-1_NuoG2-N7: C-terminal region of the NuoG-like subunit (of the variant with a [4Fe-4S] cluster, N7) of the NADH-quinone oxidoreductase/NADH dehydrogenase-1 (NDH-1) found in various bacteria. The NDH-1 is the first energy-transducting complex...; Region: MopB_CT_NDH-1_NuoG2-N7; cd02788
160488012652	NADH:ubiquinone oxidoreductase subunit H; Provisional; Region: PRK06076
160488012653	NADH dehydrogenase subunit I; Provisional; Region: PRK05888
160488012654	4Fe-4S binding domain; Region: Fer4; pfam00037
160488012655	4Fe-4S binding domain; Region: Fer4; pfam00037
160488012656	NADH:ubiquinone oxidoreductase subunit J; Provisional; Region: PRK06638
160488012657	NADH dehydrogenase subunit J; Provisional; Region: PRK06433
160488012658	NADH:ubiquinone oxidoreductase subunit K; Validated; Region: PRK05715
160488012659	NADH:ubiquinone oxidoreductase subunit L; Reviewed; Region: PRK06590
160488012660	NADH-Ubiquinone oxidoreductase (complex I), chain 5 N-terminus; Region: Oxidored_q1_N; pfam00662
160488012661	NADH-Ubiquinone/plastoquinone (complex I), various chains; Region: Oxidored_q1; pfam00361
160488012662	NADH:ubiquinone oxidoreductase subunit M; Reviewed; Region: PRK05846
160488012663	NADH-Ubiquinone/plastoquinone (complex I), various chains; Region: Oxidored_q1; pfam00361
160488012664	NADH:ubiquinone oxidoreductase subunit N; Provisional; Region: PRK05777
160488012665	NADH-Ubiquinone/plastoquinone (complex I), various chains; Region: Oxidored_q1; pfam00361
160488012666	Ogr/Delta-like zinc finger; Region: Ogr_Delta; pfam04606
160488012667	Bacteriophage CI repressor helix-turn-helix domain; Region: Phage_CI_repr; pfam07022
160488012668	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
160488012669	DNA binding residues [nucleotide binding]
160488012670	dimerization interface [polypeptide binding]; other site
160488012671	Outer membrane receptor proteins, mostly Fe transport [Inorganic ion transport and metabolism]; Region: CirA; COG1629
160488012672	Porin superfamily.  These outer membrane channels share a beta-barrel structure that differ in strand and shear number.  Classical (gram-negative ) porins are non-specific channels for small hydrophillic molecules and form 16 beta-stranded barrels (16,20)...; Region: OM_channels; cl17244
160488012673	Predicted flavoprotein [General function prediction only]; Region: COG0431
160488012674	NADPH-dependent FMN reductase; Region: FMN_red; pfam03358
160488012675	DNA polymerase III, epsilon subunit, Proteobacterial; Region: dnaQ_proteo; TIGR01406
160488012676	DEDDh 3'-5' exonuclease domain of the epsilon subunit of Escherichia coli DNA polymerase III and similar proteins; Region: DNA_pol_III_epsilon_Ecoli_like; cd06131
160488012677	active site
160488012678	catalytic site [active]
160488012679	substrate binding site [chemical binding]; other site
160488012680	RNase HI family found mainly in prokaryotes; Region: RNase_HI_prokaryote_like; cd09278
160488012681	RNA/DNA hybrid binding site [nucleotide binding]; other site
160488012682	active site
160488012683	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488012684	hydroxyacylglutathione hydrolase; Region: GSH_gloB; TIGR03413
160488012685	MltD lipid attachment motif; Region: MLTD_N; pfam06474
160488012686	membrane-bound lytic murein transglycosylase D; Provisional; Region: mltD; PRK10783
160488012687	Lytic Transglycosylase (LT)  and Goose Egg White Lysozyme (GEWL) domain. Members include the soluble and insoluble membrane-bound LTs in bacteria, the LTs in bacteriophage lambda, as well as, the eukaryotic "goose-type" lysozymes (GEWL).  LTs...; Region: LT_GEWL; cd00254
160488012688	N-acetyl-D-glucosamine binding site [chemical binding]; other site
160488012689	catalytic residue [active]
160488012690	Lysine Motif is a small domain involved in binding peptidoglycan; Region: LysM; cd00118
160488012691	Lysine Motif is a small domain involved in binding peptidoglycan; Region: LysM; cd00118
160488012692	ABC-type oligopeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: OppA; COG4166
160488012693	The substrate-binding component of an uncharacterized ABC-type nickel/dipeptide/oligopeptide-like import system contains the type 2 periplasmic binding fold; Region: PBP2_NikA_DppA_OppA_like_14; cd08497
160488012694	ABC-type oligopeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: OppA; COG4166
160488012695	The substrate-binding component of an uncharacterized ABC-type nickel/dipeptide/oligopeptide-like import system contains the type 2 periplasmic binding fold; Region: PBP2_NikA_DppA_OppA_like_14; cd08497
160488012696	ABC-type uncharacterized transport system, permease component [General function prediction only]; Region: COG4174
160488012697	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488012698	dimer interface [polypeptide binding]; other site
160488012699	conserved gate region; other site
160488012700	putative PBP binding loops; other site
160488012701	ABC-ATPase subunit interface; other site
160488012702	nickel ABC transporter, permease subunit NikC; Region: nickel_nikC; TIGR02790
160488012703	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488012704	dimer interface [polypeptide binding]; other site
160488012705	conserved gate region; other site
160488012706	putative PBP binding loops; other site
160488012707	ABC-ATPase subunit interface; other site
160488012708	ABC-type uncharacterized transport system, duplicated ATPase component [General function prediction only]; Region: COG4172
160488012709	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
160488012710	Walker A/P-loop; other site
160488012711	ATP binding site [chemical binding]; other site
160488012712	Q-loop/lid; other site
160488012713	ABC transporter signature motif; other site
160488012714	Walker B; other site
160488012715	D-loop; other site
160488012716	H-loop/switch region; other site
160488012717	Oligopeptide/dipeptide transporter, C-terminal region; Region: oligo_HPY; cl07097
160488012718	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
160488012719	Walker A/P-loop; other site
160488012720	ATP binding site [chemical binding]; other site
160488012721	Q-loop/lid; other site
160488012722	ABC transporter signature motif; other site
160488012723	Walker B; other site
160488012724	D-loop; other site
160488012725	H-loop/switch region; other site
160488012726	Oligopeptide/dipeptide transporter, C-terminal region; Region: oligo_HPY; cl07097
160488012727	DNA binding domain, excisionase family; Region: excise; TIGR01764
160488012728	PIN domain; Region: PIN_3; pfam13470
160488012729	hypothetical protein; Provisional; Region: PRK06149
160488012730	Aminoglycoside 3'-phosphotransferase (APH) and Choline Kinase (ChoK) family. The APH/ChoK family is part of a larger superfamily that includes the catalytic domains of other kinases, such as the typical serine/threonine/tyrosine protein kinases (PKs)...; Region: APH_ChoK_like; cl17270
160488012731	active site
160488012732	ATP binding site [chemical binding]; other site
160488012733	substrate binding site [chemical binding]; other site
160488012734	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
160488012735	inhibitor-cofactor binding pocket; inhibition site
160488012736	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488012737	catalytic residue [active]
160488012738	probable polyamine oxidase; Region: PLN02268
160488012739	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
160488012740	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488012741	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488012742	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
160488012743	dimerization interface [polypeptide binding]; other site
160488012744	DNA-binding transcriptional activator KdpE; Provisional; Region: PRK10529
160488012745	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488012746	active site
160488012747	phosphorylation site [posttranslational modification]
160488012748	intermolecular recognition site; other site
160488012749	dimerization interface [polypeptide binding]; other site
160488012750	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
160488012751	DNA binding site [nucleotide binding]
160488012752	Osmosensitive K+ channel histidine kinase [Signal transduction mechanisms]; Region: KdpD; COG2205
160488012753	Osmosensitive K+ channel His kinase sensor domain; Region: KdpD; pfam02702
160488012754	USP domain is located between the N-terminal sensor domain and C-terminal catalytic domain of this Osmosensitive K+ channel histidine kinase family. The family of KdpD sensor kinase proteins regulates the kdpFABC operon responsible for potassium...; Region: USP_OKCHK; cd01987
160488012755	Ligand Binding Site [chemical binding]; other site
160488012756	Domain of unknown function (DUF4118); Region: DUF4118; pfam13493
160488012757	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488012758	dimer interface [polypeptide binding]; other site
160488012759	phosphorylation site [posttranslational modification]
160488012760	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488012761	ATP binding site [chemical binding]; other site
160488012762	Mg2+ binding site [ion binding]; other site
160488012763	G-X-G motif; other site
160488012764	potassium-transporting ATPase subunit C; Reviewed; Region: PRK00315
160488012765	potassium-transporting ATPase subunit A; Provisional; Region: PRK05482
160488012766	Predicted permease, member of the PurR regulon [General function prediction only]; Region: yhhT; cl00465
160488012767	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
160488012768	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
160488012769	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
160488012770	catalytic core [active]
160488012771	Domain of unknown function (DUF4389); Region: DUF4389; pfam14333
160488012772	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase; Validated; Region: gpsA; PRK00094
160488012773	NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus; Region: NAD_Gly3P_dh_N; pfam01210
160488012774	NAD-dependent glycerol-3-phosphate dehydrogenase C-terminus; Region: NAD_Gly3P_dh_C; pfam07479
160488012775	Outer membrane receptor proteins, mostly Fe transport [Inorganic ion transport and metabolism]; Region: CirA; COG1629
160488012776	Porin superfamily.  These outer membrane channels share a beta-barrel structure that differ in strand and shear number.  Classical (gram-negative ) porins are non-specific channels for small hydrophillic molecules and form 16 beta-stranded barrels (16,20)...; Region: OM_channels; cl17244
160488012777	ABC transporter substrate binding protein; Region: ABC_sub_bind; cl17301
160488012778	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
160488012779	dimerization interface [polypeptide binding]; other site
160488012780	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488012781	dimer interface [polypeptide binding]; other site
160488012782	phosphorylation site [posttranslational modification]
160488012783	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488012784	ATP binding site [chemical binding]; other site
160488012785	Mg2+ binding site [ion binding]; other site
160488012786	G-X-G motif; other site
160488012787	Response regulator receiver domain; Region: Response_reg; pfam00072
160488012788	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488012789	active site
160488012790	phosphorylation site [posttranslational modification]
160488012791	intermolecular recognition site; other site
160488012792	dimerization interface [polypeptide binding]; other site
160488012793	FabA, beta-hydroxydecanoyl-acyl carrier protein (ACP)-dehydratase: Bacterial protein of the type II, fatty acid synthase system that binds ACP and catalyzes both dehydration and isomerization reactions, apparently in the same active site. The FabA...; Region: FabA; cd01287
160488012794	active site 1 [active]
160488012795	dimer interface [polypeptide binding]; other site
160488012796	active site 2 [active]
160488012797	3-oxoacyl-(acyl carrier protein) synthase I; Reviewed; Region: PRK07967
160488012798	Beta-ketoacyl-acyl carrier protein (ACP) synthase (KAS), type I and II. KASs are responsible for the elongation steps in fatty acid biosynthesis. KASIII catalyses the initial condensation and KAS I and II catalyze further elongation steps by Claisen...; Region: KAS_I_II; cd00834
160488012799	dimer interface [polypeptide binding]; other site
160488012800	active site
160488012801	Amidohydrolase; Region: Amidohydro_2; pfam04909
160488012802	Pirin-related protein [General function prediction only]; Region: COG1741
160488012803	Pirin; Region: Pirin; pfam02678
160488012804	Pirin C-terminal cupin domain; Region: Pirin_C; pfam05726
160488012805	Dienelactone hydrolase and related enzymes [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG0412
160488012806	Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326
160488012807	heat shock protein 90; Provisional; Region: PRK05218
160488012808	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488012809	ATP binding site [chemical binding]; other site
160488012810	Mg2+ binding site [ion binding]; other site
160488012811	G-X-G motif; other site
160488012812	PaaI_thioesterase is a tetrameric acyl-CoA thioesterase with a hot dog fold and one of several proteins responsible for phenylacetic acid (PA) degradation in bacteria.  Although orthologs of PaaI exist in archaea and eukaryotes, their function has not...; Region: PaaI_thioesterase; cd03443
160488012813	CoenzymeA binding site [chemical binding]; other site
160488012814	subunit interaction site [polypeptide binding]; other site
160488012815	PHB binding site; other site
160488012816	PaaI_thioesterase is a tetrameric acyl-CoA thioesterase with a hot dog fold and one of several proteins responsible for phenylacetic acid (PA) degradation in bacteria.  Although orthologs of PaaI exist in archaea and eukaryotes, their function has not...; Region: PaaI_thioesterase; cd03443
160488012817	CoenzymeA binding site [chemical binding]; other site
160488012818	subunit interaction site [polypeptide binding]; other site
160488012819	PHB binding site; other site
160488012820	Predicted membrane protein [Function unknown]; Region: COG3821
160488012821	Branched-chain amino acid transport protein; Region: Branch_AA_trans; cl00547
160488012822	succinyl-CoA synthetase subunit alpha; Validated; Region: PRK05678
160488012823	CoA binding domain; Region: CoA_binding; pfam02629
160488012824	CoA-ligase; Region: Ligase_CoA; pfam00549
160488012825	succinyl-CoA synthetase subunit beta; Provisional; Region: sucC; PRK00696
160488012826	ATP-grasp domain; Region: ATP-grasp_2; pfam08442
160488012827	CoA-ligase; Region: Ligase_CoA; pfam00549
160488012828	dihydrolipoamide dehydrogenase; Reviewed; Region: PRK06467
160488012829	Anaerobic glycerol-3-phosphate dehydrogenase [Amino acid transport and metabolism]; Region: GlpB; cl17730
160488012830	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
160488012831	Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852
160488012832	dihydrolipoamide succinyltransferase; Validated; Region: PRK05704
160488012833	Lipoyl domain of the dihydrolipoyl acyltransferase component (E2) of 2-oxo acid dehydrogenases. 2-oxo acid dehydrogenase multienzyme complexes, like pyruvate dehydrogenase (PDH), 2-oxoglutarate dehydrogenase (OGDH) and branched-chain 2-oxo acid...; Region: lipoyl_domain; cd06849
160488012834	E3 interaction surface; other site
160488012835	lipoyl attachment site [posttranslational modification]; other site
160488012836	e3 binding domain; Region: E3_binding; pfam02817
160488012837	2-oxoacid dehydrogenases acyltransferase (catalytic domain); Region: 2-oxoacid_dh; pfam00198
160488012838	2-oxoglutarate dehydrogenase E1 component; Reviewed; Region: sucA; PRK09404
160488012839	Thiamine pyrophosphate (TPP) family, E1 of OGDC-like subfamily, TPP-binding module; composed of proteins similar to the E1 component of the 2-oxoglutarate dehydrogenase multienzyme complex (OGDC). OGDC catalyzes the oxidative decarboxylation of...; Region: TPP_E1_OGDC_like; cd02016
160488012840	TPP-binding site [chemical binding]; other site
160488012841	Transketolase, pyrimidine binding domain; Region: Transket_pyr; pfam02779
160488012842	succinate dehydrogenase iron-sulfur subunit; Reviewed; Region: sdhB; PRK05950
160488012843	2Fe-2S iron-sulfur cluster binding domain; Region: Fer2_3; pfam13085
160488012844	succinate dehydrogenase flavoprotein subunit; Reviewed; Region: sdhA; PRK05675
160488012845	L-aspartate oxidase; Provisional; Region: PRK06175
160488012846	Fumarate reductase flavoprotein C-term; Region: Succ_DH_flav_C; pfam02910
160488012847	Succinate:quinone oxidoreductase (SQR) Type C subfamily, Succinate dehydrogenase D (SdhD) subunit; SQR catalyzes the oxidation of succinate to fumarate coupled to the reduction of quinone to quinol. E. coli SQR, a member of this subfamily, reduces the...; Region: SQR_TypeC_SdhD; cd03494
160488012848	SdhC subunit interface [polypeptide binding]; other site
160488012849	proximal heme binding site [chemical binding]; other site
160488012850	cardiolipin binding site; other site
160488012851	Iron-sulfur protein interface; other site
160488012852	proximal quinone binding site [chemical binding]; other site
160488012853	Succinate:quinone oxidoreductase (SQR) Type C subfamily, Succinate dehydrogenase C (SdhC) subunit; composed of bacterial SdhC and eukaryotic large cytochrome b binding (CybL) proteins. SQR catalyzes the oxidation of succinate to fumarate coupled to the...; Region: SQR_TypeC_SdhC; cd03499
160488012854	Iron-sulfur protein interface; other site
160488012855	proximal quinone binding site [chemical binding]; other site
160488012856	SdhD (CybS) interface [polypeptide binding]; other site
160488012857	proximal heme binding site [chemical binding]; other site
160488012858	Escherichia coli (Ec) citrate synthase (CS) GltA_like. CS catalyzes the condensation of acetyl coenzyme A (AcCoA) and oxalacetate (OAA) to form citrate and coenzyme A (CoA), the first step in the citric acid cycle (TCA or Krebs cycle). The overall CS...; Region: EcCS_like; cd06114
160488012859	Citrate synthase [Energy production and conversion]; Region: GltA; COG0372
160488012860	dimer interface [polypeptide binding]; other site
160488012861	active site
160488012862	citrylCoA binding site [chemical binding]; other site
160488012863	NADH binding [chemical binding]; other site
160488012864	cationic pore residues; other site
160488012865	oxalacetate/citrate binding site [chemical binding]; other site
160488012866	coenzyme A binding site [chemical binding]; other site
160488012867	catalytic triad [active]
160488012868	Protein of unknown function (DUF3233); Region: DUF3233; pfam11557
160488012869	Transcriptional regulators containing a DNA-binding HTH domain and an aminotransferase domain (MocR family) and their eukaryotic orthologs [Transcription / Amino acid transport and metabolism]; Region: ARO8; COG1167
160488012870	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488012871	DNA-binding site [nucleotide binding]; DNA binding site
160488012872	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
160488012873	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488012874	homodimer interface [polypeptide binding]; other site
160488012875	catalytic residue [active]
160488012876	Outer membrane protein and related peptidoglycan-associated (lipo)proteins [Cell envelope biogenesis, outer membrane]; Region: OmpA; COG2885
160488012877	Peptidoglycan binding domains similar to the C-terminal domain of outer-membrane protein OmpA; Region: OmpA_C-like; cd07185
160488012878	ligand binding site [chemical binding]; other site
160488012879	Domain of unknown function (DUF4398); Region: DUF4398; pfam14346
160488012880	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488012881	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
160488012882	substrate binding pocket [chemical binding]; other site
160488012883	membrane-bound complex binding site; other site
160488012884	Electron transfer flavoprotein, alpha subunit [Energy production and conversion]; Region: FixB; COG2025
160488012885	The electron transfer flavoprotein (ETF) serves as a specific electron acceptor for various mitochondrial dehydrogenases. ETF transfers electrons to the main respiratory chain via ETF-ubiquinone oxidoreductase. ETF is an heterodimer that consists of an...; Region: ETF_alpha; cd01715
160488012886	Electron transfer flavoprotein FAD-binding domain; Region: ETF_alpha; pfam00766
160488012887	The electron transfer flavoprotein (ETF) serves as a specific electron acceptor for various mitochondrial dehydrogenases. ETF transfers electrons to the main respiratory chain via ETF-ubiquinone oxidoreductase. ETF is an heterodimer that consists of an...; Region: ETF_beta; cd01714
160488012888	Ligand binding site [chemical binding]; other site
160488012889	Electron transfer flavoprotein domain; Region: ETF; pfam01012
160488012890	Dehydrogenases (flavoproteins) [Energy production and conversion]; Region: FixC; COG0644
160488012891	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
160488012892	Electron transfer flavoprotein-ubiquinone oxidoreductase; Region: ETF_QO; pfam05187
160488012893	antitoxin MqsA for MqsR toxin; Region: MqsA; cd12870
160488012894	toxin interface [polypeptide binding]; other site
160488012895	putative zinc finger/helix-turn-helix protein, YgiT family; Region: CxxCG_CxxCG_HTH; TIGR03830
160488012896	Zn binding site [ion binding]; other site
160488012897	Helix-turn-helix XRE-family like proteins; Region: HTH_XRE; smart00530
160488012898	non-specific DNA binding site [nucleotide binding]; other site
160488012899	salt bridge; other site
160488012900	sequence-specific DNA binding site [nucleotide binding]; other site
160488012901	Motility quorum-sensing regulator (MqsR); Region: MqsR; cd12869
160488012902	peptide binding site [polypeptide binding]; other site
160488012903	metabolite-proton symporter; Region: 2A0106; TIGR00883
160488012904	hybrid sensory histidine kinase in two-component regulatory system with EvgA; Provisional; Region: PRK09959
160488012905	RNA polymerase sigma factor; Reviewed; Region: PRK12527
160488012906	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
160488012907	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
160488012908	DNA binding residues [nucleotide binding]
160488012909	macrolide transporter subunit MacA; Provisional; Region: PRK11578
160488012910	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
160488012911	HlyD family secretion protein; Region: HlyD_3; pfam13437
160488012912	macrolide transporter ATP-binding /permease protein; Provisional; Region: PRK10535
160488012913	ATP-binding cassette domain of the transporters involved in export of lipoprotein and macrolide, and cell division protein; Region: ABC_MJ0796_LolCDE_FtsE; cd03255
160488012914	Walker A/P-loop; other site
160488012915	ATP binding site [chemical binding]; other site
160488012916	Q-loop/lid; other site
160488012917	ABC transporter signature motif; other site
160488012918	Walker B; other site
160488012919	D-loop; other site
160488012920	H-loop/switch region; other site
160488012921	MacB-like periplasmic core domain; Region: MacB_PCD; pfam12704
160488012922	FtsX-like permease family; Region: FtsX; pfam02687
160488012923	efflux transporter, outer membrane factor (OMF) lipoprotein, NodT family; Region: outer_NodT; TIGR01845
160488012924	Membrane dipeptidase (Peptidase family M19); Region: Peptidase_M19; pfam01244
160488012925	Zn-dependent dipeptidase, microsomal dipeptidase homolog [Amino acid transport and metabolism]; Region: COG2355
160488012926	active site
160488012927	Superfamily of metallo-dependent hydrolases (also called amidohydrolase superfamily) is a large group of proteins that show conservation in their 3-dimensional fold (TIM barrel) and in details of their active site. The vast majority of the members have a...; Region: metallo-dependent_hydrolases; cl00281
160488012928	Selenocysteine lyase/Cysteine desulfurase [Posttranslational modification, protein turnover, chaperones]; Region: csdA; COG0520
160488012929	Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes. PLP combines with an alpha-amino acid to form a compound called a Schiff base or aldimine intermediate, which depending on the reaction, is the...; Region: AAT_I; cl00321
160488012930	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
160488012931	catalytic residue [active]
160488012932	Uncharacterized conserved protein [Function unknown]; Region: COG1262
160488012933	Formylglycine-generating sulfatase enzyme; Region: FGE-sulfatase; pfam03781
160488012934	cyclic peptide transporter; Region: cyc_pep_trnsptr; TIGR01194
160488012935	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
160488012936	ATP-binding cassette domain of multidrug resistance protein-like transporters; Region: ABCC_MRP_Like; cd03228
160488012937	Walker A/P-loop; other site
160488012938	ATP binding site [chemical binding]; other site
160488012939	Q-loop/lid; other site
160488012940	ABC transporter signature motif; other site
160488012941	Walker B; other site
160488012942	D-loop; other site
160488012943	H-loop/switch region; other site
160488012944	Secretin and TonB N terminus short domain; Region: STN; smart00965
160488012945	Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid [Inorganic ion transport and metabolism]; Region: FhuE; COG4773
160488012946	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
160488012947	N-terminal plug; other site
160488012948	ligand-binding site [chemical binding]; other site
160488012949	alpha/beta hydrolase fold; Region: Abhydrolase_3; pfam07859
160488012950	Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326
160488012951	Condensation domain; Region: Condensation; pfam00668
160488012952	Non-ribosomal peptide synthetase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: EntF; COG1020
160488012953	HxxPF-repeated domain; Region: HxxPF_rpt; pfam13745
160488012954	The adenylation domain of nonribosomal peptide synthetases (NRPS), including salinosporamide A polyketide synthase; Region: A_NRPS_Ta1_like; cd12116
160488012955	acyl-activating enzyme (AAE) consensus motif; other site
160488012956	AMP binding site [chemical binding]; other site
160488012957	Phosphopantetheine attachment site; Region: PP-binding; pfam00550
160488012958	Condensation domain; Region: Condensation; pfam00668
160488012959	Non-ribosomal peptide synthetase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: EntF; COG1020
160488012960	HxxPF-repeated domain; Region: HxxPF_rpt; pfam13745
160488012961	The adenylation domain of nonribosomal peptide synthetases (NRPS); Region: A_NRPS; cd05930
160488012962	acyl-activating enzyme (AAE) consensus motif; other site
160488012963	AMP binding site [chemical binding]; other site
160488012964	Phosphopantetheine attachment site; Region: PP-binding; pfam00550
160488012965	Condensation domain; Region: Condensation; pfam00668
160488012966	Non-ribosomal peptide synthetase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: EntF; COG1020
160488012967	The adenylation domain of nonribosomal peptide synthetases (NRPS); Region: A_NRPS; cd05930
160488012968	acyl-activating enzyme (AAE) consensus motif; other site
160488012969	AMP binding site [chemical binding]; other site
160488012970	Phosphopantetheine attachment site; Region: PP-binding; pfam00550
160488012971	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
160488012972	Condensation domain; Region: Condensation; pfam00668
160488012973	Non-ribosomal peptide synthetase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: EntF; COG1020
160488012974	HxxPF-repeated domain; Region: HxxPF_rpt; pfam13745
160488012975	The adenylation domain of nonribosomal peptide synthetases (NRPS); Region: A_NRPS; cd05930
160488012976	acyl-activating enzyme (AAE) consensus motif; other site
160488012977	AMP binding site [chemical binding]; other site
160488012978	Phosphopantetheine attachment site; Region: PP-binding; pfam00550
160488012979	Condensation domain; Region: Condensation; pfam00668
160488012980	Non-ribosomal peptide synthetase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: EntF; COG1020
160488012981	non-ribosomal peptide synthase domain TIGR01720; Region: NRPS-para261
160488012982	Condensation domain; Region: Condensation; pfam00668
160488012983	The adenylation domain of nonribosomal peptide synthetases (NRPS); Region: A_NRPS; cd05930
160488012984	amino acid adenylation domain; Region: AA-adenyl-dom; TIGR01733
160488012985	acyl-activating enzyme (AAE) consensus motif; other site
160488012986	AMP binding site [chemical binding]; other site
160488012987	Phosphopantetheine attachment site; Region: PP-binding; pfam00550
160488012988	Condensation domain; Region: Condensation; pfam00668
160488012989	Non-ribosomal peptide synthetase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: EntF; COG1020
160488012990	HxxPF-repeated domain; Region: HxxPF_rpt; pfam13745
160488012991	The adenylation domain of nonribosomal peptide synthetases (NRPS); Region: A_NRPS; cd05930
160488012992	acyl-activating enzyme (AAE) consensus motif; other site
160488012993	AMP binding site [chemical binding]; other site
160488012994	Phosphopantetheine attachment site; Region: PP-binding; pfam00550
160488012995	Condensation domain; Region: Condensation; pfam00668
160488012996	Non-ribosomal peptide synthetase modules and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: EntF; COG1020
160488012997	HxxPF-repeated domain; Region: HxxPF_rpt; pfam13745
160488012998	The adenylation domain of nonribosomal peptide synthetases (NRPS); Region: A_NRPS; cd05930
160488012999	acyl-activating enzyme (AAE) consensus motif; other site
160488013000	AMP binding site [chemical binding]; other site
160488013001	Phosphopantetheine attachment site; Region: PP-binding; pfam00550
160488013002	Taurine catabolism dioxygenase TauD, TfdA family; Region: TauD; pfam02668
160488013003	diaminobutyrate--2-oxoglutarate aminotransferase; Provisional; Region: PRK06938
160488013004	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
160488013005	inhibitor-cofactor binding pocket; inhibition site
160488013006	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488013007	catalytic residue [active]
160488013008	sensor protein QseC; Provisional; Region: PRK10337
160488013009	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488013010	dimer interface [polypeptide binding]; other site
160488013011	phosphorylation site [posttranslational modification]
160488013012	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488013013	ATP binding site [chemical binding]; other site
160488013014	G-X-G motif; other site
160488013015	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
160488013016	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488013017	active site
160488013018	phosphorylation site [posttranslational modification]
160488013019	intermolecular recognition site; other site
160488013020	dimerization interface [polypeptide binding]; other site
160488013021	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
160488013022	DNA binding site [nucleotide binding]
160488013023	GAD-like domain; Region: GAD-like; pfam08887
160488013024	Domain of unknown function (DUF1851); Region: DUF1851; pfam08906
160488013025	GAD-like domain; Region: GAD-like; pfam08887
160488013026	Domain of unknown function (DUF1851); Region: DUF1851; pfam08906
160488013027	GT_2_like_f is a subfamily of the glycosyltransferase family 2 (GT-2) with unknown function; Region: GT_2_like_f; cd04182
160488013028	metal-binding site
160488013029	Xanthine and CO dehydrogenases maturation factor, XdhC/CoxF family [Posttranslational modification, protein turnover, chaperones]; Region: XdhC; COG1975
160488013030	XdhC and CoxI family; Region: XdhC_CoxI; pfam02625
160488013031	XdhC Rossmann domain; Region: XdhC_C; pfam13478
160488013032	Cytochrome c, mono- and diheme variants [Energy production and conversion]; Region: CccA; COG2010
160488013033	Cytochrome c, mono- and diheme variants [Energy production and conversion]; Region: CccA; COG2010
160488013034	Cytochrome c; Region: Cytochrom_C; pfam00034
160488013035	Aerobic-type carbon monoxide dehydrogenase, small subunit CoxS/CutS homologs [Energy production and conversion]; Region: CoxS; COG2080
160488013036	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cl00159
160488013037	[2Fe-2S] binding domain; Region: Fer2_2; pfam01799
160488013038	thiol:disulfide interchange protein precursor; Provisional; Region: dipZ; PRK00293
160488013039	Disulphide bond corrector protein DsbC; Region: DsbC; pfam11412
160488013040	DsbD gamma family; DsbD gamma is the C-terminal periplasmic domain of the bacterial protein DsbD. It contains a CXXC motif in a TRX fold and shuttles the reducing potential from the membrane domain (DsbD beta) to the N-terminal periplasmic domain (DsbD...; Region: DsbDgamma; cd02953
160488013041	Thioredoxin-like; Region: Thioredoxin_8; pfam13905
160488013042	DsbD alpha interface [polypeptide binding]; other site
160488013043	catalytic residues [active]
160488013044	Prolipoprotein diacylglyceryl transferase; Region: LGT; cl00478
160488013045	TlpA-like family; composed of  TlpA, ResA, DsbE and similar proteins. TlpA, ResA and DsbE are bacterial protein disulfide reductases with important roles in cytochrome maturation. They are membrane-anchored proteins with a soluble TRX domain containing a...; Region: TlpA_like_family; cd02966
160488013046	Thioredoxin-like; Region: Thioredoxin_8; pfam13905
160488013047	catalytic residues [active]
160488013048	disulfide isomerase/thiol-disulfide oxidase; Provisional; Region: dsbG; PRK11657
160488013049	DsbA family, DsbC and DsbG subfamily; V-shaped homodimeric proteins containing a redox active CXXC motif imbedded in a TRX fold. They function as protein disulfide isomerases and chaperones in the bacterial periplasm to correct non-native disulfide bonds...; Region: DsbA_DsbC_DsbG; cd03020
160488013050	dimerization domain [polypeptide binding]; other site
160488013051	dimer interface [polypeptide binding]; other site
160488013052	catalytic residues [active]
160488013053	YcaO-like family; Region: YcaO; pfam02624
160488013054	RHS repeat-associated core domain; Region: Rhs_assc_core; TIGR03696
160488013055	peptide synthase; Validated; Region: PRK05691
160488013056	Fatty acyl-AMP ligase (FAAL); Region: FAAL; cd05931
160488013057	acyl-activating enzyme (AAE) consensus motif; other site
160488013058	active site
160488013059	Phosphopantetheine attachment site; Region: PP-binding; pfam00550
160488013060	HxxPF-repeated domain; Region: HxxPF_rpt; pfam13745
160488013061	The adenylation domain of nonribosomal peptide synthetases (NRPS); Region: A_NRPS; cd05930
160488013062	acyl-activating enzyme (AAE) consensus motif; other site
160488013063	AMP binding site [chemical binding]; other site
160488013064	Phosphopantetheine attachment site; Region: PP-binding; pfam00550
160488013065	HxxPF-repeated domain; Region: HxxPF_rpt; pfam13745
160488013066	The adenylation domain of nonribosomal peptide synthetases (NRPS); Region: A_NRPS; cd05930
160488013067	acyl-activating enzyme (AAE) consensus motif; other site
160488013068	AMP binding site [chemical binding]; other site
160488013069	Phosphopantetheine attachment site; Region: PP-binding; pfam00550
160488013070	non-ribosomal peptide synthase domain TIGR01720; Region: NRPS-para261
160488013071	The adenylation domain of nonribosomal peptide synthetases (NRPS); Region: A_NRPS; cd05930
160488013072	acyl-activating enzyme (AAE) consensus motif; other site
160488013073	AMP binding site [chemical binding]; other site
160488013074	Phosphopantetheine attachment site; Region: PP-binding; pfam00550
160488013075	extracytoplasmic-function sigma-70 factor; Validated; Region: PRK07037
160488013076	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
160488013077	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
160488013078	DNA binding residues [nucleotide binding]
160488013079	Acetyltransferase (GNAT) domain; Region: Acetyltransf_8; pfam13523
160488013080	Siderophore biosynthesis protein domain; Region: AlcB; smart01006
160488013081	Bacterial periplasmic substrate-binding proteins; Region: PBPb; smart00062
160488013082	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488013083	substrate binding pocket [chemical binding]; other site
160488013084	membrane-bound complex binding site; other site
160488013085	hinge residues; other site
160488013086	DEDDh 3'-5' exonuclease domain of Caenorhabditis elegans ERI-1, human 3' exonuclease, and similar proteins; Region: ERI-1_3'hExo_like; cd06133
160488013087	active site
160488013088	catalytic site [active]
160488013089	substrate binding site [chemical binding]; other site
160488013090	Protein of unknown function (DUF1255); Region: DUF1255; pfam06865
160488013091	Predicted hydrolase of the alpha/beta-hydrolase fold [General function prediction only]; Region: COG3571
160488013092	Uncharacterized conserved protein (DUF2048); Region: DUF2048; pfam09752
160488013093	Cytochrome cbb3 oxidase subunit I.  Cytochrome cbb3 oxidase, the terminal oxidase in the respiratory chains of proteobacteria, is a multi-chain transmembrane protein located in the cell membrane. Like other cytochrome oxidases, it catalyzes the reduction...; Region: cbb3_Oxidase_I; cd01661
160488013094	Cytochrome C and Quinol oxidase polypeptide I; Region: COX1; pfam00115
160488013095	Low-spin heme binding site [chemical binding]; other site
160488013096	Putative water exit pathway; other site
160488013097	Binuclear center (active site) [active]
160488013098	Putative proton exit pathway; other site
160488013099	Cbb3-type cytochrome oxidase, cytochrome c subunit [Energy production and conversion]; Region: CcoO; COG2993
160488013100	cbb3-type cytochrome c oxidase subunit II; Provisional; Region: PRK14487
160488013101	Cbb3-type cytochrome oxidase component FixQ; Region: FixQ; pfam05545
160488013102	cytochrome c oxidase, cbb3-type, subunit III; Region: ccoP; TIGR00782
160488013103	Cytochrome C oxidase, cbb3-type, subunit III; Region: Cytochrome_CBB3; pfam13442
160488013104	Cytochrome c; Region: Cytochrom_C; pfam00034
160488013105	Cytochrome cbb3 oxidase subunit I.  Cytochrome cbb3 oxidase, the terminal oxidase in the respiratory chains of proteobacteria, is a multi-chain transmembrane protein located in the cell membrane. Like other cytochrome oxidases, it catalyzes the reduction...; Region: cbb3_Oxidase_I; cd01661
160488013106	Cytochrome C and Quinol oxidase polypeptide I; Region: COX1; pfam00115
160488013107	Low-spin heme binding site [chemical binding]; other site
160488013108	Putative water exit pathway; other site
160488013109	Binuclear center (active site) [active]
160488013110	Putative proton exit pathway; other site
160488013111	Cbb3-type cytochrome oxidase, cytochrome c subunit [Energy production and conversion]; Region: CcoO; COG2993
160488013112	cbb3-type cytochrome c oxidase subunit II; Provisional; Region: PRK14487
160488013113	Cytochrome cbb oxidase CcoQ.  Cytochrome cbb3 oxidase, the terminal oxidase in the respiratory chains of proteobacteria, is a multi-chain transmembrane protein located in the cell membrane. Like other cytochrome oxidases, it catalyzes the reduction of O2...; Region: cbb3_Oxidase_CcoQ; cd01324
160488013114	cytochrome c oxidase, cbb3-type, subunit III; Region: ccoP; TIGR00782
160488013115	Cytochrome C oxidase, cbb3-type, subunit III; Region: Cytochrome_CBB3; pfam13442
160488013116	Cytochrome c; Region: Cytochrom_C; pfam00034
160488013117	cytochrome c oxidase accessory protein FixG; Region: ccoG_rdxA_fixG; TIGR02745
160488013118	4Fe-4S binding domain; Region: Fer4_5; pfam12801
160488013119	Ubp3 associated protein Bre5; Region: Bre5; pfam11614
160488013120	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3198
160488013121	FixH; Region: FixH; pfam05751
160488013122	Putative metal-binding domain of cation transport ATPase; Region: ATPase-cat_bd; pfam12156
160488013123	Cation transport ATPase [Inorganic ion transport and metabolism]; Region: ZntA; COG2217
160488013124	Heavy-metal-associated domain; Region: HMA; pfam00403
160488013125	metal-binding site [ion binding]
160488013126	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
160488013127	haloacid dehalogenase-like hydrolase; Region: HAD; cl17202
160488013128	Cytochrome oxidase maturation protein cbb3-type; Region: CcoS; pfam03597
160488013129	Cytochrome C biogenesis protein transmembrane region; Region: DsbD; cl15788
160488013130	coproporphyrinogen III oxidase; Provisional; Region: PRK09249
160488013131	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
160488013132	FeS/SAM binding site; other site
160488013133	HemN C-terminal domain; Region: HemN_C; pfam06969
160488013134	fumarate/nitrate reduction transcriptional regulator; Provisional; Region: PRK11161
160488013135	effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038
160488013136	ligand binding site [chemical binding]; other site
160488013137	flexible hinge region; other site
160488013138	helix_turn_helix, cAMP Regulatory protein C-terminus; DNA binding domain of prokaryotic regulatory proteins belonging to the catabolite activator protein family; Region: HTH_CRP; cd00092
160488013139	putative switch regulator; other site
160488013140	non-specific DNA interactions [nucleotide binding]; other site
160488013141	DNA binding site [nucleotide binding]
160488013142	sequence specific DNA binding site [nucleotide binding]; other site
160488013143	putative cAMP binding site [chemical binding]; other site
160488013144	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
160488013145	active site
160488013146	recombination protein RecR; Reviewed; Region: recR; PRK00076
160488013147	RecR protein; Region: RecR; pfam02132
160488013148	TOPRIM_recR: topoisomerase-primase (TOPRIM) nucleotidyl transferase/hydrolase domain of the type found in Escherichia coli RecR.  RecR participates in the RecFOR pathway of homologous recombinational repair in prokaryotes. This pathway provides a...; Region: TOPRIM_recR; cd01025
160488013149	putative active site [active]
160488013150	putative metal-binding site [ion binding]; other site
160488013151	tetramer interface [polypeptide binding]; other site
160488013152	hypothetical protein; Validated; Region: PRK00153
160488013153	DNA polymerase III, subunit gamma and tau; Region: dnaX_nterm; TIGR02397
160488013154	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488013155	Walker A motif; other site
160488013156	ATP binding site [chemical binding]; other site
160488013157	Walker B motif; other site
160488013158	arginine finger; other site
160488013159	DNA polymerase III subunits gamma and tau domain III; Region: DNA_pol3_gamma3; pfam12169
160488013160	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
160488013161	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488013162	substrate binding pocket [chemical binding]; other site
160488013163	membrane-bound complex binding site; other site
160488013164	hinge residues; other site
160488013165	Protein of unknown function (DUF2938); Region: DUF2938; pfam11158
160488013166	Cu(I)-responsive transcriptional regulator; Region: CueR; TIGR02044
160488013167	Helix-Turn-Helix DNA binding domain of putative transcription regulators from the MerR superfamily; Region: HTH_MerR-like_sg6; cd04781
160488013168	DNA binding residues [nucleotide binding]
160488013169	putative dimer interface [polypeptide binding]; other site
160488013170	putative metal binding residues [ion binding]; other site
160488013171	NAD-dependent DNA ligase LigA; Validated; Region: ligA; PRK07956
160488013172	NAD+ dependent DNA ligase adenylation domain. DNA ligases catalyze the crucial step of joining the breaks in duplex DNA during DNA replication, repair and recombination, utilizing either ATP or NAD(+) as a cofactor, but using the same basic reaction...; Region: LIGANc; cd00114
160488013173	nucleotide binding pocket [chemical binding]; other site
160488013174	K-X-D-G motif; other site
160488013175	catalytic site [active]
160488013176	NAD-dependent DNA ligase OB-fold domain; Region: DNA_ligase_OB; pfam03120
160488013177	Helix-hairpin-helix motif; Region: HHH_2; pfam12826
160488013178	Breast Cancer Suppressor Protein (BRCA1), carboxy-terminal domain. The BRCT domain is found within many DNA damage repair and cell cycle checkpoint proteins. The unique diversity of this domain superfamily allows BRCT modules to interact forming homo...; Region: BRCT; cd00027
160488013179	Dimer interface [polypeptide binding]; other site
160488013180	cell division protein ZipA; Reviewed; Region: zipA; PRK00269
160488013181	Cell division protein [Cell division and chromosome partitioning]; Region: ZipA; COG3115
160488013182	FtsZ protein binding site [polypeptide binding]; other site
160488013183	chromosome segregation protein SMC, common bacterial type; Region: SMC_prok_B; TIGR02168
160488013184	ATP-binding cassette domain of barmotin, a member of the SMC protein family; Region: ABC_SMC_barmotin; cd03278
160488013185	Walker A/P-loop; other site
160488013186	ATP binding site [chemical binding]; other site
160488013187	Q-loop/lid; other site
160488013188	SMC proteins Flexible Hinge Domain; Region: SMC_hinge; smart00968
160488013189	chromosome segregation protein SMC, common bacterial type; Region: SMC_prok_B; TIGR02168
160488013190	ATP-binding cassette domain of barmotin, a member of the SMC protein family; Region: ABC_SMC_barmotin; cd03278
160488013191	ABC transporter signature motif; other site
160488013192	Walker B; other site
160488013193	D-loop; other site
160488013194	H-loop/switch region; other site
160488013195	Transcriptional regulators [Transcription]; Region: GntR; COG1802
160488013196	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488013197	DNA-binding site [nucleotide binding]; DNA binding site
160488013198	FCD domain; Region: FCD; cl11656
160488013199	xanthine dehydrogenase, small subunit; Region: xanthine_xdhA; TIGR02963
160488013200	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
160488013201	catalytic loop [active]
160488013202	iron binding site [ion binding]; other site
160488013203	[2Fe-2S] binding domain; Region: Fer2_2; pfam01799
160488013204	CO dehydrogenase flavoprotein C-terminal domain; Region: CO_deh_flav_C; pfam03450
160488013205	xanthine dehydrogenase, molybdopterin binding subunit; Region: xanthine_xdhB; TIGR02965
160488013206	Aldehyde oxidase and xanthine dehydrogenase, a/b hammerhead domain; Region: Ald_Xan_dh_C; smart01008
160488013207	Molybdopterin-binding domain of aldehyde dehydrogenase; Region: Ald_Xan_dh_C2; pfam02738
160488013208	XdhC and CoxI family; Region: XdhC_CoxI; pfam02625
160488013209	xanthine dehydrogenase accessory protein XdhC; Region: xanthine_xdhC; TIGR02964
160488013210	XdhC Rossmann domain; Region: XdhC_C; pfam13478
160488013211	guanine deaminase; Provisional; Region: PRK09228
160488013212	Guanine deaminase (GDEase). Guanine deaminase is an aminohydrolase responsible for the conversion of guanine to xanthine and ammonia, the first step to utilize guanine as a nitrogen source. This reaction also removes the guanine base from the pool and...; Region: GDEase; cd01303
160488013213	active site
160488013214	Major intrinsic protein (MIP) superfamily. Members of the MIP superfamily function as membrane channels that selectively transport water, small neutral molecules, and ions out of and between cells. The channel proteins share a common fold: the N-terminal...; Region: MIP; cd00333
160488013215	amphipathic channel; other site
160488013216	Asn-Pro-Ala signature motifs; other site
160488013217	Transcriptional regulators [Transcription]; Region: GntR; COG1802
160488013218	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488013219	DNA-binding site [nucleotide binding]; DNA binding site
160488013220	This entry represents the C-terminal ligand binding domain of many members of the GntR family; Region: FCD; smart00895
160488013221	Xanthine/uracil/vitamin C permease [Nucleotide transport and    metabolism]; Region: COG2252
160488013222	HIUase (5-hydroxyisourate hydrolase) catalyzes the second step in a three-step ureide pathway in which 5-hydroxyisourate (HIU), a product of the uricase (urate oxidase) reaction, is hydrolyzed to 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline (OHCU); Region: TLP_HIUase; cd05822
160488013223	active site
160488013224	homotetramer interface [polypeptide binding]; other site
160488013225	putative urate catabolism protein; Region: uraD_N-term-dom; TIGR03212
160488013226	Catalytic domain of bacterial PuuE allantoinases, Schizosaccharomyces pombe chitin deacetylase 1 (SpCDA1), and similar proteins; Region: CE4_PuuE_SpCDA1; cd10977
160488013227	active site
160488013228	catalytic site [active]
160488013229	tetramer interface [polypeptide binding]; other site
160488013230	OHCU decarboxylase; Region: UHCUDC; TIGR03164
160488013231	Ureidoglycolate hydrolase [Nucleotide transport and metabolism]; Region: DAL3; COG3194
160488013232	ureidoglycolate hydrolase; Provisional; Region: PRK03606
160488013233	Predicted membrane protein [Function unknown]; Region: COG3748
160488013234	Protein of unknown function (DUF989); Region: DUF989; pfam06181
160488013235	Cytochrome c; Region: Cytochrom_C; pfam00034
160488013236	xanthine permease; Region: pbuX; TIGR03173
160488013237	Nucleoside-specific channel-forming protein, Tsx; Region: Channel_Tsx; cl04114
160488013238	Nucleoside-specific channel-forming protein, Tsx; Region: Channel_Tsx; cl04114
160488013239	Protein of unknown function (DUF808); Region: DUF808; pfam05661
160488013240	pyrimidine utilization regulatory protein R; Region: RutR; TIGR03613
160488013241	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
160488013242	YcdC-like protein, C-terminal region; Region: TetR_C_3; pfam08362
160488013243	Uncharacterized protein, possibly involved in utilization of glycolate and propanediol [General function prediction only]; Region: GlcG; COG3193
160488013244	glyoxylate carboligase; Provisional; Region: PRK11269
160488013245	Pyrimidine (PYR) binding domain of POX and related proteins; Region: TPP_PYR_POX_like; cd07035
160488013246	PYR/PP interface [polypeptide binding]; other site
160488013247	dimer interface [polypeptide binding]; other site
160488013248	TPP binding site [chemical binding]; other site
160488013249	Thiamine pyrophosphate enzyme, central domain; Region: TPP_enzyme_M; pfam00205
160488013250	Thiamine pyrophosphate (TPP) enzyme family, TPP-binding module; found in many key metabolic enzymes which use TPP (also known as thiamine diphosphate) as a cofactor. These enzymes include, among others, the E1 components of the pyruvate, the acetoin and...; Region: TPP_enzymes; cl01629
160488013251	TPP-binding site [chemical binding]; other site
160488013252	hydroxypyruvate isomerase; Region: OH-pyruv-isom; TIGR03234
160488013253	tartronate semialdehyde reductase; Provisional; Region: PRK15059
160488013254	6-phosphogluconate dehydrogenase-like protein; Reviewed; Region: PRK09599
160488013255	Putative glycerate kinase [Carbohydrate transport and metabolism]; Region: GckA; COG2379
160488013256	Domain of unknown function (DUF4147); Region: DUF4147; pfam13660
160488013257	MOFRL family; Region: MOFRL; pfam05161
160488013258	pyruvate kinase; Provisional; Region: PRK06247
160488013259	Pyruvate kinase (PK):  Large allosteric enzyme that regulates glycolysis through binding of the substrate, phosphoenolpyruvate, and one or more allosteric effectors. Like other allosteric enzymes, PK has a high substrate affinity R state and a low...; Region: Pyruvate_Kinase; cl17342
160488013260	domain interfaces; other site
160488013261	active site
160488013262	Urea transporter; Region: UT; pfam03253
160488013263	RHS repeat-associated core domain; Region: Rhs_assc_core; TIGR03696
160488013264	Ion transport protein; Region: Ion_trans; pfam00520
160488013265	Ion channel; Region: Ion_trans_2; pfam07885
160488013266	zinc-ribbon domain; Region: zf-ribbon_3; cl11198
160488013267	ABC-type sulfate transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: Sbp; COG1613
160488013268	Bacterial extracellular solute-binding protein; Region: SBP_bac_11; pfam13531
160488013269	S-adenosylmethionine-dependent methyltransferase; Region: Methyltrans_SAM; pfam10672
160488013270	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488013271	S-adenosylmethionine binding site [chemical binding]; other site
160488013272	Permeases of the drug/metabolite transporter (DMT) superfamily [Carbohydrate transport and metabolism / Amino acid transport and metabolism / General function prediction only]; Region: RhaT; COG0697
160488013273	EamA-like transporter family; Region: EamA; pfam00892
160488013274	Transcriptional regulators [Transcription]; Region: Lrp; COG1522
160488013275	AsnC-type helix-turn-helix domain; Region: HTH_AsnC-type; pfam13404
160488013276	AsnC family; Region: AsnC_trans_reg; pfam01037
160488013277	uncharacterized nucleobase-cation-symport-1 (NCS1) transporter subfamily; solute-binding domain; Region: SLC-NCS1sbd_u1; cd11555
160488013278	Permease for cytosine/purines, uracil, thiamine, allantoin; Region: Transp_cyt_pur; pfam02133
160488013279	Na binding site [ion binding]; other site
160488013280	putative substrate binding site [chemical binding]; other site
160488013281	Asp/Glu/Hydantoin racemase; Region: Asp_Glu_race; cl00518
160488013282	D-amino acid dehydrogenase small subunit; Validated; Region: PRK00711
160488013283	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
160488013284	FKBP-type peptidyl-prolyl cis-trans isomerases 1 [Posttranslational modification, protein turnover, chaperones]; Region: FkpA; COG0545
160488013285	FKBP-type peptidyl-prolyl cis-trans isomerase; Region: FKBP_C; pfam00254
160488013286	Uncharacterized conserved protein [Function unknown]; Region: COG3791
160488013287	Predicted epimerase, PhzC/PhzF homolog [General function prediction only]; Region: COG0384
160488013288	Lactate dehydrogenase and related dehydrogenases [Energy production and conversion / Coenzyme metabolism / General function prediction only]; Region: LdhA; COG1052
160488013289	Formate/glycerate dehydrogenases, D-specific 2-hydroxy acid dehydrogenases and related dehydrogenases; Region: FDH_GDH_like; cl17240
160488013290	NAD binding site [chemical binding]; other site
160488013291	Transposase DDE domain; Region: DDE_Tnp_1; pfam01609
160488013292	DNA polymerase III subunits gamma and tau; Provisional; Region: PRK14950
160488013293	TlpA-like family, DsbE (also known as CcmG and CycY) subfamily; DsbE is a membrane-anchored, periplasmic TRX-like reductase containing a CXXC motif that specifically donates reducing equivalents to apocytochrome c via CcmH, another cytochrome c...; Region: TlpA_like_DsbE; cd03010
160488013294	Thioredoxin-like; Region: Thioredoxin_8; pfam13905
160488013295	catalytic residues [active]
160488013296	central insert; other site
160488013297	Cytochrome c biogenesis factor [Posttranslational modification, protein turnover, chaperones]; Region: CcmF; COG1138
160488013298	cytochrome c-type biogenesis protein CcmE; Reviewed; Region: PRK13254
160488013299	Heme exporter protein D [Intracellular trafficking and secretion]; Region: CcmD; COG3114
160488013300	heme exporter protein CcmC; Region: ccmC; TIGR01191
160488013301	CcmB protein; Region: CcmB; cl17444
160488013302	cytochrome c biogenesis protein CcmA; Provisional; Region: PRK13538
160488013303	Cytochrome c biogenesis ATP-binding export protein; Region: ABC_CcmA_heme_exporter; cd03231
160488013304	Walker A/P-loop; other site
160488013305	ATP binding site [chemical binding]; other site
160488013306	Q-loop/lid; other site
160488013307	ABC transporter signature motif; other site
160488013308	Walker B; other site
160488013309	D-loop; other site
160488013310	H-loop/switch region; other site
160488013311	Flagellar hook-length control protein FliK; Region: Flg_hook; pfam02120
160488013312	Uncharacterized homolog of the cytoplasmic domain of flagellar protein FhlB [Function unknown]; Region: COG2257
160488013313	Glycosyltransferase sugar-binding region containing DXD motif; Region: Gly_transf_sug; pfam04488
160488013314	Protein of unknown function (DUF2802); Region: DUF2802; pfam10975
160488013315	CheW, a small regulator protein, unique to the chemotaxis signalling in prokaryotes and archea. CheW interacts with the histidine kinase CheA, most likely with the related regulatory domain of CheA. CheW is proposed to form signalling arrays together...; Region: CheW; cd00732
160488013316	putative CheA interaction surface; other site
160488013317	CheW-like domain. CheW proteins are part of the chemotaxis signalling mechanism in bacteria. CheW interacts with the methyl accepting chemotaxis proteins (MCPs) and relays signals to CheY, which affects flageller rotation. This family includes CheW and...; Region: CheW_like; cd00588
160488013318	ATPases involved in chromosome partitioning [Cell division and chromosome partitioning]; Region: Soj; COG1192
160488013319	The Fer4_NifH superfamily contains a variety of proteins which share a common ATP-binding domain. Functionally, proteins in this superfamily use the energy from hydrolysis of NTP to transfer electron or ion; Region: Fer4_NifH; cl17203
160488013320	ParA and ParB of Caulobacter crescentus belong to a conserved family of bacterial proteins implicated in chromosome segregation. ParB binds to DNA sequences adjacent to the origin of replication and localizes to opposite cell poles shortly following the...; Region: ParA; cd02042
160488013321	Magnesium ion binding site [ion binding]; other site
160488013322	flagellar motor protein MotD; Reviewed; Region: PRK09038
160488013323	Membrane MotB of proton-channel complex MotA/MotB; Region: MotB_plug; pfam13677
160488013324	Peptidoglycan binding domains similar to the C-terminal domain of outer-membrane protein OmpA; Region: OmpA_C-like; cd07185
160488013325	ligand binding site [chemical binding]; other site
160488013326	flagellar motor protein; Reviewed; Region: motC; PRK09109
160488013327	Flagellar motor component [Cell motility and secretion]; Region: MotA; COG1291
160488013328	chemotaxis-specific methylesterase; Provisional; Region: PRK00742
160488013329	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488013330	active site
160488013331	phosphorylation site [posttranslational modification]
160488013332	intermolecular recognition site; other site
160488013333	dimerization interface [polypeptide binding]; other site
160488013334	CheB methylesterase; Region: CheB_methylest; pfam01339
160488013335	Histidine Phosphotransfer domain, involved in signalling through a two part component systems in which an autophosphorylating histidine protein kinase serves as a phosphoryl donor to a response regulator protein; the response regulator protein is...; Region: HPT; cd00088
160488013336	putative binding surface; other site
160488013337	active site
160488013338	Chemotaxis protein histidine kinase and related kinases [Cell motility and secretion / Signal transduction mechanisms]; Region: CheA; COG0643
160488013339	Signal transducing histidine kinase, homodimeric domain; Region: H-kinase_dim; pfam02895
160488013340	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488013341	ATP binding site [chemical binding]; other site
160488013342	Mg2+ binding site [ion binding]; other site
160488013343	G-X-G motif; other site
160488013344	CheA regulatory domain; CheA is a histidine protein kinase present in bacteria and archea. Activated by the chemotaxis receptor a histidine phosphoryl group from CheA is passed directly to an aspartate in the response regulator CheY. This signalling...; Region: CheA_reg; cd00731
160488013345	Chemotaxis phosphatase, CheZ; Region: CheZ; pfam04344
160488013346	chemotaxis regulatory protein CheY; Provisional; Region: PRK10610
160488013347	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488013348	active site
160488013349	phosphorylation site [posttranslational modification]
160488013350	intermolecular recognition site; other site
160488013351	dimerization interface [polypeptide binding]; other site
160488013352	flagellar biosynthesis sigma factor; Validated; Region: fliA; PRK06986
160488013353	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
160488013354	Sigma-70 region 3; Region: Sigma70_r3; pfam04539
160488013355	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
160488013356	DNA binding residues [nucleotide binding]
160488013357	Antiactivator of flagellar biosynthesis FleN, an ATPase [Cell motility]; Region: flhG; COG0455
160488013358	The Fer4_NifH superfamily contains a variety of proteins which share a common ATP-binding domain. Functionally, proteins in this superfamily use the energy from hydrolysis of NTP to transfer electron or ion; Region: Fer4_NifH; cl17203
160488013359	The Fer4_NifH superfamily contains a variety of proteins which share a common ATP-binding domain. Functionally, proteins in this superfamily use the energy from hydrolysis of NTP to transfer electron or ion; Region: Fer4_NifH; cl17203
160488013360	FleN is a member of the Fer4_NifH superfamily. It shares the common function as an ATPase, with the ATP-binding domain at the N-terminus. In Pseudomonas aeruginosa, FleN gene is involved in regulating the number of flagella and chemotactic motility by...; Region: FleN-like; cd02038
160488013361	flagellar biosynthesis regulator FlhF; Validated; Region: flhF; PRK05703
160488013362	The Fer4_NifH superfamily contains a variety of proteins which share a common ATP-binding domain. Functionally, proteins in this superfamily use the energy from hydrolysis of NTP to transfer electron or ion; Region: Fer4_NifH; cl17203
160488013363	flagellar biosynthesis protein FlhA; Validated; Region: flhA; PRK06012
160488013364	FHIPEP family; Region: FHIPEP; pfam00771
160488013365	Transcriptional regulators [Transcription]; Region: GntR; COG1802
160488013366	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488013367	DNA-binding site [nucleotide binding]; DNA binding site
160488013368	FCD domain; Region: FCD; pfam07729
160488013369	D-alanyl-alanine synthetase A; Reviewed; Region: ddl; PRK01966
160488013370	D-ala D-ala ligase N-terminus; Region: Dala_Dala_lig_N; pfam01820
160488013371	ATP-grasp domain; Region: ATP-grasp_4; cl17255
160488013372	Elongator protein 3, MiaB family, Radical SAM; Region: Elp3; smart00729
160488013373	Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes. PLP combines with an alpha-amino acid to form a compound called a Schiff base or aldimine intermediate, which depending on the reaction, is the...; Region: AAT_I; cl00321
160488013374	Cystathionine beta-lyases/cystathionine gamma-synthases [Amino acid transport and metabolism]; Region: MetC; COG0626
160488013375	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
160488013376	catalytic residue [active]
160488013377	Cysteine sulfinate desulfinase/cysteine desulfurase and related enzymes [Amino acid transport and metabolism]; Region: NifS; COG1104
160488013378	cysteine desulfurase DndA; Region: DNA_S_dndA; TIGR03235
160488013379	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
160488013380	catalytic residue [active]
160488013381	flagellar biosynthesis protein FlhB; Reviewed; Region: flhB; PRK05702
160488013382	Uncharacterized homolog of the cytoplasmic domain of flagellar protein FhlB [Function unknown]; Region: COG2257; cl15822
160488013383	flagellar biosynthesis protein FliR; Reviewed; Region: fliR; PRK05701
160488013384	flagellar biosynthesis protein FliQ; Validated; Region: fliQ; PRK05700
160488013385	flagellar biosynthesis protein FliP; Reviewed; Region: fliP; PRK05699
160488013386	Flagellar biosynthesis protein, FliO; Region: FliO; pfam04347
160488013387	flagellar motor switch protein; Validated; Region: fliN; PRK05698
160488013388	Surface presentation of antigens (SPOA); Region: SpoA; cl00819
160488013389	flagellar motor switch protein FliM; Validated; Region: fliM; PRK06666
160488013390	Surface presentation of antigens (SPOA); Region: SpoA; pfam01052
160488013391	flagellar basal body-associated protein FliL; Reviewed; Region: fliL; PRK05696
160488013392	Flagellar hook-length control protein FliK; Region: Flg_hook; pfam02120
160488013393	Histidine Phosphotransfer domain, involved in signalling through a two part component systems in which an autophosphorylating histidine protein kinase serves as a phosphoryl donor to a response regulator protein; the response regulator protein is...; Region: HPT; cd00088
160488013394	putative binding surface; other site
160488013395	active site
160488013396	Response regulator receiver domain; Region: Response_reg; pfam00072
160488013397	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488013398	active site
160488013399	phosphorylation site [posttranslational modification]
160488013400	intermolecular recognition site; other site
160488013401	dimerization interface [polypeptide binding]; other site
160488013402	Serine phosphatase RsbU, regulator of sigma subunit [Signal transduction mechanisms / Transcription]; Region: RsbU; COG2208
160488013403	Stage II sporulation protein E (SpoIIE); Region: SpoIIE; pfam07228
160488013404	Sulphate Transporter and Anti-Sigma factor antagonist) domain of anti-anti-sigma factors, key regulators of anti-sigma factors by phosphorylation; Region: STAS_anti-anti-sigma_factors; cd07043
160488013405	anti sigma factor interaction site; other site
160488013406	regulatory phosphorylation site [posttranslational modification]; other site
160488013407	flagellar biosynthesis chaperone; Validated; Region: fliJ; PRK05689
160488013408	Flagellar biosynthesis chaperone [Cell motility and secretion / Intracellular trafficking and secretion / Posttranslational modification, protein turnover, chaperones]; Region: FliJ; COG2882
160488013409	flagellum-specific ATP synthase; Validated; Region: fliI; PRK05688
160488013410	Flagellum-specific ATPase/type III secretory pathway virulence-related protein. This group of ATPases are responsible for the export of flagellum and virulence-related proteins. The bacterial flagellar motor is similar to the F0F1-ATPase, in that they...; Region: ATPase_flagellum-secretory_path_III; cd01136
160488013411	Walker A motif/ATP binding site; other site
160488013412	Walker B motif; other site
160488013413	flagellar assembly protein H; Validated; Region: fliH; PRK05687
160488013414	Flagellar assembly protein FliH; Region: FliH; pfam02108
160488013415	flagellar motor switch protein G; Validated; Region: fliG; PRK05686
160488013416	MgtE intracellular N domain; Region: MgtE_N; cl15244
160488013417	FliG C-terminal domain; Region: FliG_C; pfam01706
160488013418	flagellar MS-ring protein; Reviewed; Region: fliF; PRK06007
160488013419	Secretory protein of YscJ/FliF family; Region: YscJ_FliF; pfam01514
160488013420	Flagellar M-ring protein C-terminal; Region: YscJ_FliF_C; pfam08345
160488013421	flagellar hook-basal body protein FliE; Reviewed; Region: fliE; PRK00253
160488013422	Response regulator containing CheY-like receiver, AAA-type ATPase, and DNA-binding domains [Signal transduction mechanisms]; Region: AtoC; COG2204
160488013423	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488013424	active site
160488013425	phosphorylation site [posttranslational modification]
160488013426	intermolecular recognition site; other site
160488013427	dimerization interface [polypeptide binding]; other site
160488013428	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488013429	Walker A motif; other site
160488013430	ATP binding site [chemical binding]; other site
160488013431	Walker B motif; other site
160488013432	arginine finger; other site
160488013433	Bacterial regulatory protein, Fis family; Region: HTH_8; cl17420
160488013434	phosphate regulon sensor kinase PhoR; Region: phoR_proteo; TIGR02966
160488013435	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488013436	putative active site [active]
160488013437	heme pocket [chemical binding]; other site
160488013438	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488013439	dimer interface [polypeptide binding]; other site
160488013440	phosphorylation site [posttranslational modification]
160488013441	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488013442	ATP binding site [chemical binding]; other site
160488013443	Mg2+ binding site [ion binding]; other site
160488013444	G-X-G motif; other site
160488013445	Response regulator containing CheY-like receiver, AAA-type ATPase, and DNA-binding domains [Signal transduction mechanisms]; Region: AtoC; COG2204
160488013446	Flagellar regulatory protein FleQ; Region: FleQ; pfam06490
160488013447	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488013448	Walker A motif; other site
160488013449	ATP binding site [chemical binding]; other site
160488013450	Walker B motif; other site
160488013451	arginine finger; other site
160488013452	Bacterial regulatory protein, Fis family; Region: HTH_8; pfam02954
160488013453	flagellar protein FliS; Validated; Region: fliS; PRK05685
160488013454	flagellar capping protein; Reviewed; Region: fliD; PRK08032
160488013455	Flagellar hook-associated protein 2 C-terminus; Region: FliD_N; pfam02465
160488013456	Flagellar hook-associated protein 2 C-terminus; Region: FliD_C; pfam07195
160488013457	FlaG protein; Region: FlaG; pfam03646
160488013458	flagellin; Reviewed; Region: PRK08869
160488013459	Bacterial flagellin N-terminal helical region; Region: Flagellin_N; pfam00669
160488013460	Bacterial flagellin C-terminal helical region; Region: Flagellin_C; pfam00700
160488013461	Ketoacyl-acyl carrier protein synthase III (KASIII) initiates the elongation in type II fatty acid synthase systems. It is found in bacteria and plants. Elongation of fatty acids in the type II systems occurs by Claisen condensation of malonyl-acyl...; Region: KAS_III; cd00830
160488013462	3-oxoacyl-[acyl-carrier-protein]; Region: FabH; COG0332
160488013463	dimer interface [polypeptide binding]; other site
160488013464	active site
160488013465	CoA binding pocket [chemical binding]; other site
160488013466	flagellar hook-associated protein FlgL; Provisional; Region: flgL; PRK12717
160488013467	Bacterial flagellin N-terminal helical region; Region: Flagellin_N; pfam00669
160488013468	flagellar hook-associated protein FlgK; Validated; Region: flgK; PRK05683
160488013469	Flagellar basal body rod FlgEFG protein C-terminal; Region: Flg_bbr_C; pfam06429
160488013470	flagellar rod assembly protein/muramidase FlgJ; Validated; Region: flgJ; PRK05684
160488013471	Rod binding protein [Cell envelope biogenesis, outer membrane / Cell motility and secretion / Posttranslational modification, protein turnover, chaperones]; Region: COG3951
160488013472	Mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase; Region: Glucosaminidase; pfam01832
160488013473	flagellar basal body P-ring protein; Provisional; Region: flgI; PRK05303
160488013474	flagellar basal body P-ring protein; Reviewed; Region: flgI; cl14622
160488013475	flagellar basal body L-ring protein; Reviewed; Region: flgH; PRK12698
160488013476	flagellar basal body L-ring protein; Reviewed; Region: flgH; PRK00249
160488013477	flagellar basal body rod protein FlgG; Provisional; Region: flgG; PRK12693
160488013478	Flagella basal body rod protein; Region: Flg_bb_rod; pfam00460
160488013479	Flagellar basal body rod FlgEFG protein C-terminal; Region: Flg_bbr_C; pfam06429
160488013480	flagellar basal body rod protein FlgF; Reviewed; Region: flgF; PRK12640
160488013481	Flagella basal body rod protein; Region: Flg_bb_rod; pfam00460
160488013482	flagellar basal-body rod protein FlgF; Region: flgF; TIGR02490
160488013483	flagellar hook protein FlgE; Validated; Region: flgE; PRK05682
160488013484	Flagella basal body rod protein; Region: Flg_bb_rod; pfam00460
160488013485	Flagellar basal body protein FlaE; Region: FlaE; pfam07559
160488013486	Flagellar basal body rod FlgEFG protein C-terminal; Region: Flg_bbr_C; pfam06429
160488013487	flagellar basal body rod modification protein; Reviewed; Region: flgD; PRK06655
160488013488	Flagellar hook capping protein - N-terminal region; Region: FlgD; pfam03963
160488013489	FlgD Tudor-like domain; Region: FLgD_tudor; pfam13861
160488013490	flagellar basal body rod protein FlgC; Reviewed; Region: flgC; PRK05681
160488013491	Flagella basal body rod protein; Region: Flg_bb_rod; pfam00460
160488013492	Flagellar basal body rod FlgEFG protein C-terminal; Region: Flg_bbr_C; pfam06429
160488013493	flagellar basal body rod protein FlgB; Reviewed; Region: flgB; PRK07182
160488013494	flagellar basal body rod protein FlgB; Reviewed; Region: flgB; PRK05680
160488013495	Methylase of chemotaxis methyl-accepting proteins [Cell motility and secretion / Signal transduction mechanisms]; Region: CheR; COG1352
160488013496	CheR methyltransferase, all-alpha domain; Region: CheR_N; pfam03705
160488013497	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488013498	Chemotaxis signal transduction protein [Cell motility and secretion / Signal transduction mechanisms]; Region: CheW; COG0835
160488013499	Response regulator receiver domain; Region: Response_reg; pfam00072
160488013500	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488013501	active site
160488013502	phosphorylation site [posttranslational modification]
160488013503	intermolecular recognition site; other site
160488013504	dimerization interface [polypeptide binding]; other site
160488013505	flagellar basal body P-ring biosynthesis protein FlgA; Reviewed; Region: flgA; PRK07018
160488013506	SAF domains of the flagella basal body P-ring formation protein FlgA and the flp pilus assembly CpaB; Region: SAF_CpaB_FlgA_like; cd11614
160488013507	flagellar biosynthesis anti-sigma factor FlgM; Region: FlgM_jcvi; TIGR03824
160488013508	FlgN protein; Region: FlgN; pfam05130
160488013509	Flagellar regulator YcgR; Region: YcgR; pfam07317
160488013510	c-di-GMP-binding protein [Signal transduction mechanisms]; Region: COG5581
160488013511	PilZ domain; Region: PilZ; pfam07238
160488013512	putative MFS family transporter protein; Provisional; Region: PRK03633
160488013513	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488013514	putative substrate translocation pore; other site
160488013515	Glutamine synthetase [Amino acid transport and metabolism]; Region: GlnA; COG0174
160488013516	Glutamine synthetase, catalytic domain; Region: Gln-synt_C; pfam00120
160488013517	Transcriptional regulators [Transcription]; Region: Lrp; COG1522
160488013518	Winged helix-turn-helix DNA-binding; Region: HTH_24; pfam13412
160488013519	putative DNA binding site [nucleotide binding]; other site
160488013520	putative Zn2+ binding site [ion binding]; other site
160488013521	AsnC family; Region: AsnC_trans_reg; pfam01037
160488013522	2-oxoisovalerate dehydrogenase E1 alpha subunit N terminal; Region: OxoDH_E1alpha_N; pfam12573
160488013523	Pyruvate/2-oxoglutarate dehydrogenase complex, dehydrogenase (E1) component, eukaryotic type, alpha subunit [Energy production and conversion]; Region: AcoA; COG1071
160488013524	Thiamine pyrophosphate (TPP) family, E1 of PDC_ADC_BCADC subfamily, TPP-binding module; composed of proteins similar to the E1 components of the human pyruvate dehydrogenase complex (PDC), the acetoin dehydrogenase complex (ADC) and the branched chain...; Region: TPP_E1_PDC_ADC_BCADC; cd02000
160488013525	tetramer interface [polypeptide binding]; other site
160488013526	TPP-binding site [chemical binding]; other site
160488013527	heterodimer interface [polypeptide binding]; other site
160488013528	phosphorylation loop region [posttranslational modification]
160488013529	Pyruvate/2-oxoglutarate dehydrogenase complex, dehydrogenase (E1) component, eukaryotic type, beta subunit [Energy production and conversion]; Region: AcoB; COG0022
160488013530	Pyrimidine (PYR) binding domain of the beta subunits of the E1 components of human pyruvate dehydrogenase complex (E1- PDHc) and related proteins; Region: TPP_PYR_E1-PDHc-beta_like; cd07036
160488013531	alpha subunit interface [polypeptide binding]; other site
160488013532	TPP binding site [chemical binding]; other site
160488013533	heterodimer interface [polypeptide binding]; other site
160488013534	Transketolase, C-terminal domain; Region: Transketolase_C; pfam02780
160488013535	branched-chain alpha-keto acid dehydrogenase subunit E2; Reviewed; Region: PRK11856
160488013536	Lipoyl domain of the dihydrolipoyl acyltransferase component (E2) of 2-oxo acid dehydrogenases. 2-oxo acid dehydrogenase multienzyme complexes, like pyruvate dehydrogenase (PDH), 2-oxoglutarate dehydrogenase (OGDH) and branched-chain 2-oxo acid...; Region: lipoyl_domain; cd06849
160488013537	E3 interaction surface; other site
160488013538	lipoyl attachment site [posttranslational modification]; other site
160488013539	e3 binding domain; Region: E3_binding; pfam02817
160488013540	2-oxoacid dehydrogenases acyltransferase (catalytic domain); Region: 2-oxoacid_dh; pfam00198
160488013541	dihydrolipoamide dehydrogenase; Validated; Region: PRK05976
160488013542	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
160488013543	Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852
160488013544	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488013545	PAS fold; Region: PAS_3; pfam08447
160488013546	putative active site [active]
160488013547	heme pocket [chemical binding]; other site
160488013548	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
160488013549	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488013550	metal binding site [ion binding]; metal-binding site
160488013551	active site
160488013552	I-site; other site
160488013553	AAA domain; Region: AAA_32; pfam13654
160488013554	Gamma-aminobutyrate permease and related permeases [Amino acid transport and metabolism]; Region: AnsP; COG1113
160488013555	Spore germination protein; Region: Spore_permease; cl17796
160488013556	DNA breaking-rejoining enzymes, intergrase/recombinases, C-terminal catalytic domain. The tyrosine recombinase/integrase family share the same catalytic domain containing six conserved active site residues. The best-studied members of this diverse family...; Region: INT_REC_C; cd01182
160488013557	active site
160488013558	catalytic residues [active]
160488013559	DNA binding site [nucleotide binding]
160488013560	Int/Topo IB signature motif; other site
160488013561	DNA breaking-rejoining enzymes, intergrase/recombinases, C-terminal catalytic domain. The tyrosine recombinase/integrase family share the same catalytic domain containing six conserved active site residues. The best-studied members of this diverse family...; Region: INT_REC_C; cd01182
160488013562	active site
160488013563	catalytic residues [active]
160488013564	DNA binding site [nucleotide binding]
160488013565	Int/Topo IB signature motif; other site
160488013566	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
160488013567	Transposase; Region: HTH_Tnp_1; pfam01527
160488013568	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: Tra5; COG2801
160488013569	HTH-like domain; Region: HTH_21; pfam13276
160488013570	Integrase core domain; Region: rve; pfam00665
160488013571	Integrase core domain; Region: rve_3; pfam13683
160488013572	hypothetical protein; Provisional; Region: PRK07482
160488013573	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
160488013574	inhibitor-cofactor binding pocket; inhibition site
160488013575	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488013576	catalytic residue [active]
160488013577	succinic semialdehyde dehydrogenase; Region: PLN02278
160488013578	Mitochondrial succinate-semialdehyde dehydrogenase and ALDH family members 5A1 and 5F1-like; Region: ALDH_F5_SSADH_GabD; cd07103
160488013579	tetramerization interface [polypeptide binding]; other site
160488013580	NAD(P) binding site [chemical binding]; other site
160488013581	catalytic residues [active]
160488013582	ectoine utilization protein EutE; Region: ectoine_eutE; TIGR02994
160488013583	Peptidase M14 Succinylglutamate desuccinylase (ASTE)/aspartoacylase (ASPA)-like; uncharacterized subgroup; Region: M14_ASTE_ASPA_like_2; cd06252
160488013584	putative active site [active]
160488013585	Zn binding site [ion binding]; other site
160488013586	Transcriptional regulators [Transcription]; Region: Lrp; COG1522
160488013587	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
160488013588	putative DNA binding site [nucleotide binding]; other site
160488013589	putative Zn2+ binding site [ion binding]; other site
160488013590	AsnC family; Region: AsnC_trans_reg; pfam01037
160488013591	ectoine/hydroxyectoine ABC transporter, ATP-binding protein; Region: ectoine_ehuA; TIGR03005
160488013592	ATP-binding cassette domain of the histidine and glutamine transporters; Region: ABC_HisP_GlnQ; cd03262
160488013593	Walker A/P-loop; other site
160488013594	ATP binding site [chemical binding]; other site
160488013595	Q-loop/lid; other site
160488013596	ABC transporter signature motif; other site
160488013597	Walker B; other site
160488013598	D-loop; other site
160488013599	H-loop/switch region; other site
160488013600	ABC-type arginine transport system, permease component [Amino acid transport and metabolism]; Region: ArtQ; COG4215
160488013601	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488013602	dimer interface [polypeptide binding]; other site
160488013603	conserved gate region; other site
160488013604	putative PBP binding loops; other site
160488013605	ABC-ATPase subunit interface; other site
160488013606	ABC-type arginine transport system, permease component [Amino acid transport and metabolism]; Region: ArtQ; COG4215
160488013607	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488013608	dimer interface [polypeptide binding]; other site
160488013609	conserved gate region; other site
160488013610	putative PBP binding loops; other site
160488013611	ABC-ATPase subunit interface; other site
160488013612	ectoine/hydroxyectoine ABC transporter solute-binding protein; Region: ectoine_ehuB; TIGR02995
160488013613	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488013614	substrate binding pocket [chemical binding]; other site
160488013615	membrane-bound complex binding site; other site
160488013616	hinge residues; other site
160488013617	Transcriptional regulators containing a DNA-binding HTH domain and an aminotransferase domain (MocR family) and their eukaryotic orthologs [Transcription / Amino acid transport and metabolism]; Region: ARO8; COG1167
160488013618	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488013619	DNA-binding site [nucleotide binding]; DNA binding site
160488013620	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
160488013621	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488013622	homodimer interface [polypeptide binding]; other site
160488013623	catalytic residue [active]
160488013624	Threonine dehydratase [Amino acid transport and metabolism]; Region: IlvA; COG1171
160488013625	Threonine dehydratase: The first step in amino acid degradation is the removal of nitrogen. Although the nitrogen atoms of most amino acids are transferred to alpha-ketoglutarate before removal, the alpha-amino group of threonine can be directly...; Region: Thr-dehyd; cd01562
160488013626	tetramer interface [polypeptide binding]; other site
160488013627	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488013628	catalytic residue [active]
160488013629	ectoine utilization protein EutC; Region: ectoine_eutC; TIGR02992
160488013630	ornithine cyclodeaminase; Validated; Region: PRK06823; cl17400
160488013631	ectoine utilization protein EutD; Region: ectoine_eutD; TIGR02993
160488013632	Creatinase/Prolidase N-terminal domain; Region: Creatinase_N; pfam01321
160488013633	A family including aminopeptidase P, aminopeptidase M, and prolidase. Also known as metallopeptidase family M24. This family of enzymes is able to cleave amido-, imido- and amidino-containing bonds. Members exibit relatively narrow substrate specificity...; Region: APP_MetAP; cd01066
160488013634	active site
160488013635	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488013636	metabolite-proton symporter; Region: 2A0106; TIGR00883
160488013637	putative substrate translocation pore; other site
160488013638	D-amino acid dehydrogenase small subunit; Validated; Region: PRK00711
160488013639	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
160488013640	hydroxyglutarate oxidase; Provisional; Region: PRK11728
160488013641	This group of proteins belong to a large family of YjgF/YER057c/UK114-like proteins present in bacteria, archaea, and eukaryotes with no definitive function.  The conserved domain is similar in structure to chorismate mutase but there is no sequence...; Region: YjgF_YER057c_UK114_like_2; cd06150
160488013642	homotrimer interaction site [polypeptide binding]; other site
160488013643	putative active site [active]
160488013644	Transposase; Region: HTH_Tnp_1; pfam01527
160488013645	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
160488013646	IS66 Orf2 like protein; Region: TnpB_IS66; pfam05717
160488013647	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3436
160488013648	Transposase C of IS166 homeodomain; Region: LZ_Tnp_IS66; pfam13007
160488013649	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3436
160488013650	putative Helix-turn-helix domain of transposase IS66; Region: HTH_Tnp_IS66; pfam13005
160488013651	Transposase IS66 family; Region: DDE_Tnp_IS66; pfam03050
160488013652	IS66 C-terminal element; Region: DDE_Tnp_IS66_C; pfam13817
160488013653	Transposase; Region: HTH_Tnp_1; pfam01527
160488013654	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
160488013655	IS66 Orf2 like protein; Region: TnpB_IS66; pfam05717
160488013656	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3436
160488013657	Transposase C of IS166 homeodomain; Region: LZ_Tnp_IS66; pfam13007
160488013658	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3436
160488013659	putative Helix-turn-helix domain of transposase IS66; Region: HTH_Tnp_IS66; pfam13005
160488013660	Transposase IS66 family; Region: DDE_Tnp_IS66; pfam03050
160488013661	IS66 C-terminal element; Region: DDE_Tnp_IS66_C; pfam13817
160488013662	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
160488013663	Transposase; Region: HTH_Tnp_1; cl17663
160488013664	HTH-like domain; Region: HTH_21; pfam13276
160488013665	Integrase core domain; Region: rve; pfam00665
160488013666	RT_G2_intron: Reverse transcriptases (RTs) with group II intron origin. RT transcribes DNA using RNA as template. Proteins in this subfamily are found in bacterial and mitochondrial group II introns. Their most probable ancestor was a retrotransposable...; Region: RT_G2_intron; cd01651
160488013667	Reverse transcriptase (RNA-dependent DNA polymerase); Region: RVT_1; pfam00078
160488013668	putative active site [active]
160488013669	putative NTP binding site [chemical binding]; other site
160488013670	putative nucleic acid binding site [nucleotide binding]; other site
160488013671	INTRON09; Group II intron; Group II intron whose maturase has best BLASTP match to RetA from Serratia marcescens. 5-prime and 3-prime splice sites NOT determined.
160488013672	Domain of unknown function DUF87; Region: DUF87; pfam01935
160488013673	AAA-like domain; Region: AAA_10; pfam12846
160488013674	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
160488013675	catalytic core [active]
160488013676	NAD/NADP octopine/nopaline dehydrogenase, alpha-helical domain; Region: Octopine_DH; pfam02317
160488013677	ATPase components of various ABC-type transport systems, contain duplicated ATPase [General function prediction only]; Region: COG1123
160488013678	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
160488013679	Walker A/P-loop; other site
160488013680	ATP binding site [chemical binding]; other site
160488013681	Q-loop/lid; other site
160488013682	ABC transporter signature motif; other site
160488013683	Walker B; other site
160488013684	D-loop; other site
160488013685	H-loop/switch region; other site
160488013686	Oligopeptide/dipeptide transporter, C-terminal region; Region: oligo_HPY; cl07097
160488013687	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
160488013688	Walker A/P-loop; other site
160488013689	ATP binding site [chemical binding]; other site
160488013690	Q-loop/lid; other site
160488013691	ABC transporter signature motif; other site
160488013692	Walker B; other site
160488013693	D-loop; other site
160488013694	H-loop/switch region; other site
160488013695	Oligopeptide/dipeptide transporter, C-terminal region; Region: oligo_HPY; pfam08352
160488013696	ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppC; COG1173
160488013697	N-terminal TM domain of oligopeptide transport permease C; Region: OppC_N; pfam12911
160488013698	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488013699	dimer interface [polypeptide binding]; other site
160488013700	conserved gate region; other site
160488013701	putative PBP binding loops; other site
160488013702	ABC-ATPase subunit interface; other site
160488013703	ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppB; COG0601
160488013704	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488013705	dimer interface [polypeptide binding]; other site
160488013706	conserved gate region; other site
160488013707	putative PBP binding loops; other site
160488013708	ABC-ATPase subunit interface; other site
160488013709	Uncharacterized NAD(FAD)-dependent dehydrogenases [General function prediction only]; Region: HcaD; COG0446
160488013710	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
160488013711	BFD-like [2Fe-2S] binding domain; Region: Fer2_BFD; pfam04324
160488013712	Glycine/D-amino acid oxidases (deaminating) [Amino acid transport and metabolism]; Region: DadA; COG0665
160488013713	hydroxyglutarate oxidase; Provisional; Region: PRK11728
160488013714	ABC-type dipeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: DdpA; COG0747
160488013715	The substrate-binding component of an uncharacterized ABC-type nickel/dipeptide/oligopeptide-like import system contains the type 2 periplasmic binding fold; Region: PBP2_NikA_DppA_OppA_like_1; cd08508
160488013716	Helix-turn-helix domain; Region: HTH_28; pfam13518
160488013717	Winged helix-turn helix; Region: HTH_29; pfam13551
160488013718	Homeodomain-like domain; Region: HTH_32; pfam13565
160488013719	DDE superfamily endonuclease; Region: DDE_3; pfam13358
160488013720	DNA-binding transcriptional regulator LysR; Provisional; Region: PRK11013
160488013721	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488013722	The C-terminal substrate-domain of LysR-type transcriptional regulators involved in the catabolism of opines and that of related regulators, contains the type 2 periplasmic binding fold; Region: PBP2_LysR_opines_like; cd08415
160488013723	putative dimerization interface [polypeptide binding]; other site
160488013724	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488013725	metabolite-proton symporter; Region: 2A0106; TIGR00883
160488013726	putative substrate translocation pore; other site
160488013727	hypothetical protein; Validated; Region: PRK06201
160488013728	Demethylmenaquinone methyltransferase [Coenzyme metabolism]; Region: MenG; COG0684
160488013729	nitrilase; Region: PLN02798
160488013730	Nit1, Nit 2, and related proteins, and the Nit1-like domain of NitFhit (class 10 nitrilases); Region: nit; cd07572
160488013731	putative active site [active]
160488013732	catalytic triad [active]
160488013733	dimer interface [polypeptide binding]; other site
160488013734	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488013735	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488013736	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
160488013737	dimerization interface [polypeptide binding]; other site
160488013738	outer membrane porin, OprD family; Region: OprD; pfam03573
160488013739	Probable taurine catabolism dioxygenase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: TauD; COG2175
160488013740	Taurine catabolism dioxygenase TauD, TfdA family; Region: TauD; pfam02668
160488013741	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488013742	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488013743	The C-terminal substrate binding domain of LysR-type transcriptional regulators involved in the catabolism of aromatic compounds and that of other related regulators, contains type 2 periplasmic binding fold; Region: PBP2_LTTR_aromatics_like; cd08414
160488013744	dimerization interface [polypeptide binding]; other site
160488013745	substrate binding pocket [chemical binding]; other site
160488013746	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
160488013747	non-specific DNA binding site [nucleotide binding]; other site
160488013748	salt bridge; other site
160488013749	sequence-specific DNA binding site [nucleotide binding]; other site
160488013750	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cl17315
160488013751	DNA binding residues [nucleotide binding]
160488013752	Nucleoside/nucleotide kinase (NK) is a protein superfamily consisting of multiple families of enzymes that share structural similarity and are functionally related to the catalysis of the reversible phosphate group transfer from nucleoside triphosphates...; Region: NK; cl17190
160488013753	Guanylate kinase [Nucleotide transport and metabolism]; Region: Gmk; COG0194
160488013754	Arc-like DNA binding domain; Region: Arc; pfam03869
160488013755	Mg/Co/Ni transporter MgtE (contains CBS domain) [Inorganic ion transport and metabolism]; Region: MgtE; COG2239
160488013756	MgtE intracellular N domain; Region: MgtE_N; smart00924
160488013757	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domain in the magnesium transporter, MgtE.  MgtE and its homologs are found in eubacteria, archaebacteria, and eukaryota. Members of this family transport Mg2+ or other...; Region: CBS_pair_Mg_transporter; cd04606
160488013758	Divalent cation transporter; Region: MgtE; pfam01769
160488013759	carbon storage regulator; Provisional; Region: PRK01712
160488013760	aspartate kinase; Reviewed; Region: PRK06635
160488013761	AAK_AKii-LysC-BS: Amino Acid Kinase Superfamily (AAK), AKii; this CD includes the N-terminal catalytic aspartokinase (AK) domain of the lysine-sensitive aspartokinase isoenzyme AKII of Bacillus subtilis 168, and the lysine plus threonine-sensitive...; Region: AAK_AKii-LysC-BS; cd04261
160488013762	putative nucleotide binding site [chemical binding]; other site
160488013763	putative catalytic residues [active]
160488013764	putative Mg ion binding site [ion binding]; other site
160488013765	putative aspartate binding site [chemical binding]; other site
160488013766	ACT domains of the lysine-sensitive aspartokinase isoenzyme AKII of Bacillus subtilis (BS) strain 168 and related proteins; Region: ACT_AKii-LysC-BS-like_1; cd04913
160488013767	putative allosteric regulatory site; other site
160488013768	ACT domains of the lysine-sensitive, aspartokinase (AK) isoenzyme AKII of Bacillus subtilis (BS) strain 168 and related domains; Region: ACT_AKii-LysC-BS-like_2; cd04936
160488013769	putative allosteric regulatory residue; other site
160488013770	alanyl-tRNA synthetase; Reviewed; Region: alaS; PRK00252
160488013771	Alanyl-tRNA synthetase (AlaRS) class II core catalytic domain. AlaRS is a homodimer. It is responsible for the attachment of alanine to the 3' OH group of ribose of the appropriate tRNA. This domain is primarily responsible for ATP-dependent...; Region: AlaRS_core; cd00673
160488013772	motif 1; other site
160488013773	active site
160488013774	motif 2; other site
160488013775	motif 3; other site
160488013776	Threonyl and Alanyl tRNA synthetase second additional domain; Region: tRNA_SAD; smart00863
160488013777	DHHA1 domain; Region: DHHA1; pfam02272
160488013778	Peptidase M14 Succinylglutamate desuccinylase (ASTE) subfamily; Region: M14_ASTE; cd03855
160488013779	Succinylglutamate desuccinylase / Aspartoacylase family; Region: AstE_AspA; pfam04952
160488013780	putative active site [active]
160488013781	Zn binding site [ion binding]; other site
160488013782	urease accessory protein UreE; Provisional; Region: ureE; PRK13263
160488013783	succinylarginine dihydrolase; Provisional; Region: PRK13281
160488013784	succinylglutamic semialdehyde dehydrogenase; Reviewed; Region: astD; PRK09457
160488013785	N-succinylglutamate 5-semialdehyde dehydrogenase, AstD-like; Region: ALDH_SGSD_AstD; cd07095
160488013786	NAD(P) binding site [chemical binding]; other site
160488013787	catalytic residues [active]
160488013788	Arginine/ornithine N-succinyltransferase beta subunit [Amino acid transport and metabolism]; Region: AstA; COG3138
160488013789	arginine N-succinyltransferase; Region: arg_catab_AstA; TIGR03244
160488013790	Arginine/ornithine N-succinyltransferase beta subunit [Amino acid transport and metabolism]; Region: AstA; COG3138
160488013791	arginine/ornithine succinyltransferase, alpha subunit; Region: arg_AOST_alph; TIGR03245
160488013792	bifunctional N-succinyldiaminopimelate-aminotransferase/acetylornithine transaminase protein; Reviewed; Region: argD; PRK05093
160488013793	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
160488013794	inhibitor-cofactor binding pocket; inhibition site
160488013795	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488013796	catalytic residue [active]
160488013797	Transcriptional regulator containing an amidase domain and an AraC-type DNA-binding HTH domain [Transcription]; Region: COG4977
160488013798	AraC transcriptional regulators having an N-terminal Type 1 glutamine amidotransferase (GATase1)-like domain; Region: GATase1_AraC_ArgR_like; cd03136
160488013799	conserved cys residue [active]
160488013800	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488013801	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488013802	ABC-type histidine transport system, ATPase component [Amino acid transport and metabolism]; Region: HisP; COG4598
160488013803	ATP-binding cassette domain of the histidine and glutamine transporters; Region: ABC_HisP_GlnQ; cd03262
160488013804	Walker A/P-loop; other site
160488013805	ATP binding site [chemical binding]; other site
160488013806	Q-loop/lid; other site
160488013807	ABC transporter signature motif; other site
160488013808	Walker B; other site
160488013809	D-loop; other site
160488013810	H-loop/switch region; other site
160488013811	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488013812	dimer interface [polypeptide binding]; other site
160488013813	conserved gate region; other site
160488013814	putative PBP binding loops; other site
160488013815	ABC-ATPase subunit interface; other site
160488013816	ABC-type arginine transport system, permease component [Amino acid transport and metabolism]; Region: ArtQ; COG4215
160488013817	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488013818	dimer interface [polypeptide binding]; other site
160488013819	conserved gate region; other site
160488013820	putative PBP binding loops; other site
160488013821	ABC-ATPase subunit interface; other site
160488013822	lysine-arginine-ornithine-binding periplasmic protein; Region: 3A0103s03R; TIGR01096
160488013823	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488013824	substrate binding pocket [chemical binding]; other site
160488013825	membrane-bound complex binding site; other site
160488013826	hinge residues; other site
160488013827	acetyl-CoA synthetase; Provisional; Region: PRK00174
160488013828	Acetyl-CoA synthetase (also known as acetate-CoA ligase and acetyl-activating enzyme); Region: ACS; cd05966
160488013829	active site
160488013830	CoA binding site [chemical binding]; other site
160488013831	acyl-activating enzyme (AAE) consensus motif; other site
160488013832	AMP binding site [chemical binding]; other site
160488013833	acetate binding site [chemical binding]; other site
160488013834	Protein of unknown function (DUF2790); Region: DUF2790; pfam10976
160488013835	Transcriptional regulator of aromatic amino acids metabolism [Transcription / Amino acid transport and metabolism]; Region: TyrR; COG3283
160488013836	ACT domains are commonly involved in specifically binding an amino acid or other small ligand leading to regulation of the enzyme; Region: ACT; cl09141
160488013837	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488013838	putative active site [active]
160488013839	heme pocket [chemical binding]; other site
160488013840	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488013841	Walker A motif; other site
160488013842	ATP binding site [chemical binding]; other site
160488013843	Walker B motif; other site
160488013844	arginine finger; other site
160488013845	Prokaryotic phenylalanine-4-hydroxylase (pro_PheOH); a member of the biopterin-dependent aromatic amino acid hydroxylase family of non-heme, iron(II)-dependent enzymes that also includes the eukaryotic proteins, phenylalanine-4-hydroxylase (eu_PheOH); Region: pro_PheOH; cd03348
160488013846	cofactor binding site; other site
160488013847	metal binding site [ion binding]; metal-binding site
160488013848	PCD_DCoH: The bifunctional protein pterin-4alpha-carbinolamine dehydratase (PCD), also known as DCoH  (dimerization cofactor of hepatocyte nuclear factor-1), is both a transcription activator and a metabolic enzyme.  DCoH stimulates gene expression by...; Region: PCD_DCoH_subfamily_a; cd00913
160488013849	aromatic arch; other site
160488013850	DCoH dimer interaction site [polypeptide binding]; other site
160488013851	DCoH /HNF-1 dimer interaction site [polypeptide binding]; other site
160488013852	DCoH tetramer interaction site [polypeptide binding]; other site
160488013853	substrate binding site [chemical binding]; other site
160488013854	major facilitator superfamily transporter; Provisional; Region: PRK05122
160488013855	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488013856	putative substrate translocation pore; other site
160488013857	FAD/FMN-containing dehydrogenases [Energy production and conversion]; Region: GlcD; COG0277
160488013858	FAD binding domain; Region: FAD_binding_4; pfam01565
160488013859	Fe-S oxidoreductase [Energy production and conversion]; Region: GlpC; COG0247
160488013860	DNA-binding transcriptional activator GcvA; Provisional; Region: PRK11139
160488013861	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488013862	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
160488013863	dimerization interface [polypeptide binding]; other site
160488013864	aromatic amino acid transporter; Provisional; Region: PRK10238
160488013865	Putative transcriptional regulators (Ypuh-like); Region: DUF387; pfam04079
160488013866	Rec8/ScpA/Scc1-like protein (kleisin family) [Replication,    recombination, and repair]; Region: scpA; COG1354
160488013867	Telomere recombination; Region: Sua5_yciO_yrdC; cl00305
160488013868	Predicted metal-dependent phosphoesterases (PHP family) [General function prediction only]; Region: COG0613
160488013869	Polymerase and Histidinol Phosphatase domain of Histidinol phosphate phosphatase (HisPPase) AMP bound; Region: PHP_HisPPase_AMP; cd07438
160488013870	active site
160488013871	Protein of unknown function (DUF1677); Region: DUF1677; pfam07911
160488013872	Polymerase and Histidinol Phosphatase domain of Histidinol phosphate phosphatase (HisPPase) AMP bound; Region: PHP_HisPPase_AMP; cd07438
160488013873	intracellular septation protein A; Reviewed; Region: PRK00259
160488013874	YciI-like protein; Reviewed; Region: PRK11370
160488013875	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
160488013876	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488013877	active site
160488013878	phosphorylation site [posttranslational modification]
160488013879	intermolecular recognition site; other site
160488013880	dimerization interface [polypeptide binding]; other site
160488013881	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
160488013882	DNA binding site [nucleotide binding]
160488013883	CpxP component of the bacterial Cpx-two-component system and related proteins; Region: CpxP_like; cl01482
160488013884	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
160488013885	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cl01054
160488013886	dimerization interface [polypeptide binding]; other site
160488013887	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488013888	ATP binding site [chemical binding]; other site
160488013889	Mg2+ binding site [ion binding]; other site
160488013890	G-X-G motif; other site
160488013891	Nitroreductase-like family which includes NADH oxidase and arsenite oxidiase. NADH oxidase catalyses the oxidation of NAD(P)H and accepts a wide broad range of compounds as electron acceptors, such as nitrocompound. Arsenite oxidase in a...; Region: Arsenite_oxidase; cd02135
160488013892	putative FMN binding site [chemical binding]; other site
160488013893	Trk-type K+ transport systems, membrane components [Inorganic ion transport and metabolism]; Region: TrkG; COG0168
160488013894	potassium uptake protein, TrkH family; Region: 2a38; TIGR00933
160488013895	Arabinose-binding domain of AraC transcription regulator, N-term; Region: Arabinose_bd; pfam12625
160488013896	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
160488013897	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488013898	Protein of unknown function (DUF962); Region: DUF962; pfam06127
160488013899	Calcineurin-like phosphoesterase; Region: Metallophos; pfam00149
160488013900	Escherichia coli YbbF/LpxH and related proteins, metallophosphatase domain; Region: MPP_YbbF-LpxH; cd07398
160488013901	putative active site [active]
160488013902	putative metal binding site [ion binding]; other site
160488013903	Cupin domain; Region: Cupin_2; cl17218
160488013904	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488013905	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
160488013906	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488013907	EamA-like transporter family; Region: EamA; pfam00892
160488013908	Uncharacterized protein conserved in bacteria [Posttranslational modification, protein turnover, chaperones]; Region: COG3526
160488013909	Predicted esterase of the alpha-beta hydrolase superfamily [General function prediction only]; Region: RssA; COG1752
160488013910	Patatin-like phospholipase domain containing protein 6, protein 7, and fungal NTE1; Region: Pat_PNPLA6_PNPLA7_NTE1_like; cd07205
160488013911	active site
160488013912	nucleophile elbow; other site
160488013913	Surface antigen variable number repeat; Region: Surf_Ag_VNR; pfam07244
160488013914	Surface antigen; Region: Bac_surface_Ag; pfam01103
160488013915	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
160488013916	MarR family; Region: MarR_2; pfam12802
160488013917	ATP-dependent DNA helicase RecQ; Region: recQ; TIGR01389
160488013918	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
160488013919	ATP binding site [chemical binding]; other site
160488013920	putative Mg++ binding site [ion binding]; other site
160488013921	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
160488013922	nucleotide binding region [chemical binding]; other site
160488013923	ATP-binding site [chemical binding]; other site
160488013924	This DNA-binding domain is found in the RecQ helicase among others and has a helix-turn-helix structure; Region: RQC; smart00956
160488013925	HRDC domain; Region: HRDC; pfam00570
160488013926	Predicted metal-binding protein related to the C-terminal domain of SecA [General function prediction only]; Region: COG3318
160488013927	yecA family protein; Region: ygfB_yecA; TIGR02292
160488013928	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2832
160488013929	type I secretion outer membrane protein, TolC family; Region: type_I_sec_TolC; TIGR01844
160488013930	DTW domain; Region: DTW; cl01221
160488013931	PAS domain; Region: PAS_9; pfam13426
160488013932	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488013933	putative active site [active]
160488013934	heme pocket [chemical binding]; other site
160488013935	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
160488013936	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
160488013937	dimer interface [polypeptide binding]; other site
160488013938	putative CheW interface [polypeptide binding]; other site
160488013939	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488013940	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488013941	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
160488013942	dimerization interface [polypeptide binding]; other site
160488013943	Agmatinase-like family includes proclavaminic acid amidinohydrolase; Region: Agmatinase_PAH; cd11592
160488013944	agmatinase; Region: agmatinase; TIGR01230
160488013945	oligomer interface [polypeptide binding]; other site
160488013946	putative active site [active]
160488013947	Mn binding site [ion binding]; other site
160488013948	Uncharacterized bacterial solute carrier 5 subfamily; putative solute-binding domain; Region: SLC5sbd_u3; cd11479
160488013949	Na binding site [ion binding]; other site
160488013950	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488013951	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488013952	The C-terminal substrate binding domain of LysR-type transcriptional regulators, YofA and SoxR, contains the type 2 periplasmic binding fold; Region: PBP2_YofA_SoxR_like; cd08442
160488013953	putative dimerization interface [polypeptide binding]; other site
160488013954	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488013955	putative substrate translocation pore; other site
160488013956	Arabinose efflux permease [Carbohydrate transport and metabolism]; Region: AraJ; COG2814
160488013957	Permeases of the drug/metabolite transporter (DMT) superfamily [Carbohydrate transport and metabolism / Amino acid transport and metabolism / General function prediction only]; Region: RhaT; COG0697
160488013958	EamA-like transporter family; Region: EamA; pfam00892
160488013959	Domain of unknown function (DUF4415); Region: DUF4415; pfam14384
160488013960	Protein of unknown function (DUF497); Region: DUF497; pfam04365
160488013961	helicase 45; Provisional; Region: PTZ00424
160488013962	DEAD-box helicases. A diverse family of proteins involved in ATP-dependent RNA unwinding, needed in a variety of cellular processes including splicing, ribosome biogenesis and RNA degradation. The name derives from the sequence of the Walker  B motif; Region: DEADc; cd00268
160488013963	ATP binding site [chemical binding]; other site
160488013964	Mg++ binding site [ion binding]; other site
160488013965	motif III; other site
160488013966	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
160488013967	nucleotide binding region [chemical binding]; other site
160488013968	ATP-binding site [chemical binding]; other site
160488013969	Small-conductance mechanosensitive channel [Cell envelope biogenesis, outer membrane]; Region: MscS; COG0668
160488013970	Mechanosensitive ion channel; Region: MS_channel; pfam00924
160488013971	Protein of unknown function (DUF3732); Region: DUF3732; pfam12532
160488013972	Carboxylate/Amino Acid/Amine Transporter; Region: 2A78; TIGR00950
160488013973	azoreductase; Reviewed; Region: PRK00170
160488013974	NADPH-dependent FMN reductase; Region: FMN_red; pfam03358
160488013975	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488013976	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488013977	LysR substrate binding domain; Region: LysR_substrate; pfam03466
160488013978	dimerization interface [polypeptide binding]; other site
160488013979	3-oxoadipate enol-lactonase; Region: protocat_pcaD; TIGR02427
160488013980	Putative lysophospholipase; Region: Hydrolase_4; pfam12146
160488013981	peptidyl-prolyl cis-trans isomerase A (rotamase A); Provisional; Region: PRK10903
160488013982	cyclophilin_EcCYP_like: cyclophilin-type A-like peptidylprolyl cis- trans isomerase (PPIase) domain similar to the cytosolic E. coli cyclophilin A and Streptomyces antibioticus SanCyp18. Compared to the archetypal cyclophilin Human cyclophilin A, these...; Region: cyclophilin_EcCYP_like; cd01920
160488013983	substrate binding site [chemical binding]; other site
160488013984	ABC-type multidrug transport system, ATPase and permease components [Defense mechanisms]; Region: MdlB; COG1132
160488013985	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
160488013986	ATP-binding cassette domain of the bacterial lipid flippase and related proteins, subfamily C; Region: ABCC_MsbA; cd03251
160488013987	Walker A/P-loop; other site
160488013988	ATP binding site [chemical binding]; other site
160488013989	Q-loop/lid; other site
160488013990	ABC transporter signature motif; other site
160488013991	Walker B; other site
160488013992	D-loop; other site
160488013993	H-loop/switch region; other site
160488013994	Acetyltransferase (GNAT) domain; Region: Acetyltransf_6; cl17497
160488013995	Protein of unknown function, DUF482; Region: DUF482; pfam04339
160488013996	3-oxoacyl-(acyl carrier protein) synthase III; Reviewed; Region: PRK07515
160488013997	Ketoacyl-acyl carrier protein synthase III (KASIII) initiates the elongation in type II fatty acid synthase systems. It is found in bacteria and plants. Elongation of fatty acids in the type II systems occurs by Claisen condensation of malonyl-acyl...; Region: KAS_III; cd00830
160488013998	dimer interface [polypeptide binding]; other site
160488013999	active site
160488014000	CoA binding pocket [chemical binding]; other site
160488014001	ATP-dependent helicase HrpA; Region: DEAH_box_HrpA; TIGR01967
160488014002	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
160488014003	ATP binding site [chemical binding]; other site
160488014004	putative Mg++ binding site [ion binding]; other site
160488014005	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
160488014006	nucleotide binding region [chemical binding]; other site
160488014007	ATP-binding site [chemical binding]; other site
160488014008	Helicase associated domain (HA2); Region: HA2; pfam04408
160488014009	Oligonucleotide/oligosaccharide-binding (OB)-fold; Region: OB_NTP_bind; pfam07717
160488014010	Domain of unknown function (DUF3418); Region: DUF3418; pfam11898
160488014011	Glutamine synthetase [Amino acid transport and metabolism]; Region: GlnA; COG0174
160488014012	Glutamine synthetase, catalytic domain; Region: Gln-synt_C; pfam00120
160488014013	putative aminophosphonate oxidoreductase; Region: Phn_aa_oxid; TIGR03329
160488014014	Glycine/D-amino acid oxidases (deaminating) [Amino acid transport and metabolism]; Region: DadA; COG0665
160488014015	long-chain-fatty-acid--CoA ligase; Validated; Region: PRK05677
160488014016	Prokaryotic long-chain fatty acid CoA synthetases similar to Escherichia coli FadD; Region: FC-FACS_FadD_like; cd05936
160488014017	acyl-activating enzyme (AAE) consensus motif; other site
160488014018	putative AMP binding site [chemical binding]; other site
160488014019	putative active site [active]
160488014020	putative CoA binding site [chemical binding]; other site
160488014021	long-chain-fatty-acid--CoA ligase; Provisional; Region: PRK12492
160488014022	Prokaryotic long-chain fatty acid CoA synthetases similar to Escherichia coli FadD; Region: FC-FACS_FadD_like; cd05936
160488014023	acyl-activating enzyme (AAE) consensus motif; other site
160488014024	putative AMP binding site [chemical binding]; other site
160488014025	putative active site [active]
160488014026	putative CoA binding site [chemical binding]; other site
160488014027	Lysophospholipase [Lipid metabolism]; Region: PldB; COG2267
160488014028	Putative lysophospholipase; Region: Hydrolase_4; pfam12146
160488014029	Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326
160488014030	(R)-hydratase [(R)-specific enoyl-CoA hydratase] catalyzes the hydration of trans-2-enoyl CoA to (R)-3-hydroxyacyl-CoA as part of the PHA (polyhydroxyalkanoate) biosynthetic pathway. (R)-hydratase contains a hot-dog fold similar to those of thioesterase...; Region: R_hydratase; cd03449
160488014031	dimer interaction site [polypeptide binding]; other site
160488014032	substrate-binding tunnel; other site
160488014033	active site
160488014034	catalytic site [active]
160488014035	substrate binding site [chemical binding]; other site
160488014036	Predicted RNA polymerase sigma factor containing a TPR repeat domain [Transcription]; Region: COG4941
160488014037	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
160488014038	Sigma-70, region 4; Region: Sigma70_r4_2; pfam08281
160488014039	Putative hydrophobic ligand-binding SRPBCC domain of an uncharacterized subgroup of CalC- and Aha1-like proteins; Region: SRPBCC_CalC_Aha1-like_3; cd08896
160488014040	putative hydrophobic ligand binding site [chemical binding]; other site
160488014041	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3795
160488014042	Ketosteroid isomerase homolog [Function unknown]; Region: COG4319
160488014043	SnoaL-like domain; Region: SnoaL_3; pfam13474
160488014044	Protein of unknown function (DUF2790); Region: DUF2790; pfam10976
160488014045	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
160488014046	Coenzyme A binding pocket [chemical binding]; other site
160488014047	Polypeptide or peptide deformylase; a family of metalloenzymes that catalyzes the removal of the N-terminal formyl group in a growing polypeptide chain following translation initiation during protein synthesis in prokaryotes. These enzymes utilize Fe(II)...; Region: Pep_deformylase; cd00487
160488014048	active site
160488014049	catalytic residues [active]
160488014050	metal binding site [ion binding]; metal-binding site
160488014051	Virulence factor BrkB; Region: Virul_fac_BrkB; pfam03631
160488014052	CsbD-like; Region: CsbD; pfam05532
160488014053	Predicted RNA-bindining protein (contains S1 and HTH domains) [General function prediction only]; Region: COG2996
160488014054	S1 domain; Region: S1_2; pfam13509
160488014055	S1 domain; Region: S1_2; pfam13509
160488014056	Isocitrate dehydrogenase kinase/phosphatase [Signal transduction mechanisms]; Region: COG4579
160488014057	Isocitrate dehydrogenase kinase/phosphatase (AceK); Region: AceK; pfam06315
160488014058	EamA-like transporter family; Region: EamA; pfam00892
160488014059	Carboxylate/Amino Acid/Amine Transporter; Region: 2A78; TIGR00950
160488014060	EamA-like transporter family; Region: EamA; pfam00892
160488014061	Domain of unknown function (DUF4265); Region: DUF4265; pfam14085
160488014062	Aspartyl/asparaginyl beta-hydroxylase and related dioxygenases [Posttranslational modification, protein turnover, chaperones]; Region: COG3555
160488014063	Cysteine synthase [Amino acid transport and metabolism]; Region: CysK; COG0031
160488014064	CBS_like: This subgroup includes Cystathionine beta-synthase (CBS) and Cysteine synthase. CBS is a unique heme-containing enzyme that catalyzes a pyridoxal 5'-phosphate (PLP)-dependent condensation of serine and homocysteine to give cystathionine; Region: CBS_like; cd01561
160488014065	dimer interface [polypeptide binding]; other site
160488014066	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488014067	catalytic residue [active]
160488014068	Domain of Unknown Function (DUF748); Region: DUF748; pfam05359
160488014069	ATPases associated with a variety of cellular activities; Region: AAA; smart00382
160488014070	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488014071	Walker A motif; other site
160488014072	ATP binding site [chemical binding]; other site
160488014073	Walker B motif; other site
160488014074	arginine finger; other site
160488014075	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3825
160488014076	Allophanate hydrolase subunit 2; Region: AHS2; smart00797
160488014077	Allophanate hydrolase subunit 1; Region: AHS1; pfam02682
160488014078	Allophanate hydrolase subunit 1 [Amino acid transport and metabolism]; Region: DUR1; COG2049
160488014079	LamB/YcsF family of  lactam utilization protein; Region: LamB_YcsF_like; cd10787
160488014080	putative active site [active]
160488014081	benzoate transport; Region: 2A0115; TIGR00895
160488014082	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488014083	putative substrate translocation pore; other site
160488014084	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488014085	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488014086	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
160488014087	dimerization interface [polypeptide binding]; other site
160488014088	Protein of unknown function (DUF2937); Region: DUF2937; pfam11157
160488014089	Predicted glutamine amidotransferase [General function prediction only]; Region: COG0121
160488014090	Glutamine amidotransferases class-II (Gn-AT)_YafJ-type.  YafJ is a glutamine amidotransferase-like protein of unknown function found in prokaryotes, eukaryotes and archaea.  YafJ has a conserved structural fold similar to those of other class II...; Region: YafJ; cd01908
160488014091	putative active site [active]
160488014092	putative dimer interface [polypeptide binding]; other site
160488014093	Protease II [Amino acid transport and metabolism]; Region: PtrB; COG1770
160488014094	Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326
160488014095	HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085
160488014096	active site
160488014097	SpoU rRNA Methylase family; Region: SpoU_methylase; cl17307
160488014098	Predicted protease with the C-terminal PDZ domain [General function prediction only]; Region: COG3975
160488014099	hypothetical protein; Provisional; Region: PRK05170
160488014100	Nitroreductase-like family 2. A subfamily of the nitroreductase family containing uncharacterized proteins that are similar to nitroreductase. Nitroreductase catalyzes the reduction of nitroaromatic compounds such as nitrotoluenes, nitrofurans and...; Region: Nitroreductase_2; cd02138
160488014101	putative FMN binding site [chemical binding]; other site
160488014102	Putative D-isomer specific 2-hydroxyacid dehydrogenase; Region: 2-Hacid_dh_1; cd05300
160488014103	Phosphoglycerate dehydrogenase and related dehydrogenases [Amino acid transport and metabolism]; Region: SerA; COG0111
160488014104	NAD binding site [chemical binding]; other site
160488014105	ligand binding site [chemical binding]; other site
160488014106	catalytic site [active]
160488014107	YcgL domain; Region: YcgL; pfam05166
160488014108	ribonuclease D; Region: rnd; TIGR01388
160488014109	DEDDy 3'-5' exonuclease domain of Ribonuclease D and similar proteins; Region: RNaseD_exo; cd06142
160488014110	catalytic site [active]
160488014111	putative active site [active]
160488014112	putative substrate binding site [chemical binding]; other site
160488014113	HRDC domain; Region: HRDC; pfam00570
160488014114	putative metal dependent hydrolase; Provisional; Region: PRK11598
160488014115	Domain of unknown function (DUF1705); Region: DUF1705; pfam08019
160488014116	Sulfatase; Region: Sulfatase; pfam00884
160488014117	Protein of unknown function (DUF465); Region: DUF465; pfam04325
160488014118	Cys/Met metabolism PLP-dependent enzyme; Region: Cys_Met_Meta_PP; pfam01053
160488014119	CGS_like: Cystathionine gamma-synthase is a PLP dependent enzyme and catalyzes the committed step of methionine biosynthesis. This pathway is unique to microorganisms and plants, rendering the enzyme an attractive target for the development of...; Region: CGS_like; cd00614
160488014120	homodimer interface [polypeptide binding]; other site
160488014121	substrate-cofactor binding pocket; other site
160488014122	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488014123	catalytic residue [active]
160488014124	Transcriptional regulators [Transcription]; Region: Lrp; COG1522
160488014125	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
160488014126	putative DNA binding site [nucleotide binding]; other site
160488014127	putative Zn2+ binding site [ion binding]; other site
160488014128	AsnC family; Region: AsnC_trans_reg; pfam01037
160488014129	oxidoreductase alpha (molybdopterin) subunit; Region: Fdhalpha-like; TIGR01701
160488014130	The MopB_ydeP CD includes a group of related uncharacterized bacterial molybdopterin-binding oxidoreductase-like domains with a putative molybdopterin cofactor binding site. These members belong to the molybdopterin_binding (MopB) superfamily of proteins; Region: MopB_ydeP; cd02767
160488014131	putative molybdopterin cofactor binding site [chemical binding]; other site
160488014132	The MopB_CT_ydeP CD includes a group of related uncharacterized bacterial molybdopterin-binding oxidoreductase-like domains with a putative molybdopterin cofactor binding site. This CD is of the conserved molybdopterin_binding C-terminal (MopB_CT) region...; Region: MopB_CT_ydeP; cd02787
160488014133	putative molybdopterin cofactor binding site; other site
160488014134	molybdenum cofactor biosynthesis protein A; Provisional; Region: PRK13361
160488014135	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
160488014136	FeS/SAM binding site; other site
160488014137	Molybdenum Cofactor Synthesis C; Region: Mob_synth_C; pfam06463
160488014138	Bestrophin, RFP-TM, chloride channel; Region: Bestrophin; pfam01062
160488014139	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3547
160488014140	Transposase; Region: DEDD_Tnp_IS110; pfam01548
160488014141	Transposase IS116/IS110/IS902 family; Region: Transposase_20; pfam02371
160488014142	MogA_MoaB family. Members of this family are involved in biosynthesis of the molybdenum cofactor (MoCF) an essential cofactor of a diverse group of redox enzymes. MoCF biosynthesis is an evolutionarily conserved pathway present in eubacteria, archaea; Region: MogA_MoaB; cd00886
160488014143	MPT binding site; other site
160488014144	trimer interface [polypeptide binding]; other site
160488014145	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488014146	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488014147	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
160488014148	dimerization interface [polypeptide binding]; other site
160488014149	PAS fold; Region: PAS_4; pfam08448
160488014150	AraC-type DNA-binding domain-containing proteins [Transcription]; Region: AraC; COG2207
160488014151	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488014152	Transposase; Region: DEDD_Tnp_IS110; pfam01548
160488014153	Transposase IS116/IS110/IS902 family; Region: Transposase_20; pfam02371
160488014154	Permeases of the drug/metabolite transporter (DMT) superfamily [Carbohydrate transport and metabolism / Amino acid transport and metabolism / General function prediction only]; Region: RhaT; COG0697
160488014155	EamA-like transporter family; Region: EamA; pfam00892
160488014156	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488014157	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
160488014158	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488014159	TonB-dependent siderophore receptor; Region: TonB-siderophor; TIGR01783
160488014160	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
160488014161	N-terminal plug; other site
160488014162	ligand-binding site [chemical binding]; other site
160488014163	Fe2+-dicitrate sensor, membrane component [Inorganic ion transport and metabolism / Signal transduction mechanisms]; Region: FecR; COG3712
160488014164	FecR protein; Region: FecR; pfam04773
160488014165	RNA polymerase sigma-70 factor, Bacteroides expansion family 1; Region: Sig70_bacteroi1; TIGR02985
160488014166	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
160488014167	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
160488014168	DNA binding residues [nucleotide binding]
160488014169	Protein of unknown function (DUF3325); Region: DUF3325; pfam11804
160488014170	Uncharacterized iron-regulated membrane protein [Function unknown]; Region: PiuB; COG3182
160488014171	PepSY-associated TM helix; Region: PepSY_TM_3; pfam13706
160488014172	PepSY-associated TM helix; Region: PepSY_TM_2; pfam13703
160488014173	RNA polymerase sigma factor; Provisional; Region: PRK12528
160488014174	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
160488014175	Sigma-70, region 4; Region: Sigma70_r4_2; pfam08281
160488014176	DNA binding residues [nucleotide binding]
160488014177	Fe2+-dicitrate sensor, membrane component [Inorganic ion transport and metabolism / Signal transduction mechanisms]; Region: FecR; COG3712
160488014178	FecR protein; Region: FecR; pfam04773
160488014179	Secretin and TonB N terminus short domain; Region: STN; smart00965
160488014180	Outer membrane receptor for Fe3+-dicitrate [Inorganic ion transport and metabolism]; Region: FecA; COG4772
160488014181	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
160488014182	N-terminal plug; other site
160488014183	ligand-binding site [chemical binding]; other site
160488014184	Protein of unknown function (DUF3509); Region: DUF3509; pfam12021
160488014185	Predicted membrane protein [Function unknown]; Region: COG3223
160488014186	YebG protein; Region: YebG; pfam07130
160488014187	Glutamate dehydrogenase/leucine dehydrogenase [Amino acid transport and metabolism]; Region: GdhA; COG0334
160488014188	Glu/Leu/Phe/Val dehydrogenase, dimerisation domain; Region: ELFV_dehydrog_N; pfam02812
160488014189	NAD(P) binding domain of leucine dehydrogenase, phenylalanine dehydrogenase, and valine dehydrogenase; Region: NAD_bind_Leu_Phe_Val_DH; cd01075
160488014190	NAD binding site [chemical binding]; other site
160488014191	Phe binding site; other site
160488014192	Uncharacterized conserved protein [Function unknown]; Region: COG2912
160488014193	Transglutaminase-like superfamily; Region: Transglut_core2; pfam13369
160488014194	maleylacetoacetate isomerase; Region: maiA; TIGR01262
160488014195	GST_N family, Class Zeta subfamily; GSTs are cytosolic dimeric proteins involved in cellular detoxification by catalyzing the conjugation of glutathione (GSH) with a wide range of endogenous and xenobiotic alkylating agents, including carcinogens; Region: GST_N_Zeta; cd03042
160488014196	C-terminal domain interface [polypeptide binding]; other site
160488014197	GSH binding site (G-site) [chemical binding]; other site
160488014198	putative dimer interface [polypeptide binding]; other site
160488014199	C-terminal, alpha helical domain of Class Zeta Glutathione S-transferases; Region: GST_C_Zeta; cd03191
160488014200	dimer interface [polypeptide binding]; other site
160488014201	maleylacetoacetate (MAA) substrate binding site (H site) [chemical binding]; other site
160488014202	N-terminal domain interface [polypeptide binding]; other site
160488014203	fumarylacetoacetase; Region: fum_ac_acetase; TIGR01266
160488014204	Domain of unknown function (DUF1969); Region: DUF1969; pfam09298
160488014205	Fumarylacetoacetate (FAA) hydrolase family; Region: FAA_hydrolase; pfam01557
160488014206	homogentisate 1,2-dioxygenase; Provisional; Region: PRK05341
160488014207	helix_turn_helix isocitrate lyase regulation; Region: HTH_ICLR; smart00346
160488014208	Transcriptional regulator [Transcription]; Region: IclR; COG1414
160488014209	Bacterial transcriptional regulator; Region: IclR; pfam01614
160488014210	Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697
160488014211	LrgB-like family; Region: LrgB; pfam04172
160488014212	LrgA family; Region: LrgA; pfam03788
160488014213	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488014214	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488014215	The C-terminal substrate binding domain of LysR-like transcriptional regulator CidR, contains the type 2 periplasmic binding fold; Region: PBP2_CidR; cd08438
160488014216	putative dimerization interface [polypeptide binding]; other site
160488014217	flavodoxin; Provisional; Region: PRK05723
160488014218	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488014219	PAS domain; Region: PAS_9; pfam13426
160488014220	putative active site [active]
160488014221	heme pocket [chemical binding]; other site
160488014222	MerR HTH family regulatory protein; Region: MerR_1; pfam13411
160488014223	Helix-Turn-Helix DNA binding domain of the transcription regulators MlrA and CarA; Region: HTH_MlrA-CarA; cd01104
160488014224	DNA binding residues [nucleotide binding]
160488014225	B12 binding domain; Region: B12-binding_2; pfam02607
160488014226	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3224
160488014227	dihydromonapterin reductase; Provisional; Region: PRK06483
160488014228	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
160488014229	NAD(P) binding site [chemical binding]; other site
160488014230	active site
160488014231	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3492
160488014232	Predicted alpha/beta hydrolase [General function prediction only]; Region: COG4757
160488014233	Putative lysophospholipase; Region: Hydrolase_4; pfam12146
160488014234	trans-2-enoyl-CoA reductase; Provisional; Region: PRK13656
160488014235	NAD(P)H binding domain of trans-2-enoyl-CoA reductase; Region: Eno-Rase_NADH_b; pfam12242
160488014236	Trans-2-enoyl-CoA reductase catalytic region; Region: Enoyl_reductase; pfam12241
160488014237	Enoyl reductase FAD binding domain; Region: Eno-Rase_FAD_bd; pfam07055
160488014238	acetyl-CoA acetyltransferase; Provisional; Region: PRK05656
160488014239	Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751
160488014240	dimer interface [polypeptide binding]; other site
160488014241	active site
160488014242	The URO-D_CIMS_like protein superfamily includes bacterial and eukaryotic uroporphyrinogen decarboxylases (URO-D), coenzyme M methyltransferases and other putative bacterial methyltransferases, as well as cobalamine (B12) independent methionine synthases; Region: URO-D_CIMS_like; cl00464
160488014243	Methylenetetrahydrofolate reductase (MTHFR). 5,10-Methylenetetrahydrofolate is reduced to 5-methyltetrahydrofolate by methylenetetrahydrofolate reductase, a cytoplasmic, NAD(P)-dependent enzyme. 5-methyltetrahydrofolate is utilized by methionine synthase...; Region: MTHFR; cd00537
160488014244	FAD binding site [chemical binding]; other site
160488014245	Methylene-tetrahydrofolate reductase C terminal; Region: MTHFR_C; pfam12225
160488014246	putative GTP-binding protein YjiA; Provisional; Region: PRK11537
160488014247	The function of this protein family is unkown. The amino acid sequence of YjiA protein in E. coli contains several conserved motifs that characterizes it as a P-loop GTPase. YijA gene is among the genes significantly induced in response to DNA-damage...; Region: CobW_like; cd03112
160488014248	P-loop, Walker A motif; other site
160488014249	Base recognition motif; other site
160488014250	Cobalamin synthesis protein cobW C-terminal domain; Region: CobW_C; pfam07683
160488014251	Protein of unknown function (DUF466); Region: DUF466; pfam04328
160488014252	carbon starvation protein A; Provisional; Region: PRK15015
160488014253	Carbon starvation protein CstA; Region: CstA; pfam02554
160488014254	C-terminal domain on CstA (DUF4161); Region: DUF4161; pfam13722
160488014255	xanthine permease; Region: pbuX; TIGR03173
160488014256	DNA repair protein RadA; Provisional; Region: PRK11823
160488014257	RecA-like NTPases. This family includes the NTP binding domain of F1 and V1 H+ATPases, DnaB and related helicases as well as bacterial RecA and related eukaryotic and archaeal recombinases. This group also includes bacterial conjugation proteins and...; Region: RecA-like_NTPases; cl17233
160488014258	Walker A motif; other site
160488014259	ATP binding site [chemical binding]; other site
160488014260	Walker B motif; other site
160488014261	Subunit ChlI of Mg-chelatase; Region: ChlI; pfam13541
160488014262	large-conductance mechanosensitive channel; Provisional; Region: mscL; PRK13952
160488014263	large-conductance mechanosensitive channel; Reviewed; Region: mscL; PRK00567
160488014264	Ferredoxin-NADP+ (oxido)reductase is an FAD-containing enzyme that catalyzes the reversible electron transfer between NADP(H) and electron carrier proteins such as ferredoxin and flavodoxin. Isoforms of these flavoproteins (i.e. having a non-covalently...; Region: FNR1; cd06195
160488014265	ferredoxin-NADP reductase; Provisional; Region: PRK10926
160488014266	FAD binding pocket [chemical binding]; other site
160488014267	FAD binding motif [chemical binding]; other site
160488014268	phosphate binding motif [ion binding]; other site
160488014269	beta-alpha-beta structure motif; other site
160488014270	NAD binding pocket [chemical binding]; other site
160488014271	Autoinducer binding domain; Region: Autoind_bind; pfam03472
160488014272	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
160488014273	DNA binding residues [nucleotide binding]
160488014274	16S RNA G1207 methylase RsmC [Translation, ribosomal structure and biogenesis]; Region: RsmC; COG2813
160488014275	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488014276	S-adenosylmethionine binding site [chemical binding]; other site
160488014277	Protein of unknown function (DUF2474); Region: DUF2474; pfam10617
160488014278	Cytochrome oxidase subunit II; Region: Cyto_ox_2; pfam02322
160488014279	cytochrome d ubiquinol oxidase subunit 2; Provisional; Region: PRK15003; cl12219
160488014280	cytochrome d ubiquinol oxidase subunit 2; Provisional; Region: PRK15003; cl12219
160488014281	Bacterial Cytochrome Ubiquinol Oxidase; Region: Bac_Ubq_Cox; pfam01654
160488014282	H+ Antiporter protein; Region: 2A0121; TIGR00900
160488014283	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488014284	putative substrate translocation pore; other site
160488014285	Xanthine/uracil/vitamin C permease [Nucleotide transport and    metabolism]; Region: COG2252
160488014286	tRNA (uracil-5-)-methyltransferase; Validated; Region: PRK05031
160488014287	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488014288	S-adenosylmethionine binding site [chemical binding]; other site
160488014289	Protocatechuate 3,4-dioxygenase beta subunit [Secondary metabolites biosynthesis, transport, and catabolism]; Region: PcaH; COG3485
160488014290	Protocatechuate 3,4-dioxygenase (3,4-PCD) , alpha subunit. 3,4-PCD catalyzes the oxidative ring cleavage of 3,4-dihydroxybenzoate to produce beta-carboxy-cis,cis-muconate. 3,4-PCDs are large aggregates of 12 protomers, each composed of an alpha- and...; Region: 3,4-PCD_alpha; cd03463
160488014291	heterodimer interface [polypeptide binding]; other site
160488014292	active site
160488014293	Protocatechuate 3,4-dioxygenase (3,4-PCD) , beta subunit. 3,4-PCD catalyzes the oxidative ring cleavage of 3,4-dihydroxybenzoate to produce beta-carboxy-cis,cis-muconate. 3,4-PCDs are large aggregates of 12 protomers, each composed of an alpha- and...; Region: 3,4-PCD_beta; cd03464
160488014294	heterodimer interface [polypeptide binding]; other site
160488014295	multimer interface [polypeptide binding]; other site
160488014296	protocatechuate 3,4-dioxygenase, beta subunit; Region: protocat_beta; TIGR02422
160488014297	active site
160488014298	Predicted metalloprotease [General function prediction only]; Region: COG2321
160488014299	Putative neutral zinc metallopeptidase; Region: Zn_peptidase; pfam04228
160488014300	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
160488014301	dimerization interface [polypeptide binding]; other site
160488014302	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
160488014303	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
160488014304	dimer interface [polypeptide binding]; other site
160488014305	putative CheW interface [polypeptide binding]; other site
160488014306	Gamma-glutamyltransferase [Amino acid transport and metabolism]; Region: Ggt; COG0405
160488014307	Gamma-glutamyltranspeptidase; Region: G_glu_transpept; pfam01019
160488014308	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488014309	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488014310	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
160488014311	dimerization interface [polypeptide binding]; other site
160488014312	Putative NADPH-quinone reductase (modulator of drug activity B) [General function prediction only]; Region: MdaB; COG2249
160488014313	Uncharacterized conserved protein [Function unknown]; Region: COG1359
160488014314	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488014315	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488014316	The C-terminal substrate binding domain of an uncharacterized LysR-type transcriptional regulator, contains the type 2 periplasmic binding fold; Region: PBP2_LTTR_like_1; cd08421
160488014317	putative dimerization interface [polypeptide binding]; other site
160488014318	Predicted enzyme of the cupin superfamily [General function prediction only]; Region: COG3450
160488014319	6-phosphogluconate dehydrogenase-like protein; Reviewed; Region: PRK09599
160488014320	3-hydroxyisobutyrate dehydrogenase; Region: HIBADH; TIGR01692
160488014321	Methylmalonate semialdehyde dehydrogenase and ALDH family members 6A1 and 6B2; Region: ALDH_F6_MMSDH; cd07085
160488014322	methylmalonic acid semialdehyde dehydrogenase; Region: MMSDH; TIGR01722
160488014323	tetrameric interface [polypeptide binding]; other site
160488014324	NAD binding site [chemical binding]; other site
160488014325	catalytic residues [active]
160488014326	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488014327	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488014328	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
160488014329	dimerization interface [polypeptide binding]; other site
160488014330	putative outer membrane lipoprotein; Provisional; Region: PRK09967
160488014331	Peptidoglycan binding domains similar to the C-terminal domain of outer-membrane protein OmpA; Region: OmpA_C-like; cd07185
160488014332	ligand binding site [chemical binding]; other site
160488014333	putative inner membrane diguanylate cyclase; Provisional; Region: PRK09966
160488014334	HAMP domain; Region: HAMP; pfam00672
160488014335	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488014336	metal binding site [ion binding]; metal-binding site
160488014337	active site
160488014338	I-site; other site
160488014339	Domain of unknown function (DUF4154); Region: DUF4154; pfam13689
160488014340	exodeoxyribonuclease V, alpha subunit; Region: recD; TIGR01447
160488014341	AAA domain; Region: AAA_30; pfam13604
160488014342	Family description; Region: UvrD_C_2; pfam13538
160488014343	exonuclease V subunit beta; Provisional; Region: recB; PRK10876
160488014344	Family description; Region: UvrD_C_2; pfam13538
160488014345	exodeoxyribonuclease V, gamma subunit; Region: recC; TIGR01450
160488014346	exonuclease V subunit gamma; Provisional; Region: recC; PRK11069
160488014347	putative sulfite oxidase subunit YedZ; Reviewed; Region: PRK05419
160488014348	TMAO/DMSO reductase; Reviewed; Region: PRK05363
160488014349	Sulfite oxidase (SO) family, molybdopterin binding domain. This molybdopterin cofactor (Moco) binding domain is found in a variety of oxidoreductases, main members of this family are nitrate reductase (NR) and sulfite oxidase (SO). SO catalyzes the...; Region: SO_family_Moco; cl00199
160488014350	Moco binding site; other site
160488014351	metal coordination site [ion binding]; other site
160488014352	Phosphatidylserine synthase [Lipid metabolism]; Region: PssA; COG1183
160488014353	CDP-alcohol phosphatidyltransferase; Region: CDP-OH_P_transf; pfam01066
160488014354	ketol-acid reductoisomerase; Provisional; Region: PRK05479
160488014355	Acetohydroxy acid isomeroreductase, catalytic domain; Region: IlvN; pfam07991
160488014356	Acetohydroxy acid isomeroreductase, catalytic domain; Region: IlvC; pfam01450
160488014357	acetolactate synthase 3 regulatory subunit; Reviewed; Region: ilvH; PRK11895
160488014358	N-terminal ACT domain of the Escherichia coli IlvH-like regulatory subunit of acetohydroxyacid synthase (AHAS); Region: ACT_AHAS; cd04878
160488014359	putative valine binding site [chemical binding]; other site
160488014360	dimer interface [polypeptide binding]; other site
160488014361	Small subunit of acetolactate synthase; Region: ALS_ss_C; pfam10369
160488014362	acetolactate synthase 3 catalytic subunit; Validated; Region: PRK06466
160488014363	Pyrimidine (PYR) binding domain of POX and related proteins; Region: TPP_PYR_POX_like; cd07035
160488014364	PYR/PP interface [polypeptide binding]; other site
160488014365	dimer interface [polypeptide binding]; other site
160488014366	TPP binding site [chemical binding]; other site
160488014367	Thiamine pyrophosphate enzyme, central domain; Region: TPP_enzyme_M; pfam00205
160488014368	Thiamine pyrophosphate (TPP) family, Acetohydroxyacid synthase (AHAS) subfamily, TPP-binding module; composed of proteins similar to the large catalytic subunit of AHAS. AHAS catalyzes the condensation of two molecules of pyruvate to give the...; Region: TPP_AHAS; cd02015
160488014369	TPP-binding site [chemical binding]; other site
160488014370	dimer interface [polypeptide binding]; other site
160488014371	tRNA pseudouridine synthase C; Region: DUF446; pfam04287
160488014372	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cl02429
160488014373	TPR motif; other site
160488014374	binding surface
160488014375	penicillin-binding protein 1B; Region: PBP_1b; TIGR02071
160488014376	Transglycosylase; Region: Transgly; pfam00912
160488014377	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; cl17760
160488014378	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2187
160488014379	AAA domain; Region: AAA_33; pfam13671
160488014380	Gluconate kinase (GntK) catalyzes the phosphoryl transfer from ATP to gluconate. The resulting product gluconate-6-phoshate is an important precursor of gluconate metabolism. GntK acts as a dimmer composed of two identical subunits; Region: GntK; cd02021
160488014381	ATP-binding site [chemical binding]; other site
160488014382	Gluconate-6-phosphate binding site [chemical binding]; other site
160488014383	TfoX C-terminal domain; Region: TfoX_C; pfam04994
160488014384	Protein of unknown function, DUF399; Region: DUF399; cl01139
160488014385	hemin importer ATP-binding subunit; Provisional; Region: hmuV; PRK13548
160488014386	ATP-binding component of iron-siderophores, vitamin B12 and hemin transporters and related proteins; Region: ABC_Iron-Siderophores_B12_Hemin; cd03214
160488014387	Walker A/P-loop; other site
160488014388	ATP binding site [chemical binding]; other site
160488014389	Q-loop/lid; other site
160488014390	ABC transporter signature motif; other site
160488014391	Walker B; other site
160488014392	D-loop; other site
160488014393	H-loop/switch region; other site
160488014394	iron-hydroxamate transporter permease subunit; Provisional; Region: PRK10577
160488014395	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
160488014396	ABC-ATPase subunit  interface; other site
160488014397	dimer interface [polypeptide binding]; other site
160488014398	putative PBP binding regions; other site
160488014399	ABC-type hemin transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: ChuT; COG4558
160488014400	Helical backbone metal receptor (TroA-like domain). These proteins have been shown to function in the ABC transport of ferric siderophores and metal ions such as Mn2+, Fe3+, Cu2+ and/or Zn2+.  Their ligand binding site is formed in the interface between...; Region: TroA-like; cl00262
160488014401	intersubunit interface [polypeptide binding]; other site
160488014402	Rieske domain; a [2Fe-2S] cluster binding domain commonly found in Rieske non-heme iron oxygenase (RO) systems such as naphthalene and biphenyl dioxygenases, as well as in plant/cyanobacterial chloroplast b6f and mitochondrial cytochrome bc(1) complexes; Region: Rieske; cd03467
160488014403	iron-sulfur cluster [ion binding]; other site
160488014404	[2Fe-2S] cluster binding site [ion binding]; other site
160488014405	putative DNA-binding transcriptional regulator; Reviewed; Region: PRK00347
160488014406	hypothetical protein; Provisional; Region: PRK08960
160488014407	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
160488014408	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488014409	homodimer interface [polypeptide binding]; other site
160488014410	catalytic residue [active]
160488014411	RNA polymerase-binding protein DksA; Region: dksA; TIGR02420
160488014412	Glutamyl- and glutaminyl-tRNA synthetases [Translation, ribosomal structure and biogenesis]; Region: GlnS; COG0008
160488014413	glutamyl-Q tRNA(Asp) synthetase; Reviewed; Region: PRK05710
160488014414	active site
160488014415	HIGH motif; other site
160488014416	nucleotide binding site [chemical binding]; other site
160488014417	KMSKS motif; other site
160488014418	Na+/proline symporter [Amino acid transport and metabolism / General function prediction only]; Region: PutP; COG0591
160488014419	Na binding site [ion binding]; other site
160488014420	phosphate regulon sensor kinase PhoR; Region: phoR_proteo; TIGR02966
160488014421	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488014422	putative active site [active]
160488014423	heme pocket [chemical binding]; other site
160488014424	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488014425	dimer interface [polypeptide binding]; other site
160488014426	phosphorylation site [posttranslational modification]
160488014427	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488014428	ATP binding site [chemical binding]; other site
160488014429	Mg2+ binding site [ion binding]; other site
160488014430	G-X-G motif; other site
160488014431	Response regulator containing CheY-like receiver, AAA-type ATPase, and DNA-binding domains [Signal transduction mechanisms]; Region: AtoC; COG2204
160488014432	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488014433	active site
160488014434	phosphorylation site [posttranslational modification]
160488014435	intermolecular recognition site; other site
160488014436	dimerization interface [polypeptide binding]; other site
160488014437	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488014438	Walker A motif; other site
160488014439	ATP binding site [chemical binding]; other site
160488014440	Walker B motif; other site
160488014441	arginine finger; other site
160488014442	poly(A) polymerase; Region: pcnB; TIGR01942
160488014443	Nucleotidyltransferase (NT) domain of ClassII CCA-adding enzymes; Region: NT_ClassII-CCAase; cd05398
160488014444	active site
160488014445	NTP binding site [chemical binding]; other site
160488014446	metal binding triad [ion binding]; metal-binding site
160488014447	Probable RNA and SrmB- binding site of polymerase A; Region: PolyA_pol_RNAbd; pfam12627
160488014448	Polymerase A arginine-rich C-terminus; Region: PolyA_pol_arg_C; pfam12626
160488014449	7,8-dihydro-6-hydroxymethylpterin-pyrophosphokinase (HPPK). Folate derivatives are essential cofactors in the biosynthesis of purines, pyrimidines, and amino acids as well as formyl-tRNA. Mammalian cells are able to utilize pre-formed folates after...; Region: HPPK; cd00483
160488014450	catalytic center binding site [active]
160488014451	ATP binding site [chemical binding]; other site
160488014452	Ketopantoate hydroxymethyltransferase (KPHMT) is the first enzyme in the pantothenate biosynthesis pathway. Ketopantoate hydroxymethyltransferase (KPHMT) catalyzes the first committed step in the biosynthesis of pantothenate (vitamin B5), which is a...; Region: KPHMT-like; cd06557
160488014453	oligomerization interface [polypeptide binding]; other site
160488014454	active site
160488014455	metal binding site [ion binding]; metal-binding site
160488014456	Pantoate-beta-alanine ligase; Region: PanC; cd00560
160488014457	pantoate--beta-alanine ligase; Region: panC; TIGR00018
160488014458	active site
160488014459	ATP-binding site [chemical binding]; other site
160488014460	pantoate-binding site; other site
160488014461	HXXH motif; other site
160488014462	glucose-6-phosphate isomerase; Reviewed; Region: pgi; PRK00179
160488014463	Phosphoglucose isomerase (PGI) contains two SIS (Sugar ISomerase) domains. This classification is based on the alignment of the first SIS domain. PGI is a multifunctional enzyme which as an intracellular dimer catalyzes the reversible isomerization of...; Region: SIS_PGI_1; cd05015
160488014464	active site
160488014465	dimer interface [polypeptide binding]; other site
160488014466	Phosphoglucose isomerase (PGI) contains two SIS (Sugar ISomerase) domains. This classification is based on the alignment of the second SIS domain. PGI is a multifunctional enzyme which as an intracellular dimer catalyzes the reversible isomerization of...; Region: SIS_PGI_2; cd05016
160488014467	dimer interface [polypeptide binding]; other site
160488014468	active site
160488014469	acetyl-CoA synthetase; Provisional; Region: PRK00174
160488014470	Acetyl-CoA synthetase (also known as acetate-CoA ligase and acetyl-activating enzyme); Region: ACS; cd05966
160488014471	active site
160488014472	CoA binding site [chemical binding]; other site
160488014473	acyl-activating enzyme (AAE) consensus motif; other site
160488014474	AMP binding site [chemical binding]; other site
160488014475	acetate binding site [chemical binding]; other site
160488014476	Uncharacterized protein conserved in bacteria (DUF2236); Region: DUF2236; cl01472
160488014477	Domain of Unknown Function (DUF748); Region: DUF748; pfam05359
160488014478	Domain of Unknown Function (DUF748); Region: DUF748; pfam05359
160488014479	Domain of Unknown Function (DUF748); Region: DUF748; pfam05359
160488014480	Peptidoglycan binding domains similar to the C-terminal domain of outer-membrane protein OmpA; Region: OmpA_C-like; cl02931
160488014481	ligand binding site [chemical binding]; other site
160488014482	This domain superfamily is found in a variety of structurally related metalloproteins, including the type I extradiol dioxygenases, glyoxalase I and a group of antibiotic resistance proteins; Region: Glo_EDI_BRP_like; cd06587
160488014483	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
160488014484	active site
160488014485	metal binding site [ion binding]; metal-binding site
160488014486	Uncharacterized conserved protein [Function unknown]; Region: COG1359
160488014487	BON domain; Region: BON; pfam04972
160488014488	polynucleotide phosphorylase/polyadenylase; Provisional; Region: PRK11824
160488014489	Polyribonucleotide nucleotidyltransferase, repeat 1; Region: RNase_PH_PNPase_1; cd11363
160488014490	RNase E interface [polypeptide binding]; other site
160488014491	trimer interface [polypeptide binding]; other site
160488014492	Polyribonucleotide nucleotidyltransferase, RNA binding domain; Region: PNPase; pfam03726
160488014493	Polyribonucleotide nucleotidyltransferase, repeat 2; Region: RNase_PH_PNPase_2; cd11364
160488014494	RNase E interface [polypeptide binding]; other site
160488014495	trimer interface [polypeptide binding]; other site
160488014496	active site
160488014497	Polynucleotide phosphorylase (PNPase) K homology RNA-binding domain (KH). PNPase is a polyribonucleotide nucleotidyl transferase that degrades mRNA in prokaryotes and plant chloroplasts. The C-terminal region of PNPase contains domains homologous to...; Region: PNPase_KH; cd02393
160488014498	putative nucleic acid binding region [nucleotide binding]; other site
160488014499	G-X-X-G motif; other site
160488014500	S1_PNPase: Polynucleotide phosphorylase (PNPase), ), S1-like RNA-binding domain. PNPase  is a polyribonucleotide nucleotidyl transferase that degrades mRNA. It is a trimeric multidomain protein. The C-terminus contains the S1 domain which binds ssRNA; Region: S1_PNPase; cd04472
160488014501	RNA binding site [nucleotide binding]; other site
160488014502	domain interface; other site
160488014503	Ribosomal protein S15 (prokaryotic)_S13 (eukaryotic) binds the central domain of 16S rRNA and is required for assembly of the small ribosomal subunit and for intersubunit association, thus representing a key element in the assembly of the whole ribosome; Region: Ribosomal_S15p_S13e; cd00353
160488014504	16S/18S rRNA binding site [nucleotide binding]; other site
160488014505	S13e-L30e interaction site [polypeptide binding]; other site
160488014506	25S rRNA binding site [nucleotide binding]; other site
160488014507	ribosome-binding factor A; Validated; Region: rbfA; PRK00521
160488014508	Translation initiation factor IF-2, N-terminal region; Region: IF2_N; pfam04760
160488014509	Bacterial translation initiation factor IF-2 associated region; Region: IF2_assoc; pfam08364
160488014510	translation initiation factor IF-2; Region: IF-2; TIGR00487
160488014511	Translation initiation factor IF-2, N-terminal region; Region: IF2_N; pfam04760
160488014512	Initiation Factor 2 (IF2)/ eukaryotic Initiation Factor 5B (eIF5B) family; Region: IF2_eIF5B; cd01887
160488014513	G1 box; other site
160488014514	putative GEF interaction site [polypeptide binding]; other site
160488014515	GTP/Mg2+ binding site [chemical binding]; other site
160488014516	Switch I region; other site
160488014517	G2 box; other site
160488014518	G3 box; other site
160488014519	Switch II region; other site
160488014520	G4 box; other site
160488014521	G5 box; other site
160488014522	This family represents the domain II of bacterial Initiation Factor 2 (IF2) and its eukaryotic mitochondrial homologue mtIF2. IF2, the largest initiation factor is an essential GTP binding protein. In E. coli three natural forms of IF2 exist in the cell; Region: IF2_mtIF2_II; cd03702
160488014523	Translation-initiation factor 2; Region: IF-2; pfam11987
160488014524	mtIF2_IVc: this family represents the C2 subdomain of domain IV of mitochondrial translation initiation factor 2 (mtIF2) which adopts a beta-barrel fold displaying a high degree of structural similarity with domain II of the translation elongation factor...; Region: mtIF2_IVc; cd03692
160488014525	transcription elongation factor NusA; Validated; Region: nusA; PRK09202
160488014526	NusA N-terminal domain; Region: NusA_N; pfam08529
160488014527	S1_NusA: N-utilizing substance A protein (NusA), S1-like RNA-binding domain. S1-like RNA-binding domains are found in a wide variety of RNA-associated proteins. NusA is a transcription elongation factor containing an N-terminal catalytic domain and three...; Region: S1_NusA; cd04455
160488014528	RNA binding site [nucleotide binding]; other site
160488014529	homodimer interface [polypeptide binding]; other site
160488014530	NusA-like KH domain; Region: KH_5; pfam13184
160488014531	NusA_K homology RNA-binding domain (KH). NusA is an essential multifunctional transcription elongation factor that is universally conserved among prokaryotes and archaea. NusA anti-termination function plays an important role in the expression of...; Region: NusA_KH; cd02134
160488014532	G-X-X-G motif; other site
160488014533	transcription termination factor NusA, C-terminal duplication; Region: nusA_Cterm_rpt; TIGR01954
160488014534	transcription termination factor NusA, C-terminal duplication; Region: nusA_Cterm_rpt; TIGR01954
160488014535	ribosome maturation protein RimP; Reviewed; Region: PRK00092
160488014536	Sm and related proteins; Region: Sm_like; cl00259
160488014537	Bacillus subtilis YxlS-like, C-terminal domain; Region: YlxS_C; cd01734
160488014538	putative oligomer interface [polypeptide binding]; other site
160488014539	putative RNA binding site [nucleotide binding]; other site
160488014540	Triosephosphate isomerase (TIM) is a glycolytic enzyme that catalyzes the interconversion of dihydroxyacetone phosphate and D-glyceraldehyde-3-phosphate. The reaction is very efficient and requires neither cofactors nor metal ions. TIM, usually...; Region: TIM; cd00311
160488014541	triosephosphate isomerase; Provisional; Region: PRK14567
160488014542	substrate binding site [chemical binding]; other site
160488014543	dimer interface [polypeptide binding]; other site
160488014544	catalytic triad [active]
160488014545	phosphoglucosamine mutase; Provisional; Region: glmM; PRK10887
160488014546	GlmM is a bacterial phosphoglucosamine mutase (PNGM) that belongs to the alpha-D-phosphohexomutase superfamily. It is required for the interconversion of glucosamine-6-phosphate and glucosamine-1-phosphate in the biosynthetic pathway of...; Region: GlmM; cd05802
160488014547	active site
160488014548	substrate binding site [chemical binding]; other site
160488014549	metal binding site [ion binding]; metal-binding site
160488014550	DHPS subgroup of Pterin binding enzymes. DHPS (dihydropteroate synthase), a functional homodimer, catalyzes the condensation of p-aminobenzoic acid (pABA) in the de novo biosynthesis of folate, which is an essential cofactor in both nucleic acid and...; Region: DHPS; cd00739
160488014551	dihydropteroate synthase; Region: DHPS; TIGR01496
160488014552	substrate binding pocket [chemical binding]; other site
160488014553	dimer interface [polypeptide binding]; other site
160488014554	inhibitor binding site; inhibition site
160488014555	ATP-dependent metalloprotease; Reviewed; Region: hflB; PRK10733
160488014556	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488014557	Walker A motif; other site
160488014558	ATP binding site [chemical binding]; other site
160488014559	Walker B motif; other site
160488014560	arginine finger; other site
160488014561	Peptidase family M41; Region: Peptidase_M41; pfam01434
160488014562	23S rRNA methylase [Translation, ribosomal structure and biogenesis]; Region: FtsJ; COG0293
160488014563	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488014564	S-adenosylmethionine binding site [chemical binding]; other site
160488014565	Escherichia coli YhbY is associated with pre-50S ribosomal subunits, which implies a function in ribosome assembly; Region: CRS1_YhbY; smart01103
160488014566	transcription elongation factor GreA; Reviewed; Region: greA; PRK00226
160488014567	Transcription elongation factor, N-terminal; Region: GreA_GreB_N; pfam03449
160488014568	Transcription elongation factor, GreA/GreB, C-term; Region: GreA_GreB; pfam01272
160488014569	carbamoyl phosphate synthase large subunit; Reviewed; Region: carB; PRK05294
160488014570	Carbamoyl-phosphate synthase L chain, N-terminal domain; Region: CPSase_L_chain; pfam00289
160488014571	Carbamoyl-phosphate synthase L chain, ATP binding domain; Region: CPSase_L_D2; pfam02786
160488014572	Carbamoyl-phosphate synthetase large chain, oligomerisation domain; Region: CPSase_L_D3; pfam02787
160488014573	Carbamoyl-phosphate synthase L chain, N-terminal domain; Region: CPSase_L_chain; pfam00289
160488014574	ATP-grasp domain; Region: ATP-grasp_4; cl17255
160488014575	Methylglyoxal synthase-like domain from type II glutamine-dependent carbamoyl phosphate synthetase (CSP). CSP, a CarA and CarB heterodimer, catalyzes the production of carbamoyl phosphate which is subsequently employed in the metabolic pathways...; Region: MGS_CPS_II; cd01424
160488014576	IMP binding site; other site
160488014577	dimer interface [polypeptide binding]; other site
160488014578	interdomain contacts; other site
160488014579	partial ornithine binding site; other site
160488014580	carbamoyl phosphate synthase small subunit; Reviewed; Region: PRK12564
160488014581	Carbamoyl-phosphate synthase small chain, CPSase domain; Region: CPSase_sm_chain; smart01097
160488014582	Small chain of the glutamine-dependent form of carbamoyl phosphate synthase, CPSase II; Region: GATase1_CPSase; cd01744
160488014583	catalytic site [active]
160488014584	subunit interface [polypeptide binding]; other site
160488014585	dihydrodipicolinate reductase; Provisional; Region: PRK00048
160488014586	Dihydrodipicolinate reductase, N-terminus; Region: DapB_N; pfam01113
160488014587	Dihydrodipicolinate reductase, C-terminus; Region: DapB_C; pfam05173
160488014588	chaperone protein DnaJ; Provisional; Region: PRK10767
160488014589	DnaJ domain or J-domain.  DnaJ/Hsp40 (heat shock protein 40) proteins are highly conserved and play crucial roles in protein translation, folding, unfolding, translocation, and degradation. They act primarily by stimulating the ATPase activity of Hsp70s; Region: DnaJ; cd06257
160488014590	HSP70 interaction site [polypeptide binding]; other site
160488014591	C-terminal substrate binding domain of DnaJ and HSP40; Region: DnaJ_C; cl03262
160488014592	substrate binding site [polypeptide binding]; other site
160488014593	Zinc finger domain of DnaJ and HSP40; Region: DnaJ_zf; cd10719
160488014594	Zn binding sites [ion binding]; other site
160488014595	C-terminal substrate binding domain of DnaJ and HSP40; Region: DnaJ_C; cd10747
160488014596	dimer interface [polypeptide binding]; other site
160488014597	molecular chaperone DnaK; Provisional; Region: dnaK; PRK00290
160488014598	Nucleotide-binding domain of human HSPA9, Escherichia coli DnaK, and similar proteins; Region: HSPA9-like_NBD; cd11733
160488014599	nucleotide binding site [chemical binding]; other site
160488014600	NEF interaction site [polypeptide binding]; other site
160488014601	SBD interface [polypeptide binding]; other site
160488014602	GrpE; Region: GrpE; pfam01025
160488014603	GrpE is the adenine nucleotide exchange factor of DnaK (Hsp70)-type ATPases. The GrpE dimer binds to the ATPase domain of Hsp70 catalyzing the dissociation of ADP, which enables rebinding of ATP, one step in the Hsp70 reaction cycle in protein folding; Region: GrpE; cd00446
160488014604	dimer interface [polypeptide binding]; other site
160488014605	hsp70 (ATPase domain) interactions [polypeptide binding]; other site
160488014606	ATPase involved in DNA repair [DNA replication, recombination, and repair]; Region: RecN; COG0497
160488014607	ATP-binding cassette domain of RecN; Region: ABC_RecN; cd03241
160488014608	Walker A/P-loop; other site
160488014609	ATP binding site [chemical binding]; other site
160488014610	Q-loop/lid; other site
160488014611	ATP-binding cassette domain of RecN; Region: ABC_RecN; cd03241
160488014612	ABC transporter signature motif; other site
160488014613	Walker B; other site
160488014614	D-loop; other site
160488014615	H-loop/switch region; other site
160488014616	Ferric uptake regulator(Fur) and related metalloregulatory proteins; typically iron-dependent, DNA-binding repressors and activators; Region: Fur_like; cd07153
160488014617	metal binding site 2 [ion binding]; metal-binding site
160488014618	putative DNA binding helix; other site
160488014619	metal binding site 1 [ion binding]; metal-binding site
160488014620	dimer interface [polypeptide binding]; other site
160488014621	structural Zn2+ binding site [ion binding]; other site
160488014622	Outer membrane lipoprotein OmlA (small protein A) [Cell envelope biogenesis, outer membrane]; Region: OlmA; COG2913
160488014623	SmpA / OmlA family; Region: SmpA_OmlA; pfam04355
160488014624	Coenzyme Q-binding protein COQ10p and similar proteins; Region: COQ10p_like; cd07813
160488014625	putative coenzyme Q binding site [chemical binding]; other site
160488014626	Small protein B (SmpB) is a component of the trans-translation system in prokaryotes for releasing stalled ribosome from damaged messenger RNAs; Region: SmpB; cd09294
160488014627	SmpB-tmRNA interface; other site
160488014628	transcriptional regulator PdhR; Reviewed; Region: pdhR; PRK09464
160488014629	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488014630	DNA-binding site [nucleotide binding]; DNA binding site
160488014631	This entry represents the C-terminal ligand binding domain of many members of the GntR family; Region: FCD; smart00895
160488014632	glycolate transporter; Provisional; Region: PRK09695
160488014633	L-lactate permease; Region: Lactate_perm; cl00701
160488014634	L-lactate dehydrogenase; Provisional; Region: lldD; PRK11197
160488014635	TIM barrel proteins share a structurally conserved phosphate binding motif and in general share an eight beta/alpha closed barrel structure. Specific for this family is the conserved phosphate binding site at the edges of strands 7 and 8. The phosphate...; Region: TIM_phosphate_binding; cl17186
160488014636	phosphate binding site [ion binding]; other site
160488014637	FAD/FMN-containing dehydrogenases [Energy production and conversion]; Region: GlcD; COG0277
160488014638	FAD binding domain; Region: FAD_binding_4; pfam01565
160488014639	The HCP family of iron-sulfur proteins includes hybrid cluster protein (HCP), acetyl-CoA synthase (ACS), and carbon monoxide dehydrogenase (CODH), all of which contain [Fe4-S4] metal clusters at their active sites. These proteins have a conserved...; Region: HCP_like; cl14655
160488014640	Fe-S oxidoreductase [Energy production and conversion]; Region: GlpC; COG0247
160488014641	Type I site-specific restriction-modification system, R (restriction) subunit and related helicases [Defense mechanisms]; Region: HsdR; COG4096
160488014642	Type I restriction enzyme R protein N terminus (HSDR_N); Region: HSDR_N; cl14958
160488014643	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
160488014644	ATP binding site [chemical binding]; other site
160488014645	putative Mg++ binding site [ion binding]; other site
160488014646	Type I restriction-modification system methyltransferase subunit [Defense mechanisms]; Region: HsdM; COG0286
160488014647	HsdM N-terminal domain; Region: HsdM_N; pfam12161
160488014648	Methyltransferase domain; Region: Methyltransf_26; pfam13659
160488014649	Restriction endonuclease S subunits [Defense mechanisms]; Region: HsdS; COG0732
160488014650	Type I restriction modification DNA specificity domain; Region: Methylase_S; pfam01420
160488014651	Restriction endonuclease S subunits [Defense mechanisms]; Region: HsdS; COG0732
160488014652	AAA domain; Region: AAA_21; pfam13304
160488014653	Transposase C of IS166 homeodomain; Region: LZ_Tnp_IS66; pfam13007
160488014654	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3436
160488014655	putative Helix-turn-helix domain of transposase IS66; Region: HTH_Tnp_IS66; pfam13005
160488014656	Transposase IS66 family; Region: DDE_Tnp_IS66; pfam03050
160488014657	IS66 C-terminal element; Region: DDE_Tnp_IS66_C; pfam13817
160488014658	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3436
160488014659	IS66 Orf2 like protein; Region: TnpB_IS66; pfam05717
160488014660	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
160488014661	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488014662	substrate binding pocket [chemical binding]; other site
160488014663	membrane-bound complex binding site; other site
160488014664	hinge residues; other site
160488014665	ABC-type arginine transport system, permease component [Amino acid transport and metabolism]; Region: ArtQ; COG4215
160488014666	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488014667	dimer interface [polypeptide binding]; other site
160488014668	conserved gate region; other site
160488014669	putative PBP binding loops; other site
160488014670	ABC-ATPase subunit interface; other site
160488014671	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488014672	dimer interface [polypeptide binding]; other site
160488014673	conserved gate region; other site
160488014674	putative PBP binding loops; other site
160488014675	ABC-ATPase subunit interface; other site
160488014676	ABC-type polar amino acid transport system, ATPase component [Amino acid transport and metabolism]; Region: GlnQ; COG1126
160488014677	ATP-binding cassette domain of the histidine and glutamine transporters; Region: ABC_HisP_GlnQ; cd03262
160488014678	Walker A/P-loop; other site
160488014679	ATP binding site [chemical binding]; other site
160488014680	Q-loop/lid; other site
160488014681	ABC transporter signature motif; other site
160488014682	Walker B; other site
160488014683	D-loop; other site
160488014684	H-loop/switch region; other site
160488014685	Xaa-Pro aminopeptidase [Amino acid transport and metabolism]; Region: PepP; COG0006
160488014686	Creatinase/Prolidase N-terminal domain; Region: Creatinase_N; pfam01321
160488014687	A family including aminopeptidase P, aminopeptidase M, and prolidase. Also known as metallopeptidase family M24. This family of enzymes is able to cleave amido-, imido- and amidino-containing bonds. Members exibit relatively narrow substrate specificity...; Region: APP_MetAP; cd01066
160488014688	active site
160488014689	mycofactocin system FadH/OYE family oxidoreductase 2; Region: mycofact_OYE_2; TIGR03997
160488014690	Old yellow enzyme (OYE)-related FMN binding domain, group 3. Each monomer of OYE contains FMN as a non-covalently bound cofactor, uses NADPH as a reducing agent with oxygens, quinones, and alpha,beta-unsaturated aldehydes and ketones, and can act as...; Region: OYE_like_3_FMN; cd04734
160488014691	putative active site [active]
160488014692	putative FMN binding site [chemical binding]; other site
160488014693	putative substrate binding site [chemical binding]; other site
160488014694	putative catalytic residue [active]
160488014695	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
160488014696	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
160488014697	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
160488014698	Secretin and TonB N terminus short domain; Region: STN; smart00965
160488014699	ferrichrome receptor precursor protein; Provisional; Region: PRK14050
160488014700	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
160488014701	N-terminal plug; other site
160488014702	ligand-binding site [chemical binding]; other site
160488014703	gamma-aminobutyrate permease; Region: GABAperm; TIGR01773
160488014704	glucarate dehydratase; Region: glucar-dehydr; TIGR03247
160488014705	D-Glucarate dehydratase (GlucD) catalyzes the dehydration of both D-glucarate and L-idarate to form 5-keto-4-deoxy-D-glucarate (5-KDG) , the initial reaction of the catabolic pathway for (D)-glucarate. GlucD belongs to the enolase superfamily of enzymes; Region: D-glucarate_dehydratase; cd03323
160488014706	active site
160488014707	tetramer interface [polypeptide binding]; other site
160488014708	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488014709	D-galactonate transporter; Region: 2A0114; TIGR00893
160488014710	putative substrate translocation pore; other site
160488014711	Transcriptional regulators [Transcription]; Region: FadR; COG2186
160488014712	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488014713	DNA-binding site [nucleotide binding]; DNA binding site
160488014714	This entry represents the C-terminal ligand binding domain of many members of the GntR family; Region: FCD; smart00895
160488014715	Medium chain dehydrogenases/reductase (MDR)/zinc-dependent alcohol dehydrogenase-like family; Region: MDR7; cd08276
160488014716	NADPH:quinone reductase and related Zn-dependent oxidoreductases [Energy production and conversion / General function prediction only]; Region: Qor; COG0604
160488014717	putative NAD(P) binding site [chemical binding]; other site
160488014718	Predicted phosphatases [General function prediction only]; Region: Gph; COG0546
160488014719	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
160488014720	active site
160488014721	motif I; other site
160488014722	motif II; other site
160488014723	Acyl-CoA thioesterase [Lipid metabolism]; Region: TesB; COG1946
160488014724	Thioesterase II (TEII) is thought to regenerate misprimed nonribosomal peptide synthetases (NRPSs) as well as modular polyketide synthases (PKSs) by hydrolyzing acetyl groups bound to the peptidyl carrier protein (PCP) and acyl carrier protein (ACP)...; Region: Thioesterase_II_repeat2; cd03445
160488014725	active site
160488014726	Thioesterase II (TEII) is thought to regenerate misprimed nonribosomal peptide synthetases (NRPSs) as well as modular polyketide synthases (PKSs) by hydrolyzing acetyl groups bound to the peptidyl carrier protein (PCP) and acyl carrier protein (ACP)...; Region: Thioesterase_II_repeat1; cd03444
160488014727	catalytic triad [active]
160488014728	dimer interface [polypeptide binding]; other site
160488014729	Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302
160488014730	Acetyltransferase (GNAT) family; Region: Acetyltransf_1; pfam00583
160488014731	Deacetylases, including yeast histone deacetylase and acetoin utilization protein [Chromatin structure and dynamics / Secondary metabolites biosynthesis, transport, and catabolism]; Region: AcuC; COG0123
160488014732	Histone deacetylase class IV also known as histone deacetylase 11; Region: HDAC_classIV; cd09993
160488014733	putative active site [active]
160488014734	Zn binding site [ion binding]; other site
160488014735	uncharacterized flavoprotein, PP_4765 family; Region: flavo_PP4765; TIGR03862
160488014736	ATP-dependent RNA helicase SrmB; Provisional; Region: PRK11192
160488014737	DEAD-box helicases. A diverse family of proteins involved in ATP-dependent RNA unwinding, needed in a variety of cellular processes including splicing, ribosome biogenesis and RNA degradation. The name derives from the sequence of the Walker  B motif; Region: DEADc; cd00268
160488014738	ATP binding site [chemical binding]; other site
160488014739	Mg++ binding site [ion binding]; other site
160488014740	motif III; other site
160488014741	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
160488014742	nucleotide binding region [chemical binding]; other site
160488014743	ATP-binding site [chemical binding]; other site
160488014744	putative DMT superfamily transporter inner membrane protein; Provisional; Region: PRK11272
160488014745	EamA-like transporter family; Region: EamA; pfam00892
160488014746	EamA-like transporter family; Region: EamA; pfam00892
160488014747	DEDDh 3'-5' exonuclease domain family; Region: DEDDh; cd06127
160488014748	active site
160488014749	catalytic site [active]
160488014750	substrate binding site [chemical binding]; other site
160488014751	Uncharacterized conserved protein [Function unknown]; Region: COG1432
160488014752	LabA_like proteins; Region: LabA; cd10911
160488014753	putative metal binding site [ion binding]; other site
160488014754	Uncharacterized protein conserved in bacteria (DUF2076); Region: DUF2076; pfam09849
160488014755	ATP-dependent helicase HrpB; Region: DEAH_box_HrpB; TIGR01970
160488014756	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
160488014757	ATP binding site [chemical binding]; other site
160488014758	putative Mg++ binding site [ion binding]; other site
160488014759	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
160488014760	nucleotide binding region [chemical binding]; other site
160488014761	ATP-binding site [chemical binding]; other site
160488014762	Helicase associated domain (HA2) Add an annotation; Region: HA2; smart00847
160488014763	ATP-dependent helicase C-terminal; Region: HrpB_C; pfam08482
160488014764	Cation efflux family; Region: Cation_efflux; cl00316
160488014765	Predicted Co/Zn/Cd cation transporters [Inorganic ion transport and metabolism]; Region: MMT1; COG0053
160488014766	Transcriptional regulators [Transcription]; Region: Lrp; COG1522
160488014767	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
160488014768	putative DNA binding site [nucleotide binding]; other site
160488014769	putative Zn2+ binding site [ion binding]; other site
160488014770	AsnC family; Region: AsnC_trans_reg; pfam01037
160488014771	Protein of unknown function (DUF2788); Region: DUF2788; pfam10981
160488014772	AMP nucleosidase; Provisional; Region: PRK08292
160488014773	Bacterial AMP nucleoside phosphorylase N-terminus; Region: AMNp_N; pfam10423
160488014774	Nucleoside phosphorylase [Nucleotide transport and metabolism]; Region: Pfs; COG0775
160488014775	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
160488014776	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
160488014777	active site
160488014778	7TMR-DISM extracellular 2; Region: 7TMR-DISMED2; pfam07696
160488014779	7TM diverse intracellular signalling; Region: 7TMR-DISM_7TM; pfam07695
160488014780	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488014781	dimer interface [polypeptide binding]; other site
160488014782	phosphorylation site [posttranslational modification]
160488014783	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488014784	ATP binding site [chemical binding]; other site
160488014785	Mg2+ binding site [ion binding]; other site
160488014786	G-X-G motif; other site
160488014787	4-amino-5-hydroxymethyl-2-methyl-pyrimidine phosphate kinase (HMPP-kinase) catalyzes two consecutive phosphorylation steps in the thiamine phosphate biosynthesis pathway, leading to the synthesis of vitamin B1. The first step is the phosphorylation of...; Region: HMPP_kinase; cd01169
160488014788	dimer interface [polypeptide binding]; other site
160488014789	substrate binding site [chemical binding]; other site
160488014790	ATP binding site [chemical binding]; other site
160488014791	Thiamine monophosphate synthase (TMP synthase)/TenI. TMP synthase catalyzes an important step in the thiamine biosynthesis pathway, the substitution of the pyrophosphate of 2-methyl-4-amino-5- hydroxymethylpyrimidine pyrophosphate by 4-methyl-5-; Region: TMP_TenI; cd00564
160488014792	thiamine phosphate binding site [chemical binding]; other site
160488014793	active site
160488014794	pyrophosphate binding site [ion binding]; other site
160488014795	glutamate-1-semialdehyde aminotransferase; Provisional; Region: PRK00062
160488014796	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
160488014797	inhibitor-cofactor binding pocket; inhibition site
160488014798	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488014799	catalytic residue [active]
160488014800	FOG: TPR repeat, SEL1 subfamily [General function prediction only]; Region: COG0790
160488014801	Sel1-like repeats; Region: SEL1; smart00671
160488014802	Sel1-like repeats; Region: SEL1; smart00671
160488014803	Domain of unknown function (DUF1820); Region: DUF1820; pfam08850
160488014804	Phosphate starvation-inducible protein PhoH, predicted ATPase [Signal transduction mechanisms]; Region: PhoH; COG1702
160488014805	PhoH-like protein; Region: PhoH; pfam02562
160488014806	metal-binding heat shock protein; Provisional; Region: PRK00016
160488014807	Putative Mg2+ and Co2+ transporter CorC [Inorganic ion transport and metabolism]; Region: CorC; COG4535
160488014808	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains associated with the CorC_HlyC domain. CorC_HlyC is a transporter associated domain. This small domain is found in Na+/H+ antiporters, in proteins involved in...; Region: CBS_pair_CorC_HlyC_assoc; cd04590
160488014809	Transporter associated domain; Region: CorC_HlyC; smart01091
160488014810	apolipoprotein N-acyltransferase; Reviewed; Region: lnt; PRK00302
160488014811	Apolipoprotein N-acyl transferase (class 9 nitrilases); Region: ALP_N-acyl_transferase; cd07571
160488014812	putative active site [active]
160488014813	catalytic triad [active]
160488014814	putative dimer interface [polypeptide binding]; other site
160488014815	Transposase; Region: DEDD_Tnp_IS110; pfam01548
160488014816	Transposase IS116/IS110/IS902 family; Region: Transposase_20; pfam02371
160488014817	Uncharacterized conserved protein [Function unknown]; Region: COG1434
160488014818	YdcF-like. YdcF-like is a large family of mainly bacterial proteins, with a few members found in fungi, plants, and archaea. Escherichia coli YdcF has been shown to bind S-adenosyl-L-methionine (AdoMet), but a biochemical function has not been...; Region: YdcF-like; cd06259
160488014819	putative active site [active]
160488014820	leucyl-tRNA synthetase; Validated; Region: leuS; PRK00390
160488014821	catalytic core domain of leucyl-tRNA synthetases; Region: LeuRS_core; cd00812
160488014822	HIGH motif; other site
160488014823	Leucyl-tRNA synthetase, Domain 2; Region: tRNA-synt_1_2; pfam13603
160488014824	nucleotidyl transferase superfamily; Region: nt_trans; cl00015
160488014825	active site
160488014826	KMSKS motif; other site
160488014827	Anticodon-binding domain of bacterial and eukaryotic mitochondrial leucyl tRNA synthetases; Region: Anticodon_Ia_Leu_BEm; cd07958
160488014828	tRNA binding surface [nucleotide binding]; other site
160488014829	Lipopolysaccharide-assembly; Region: LptE; cl01125
160488014830	DNA polymerase III subunit delta; Reviewed; Region: holA; PRK05574
160488014831	DNA polymerase III, delta subunit; Region: DNA_pol3_delta; pfam06144
160488014832	Domain of unknown function; Region: DUF331; cl01149
160488014833	Transglycosylase SLT domain; Region: SLT_2; pfam13406
160488014834	Lytic Transglycosylase (LT)  and Goose Egg White Lysozyme (GEWL) domain. Members include the soluble and insoluble membrane-bound LTs in bacteria, the LTs in bacteriophage lambda, as well as, the eukaryotic "goose-type" lysozymes (GEWL).  LTs...; Region: LT_GEWL; cd00254
160488014835	N-acetyl-D-glucosamine binding site [chemical binding]; other site
160488014836	Putative peptidoglycan binding domain; Region: PG_binding_1; pfam01471
160488014837	LD-Carboxypeptidase, a serine protease, includes microcin C7 self immunity protein; Region: Peptidase_S66; cd07025
160488014838	dimer interface [polypeptide binding]; other site
160488014839	catalytic triad [active]
160488014840	lipoyl synthase; Provisional; Region: PRK05481
160488014841	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
160488014842	FeS/SAM binding site; other site
160488014843	lipoate-protein ligase B; Provisional; Region: PRK14342
160488014844	hypothetical protein; Provisional; Region: PRK00341
160488014845	D-alanyl-D-alanine carboxypeptidase [Cell envelope biogenesis, outer membrane]; Region: DacC; COG1686
160488014846	Beta-lactamase enzyme family; Region: Beta-lactamase2; cl17872
160488014847	Penicillin-binding protein 5, C-terminal domain; Region: PBP5_C; pfam07943
160488014848	Lipoproteins [Cell envelope biogenesis, outer membrane]; Region: RlpA; COG0797
160488014849	Rare lipoprotein A (RlpA)-like double-psi beta-barrel; Region: DPBB_1; pfam03330
160488014850	Sporulation related domain; Region: SPOR; pfam05036
160488014851	Transglycosylase SLT domain; Region: SLT_2; pfam13406
160488014852	Lytic Transglycosylase (LT)  and Goose Egg White Lysozyme (GEWL) domain. Members include the soluble and insoluble membrane-bound LTs in bacteria, the LTs in bacteriophage lambda, as well as, the eukaryotic "goose-type" lysozymes (GEWL).  LTs...; Region: LT_GEWL; cd00254
160488014853	N-acetyl-D-glucosamine binding site [chemical binding]; other site
160488014854	rod shape-determining protein RodA; Region: rodA_shape; TIGR02210
160488014855	penicillin-binding protein 2; Region: pbp2_mrdA; TIGR03423
160488014856	Penicillin-binding Protein dimerisation domain; Region: PBP_dimer; pfam03717
160488014857	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; pfam00905
160488014858	rRNA large subunit methyltransferase; Provisional; Region: PRK00103
160488014859	iojap-like ribosome-associated protein; Region: iojap_ybeB; TIGR00090
160488014860	nicotinic acid mononucleotide adenylyltransferase; Provisional; Region: nadD; PRK00071
160488014861	Nicotinamide/nicotinate mononucleotide adenylyltransferase; Region: NMNAT; cd02165
160488014862	active site
160488014863	(T/H)XGH motif; other site
160488014864	Gamma-glutamyl phosphate reductase (GPR), aldehyde dehydrogenase families 18 and 19; Region: ALDH_F18-19_ProA-GPR; cd07079
160488014865	putative catalytic cysteine [active]
160488014866	Alkyladenine DNA glycosylase catalyzes the first step in base excision repair; Region: AAG; cd00540
160488014867	active site
160488014868	DNA binding site [nucleotide binding]
160488014869	Uncharacterized membrane-associated protein [Function unknown]; Region: DedA; COG0586
160488014870	SNARE associated Golgi protein; Region: SNARE_assoc; pfam09335
160488014871	PAP2_like_2 proteins. PAP2 is a super-family of phosphatases and haloperoxidases. This subgroup, which is specific to bacteria, lacks functional characterization and may act as a membrane-associated lipid phosphatase; Region: PAP2_like_2; cd03392
160488014872	Membrane-associated phospholipid phosphatase [Lipid metabolism]; Region: PgpB; COG0671
160488014873	active site
160488014874	Uncharacterized protein, similar to the N-terminal domain of Lon protease [General function prediction only]; Region: COG2802
160488014875	LrgB-like family; Region: LrgB; pfam04172
160488014876	Putative effector of murein hydrolase LrgA [General function prediction only]; Region: COG1380
160488014877	NodN (nodulation factor N) contains a single hot dog fold similar to those of the peroxisomal Hydratase-Dehydrogenase-Epimerase (HDE) protein, and the fatty acid synthase beta subunit.  Rhizobium and related species form nodules on the roots of their...; Region: NodN; cd03450
160488014878	putative active site [active]
160488014879	putative catalytic site [active]
160488014880	Ribosomal protein L11 methyltransferase (PrmA); Region: PrmA; pfam06325
160488014881	Methyltransferase domain; Region: Methyltransf_18; pfam12847
160488014882	MJ0042 family finger-like domain; Region: MJ0042_CXXC; TIGR02098
160488014883	Protein of unknown function (DUF3426); Region: DUF3426; pfam11906
160488014884	putative TIM-barrel protein, nifR3 family; Region: nifR3_yhdG; TIGR00737
160488014885	Dihydrouridine synthase-like (DUS-like) FMN-binding domain. Members of this family catalyze the reduction of the 5,6-double bond of a uridine residue on tRNA. Dihydrouridine modification of tRNA is widely observed in prokaryotes and eukaryotes, and also...; Region: DUS_like_FMN; cd02801
160488014886	FMN binding site [chemical binding]; other site
160488014887	active site
160488014888	catalytic residues [active]
160488014889	substrate binding site [chemical binding]; other site
160488014890	Factor for inversion stimulation Fis, transcriptional activator [Transcription / DNA replication, recombination, and repair]; Region: Fis; COG2901
160488014891	global DNA-binding transcriptional dual regulator Fis; Provisional; Region: fis; PRK00430
160488014892	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase; Provisional; Region: purH; PRK00881
160488014893	Inosine monophosphate cyclohydrolase domain. This is the N-terminal domain in the purine biosynthesis pathway protein ATIC (purH). The bifunctional ATIC protein contains a C-terminal  ATIC formylase domain that formylates...; Region: IMPCH; cd01421
160488014894	purine monophosphate binding site [chemical binding]; other site
160488014895	dimer interface [polypeptide binding]; other site
160488014896	putative catalytic residues [active]
160488014897	AICARFT/IMPCHase bienzyme; Region: AICARFT_IMPCHas; smart00798
160488014898	AICARFT/IMPCHase bienzyme; Region: AICARFT_IMPCHas; cl03362
160488014899	phosphoribosylamine--glycine ligase; Provisional; Region: PRK00885
160488014900	Phosphoribosylglycinamide synthetase, N domain; Region: GARS_N; pfam02844
160488014901	Phosphoribosylglycinamide synthetase, ATP-grasp (A) domain; Region: GARS_A; pfam01071
160488014902	Phosphoribosylglycinamide synthetase, C domain; Region: GARS_C; pfam02843
160488014903	7TMR-DISM extracellular 2; Region: 7TMR-DISMED2; pfam07696
160488014904	7TM diverse intracellular signalling; Region: 7TMR-DISM_7TM; pfam07695
160488014905	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488014906	dimer interface [polypeptide binding]; other site
160488014907	phosphorylation site [posttranslational modification]
160488014908	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488014909	ATP binding site [chemical binding]; other site
160488014910	Mg2+ binding site [ion binding]; other site
160488014911	G-X-G motif; other site
160488014912	Response regulator receiver domain; Region: Response_reg; pfam00072
160488014913	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488014914	active site
160488014915	phosphorylation site [posttranslational modification]
160488014916	intermolecular recognition site; other site
160488014917	dimerization interface [polypeptide binding]; other site
160488014918	Response regulator receiver domain; Region: Response_reg; pfam00072
160488014919	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488014920	active site
160488014921	phosphorylation site [posttranslational modification]
160488014922	intermolecular recognition site; other site
160488014923	dimerization interface [polypeptide binding]; other site
160488014924	Multiple antibiotic transporter [Intracellular trafficking and secretion]; Region: MarC; COG2095
160488014925	Cobalamin biosynthesis protein CbiG [Coenzyme metabolism]; Region: CbiG; COG2073
160488014926	Cobalamin synthesis G N-terminal; Region: CbiG_N; pfam11760
160488014927	Cobalamin biosynthesis central region; Region: CbiG_mid; pfam11761
160488014928	Cobalamin synthesis G C-terminus; Region: CbiG_C; pfam01890
160488014929	Precorrin-3B C(17)-methyltransferase (CobJ/CbiH); Region: Precorrin_3B_C17_MT; cd11646
160488014930	active site
160488014931	SAM binding site [chemical binding]; other site
160488014932	homodimer interface [polypeptide binding]; other site
160488014933	Precorrin-2 C20-methyltransferase, also named CobI or CbiL; Region: Precorrin_2_C20_MT; cd11645
160488014934	homodimer interface [polypeptide binding]; other site
160488014935	active site
160488014936	SAM binding site [chemical binding]; other site
160488014937	precorrin-8X methylmutase; Reviewed; Region: cobH; PRK08285
160488014938	Precorrin-8X methylmutase; Region: CbiC; pfam02570
160488014939	precorrin-3B synthase; Region: CobG; TIGR02435
160488014940	Nitrite/Sulfite reductase ferredoxin-like half domain; Region: NIR_SIR_ferr; pfam03460
160488014941	Precorrin-6Y methyltransferase, the cobalamin biosynthesis enzyme CbiE; Region: Precorrin-6Y-methylase; cd11644
160488014942	active site
160488014943	putative homodimer interface [polypeptide binding]; other site
160488014944	SAM binding site [chemical binding]; other site
160488014945	Precorrin-6B methylase 2 [Coenzyme metabolism]; Region: CobL; COG2242
160488014946	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488014947	S-adenosylmethionine binding site [chemical binding]; other site
160488014948	cobalt-precorrin-6A synthase; Reviewed; Region: cbiD; PRK00075
160488014949	cobalt-precorrin-6x reductase; Reviewed; Region: PRK08057
160488014950	Precorrin-6x reductase [Coenzyme metabolism]; Region: CobK; COG2099
160488014951	Membrane protein implicated in regulation of membrane protease activity [Posttranslational modification, protein turnover, chaperones / Intracellular trafficking and secretion]; Region: COG1585
160488014952	Membrane protease subunits, stomatin/prohibitin homologs [Posttranslational modification, protein turnover, chaperones]; Region: HflC; COG0330
160488014953	Band_7_stomatin_like: A subgroup of the band 7 domain of flotillin (reggie) like proteins similar to stomatin and podicin (two lipid raft-associated integral membrane proteins). Individual proteins of this band 7 domain family may cluster to form...; Region: Band_7_stomatin_like; cd03403
160488014954	Protein of unknown function (DUF2946); Region: DUF2946; pfam11162
160488014955	Protein of unknown function (DUF461); Region: DUF461; pfam04314
160488014956	Protein of unknown function (DUF2946); Region: DUF2946; pfam11162
160488014957	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
160488014958	N-terminal plug; other site
160488014959	TonB-dependent copper receptor; Region: TonB-copper; TIGR01778
160488014960	ligand-binding site [chemical binding]; other site
160488014961	Uncharacterized iron-regulated membrane protein [Function unknown]; Region: PiuB; COG3182
160488014962	PepSY-associated TM helix; Region: PepSY_TM_1; pfam13172
160488014963	Peptidase propeptide and YPEB domain; Region: PepSY; pfam03413
160488014964	PepSY-associated TM helix; Region: PepSY_TM_2; pfam13703
160488014965	Peptidase propeptide and YPEB domain; Region: PepSY; pfam03413
160488014966	D-alanine/D-serine/glycine permease; Provisional; Region: PRK11049
160488014967	Spore germination protein; Region: Spore_permease; cl17796
160488014968	Periplasmic binding protein; Region: Peripla_BP_6; pfam13458
160488014969	Periplasmic component (FmdD) of an active transport system for short-chain amides and urea (FmdDEF); Region: PBP1_FmdD_like; cd06355
160488014970	putative ligand binding site [chemical binding]; other site
160488014971	Transmembrane subunit (TM) of Escherichia coli LivH and related proteins. LivH is one of two TMs of the E. coli LIV-1/LS transporter, a Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporter involved in the uptake of...; Region: TM_PBP1_LivH_like; cd06582
160488014972	TM-ABC transporter signature motif; other site
160488014973	ABC-type branched-chain amino acid transport system, permease component [Amino acid transport and metabolism]; Region: LivM; COG4177
160488014974	Transmembrane subunit (TM) of Escherichia coli LivM and related proteins. LivM is one of two TMs of the E. coli LIV-1/LS transporter, a Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporter involved in the uptake of...; Region: TM_PBP1_LivM_like; cd06581
160488014975	TM-ABC transporter signature motif; other site
160488014976	urea ABC transporter, ATP-binding protein UrtD; Region: urea_trans_UrtD; TIGR03411
160488014977	ATP-binding cassette component of branched chain amino acids transport system; Region: ABC_Mj1267_LivG_branched; cd03219
160488014978	Walker A/P-loop; other site
160488014979	ATP binding site [chemical binding]; other site
160488014980	Q-loop/lid; other site
160488014981	ABC transporter signature motif; other site
160488014982	Walker B; other site
160488014983	D-loop; other site
160488014984	H-loop/switch region; other site
160488014985	urea ABC transporter, ATP-binding protein UrtE; Region: urea_trans_UrtE; TIGR03410
160488014986	ATP-binding cassette domain of branched-chain amino acid transporter; Region: ABC_TM1139_LivF_branched; cd03224
160488014987	Walker A/P-loop; other site
160488014988	ATP binding site [chemical binding]; other site
160488014989	Q-loop/lid; other site
160488014990	ABC transporter signature motif; other site
160488014991	Walker B; other site
160488014992	D-loop; other site
160488014993	H-loop/switch region; other site
160488014994	Sortase and related acyltransferases [Cell envelope biogenesis, outer membrane]; Region: COG1247
160488014995	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
160488014996	Coenzyme A binding pocket [chemical binding]; other site
160488014997	chaperone-modulator protein CbpM; Provisional; Region: PRK10265
160488014998	MerR HTH family regulatory protein; Region: MerR_2; pfam13591
160488014999	curved DNA-binding protein CbpA; Provisional; Region: PRK10266
160488015000	DnaJ domain or J-domain.  DnaJ/Hsp40 (heat shock protein 40) proteins are highly conserved and play crucial roles in protein translation, folding, unfolding, translocation, and degradation. They act primarily by stimulating the ATPase activity of Hsp70s; Region: DnaJ; cd06257
160488015001	HSP70 interaction site [polypeptide binding]; other site
160488015002	C-terminal substrate binding domain of DnaJ and HSP40; Region: DnaJ_C; cd10747
160488015003	substrate binding site [polypeptide binding]; other site
160488015004	dimer interface [polypeptide binding]; other site
160488015005	Escherichia coli YegD, a putative chaperone protein, and related proteins; Region: YegD_like; cd10231
160488015006	putative chaperone; Provisional; Region: PRK11678
160488015007	nucleotide binding site [chemical binding]; other site
160488015008	putative NEF/HSP70 interaction site [polypeptide binding]; other site
160488015009	SBD interface [polypeptide binding]; other site
160488015010	Predicted permease, member of the PurR regulon [General function prediction only]; Region: yhhT; cl00465
160488015011	hypothetical protein; Provisional; Region: PRK11505
160488015012	psiF repeat; Region: PsiF_repeat; pfam07769
160488015013	psiF repeat; Region: PsiF_repeat; pfam07769
160488015014	AraC-like ligand binding domain; Region: AraC_binding; pfam02311
160488015015	Helix-turn-helix domain; Region: HTH_18; pfam12833
160488015016	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488015017	EamA-like transporter family; Region: EamA; pfam00892
160488015018	Permeases of the drug/metabolite transporter (DMT) superfamily [Carbohydrate transport and metabolism / Amino acid transport and metabolism / General function prediction only]; Region: RhaT; COG0697
160488015019	EamA-like transporter family; Region: EamA; pfam00892
160488015020	Predicted acetyltransferases and hydrolases with the alpha/beta hydrolase fold [General function prediction only]; Region: LipA; COG1075
160488015021	DNA-binding transcriptional activator OsmE; Provisional; Region: PRK11251
160488015022	Ferritin-like superfamily of diiron-containing four-helix-bundle proteins; Region: Ferritin_like; cd00657
160488015023	Ferritin-like domain; Region: Ferritin; pfam00210
160488015024	dinuclear metal binding motif [ion binding]; other site
160488015025	Uncharacterized protein involved in outer membrane biogenesis [Cell envelope biogenesis, outer membrane]; Region: AsmA; COG2982
160488015026	AsmA-like C-terminal region; Region: AsmA_2; pfam13502
160488015027	DNA-binding transcriptional repressor FabR; Provisional; Region: PRK11202
160488015028	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
160488015029	dimerization interface [polypeptide binding]; other site
160488015030	N-acylglucosamine 2-epimerase (GlcNAc 2-epimerase); Region: GlcNAc_2-epim; pfam07221
160488015031	putative active cleft [active]
160488015032	classical (c) SDR, subgroup 5; Region: SDR_c5; cd05346
160488015033	Short-chain alcohol dehydrogenase of unknown specificity [General function prediction only]; Region: COG4221
160488015034	putative NAD(P) binding site [chemical binding]; other site
160488015035	homotetramer interface [polypeptide binding]; other site
160488015036	homodimer interface [polypeptide binding]; other site
160488015037	active site
160488015038	ABC-type branched-chain amino acid transport systems, ATPase component [Amino acid transport and metabolism]; Region: LivF; COG0410
160488015039	ATP-binding cassette domain of branched-chain amino acid transporter; Region: ABC_TM1139_LivF_branched; cd03224
160488015040	Walker A/P-loop; other site
160488015041	ATP binding site [chemical binding]; other site
160488015042	Q-loop/lid; other site
160488015043	ABC transporter signature motif; other site
160488015044	Walker B; other site
160488015045	D-loop; other site
160488015046	H-loop/switch region; other site
160488015047	leucine/isoleucine/valine transporter ATP-binding subunit; Provisional; Region: livG; PRK11300
160488015048	ATP-binding cassette component of branched chain amino acids transport system; Region: ABC_Mj1267_LivG_branched; cd03219
160488015049	Walker A/P-loop; other site
160488015050	ATP binding site [chemical binding]; other site
160488015051	Q-loop/lid; other site
160488015052	ABC transporter signature motif; other site
160488015053	Walker B; other site
160488015054	D-loop; other site
160488015055	H-loop/switch region; other site
160488015056	leucine/isoleucine/valine transporter permease subunit; Provisional; Region: livM; PRK11301
160488015057	Domain of unknown function (DUF3382); Region: DUF3382; pfam11862
160488015058	Transmembrane subunit (TM) of Escherichia coli LivM and related proteins. LivM is one of two TMs of the E. coli LIV-1/LS transporter, a Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporter involved in the uptake of...; Region: TM_PBP1_LivM_like; cd06581
160488015059	TM-ABC transporter signature motif; other site
160488015060	Branched-chain amino acid transport system / permease component; Region: BPD_transp_2; pfam02653
160488015061	Transmembrane subunit (TM) of Escherichia coli LivH and related proteins. LivH is one of two TMs of the E. coli LIV-1/LS transporter, a Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporter involved in the uptake of...; Region: TM_PBP1_LivH_like; cd06582
160488015062	TM-ABC transporter signature motif; other site
160488015063	ABC-type branched-chain amino acid transport systems, periplasmic component [Amino acid transport and metabolism]; Region: LivK; COG0683
160488015064	Type I periplasmic ligand-binding domain of ABC (Atpase Binding Cassette)-type active transport systems that are involved in the transport of all three branched chain aliphatic amino acids (leucine, isoleucine and valine); Region: PBP1_ABC_LIVBP_like; cd06342
160488015065	dimerization interface [polypeptide binding]; other site
160488015066	ligand binding site [chemical binding]; other site
160488015067	nicotinate phosphoribosyltransferase; Region: NAPRTase; TIGR01514
160488015068	Nicotinate phosphoribosyltransferase (NAPRTase), related to PncB. Nicotinate phosphoribosyltransferase catalyses the formation of NAMN and PPi from 5-phosphoribosy -1-pyrophosphate (PRPP) and nicotinic acid, this is the first, and also rate limiting; Region: PncB_like; cd01401
160488015069	active site
160488015070	NAD+ synthetase; Region: nadE; TIGR00552
160488015071	NAD+ synthase is a homodimer, which catalyzes the final step in de novo nicotinamide adenine dinucleotide (NAD+) biosynthesis, an amide transfer from either ammonia or glutamine to nicotinic acid adenine dinucleotide (NaAD). The conversion of NaAD to NAD...; Region: NAD_synthase; cd00553
160488015072	homodimer interface [polypeptide binding]; other site
160488015073	NAD binding pocket [chemical binding]; other site
160488015074	ATP binding pocket [chemical binding]; other site
160488015075	Mg binding site [ion binding]; other site
160488015076	active-site loop [active]
160488015077	Cupredoxin-like domain; Region: Cupredoxin_1; cl17234
160488015078	Possible lysine decarboxylase; Region: Lysine_decarbox; cl00695
160488015079	hypothetical protein; Provisional; Region: PRK01254
160488015080	Radical SAM N-terminal; Region: Radical_SAM_N; pfam08497
160488015081	Domain of unknown function (DUF3362); Region: DUF3362; pfam11842
160488015082	replicative DNA helicase; Provisional; Region: PRK05748
160488015083	DnaB-like helicase N terminal domain; Region: DnaB; pfam00772
160488015084	DnaB helicase C terminal domain. The hexameric helicase DnaB unwinds the DNA duplex at the  chromosome replication fork. Although the mechanism by which DnaB both couples ATP hydrolysis to translocation along DNA and denatures the duplex is unknown, a...; Region: DnaB_C; cd00984
160488015085	Walker A motif; other site
160488015086	ATP binding site [chemical binding]; other site
160488015087	Walker B motif; other site
160488015088	DNA binding loops [nucleotide binding]
160488015089	50S ribosomal protein L9; Reviewed; Region: rplI; PRK00137
160488015090	Ribosomal protein L9, N-terminal domain; Region: Ribosomal_L9_N; pfam01281
160488015091	Ribosomal protein L9, C-terminal domain; Region: Ribosomal_L9_C; pfam03948
160488015092	30S ribosomal protein S18; Reviewed; Region: rpsR; PRK00391
160488015093	30S ribosomal protein S6; Reviewed; Region: rpsF; PRK00453
160488015094	23S rRNA (guanosine-2'-O-)-methyltransferase; Provisional; Region: PRK11181
160488015095	RNA 2'-O ribose methyltransferase substrate binding; Region: SpoU_sub_bind; pfam08032
160488015096	SpoU rRNA Methylase family; Region: SpoU_methylase; pfam00588
160488015097	ribonuclease R; Region: RNase_R; TIGR02063
160488015098	Ribonuclease B OB domain; Region: OB_RNB; pfam08206
160488015099	RNB domain; Region: RNB; pfam00773
160488015100	S1_RNase_R: RNase R C-terminal S1 domain. RNase R is a processive 3' to 5' exoribonuclease, which is a homolog of RNase II. RNase R degrades RNA with secondary structure having a 3' overhang of at least 7 nucleotides. RNase R and PNPase...; Region: S1_RNase_R; cd04471
160488015101	RNA binding site [nucleotide binding]; other site
160488015102	Bacterial extracellular solute-binding protein; Region: SBP_bac_11; pfam13531
160488015103	ABC-type Fe3+ transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: AfuA; COG1840
160488015104	ABC-type Fe3+ transport system, permease component [Inorganic ion transport and metabolism]; Region: ThiP; COG1178
160488015105	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488015106	dimer interface [polypeptide binding]; other site
160488015107	conserved gate region; other site
160488015108	putative PBP binding loops; other site
160488015109	ABC-ATPase subunit interface; other site
160488015110	H(+) -translocating inorganic pyrophosphatase; Region: PLN02255; cl11452
160488015111	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488015112	dimer interface [polypeptide binding]; other site
160488015113	conserved gate region; other site
160488015114	putative PBP binding loops; other site
160488015115	ABC-ATPase subunit interface; other site
160488015116	Protein of unknown function (DUF796); Region: DUF796; pfam05638
160488015117	Protein of unknown function (DUF2867); Region: DUF2867; pfam11066
160488015118	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
160488015119	dimerization interface [polypeptide binding]; other site
160488015120	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
160488015121	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
160488015122	dimer interface [polypeptide binding]; other site
160488015123	putative CheW interface [polypeptide binding]; other site
160488015124	Adenylosuccinate synthetase; Region: Adenylsucc_synt; smart00788
160488015125	Adenylosuccinate synthetase (AdSS) catalyzes the first step in the de novo biosynthesis of AMP. IMP and L-aspartate are conjugated in a two-step reaction accompanied by the hydrolysis of GTP to GDP in the presence of Mg2+. In the first step, the...; Region: AdSS; cd03108
160488015126	GDP-binding site [chemical binding]; other site
160488015127	ACT binding site; other site
160488015128	IMP binding site; other site
160488015129	ATP phosphoribosyltransferase regulatory subunit; Provisional; Region: PRK12421
160488015130	Class II Histidinyl-tRNA synthetase (HisRS)-like catalytic core domain. HisRS is a homodimer. It is responsible for the attachment of histidine to the 3' OH group of ribose of the appropriate tRNA. This domain is primarily responsible for...; Region: HisRS-like_core; cd00773
160488015131	dimer interface [polypeptide binding]; other site
160488015132	motif 1; other site
160488015133	active site
160488015134	motif 2; other site
160488015135	motif 3; other site
160488015136	FtsH protease regulator HflC; Provisional; Region: PRK11029
160488015137	Band_7_HflC: The band 7 domain of flotillin (reggie) like proteins. This group includes proteins similar to prokaryotic HlfC (High frequency of lysogenization C). Although many members of the band 7 family are lipid raft associated, prokaryote plasma...; Region: Band_7_HflC; cd03405
160488015138	Bacterial membrane protein N terminal; Region: HflK_N; pfam12221
160488015139	Band_7_HflK: The band 7 domain of flotillin (reggie) like proteins. This group includes proteins similar to prokaryotic HlfK (High frequency of lysogenization K). Although many members of the band 7 family are lipid raft associated, prokaryote plasma...; Region: Band_7_HflK; cd03404
160488015140	HflK protein; Region: hflK; TIGR01933
160488015141	GTP-binding protein HflX; Region: GTP_HflX; TIGR03156
160488015142	GTP-binding GTPase N-terminal; Region: GTP-bdg_N; pfam13167
160488015143	HflX GTPase family; Region: HflX; cd01878
160488015144	G1 box; other site
160488015145	GTP/Mg2+ binding site [chemical binding]; other site
160488015146	Switch I region; other site
160488015147	G2 box; other site
160488015148	G3 box; other site
160488015149	Switch II region; other site
160488015150	G4 box; other site
160488015151	G5 box; other site
160488015152	bacterial Hfq-like; Region: Hfq; cd01716
160488015153	hexamer interface [polypeptide binding]; other site
160488015154	Sm1 motif; other site
160488015155	RNA binding site [nucleotide binding]; other site
160488015156	Sm2 motif; other site
160488015157	tRNA delta(2)-isopentenylpyrophosphate transferase [Translation, ribosomal structure and biogenesis]; Region: MiaA; COG0324
160488015158	tRNA delta(2)-isopentenylpyrophosphate transferase; Reviewed; Region: miaA; PRK00091
160488015159	DNA mismatch repair protein; Reviewed; Region: mutL; PRK00095
160488015160	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488015161	ATP binding site [chemical binding]; other site
160488015162	Mg2+ binding site [ion binding]; other site
160488015163	G-X-G motif; other site
160488015164	MutL_Trans_MutL: transducer domain, having a ribosomal S5 domain 2-like fold, found in proteins similar to Escherichia coli MutL.  EcMutL belongs to the DNA mismatch repair (MutL/MLH1/PMS2) family.  This transducer domain is homologous to the second...; Region: MutL_Trans_MutL; cd03482
160488015165	ATP binding site [chemical binding]; other site
160488015166	MutL C terminal dimerisation domain; Region: MutL_C; pfam08676
160488015167	AMIN domain; Region: AMIN; pfam11741
160488015168	N-acetylmuramoyl-L-alanine amidase or MurNAc-LAA (also known as peptidoglycan aminohydrolase, NAMLA amidase, NAMLAA, Amidase 3, and peptidoglycan amidase; EC 3.5.1.28) is an autolysin that hydrolyzes the amide bond between N-acetylmuramoyl and L-amino...; Region: MurNAc-LAA; cd02696
160488015169	active site
160488015170	metal binding site [ion binding]; metal-binding site
160488015171	Lysine Motif is a small domain involved in binding peptidoglycan; Region: LysM; cd00118
160488015172	Uncharacterized P-loop hydrolase UPF0079; Region: UPF0079; cl00520
160488015173	B.subtilis YXKO protein of unknown function and related proteins. Based on the conservation of the ATP binding site, the substrate binding site and the Mg2+binding site and structural homology this group is a member of the ribokinase-like superfamily; Region: YXKO-related; cd01171
160488015174	putative ATP binding site [chemical binding]; other site
160488015175	putative substrate binding site [chemical binding]; other site
160488015176	epoxyqueuosine reductase; Region: TIGR00276
160488015177	Domain of unknown function (DUF1730); Region: DUF1730; pfam08331
160488015178	Predicted membrane protein [Function unknown]; Region: COG2860
160488015179	UPF0126 domain; Region: UPF0126; pfam03458
160488015180	UPF0126 domain; Region: UPF0126; pfam03458
160488015181	DEDDh 3'-5' exonuclease domain of oligoribonuclease and similar proteins; Region: Orn; cd06135
160488015182	catalytic site [active]
160488015183	putative active site [active]
160488015184	putative substrate binding site [chemical binding]; other site
160488015185	dimer interface [polypeptide binding]; other site
160488015186	GTPase RsgA; Reviewed; Region: PRK12288
160488015187	S1_like: Ribosomal protein S1-like RNA-binding domain. Found in a wide variety of RNA-associated proteins. Originally identified in S1 ribosomal protein. This superfamily also contains the Cold Shock Domain (CSD), which is a homolog of the S1 domain; Region: S1_like; cl09927
160488015188	RNA binding site [nucleotide binding]; other site
160488015189	Ribosomal interacting GTPase YjeQ/EngC, a circularly permuted subfamily of the Ras GTPases; Region: YjeQ_EngC; cd01854
160488015190	GTPase/Zn-binding domain interface [polypeptide binding]; other site
160488015191	GTP/Mg2+ binding site [chemical binding]; other site
160488015192	G4 box; other site
160488015193	G5 box; other site
160488015194	G1 box; other site
160488015195	Switch I region; other site
160488015196	G2 box; other site
160488015197	G3 box; other site
160488015198	Switch II region; other site
160488015199	Membrane MotB of proton-channel complex MotA/MotB; Region: MotB_plug; pfam13677
160488015200	Flagellar motor protein [Cell motility and secretion]; Region: MotB; COG1360
160488015201	Peptidoglycan binding domains similar to the C-terminal domain of outer-membrane protein OmpA; Region: OmpA_C-like; cd07185
160488015202	ligand binding site [chemical binding]; other site
160488015203	Flagellar motor component [Cell motility and secretion]; Region: MotA; COG1291
160488015204	flagellar motor protein MotA; Validated; Region: PRK09110
160488015205	HDOD domain; Region: HDOD; pfam08668
160488015206	Rhodanese-related sulfurtransferase [Inorganic ion transport and metabolism]; Region: SseA; COG2897
160488015207	Rhodanese Homology Domain (RHOD); an alpha beta fold domain found duplicated in the rhodanese protein. The cysteine containing enzymatically active version of the domain is also found in the Cdc25 class of protein phosphatases and a variety of proteins...; Region: RHOD; cl00125
160488015208	active site residue [active]
160488015209	Thiosulfate sulfurtransferase (TST), C-terminal, catalytic domain. TST contains 2 copies of the Rhodanese Homology Domain; this is the second repeat. Only the second repeat contains the catalytically active Cys residue; Region: TST_Repeat_2; cd01449
160488015210	active site residue [active]
160488015211	phosphatidylserine decarboxylase; Reviewed; Region: psd; PRK00044
160488015212	Glycine cleavage system regulatory protein [Amino acid transport and metabolism]; Region: GcvR; COG2716
160488015213	CT domains found N-terminal of phosphoserine phosphatase (PSP, SerB); Region: ACT_PSP_1; cd04870
160488015214	ACT domains found N-terminal of phosphoserine phosphatase (PSP, SerB); Region: ACT_PSP_2; cd04871
160488015215	phosphoserine phosphatase SerB; Region: serB; TIGR00338
160488015216	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
160488015217	motif II; other site
160488015218	Uncharacterized membrane protein affecting hemolysin expression [General function prediction only]; Region: AhpA; COG3726
160488015219	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3009
160488015220	Protein of unknown function (DUF330); Region: DUF330; pfam03886
160488015221	DNA topoisomerase IV subunit A; Validated; Region: PRK05561
160488015222	DNA Topoisomerase, subtype IIA; domain A'; bacterial DNA topoisomerase IV (C subunit, ParC), bacterial DNA gyrases (A subunit, GyrA),mammalian DNA toposiomerases II. DNA topoisomerases are essential enzymes that regulate the conformational changes...; Region: TOP4c; cd00187
160488015223	CAP-like domain; other site
160488015224	active site
160488015225	primary dimer interface [polypeptide binding]; other site
160488015226	Bacterial aspartate proteases, retropepsin-like protease family; Region: retropepsin_like_bacteria; cd05483
160488015227	catalytic motif [active]
160488015228	Catalytic residue [active]
160488015229	SdiA-regulated; Region: SdiA-regulated; cd09971
160488015230	DNA topoisomerase IV subunit B; Reviewed; Region: PRK05559
160488015231	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488015232	ATP binding site [chemical binding]; other site
160488015233	Mg2+ binding site [ion binding]; other site
160488015234	G-X-G motif; other site
160488015235	TopoIIA_Trans_DNA_gyrase: Transducer domain, having a ribosomal S5 domain 2-like fold, of the type found in proteins of the type IIA family of DNA topoisomerases similar to the B subunits of E. coli DNA gyrase and E. coli Topoisomerase IV which are; Region: TopoII_Trans_DNA_gyrase; cd00822
160488015236	anchoring element; other site
160488015237	dimer interface [polypeptide binding]; other site
160488015238	ATP binding site [chemical binding]; other site
160488015239	Topoisomerase-primase domain. This is a nucleotidyl transferase/hydrolase domain found in type IA, type IIA and type IIB topoisomerases, bacterial DnaG-type primases, small primase-like proteins from bacteria and archaea, OLD family nucleases from...; Region: TOPRIM; cl00718
160488015240	active site
160488015241	metal binding site [ion binding]; metal-binding site
160488015242	DNA gyrase B subunit, carboxyl terminus; Region: DNA_gyraseB_C; pfam00986
160488015243	Uncharacterized protein family (UPF0227); Region: UPF0227; cl14886
160488015244	Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697
160488015245	Enterobacter aerogenes GpdQ and related proteins, metallophosphatase domain; Region: MPP_GpdQ; cd07402
160488015246	Calcineurin-like phosphoesterase; Region: Metallophos; pfam00149
160488015247	active site
160488015248	metal binding site [ion binding]; metal-binding site
160488015249	hexamer interface [polypeptide binding]; other site
160488015250	Protein of unknown function (DUF1249); Region: DUF1249; pfam06853
160488015251	ADP-ribose pyrophosphatase NudF; Provisional; Region: nudF; PRK10729
160488015252	ADP-ribose pyrophosphatase (ADPRase) catalyzes the hydrolysis of ADP-ribose and a variety of additional ADP-sugar conjugates to AMP and ribose-5-phosphate. Like other members of the Nudix hydrolase superfamily, it requires a divalent cation, such as Mg2+; Region: ADPRase_NUDT5; cd03424
160488015253	dimer interface [polypeptide binding]; other site
160488015254	ADP-ribose binding site [chemical binding]; other site
160488015255	active site
160488015256	nudix motif; other site
160488015257	metal binding site [ion binding]; metal-binding site
160488015258	Protein of unknown function (DUF3298); Region: DUF3298; pfam11738
160488015259	putative hydroxymethylpyrimidine transporter CytX; Region: thia_cytX; TIGR02358
160488015260	Na binding site [ion binding]; other site
160488015261	thiamine biosynthesis protein ThiC; Provisional; Region: PRK09284
160488015262	ThiC-associated domain; Region: ThiC-associated; pfam13667
160488015263	Thiamine biosynthesis protein ThiC [Coenzyme metabolism]; Region: ThiC; COG0422
160488015264	outer membrane channel protein; Reviewed; Region: tolC; PRK09465
160488015265	RTX toxins and related Ca2+-binding proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG2931
160488015266	Peptidase S8 family domain in Protein convertases; Region: Peptidases_S8_Protein_convertases_Kexins_Furin-lik; cd04059
160488015267	calcium binding site 1 [ion binding]; other site
160488015268	active site
160488015269	catalytic triad [active]
160488015270	calcium binding site 2 [ion binding]; other site
160488015271	calcium binding site 3 [ion binding]; other site
160488015272	Peptidase domain in the S8 and S53 families; Region: Peptidases_S8_S53; cl10459
160488015273	catalytic residues [active]
160488015274	Proprotein convertase P-domain; Region: P_proprotein; pfam01483
160488015275	type I secretion membrane fusion protein, HlyD family; Region: type_I_hlyD; TIGR01843
160488015276	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
160488015277	HlyD family secretion protein; Region: HlyD_3; pfam13437
160488015278	A sub-family of peptidase C39 which contains Cyclolysin and Hemolysin processing peptidases.  Peptidase family C39 mostly contains bacteriocin-processing endopeptidases from bacteria. The cysteine peptidases in family C39 cleave the "double-glycine...; Region: Peptidase_C39_likeA; cd02417
160488015279	type I secretion system ABC transporter, HlyB family; Region: type_I_sec_HlyB; TIGR01846
160488015280	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
160488015281	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488015282	Walker A/P-loop; other site
160488015283	ATP binding site [chemical binding]; other site
160488015284	Q-loop/lid; other site
160488015285	ABC transporter signature motif; other site
160488015286	Walker B; other site
160488015287	D-loop; other site
160488015288	H-loop/switch region; other site
160488015289	3-deoxy-D-manno-octulosonic-acid transferase; Reviewed; Region: PRK05749
160488015290	3-Deoxy-D-manno-octulosonic-acid transferase (kdotransferase); Region: Glycos_transf_N; pfam04413
160488015291	Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. The acceptor molecule can be a lipid, a protein, a heterocyclic compound, or another carbohydrate...; Region: Glycosyltransferase_GTB_type; cl10013
160488015292	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488015293	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488015294	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
160488015295	dimerization interface [polypeptide binding]; other site
160488015296	Membrane transporters of cations and cationic drugs [Inorganic ion transport and metabolism]; Region: EmrE; COG2076
160488015297	Glycerol-3-phosphate dehydrogenase [Energy production and conversion]; Region: GlpA; COG0578
160488015298	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
160488015299	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660
160488015300	Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248
160488015301	active site
160488015302	catalytic tetrad [active]
160488015303	bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase; Provisional; Region: PRK11316
160488015304	RfaE encodes a bifunctional ADP-heptose synthase involved in the biosynthesis of the lipopolysaccharide (LPS) core precursor ADP-L-glycero-D-manno-heptose. LPS plays an important role in maintaining the structural integrity of the bacterial outer...; Region: RfaE_like; cd01172
160488015305	putative ribose interaction site [chemical binding]; other site
160488015306	putative ADP binding site [chemical binding]; other site
160488015307	rfaE bifunctional protein, domain II; Region: rfaE_dom_II; TIGR02199
160488015308	active site
160488015309	nucleotide binding site [chemical binding]; other site
160488015310	HIGH motif; other site
160488015311	KMSKS motif; other site
160488015312	lipid A export permease/ATP-binding protein MsbA; Region: MsbA_lipidA; TIGR02203
160488015313	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
160488015314	ATP-binding cassette domain of the bacterial lipid flippase and related proteins, subfamily C; Region: ABCC_MsbA; cd03251
160488015315	Walker A/P-loop; other site
160488015316	ATP binding site [chemical binding]; other site
160488015317	Q-loop/lid; other site
160488015318	ABC transporter signature motif; other site
160488015319	Walker B; other site
160488015320	D-loop; other site
160488015321	H-loop/switch region; other site
160488015322	Lipid A core - O-antigen ligase and related enzymes [Cell envelope biogenesis, outer membrane]; Region: RfaL; COG3307
160488015323	O-Antigen ligase; Region: Wzy_C; pfam04932
160488015324	Aminoglycoside 3'-phosphotransferase (APH) and Choline Kinase (ChoK) family. The APH/ChoK family is part of a larger superfamily that includes the catalytic domains of other kinases, such as the typical serine/threonine/tyrosine protein kinases (PKs)...; Region: APH_ChoK_like; cd05120
160488015325	active site
160488015326	substrate binding site [chemical binding]; other site
160488015327	ATP binding site [chemical binding]; other site
160488015328	Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438
160488015329	Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. The acceptor molecule can be a lipid, a protein, a heterocyclic compound, or another carbohydrate...; Region: Glycosyltransferase_GTB_type; cl10013
160488015330	Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438
160488015331	Glycosyl transferases group 1; Region: Glyco_trans_1_2; pfam13524
160488015332	GlcNAc-PI de-N-acetylase; Region: PIG-L; pfam02585
160488015333	Mig-14; Region: Mig-14; pfam07395
160488015334	Acetyltransferase (GNAT) domain; Region: Acetyltransf_6; pfam13480
160488015335	This family is most closely related to the GT1 family of glycosyltransferases. WabH in Klebsiella pneumoniae has been shown to transfer a GlcNAc residue from UDP-GlcNAc onto the acceptor GalUA residue in the cellular outer core; Region: GT1_WabH_like; cd03811
160488015336	putative ADP-binding pocket [chemical binding]; other site
160488015337	Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438
160488015338	Predicted carbamoyl transferase, NodU family [Posttranslational modification, protein turnover, chaperones]; Region: COG2192
160488015339	Carbamoyltransferase; Region: CmcH_NodU; pfam02543
160488015340	Protein involved in catabolism of external DNA [General function prediction only]; Region: ComJ; COG2961
160488015341	Na(+)/proline cotransporter PutP and related proteins; solute binding domain; Region: SLC5sbd_PutP; cd11475
160488015342	Na binding site [ion binding]; other site
160488015343	trifunctional transcriptional regulator/proline dehydrogenase/pyrroline-5-carboxylate dehydrogenase; Reviewed; Region: putA; PRK11809
160488015344	Predicted transcriptional regulator [Transcription]; Region: COG3905
160488015345	Proline dehydrogenase [Amino acid transport and metabolism]; Region: PutA; COG0506
160488015346	Delta(1)-pyrroline-5-carboxylate dehydrogenase, PutA; Region: ALDH_PutA-P5CDH; cd07125
160488015347	Glutamate binding site [chemical binding]; other site
160488015348	NAD binding site [chemical binding]; other site
160488015349	catalytic residues [active]
160488015350	NAD(P)+-dependent aldehyde dehydrogenase superfamily; Region: ALDH-SF; cl11961
160488015351	Acyl-CoA dehydrogenase N terminal; Region: AcylCoA_DH_N; pfam12418
160488015352	acyl-CoA dehydrogenase; Provisional; Region: PTZ00456
160488015353	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
160488015354	active site
160488015355	Acetyl-CoA dehydrogenase C-terminal like; Region: Acyl-CoA_dh_C; pfam12806
160488015356	Predicted Zn-dependent proteases and their inactivated homologs [General function prediction only]; Region: TldD; COG0312
160488015357	Predicted Zn-dependent proteases and their inactivated homologs [General function prediction only]; Region: TldD; COG0312
160488015358	putative transporter; Provisional; Region: PRK10504
160488015359	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488015360	putative substrate translocation pore; other site
160488015361	ATP-dependent RNA helicase DbpA; Provisional; Region: PRK11776
160488015362	DEAD-box helicases. A diverse family of proteins involved in ATP-dependent RNA unwinding, needed in a variety of cellular processes including splicing, ribosome biogenesis and RNA degradation. The name derives from the sequence of the Walker  B motif; Region: DEADc; cd00268
160488015363	ATP binding site [chemical binding]; other site
160488015364	Mg++ binding site [ion binding]; other site
160488015365	motif III; other site
160488015366	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
160488015367	nucleotide binding region [chemical binding]; other site
160488015368	ATP-binding site [chemical binding]; other site
160488015369	RNA recognition motif in Escherichia coli RNA helicase dbpA and similar proteins; Region: RRM_EcDbpA_like; cd12501
160488015370	putative RNA binding site [nucleotide binding]; other site
160488015371	HI0933-like protein; Region: HI0933_like; pfam03486
160488015372	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
160488015373	integral membrane protein, YccS/YhfK family; Region: YCCS_YHJK; TIGR01667
160488015374	FUSC-like inner membrane protein yccS; Region: FUSC-like; pfam12805
160488015375	Fusaric acid resistance protein-like; Region: FUSC_2; pfam13515
160488015376	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
160488015377	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488015378	substrate binding pocket [chemical binding]; other site
160488015379	membrane-bound complex binding site; other site
160488015380	hinge residues; other site
160488015381	Predicted acyltransferase [General function prediction only]; Region: ElaA; COG2153
160488015382	Uncharacterized protein conserved in bacteria (DUF2131); Region: DUF2131; pfam09904
160488015383	Predicted metal-dependent hydrolase [General function prediction only]; Region: COG1451
160488015384	Response regulator receiver domain; Region: Response_reg; pfam00072
160488015385	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488015386	active site
160488015387	phosphorylation site [posttranslational modification]
160488015388	intermolecular recognition site; other site
160488015389	dimerization interface [polypeptide binding]; other site
160488015390	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488015391	PAS domain; Region: PAS_9; pfam13426
160488015392	putative active site [active]
160488015393	heme pocket [chemical binding]; other site
160488015394	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
160488015395	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488015396	metal binding site [ion binding]; metal-binding site
160488015397	active site
160488015398	I-site; other site
160488015399	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
160488015400	Tagatose-1,6-bisphosphate (TBP) aldolase and related Type B Class II aldolases. TBP aldolase is a tetrameric class II aldolase that catalyzes the reversible condensation of dihydroxyacetone phosphate with glyceraldehyde 3-phsophate to produce tagatose 1; Region: TBP_aldolase_IIB; cd00947
160488015401	intersubunit interface [polypeptide binding]; other site
160488015402	active site
160488015403	zinc binding site [ion binding]; other site
160488015404	Na+ binding site [ion binding]; other site
160488015405	Membrane-bound lysozyme-inhibitor of c-type lysozyme; Region: MliC; pfam09864
160488015406	phosphoglycerate kinase; Provisional; Region: pgk; PRK00073
160488015407	Phosphoglycerate kinase; Region: PGK; pfam00162
160488015408	substrate binding site [chemical binding]; other site
160488015409	hinge regions; other site
160488015410	ADP binding site [chemical binding]; other site
160488015411	catalytic site [active]
160488015412	erythrose-4-phosphate dehydrogenase; Region: E4PD_g-proteo; TIGR01532
160488015413	Glyceraldehyde 3-phosphate dehydrogenase, NAD binding domain; Region: Gp_dh_N; smart00846
160488015414	Glyceraldehyde 3-phosphate dehydrogenase, C-terminal domain; Region: Gp_dh_C; pfam02800
160488015415	transketolase; Reviewed; Region: PRK12753
160488015416	Thiamine pyrophosphate (TPP) family, Transketolase (TK) subfamily, TPP-binding module; TK catalyzes the transfer of a two-carbon unit from ketose phosphates to aldose phosphates. In heterotrophic organisms, TK provides a link between glycolysis and the...; Region: TPP_TK; cd02012
160488015417	TPP-binding site [chemical binding]; other site
160488015418	dimer interface [polypeptide binding]; other site
160488015419	Pyrimidine (PYR) binding domain of 1-deoxy-D-xylulose-5-phosphate synthase (DXS), transketolase (TK), and related proteins; Region: TPP_PYR_DXS_TK_like; cd07033
160488015420	PYR/PP interface [polypeptide binding]; other site
160488015421	dimer interface [polypeptide binding]; other site
160488015422	TPP binding site [chemical binding]; other site
160488015423	Transketolase, C-terminal domain; Region: Transketolase_C; pfam02780
160488015424	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
160488015425	putative DNA binding site [nucleotide binding]; other site
160488015426	Methyltransferase domain; Region: Methyltransf_23; pfam13489
160488015427	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488015428	S-adenosylmethionine binding site [chemical binding]; other site
160488015429	S-adenosylmethionine synthetase; Validated; Region: PRK05250
160488015430	S-adenosylmethionine synthetase, N-terminal domain; Region: S-AdoMet_synt_N; pfam00438
160488015431	S-adenosylmethionine synthetase, central domain; Region: S-AdoMet_synt_M; pfam02772
160488015432	S-adenosylmethionine synthetase, C-terminal domain; Region: S-AdoMet_synt_C; pfam02773
160488015433	NAD-dependent DNA ligase LigB; Reviewed; Region: ligB; PRK08097
160488015434	NAD+ dependent DNA ligase adenylation domain. DNA ligases catalyze the crucial step of joining the breaks in duplex DNA during DNA replication, repair and recombination, utilizing either ATP or NAD(+) as a cofactor, but using the same basic reaction...; Region: LIGANc; cl03295
160488015435	nucleotide binding pocket [chemical binding]; other site
160488015436	K-X-D-G motif; other site
160488015437	catalytic site [active]
160488015438	NAD-dependent DNA ligase OB-fold domain; Region: DNA_ligase_OB; pfam03120
160488015439	Protein of unknown function (DUF1090); Region: DUF1090; pfam06476
160488015440	Cytochrome C' Region: Cytochrom_C_2; pfam01322
160488015441	Membrane-bound lytic murein transglycosylase [Cell envelope biogenesis, outer membrane]; Region: MltA; COG2821
160488015442	MltA specific insert domain; Region: MltA; pfam03562
160488015443	3D domain; Region: 3D; pfam06725
160488015444	MAPEG family; Region: MAPEG; cl09190
160488015445	phosphonate utilization associated putative membrane protein; Region: phn_DUF6; TIGR03340
160488015446	EamA-like transporter family; Region: EamA; pfam00892
160488015447	NhaP-type Na+/H+ and K+/H+ antiporters [Inorganic ion transport and metabolism]; Region: NhaP; COG0025
160488015448	Kef-type K+ transport systems, membrane components [Inorganic ion transport and metabolism]; Region: KefB; cl10482
160488015449	Brown fat-inducible thioesterase (BFIT).  Brain acyl-CoA hydrolase (BACH).  These enzymes deacylate long-chain fatty acids by hydrolyzing acyl-CoA thioesters to free fatty acids and CoA-SH. Eukaryotic members of this family are expressed in brain, testis; Region: BFIT_BACH; cd03442
160488015450	Methylenetetrahydrofolate reductase (MTHFR). 5,10-Methylenetetrahydrofolate is reduced to 5-methyltetrahydrofolate by methylenetetrahydrofolate reductase, a cytoplasmic, NAD(P)-dependent enzyme. 5-methyltetrahydrofolate is utilized by methionine synthase...; Region: MTHFR; cd00537
160488015451	FAD binding site [chemical binding]; other site
160488015452	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
160488015453	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488015454	substrate binding pocket [chemical binding]; other site
160488015455	membrane-bound complex binding site; other site
160488015456	hinge residues; other site
160488015457	DEAD-box helicases. A diverse family of proteins involved in ATP-dependent RNA unwinding, needed in a variety of cellular processes including splicing, ribosome biogenesis and RNA degradation. The name derives from the sequence of the Walker  B motif; Region: DEADc; cd00268
160488015458	DEAD-like helicases superfamily; Region: DEXDc; smart00487
160488015459	ATP binding site [chemical binding]; other site
160488015460	Mg++ binding site [ion binding]; other site
160488015461	motif III; other site
160488015462	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
160488015463	nucleotide binding region [chemical binding]; other site
160488015464	ATP-binding site [chemical binding]; other site
160488015465	hypothetical protein; Provisional; Region: PRK03757
160488015466	Cytochrome B561 [Energy production and conversion]; Region: CybB; COG3038
160488015467	Monoamine oxidase [Amino acid transport and metabolism]; Region: COG1231
160488015468	adenosylmethionine--8-amino-7-oxononanoate transaminase; Provisional; Region: PRK07030
160488015469	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
160488015470	inhibitor-cofactor binding pocket; inhibition site
160488015471	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488015472	catalytic residue [active]
160488015473	16S ribosomal RNA methyltransferase RsmE; Provisional; Region: PRK11713
160488015474	RNA methyltransferase, RsmE family; Region: TIGR00046
160488015475	Predicted membrane protein, hemolysin III homolog [General function prediction only]; Region: COG1272
160488015476	channel protein, hemolysin III family; Region: hlyIII; TIGR01065
160488015477	CheW-like domain; Region: CheW; pfam01584
160488015478	Histidine Phosphotransfer domain, involved in signalling through a two part component systems in which an autophosphorylating histidine protein kinase serves as a phosphoryl donor to a response regulator protein; the response regulator protein is...; Region: HPT; cd00088
160488015479	putative binding surface; other site
160488015480	active site
160488015481	Histidine Phosphotransfer domain, involved in signalling through a two part component systems in which an autophosphorylating histidine protein kinase serves as a phosphoryl donor to a response regulator protein; the response regulator protein is...; Region: HPT; cd00088
160488015482	putative binding surface; other site
160488015483	active site
160488015484	Hpt domain; Region: Hpt; pfam01627
160488015485	Histidine Phosphotransfer domain, involved in signalling through a two part component systems in which an autophosphorylating histidine protein kinase serves as a phosphoryl donor to a response regulator protein; the response regulator protein is...; Region: HPT; cd00088
160488015486	putative binding surface; other site
160488015487	active site
160488015488	Signal transducing histidine kinase, homodimeric domain; Region: H-kinase_dim; pfam02895
160488015489	Chemotaxis protein histidine kinase and related kinases [Cell motility and secretion / Signal transduction mechanisms]; Region: CheA; COG0643
160488015490	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488015491	ATP binding site [chemical binding]; other site
160488015492	Mg2+ binding site [ion binding]; other site
160488015493	G-X-G motif; other site
160488015494	CheW-like domain. CheW proteins are part of the chemotaxis signalling mechanism in bacteria. CheW interacts with the methyl accepting chemotaxis proteins (MCPs) and relays signals to CheY, which affects flageller rotation. This family includes CheW and...; Region: CheW_like; cl00256
160488015495	Response regulator receiver domain; Region: Response_reg; pfam00072
160488015496	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488015497	active site
160488015498	phosphorylation site [posttranslational modification]
160488015499	intermolecular recognition site; other site
160488015500	dimerization interface [polypeptide binding]; other site
160488015501	Type IV pili methyl-accepting chemotaxis transducer N-term; Region: PilJ; pfam13675
160488015502	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
160488015503	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
160488015504	dimer interface [polypeptide binding]; other site
160488015505	putative CheW interface [polypeptide binding]; other site
160488015506	Chemotaxis signal transduction protein [Cell motility and secretion / Signal transduction mechanisms]; Region: CheW; COG0835
160488015507	Response regulator receiver domain; Region: Response_reg; pfam00072
160488015508	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488015509	active site
160488015510	phosphorylation site [posttranslational modification]
160488015511	intermolecular recognition site; other site
160488015512	dimerization interface [polypeptide binding]; other site
160488015513	Response regulator receiver domain; Region: Response_reg; pfam00072
160488015514	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488015515	active site
160488015516	phosphorylation site [posttranslational modification]
160488015517	intermolecular recognition site; other site
160488015518	dimerization interface [polypeptide binding]; other site
160488015519	glutathione synthetase; Provisional; Region: PRK05246
160488015520	Prokaryotic glutathione synthetase, N-terminal domain; Region: GSH-S_N; pfam02951
160488015521	Prokaryotic glutathione synthetase, ATP-grasp domain; Region: GSH-S_ATP; pfam02955
160488015522	Periplasmic protein TonB, links inner and outer membranes [Cell envelope biogenesis, outer membrane]; Region: TonB; COG0810
160488015523	Gram-negative bacterial tonB protein; Region: TonB; pfam03544
160488015524	hypothetical protein; Validated; Region: PRK00228
160488015525	Holliday junction resolvase-like protein; Reviewed; Region: PRK00109
160488015526	Pyrimidine operon attenuation protein/uracil phosphoribosyltransferase [Nucleotide transport and metabolism]; Region: PyrR; COG2065
160488015527	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
160488015528	active site
160488015529	aspartate carbamoyltransferase catalytic subunit; Provisional; Region: pyrB; PRK00856
160488015530	Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding domain; Region: OTCace_N; pfam02729
160488015531	Aspartate/ornithine carbamoyltransferase, Asp/Orn binding domain; Region: OTCace; pfam00185
160488015532	dihydroorotase; Validated; Region: pyrC; PRK09357
160488015533	Dihydroorotase (DHOase), subgroup IIa; DHOases catalyze the reversible interconversion of carbamoyl aspartate to dihydroorotate, a key reaction in pyrimidine biosynthesis. This subgroup also contains proteins that lack the active site, like unc-33, a C; Region: DHOase_IIa; cd01317
160488015534	active site
160488015535	Protease HslV and the ATPase/chaperone HslU are part of an ATP-dependent proteolytic system that is the prokaryotic homolog of the proteasome. HslV is a dimer of hexamers (a dodecamer) that forms a central proteolytic chamber with active sites on the...; Region: protease_HslV; cd01913
160488015536	active site
160488015537	HslU subunit interaction site [polypeptide binding]; other site
160488015538	ATP-dependent protease ATP-binding subunit HslU; Provisional; Region: hslU; PRK05201
160488015539	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488015540	Walker A motif; other site
160488015541	ATP binding site [chemical binding]; other site
160488015542	AAA domain (Cdc48 subfamily); Region: AAA_2; pfam07724
160488015543	C-terminal, D2-small domain, of ClpB protein; Region: ClpB_D2-small; cl11083
160488015544	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3536
160488015545	poly(R)-hydroxyalkanoic acid synthase, class II; Region: PHA_synth_II; TIGR01839
160488015546	Poly-beta-hydroxybutyrate polymerase (PhaC) N-terminus; Region: PhaC_N; pfam07167
160488015547	poly(3-hydroxyalkanoate) depolymerase; Region: PHA_depoly_arom; TIGR02240
160488015548	homoserine O-acetyltransferase; Provisional; Region: metX; cl17114
160488015549	poly(R)-hydroxyalkanoic acid synthase, class II; Region: PHA_synth_II; TIGR01839
160488015550	Poly-beta-hydroxybutyrate polymerase (PhaC) N-terminus; Region: PhaC_N; pfam07167
160488015551	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
160488015552	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
160488015553	Bacterial transcriptional repressor; Region: TetR; pfam13972
160488015554	Poly(hydroxyalcanoate) granule associated protein (phasin); Region: Phasin; pfam05597
160488015555	Poly(hydroxyalcanoate) granule associated protein (phasin); Region: Phasin; pfam05597
160488015556	putative polyhydroxyalkanoic acid system protein; Region: PHA_gran_rgn; TIGR02610
160488015557	Methylase involved in ubiquinone/menaquinone biosynthesis [Coenzyme metabolism]; Region: UbiE; COG2226
160488015558	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488015559	S-adenosylmethionine binding site [chemical binding]; other site
160488015560	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3165
160488015561	SCP-2 sterol transfer family; Region: SCP2; pfam02036
160488015562	phosphoribosyl-AMP cyclohydrolase; Reviewed; Region: hisI; PRK00051
160488015563	Nucleoside Triphosphate Pyrophosphohydrolase (EC 3.6.1.8) MazG-like domain found in Escherichia coli phosphoribosyl-ATP pyrophosphohydrolase (HisIE or PRATP-PH) and its homologs; Region: NTP-PPase_HisIE_like; cd11534
160488015564	metal binding site [ion binding]; metal-binding site
160488015565	twin arginine translocase protein A; Provisional; Region: tatA; PRK00442
160488015566	mttA/Hcf106 family; Region: MttA_Hcf106; cl00788
160488015567	sec-independent translocase; Provisional; Region: tatB; PRK00404
160488015568	twin arginine-targeting protein translocase TatB; Region: tatB; TIGR01410
160488015569	Sec-independent protein translocase protein (TatC); Region: TatC; cl00521
160488015570	16S ribosomal RNA methyltransferase RsmE; Provisional; Region: PRK11713
160488015571	RNA methyltransferase, RsmE family; Region: TIGR00046
160488015572	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
160488015573	dimerization interface [polypeptide binding]; other site
160488015574	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
160488015575	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
160488015576	dimer interface [polypeptide binding]; other site
160488015577	putative CheW interface [polypeptide binding]; other site
160488015578	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
160488015579	dimerization interface [polypeptide binding]; other site
160488015580	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
160488015581	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
160488015582	dimer interface [polypeptide binding]; other site
160488015583	putative CheW interface [polypeptide binding]; other site
160488015584	ABC-type polar amino acid transport system, ATPase component [Amino acid transport and metabolism]; Region: GlnQ; COG1126
160488015585	ATP-binding cassette domain of the histidine and glutamine transporters; Region: ABC_HisP_GlnQ; cd03262
160488015586	Walker A/P-loop; other site
160488015587	ATP binding site [chemical binding]; other site
160488015588	Q-loop/lid; other site
160488015589	ABC transporter signature motif; other site
160488015590	Walker B; other site
160488015591	D-loop; other site
160488015592	H-loop/switch region; other site
160488015593	ABC-type arginine transport system, permease component [Amino acid transport and metabolism]; Region: ArtQ; COG4215
160488015594	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488015595	dimer interface [polypeptide binding]; other site
160488015596	conserved gate region; other site
160488015597	putative PBP binding loops; other site
160488015598	ABC-ATPase subunit interface; other site
160488015599	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
160488015600	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488015601	substrate binding pocket [chemical binding]; other site
160488015602	membrane-bound complex binding site; other site
160488015603	hinge residues; other site
160488015604	Glycosyltransferase like family 2; Region: Glyco_tranf_2_3; pfam13641
160488015605	Glucan_BSP_ModH catalyzes the elongation of beta-1,2 polyglucose chains of glucan; Region: Glucan_BSP_ModH; cd04191
160488015606	Ligand binding site; other site
160488015607	DXD motif; other site
160488015608	glucan biosynthesis protein G; Provisional; Region: mdoG; PRK13274
160488015609	Periplasmic glucan biosynthesis protein, MdoG; Region: MdoG; cl15433
160488015610	D-Tyrosyl-tRNAtyr deacylases; a class of tRNA-dependent hydrolases which are capable of hydrolyzing the ester bond of D-Tyrosyl-tRNA reducing the level of cellular D-Tyrosine while recycling the peptidyl-tRNA; found in bacteria and in eukaryotes but not...; Region: Dtyr_deacylase; cd00563
160488015611	putative active site [active]
160488015612	dimerization interface [polypeptide binding]; other site
160488015613	putative tRNAtyr binding site [nucleotide binding]; other site
160488015614	proline iminopeptidase, Neisseria-type subfamily; Region: pro_imino_pep_1; TIGR01249
160488015615	TAP-like protein; Region: Abhydrolase_4; pfam08386
160488015616	N-formylglutamate amidohydrolase; Region: hutG_amidohyd; TIGR02017
160488015617	imidazolonepropionase; Validated; Region: PRK09356
160488015618	Imidazolonepropionase/imidazolone-5-propionate hydrolase (Imidazolone-5PH) catalyzes the third step in the histidine degradation pathway, the hydrolysis of (S)-3-(5-oxo-4,5-dihydro-3H-imidazol-4-yl)propanoate to N-formimidoyl-L-glutamate. In bacteria; Region: Imidazolone-5PH; cd01296
160488015619	active site
160488015620	putative proline-specific permease; Provisional; Region: proY; PRK10580
160488015621	Spore germination protein; Region: Spore_permease; cl17796
160488015622	Phenylalanine ammonia-lyase (PAL) and histidine ammonia-lyase (HAL); Region: PAL-HAL; cd00332
160488015623	active sites [active]
160488015624	tetramer interface [polypeptide binding]; other site
160488015625	urocanate hydratase; Provisional; Region: PRK05414
160488015626	HutD; Region: HutD; pfam05962
160488015627	histidine utilization repressor, proteobacterial; Region: his_ut_repres; TIGR02018
160488015628	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488015629	DNA-binding site [nucleotide binding]; DNA binding site
160488015630	UTRA domain; Region: UTRA; pfam07702
160488015631	N-formimino-L-glutamate deiminase; Validated; Region: PRK09229
160488015632	Metallo-dependent hydrolases, subgroup D is part of the superfamily of metallo-dependent hydrolases, a large group of proteins that show conservation in their 3-dimensional fold (TIM barrel) and in details of their active site. The vast majority of the...; Region: Met_dep_hydrolase_E; cd01313
160488015633	active site
160488015634	Bacterial lipocalin [Cell envelope biogenesis, outer membrane]; Region: Blc; COG3040
160488015635	Lipocalin-like domain; Region: Lipocalin_2; pfam08212
160488015636	SmpA / OmlA family; Region: SmpA_OmlA; cl17115
160488015637	Bacterial protein of unknown function (DUF924); Region: DUF924; pfam06041
160488015638	fructose-1,6-bisphosphatase family protein; Region: PLN02628
160488015639	Fructose-1,6-bisphosphatase, an enzyme that catalyzes the hydrolysis of fructose-1,6-biphosphate  into fructose-6-phosphate and is critical in gluconeogenesis pathway. The alignment model also includes chloroplastic FBPases and sedoheptulose-1; Region: FBPase; cd00354
160488015640	AMP binding site [chemical binding]; other site
160488015641	metal binding site [ion binding]; metal-binding site
160488015642	active site
160488015643	This is a family of oligosaccharide phosphorylases. It includes yeast and mammalian glycogen phosphorylases, plant starch/glucan phosphorylase, as well as the maltodextrin phosphorylases of bacteria. The members of this family catalyze the breakdown of...; Region: GT1_Glycogen_Phosphorylase; cd04300
160488015644	homodimer interface [polypeptide binding]; other site
160488015645	glycogen/starch/alpha-glucan phosphorylases; Region: P_ylase; TIGR02093
160488015646	active site pocket [active]
160488015647	Predicted Fe-S-cluster oxidoreductase [General function prediction only]; Region: COG0727
160488015648	PhoPQ-activated pathogenicity-related protein; Region: PhoPQ_related; pfam10142
160488015649	Alpha/beta hydrolase family; Region: Abhydrolase_5; pfam12695
160488015650	Predicted membrane GTPase involved in stress response [Signal transduction mechanisms]; Region: TypA; COG1217
160488015651	Tyrosine phosphorylated protein A (TypA)/BipA family belongs to ribosome-binding GTPases; Region: TypA_BipA; cd01891
160488015652	G1 box; other site
160488015653	putative GEF interaction site [polypeptide binding]; other site
160488015654	GTP/Mg2+ binding site [chemical binding]; other site
160488015655	Switch I region; other site
160488015656	G2 box; other site
160488015657	G3 box; other site
160488015658	Switch II region; other site
160488015659	G4 box; other site
160488015660	G5 box; other site
160488015661	BipA_TypA_II: domain II of BipA (also called TypA) having homology to domain II of the elongation factors (EFs) EF-G and EF-Tu.  BipA is a highly conserved protein with global regulatory properties in Escherichia coli. BipA is phosphorylated on a...; Region: BipA_TypA_II; cd03691
160488015662	BipA_TypA_C: a C-terminal portion of BipA or TypA having homology to the C terminal domains of the elongation factors EF-G and EF-2. A member of the ribosome binding GTPase superfamily, BipA is widely distributed in bacteria and plants.  BipA is a highly...; Region: BipA_TypA_C; cd03710
160488015663	tRNA s(4)U8 sulfurtransferase; Provisional; Region: PRK01269
160488015664	THUMP domain of thiamine biosynthesis protein ThiI; Region: THUMP_ThiI; cd11716
160488015665	ThiI is required for thiazole synthesis in the thiamine biosynthesis pathway. It belongs to the Adenosine Nucleotide Hydrolysis suoerfamily and predicted to bind to Adenosine nucleotide; Region: ThiI; cd01712
160488015666	Ligand Binding Site [chemical binding]; other site
160488015667	thiazole biosynthesis domain; Region: ThiI_C_thiazole; TIGR04271
160488015668	glutamine synthetase; Provisional; Region: glnA; PRK09469
160488015669	Glutamine synthetase, beta-Grasp domain; Region: Gln-synt_N; pfam03951
160488015670	Glutamine synthetase, catalytic domain; Region: Gln-synt_C; pfam00120
160488015671	Signal transduction histidine kinase, nitrogen specific [Signal transduction mechanisms]; Region: NtrB; COG3852
160488015672	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488015673	dimer interface [polypeptide binding]; other site
160488015674	phosphorylation site [posttranslational modification]
160488015675	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488015676	ATP binding site [chemical binding]; other site
160488015677	Mg2+ binding site [ion binding]; other site
160488015678	G-X-G motif; other site
160488015679	nitrogen regulation protein NR(I); Region: ntrC; TIGR01818
160488015680	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488015681	active site
160488015682	phosphorylation site [posttranslational modification]
160488015683	intermolecular recognition site; other site
160488015684	dimerization interface [polypeptide binding]; other site
160488015685	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488015686	Walker A motif; other site
160488015687	ATP binding site [chemical binding]; other site
160488015688	Walker B motif; other site
160488015689	arginine finger; other site
160488015690	Bacterial regulatory protein, Fis family; Region: HTH_8; pfam02954
160488015691	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3547
160488015692	Transposase; Region: DEDD_Tnp_IS110; pfam01548
160488015693	Transposase IS116/IS110/IS902 family; Region: Transposase_20; pfam02371
160488015694	Predicted rRNA methylase (SpoU class) [Translation, ribosomal structure and biogenesis]; Region: CspR; COG0219
160488015695	Preprotein translocase subunit SecB. SecB is a cytoplasmic component of the multisubunit membrane-bound enzyme termed Sec protein translocase, which is the main constituent of the General Secretory (type II) Pathway involved in translocation of nascent...; Region: Translocase_SecB; cd00557
160488015696	SecA binding site; other site
160488015697	Preprotein binding site; other site
160488015698	Glutaredoxin (GRX) family, GRX bacterial class 1 and 3 (b_1_3)-like subfamily; composed of bacterial GRXs, approximately 10 kDa in size, and proteins containing a GRX or GRX-like domain. GRX is a glutathione (GSH) dependent reductase, catalyzing the...; Region: GRX_GRXb_1_3_like; cd03418
160488015699	GSH binding site [chemical binding]; other site
160488015700	catalytic residues [active]
160488015701	Rhodanese Homology Domain (RHOD); an alpha beta fold domain found duplicated in the rhodanese protein. The cysteine containing enzymatically active version of the domain is also found in the Cdc25 class of protein phosphatases and a variety of proteins...; Region: RHOD; cd00158
160488015702	active site residue [active]
160488015703	phosphoglyceromutase; Provisional; Region: PRK05434
160488015704	2,3-bisphosphoglycerate-independent phosphoglycerate mutase; Region: pgm_bpd_ind; TIGR01307
160488015705	Membrane-bound metallopeptidase [Cell division and chromosome partitioning]; Region: COG4942
160488015706	Peptidase family M23; Region: Peptidase_M23; pfam01551
160488015707	C-terminal processing peptidase family S41; Region: Peptidase_S41; cl02526
160488015708	C-terminal peptidase (prc); Region: prc; TIGR00225
160488015709	PDZ domain of C-terminal processing-, tail-specific-, and tricorn proteases, which function in posttranslational protein processing, maturation, and disassembly or degradation, in Bacteria, Archaea, and plant chloroplasts. May be responsible for...; Region: PDZ_CTP_protease; cd00988
160488015710	protein binding site [polypeptide binding]; other site
160488015711	C-terminal processing peptidase; serine protease family S41; Region: Peptidase_S41_CPP; cd07560
160488015712	Catalytic dyad [active]
160488015713	Putative catalytic domain of family 2 polysaccharide deacetylases (DACs) from bacteria; Region: CE4_DAC2; cd10936
160488015714	NodB motif; other site
160488015715	putative active site [active]
160488015716	putative catalytic site [active]
160488015717	Zn binding site [ion binding]; other site
160488015718	BCCT family transporter; Region: BCCT; cl00569
160488015719	betaine aldehyde dehydrogenase; Provisional; Region: PRK13252
160488015720	NAD(P)+-dependent aldehyde dehydrogenase superfamily; Region: ALDH-SF; cl11961
160488015721	NAD(P) binding site [chemical binding]; other site
160488015722	catalytic residues [active]
160488015723	choline dehydrogenase; Validated; Region: PRK02106
160488015724	ubiquinone biosynthesis hydroxylase family protein; Provisional; Region: PRK07608; cl17314
160488015725	GMC oxidoreductase; Region: GMC_oxred_C; pfam05199
160488015726	potassium/proton antiporter; Reviewed; Region: PRK05326
160488015727	Kef-type K+ transport systems, membrane components [Inorganic ion transport and metabolism]; Region: KefB; cl10482
160488015728	TrkA-C domain; Region: TrkA_C; pfam02080
160488015729	Transporter associated domain; Region: CorC_HlyC; smart01091
160488015730	hypothetical protein; Provisional; Region: PRK11281
160488015731	Mechanosensitive ion channel inner membrane domain 1; Region: MscS_TM; pfam12794
160488015732	Mechanosensitive ion channel; Region: MS_channel; pfam00924
160488015733	hypothetical protein; Validated; Region: PRK00029
160488015734	Uncharacterized conserved protein [Function unknown]; Region: COG0397
160488015735	thioredoxin 2; Provisional; Region: PRK10996
160488015736	TRX family; composed of two groups: Group I, which includes proteins that exclusively encode a TRX domain; and Group II, which are composed of fusion proteins of TRX and additional domains. Group I TRX is a small ancient protein that alter the redox...; Region: TRX_family; cd02947
160488015737	catalytic residues [active]
160488015738	ATPases involved in chromosome partitioning [Cell division and chromosome partitioning]; Region: Soj; COG1192
160488015739	ParA and ParB of Caulobacter crescentus belong to a conserved family of bacterial proteins implicated in chromosome segregation. ParB binds to DNA sequences adjacent to the origin of replication and localizes to opposite cell poles shortly following the...; Region: ParA; cd02042
160488015740	P-loop; other site
160488015741	Magnesium ion binding site [ion binding]; other site
160488015742	ParA and ParB of Caulobacter crescentus belong to a conserved family of bacterial proteins implicated in chromosome segregation. ParB binds to DNA sequences adjacent to the origin of replication and localizes to opposite cell poles shortly following the...; Region: ParA; cd02042
160488015743	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488015744	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488015745	The C-terminal substrate binding domain of LysR-type transcriptional regulators involved in the catabolism of aromatic compounds and that of other related regulators, contains type 2 periplasmic binding fold; Region: PBP2_LTTR_aromatics_like; cd08414
160488015746	dimerization interface [polypeptide binding]; other site
160488015747	substrate binding pocket [chemical binding]; other site
160488015748	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488015749	Major Facilitator Superfamily; Region: MFS_1; pfam07690
160488015750	putative substrate translocation pore; other site
160488015751	Bacterial OB fold (BOF) protein; Region: BOF; cl01196
160488015752	methylcobalamin:coenzyme M methyltransferase; Validated; Region: PRK06252
160488015753	Uroporphyrinogen decarboxylase (URO-D) is a dimeric cytosolic enzyme that decarboxylates the four acetate side chains of uroporphyrinogen III (uro-III) to create coproporphyrinogen III, without requiring any prosthetic groups or cofactors. This reaction...; Region: URO-D; cd00717
160488015754	substrate binding site [chemical binding]; other site
160488015755	active site
160488015756	glutamate synthase small subunit family protein, proteobacterial; Region: gltD_gamma_fam; TIGR01318
160488015757	The HCP family of iron-sulfur proteins includes hybrid cluster protein (HCP), acetyl-CoA synthase (ACS), and carbon monoxide dehydrogenase (CODH), all of which contain [Fe4-S4] metal clusters at their active sites. These proteins have a conserved...; Region: HCP_like; cl14655
160488015758	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
160488015759	glutamate synthase subunit alpha; Provisional; Region: gltB; PRK11750
160488015760	Glutamine amidotransferases class-II (Gn-AT), glutamate synthase (GltS)-type. GltS is a homodimer that synthesizes L-glutamate from 2-oxoglutarate and L-glutamine, an important step in ammonia assimilation in bacteria, cyanobacteria and plants. The...; Region: GltS; cd00713
160488015761	active site
160488015762	dimer interface [polypeptide binding]; other site
160488015763	Glutamate synthase central domain; Region: Glu_syn_central; pfam04898
160488015764	Glutamate synthase (GltS) FMN-binding domain.  GltS is a complex iron-sulfur flavoprotein that catalyzes the reductive synthesis of L-glutamate from 2-oxoglutarate and L-glutamine via intramolecular channelling of ammonia, a reaction in the plant, yeast...; Region: GltS_FMN; cd02808
160488015765	active site
160488015766	FMN binding site [chemical binding]; other site
160488015767	substrate binding site [chemical binding]; other site
160488015768	3Fe-4S cluster binding site [ion binding]; other site
160488015769	gltb_C. This domain is found at the C-terminus of the large subunit (gltB) of glutamate synthase (GltS). GltS encodes a complex iron-sulfur flavoprotein that catalyzes the synthesis of L-glutamate from L-glutamine and 2-oxoglutarate. It requires the...; Region: gltB_C; cd00982
160488015770	domain interface; other site
160488015771	Type II secretory pathway, component ExeA (predicted ATPase) [Intracellular trafficking and secretion]; Region: ExeA; COG3267
160488015772	Sporulation related domain; Region: SPOR; pfam05036
160488015773	Dehydroquinate synthase (DHQS) catalyzes the conversion of DAHP to DHQ in shikimate pathway for aromatic compounds synthesis; Region: DHQS; cd08195
160488015774	active site
160488015775	dimer interface [polypeptide binding]; other site
160488015776	metal binding site [ion binding]; metal-binding site
160488015777	shikimate kinase; Reviewed; Region: aroK; PRK00131
160488015778	Shikimate kinase (SK) is the fifth enzyme in the shikimate pathway, a seven-step biosynthetic pathway which converts erythrose-4-phosphate to chorismic acid, found in bacteria, fungi and plants. Chorismic acid is a important intermediate in the synthesis...; Region: SK; cd00464
160488015779	ADP binding site [chemical binding]; other site
160488015780	magnesium binding site [ion binding]; other site
160488015781	putative shikimate binding site; other site
160488015782	type IV pilus secretin (or competence protein) PilQ; Region: IV_pilus_PilQ; TIGR02515
160488015783	Secretin and TonB N terminus short domain; Region: STN; smart00965
160488015784	Bacterial type II/III secretion system short domain; Region: Secretin_N; pfam03958
160488015785	Bacterial type II and III secretion system protein; Region: Secretin; pfam00263
160488015786	Pilus assembly protein, PilO; Region: PilO; cl01234
160488015787	Pilus assembly protein, PilP; Region: PilP; pfam04351
160488015788	Tfp pilus assembly protein PilN [Cell motility and secretion / Intracellular trafficking and secretion]; Region: PilN; COG3166
160488015789	Fimbrial assembly protein (PilN); Region: PilN; pfam05137
160488015790	Competence protein A; Region: Competence_A; pfam11104
160488015791	Membrane carboxypeptidase/penicillin-binding protein [Cell envelope biogenesis, outer membrane]; Region: MrcA; COG5009
160488015792	Transglycosylase; Region: Transgly; pfam00912
160488015793	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; cl17760
160488015794	Malic enzyme [Energy production and conversion]; Region: SfcA; COG0281
160488015795	Malic enzyme, N-terminal domain; Region: malic; pfam00390
160488015796	NAD(P) binding domain of malic enzyme (ME), subgroup 2; Region: NAD_bind_2_malic_enz; cd05311
160488015797	putative NAD(P) binding site [chemical binding]; other site
160488015798	Staphylococcal nuclease homologues; Region: SNc; smart00318
160488015799	Staphylococcal nuclease homologues. SNase homologues are found in bacteria, archaea, and eukaryotes. They contain no disufide bonds; Region: SNc; cl00140
160488015800	Catalytic site; other site
160488015801	50S ribosomal protein L31; Reviewed; Region: rpmE; PRK00019
160488015802	primosome assembly protein PriA; Validated; Region: PRK05580
160488015803	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
160488015804	ATP binding site [chemical binding]; other site
160488015805	putative Mg++ binding site [ion binding]; other site
160488015806	helicase superfamily c-terminal domain; Region: HELICc; smart00490
160488015807	ATP-binding site [chemical binding]; other site
160488015808	Arginyl-tRNA synthetase [Translation, ribosomal structure and biogenesis]; Region: ArgS; COG0018
160488015809	Arginyl tRNA synthetase N terminal dom; Region: Arg_tRNA_synt_N; smart01016
160488015810	catalytic core domain of arginyl-tRNA synthetases; Region: ArgRS_core; cd00671
160488015811	active site
160488015812	HIGH motif; other site
160488015813	KMSK motif region; other site
160488015814	Anticodon-binding domain of class Ia aminoacyl tRNA synthetases and similar domains; Region: Anticodon_Ia_like; cl12020
160488015815	tRNA binding surface [nucleotide binding]; other site
160488015816	anticodon binding site; other site
160488015817	Cell division protein [Cell division and chromosome partitioning]; Region: FtsN; COG3087
160488015818	Sporulation related domain; Region: SPOR; pfam05036
160488015819	Predicted membrane protein [Function unknown]; Region: XynA; COG2314
160488015820	TM2 domain; Region: TM2; cl00984
160488015821	Cell wall-associated hydrolases (invasion-associated proteins) [Cell envelope biogenesis, outer membrane]; Region: Spr; COG0791
160488015822	NlpC/P60 family; Region: NLPC_P60; pfam00877
160488015823	pilus retraction protein PilT; Region: pilT_fam; TIGR01420
160488015824	RecA-like NTPases. This family includes the NTP binding domain of F1 and V1 H+ATPases, DnaB and related helicases as well as bacterial RecA and related eukaryotic and archaeal recombinases. This group also includes bacterial conjugation proteins and...; Region: RecA-like_NTPases; cl17233
160488015825	Walker A motif; other site
160488015826	ATP binding site [chemical binding]; other site
160488015827	Walker B motif; other site
160488015828	Pyridoxal 5-phosphate (PLP)-binding TIM barrel domain of Type III PLP-Dependent Enzymes, Yggs-like proteins; Region: PLPDE_III_Yggs_like; cd06824
160488015829	pyridoxal 5'-phosphate (PLP) binding site [chemical binding]; other site
160488015830	catalytic residue [active]
160488015831	pyrroline-5-carboxylate reductase; Reviewed; Region: PRK11880
160488015832	pyrroline-5-carboxylate reductase; Region: PLN02688
160488015833	YGGT family; Region: YGGT; pfam02325
160488015834	YGGT family; Region: YGGT; pfam02325
160488015835	homoserine O-acetyltransferase; Provisional; Region: metX; PRK00175
160488015836	homoserine O-acetyltransferase; Region: homoserO_Ac_trn; TIGR01392
160488015837	hypothetical protein; Provisional; Region: PRK08317
160488015838	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488015839	S-adenosylmethionine binding site [chemical binding]; other site
160488015840	Domain of unknown function (DUF4426); Region: DUF4426; pfam14467
160488015841	NTPase/HAM1.  This family consists of the HAM1 protein and pyrophosphate-releasing xanthosine/ inosine triphosphatase. HAM1 protects the cell against mutagenesis by the base analog 6-N-hydroxylaminopurine (HAP) in E. Coli and S. cerevisiae. A...; Region: HAM1; cd00515
160488015842	active site
160488015843	dimerization interface [polypeptide binding]; other site
160488015844	HemN family oxidoreductase; Provisional; Region: PRK05660
160488015845	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
160488015846	FeS/SAM binding site; other site
160488015847	HemN C-terminal domain; Region: HemN_C; pfam06969
160488015848	Protein of unknown function (DUF3392); Region: DUF3392; pfam11872
160488015849	Methyltransferase domain; Region: Methyltransf_31; pfam13847
160488015850	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488015851	S-adenosylmethionine binding site [chemical binding]; other site
160488015852	Thiazole synthase (ThiG) is the tetrameric enzyme that is involved in the formation of the thiazole moiety of thiamin pyrophosphate, an essential ubiquitous cofactor that plays an important role in carbohydrate and amino acid metabolism. ThiG catalyzes...; Region: ThiG; cd04728
160488015853	ThiS interaction site; other site
160488015854	putative active site [active]
160488015855	tetramer interface [polypeptide binding]; other site
160488015856	ThiaminS ubiquitin-like sulfur carrier protein; Region: ThiS; cd00565
160488015857	thiS-thiF/thiG interaction site; other site
160488015858	Uncharacterized small membrane protein [Function unknown]; Region: COG2363
160488015859	monofunctional biosynthetic peptidoglycan transglycosylase; Provisional; Region: mtgA; PRK00056
160488015860	Transglycosylase; Region: Transgly; cl17702
160488015861	RNA polymerase factor sigma-32; Reviewed; Region: PRK06596
160488015862	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
160488015863	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
160488015864	DNA binding residues [nucleotide binding]
160488015865	cell division ABC transporter subunit FtsX; Provisional; Region: ftsX; PRK11026
160488015866	Cell division protein [Cell division and chromosome partitioning]; Region: FtsX; COG2177
160488015867	Predicted ATPase involved in cell division [Cell division and chromosome partitioning]; Region: FtsE; COG2884
160488015868	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488015869	Walker A/P-loop; other site
160488015870	ATP binding site [chemical binding]; other site
160488015871	Q-loop/lid; other site
160488015872	ABC transporter signature motif; other site
160488015873	Walker B; other site
160488015874	D-loop; other site
160488015875	H-loop/switch region; other site
160488015876	signal recognition particle-docking protein FtsY; Provisional; Region: PRK10416
160488015877	SRP54-type protein, helical bundle domain; Region: SRP54_N; pfam02881
160488015878	The signal recognition particle (SRP) mediates the transport to or across the plasma membrane in bacteria and the endoplasmic reticulum in eukaryotes. SRP recognizes N-terminal sighnal sequences of newly synthesized polypeptides at the ribosome. The...; Region: SRP; cd03115
160488015879	P loop; other site
160488015880	GTP binding site [chemical binding]; other site
160488015881	Predicted Zn-dependent peptidases [General function prediction only]; Region: PqqL; COG0612
160488015882	Insulinase (Peptidase family M16); Region: Peptidase_M16; pfam00675
160488015883	Peptidase M16 inactive domain; Region: Peptidase_M16_C; pfam05193
160488015884	Predicted Zn-dependent peptidases [General function prediction only]; Region: PqqL; COG0612
160488015885	Peptidase M16 inactive domain; Region: Peptidase_M16_C; pfam05193
160488015886	N6-adenine-specific methylase [DNA replication, recombination, and repair]; Region: COG0742
160488015887	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488015888	S-adenosylmethionine binding site [chemical binding]; other site
160488015889	Predicted Zn-dependent peptidases [General function prediction only]; Region: PqqL; COG0612
160488015890	Insulinase (Peptidase family M16); Region: Peptidase_M16; pfam00675
160488015891	Peptidase M16 inactive domain; Region: Peptidase_M16_C; pfam05193
160488015892	Predicted Zn-dependent peptidases [General function prediction only]; Region: PqqL; COG0612
160488015893	Peptidase M16 inactive domain; Region: Peptidase_M16_C; pfam05193
160488015894	Predicted hydrolase of the alpha/beta-hydrolase fold [General function prediction only]; Region: COG0429
160488015895	Lipase.  Lipases are esterases that can hydrolyze long-chain acyl-triglycerides into di- and monoglycerides, glycerol, and free fatty acids at a water/lipid interface. A typical feature of lipases is "interfacial activation", the process of...; Region: Lipase; cl14883
160488015896	nucleophilic elbow; other site
160488015897	catalytic triad; other site
160488015898	Rhodanese-related sulfurtransferase [Inorganic ion transport and metabolism]; Region: SseA; COG2897
160488015899	Thiosulfate sulfurtransferase (TST), N-terminal, inactive domain. TST contains 2 copies of the Rhodanese Homology Domain; this is the 1st repeat, which does not contain the catalytically active Cys residue. The role of the 1st repeat is uncertain, but it...; Region: TST_Repeat_1; cd01448
160488015900	active site residue [active]
160488015901	Thiosulfate sulfurtransferase (TST), C-terminal, catalytic domain. TST contains 2 copies of the Rhodanese Homology Domain; this is the second repeat. Only the second repeat contains the catalytically active Cys residue; Region: TST_Repeat_2; cd01449
160488015902	active site residue [active]
160488015903	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
160488015904	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
160488015905	Bacterial transcriptional repressor; Region: TetR; pfam13972
160488015906	aldehyde dehydrogenase family protein; Provisional; Region: PTZ00381
160488015907	Coniferyl aldehyde dehydrogenase-like; Region: ALDH_CALDH_CalB; cd07133
160488015908	NAD(P) binding site [chemical binding]; other site
160488015909	catalytic residues [active]
160488015910	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
160488015911	GMC oxidoreductase; Region: GMC_oxred_N; pfam00732
160488015912	GMC oxidoreductase; Region: GMC_oxred_C; pfam05199
160488015913	phosphopantetheine adenylyltransferase; Provisional; Region: coaD; PRK00168
160488015914	Phosphopantetheine adenylyltransferase; Region: PPAT; cd02163
160488015915	active site
160488015916	(T/H)XGH motif; other site
160488015917	4Fe-4S dicluster domain; Region: Fer4_7; pfam12838
160488015918	formamidopyrimidine/5-formyluracil/ 5-hydroxymethyluracil DNA glycosylase; Validated; Region: PRK01103
160488015919	N-terminal domain of Escherichia coli Fpg1/MutM and related bacterial DNA glycosylases; Region: EcFpg-like_N; cd08966
160488015920	DNA binding site [nucleotide binding]
160488015921	catalytic residue [active]
160488015922	H2TH interface [polypeptide binding]; other site
160488015923	putative catalytic residues [active]
160488015924	turnover-facilitating residue; other site
160488015925	intercalation triad [nucleotide binding]; other site
160488015926	8OG recognition residue [nucleotide binding]; other site
160488015927	putative reading head residues; other site
160488015928	Formamidopyrimidine-DNA glycosylase H2TH domain; Region: H2TH; pfam06831
160488015929	Zinc finger found in FPG and IleRS; Region: zf-FPG_IleRS; pfam06827
160488015930	HDOD domain; Region: HDOD; pfam08668
160488015931	Predicted SAM-dependent methyltransferases [General function prediction only]; Region: COG1092
160488015932	Middle domain of the SAM-dependent methyltransferase RlmI and related proteins; Region: RlmI_M_like; cd11572
160488015933	putative RNA binding site [nucleotide binding]; other site
160488015934	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488015935	S-adenosylmethionine binding site [chemical binding]; other site
160488015936	dihydroxy-acid dehydratase; Provisional; Region: PRK12448
160488015937	Macro domain, Poa1p_like family. The macro domain is a high-affinity ADP-ribose binding module found in a variety of proteins as a stand-alone domain or in combination with other domains like in histone macroH2A and some PARPs (poly ADP-ribose...; Region: Macro_Poa1p_like; cd02901
160488015938	ADP-ribose binding site [chemical binding]; other site
160488015939	haloacid dehalogenase-like hydrolase; Region: HAD; cl17202
160488015940	Predicted Na+/dicarboxylate symporter [General function prediction only]; Region: COG1823
160488015941	Na+/H+-dicarboxylate symporters [Energy production and conversion]; Region: GltP; COG1301
160488015942	Dihydrofolate reductase (DHFR). Reduces 7,8-dihydrofolate to 5,6,7,8-tetrahydrofolate with NADPH as a cofactor. This is an essential step in the biosynthesis of deoxythymidine phosphate since 5,6,7,8-tetrahydrofolate is required to regenerate 5; Region: DHFR; cd00209
160488015943	Dihydrofolate reductase [Coenzyme metabolism]; Region: FolA; COG0262
160488015944	folate binding site [chemical binding]; other site
160488015945	NADP+ binding site [chemical binding]; other site
160488015946	Protein of unknown function (DUF2868); Region: DUF2868; pfam11067
160488015947	Rat sarcoma (Ras)-like superfamily of small guanosine triphosphatases (GTPases); Region: Ras_like_GTPase; cl17170
160488015948	G1 box; other site
160488015949	GTP/Mg2+ binding site [chemical binding]; other site
160488015950	G2 box; other site
160488015951	Switch I region; other site
160488015952	G3 box; other site
160488015953	Switch II region; other site
160488015954	G4 box; other site
160488015955	Domain of unknown function (DUF3482); Region: DUF3482; pfam11981
160488015956	G5 box; other site
160488015957	Bacterial extracellular solute-binding protein; Region: SBP_bac_1; cl17199
160488015958	Bacterial extracellular solute-binding protein; Region: SBP_bac_11; pfam13531
160488015959	putative 2-aminoethylphosphonate ABC transporter, permease protein; Region: PhnU2; TIGR03262
160488015960	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488015961	dimer interface [polypeptide binding]; other site
160488015962	conserved gate region; other site
160488015963	putative PBP binding loops; other site
160488015964	ABC-ATPase subunit interface; other site
160488015965	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488015966	dimer interface [polypeptide binding]; other site
160488015967	conserved gate region; other site
160488015968	putative PBP binding loops; other site
160488015969	ABC-ATPase subunit interface; other site
160488015970	putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein; Region: PhnT2; TIGR03265
160488015971	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488015972	Walker A/P-loop; other site
160488015973	ATP binding site [chemical binding]; other site
160488015974	Q-loop/lid; other site
160488015975	ABC transporter signature motif; other site
160488015976	Walker B; other site
160488015977	D-loop; other site
160488015978	H-loop/switch region; other site
160488015979	aminoethylphosphonate catabolism associated LysR family transcriptional regulator; Region: phn_lysR; TIGR03339
160488015980	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488015981	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
160488015982	dimerization interface [polypeptide binding]; other site
160488015983	Cation transport ATPase [Inorganic ion transport and metabolism]; Region: ZntA; COG2217
160488015984	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
160488015985	Soluble P-type ATPase [General function prediction only]; Region: COG4087
160488015986	Cd(II)/Pb(II)-responsive transcriptional regulator; Region: CadR-PbrR; TIGR02047
160488015987	Helix-Turn-Helix DNA binding domain of the CadR and PbrR transcription regulators; Region: HTH_CadR-PbrR; cd04784
160488015988	DNA binding residues [nucleotide binding]
160488015989	dimer interface [polypeptide binding]; other site
160488015990	putative metal binding site [ion binding]; other site
160488015991	thymidylate synthase; Provisional; Region: thyA; PRK13821
160488015992	Thymidylate synthase and pyrimidine hydroxymethylase: Thymidylate synthase (TS) and deoxycytidylate hydroxymethylase (dCMP-HMase) are homologs that catalyze analogous alkylation of C5 of pyrimidine nucleotides. Both enzymes are involved in the...; Region: TS_Pyrimidine_HMase; cd00351
160488015993	dimerization interface [polypeptide binding]; other site
160488015994	active site
160488015995	prolipoprotein diacylglyceryl transferase; Reviewed; Region: PRK00052
160488015996	Sulfite exporter TauE/SafE; Region: TauE; pfam01925
160488015997	NRDE protein; Region: NRDE; cl01315
160488015998	Signal transduction protein containing GAF and PtsI domains [Signal transduction mechanisms]; Region: PtsP; COG3605
160488015999	Domain present in phytochromes and cGMP-specific phosphodiesterases; Region: GAF; smart00065
160488016000	PEP-utilising enzyme, N-terminal; Region: PEP-utilisers_N; pfam05524
160488016001	PEP-utilising enzyme, mobile domain; Region: PEP-utilizers; pfam00391
160488016002	PEP-utilising enzyme, TIM barrel domain; Region: PEP-utilizers_C; pfam02896
160488016003	Diadenosine tetraphosphate (Ap4A) hydrolase is a member of the Nudix hydrolase superfamily. Members of this family are well represented in a variety of prokaryotic and eukaryotic organisms. Phylogenetic analysis reveals two distinct subgroups where plant...; Region: Ap4A_hydrolase_plant_like; cd03671
160488016004	putative active site [active]
160488016005	Ap4A binding site [chemical binding]; other site
160488016006	nudix motif; other site
160488016007	putative metal binding site [ion binding]; other site
160488016008	Phosphoserine phosphatase [Amino acid transport and metabolism]; Region: SerB; COG0560
160488016009	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
160488016010	motif II; other site
160488016011	Predicted integral membrane protein (DUF2269); Region: DUF2269; pfam10027
160488016012	threonine dehydratase; Reviewed; Region: PRK09224
160488016013	Threonine dehydratase: The first step in amino acid degradation is the removal of nitrogen. Although the nitrogen atoms of most amino acids are transferred to alpha-ketoglutarate before removal, the alpha-amino group of threonine can be directly...; Region: Thr-dehyd; cd01562
160488016014	tetramer interface [polypeptide binding]; other site
160488016015	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488016016	catalytic residue [active]
160488016017	First of two tandem C-terminal ACT domains of threonine dehydratase I (ThrD-I; L-threonine hydrolyase); Region: ACT_ThrD-I_1; cd04906
160488016018	putative Ile/Val binding site [chemical binding]; other site
160488016019	Second of two tandem C-terminal ACT domains of threonine dehydratase I (ThrD-I; L-threonine hydrolyase); Region: ACT_ThrD-I_2; cd04907
160488016020	putative Ile/Val binding site [chemical binding]; other site
160488016021	RPI_A: Ribose 5-phosphate isomerase type A (RPI_A) subfamily; RPI catalyzes the reversible conversion of ribose-5-phosphate to ribulose 5-phosphate, the first step of the non-oxidative branch of the pentose phosphate pathway. This reaction leads to the...; Region: RPI_A; cd01398
160488016022	tetramer (dimer of dimers) interface [polypeptide binding]; other site
160488016023	active site
160488016024	dimer interface [polypeptide binding]; other site
160488016025	SdiA-regulated; Region: SdiA-regulated; pfam06977
160488016026	SdiA-regulated; Region: SdiA-regulated; cd09971
160488016027	putative active site [active]
160488016028	SdiA-regulated; Region: SdiA-regulated; pfam06977
160488016029	SdiA-regulated; Region: SdiA-regulated; cd09971
160488016030	putative active site [active]
160488016031	Fumarylacetoacetate (FAA) hydrolase family; Region: FAA_hydrolase; cl11421
160488016032	2-keto-4-pentenoate hydratase/2-oxohepta-3-ene-1,7-dioic acid hydratase (catechol pathway) [Secondary metabolites biosynthesis, transport, and catabolism]; Region: MhpD; COG0179
160488016033	FAD/FMN-containing dehydrogenases [Energy production and conversion]; Region: GlcD; COG0277
160488016034	FAD binding domain; Region: FAD_binding_4; pfam01565
160488016035	D-3-phosphoglycerate dehydrogenase; Provisional; Region: PRK11790
160488016036	Phosphoglycerate dehydrogenases, NAD-binding and catalytic domains; Region: PGDH_3; cd12176
160488016037	ligand binding site [chemical binding]; other site
160488016038	NAD binding site [chemical binding]; other site
160488016039	tetramer interface [polypeptide binding]; other site
160488016040	catalytic site [active]
160488016041	C-terminal ACT (regulatory) domain of D-3-Phosphoglycerate Dehydrogenase (3PGDH) found in fungi and bacteria; Region: ACT_3PGDH; cd04901
160488016042	L-serine binding site [chemical binding]; other site
160488016043	ACT domain interface; other site
160488016044	Domain of unknown function (DUF4399); Region: DUF4399; pfam14347
160488016045	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
160488016046	substrate binding pocket [chemical binding]; other site
160488016047	Uncharacterized conserved protein [Function unknown]; Region: COG1683
160488016048	Predicted proline hydroxylase [Posttranslational modification, protein turnover, chaperones]; Region: EGL-9; COG3751
160488016049	2OG-Fe(II) oxygenase superfamily; Region: 2OG-FeII_Oxy_3; pfam13640
160488016050	Uncharacterized protein conserved in bacteria (DUF2059); Region: DUF2059; pfam09832
160488016051	Putative lysophospholipase; Region: Hydrolase_4; pfam12146
160488016052	Lysophospholipase [Lipid metabolism]; Region: PldB; COG2267
160488016053	maltose O-acetyltransferase; Provisional; Region: PRK10092
160488016054	Maltose O-acetyltransferase (MAT) and Galactoside O-acetyltransferase (GAT): MAT and GAT catalyze the CoA-dependent acetylation of the 6-hydroxyl group of their respective sugar substrates. MAT acetylates maltose and glucose exclusively at the C6...; Region: LbH_MAT_GAT; cd03357
160488016055	active site
160488016056	substrate binding site [chemical binding]; other site
160488016057	trimer interface [polypeptide binding]; other site
160488016058	CoA binding site [chemical binding]; other site
160488016059	Protein related to penicillin acylase [General function prediction only]; Region: COG2366
160488016060	The Ntn hydrolases (N-terminal nucleophile) are a diverse superfamily of of enzymes that are activated autocatalytically via an N-terminally lcated nucleophilic amino acid.  N-terminal nucleophile (NTN-) hydrolase superfamily, which contains a...; Region: Ntn_hydrolase; cl00467
160488016061	Penicillin G acylase (PGA) belongs to a family of beta-lactam acylases that includes cephalosporin acylase (CA) and aculeacin A acylase. PGA and CA are crucial for the production of backbone chemicals like 6-aminopenicillanic acid and...; Region: Ntn_PGA_like; cd03747
160488016062	active site
160488016063	NLPA lipoprotein; Region: Lipoprotein_9; pfam03180
160488016064	ABC-type metal ion transport system, periplasmic component/surface antigen [Inorganic ion transport and metabolism]; Region: NlpA; COG1464
160488016065	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
160488016066	ATPases associated with a variety of cellular activities; Region: AAA; smart00382
160488016067	Walker A motif; other site
160488016068	ATP binding site [chemical binding]; other site
160488016069	Walker B motif; other site
160488016070	arginine finger; other site
160488016071	Serine hydrolase; Region: Ser_hydrolase; pfam06821
160488016072	Alpha/beta hydrolase family; Region: Abhydrolase_5; pfam12695
160488016073	ABC-type sulfate/molybdate transport systems, ATPase component [Inorganic ion transport and metabolism]; Region: CysA; COG1118
160488016074	ATP-binding cassette domain of the sulfate transporter; Region: ABC_CysA_sulfate_importer; cd03296
160488016075	Walker A/P-loop; other site
160488016076	ATP binding site [chemical binding]; other site
160488016077	Q-loop/lid; other site
160488016078	ABC transporter signature motif; other site
160488016079	Walker B; other site
160488016080	D-loop; other site
160488016081	H-loop/switch region; other site
160488016082	TOBE-like domain; Region: TOBE_3; pfam12857
160488016083	ABC-type sulfate transport system, permease component [Posttranslational modification, protein turnover, chaperones]; Region: CysU; COG0555
160488016084	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488016085	dimer interface [polypeptide binding]; other site
160488016086	conserved gate region; other site
160488016087	putative PBP binding loops; other site
160488016088	ABC-ATPase subunit interface; other site
160488016089	ABC-type sulfate transport system, permease component [Posttranslational modification, protein turnover, chaperones]; Region: CysU; COG0555
160488016090	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488016091	dimer interface [polypeptide binding]; other site
160488016092	conserved gate region; other site
160488016093	putative PBP binding loops; other site
160488016094	ABC-ATPase subunit interface; other site
160488016095	ABC-type sulfate transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: Sbp; COG1613
160488016096	Bacterial extracellular solute-binding protein; Region: SBP_bac_11; pfam13531
160488016097	Uncharacterized small protein [Function unknown]; Region: COG5583
160488016098	Cation/multidrug efflux pump [Defense mechanisms]; Region: AcrB; COG0841
160488016099	RND family efflux transporter, MFP subunit; Region: RND_mfp; TIGR01730
160488016100	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
160488016101	HlyD family secretion protein; Region: HlyD_3; pfam13437
160488016102	RND family efflux transporter, MFP subunit; Region: RND_mfp; TIGR01730
160488016103	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
160488016104	HlyD family secretion protein; Region: HlyD_3; pfam13437
160488016105	Transposase IS200 like; Region: Y1_Tnp; pfam01797
160488016106	ABC-type spermidine/putrescine transport system, permease component II [Amino acid transport and metabolism]; Region: PotC; COG1177
160488016107	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488016108	dimer interface [polypeptide binding]; other site
160488016109	conserved gate region; other site
160488016110	putative PBP binding loops; other site
160488016111	ABC-ATPase subunit interface; other site
160488016112	ABC-type spermidine/putrescine transport system, permease component II [Amino acid transport and metabolism]; Region: PotC; COG1177
160488016113	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488016114	dimer interface [polypeptide binding]; other site
160488016115	conserved gate region; other site
160488016116	putative PBP binding loops; other site
160488016117	ABC-ATPase subunit interface; other site
160488016118	putrescine transporter ATP-binding subunit; Provisional; Region: potG; PRK11607
160488016119	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488016120	Walker A/P-loop; other site
160488016121	ATP binding site [chemical binding]; other site
160488016122	Q-loop/lid; other site
160488016123	ABC transporter signature motif; other site
160488016124	Walker B; other site
160488016125	D-loop; other site
160488016126	H-loop/switch region; other site
160488016127	TOBE domain; Region: TOBE_2; pfam08402
160488016128	putrescine transporter subunit: periplasmic-binding component of ABC superfamily; Provisional; Region: PRK10682
160488016129	Bacterial extracellular solute-binding protein; Region: SBP_bac_1; cl17199
160488016130	putrescine transporter subunit: periplasmic-binding component of ABC superfamily; Provisional; Region: PRK10682
160488016131	Bacterial extracellular solute-binding protein; Region: SBP_bac_1; cl17199
160488016132	putative aminotransferase; Validated; Region: PRK07480
160488016133	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
160488016134	inhibitor-cofactor binding pocket; inhibition site
160488016135	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488016136	catalytic residue [active]
160488016137	Glutamine synthetase [Amino acid transport and metabolism]; Region: GlnA; COG0174
160488016138	Glutamine synthetase, catalytic domain; Region: Gln-synt_C; pfam00120
160488016139	Glutamine synthetase [Amino acid transport and metabolism]; Region: GlnA; COG0174
160488016140	Glutamine synthetase, catalytic domain; Region: Gln-synt_C; pfam00120
160488016141	N-acetylglutamate synthase; Validated; Region: PRK05279
160488016142	AAK_NAGS-ABP: N-acetylglutamate (NAG) kinase-like domain of the NAG Synthase (NAGS) of the arginine-biosynthesis pathway (ABP) found in gamma- and beta-proteobacteria and higher plant chloroplasts. Domain architecture of these NAGS consisted of an...; Region: AAK_NAGS-ABP; cd04237
160488016143	putative feedback inhibition sensing region; other site
160488016144	putative nucleotide binding site [chemical binding]; other site
160488016145	putative substrate binding site [chemical binding]; other site
160488016146	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
160488016147	Coenzyme A binding pocket [chemical binding]; other site
160488016148	acetylornithine deacetylase; Provisional; Region: PRK05111
160488016149	M20 Peptidase acetylornithine deacetylase; Region: M20_ArgE; cd03894
160488016150	metal binding site [ion binding]; metal-binding site
160488016151	putative dimer interface [polypeptide binding]; other site
160488016152	Uncharacterized conserved protein [Function unknown]; Region: COG3025
160488016153	CYTH-like (also known as triphosphate tunnel metalloenzyme (TTM)-like) Phosphatases; Region: CYTH-like_Pase; cl11964
160488016154	putative active site; other site
160488016155	putative metal binding residues [ion binding]; other site
160488016156	signature motif; other site
160488016157	putative triphosphate binding site [ion binding]; other site
160488016158	Transcriptional regulators [Transcription]; Region: Lrp; COG1522
160488016159	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
160488016160	putative DNA binding site [nucleotide binding]; other site
160488016161	putative Zn2+ binding site [ion binding]; other site
160488016162	AsnC family; Region: AsnC_trans_reg; pfam01037
160488016163	Type II secretion system (T2SS), protein E, N-terminal domain; Region: T2SE_Nter; pfam05157
160488016164	Type II secretory pathway, ATPase PulE/Tfp pilus assembly pathway, ATPase PilB [Cell motility and secretion / Intracellular trafficking and secretion]; Region: PulE; COG2804
160488016165	RecA-like NTPases. This family includes the NTP binding domain of F1 and V1 H+ATPases, DnaB and related helicases as well as bacterial RecA and related eukaryotic and archaeal recombinases. This group also includes bacterial conjugation proteins and...; Region: RecA-like_NTPases; cl17233
160488016166	Walker A motif; other site
160488016167	ATP binding site [chemical binding]; other site
160488016168	Walker B motif; other site
160488016169	conserverd hypothetical protein; Region: TIGR02448
160488016170	glycine dehydrogenase; Provisional; Region: PRK12566
160488016171	Glycine cleavage system P-protein, alpha- and beta-subunits. This family consists of Glycine cleavage system P-proteins EC:1.4.4.2 from bacterial, mammalian and plant sources. The P protein is part of the glycine decarboxylase multienzyme complex EC:2.1; Region: GDC-P; cd00613
160488016172	tetramer interface [polypeptide binding]; other site
160488016173	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488016174	catalytic residue [active]
160488016175	Glycine cleavage system P-protein, alpha- and beta-subunits. This family consists of Glycine cleavage system P-proteins EC:1.4.4.2 from bacterial, mammalian and plant sources. The P protein is part of the glycine decarboxylase multienzyme complex EC:2.1; Region: GDC-P; cd00613
160488016176	tetramer interface [polypeptide binding]; other site
160488016177	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488016178	catalytic residue [active]
160488016179	Glycine cleavage H-protein. Glycine cleavage H-proteins are part of the glycine cleavage system (GCS) found in bacteria, archea and the mitochondria of eukaryotes. GCS is a multienzyme complex consisting of 4 different components (P-, H-, T- and...; Region: GCS_H; cd06848
160488016180	lipoyl attachment site [posttranslational modification]; other site
160488016181	glycine cleavage system aminomethyltransferase T; Reviewed; Region: gcvT; PRK00389
160488016182	Glycine cleavage T-protein C-terminal barrel domain; Region: GCV_T_C; pfam08669
160488016183	ABC-type Fe3+ transport system, permease component [Inorganic ion transport and metabolism]; Region: ThiP; COG1178
160488016184	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488016185	dimer interface [polypeptide binding]; other site
160488016186	conserved gate region; other site
160488016187	putative PBP binding loops; other site
160488016188	ABC-ATPase subunit interface; other site
160488016189	ABC-type Fe3+ transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: AfuA; COG1840
160488016190	Bacterial extracellular solute-binding protein; Region: SBP_bac_8; pfam13416
160488016191	ubiquinone biosynthesis hydroxylase family protein; Provisional; Region: PRK07608; cl17314
160488016192	2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase; Provisional; Region: PRK05714
160488016193	The hotdog fold was initially identified in the E. coli FabA (beta-hydroxydecanoyl-acyl carrier protein (ACP)-dehydratase) structure and subsequently in 4HBT (4-hydroxybenzoyl-CoA thioesterase) from Pseudomonas. A number of other seemingly unrelated...; Region: hot_dog; cl00509
160488016194	active site 2 [active]
160488016195	active site 1 [active]
160488016196	2-octaprenyl-6-methoxyphenyl hydroxylase; Validated; Region: PRK05732
160488016197	Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family; Region: Ubi-OHases; TIGR01988
160488016198	proline aminopeptidase P II; Provisional; Region: PRK10879
160488016199	Aminopeptidase P, N-terminal domain; Region: AMP_N; pfam05195
160488016200	Prolidase. E.C. 3.4.13.9. Also known as Xaa-Pro dipeptidase, X-Pro dipeptidase, proline dipeptidase., imidodipeptidase, peptidase D, gamma-peptidase. Catalyses hydrolysis of Xaa-Pro dipeptides; also acts on aminoacyl-hydroxyproline analogs. No action on...; Region: Prolidase; cd01087
160488016201	active site
160488016202	hypothetical protein; Reviewed; Region: PRK02166
160488016203	Cell division protein ZapA; Region: ZapA; pfam05164
160488016204	5-formyltetrahydrofolate cyclo-ligase [Coenzyme metabolism]; Region: COG0212
160488016205	5-formyltetrahydrofolate cyclo-ligase family; Region: 5-FTHF_cyc-lig; pfam01812
160488016206	EVE domain; Region: EVE; cl00728
160488016207	RND family efflux transporter, MFP subunit; Region: RND_mfp; TIGR01730
160488016208	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
160488016209	HlyD family secretion protein; Region: HlyD_3; pfam13437
160488016210	ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system; Region: PQQ_ABC_ATP; TIGR03864
160488016211	ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230
160488016212	Walker A/P-loop; other site
160488016213	ATP binding site [chemical binding]; other site
160488016214	Q-loop/lid; other site
160488016215	ABC transporter signature motif; other site
160488016216	Walker B; other site
160488016217	D-loop; other site
160488016218	H-loop/switch region; other site
160488016219	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
160488016220	daunorubicin resistance ABC transporter ATP-binding subunit; Region: drrA; TIGR01188
160488016221	Walker A/P-loop; other site
160488016222	ATP binding site [chemical binding]; other site
160488016223	Q-loop/lid; other site
160488016224	ABC transporter signature motif; other site
160488016225	Walker B; other site
160488016226	D-loop; other site
160488016227	H-loop/switch region; other site
160488016228	ABC-type multidrug transport system, permease component [Defense mechanisms]; Region: COG0842
160488016229	ABC-2 type transporter; Region: ABC2_membrane; pfam01061
160488016230	ABC-type multidrug transport system, permease component [Defense mechanisms]; Region: COG0842
160488016231	ABC-2 type transporter; Region: ABC2_membrane; pfam01061
160488016232	flagellar basal body-associated protein FliL-like protein; Validated; Region: PRK05697
160488016233	Quinone oxidoreductase (QOR); Region: QOR1; cd08241
160488016234	NADPH:quinone reductase and related Zn-dependent oxidoreductases [Energy production and conversion / General function prediction only]; Region: Qor; COG0604
160488016235	NAD(P) binding site [chemical binding]; other site
160488016236	GGCT-like domains, also called AIG2-like family. Gamma-glutamyl cyclotransferase (GGCT) catalyzes the formation of pyroglutamic acid (5-oxoproline) from dipeptides containing gamma-glutamyl, and is a dimeric protein. In Homo sapiens, the protein is...; Region: GGCT_like; cd06661
160488016237	putative active site pocket [active]
160488016238	dimerization interface [polypeptide binding]; other site
160488016239	putative catalytic residue [active]
160488016240	CDP-6-deoxy-delta-3,4-glucoseen reductase; Validated; Region: PRK07609
160488016241	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
160488016242	catalytic loop [active]
160488016243	iron binding site [ion binding]; other site
160488016244	NAD(P)H dependent flavin oxidoreductases use flavin as a substrate in mediating electron transfer from iron complexes or iron proteins. Structurally similar to ferredoxin reductases, but with only 15% sequence identity, flavin reductases reduce FAD, FMN; Region: flavin_oxioreductase; cd06189
160488016245	FAD binding pocket [chemical binding]; other site
160488016246	FAD binding motif [chemical binding]; other site
160488016247	phosphate binding motif [ion binding]; other site
160488016248	beta-alpha-beta structure motif; other site
160488016249	NAD binding pocket [chemical binding]; other site
160488016250	3-octaprenyl-4-hydroxybenzoate carboxy-lyase; Region: UbiD; cl00311
160488016251	transcription termination factor Rho; Provisional; Region: rho; PRK09376
160488016252	Rho termination factor, N-terminal domain; Region: Rho_N; smart00959
160488016253	Rho_CSD: Rho protein cold-shock domain (CSD). Rho protein is a transcription termination factor in most bacteria. In bacteria, there are two distinct mechanisms for mRNA transcription termination. In intrinsic termination, RNA polymerase and nascent mRNA...; Region: Rho_CSD; cd04459
160488016254	RNA binding site [nucleotide binding]; other site
160488016255	Transcription termination factor rho is a bacterial ATP-dependent RNA/DNA helicase. It is a homohexamer. Each monomer consists of an N-terminal domain of the OB fold, which is responsible for binding to cysteine rich nucleotides. This alignment is of the...; Region: rho_factor; cd01128
160488016256	multimer interface [polypeptide binding]; other site
160488016257	Walker A motif; other site
160488016258	ATP binding site [chemical binding]; other site
160488016259	Walker B motif; other site
160488016260	TRX family; composed of two groups: Group I, which includes proteins that exclusively encode a TRX domain; and Group II, which are composed of fusion proteins of TRX and additional domains. Group I TRX is a small ancient protein that alter the redox...; Region: TRX_family; cd02947
160488016261	Thioredoxin-like; Region: Thioredoxin_8; pfam13905
160488016262	catalytic residues [active]
160488016263	Exopolyphosphatase [Nucleotide transport and metabolism / Inorganic ion transport and metabolism]; Region: GppA; COG0248
160488016264	Ppx/GppA phosphatase family; Region: Ppx-GppA; pfam02541
160488016265	polyphosphate kinase; Provisional; Region: PRK05443
160488016266	Polyphosphate kinase N-terminal domain; Region: PP_kinase_N; pfam13089
160488016267	Polyphosphate kinase middle domain; Region: PP_kinase; pfam02503
160488016268	Catalytic domain of phospholipase D superfamily proteins; Region: PLDc_SF; cl15239
160488016269	putative active site [active]
160488016270	catalytic site [active]
160488016271	Catalytic C-terminal domain, second repeat, of Pseudomonas aeruginosa polyphosphate kinase 1 and similar proteins; Region: PLDc_PaPPK1_C2_like; cd09168
160488016272	putative domain interface [polypeptide binding]; other site
160488016273	putative active site [active]
160488016274	catalytic site [active]
160488016275	Uncharacterized membrane-associated protein [Function unknown]; Region: DedA; COG0586
160488016276	SNARE associated Golgi protein; Region: SNARE_assoc; pfam09335
160488016277	Sterol desaturase [Lipid metabolism]; Region: ERG3; COG3000
160488016278	Fatty acid hydroxylase superfamily; Region: FA_hydroxylase; pfam04116
160488016279	isoprenoid biosynthesis protein with amidotransferase-like domain; Provisional; Region: PRK11780
160488016280	Type 1 glutamine amidotransferase (GATase1)-like domain found in zebrafish ES1; Region: GATase1_ES1; cd03133
160488016281	conserved cys residue [active]
160488016282	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG1671
160488016283	adenylate cyclase; Provisional; Region: cyaA; PRK09450
160488016284	Adenylate cyclase NT domain; Region: Adenyl_cycl_N; pfam12633
160488016285	Adenylate cyclase, class-I; Region: Adenylate_cycl; pfam01295
160488016286	nucleoside diphosphate kinase regulator; Provisional; Region: PRK05753
160488016287	Transcription elongation factor, GreA/GreB, C-term; Region: GreA_GreB; pfam01272
160488016288	Protein of unknown function (DUF1289); Region: DUF1289; pfam06945
160488016289	frataxin-like protein; Provisional; Region: cyaY; PRK00446
160488016290	putative iron binding site [ion binding]; other site
160488016291	diaminopimelate decarboxylase; Region: lysA; TIGR01048
160488016292	Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzyme Diaminopimelate Decarboxylase; Region: PLPDE_III_DapDC; cd06828
160488016293	active site
160488016294	pyridoxal 5'-phosphate (PLP) binding site [chemical binding]; other site
160488016295	substrate binding site [chemical binding]; other site
160488016296	catalytic residues [active]
160488016297	dimer interface [polypeptide binding]; other site
160488016298	diaminopimelate epimerase; Provisional; Region: dapF; PRK00450
160488016299	Diaminopimelate epimerase; Region: DAP_epimerase; pfam01678
160488016300	Diaminopimelate epimerase; Region: DAP_epimerase; pfam01678
160488016301	Protein of unknown function, DUF484; Region: DUF484; cl17449
160488016302	site-specific tyrosine recombinase XerC; Reviewed; Region: xerC; PRK00236
160488016303	DNA breaking-rejoining enzymes, C-terminal catalytic domain. The DNA breaking-rejoining enzyme superfamily includes type IB topoisomerases and tyrosine recombinases that share the same fold in their catalytic domain containing six conserved active site...; Region: DNA_BRE_C; cl00213
160488016304	active site
160488016305	DNA binding site [nucleotide binding]
160488016306	Int/Topo IB signature motif; other site
160488016307	flavin mononucleotide phosphatase; Provisional; Region: PRK10748
160488016308	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
160488016309	motif II; other site
160488016310	Ammonia permease [Inorganic ion transport and metabolism]; Region: AmtB; COG0004
160488016311	Nitrogen regulatory protein PII [Amino acid transport and metabolism]; Region: GlnK; COG0347
160488016312	Nitrogen regulatory protein P-II; Region: P-II; smart00938
160488016313	Membrane fusogenic activity; Region: BMFP; pfam04380
160488016314	Domain of unknown function (DUF4034); Region: DUF4034; pfam13226
160488016315	FOG: TPR repeat, SEL1 subfamily [General function prediction only]; Region: COG0790
160488016316	putative ATP-dependent protease; Provisional; Region: PRK09862
160488016317	Protein of unknown function (DUF796); Region: DUF796; pfam05638
160488016318	Predicted ATPase with chaperone activity [Posttranslational modification, protein turnover, chaperones]; Region: COG0606
160488016319	Subunit ChlI of Mg-chelatase; Region: ChlI; pfam13541
160488016320	Magnesium chelatase, subunit ChlI; Region: Mg_chelatase; pfam01078
160488016321	Magnesium chelatase, subunit ChlI; Region: Mg_chelatase_2; pfam13335
160488016322	Response regulator receiver domain; Region: Response_reg; pfam00072
160488016323	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488016324	active site
160488016325	phosphorylation site [posttranslational modification]
160488016326	intermolecular recognition site; other site
160488016327	dimerization interface [polypeptide binding]; other site
160488016328	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
160488016329	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
160488016330	DNA binding site [nucleotide binding]
160488016331	Response regulator [Signal transduction mechanisms]; Region: TtrR; COG4566
160488016332	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488016333	active site
160488016334	phosphorylation site [posttranslational modification]
160488016335	intermolecular recognition site; other site
160488016336	dimerization interface [polypeptide binding]; other site
160488016337	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
160488016338	DNA binding residues [nucleotide binding]
160488016339	dimerization interface [polypeptide binding]; other site
160488016340	Protein Kinases, catalytic domain; Region: PKc_like; cl09925
160488016341	active site
160488016342	substrate binding site [chemical binding]; other site
160488016343	AAA ATPase domain; Region: AAA_16; pfam13191
160488016344	Predicted ATPase [General function prediction only]; Region: COG3899
160488016345	FOG: GAF domain [Signal transduction mechanisms]; Region: FhlA; COG2203
160488016346	Domain present in phytochromes and cGMP-specific phosphodiesterases; Region: GAF; smart00065
160488016347	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488016348	dimer interface [polypeptide binding]; other site
160488016349	phosphorylation site [posttranslational modification]
160488016350	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488016351	ATP binding site [chemical binding]; other site
160488016352	Mg2+ binding site [ion binding]; other site
160488016353	G-X-G motif; other site
160488016354	Isochorismatase family; Region: Isochorismatase; pfam00857
160488016355	YcaC related amidohydrolases; E.coli YcaC is an homooctameric hydrolase with unknown specificity. Despite its weak sequence similarity, it is structurally related to other amidohydrolases and shares conserved active site residues with them; Region: YcaC_related; cd01012
160488016356	catalytic triad [active]
160488016357	dimer interface [polypeptide binding]; other site
160488016358	conserved cis-peptide bond; other site
160488016359	AraC-type DNA-binding domain-containing proteins [Transcription]; Region: AraC; COG2207
160488016360	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488016361	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488016362	Transcriptional regulator containing an amidase domain and an AraC-type DNA-binding HTH domain [Transcription]; Region: COG4977
160488016363	AraC transcriptional regulators having a Type 1 glutamine amidotransferase (GATase1)-like domain; Region: GATase1_AraC_1; cd03137
160488016364	conserved cys residue [active]
160488016365	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488016366	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
160488016367	glutathione-regulated potassium-efflux system protein KefB; Provisional; Region: PRK03659
160488016368	transporter, monovalent cation:proton antiporter-2 (CPA2) family; Region: 2a37; TIGR00932
160488016369	TrkA-N domain; Region: TrkA_N; pfam02254
160488016370	Protein of unknown function (DUF3077); Region: DUF3077; pfam11275
160488016371	Isochorismatase family; Region: Isochorismatase; pfam00857
160488016372	YcaC related amidohydrolases; E.coli YcaC is an homooctameric hydrolase with unknown specificity. Despite its weak sequence similarity, it is structurally related to other amidohydrolases and shares conserved active site residues with them; Region: YcaC_related; cd01012
160488016373	catalytic triad [active]
160488016374	dimer interface [polypeptide binding]; other site
160488016375	conserved cis-peptide bond; other site
160488016376	LysR family transcriptional regulator; Provisional; Region: PRK14997
160488016377	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488016378	The C-terminal substrate binding domain of an uncharacterized LysR-type transcriptional regulator CrgA-like, contains the type 2 periplasmic binding fold; Region: PBP2_CrgA_like_4; cd08473
160488016379	putative effector binding pocket; other site
160488016380	putative dimerization interface [polypeptide binding]; other site
160488016381	outer membrane porin, OprD family; Region: OprD; pfam03573
160488016382	Transmembrane secretion effector; Region: MFS_3; pfam05977
160488016383	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488016384	putative substrate translocation pore; other site
160488016385	Predicted metal-dependent hydrolase with the TIM-barrel fold [General function prediction only]; Region: COG1574
160488016386	YtcJ_like metal dependent amidohydrolases. YtcJ is a Bacillus subtilis ORF of unknown function. The Arabidopsis homolog LAF3 has been identified as a factor required for photochrome A signalling; Region: YtcJ_like; cd01300
160488016387	active site
160488016388	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
160488016389	Putative lysophospholipase; Region: Hydrolase_4; pfam12146
160488016390	Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326
160488016391	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3224
160488016392	Isochorismatase family; Region: Isochorismatase; pfam00857
160488016393	YcaC related amidohydrolases; E.coli YcaC is an homooctameric hydrolase with unknown specificity. Despite its weak sequence similarity, it is structurally related to other amidohydrolases and shares conserved active site residues with them; Region: YcaC_related; cd01012
160488016394	catalytic triad [active]
160488016395	dimer interface [polypeptide binding]; other site
160488016396	conserved cis-peptide bond; other site
160488016397	Mechanosensitive ion channel; Region: MS_channel; pfam00924
160488016398	Small-conductance mechanosensitive channel [Cell envelope biogenesis, outer membrane]; Region: MscS; COG0668
160488016399	cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases [Signal transduction mechanisms]; Region: Crp; COG0664
160488016400	effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038
160488016401	ligand binding site [chemical binding]; other site
160488016402	flexible hinge region; other site
160488016403	putative aminophosphonate oxidoreductase; Region: Phn_aa_oxid; TIGR03329
160488016404	Glycine/D-amino acid oxidases (deaminating) [Amino acid transport and metabolism]; Region: DadA; COG0665
160488016405	aldehyde dehydrogenase family 7 member; Region: PLN02315
160488016406	NAD+-dependent alpha-aminoadipic semialdehyde dehydrogenase, ALDH family members 7A1 and 7B; Region: ALDH_F7_AASADH; cd07130
160488016407	tetrameric interface [polypeptide binding]; other site
160488016408	NAD binding site [chemical binding]; other site
160488016409	catalytic residues [active]
160488016410	DNA-binding transcriptional activator GcvA; Provisional; Region: PRK11139
160488016411	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488016412	The C-terminal substrate binding domain of LysR-type transcriptional regulators GcdR-like, contains the type 2 periplasmic binding fold; Region: PBP2_GcdR_like; cd08481
160488016413	dimerization interface [polypeptide binding]; other site
160488016414	substrate binding pocket [chemical binding]; other site
160488016415	Domain of unknown function (DUF1338); Region: DUF1338; pfam07063
160488016416	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG5383
160488016417	DNA-binding transcriptional activator GcvA; Provisional; Region: PRK11139
160488016418	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488016419	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
160488016420	dimerization interface [polypeptide binding]; other site
160488016421	multidrug efflux protein NorA; Provisional; Region: PRK00187
160488016422	Subfamily of the multidrug and toxic compound extrusion (MATE)-like proteins similar to Vibrio cholerae NorM; Region: MATE_NorM_like; cd13131
160488016423	cation binding site [ion binding]; other site
160488016424	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
160488016425	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
160488016426	metal binding site [ion binding]; metal-binding site
160488016427	active site
160488016428	I-site; other site
160488016429	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
160488016430	ATP-dependent DNA helicase Rep; Region: rep; TIGR01074
160488016431	Part of AAA domain; Region: AAA_19; pfam13245
160488016432	Family description; Region: UvrD_C_2; pfam13538
160488016433	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
160488016434	active site
160488016435	Acetyl-CoA hydrolase [Energy production and conversion]; Region: ACH1; COG0427
160488016436	Acetyl-CoA hydrolase/transferase C-terminal domain; Region: AcetylCoA_hyd_C; pfam13336
160488016437	Cytochrome c5 [Energy production and conversion]; Region: CycB; COG3245
160488016438	DNA-binding transcriptional repressor PuuR; Provisional; Region: PRK09943
160488016439	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
160488016440	non-specific DNA binding site [nucleotide binding]; other site
160488016441	salt bridge; other site
160488016442	sequence-specific DNA binding site [nucleotide binding]; other site
160488016443	Cupin domain; Region: Cupin_2; pfam07883
160488016444	alanine racemase; Reviewed; Region: dadX; PRK03646
160488016445	Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzymes, Proteobacterial Alanine Racemases; Region: PLPDE_III_AR_proteobact; cd06827
160488016446	active site
160488016447	pyridoxal 5'-phosphate (PLP) binding site [chemical binding]; other site
160488016448	substrate binding site [chemical binding]; other site
160488016449	catalytic residues [active]
160488016450	dimer interface [polypeptide binding]; other site
160488016451	D-amino acid dehydrogenase small subunit; Validated; Region: PRK00711
160488016452	Ketopantoate reductase PanE/ApbA; Region: ApbA; pfam02558
160488016453	hydroxyglutarate oxidase; Provisional; Region: PRK11728
160488016454	leucine-responsive transcriptional regulator; Provisional; Region: PRK11169
160488016455	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
160488016456	putative DNA binding site [nucleotide binding]; other site
160488016457	putative Zn2+ binding site [ion binding]; other site
160488016458	AsnC family; Region: AsnC_trans_reg; pfam01037
160488016459	Flagellin N-methylase; Region: FliB; pfam03692
160488016460	putative aminophosphonate oxidoreductase; Region: Phn_aa_oxid; TIGR03329
160488016461	Glycine/D-amino acid oxidases (deaminating) [Amino acid transport and metabolism]; Region: DadA; COG0665
160488016462	Uncharacterized conserved small protein [Function unknown]; Region: COG5457
160488016463	Transcriptional regulators containing a DNA-binding HTH domain and an aminotransferase domain (MocR family) and their eukaryotic orthologs [Transcription / Amino acid transport and metabolism]; Region: ARO8; COG1167
160488016464	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488016465	DNA-binding site [nucleotide binding]; DNA binding site
160488016466	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
160488016467	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488016468	homodimer interface [polypeptide binding]; other site
160488016469	catalytic residue [active]
160488016470	Putative catalytic domain, repeat 1, of Escherichia coli uncharacterized protein ymdC and similar proteins; Region: PLDc_ymdC_like_1; cd09111
160488016471	PLD-like domain; Region: PLDc_2; pfam13091
160488016472	putative active site [active]
160488016473	catalytic site [active]
160488016474	Putative catalytic domain, repeat 2, of Escherichia coli uncharacterized protein ymdC and similar proteins; Region: PLDc_ymdC_like_2; cd09113
160488016475	PLD-like domain; Region: PLDc_2; pfam13091
160488016476	putative active site [active]
160488016477	catalytic site [active]
160488016478	Cyanate permease [Inorganic ion transport and metabolism]; Region: CynX; COG2807
160488016479	gamma-glutamyl-gamma-aminobutyraldehyde dehydrogenase; Provisional; Region: PRK09847
160488016480	Escherichia coli NADP+-dependent gamma-glutamyl-gamma-aminobutyraldehyde dehydrogenase PuuC-like; Region: ALDH_GABALDH-PuuC; cd07112
160488016481	NAD(P) binding site [chemical binding]; other site
160488016482	catalytic residues [active]
160488016483	Predicted enzyme of the cupin superfamily [General function prediction only]; Region: COG3450
160488016484	50S ribosomal protein L33; Validated; Region: rpmG; PRK00595
160488016485	50S ribosomal protein L28; Reviewed; Region: rpmB; PRK00359
160488016486	ABC-type dipeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: DdpA; COG0747
160488016487	The substrate-binding component of an ABC-type dipeptide import system contains the type 2 periplasmic binding fold; Region: PBP2_DppA_like; cd08493
160488016488	peptide binding site [polypeptide binding]; other site
160488016489	hypothetical protein; Reviewed; Region: PRK00024
160488016490	Mov34/MPN/PAD-1 family; Region: MPN_DUF2466; cd08071
160488016491	MPN+ (JAMM) motif; other site
160488016492	Zinc-binding site [ion binding]; other site
160488016493	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate synthase; Validated; Region: PRK05579
160488016494	Flavoprotein; Region: Flavoprotein; pfam02441
160488016495	DNA / pantothenate metabolism flavoprotein; Region: DFP; pfam04127
160488016496	Trimeric dUTP diphosphatases; Region: trimeric_dUTPase; cd07557
160488016497	trimer interface [polypeptide binding]; other site
160488016498	active site
160488016499	The phosphomannomutase/phosphoglucomutase (PMM/PGM) bifunctional enzyme catalyzes the reversible conversion of 1-phospho to 6-phospho-sugars (e.g. between mannose-1-phosphate and mannose-6-phosphate or glucose-1-phosphate and glucose-6-phosphate) via a...; Region: PMM_PGM; cd03089
160488016500	Phosphomannomutase [Carbohydrate transport and metabolism]; Region: {ManB}; COG1109
160488016501	active site
160488016502	substrate binding site [chemical binding]; other site
160488016503	metal binding site [ion binding]; metal-binding site
160488016504	AAK_NAGK-C: N-Acetyl-L-glutamate kinase - cyclic (NAGK-C) catalyzes the phosphorylation of the gamma-COOH group of N-acetyl-L-glutamate (NAG) by ATP in the second step of arginine biosynthesis found in some bacteria and photosynthetic organisms using the...; Region: AAK_NAGK-C; cd04250
160488016505	feedback inhibition sensing region; other site
160488016506	homohexameric interface [polypeptide binding]; other site
160488016507	nucleotide binding site [chemical binding]; other site
160488016508	N-acetyl-L-glutamate binding site [chemical binding]; other site
160488016509	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3547
160488016510	Transposase; Region: DEDD_Tnp_IS110; pfam01548
160488016511	Transposase IS116/IS110/IS902 family; Region: Transposase_20; pfam02371
160488016512	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
160488016513	active site
160488016514	Neisseria meningitides Nape-like subfamily of the ExoIII family purinic/apyrimidinic (AP) endonucleases; Region: Nape_like_AP-endo; cd10281
160488016515	putative active site [active]
160488016516	putative catalytic site [active]
160488016517	putative DNA binding site [nucleotide binding]; other site
160488016518	putative phosphate binding site [ion binding]; other site
160488016519	metal binding site A [ion binding]; metal-binding site
160488016520	putative AP binding site [nucleotide binding]; other site
160488016521	putative metal binding site B [ion binding]; other site
160488016522	Tic20-like protein; Region: Tic20; pfam09685
160488016523	ribonuclease PH; Reviewed; Region: rph; PRK00173
160488016524	Ribonuclease PH; Region: RNase_PH_bact; cd11362
160488016525	hexamer interface [polypeptide binding]; other site
160488016526	active site
160488016527	hypothetical protein; Provisional; Region: PRK11820
160488016528	YicC-like family, N-terminal region; Region: YicC_N; pfam03755
160488016529	Domain of unknown function (DUF1732); Region: DUF1732; pfam08340
160488016530	Guanylate kinase [Nucleotide transport and metabolism]; Region: Gmk; COG0194
160488016531	Guanosine monophosphate kinase (GMPK, EC 2.7.4.8), also known as guanylate kinase (GKase), catalyzes the reversible phosphoryl transfer from adenosine triphosphate (ATP) to guanosine monophosphate (GMP) to yield adenosine diphosphate (ADP) and guanosine...; Region: GMPK; cd00071
160488016532	catalytic site [active]
160488016533	G-X2-G-X-G-K; other site
160488016534	Amino acid transporters [Amino acid transport and metabolism]; Region: PotE; COG0531
160488016535	Peptidase C26; Region: Peptidase_C26; pfam07722
160488016536	Subgroup of proteins having the Type 1 glutamine amidotransferase (GATase1) domain; Region: GATase1_2; cd01745
160488016537	catalytic triad [active]
160488016538	Glutamine synthetase [Amino acid transport and metabolism]; Region: GlnA; COG0174
160488016539	Glutamine synthetase, catalytic domain; Region: Gln-synt_C; pfam00120
160488016540	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488016541	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488016542	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
160488016543	dimerization interface [polypeptide binding]; other site
160488016544	DNA-directed RNA polymerase subunit omega; Reviewed; Region: rpoZ; PRK00392
160488016545	bifunctional (p)ppGpp synthetase II/ guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase; Provisional; Region: PRK11092
160488016546	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
160488016547	Zn2+ binding site [ion binding]; other site
160488016548	Mg2+ binding site [ion binding]; other site
160488016549	Nucleotidyltransferase (NT) domain of RelA- and SpoT-like ppGpp synthetases and hydrolases; Region: NT_Rel-Spo_like; cd05399
160488016550	synthetase active site [active]
160488016551	NTP binding site [chemical binding]; other site
160488016552	metal binding site [ion binding]; metal-binding site
160488016553	TGS_RelA_SpoT: The RelA (SpoT) protein, also referred to as ppGpp hydrolase/synthetase, is a ribosome-associated protein that is activated during amino acid starvation and thought to mediate the stringent response. RelA contains a TGS domain, named after...; Region: TGS_RelA_SpoT; cd01668
160488016554	ACT  domain found C-terminal of the RelA/SpoT domains; Region: ACT_RelA-SpoT; cd04876
160488016555	YjgF, YER057c, and UK114 belong to a large family of proteins present in bacteria, archaea, and eukaryotes with no definitive function. The conserved domain is similar in structure to chorismate mutase but there is no sequence similarity and no...; Region: YjgF_YER057c_UK114_family; cd00448
160488016556	homotrimer interaction site [polypeptide binding]; other site
160488016557	putative active site [active]
160488016558	Nucleoside-diphosphate-sugar epimerases [Cell envelope biogenesis, outer membrane / Carbohydrate transport and metabolism]; Region: WcaG; COG0451
160488016559	atypical (a) SDRs, subgroup 4; Region: SDR_a4; cd05266
160488016560	putative NAD(P) binding site [chemical binding]; other site
160488016561	tonB-system energizer ExbB; Region: exbB; TIGR02797
160488016562	biopolymer transport protein ExbD; Provisional; Region: PRK11267
160488016563	Biopolymer transport protein [Intracellular trafficking and secretion]; Region: ExbD; COG0848
160488016564	Periplasmic protein TonB, links inner and outer membranes [Cell envelope biogenesis, outer membrane]; Region: TonB; COG0810
160488016565	Gram-negative bacterial tonB protein; Region: TonB; pfam03544
160488016566	DNA-binding transcriptional regulator OxyR; Provisional; Region: PRK11151
160488016567	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488016568	The C-terminal substrate-binding domain of the LysR-type transcriptional regulator OxyR, a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_OxyR; cd08411
160488016569	dimerization interface [polypeptide binding]; other site
160488016570	ATP-dependent DNA helicase RecG; Provisional; Region: PRK10917
160488016571	RecG_wedge_OBF: A subfamily of OB folds corresponding to the OB fold found in the N-terminal (wedge) domain of Escherichia coli RecG. RecG is a branched-DNA-specific helicase, which catalyzes the interconversion of a DNA replication fork to a...; Region: RecG_wedge_OBF; cd04488
160488016572	generic binding surface II; other site
160488016573	ssDNA binding site; other site
160488016574	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
160488016575	ATP binding site [chemical binding]; other site
160488016576	putative Mg++ binding site [ion binding]; other site
160488016577	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
160488016578	nucleotide binding region [chemical binding]; other site
160488016579	ATP-binding site [chemical binding]; other site
160488016580	YbaK-like.  The YbaK family of deacylase domains includes the INS amino acid-editing domain of  the bacterial class II prolyl tRNA synthetase (ProRS), and it's trans-acting homologs, YbaK, ProX, and PrdX. The primary function of INS is to hydrolyze...; Region: YbaK_like; cd04332
160488016581	putative deacylase active site [active]
160488016582	Predicted signal transduction protein [Signal transduction mechanisms]; Region: COG1639
160488016583	SCP-2 sterol transfer family; Region: SCP2; pfam02036
160488016584	Integration host factor (IHF) and HU are small heterodimeric members of the DNABII protein family that bind and bend DNA, functioning as architectural factors in many cellular processes including transcription, site-specific recombination, and...; Region: HU_IHF; cd00591
160488016585	IHF dimer interface [polypeptide binding]; other site
160488016586	IHF - DNA interface [nucleotide binding]; other site
160488016587	NADH:flavorubredoxin oxidoreductase; Provisional; Region: PRK04965
160488016588	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
160488016589	Rubredoxin [Energy production and conversion]; Region: COG1773
160488016590	Rubredoxin; nonheme iron binding domains containing a [Fe(SCys)4] center. Rubredoxins are small nonheme iron proteins. The iron atom is coordinated by four cysteine residues (Fe(S-Cys)4), but iron can also be replaced by cobalt, nickel or zinc. They are...; Region: rubredoxin; cd00730
160488016591	iron binding site [ion binding]; other site
160488016592	Chorismate lyase; Region: Chor_lyase; cl01230
160488016593	4-hydroxybenzoate octaprenyltransferase; Reviewed; Region: ubiA; PRK12848
160488016594	UbiA prenyltransferase family; Region: UbiA; pfam01040
160488016595	Secreted repeat of unknown function; Region: Lipoprotein_15; pfam03640
160488016596	Secreted repeat of unknown function; Region: Lipoprotein_15; pfam03640
160488016597	phosphate regulon transcriptional regulatory protein PhoB; Region: PhoB; TIGR02154
160488016598	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488016599	active site
160488016600	phosphorylation site [posttranslational modification]
160488016601	intermolecular recognition site; other site
160488016602	dimerization interface [polypeptide binding]; other site
160488016603	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
160488016604	DNA binding site [nucleotide binding]
160488016605	Domain of unknown function (DUF3329); Region: DUF3329; pfam11808
160488016606	phosphate regulon sensor kinase PhoR; Region: phoR_proteo; TIGR02966
160488016607	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
160488016608	putative active site [active]
160488016609	heme pocket [chemical binding]; other site
160488016610	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488016611	dimer interface [polypeptide binding]; other site
160488016612	phosphorylation site [posttranslational modification]
160488016613	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488016614	ATP binding site [chemical binding]; other site
160488016615	Mg2+ binding site [ion binding]; other site
160488016616	G-X-G motif; other site
160488016617	Hemolysins and related proteins containing CBS domains [General function prediction only]; Region: TlyC; COG1253
160488016618	Domain of unknown function DUF21; Region: DUF21; pfam01595
160488016619	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains associated with the CorC_HlyC domain. CorC_HlyC is a transporter associated domain. This small domain is found in Na+/H+ antiporters, in proteins involved in...; Region: CBS_pair_CorC_HlyC_assoc; cd04590
160488016620	Transporter associated domain; Region: CorC_HlyC; smart01091
160488016621	Domain of unknown function (DUF4124); Region: DUF4124; pfam13511
160488016622	Membrane proteins related to metalloendopeptidases [Cell envelope biogenesis, outer membrane]; Region: NlpD; COG0739
160488016623	Peptidase family M23; Region: Peptidase_M23; pfam01551
160488016624	Response regulator receiver domain; Region: Response_reg; pfam00072
160488016625	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488016626	active site
160488016627	phosphorylation site [posttranslational modification]
160488016628	intermolecular recognition site; other site
160488016629	dimerization interface [polypeptide binding]; other site
160488016630	transcriptional regulator PhoU; Provisional; Region: PRK11115
160488016631	PhoU domain; Region: PhoU; pfam01895
160488016632	PhoU domain; Region: PhoU; pfam01895
160488016633	phosphate transporter ATP-binding protein; Provisional; Region: PRK14236
160488016634	ATP-binding cassette domain of the phosphate transport system; Region: ABC_PstB_phosphate_transporter; cd03260
160488016635	Walker A/P-loop; other site
160488016636	ATP binding site [chemical binding]; other site
160488016637	Q-loop/lid; other site
160488016638	ABC transporter signature motif; other site
160488016639	Walker B; other site
160488016640	D-loop; other site
160488016641	H-loop/switch region; other site
160488016642	ABC-type phosphate transport system, auxiliary component [Inorganic ion transport and metabolism]; Region: COG4985
160488016643	ABC-type phosphate transport system, permease component [Inorganic ion transport and metabolism]; Region: PstA; COG0581
160488016644	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488016645	dimer interface [polypeptide binding]; other site
160488016646	conserved gate region; other site
160488016647	putative PBP binding loops; other site
160488016648	ABC-ATPase subunit interface; other site
160488016649	ABC-type uncharacterized transport system, permease component [General function prediction only]; Region: COG4590
160488016650	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
160488016651	dimer interface [polypeptide binding]; other site
160488016652	conserved gate region; other site
160488016653	putative PBP binding loops; other site
160488016654	ABC-ATPase subunit interface; other site
160488016655	phosphate binding protein; Region: ptsS_2; TIGR02136
160488016656	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488016657	metabolite-proton symporter; Region: 2A0106; TIGR00883
160488016658	putative substrate translocation pore; other site
160488016659	Brown fat-inducible thioesterase (BFIT).  Brain acyl-CoA hydrolase (BACH).  These enzymes deacylate long-chain fatty acids by hydrolyzing acyl-CoA thioesters to free fatty acids and CoA-SH. Eukaryotic members of this family are expressed in brain, testis; Region: BFIT_BACH; cd03442
160488016660	D-hexose-6-phosphate epimerase-like; Region: D-hex-6-P-epi_like; cd09020
160488016661	active site
160488016662	phosphate binding residues; other site
160488016663	catalytic residues [active]
160488016664	Protein of unknown function (DUF3299); Region: DUF3299; pfam11736
160488016665	Predicted membrane protein [Function unknown]; Region: COG2261
160488016666	phosphoribosylaminoimidazole carboxylase ATPase subunit; Reviewed; Region: PRK06019
160488016667	ATP-grasp domain; Region: ATP-grasp; pfam02222
160488016668	Phosphoribosylcarboxyaminoimidazole (NCAIR) mutase [Nucleotide transport and metabolism]; Region: PurE; COG0041
160488016669	cell density-dependent motility repressor; Provisional; Region: PRK10082
160488016670	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488016671	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
160488016672	dimerization interface [polypeptide binding]; other site
160488016673	aspartate ammonia-lyase; Provisional; Region: aspA; PRK12273
160488016674	Aspartase; Region: Aspartase; cd01357
160488016675	active sites [active]
160488016676	tetramer interface [polypeptide binding]; other site
160488016677	Arabinose-binding domain of AraC transcription regulator, N-term; Region: Arabinose_bd; pfam12625
160488016678	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
160488016679	Histone deacetylase class IIa; Region: HDAC_classII_APAH; cd10001
160488016680	Deacetylases, including yeast histone deacetylase and acetoin utilization protein [Chromatin structure and dynamics / Secondary metabolites biosynthesis, transport, and catabolism]; Region: AcuC; COG0123
160488016681	active site
160488016682	Zn binding site [ion binding]; other site
160488016683	putrescine transporter subunit: periplasmic-binding component of ABC superfamily; Provisional; Region: PRK10682
160488016684	Bacterial extracellular solute-binding protein; Region: SBP_bac_1; cl17199
160488016685	Transcriptional regulators containing a DNA-binding HTH domain and an aminotransferase domain (MocR family) and their eukaryotic orthologs [Transcription / Amino acid transport and metabolism]; Region: ARO8; COG1167
160488016686	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
160488016687	DNA-binding site [nucleotide binding]; DNA binding site
160488016688	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
160488016689	pyridoxal 5'-phosphate binding site [chemical binding]; other site
160488016690	homodimer interface [polypeptide binding]; other site
160488016691	catalytic residue [active]
160488016692	Putative FMN-binding domain; Region: FMN_bind_2; pfam04299
160488016693	Acetyltransferase (GNAT) domain; Region: Acetyltransf_10; pfam13673
160488016694	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
160488016695	Coenzyme A binding pocket [chemical binding]; other site
160488016696	Acetyltransferases, including N-acetylases of ribosomal proteins [Translation, ribosomal structure and biogenesis]; Region: RimL; COG1670
160488016697	Acetyltransferase (GNAT) family; Region: Acetyltransf_1; pfam00583
160488016698	pyruvate carboxylase subunit B; Validated; Region: PRK09282
160488016699	Pyruvate carboxylase and Transcarboxylase 5S, carboxyltransferase domain; Region: DRE_TIM_PC_TC_5S; cd07937
160488016700	active site
160488016701	catalytic residues [active]
160488016702	metal binding site [ion binding]; metal-binding site
160488016703	homodimer binding site [polypeptide binding]; other site
160488016704	The biotinyl-domain or biotin carboxyl carrier protein (BCCP) domain is present in all biotin-dependent enzymes, such as acetyl-CoA carboxylase, pyruvate carboxylase, propionyl-CoA carboxylase, methylcrotonyl-CoA carboxylase, geranyl-CoA carboxylase; Region: biotinyl_domain; cd06850
160488016705	carboxyltransferase (CT) interaction site; other site
160488016706	biotinylation site [posttranslational modification]; other site
160488016707	pyruvate carboxylase subunit A; Validated; Region: PRK07178
160488016708	Carbamoyl-phosphate synthase L chain, N-terminal domain; Region: CPSase_L_chain; pfam00289
160488016709	Carbamoyl-phosphate synthase L chain, ATP binding domain; Region: CPSase_L_D2; pfam02786
160488016710	Biotin carboxylase C-terminal domain; Region: Biotin_carb_C; smart00878
160488016711	Transcriptional regulator [Transcription]; Region: LysR; COG0583
160488016712	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488016713	The C-terminal substrate binding of LysR-type transcriptional regulator (CbbR) of RubisCO operon, which is involved in the carbon dioxide fixation, contains the type 2 periplasmic binding fold; Region: PBP2_CbbR_RubisCO_like; cd08419
160488016714	putative dimerization interface [polypeptide binding]; other site
160488016715	DNA-binding transcriptional regulator HexR; Provisional; Region: PRK11302
160488016716	Helix-turn-helix domain, rpiR family; Region: HTH_6; pfam01418
160488016717	RpiR-like protein. RpiR contains a SIS (Sugar ISomerase) domain, which is found in many phosphosugar isomerases and phosphosugar binding proteins. In E. coli, rpiR negatively regulates the expression of rpiB gene. Both rpiB and rpiA are ribose phosphate...; Region: SIS_RpiR; cd05013
160488016718	putative active site [active]
160488016719	glucose-6-phosphate 1-dehydrogenase; Validated; Region: PRK05722
160488016720	Glucose-6-phosphate dehydrogenase, NAD binding domain; Region: G6PD_N; pfam00479
160488016721	Glucose-6-phosphate dehydrogenase, C-terminal domain; Region: G6PD_C; pfam02781
160488016722	DNA-dependent helicase II; Provisional; Region: uvrD; PRK11773
160488016723	Part of AAA domain; Region: AAA_19; pfam13245
160488016724	Family description; Region: UvrD_C_2; pfam13538
160488016725	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4395
160488016726	SMI1 / KNR4 family (SUKH-1); Region: SMI1_KNR4; cl01747
160488016727	Kef-type K+ transport systems, membrane components [Inorganic ion transport and metabolism]; Region: KefB; COG0475
160488016728	Sodium/hydrogen exchanger family; Region: Na_H_Exchanger; pfam00999
160488016729	Brown fat-inducible thioesterase (BFIT).  Brain acyl-CoA hydrolase (BACH).  These enzymes deacylate long-chain fatty acids by hydrolyzing acyl-CoA thioesters to free fatty acids and CoA-SH. Eukaryotic members of this family are expressed in brain, testis; Region: BFIT_BACH; cd03442
160488016730	pyridoxamine kinase; Validated; Region: PRK05756
160488016731	Pyridoxal kinase plays a key role in the synthesis of the active coenzyme pyridoxal-5'-phosphate  (PLP), by catalyzing the phosphorylation of the precursor vitamin B6  in the presence of Zn2+ and ATP. Mammals are unable to synthesize PLP de novo and...; Region: pyridoxal_pyridoxamine_kinase; cd01173
160488016732	pyridoxal binding site [chemical binding]; other site
160488016733	dimer interface [polypeptide binding]; other site
160488016734	ATP binding site [chemical binding]; other site
160488016735	Protein of unknown function (DUF3301); Region: DUF3301; pfam11743
160488016736	Putative GTPases (G3E family) [General function prediction only]; Region: COG0523
160488016737	CobW/HypB/UreG, nucleotide-binding domain; Region: cobW; pfam02492
160488016738	Cobalamin synthesis protein cobW C-terminal domain; Region: CobW_C; pfam07683
160488016739	Protein of unknown function (DUF1826); Region: DUF1826; pfam08856
160488016740	Putative GTPases (G3E family) [General function prediction only]; Region: COG0523
160488016741	CobW/HypB/UreG, nucleotide-binding domain; Region: cobW; pfam02492
160488016742	Cobalamin synthesis protein cobW C-terminal domain; Region: CobW_C; smart00833
160488016743	Protein of unknown function (DUF3617); Region: DUF3617; pfam12276
160488016744	cardiolipin synthetase; Reviewed; Region: cls; PRK01642
160488016745	Putative catalytic domain, repeat 1, of Pseudomonas aeruginosa cardiolipin synthase and similar proteins; Region: PLDc_PaCLS_like_1; cd09155
160488016746	putative active site [active]
160488016747	catalytic site [active]
160488016748	Catalytic domain of phospholipase D superfamily proteins; Region: PLDc_SF; cl15239
160488016749	putative active site [active]
160488016750	catalytic site [active]
160488016751	Mycolic acid cyclopropane synthetase; Region: CMAS; pfam02353
160488016752	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
160488016753	S-adenosylmethionine binding site [chemical binding]; other site
160488016754	dihydrolipoamide dehydrogenase; Reviewed; Region: PRK06115
160488016755	Anaerobic glycerol-3-phosphate dehydrogenase [Amino acid transport and metabolism]; Region: GlpB; cl17730
160488016756	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
160488016757	Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852
160488016758	Transketolase, C-terminal subunit [Carbohydrate transport and metabolism]; Region: COG3958
160488016759	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
160488016760	putative substrate translocation pore; other site
160488016761	ethanolamine utilization protein EutQ; Provisional; Region: PRK15457
160488016762	putative aminophosphonate oxidoreductase; Region: Phn_aa_oxid; TIGR03329
160488016763	Glycine/D-amino acid oxidases (deaminating) [Amino acid transport and metabolism]; Region: DadA; COG0665
160488016764	Rubredoxin [Energy production and conversion]; Region: COG1773
160488016765	Rubredoxin; nonheme iron binding domains containing a [Fe(SCys)4] center. Rubredoxins are small nonheme iron proteins. The iron atom is coordinated by four cysteine residues (Fe(S-Cys)4), but iron can also be replaced by cobalt, nickel or zinc. They are...; Region: rubredoxin; cd00730
160488016766	iron binding site [ion binding]; other site
160488016767	NADH:flavorubredoxin oxidoreductase; Provisional; Region: PRK04965
160488016768	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
160488016769	Aldehyde dehydrogenase family; Region: Aldedh; pfam00171
160488016770	Uncharacterized Saccharopolyspora spinosa aldehyde dehydrogenase (AAS00426)-like; Region: ALDH_AAS00426; cd07109
160488016771	NAD(P) binding site [chemical binding]; other site
160488016772	catalytic residues [active]
160488016773	catalytic residues [active]
160488016774	Phenylpropionate dioxygenase and related ring-hydroxylating dioxygenases, large terminal subunit [Inorganic ion transport and metabolism / General function prediction only]; Region: HcaE; COG4638
160488016775	Rieske non-heme iron oxygenase (RO) family, N-terminal Rieske domain of the oxygenase alpha subunit; The RO family comprise a large class of aromatic ring-hydroxylating dioxygenases found predominantly in microorganisms. These enzymes enable...; Region: Rieske_RO_Alpha_N; cd03469
160488016776	[2Fe-2S] cluster binding site [ion binding]; other site
160488016777	C-terminal catalytic domain of the oxygenase alpha subunit of Rieske-type non-heme iron aromatic ring-hydroxylating oxygenases; Region: RHO_alpha_C; cd00680
160488016778	alpha subunit interface [polypeptide binding]; other site
160488016779	active site
160488016780	substrate binding site [chemical binding]; other site
160488016781	Fe binding site [ion binding]; other site
160488016782	BCCT family transporter; Region: BCCT; pfam02028
160488016783	DNA-binding transcriptional activator GcvA; Provisional; Region: PRK11139
160488016784	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
160488016785	The C-terminal substrate domain of LysR-type GcdR, TrPI, HvR and beta-lactamase regulators, and that of other closely related homologs; contains the type 2 periplasmic binding fold; Region: PBP2_GcdR_TrpI_HvrB_AmpR_like; cd08432
160488016786	dimerization interface [polypeptide binding]; other site
160488016787	substrate binding pocket [chemical binding]; other site
160488016788	Protein of unknown function (DUF2790); Region: DUF2790; pfam10976
160488016789	Predicted metal-binding protein [General function prediction only]; Region: COG3019
160488016790	Cytochrome C oxidase, cbb3-type, subunit III; Region: Cytochrome_CBB3; pfam13442
160488016791	Copper resistance protein B precursor (CopB); Region: CopB; pfam05275
160488016792	copper-resistance protein, CopA family; Region: copper_res_A; TIGR01480
160488016793	Multicopper oxidase; Region: Cu-oxidase_3; pfam07732
160488016794	Multicopper oxidase; Region: Cu-oxidase; pfam00394
160488016795	Copper resistance protein B precursor (CopB); Region: CopB; cl01476
160488016796	Multicopper oxidase; Region: Cu-oxidase_2; pfam07731
160488016797	heavy metal response regulator; Region: cztR_silR_copR; TIGR01387
160488016798	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
160488016799	active site
160488016800	phosphorylation site [posttranslational modification]
160488016801	intermolecular recognition site; other site
160488016802	dimerization interface [polypeptide binding]; other site
160488016803	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
160488016804	DNA binding site [nucleotide binding]
160488016805	heavy metal sensor kinase; Region: cztS_silS_copS; TIGR01386
160488016806	HAMP domain; Region: HAMP; pfam00672
160488016807	dimerization interface [polypeptide binding]; other site
160488016808	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
160488016809	dimer interface [polypeptide binding]; other site
160488016810	phosphorylation site [posttranslational modification]
160488016811	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
160488016812	ATP binding site [chemical binding]; other site
160488016813	Mg2+ binding site [ion binding]; other site
160488016814	G-X-G motif; other site
160488016815	Outer membrane efflux protein; Region: OEP; pfam02321
160488016816	Outer membrane efflux protein; Region: OEP; pfam02321
160488016817	copper/silver efflux system membrane fusion protein CusB; Provisional; Region: PRK09783
160488016818	HlyD family secretion protein; Region: HlyD_3; pfam13437
160488016819	Copper binding periplasmic protein CusF; Region: CusF_Ec; pfam11604
160488016820	Putative silver efflux pump [Inorganic ion transport and metabolism]; Region: COG3696
160488016821	Copper binding periplasmic protein CusF; Region: CusF_Ec; pfam11604
160488016822	Putative protein-S-isoprenylcysteine methyltransferase [Posttranslational modification, protein turnover, chaperones]; Region: STE14; COG2020
160488016823	Protein of unknown function (DUF2933); Region: DUF2933; pfam11666
160488016824	PQQ-dependent catabolism-associated beta-propeller protein; Region: PQQ_ABC_repeats; TIGR03866
160488016825	40-residue YVTN family beta-propeller repeat; Region: beta_rpt_yvtn; TIGR02276
160488016826	40-residue YVTN family beta-propeller repeat; Region: beta_rpt_yvtn; TIGR02276
160488016827	40-residue YVTN family beta-propeller repeat; Region: beta_rpt_yvtn; TIGR02276
160488016828	Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371
160488016829	metal-binding site [ion binding]
160488016830	Protein of unknown function DUF43; Region: DUF43; pfam01861
160488016831	Transposase C of IS166 homeodomain; Region: LZ_Tnp_IS66; pfam13007
160488016832	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3436
160488016833	putative Helix-turn-helix domain of transposase IS66; Region: HTH_Tnp_IS66; pfam13005
160488016834	Transposase IS66 family; Region: DDE_Tnp_IS66; pfam03050
160488016835	IS66 C-terminal element; Region: DDE_Tnp_IS66_C; pfam13817
160488016836	IS66 Orf2 like protein; Region: TnpB_IS66; pfam05717
160488016837	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3436
160488016838	Transposase; Region: HTH_Tnp_1; pfam01527
160488016839	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
160488016840	Domain of unknown function (DUF955); Region: DUF955; cl01076
160488016841	NAD-dependent deacetylase; Provisional; Region: PRK00481
160488016842	SIRT5_Af1_CobB: Eukaryotic, archaeal and prokaryotic group (class3) which includes human sirtuin SIRT5, Archaeoglobus fulgidus Sir2-Af1, and E. coli CobB; and are members of the SIR2 family of proteins, silent information regulator 2 (Sir2) enzymes which...; Region: SIRT5_Af1_CobB; cd01412
160488016843	NAD+ binding site [chemical binding]; other site
160488016844	substrate binding site [chemical binding]; other site
160488016845	Zn binding site [ion binding]; other site
160488016846	AAA domain; Region: AAA_22; pfam13401
160488016847	glucosamine--fructose-6-phosphate aminotransferase; Reviewed; Region: PRK00331
160488016848	Glutamine amidotransferases class-II (Gn-AT)_GFAT-type. This domain is found at the N-terminus of glucosamine-6P synthase (GlmS, or GFAT in humans).  The glutaminase domain catalyzes amide nitrogen transfer from glutamine to the appropriate substrate. In...; Region: GFAT; cd00714
160488016849	glutaminase active site [active]
160488016850	SIS (Sugar ISomerase) domain repeat 1 found in Glucosamine 6-phosphate synthase (GlmS) and Glucosamine-6-phosphate deaminase (GlmD). The SIS domain is found in many phosphosugar isomerases and phosphosugar binding proteins. GlmS contains a N-terminal...; Region: SIS_GlmS_GlmD_1; cd05008
160488016851	dimer interface [polypeptide binding]; other site
160488016852	active site
160488016853	SIS (Sugar ISomerase) domain repeat 2 found in Glucosamine 6-phosphate synthase (GlmS) and Glucosamine-6-phosphate deaminase (GlmD). The SIS domain is found in many phosphosugar isomerases and phosphosugar binding proteins. GlmS contains a N-terminal...; Region: SIS_GlmS_GlmD_2; cd05009
160488016854	dimer interface [polypeptide binding]; other site
160488016855	active site
160488016856	DNA-bindng transcriptional repressor SrlR; Provisional; Region: srlR; PRK10434
160488016857	helix_turn_helix, Deoxyribose operon repressor; Region: HTH_DEOR; smart00420
160488016858	DeoR C terminal sensor domain; Region: DeoRC; pfam00455
160488016859	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase; Region: glmU; TIGR01173
160488016860	N-terminal domain of bacterial GlmU; Region: GT2_GlmU_N_bac; cd02540
160488016861	Substrate binding site; other site
160488016862	Mg++ binding site; other site
160488016863	N-acetyl-glucosamine-1-phosphate uridyltransferase (GlmU), C-terminal left-handed beta-helix (LbH) acetyltransferase domain: GlmU is also known as UDP-N-acetylglucosamine pyrophosphorylase. It is a bifunctional bacterial enzyme that catalyzes two...; Region: LbH_GlmU_C; cd03353
160488016864	active site
160488016865	substrate binding site [chemical binding]; other site
160488016866	CoA binding site [chemical binding]; other site
160488016867	F0F1 ATP synthase subunit epsilon; Validated; Region: atpC; PRK00571
160488016868	mitochondrial ATP synthase delta subunit; Region: F1-ATPase_delta; cd12152
160488016869	gamma subunit interface [polypeptide binding]; other site
160488016870	epsilon subunit interface [polypeptide binding]; other site
160488016871	LBP interface [polypeptide binding]; other site
160488016872	F0F1 ATP synthase subunit beta; Validated; Region: PRK09280
160488016873	ATP synthase alpha/beta family, beta-barrel domain; Region: ATP-synt_ab_N; pfam02874
160488016874	F1 ATP synthase beta subunit, nucleotide-binding domain. The F-ATPase is found in bacterial plasma membranes, mitochondrial inner membranes and in chloroplast thylakoid membranes. It has also been found in the archaea Methanosarcina barkeri. It uses a...; Region: F1-ATPase_beta; cd01133
160488016875	alpha subunit interaction interface [polypeptide binding]; other site
160488016876	Walker A motif; other site
160488016877	ATP binding site [chemical binding]; other site
160488016878	Walker B motif; other site
160488016879	inhibitor binding site; inhibition site
160488016880	ATP synthase alpha/beta chain, C terminal domain; Region: ATP-synt_ab_C; pfam00306
160488016881	mitochondrial ATP synthase gamma subunit; Region: F1-ATPase_gamma; cd12151
160488016882	core domain interface [polypeptide binding]; other site
160488016883	delta subunit interface [polypeptide binding]; other site
160488016884	epsilon subunit interface [polypeptide binding]; other site
160488016885	F0F1 ATP synthase subunit alpha; Validated; Region: PRK09281
160488016886	ATP synthase alpha/beta family, beta-barrel domain; Region: ATP-synt_ab_N; pfam02874
160488016887	F1 ATP synthase alpha, central domain. The F-ATPase is found in bacterial plasma membranes, mitochondrial inner membranes and in chloroplast thylakoid membranes. It has also been found in the archaea Methanosarcina barkeri. It uses a proton gradient to...; Region: F1_ATPase_alpha; cd01132
160488016888	beta subunit interaction interface [polypeptide binding]; other site
160488016889	Walker A motif; other site
160488016890	ATP binding site [chemical binding]; other site
160488016891	Walker B motif; other site
160488016892	ATP synthase alpha/beta chain, C terminal domain; Region: ATP-synt_ab_C; pfam00306
160488016893	F0F1 ATP synthase subunit delta; Validated; Region: PRK05758
160488016894	ATP synthase delta (OSCP) subunit; Region: OSCP; pfam00213
160488016895	F0F1-type ATP synthase, subunit b [Energy production and conversion]; Region: AtpF; COG0711
160488016896	F0F1 ATP synthase subunit B; Validated; Region: PRK05759
160488016897	F0F1 ATP synthase subunit C; Validated; Region: PRK06876
160488016898	F0F1-type ATP synthase, subunit a [Energy production and conversion]; Region: AtpB; COG0356
160488016899	F0F1 ATP synthase subunit A; Validated; Region: PRK05815
160488016900	F0F1 ATP synthase subunit I; Validated; Region: PRK05760