-- dump date   	20140620_055119
-- class       	Genbank::misc_feature
-- table       	misc_feature_note
-- id	note
568708000002	bifunctional aspartokinase I/homoserine dehydrogenase I; Provisional; Region: thrA; PRK09436
568708000003	AAK_AK-HSDH: Amino Acid Kinase Superfamily (AAK), AK-HSDH; this CD includes the N-terminal catalytic domain of aspartokinase (AK) of the bifunctional enzyme AK - homoserine dehydrogenase (HSDH). These aspartokinases are found in bacteria (E. coli...; Region: AAK_AK-HSDH; cd04257
568708000004	putative catalytic residues [active]
568708000005	putative nucleotide binding site [chemical binding]; other site
568708000006	putative aspartate binding site [chemical binding]; other site
568708000007	ACT domains of the bifunctional enzyme aspartokinase (AK) - homoserine dehydrogenase (HSDH); Region: ACT_AKi-HSDH-ThrA-like_1; cd04921
568708000008	dimer interface [polypeptide binding]; other site
568708000009	putative threonine allosteric regulatory site; other site
568708000010	ACT domains of the bifunctional enzyme aspartokinase (AK) - homoserine dehydrogenase (HSDH); Region: ACT_AKi-HSDH-ThrA_2; cd04922
568708000011	putative threonine allosteric regulatory site; other site
568708000012	Homoserine dehydrogenase, NAD binding domain; Region: NAD_binding_3; pfam03447
568708000013	Homoserine dehydrogenase; Region: Homoserine_dh; pfam00742
568708000018	homoserine kinase; Provisional; Region: PRK01212
568708000019	GHMP kinases N terminal domain; Region: GHMP_kinases_N; pfam00288
568708000022	Threonine synthase [Amino acid transport and metabolism]; Region: ThrC; COG0498
568708000023	Threonine synthase catalyzes the final step of threonine biosynthesis. The conversion of O-phosphohomoserine into threonine and inorganic phosphate is pyridoxal 5'-phosphate dependent. The Thr-synth_1 CD includes members from higher plants; Region: Thr-synth_2; cd01560
568708000024	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708000025	catalytic residue [active]
568708000027	hypothetical protein; Validated; Region: PRK02101
568708000029	Na+/alanine symporter [Amino acid transport and metabolism]; Region: AlsT; COG1115
568708000030	Sodium:alanine symporter family; Region: Na_Ala_symp; pfam01235
568708000031	9 probable transmembrane helices predicted for STM_MW00051 by TMHMM2.0 at aa 13-35, 75-97, 136-158, 171-193, 203-225, 301-323, 343-365, 386-408 and 413-435
568708000033	transaldolase-like protein; Provisional; Region: PTZ00411
568708000034	Transaldolases including both TalA and TalB; Region: Transaldolase_TalAB; cd00957
568708000035	active site
568708000036	dimer interface [polypeptide binding]; other site
568708000037	catalytic residue [active]
568708000039	MogA_MoaB family. Members of this family are involved in biosynthesis of the molybdenum cofactor (MoCF) an essential cofactor of a diverse group of redox enzymes. MoCF biosynthesis is an evolutionarily conserved pathway present in eubacteria, archaea; Region: MogA_MoaB; cd00886
568708000040	MPT binding site; other site
568708000041	trimer interface [polypeptide binding]; other site
568708000043	hypothetical protein; Provisional; Region: PRK10659
568708000045	6 probable transmembrane helices predicted for STM_MW00081 by TMHMM2.0 at aa 12-34, 38-57, 64-86, 96-118, 125-144 and 148-170
568708000046	hypothetical protein; Provisional; Region: PRK10236
568708000047	Domain of unknown function (DUF3944); Region: DUF3944; pfam13099
568708000048	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4735
568708000050	Protein of unknown function (DUF2541); Region: DUF2541; pfam10807
568708000052	Signal peptide predicted for STM_MW00101 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.944 between residues 23 and 24
568708000053	molecular chaperone DnaK; Provisional; Region: dnaK; PRK00290
568708000054	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cl17037
568708000055	nucleotide binding site [chemical binding]; other site
568708000057	chaperone protein DnaJ; Provisional; Region: PRK10767
568708000058	DnaJ domain or J-domain.  DnaJ/Hsp40 (heat shock protein 40) proteins are highly conserved and play crucial roles in protein translation, folding, unfolding, translocation, and degradation. They act primarily by stimulating the ATPase activity of Hsp70s; Region: DnaJ; cd06257
568708000059	HSP70 interaction site [polypeptide binding]; other site
568708000060	C-terminal substrate binding domain of DnaJ and HSP40; Region: DnaJ_C; cl03262
568708000061	substrate binding site [polypeptide binding]; other site
568708000062	Zinc finger domain of DnaJ and HSP40; Region: DnaJ_zf; cd10719
568708000063	Zn binding sites [ion binding]; other site
568708000064	C-terminal substrate binding domain of DnaJ and HSP40; Region: DnaJ_C; cd10747
568708000065	dimer interface [polypeptide binding]; other site
568708000069	Transcriptional regulator [Transcription]; Region: LysR; COG0583
568708000070	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708000071	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
568708000072	dimerization interface [polypeptide binding]; other site
568708000074	3 probable transmembrane helices predicted for STM_MW00141 by TMHMM2.0 at aa 15-37, 50-72 and 82-101
568708000075	Lysozyme family protein [General function prediction only]; Region: zliS; COG3926
568708000076	Glycosyl hydrolase 108; Region: Glyco_hydro_108; pfam05838
568708000077	Predicted Peptidoglycan domain; Region: PG_binding_3; pfam09374
568708000080	DNA-binding winged-HTH domains [Transcription]; Region: CadC; COG3710
568708000081	1 probable transmembrane helix predicted for STM_MW00161 by TMHMM2.0 at aa 127-146
568708000082	Chitinase [Carbohydrate transport and metabolism]; Region: ChiA; COG3325
568708000083	The GH18 (glycosyl hydrolases, family 18) type II chitinases hydrolyze chitin, an abundant polymer of N-acetylglucosamine and have been identified in bacteria, fungi, insects, plants, viruses, and protozoan parasites. The structure of this domain is an...; Region: GH18_chitinase; cd06548
568708000084	active site
568708000085	Uncharacterized protein contain chitin-binding domain type 3 [General function prediction only]; Region: COG3979
568708000086	Chitin-binding domain of chitinase C; Region: ChiC_BD; cd12215
568708000087	aromatic chitin/cellulose binding site residues [chemical binding]; other site
568708000090	cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases [Signal transduction mechanisms]; Region: Crp; COG0664
568708000091	Helix-turn-helix domain; Region: HTH_36; pfam13730
568708000092	fimbrial protein BcfA; Provisional; Region: PRK15187
568708000093	Signal peptide predicted for STM_MW00201 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.993 between residues 24 and 25
568708000095	fimbrial chaperone protein BcfB; Provisional; Region: PRK15188
568708000096	Gram-negative pili assembly chaperone, N-terminal domain; Region: Pili_assembly_N; pfam00345
568708000097	Gram-negative pili assembly chaperone, C-terminal domain; Region: Pili_assembly_C; pfam02753
568708000098	Signal peptide predicted for STM_MW00211 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.937 between residues 26 and 27
568708000099	1 probable transmembrane helix predicted for STM_MW00211 by TMHMM2.0 at aa 7-29
568708000102	outer membrane usher protein; Provisional; Region: PRK15193
568708000103	PapC N-terminal domain; Region: PapC_N; pfam13954
568708000104	Type VII secretion system (T7SS), usher protein; Region: Usher; pfam00577
568708000105	PapC C-terminal domain; Region: PapC_C; pfam13953
568708000106	Signal peptide predicted for STM_MW00221 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.999 between residues 35 and 36
568708000108	fimbrial protein BcfD; Provisional; Region: PRK15189
568708000109	Signal peptide predicted for STM_MW00231 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.989 between residues 21 and 22
568708000111	fimbrial protein BcfE; Provisional; Region: PRK15190
568708000112	Signal peptide predicted for STM_MW00241 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.758 between residues 23 and 24
568708000114	fimbrial protein BcfF; Provisional; Region: PRK15191
568708000115	Signal peptide predicted for STM_MW00251 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.997 between residues 20 and 21
568708000117	fimbrial chaperone BcfG; Provisional; Region: PRK15192
568708000118	Gram-negative pili assembly chaperone, N-terminal domain; Region: Pili_assembly_N; pfam00345
568708000119	Gram-negative pili assembly chaperone, C-terminal domain; Region: Pili_assembly_C; pfam02753
568708000120	1 probable transmembrane helix predicted for STM_MW00261 by TMHMM2.0 at aa 13-35
568708000123	DsbA family, Com1-like subfamily; composed of proteins similar to Com1, a 27-kDa outer membrane-associated immunoreactive protein originally found in both acute and chronic disease strains of the pathogenic bacteria Coxiella burnetti. It contains a CXXC...; Region: DsbA_Com1_like; cd03023
568708000124	DSBA-like thioredoxin domain; Region: DSBA; pfam01323
568708000125	catalytic residues [active]
568708000126	Signal peptide predicted for STM_MW00271 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.986 between residues 27 and 28
568708000128	DNA-binding winged-HTH domains [Transcription]; Region: CadC; COG3710
568708000129	1 probable transmembrane helix predicted for STM_MW00291 by TMHMM2.0 at aa 128-147
568708000131	Transcriptional regulator [Transcription]; Region: LysR; COG0583
568708000132	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708000133	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
568708000135	DNA-binding winged-HTH domains [Transcription]; Region: CadC; COG3710
568708000136	1 probable transmembrane helix predicted for STM_MW00311 by TMHMM2.0 at aa 128-145
568708000138	Arylsulfotransferase (ASST); Region: Arylsulfotrans; pfam05935
568708000140	5'-nucleotidase/2',3'-cyclic phosphodiesterase and related esterases [Nucleotide transport and metabolism]; Region: UshA; COG0737
568708000141	Escherichia coli UshA-like family, N-terminal metallophosphatase domain; Region: MPP_UshA_N_like; cd00845
568708000142	active site
568708000143	metal binding site [ion binding]; metal-binding site
568708000144	5'-nucleotidase, C-terminal domain; Region: 5_nucleotid_C; pfam02872
568708000147	Signal peptide predicted for STM_MW00341 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.798 between residues 29 and 30
568708000148	Nucleoside-specific channel-forming protein, Tsx; Region: Channel_Tsx; pfam03502
568708000150	Signal peptide predicted for STM_MW00351 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 24 and 25
568708000151	Arylsulfatase A and related enzymes [Inorganic ion transport and metabolism]; Region: AslA; COG3119
568708000152	Sulfatase; Region: Sulfatase; pfam00884
568708000153	Signal peptide predicted for STM_MW00361 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.916 between residues 25 and 26
568708000154	1 probable transmembrane helix predicted for STM_MW00361 by TMHMM2.0 at aa 5-27
568708000156	anaerobic sulfatase-maturating enzyme; Region: sulfatase_rSAM; TIGR03942
568708000157	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
568708000158	FeS/SAM binding site; other site
568708000159	radical SAM additional 4Fe4S-binding SPASM domain; Region: rSAM_more_4Fe4S; TIGR04085
568708000161	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3677
568708000163	Arylsulfotransferase (ASST); Region: Arylsulfotrans; pfam05935
568708000165	pH-dependent sodium/proton antiporter; Reviewed; Region: nhaA; PRK09561
568708000166	Signal peptide predicted for STM_MW00401 by SignalP 2.0 HMM (Signal peptide probability 0.985) with cleavage site probability 0.378 between residues 35 and 36
568708000168	11 probable transmembrane helices predicted for STM_MW00401 by TMHMM2.0 at aa 7-29, 59-76, 96-115, 125-147, 154-176, 180-202, 215-237, 257-279, 291-313, 328-350 and 357-379
568708000169	transcriptional activator NhaR; Provisional; Region: nhaR; PRK11062
568708000170	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708000171	The C-terminal substrate binding domain of LysR-type transcriptional activator of the nhaA gene, encoding Na+/H+ antiporter, contains the type 2 periplasmic binding fold; Region: PBP2_NhaR; cd08429
568708000172	putative dimerization interface [polypeptide binding]; other site
568708000175	putative alpha-glucosidase; Provisional; Region: PRK10658
568708000176	Galactose mutarotase-like; Region: Gal_mutarotas_2; pfam13802
568708000177	XylS is a glycosyl hydrolase family 31 (GH31) alpha-xylosidase found in prokaryotes, eukaryotes, and archaea, that catalyzes the release of alpha-xylose from the non-reducing terminal side of the alpha-xyloside substrate. XylS has been characterized in...; Region: GH31_xylosidase_XylS; cd06591
568708000178	putative active site [active]
568708000179	putative catalytic site [active]
568708000181	Na+/melibiose symporter and related transporters [Carbohydrate transport and metabolism]; Region: MelB; COG2211
568708000182	melibiose:sodium symporter; Provisional; Region: PRK10429; cl15392
568708000183	11 probable transmembrane helices predicted for STM_MW00431 by TMHMM2.0 at aa 42-64, 92-109, 124-146, 167-184, 189-211, 240-257, 277-299, 306-326, 336-358, 371-396 and 416-438
568708000185	30S ribosomal protein S20; Reviewed; Region: rpsT; PRK00239
568708000187	Protein of unknown function (DUF2575); Region: DUF2575; pfam10837
568708000189	bifunctional riboflavin kinase/FMN adenylyltransferase; Reviewed; Region: PRK05627
568708000190	FAD synthetase, N-terminal domain of the bifunctional enzyme; Region: FAD_synthetase_N; cd02064
568708000191	active site
568708000192	Riboflavin kinase; Region: Flavokinase; smart00904
568708000195	isoleucyl-tRNA synthetase; Reviewed; Region: ileS; PRK05743
568708000196	nucleotidyl transferase superfamily; Region: nt_trans; cl00015
568708000197	active site
568708000198	HIGH motif; other site
568708000199	nucleotide binding site [chemical binding]; other site
568708000200	catalytic core domain of isoleucyl-tRNA synthetases; Region: IleRS_core; cd00818
568708000201	active site
568708000202	KMSKS motif; other site
568708000203	Anticodon-binding domain of bacterial and eukaryotic mitochondrial isoleucyl tRNA synthetases; Region: Anticodon_Ia_Ile_BEm; cd07960
568708000204	tRNA binding surface [nucleotide binding]; other site
568708000205	anticodon binding site; other site
568708000206	Zinc finger found in FPG and IleRS; Region: zf-FPG_IleRS; pfam06827
568708000210	lipoprotein signal peptidase; Reviewed; Region: lspA; PRK00376
568708000211	4 probable transmembrane helices predicted for STM_MW00481 by TMHMM2.0 at aa 13-35, 67-86, 99-121 and 136-158
568708000213	FKBP-type peptidyl-prolyl cis-trans isomerase; Provisional; Region: PRK15095
568708000214	FKBP-type peptidyl-prolyl cis-trans isomerase; Region: FKBP_C; pfam00254
568708000216	4-hydroxy-3-methylbut-2-enyl diphosphate reductase; Reviewed; Region: ispH; PRK01045
568708000217	4-Hydroxy-3-methylbut-2-enyl diphosphate reductase IspH [Lipid metabolism]; Region: lytB; COG0761
568708000219	Signal peptide predicted for STM_MW00511 by SignalP 2.0 HMM (Signal peptide probability 0.625) with cleavage site probability 0.364 between residues 22 and 23
568708000220	nuc_hydro_IU_UC_XIUA: inosine-uridine preferring, xanthosine-inosine-uridine-adenosine-preferring and, uridine-cytidine preferring nucleoside hydrolases. Nucleoside hydrolases cleave the N-glycosidic bond in nucleosides generating ribose and the...; Region: nuc_hydro_IU_UC_XIUA; cd02651
568708000221	active site
568708000222	tetramer interface [polypeptide binding]; other site
568708000224	Response regulator of citrate/malate metabolism [Transcription / Signal transduction mechanisms]; Region: CitB; COG4565
568708000225	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708000226	active site
568708000227	phosphorylation site [posttranslational modification]
568708000228	intermolecular recognition site; other site
568708000229	dimerization interface [polypeptide binding]; other site
568708000230	Transcriptional regulator; Region: CitT; pfam12431
568708000232	Signal transduction histidine kinase regulating citrate/malate metabolism [Signal transduction mechanisms]; Region: CitA; COG3290
568708000233	PAS domain; Region: PAS; smart00091
568708000234	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708000235	ATP binding site [chemical binding]; other site
568708000236	Mg2+ binding site [ion binding]; other site
568708000237	G-X-G motif; other site
568708000238	2 probable transmembrane helices predicted for STM_MW00541 by TMHMM2.0 at aa 20-39 and 173-195
568708000240	oxaloacetate decarboxylase subunit beta; Provisional; Region: PRK15476
568708000241	9 probable transmembrane helices predicted for STM_MW00551 by TMHMM2.0 at aa 13-35, 42-64, 125-147, 160-182, 214-236, 266-288, 308-327, 339-361 and 409-431
568708000243	oxaloacetate decarboxylase; Provisional; Region: PRK14040
568708000244	Pyruvate carboxylase and Transcarboxylase 5S, carboxyltransferase domain; Region: DRE_TIM_PC_TC_5S; cd07937
568708000245	active site
568708000246	catalytic residues [active]
568708000247	metal binding site [ion binding]; metal-binding site
568708000248	homodimer binding site [polypeptide binding]; other site
568708000249	The biotinyl-domain or biotin carboxyl carrier protein (BCCP) domain is present in all biotin-dependent enzymes, such as acetyl-CoA carboxylase, pyruvate carboxylase, propionyl-CoA carboxylase, methylcrotonyl-CoA carboxylase, geranyl-CoA carboxylase; Region: biotinyl_domain; cd06850
568708000250	carboxyltransferase (CT) interaction site; other site
568708000251	biotinylation site [posttranslational modification]; other site
568708000255	oxaloacetate decarboxylase subunit gamma; Provisional; Region: PRK02919
568708000257	1 probable transmembrane helix predicted for STM_MW00571 by TMHMM2.0 at aa 10-32
568708000258	Na+/citrate symporter [Energy production and conversion]; Region: CitS; COG3493
568708000259	12 probable transmembrane helices predicted for STM_MW00581 by TMHMM2.0 at aa 23-45, 52-69, 79-101, 114-132, 147-169, 176-198, 208-230, 269-286, 296-318, 331-348, 363-385 and 425-444
568708000261	Citrate lyase synthetase [Energy production and conversion]; Region: CitC; COG3053
568708000262	Citrate lyase ligase; Region: Citrate_lyase_ligase; cd02169
568708000263	putative active site [active]
568708000264	(T/H)XGH motif; other site
568708000266	Citrate lyase, gamma subunit [Energy production and conversion]; Region: CitD; COG3052
568708000268	HpcH/HpaI aldolase/citrate lyase family; Region: HpcH_HpaI; cl17231
568708000269	Signal peptide predicted for STM_MW00611 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.975 between residues 25 and 26
568708000271	Citrate lyase, alpha subunit [Energy production and conversion]; Region: CitF; COG3051
568708000272	Acetyl-CoA hydrolase/transferase C-terminal domain; Region: AcetylCoA_hyd_C; pfam13336
568708000274	Phosphoribosyl-dephospho-CoA transferase (holo-ACP synthetase) [Coenzyme metabolism / Lipid metabolism]; Region: CitX; COG3697
568708000276	triphosphoribosyl-dephospho-CoA synthase CitG; Region: citrate_citG; TIGR03125
568708000278	Dihydrodipicolinate reductase [Amino acid transport and metabolism]; Region: DapB; COG0289
568708000279	Dihydrodipicolinate reductase, N-terminus; Region: DapB_N; pfam01113
568708000280	Dihydrodipicolinate reductase, C-terminus; Region: DapB_C; pfam05173
568708000283	tmhmm; query 1-116
568708000284	carbamoyl phosphate synthase small subunit; Reviewed; Region: PRK12564
568708000285	Carbamoyl-phosphate synthase small chain, CPSase domain; Region: CPSase_sm_chain; smart01097
568708000286	Small chain of the glutamine-dependent form of carbamoyl phosphate synthase, CPSase II; Region: GATase1_CPSase; cd01744
568708000287	catalytic site [active]
568708000288	subunit interface [polypeptide binding]; other site
568708000291	carbamoyl phosphate synthase large subunit; Reviewed; Region: carB; PRK05294
568708000292	Carbamoyl-phosphate synthase L chain, N-terminal domain; Region: CPSase_L_chain; pfam00289
568708000293	Carbamoyl-phosphate synthase L chain, ATP binding domain; Region: CPSase_L_D2; pfam02786
568708000294	Carbamoyl-phosphate synthetase large chain, oligomerisation domain; Region: CPSase_L_D3; pfam02787
568708000295	Carbamoyl-phosphate synthase L chain, N-terminal domain; Region: CPSase_L_chain; pfam00289
568708000296	ATP-grasp domain; Region: ATP-grasp_4; cl17255
568708000297	Methylglyoxal synthase-like domain from type II glutamine-dependent carbamoyl phosphate synthetase (CSP). CSP, a CarA and CarB heterodimer, catalyzes the production of carbamoyl phosphate which is subsequently employed in the metabolic pathways...; Region: MGS_CPS_II; cd01424
568708000298	IMP binding site; other site
568708000299	dimer interface [polypeptide binding]; other site
568708000300	interdomain contacts; other site
568708000301	partial ornithine binding site; other site
568708000302	Signal peptide predicted for STM_MW00691 by SignalP 2.0 HMM (Signal peptide probability 0.643) with cleavage site probability 0.569 between residues 23 and 24
568708000307	DNA-binding transcriptional activator CaiF; Provisional; Region: PRK11476
568708000309	carnitine operon protein CaiE; Provisional; Region: PRK13627
568708000310	paaY-like: This group is composed by uncharacterized proteins with similarity to the protein product of the E. coli paaY gene, which is part of the paa gene cluster responsible for phenylacetic acid degradation. Proteins in this group are expected to...; Region: LbH_paaY_like; cd04745
568708000311	putative trimer interface [polypeptide binding]; other site
568708000312	putative metal binding site [ion binding]; other site
568708000314	carnitinyl-CoA dehydratase; Provisional; Region: PRK03580
568708000315	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
568708000316	substrate binding site [chemical binding]; other site
568708000317	oxyanion hole (OAH) forming residues; other site
568708000318	trimer interface [polypeptide binding]; other site
568708000320	putative crotonobetaine/carnitine-CoA ligase; Validated; Region: caiC; PRK08008
568708000321	Uncharacterized subfamily of fatty acid CoA ligase (FACL); Region: FACL_DitJ_like; cd05934
568708000322	acyl-activating enzyme (AAE) consensus motif; other site
568708000323	putative AMP binding site [chemical binding]; other site
568708000324	putative active site [active]
568708000325	putative CoA binding site [chemical binding]; other site
568708000327	crotonobetainyl-CoA:carnitine CoA-transferase; Provisional; Region: PRK03525
568708000328	CoA-transferase family III; Region: CoA_transf_3; pfam02515
568708000330	crotonobetainyl-CoA dehydrogenase; Validated; Region: PRK03354
568708000331	Acyl-CoA dehydrogenase; Region: ACAD; cd00567
568708000332	active site
568708000336	L-carnitine/gamma-butyrobetaine antiporter; Provisional; Region: PRK03356
568708000337	12 probable transmembrane helices predicted for STM_MW00761 by TMHMM2.0 at aa 13-30, 50-72, 92-114, 144-163, 195-214, 229-251, 264-286, 312-334, 347-366, 410-432, 445-467 and 472-494
568708000339	The electron transfer flavoprotein (ETF) serves as a specific electron acceptor for various mitochondrial dehydrogenases. ETF transfers electrons to the main respiratory chain via ETF-ubiquinone oxidoreductase. ETF is an heterodimer that consists of an...; Region: ETF_beta; cd01714
568708000340	Ligand binding site [chemical binding]; other site
568708000341	Electron transfer flavoprotein domain; Region: ETF; pfam01012
568708000343	putative electron transfer flavoprotein FixB; Provisional; Region: fixB; PRK03363
568708000344	Electron transfer flavoprotein domain; Region: ETF; smart00893
568708000345	Electron transfer flavoprotein FAD-binding domain; Region: ETF_alpha; pfam00766
568708000348	putative oxidoreductase FixC; Provisional; Region: PRK10157
568708000350	ferredoxin-like protein FixX; Provisional; Region: PRK15449
568708000351	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708000352	Sugar (and other) transporter; Region: Sugar_tr; pfam00083
568708000353	putative substrate translocation pore; other site
568708000354	11 probable transmembrane helices predicted for STM_MW00811 by TMHMM2.0 at aa 47-69, 82-104, 113-132, 137-159, 172-194, 199-221, 272-294, 309-331, 352-374, 400-422 and 427-449
568708000356	Bacterial protein of unknown function (DUF903); Region: DUF903; pfam06004
568708000357	Signal peptide predicted for STM_MW00821 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.786 between residues 37 and 38
568708000359	Signal peptide predicted for STM_MW00841 by SignalP 2.0 HMM (Signal peptide probability 0.955) with cleavage site probability 0.672 between residues 18 and 19
568708000360	Protein of unknown function (DUF1471); Region: DUF1471; pfam07338
568708000362	Signal peptide predicted for STM_MW00851 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.993 between residues 21 and 22
568708000364	1 probable transmembrane helix predicted for STM_MW00871 by TMHMM2.0 at aa 25-47
568708000365	Arylsulfatase A and related enzymes [Inorganic ion transport and metabolism]; Region: AslA; COG3119
568708000366	Sulfatase; Region: Sulfatase; cl17466
568708000367	Sulfatase; Region: Sulfatase; cl17466
568708000368	Sulfatase; Region: Sulfatase; cl17466
568708000369	Signal peptide predicted for STM_MW00881 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.874 between residues 38 and 39
568708000372	glutathione-regulated potassium-efflux system ancillary protein KefF; Provisional; Region: PRK00871
568708000374	glutathione-regulated potassium-efflux system protein KefC; Provisional; Region: PRK03562
568708000375	transporter, monovalent cation:proton antiporter-2 (CPA2) family; Region: 2a37; TIGR00932
568708000376	TrkA-N domain; Region: TrkA_N; pfam02254
568708000377	13 probable transmembrane helices predicted for STM_MW00911 by TMHMM2.0 at aa 5-24, 26-45, 55-74, 86-108, 112-134, 147-169, 179-201, 214-233, 237-254, 267-289, 293-315, 327-349 and 359-378
568708000380	Dihydrofolate reductase [Coenzyme metabolism]; Region: FolA; COG0262
568708000381	Dihydrofolate reductase (DHFR). Reduces 7,8-dihydrofolate to 5,6,7,8-tetrahydrofolate with NADPH as a cofactor. This is an essential step in the biosynthesis of deoxythymidine phosphate since 5,6,7,8-tetrahydrofolate is required to regenerate 5; Region: DHFR; cd00209
568708000382	folate binding site [chemical binding]; other site
568708000383	NADP+ binding site [chemical binding]; other site
568708000385	bis(5'-nucleosyl)-tetraphosphatase (symmetrical); Region: apaH; TIGR00668
568708000386	Escherichia coli ApaH and related proteins, metallophosphatase domain; Region: MPP_ApaH; cd07422
568708000387	active site
568708000388	metal binding site [ion binding]; metal-binding site
568708000390	CO2+/MG2+ efflux protein ApaG; Reviewed; Region: apaG; PRK05461
568708000392	16S ribosomal RNA methyltransferase KsgA/Dim1 family protein; Reviewed; Region: ksgA; PRK00274
568708000393	Dimethyladenosine transferase (rRNA methylation) [Translation, ribosomal structure and biogenesis]; Region: KsgA; COG0030
568708000395	4-hydroxythreonine-4-phosphate dehydrogenase; Reviewed; Region: pdxA; PRK00232
568708000396	4-hydroxythreonine-4-phosphate dehydrogenase; Validated; Region: pdxA; PRK03743
568708000398	peptidyl-prolyl cis-trans isomerase SurA; Provisional; Region: PRK10770
568708000399	SurA N-terminal domain; Region: SurA_N; pfam09312
568708000400	PPIC-type PPIASE domain; Region: Rotamase; pfam00639
568708000401	PPIC-type PPIASE domain; Region: Rotamase; pfam00639
568708000404	Signal peptide predicted for STM_MW00971 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 20 and 21
568708000405	LPS assembly outer membrane complex protein LptD; Provisional; Region: PRK03761
568708000406	OstA-like protein; Region: OstA; pfam03968
568708000407	Organic solvent tolerance protein; Region: OstA_C; pfam04453
568708000410	Signal peptide predicted for STM_MW00981 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.997 between residues 24 and 25
568708000411	Dna-J like membrane chaperone protein; Provisional; Region: djlA; PRK09430
568708000412	N-terminal tellurium resistance protein terB-like domain of heat shock DnaJ-like proteins; Region: terB_like_DjlA; cd07316
568708000413	putative metal binding site [ion binding]; other site
568708000414	DnaJ domain or J-domain.  DnaJ/Hsp40 (heat shock protein 40) proteins are highly conserved and play crucial roles in protein translation, folding, unfolding, translocation, and degradation. They act primarily by stimulating the ATPase activity of Hsp70s; Region: DnaJ; cd06257
568708000415	HSP70 interaction site [polypeptide binding]; other site
568708000416	1 probable transmembrane helix predicted for STM_MW00991 by TMHMM2.0 at aa 7-29
568708000419	Pseudouridylate synthases, 23S RNA-specific [Translation, ribosomal structure and biogenesis]; Region: RluA; COG0564
568708000420	Pseudouridine synthase, RsuA/RluD family; Region: PseudoU_synth_RluCD_like; cd02869
568708000421	active site
568708000423	ATP-dependent helicase HepA; Validated; Region: PRK04914
568708000424	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
568708000425	ATP binding site [chemical binding]; other site
568708000426	putative Mg++ binding site [ion binding]; other site
568708000427	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
568708000428	nucleotide binding region [chemical binding]; other site
568708000429	ATP-binding site [chemical binding]; other site
568708000432	DNA polymerase II; Reviewed; Region: PRK05762
568708000433	DEDDy 3'-5' exonuclease domain of Escherichia coli DNA polymerase II and similar bacterial family-B DNA polymerases; Region: DNA_polB_II_exo; cd05784
568708000434	active site
568708000435	catalytic site [active]
568708000436	substrate binding site [chemical binding]; other site
568708000437	DNA polymerase type-II subfamily catalytic domain. Bacteria contain five DNA polymerases (I, II, III, IV and V). DNA polymerase II (Pol II) is a prototype for the B-family of polymerases. The role of Pol II in a variety of cellular activities, such as...; Region: POLBc_Pol_II; cd05537
568708000438	active site
568708000439	metal-binding site
568708000442	Uncharacterized conserved protein [Function unknown]; Region: COG1434
568708000443	YdcF-like. YdcF-like is a large family of mainly bacterial proteins, with a few members found in fungi, plants, and archaea. Escherichia coli YdcF has been shown to bind S-adenosyl-L-methionine (AdoMet), but a biochemical function has not been...; Region: YdcF-like; cd06259
568708000444	putative active site [active]
568708000446	Signal peptide predicted for STM_MW01031 by SignalP 2.0 HMM (Signal peptide probability 0.907) with cleavage site probability 0.613 between residues 27 and 28
568708000447	1 probable transmembrane helix predicted for STM_MW01031 by TMHMM2.0 at aa 5-27
568708000449	1 probable transmembrane helix predicted for STM_MW01051 by TMHMM2.0 at aa 52-74
568708000450	L-ribulose-5-phosphate 4-epimerase; Reviewed; Region: araD; PRK08193
568708000451	Class II Aldolase and Adducin head (N-terminal) domain. Aldolases are ubiquitous enzymes catalyzing central steps of carbohydrate metabolism. Based on enzymatic mechanisms, this superfamily has been divided into two distinct classes (Class I and II); Region: Aldolase_II; cd00398
568708000452	intersubunit interface [polypeptide binding]; other site
568708000453	active site
568708000454	Zn2+ binding site [ion binding]; other site
568708000456	L-arabinose isomerase; Provisional; Region: PRK02929
568708000457	L-Arabinose isomerase (AI) catalyzes the isomerization of L-arabinose to L-ribulose, the first reaction in its conversion into D-xylulose-5-phosphate, an intermediate in the pentose phosphate pathway, which allows L-arabinose to be used as a carbon...; Region: L-arabinose_isomerase; cd03557
568708000458	putative hexamer (dimer of trimers) interface [polypeptide binding]; other site
568708000459	trimer interface [polypeptide binding]; other site
568708000460	putative substrate binding site [chemical binding]; other site
568708000461	putative metal binding site [ion binding]; other site
568708000464	ribulokinase; Provisional; Region: PRK04123
568708000465	Ribulokinases; belongs to the FGGY family of carbohydrate kinases; Region: FGGY_RBK; cd07781
568708000466	N- and C-terminal domain interface [polypeptide binding]; other site
568708000467	active site
568708000468	MgATP binding site [chemical binding]; other site
568708000469	catalytic site [active]
568708000470	metal binding site [ion binding]; metal-binding site
568708000471	carbohydrate binding site [chemical binding]; other site
568708000472	homodimer interface [polypeptide binding]; other site
568708000475	DNA-binding transcriptional regulator AraC; Provisional; Region: PRK10572
568708000476	AraC-like ligand binding domain; Region: AraC_binding; pfam02311
568708000477	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708000478	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708000481	Uncharacterized membrane-associated protein [Function unknown]; Region: DedA; COG0586
568708000482	SNARE associated Golgi protein; Region: SNARE_assoc; pfam09335
568708000483	5 probable transmembrane helices predicted for STM_MW01111 by TMHMM2.0 at aa 13-35, 57-79, 140-162, 177-199 and 219-241
568708000485	thiamine transporter ATP-binding subunit; Provisional; Region: thiQ; PRK10771
568708000486	ATP-binding cassette domain of the thiamine transport system; Region: ABC_ThiQ_thiamine_transporter; cd03298
568708000487	Walker A/P-loop; other site
568708000488	ATP binding site [chemical binding]; other site
568708000489	Q-loop/lid; other site
568708000490	ABC transporter signature motif; other site
568708000491	Walker B; other site
568708000492	D-loop; other site
568708000493	H-loop/switch region; other site
568708000495	thiamine transporter membrane protein; Reviewed; Region: thiP; PRK09433
568708000496	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708000497	dimer interface [polypeptide binding]; other site
568708000498	conserved gate region; other site
568708000499	putative PBP binding loops; other site
568708000500	ABC-ATPase subunit interface; other site
568708000501	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708000502	dimer interface [polypeptide binding]; other site
568708000503	conserved gate region; other site
568708000504	putative PBP binding loops; other site
568708000505	ABC-ATPase subunit interface; other site
568708000506	12 probable transmembrane helices predicted for STM_MW01131 by TMHMM2.0 at aa 13-35, 55-77, 90-112, 127-149, 199-221, 241-260, 293-315, 335-357, 370-392, 407-424, 462-484 and 508-525
568708000508	Signal peptide predicted for STM_MW01131 by SignalP 2.0 HMM (Signal peptide probability 0.995) with cleavage site probability 0.574 between residues 29 and 30
568708000509	thiamine transporter substrate binding subunit; Provisional; Region: tbpA; PRK11205
568708000510	ABC-type thiamine transport system, periplasmic component [Coenzyme metabolism]; Region: TbpA; COG4143
568708000512	Signal peptide predicted for STM_MW01141 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 18 and 19
568708000513	transcriptional regulator SgrR; Provisional; Region: PRK13626
568708000514	Sugar transport-related sRNA regulator N-term; Region: SgrR_N; pfam12793
568708000515	The C-terminal solute-binding domain of DNA-binding transcriptional regulator SgrR is related to the ABC-type oligopeptide-binding proteins and contains the type 2 periplasmic-binding fold; Region: PBP2_SgrR_like; cd08507
568708000517	isopropylmalate isomerase small subunit; Provisional; Region: leuD; PRK01641
568708000518	Aconatase-like swivel domain of 3-isopropylmalate dehydratase and related uncharacterized proteins. 3-isopropylmalate dehydratase catalyzes the isomerization between 2-isopropylmalate and 3-isopropylmalate, via the formation of 2-isopropylmaleate...; Region: IPMI_Swivel; cd01577
568708000519	substrate binding site [chemical binding]; other site
568708000521	3-isopropylmalate dehydratase large subunit; Reviewed; Region: PRK00402
568708000522	3-isopropylmalate dehydratase catalyzes the isomerization between 2-isopropylmalate and 3-isopropylmalate; Region: IPMI; cd01583
568708000523	substrate binding site [chemical binding]; other site
568708000524	ligand binding site [chemical binding]; other site
568708000526	3-isopropylmalate dehydrogenase; Provisional; Region: PRK00772
568708000527	tartrate dehydrogenase; Region: TTC; TIGR02089
568708000529	2-isopropylmalate synthase; Validated; Region: PRK00915
568708000530	2-isopropylmalate synthase (IPMS), N-terminal catalytic TIM barrel domain; Region: DRE_TIM_IPMS; cd07940
568708000531	active site
568708000532	catalytic residues [active]
568708000533	metal binding site [ion binding]; metal-binding site
568708000534	LeuA allosteric (dimerisation) domain; Region: LeuA_dimer; pfam08502
568708000537	leu operon leader peptide; Provisional; Region: PRK14744
568708000539	leucine transcriptional activator; Reviewed; Region: leuO; PRK09508
568708000540	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708000541	The C-terminal substrate binding domain of LysR-type transcriptional regulator LeuO, an activator of leucine synthesis operon, contains the type 2 periplasmic binding fold; Region: PBP2_LeuO; cd08466
568708000542	putative substrate binding pocket [chemical binding]; other site
568708000543	putative dimerization interface [polypeptide binding]; other site
568708000546	acetolactate synthase 3 catalytic subunit; Validated; Region: PRK07979
568708000547	Pyrimidine (PYR) binding domain of POX and related proteins; Region: TPP_PYR_POX_like; cd07035
568708000548	dimer interface [polypeptide binding]; other site
568708000549	PYR/PP interface [polypeptide binding]; other site
568708000550	TPP binding site [chemical binding]; other site
568708000551	Thiamine pyrophosphate enzyme, central domain; Region: TPP_enzyme_M; pfam00205
568708000552	Thiamine pyrophosphate (TPP) family, Acetohydroxyacid synthase (AHAS) subfamily, TPP-binding module; composed of proteins similar to the large catalytic subunit of AHAS. AHAS catalyzes the condensation of two molecules of pyruvate to give the...; Region: TPP_AHAS; cd02015
568708000553	TPP-binding site [chemical binding]; other site
568708000554	dimer interface [polypeptide binding]; other site
568708000558	acetolactate synthase 3 regulatory subunit; Reviewed; Region: ilvH; PRK11895
568708000559	N-terminal ACT domain of the Escherichia coli IlvH-like regulatory subunit of acetohydroxyacid synthase (AHAS); Region: ACT_AHAS; cd04878
568708000560	putative valine binding site [chemical binding]; other site
568708000561	dimer interface [polypeptide binding]; other site
568708000562	Small subunit of acetolactate synthase; Region: ALS_ss_C; pfam10369
568708000565	DNA-binding transcriptional regulator FruR; Provisional; Region: PRK11303
568708000566	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
568708000567	DNA binding site [nucleotide binding]
568708000568	domain linker motif; other site
568708000569	Ligand binding domain of DNA transcription repressor specific for fructose (FruR) and its close homologs; Region: PBP1_FruR; cd06274
568708000570	dimerization interface [polypeptide binding]; other site
568708000571	ligand binding site [chemical binding]; other site
568708000574	mraZ protein; Region: TIGR00242
568708000575	MraZ protein; Region: MraZ; pfam02381
568708000576	MraZ protein; Region: MraZ; pfam02381
568708000578	16S rRNA (cytosine(1402)-N(4))-methyltransferase; Region: TIGR00006
568708000579	16S rRNA m(4)C1402 methyltranserfase; Provisional; Region: PRK00050
568708000581	cell division protein FtsL; Provisional; Region: PRK10772
568708000583	1 probable transmembrane helix predicted for STM_MW01271 by TMHMM2.0 at aa 35-57
568708000584	peptidoglycan synthase FtsI; Provisional; Region: PRK15105
568708000585	Penicillin-binding Protein dimerisation domain; Region: PBP_dimer; pfam03717
568708000586	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; pfam00905
568708000587	Signal peptide predicted for STM_MW01281 by SignalP 2.0 HMM (Signal peptide probability 0.994) with cleavage site probability 0.824 between residues 42 and 43
568708000588	1 probable transmembrane helix predicted for STM_MW01281 by TMHMM2.0 at aa 21-43
568708000591	UDP-N-acetylmuramoylalanyl-D-glutamate--2, 6-diaminopimelate ligase; Provisional; Region: murE; PRK00139
568708000592	Mur ligase family, catalytic domain; Region: Mur_ligase; pfam01225
568708000593	Mur ligase middle domain; Region: Mur_ligase_M; pfam08245
568708000594	Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875
568708000598	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase; Reviewed; Region: murF; PRK10773
568708000599	Mur ligase family, catalytic domain; Region: Mur_ligase; pfam01225
568708000600	Mur ligase middle domain; Region: Mur_ligase_M; pfam08245
568708000601	Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875
568708000605	phospho-N-acetylmuramoyl-pentapeptide-transferase; Provisional; Region: mraY; PRK00108
568708000606	Phospho-N-acetylmuramoyl-pentapeptide-transferase (mraY) is an enzyme responsible for the formation of the first lipid intermediate in the synthesis of bacterial cell wall peptidoglycan. It catalyzes the formation of...; Region: GT_MraY; cd06852
568708000607	Mg++ binding site [ion binding]; other site
568708000608	putative catalytic motif [active]
568708000609	putative substrate binding site [chemical binding]; other site
568708000610	10 probable transmembrane helices predicted for STM_MW01311 by TMHMM2.0 at aa 15-37, 75-92, 97-114, 134-151, 171-193, 200-219, 234-256, 263-285, 289-311 and 338-357
568708000613	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate synthetase; Provisional; Region: murD; PRK03806
568708000614	Mur ligase middle domain; Region: Mur_ligase_M; pfam08245
568708000615	Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875
568708000616	1 probable transmembrane helix predicted for STM_MW01321 by TMHMM2.0 at aa 9-31
568708000619	cell division protein FtsW; Provisional; Region: PRK10774
568708000621	8 probable transmembrane helices predicted for STM_MW01331 by TMHMM2.0 at aa 20-42, 57-74, 81-103, 155-177, 190-212, 278-300, 312-334 and 344-366
568708000622	undecaprenyldiphospho-muramoylpentapeptide beta-N- acetylglucosaminyltransferase; Provisional; Region: murG; PRK00726
568708000623	MurG is an N-acetylglucosaminyltransferase, the last enzyme involved in the intracellular phase of peptidoglycan biosynthesis. It transfers N-acetyl-D-glucosamine (GlcNAc) from UDP-GlcNAc to the C4 hydroxyl of a lipid-linked N-acetylmuramoyl pentapeptide...; Region: GT1_MurG; cd03785
568708000624	active site
568708000625	homodimer interface [polypeptide binding]; other site
568708000626	Signal peptide predicted for STM_MW01341 by SignalP 2.0 HMM (Signal peptide probability 0.680) with cleavage site probability 0.584 between residues 26 and 27
568708000629	UDP-N-acetylmuramate--L-alanine ligase; Provisional; Region: murC; PRK00421
568708000630	Mur ligase family, catalytic domain; Region: Mur_ligase; pfam01225
568708000631	Mur ligase middle domain; Region: Mur_ligase_M; pfam08245
568708000632	Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875
568708000636	D-alanine--D-alanine ligase; Reviewed; Region: ddl; PRK01372
568708000637	D-ala D-ala ligase N-terminus; Region: Dala_Dala_lig_N; pfam01820
568708000638	D-ala D-ala ligase C-terminus; Region: Dala_Dala_lig_C; pfam07478
568708000641	cell division protein FtsQ; Provisional; Region: PRK10775
568708000642	POTRA domain, FtsQ-type; Region: POTRA_1; pfam08478
568708000643	Cell division protein FtsQ; Region: FtsQ; pfam03799
568708000644	1 probable transmembrane helix predicted for STM_MW01371 by TMHMM2.0 at aa 26-48
568708000647	cell division protein FtsA; Reviewed; Region: ftsA; PRK09472
568708000648	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cd00012
568708000649	Cell division protein FtsA; Region: FtsA; pfam14450
568708000651	cell division protein FtsZ; Validated; Region: PRK09330
568708000652	FtsZ is a GTPase that is similar to the eukaryotic tubulins and is essential for cell division in prokaryotes.  FtsZ is capable of polymerizing in a GTP-driven process into structures similar to those formed by tubulin. FtsZ forms a ring-shaped septum at...; Region: FtsZ_type1; cd02201
568708000653	nucleotide binding site [chemical binding]; other site
568708000654	SulA interaction site; other site
568708000655	cell division protein FtsZ, alphaProteobacterial C-terminal extension; Region: FtsZ_alphas_C; TIGR03483
568708000658	UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase; Reviewed; Region: lpxC; PRK13186
568708000659	UDP-3-O-acyl N-acetylglycosamine deacetylase; Region: LpxC; pfam03331
568708000661	SecA regulator SecM; Provisional; Region: PRK02943
568708000663	preprotein translocase subunit SecA; Reviewed; Region: PRK12904
568708000664	SecA preprotein cross-linking domain; Region: SecA_PP_bind; smart00958
568708000665	SEC-C motif; Region: SEC-C; pfam02810
568708000670	The MutT pyrophosphohydrolase is a prototypical Nudix hydrolase that catalyzes the hydrolysis of nucleoside and deoxynucleoside triphosphates (NTPs and dNTPs) by substitution at a beta-phosphorus to yield a nucleotide monophosphate (NMP) and inorganic...; Region: MutT_pyrophosphohydrolase; cd03425
568708000671	active site
568708000672	8-oxo-dGMP binding site [chemical binding]; other site
568708000673	nudix motif; other site
568708000674	metal binding site [ion binding]; metal-binding site
568708000676	DNA gyrase inhibitor; Reviewed; Region: PRK00418
568708000678	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4582
568708000680	Dephospho-CoA kinase [Coenzyme metabolism]; Region: CoaE; COG0237
568708000681	Dephospho-coenzyme A kinase (DPCK, EC 2.7.1.24) catalyzes the phosphorylation of dephosphocoenzyme A (dCoA) to yield CoA, which is the final step in CoA biosynthesis; Region: DPCK; cd02022
568708000682	CoA-binding site [chemical binding]; other site
568708000683	ATP-binding [chemical binding]; other site
568708000685	guanosine 5'-monophosphate oxidoreductase; Provisional; Region: PRK05096
568708000686	IMPDH: The catalytic domain of the inosine monophosphate dehydrogenase. IMPDH catalyzes the NAD-dependent oxidation of inosine 5'-monophosphate (IMP) to xanthosine 5' monophosphate (XMP). It is a rate-limiting step in the de novo synthesis of...; Region: IMPDH; cd00381
568708000687	active site
568708000689	type IV pilin biogenesis protein; Provisional; Region: PRK10573
568708000690	Type II secretion system (T2SS), protein F; Region: T2SF; pfam00482
568708000691	Type II secretion system (T2SS), protein F; Region: T2SF; pfam00482
568708000692	3 probable transmembrane helices predicted for STM_MW01481 by TMHMM2.0 at aa 163-185, 205-227 and 368-390
568708000694	hypothetical protein; Provisional; Region: PRK10436
568708000695	PulE/GspE The type II secretory pathway is the main terminal branch of the general secretory pathway (GSP). It is responsible for the export the majority of Gram-negative bacterial exoenzymes and toxins. PulE is a cytoplasmic protein of the GSP, which...; Region: PulE-GspE; cd01129
568708000696	Walker A motif; other site
568708000697	ATP binding site [chemical binding]; other site
568708000698	Walker B motif; other site
568708000701	putative major pilin subunit; Provisional; Region: PRK10574
568708000702	Type IV pilin N-term methylation site GFxxxE; Region: N_methyl_2; cl06830
568708000703	Pilin (bacterial filament); Region: Pilin; pfam00114
568708000706	1 probable transmembrane helix predicted for STM_MW01501 by TMHMM2.0 at aa 7-29
568708000707	nicotinate-nucleotide pyrophosphorylase; Region: nadC; TIGR00078
568708000708	Quinolinate phosphoribosyl transferase (QAPRTase or QPRTase), also called nicotinate-nucleotide pyrophosphorylase, is involved in the de novo synthesis of NAD in both prokaryotes and eukaryotes. It catalyses the reaction of quinolinic acid (QA) with...; Region: QPRTase; cd01572
568708000709	dimerization interface [polypeptide binding]; other site
568708000710	active site
568708000713	N-acetyl-anhydromuramyl-L-alanine amidase [Cell envelope biogenesis, outer membrane]; Region: ampD; COG3023
568708000714	Peptidoglycan recognition proteins (PGRPs) are pattern recognition receptors that bind, and in certain cases, hydrolyze peptidoglycans (PGNs) of bacterial cell walls. PGRPs have been divided into three classes: short PGRPs (PGRP-S), that are small (20...; Region: PGRP; cd06583
568708000715	amidase catalytic site [active]
568708000716	Zn binding residues [ion binding]; other site
568708000717	substrate binding site [chemical binding]; other site
568708000719	regulatory protein AmpE; Provisional; Region: PRK10987
568708000721	4 probable transmembrane helices predicted for STM_MW01531 by TMHMM2.0 at aa 36-58, 63-85, 146-168 and 266-283
568708000722	Glycosyl hydrolase family 43; Region: GH43_1; cd08980
568708000723	active site
568708000725	Na+/melibiose symporter and related transporters [Carbohydrate transport and metabolism]; Region: MelB; COG2211
568708000726	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708000727	putative substrate translocation pore; other site
568708000729	12 probable transmembrane helices predicted for STM_MW01551 by TMHMM2.0 at aa 12-31, 35-57, 81-100, 115-137, 150-172, 182-204, 234-256, 266-288, 295-317, 322-344, 365-387 and 407-429
568708000730	aromatic amino acid transporter; Provisional; Region: PRK10238
568708000731	12 probable transmembrane helices predicted for STM_MW01561 by TMHMM2.0 at aa 20-42, 47-66, 87-109, 119-141, 154-176, 199-221, 241-263, 283-305, 332-354, 358-380, 400-422 and 427-446
568708000733	transcriptional regulator PdhR; Reviewed; Region: pdhR; PRK09464
568708000734	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
568708000735	DNA-binding site [nucleotide binding]; DNA binding site
568708000736	This entry represents the C-terminal ligand binding domain of many members of the GntR family; Region: FCD; smart00895
568708000739	pyruvate dehydrogenase subunit E1; Reviewed; Region: aceE; PRK09405
568708000740	Thiamine pyrophosphate (TPP) family, E1 of E. coli PDC-like subfamily, TPP-binding module; composed of proteins similar to the E1 component of the Escherichia coli pyruvate dehydrogenase multienzyme complex (PDC). PDC catalyzes the oxidative...; Region: TPP_E1_EcPDC_like; cd02017
568708000741	dimer interface [polypeptide binding]; other site
568708000742	TPP-binding site [chemical binding]; other site
568708000744	pyruvate dehydrogenase dihydrolipoyltransacetylase; Validated; Region: aceF; PRK11854
568708000745	Lipoyl domain of the dihydrolipoyl acyltransferase component (E2) of 2-oxo acid dehydrogenases. 2-oxo acid dehydrogenase multienzyme complexes, like pyruvate dehydrogenase (PDH), 2-oxoglutarate dehydrogenase (OGDH) and branched-chain 2-oxo acid...; Region: lipoyl_domain; cd06849
568708000746	E3 interaction surface; other site
568708000747	lipoyl attachment site [posttranslational modification]; other site
568708000748	Lipoyl domain of the dihydrolipoyl acyltransferase component (E2) of 2-oxo acid dehydrogenases. 2-oxo acid dehydrogenase multienzyme complexes, like pyruvate dehydrogenase (PDH), 2-oxoglutarate dehydrogenase (OGDH) and branched-chain 2-oxo acid...; Region: lipoyl_domain; cd06849
568708000749	E3 interaction surface; other site
568708000750	lipoyl attachment site [posttranslational modification]; other site
568708000751	Lipoyl domain of the dihydrolipoyl acyltransferase component (E2) of 2-oxo acid dehydrogenases. 2-oxo acid dehydrogenase multienzyme complexes, like pyruvate dehydrogenase (PDH), 2-oxoglutarate dehydrogenase (OGDH) and branched-chain 2-oxo acid...; Region: lipoyl_domain; cd06849
568708000752	E3 interaction surface; other site
568708000753	lipoyl attachment site [posttranslational modification]; other site
568708000754	e3 binding domain; Region: E3_binding; pfam02817
568708000755	2-oxoacid dehydrogenases acyltransferase (catalytic domain); Region: 2-oxoacid_dh; pfam00198
568708000759	dihydrolipoamide dehydrogenase; Reviewed; Region: PRK06467
568708000760	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
568708000761	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
568708000762	Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852
568708000766	Signal peptide predicted for STM_MW01611 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 21 and 22
568708000767	Protein of unknown function (DUF2950); Region: DUF2950; pfam11453
568708000769	Signal peptide predicted for STM_MW01621 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.964 between residues 19 and 20
568708000770	pfam_scan;Pfam:PF11737; E()=1.0E-78;score=263.2;query 59-303;description=DUF3300
568708000772	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase; Validated; Region: PRK09238
568708000773	Aconitase B swivel domain. Aconitate hydratase B is involved in energy metabolism as part of the TCA cycle. It catalyses the formation of cis-aconitate from citrate. This is the aconitase swivel domain, which undergoes swivelling conformational change in...; Region: AcnB_Swivel; cd01576
568708000774	substrate binding site [chemical binding]; other site
568708000775	Aconitate hydratase B catalyses the formation of cis-aconitate from citrate as part of the TCA cycle; Region: AcnB; cd01581
568708000776	substrate binding site [chemical binding]; other site
568708000777	ligand binding site [chemical binding]; other site
568708000781	Predicted restriction endonuclease [Defense mechanisms]; Region: COG3183
568708000782	HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cl00083
568708000783	hypothetical protein; Provisional; Region: PRK05248
568708000785	2-keto-3-deoxygluconate permease; Provisional; Region: PRK12460
568708000787	10 probable transmembrane helices predicted for STM_MW01671 by TMHMM2.0 at aa 13-35, 45-64, 71-90, 100-122, 134-156, 160-182, 189-211, 215-237, 244-266 and 281-303
568708000788	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3395
568708000790	4-hydroxythreonine-4-phosphate dehydrogenase; Validated; Region: pdxA; PRK03743
568708000791	4-hydroxythreonine-4-phosphate dehydrogenase 2; Provisional; Region: pdxA; PRK03371
568708000793	Transcriptional regulators of sugar metabolism [Transcription / Carbohydrate transport and metabolism]; Region: GlpR; COG1349
568708000794	helix_turn_helix, Deoxyribose operon repressor; Region: HTH_DEOR; smart00420
568708000795	DeoR C terminal sensor domain; Region: DeoRC; pfam00455
568708000798	S-adenosylmethionine decarboxylase; Provisional; Region: PRK05462
568708000800	spermidine synthase; Provisional; Region: PRK00811
568708000801	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708000802	S-adenosylmethionine binding site [chemical binding]; other site
568708000804	Bacterial chaperone lipoprotein (PulS_OutS); Region: PulS_OutS; cl09898
568708000806	Signal peptide predicted for STM_MW01731 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.745 between residues 22 and 23
568708000807	multicopper oxidase; Provisional; Region: PRK10965
568708000808	Multicopper oxidase; Region: Cu-oxidase_3; pfam07732
568708000809	Multicopper oxidase; Region: Cu-oxidase_2; pfam07731
568708000810	Signal peptide predicted for STM_MW01741 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 28 and 29
568708000813	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family; Region: PQQ_membr_DH; TIGR03074
568708000814	Membrane-bound PQQ-dependent glucose dehydrogenase; Region: PQQ_mGDH; cd10280
568708000815	Trp docking motif [polypeptide binding]; other site
568708000816	putative active site [active]
568708000820	5 probable transmembrane helices predicted for STM_MW01751 by TMHMM2.0 at aa 13-35, 40-57, 64-81, 96-114 and 121-140
568708000821	Pyrimidine operon attenuation protein/uracil phosphoribosyltransferase [Nucleotide transport and metabolism]; Region: PyrR; COG2065
568708000822	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
568708000823	active site
568708000825	Carbonic anhydrases (CA) are zinc-containing enzymes that catalyze the reversible hydration of carbon dioxide in a two-step mechanism in which the nucleophilic attack of a zinc-bound hydroxide ion on carbon dioxide is followed by the regeneration of an...; Region: beta_CA_cladeA; cd00883
568708000826	active site clefts [active]
568708000827	zinc binding site [ion binding]; other site
568708000828	dimer interface [polypeptide binding]; other site
568708000830	ABC-type multidrug transport system, ATPase component [Defense mechanisms]; Region: CcmA; COG1131
568708000831	ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230
568708000832	Walker A/P-loop; other site
568708000833	ATP binding site [chemical binding]; other site
568708000834	Q-loop/lid; other site
568708000835	ABC transporter signature motif; other site
568708000836	Walker B; other site
568708000837	D-loop; other site
568708000838	H-loop/switch region; other site
568708000840	inner membrane transport permease; Provisional; Region: PRK15066
568708000841	ABC-type multidrug transport system, permease component [Defense mechanisms]; Region: COG0842
568708000843	6 probable transmembrane helices predicted for STM_MW01791 by TMHMM2.0 at aa 20-42, 62-84, 104-126, 141-163, 170-192 and 226-248
568708000844	putative fimbrial protein StiH; Provisional; Region: PRK15297
568708000846	Signal peptide predicted for STM_MW01801 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 19 and 20
568708000847	fimbrial outer membrane usher protein StiC; Provisional; Region: PRK15298
568708000848	PapC N-terminal domain; Region: PapC_N; pfam13954
568708000849	Type VII secretion system (T7SS), usher protein; Region: Usher; pfam00577
568708000850	PapC C-terminal domain; Region: PapC_C; pfam13953
568708000852	Signal peptide predicted for STM_MW01811 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.990 between residues 30 and 31
568708000853	fimbrial chaperone protein StiB; Provisional; Region: PRK15299
568708000854	Gram-negative pili assembly chaperone, N-terminal domain; Region: Pili_assembly_N; pfam00345
568708000855	Gram-negative pili assembly chaperone, C-terminal domain; Region: Pili_assembly_C; pfam02753
568708000858	Signal peptide predicted for STM_MW01821 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 21 and 22
568708000859	fimbrial protein StiA; Provisional; Region: PRK15300
568708000861	Signal peptide predicted for STM_MW01831 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.997 between residues 23 and 24
568708000862	PTS_IIA, PTS system, mannose/sorbose specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIA_man; cd00006
568708000863	active pocket/dimerization site; other site
568708000864	active site
568708000865	phosphorylation site [posttranslational modification]
568708000867	Putative catalytic polysaccharide deacetylase domain of uncharacterized protein yadE and similar proteins; Region: CE4_yadE_5s; cd10966
568708000868	putative active site [active]
568708000869	putative metal binding site [ion binding]; other site
568708000870	Signal peptide predicted for STM_MW01851 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 19 and 20
568708000872	Aspartate alpha-decarboxylase or L-aspartate 1-decarboxylase, a pyruvoyl group-dependent  decarboxylase in beta-alanine production; Region: Asp_decarbox; cd06919
568708000873	tetramerization interface [polypeptide binding]; other site
568708000874	active site
568708000876	Pantoate-beta-alanine ligase; Region: PanC; cd00560
568708000877	pantoate--beta-alanine ligase; Region: panC; TIGR00018
568708000878	active site
568708000879	ATP-binding site [chemical binding]; other site
568708000880	pantoate-binding site; other site
568708000881	HXXH motif; other site
568708000883	Ketopantoate hydroxymethyltransferase (KPHMT) is the first enzyme in the pantothenate biosynthesis pathway. Ketopantoate hydroxymethyltransferase (KPHMT) catalyzes the first committed step in the biosynthesis of pantothenate (vitamin B5), which is a...; Region: KPHMT-like; cd06557
568708000884	oligomerization interface [polypeptide binding]; other site
568708000885	active site
568708000886	metal binding site [ion binding]; metal-binding site
568708000888	7,8-dihydro-6-hydroxymethylpterin-pyrophosphokinase (HPPK). Folate derivatives are essential cofactors in the biosynthesis of purines, pyrimidines, and amino acids as well as formyl-tRNA. Mammalian cells are able to utilize pre-formed folates after...; Region: HPPK; cd00483
568708000889	catalytic center binding site [active]
568708000890	ATP binding site [chemical binding]; other site
568708000892	poly(A) polymerase I; Provisional; Region: pcnB; PRK11623
568708000893	Nucleotidyltransferase (NT) domain of ClassII CCA-adding enzymes; Region: NT_ClassII-CCAase; cd05398
568708000894	active site
568708000895	NTP binding site [chemical binding]; other site
568708000896	metal binding triad [ion binding]; metal-binding site
568708000897	Probable RNA and SrmB- binding site of polymerase A; Region: PolyA_pol_RNAbd; pfam12627
568708000898	Polymerase A arginine-rich C-terminus; Region: PolyA_pol_arg_C; pfam12626
568708000900	Glutamyl- and glutaminyl-tRNA synthetases [Translation, ribosomal structure and biogenesis]; Region: GlnS; COG0008
568708000901	glutamyl-Q tRNA(Asp) synthetase; Reviewed; Region: PRK05710
568708000902	active site
568708000903	nucleotide binding site [chemical binding]; other site
568708000904	HIGH motif; other site
568708000905	KMSKS motif; other site
568708000907	RNA polymerase-binding transcription factor; Provisional; Region: dksA; PRK10778
568708000909	putative DNA-binding transcriptional regulator; Reviewed; Region: PRK00347
568708000911	2'-5' RNA ligase; Provisional; Region: PRK15124
568708000912	LigT like Phosphoesterase; Region: LigT_PEase; pfam02834
568708000913	LigT like Phosphoesterase; Region: LigT_PEase; pfam02834
568708000915	ATP-dependent RNA helicase HrpB; Provisional; Region: PRK11664
568708000916	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
568708000917	ATP binding site [chemical binding]; other site
568708000918	putative Mg++ binding site [ion binding]; other site
568708000919	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
568708000920	nucleotide binding region [chemical binding]; other site
568708000921	ATP-binding site [chemical binding]; other site
568708000922	ATP-dependent helicase C-terminal; Region: HrpB_C; pfam08482
568708000927	bifunctional glycosyl transferase/transpeptidase; Reviewed; Region: mrcB; PRK09506
568708000928	Transglycosylase; Region: Transgly; pfam00912
568708000929	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; cl17760
568708000930	1 probable transmembrane helix predicted for STM_MW01961 by TMHMM2.0 at aa 60-82
568708000933	ferrichrome outer membrane transporter; Provisional; Region: PRK10044
568708000934	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
568708000935	N-terminal plug; other site
568708000936	ligand-binding site [chemical binding]; other site
568708000937	Signal peptide predicted for STM_MW01971 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.985 between residues 33 and 34
568708000940	iron-hydroxamate transporter ATP-binding subunit; Provisional; Region: PRK10575
568708000941	ATP-binding component of iron-siderophores, vitamin B12 and hemin transporters and related proteins; Region: ABC_Iron-Siderophores_B12_Hemin; cd03214
568708000942	Walker A/P-loop; other site
568708000943	ATP binding site [chemical binding]; other site
568708000944	Q-loop/lid; other site
568708000945	ABC transporter signature motif; other site
568708000946	Walker B; other site
568708000947	D-loop; other site
568708000948	H-loop/switch region; other site
568708000950	Fe3+-siderophore binding domain FhuD.  These proteins have been shown to function as initial receptors in ABC transport of Fe3+-siderophores in many eubacterial species. They belong to the TroA-like superfamily of helical backbone metal receptor proteins...; Region: FhuD; cd01146
568708000951	Periplasmic binding protein; Region: Peripla_BP_2; pfam01497
568708000952	siderophore binding site; other site
568708000953	Signal peptide predicted for STM_MW01991 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.989 between residues 30 and 31
568708000955	iron-hydroxamate transporter permease subunit; Provisional; Region: PRK10577
568708000956	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
568708000957	ABC-ATPase subunit  interface; other site
568708000958	dimer interface [polypeptide binding]; other site
568708000959	putative PBP binding regions; other site
568708000960	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
568708000961	ABC-ATPase subunit  interface; other site
568708000962	dimer interface [polypeptide binding]; other site
568708000963	putative PBP binding regions; other site
568708000964	17 probable transmembrane helices predicted for STM_MW02001 by TMHMM2.0 at aa 35-57, 87-104, 117-136, 140-162, 169-191, 264-286, 298-316, 326-348, 372-394, 414-436, 449-467, 471-493, 505-524, 544-566, 593-615, 630-649 and 656-678
568708000966	putative fimbrial subunit StfA; Provisional; Region: PRK15283
568708000967	Signal peptide predicted for STM_MW02011 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.975 between residues 23 and 24
568708000969	putative fimbrial outer membrane usher protein StfC; Provisional; Region: PRK15284
568708000970	PapC N-terminal domain; Region: PapC_N; pfam13954
568708000971	Type VII secretion system (T7SS), usher protein; Region: Usher; pfam00577
568708000972	PapC C-terminal domain; Region: PapC_C; pfam13953
568708000973	Signal peptide predicted for STM_MW02021 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.964 between residues 29 and 30
568708000975	putative fimbrial chaperone protein StfD; Provisional; Region: PRK15285
568708000976	Gram-negative pili assembly chaperone, N-terminal domain; Region: Pili_assembly_N; pfam00345
568708000977	Gram-negative pili assembly chaperone, C-terminal domain; Region: Pili_assembly_C; pfam02753
568708000978	Signal peptide predicted for STM_MW02031 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.994 between residues 25 and 26
568708000979	1 probable transmembrane helix predicted for STM_MW02031 by TMHMM2.0 at aa 7-29
568708000982	putative minor fimbrial subunit StfE; Provisional; Region: PRK15286
568708000983	putative minor fimbrial subunit StfF; Provisional; Region: PRK15287
568708000984	Signal peptide predicted for STM_MW02051 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 18 and 19
568708000986	putative minor fimbrial subunit StfG; Provisional; Region: PRK15288
568708000987	Signal peptide predicted for STM_MW02061 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.988 between residues 25 and 26
568708000988	1 probable transmembrane helix predicted for STM_MW02061 by TMHMM2.0 at aa 7-26
568708000990	Protein of unknown function (DUF2544); Region: DUF2544; pfam11245
568708000991	Signal peptide predicted for STM_MW02071 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.997 between residues 21 and 22
568708000993	glutamate-1-semialdehyde aminotransferase; Provisional; Region: PRK00062
568708000994	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
568708000995	inhibitor-cofactor binding pocket; inhibition site
568708000996	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708000997	catalytic residue [active]
568708000999	Chloride channel protein EriC [Inorganic ion transport and metabolism]; Region: EriC; COG0038
568708001000	ClC chloride channel EriC.  This domain is found in the EriC chloride transporters that mediate the extreme acid resistance response in eubacteria and archaea. This response allows bacteria to survive in the acidic environments by decarboxylation-linked...; Region: EriC; cd01031
568708001001	Cl- selectivity filter; other site
568708001002	Cl- binding residues [ion binding]; other site
568708001003	pore gating glutamate residue; other site
568708001004	dimer interface [polypeptide binding]; other site
568708001005	H+/Cl- coupling transport residue; other site
568708001006	11 probable transmembrane helices predicted for STM_MW02091 by TMHMM2.0 at aa 31-53, 75-97, 124-146, 179-201, 210-232, 252-274, 291-313, 328-350, 357-379, 389-411 and 418-440
568708001008	iron-sulfur cluster insertion protein ErpA; Provisional; Region: PRK13623
568708001010	hypothetical protein; Provisional; Region: PRK10578
568708001011	UPF0126 domain; Region: UPF0126; pfam03458
568708001012	UPF0126 domain; Region: UPF0126; pfam03458
568708001014	6 probable transmembrane helices predicted for STM_MW02111 by TMHMM2.0 at aa 4-23, 30-47, 62-79, 88-105, 115-137 and 149-171
568708001015	vitamin B12-transporter protein BtuF; Provisional; Region: PRK03379
568708001016	Cobalamin binding protein BtuF.  These proteins have been shown to function as initial receptors in ABC transport of vitamin B12 (cobalamin) in eubacterial and some archaeal species.  They belong to the TroA superfamily of helical backbone metal receptor...; Region: BtuF; cd01144
568708001017	cobalamin binding residues [chemical binding]; other site
568708001018	putative BtuC binding residues; other site
568708001019	dimer interface [polypeptide binding]; other site
568708001021	1 probable transmembrane helix predicted for STM_MW02121 by TMHMM2.0 at aa 7-29
568708001022	Signal peptide predicted for STM_MW02121 by SignalP 2.0 HMM (Signal peptide probability 0.988) with cleavage site probability 0.875 between residues 22 and 23
568708001023	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase; Validated; Region: PRK05584
568708001024	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase; Region: MTA/SAH-Nsdase; TIGR01704
568708001026	deoxyguanosinetriphosphate triphosphohydrolase; Provisional; Region: dgt; PRK04926
568708001027	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
568708001028	Zn2+ binding site [ion binding]; other site
568708001029	Mg2+ binding site [ion binding]; other site
568708001030	Phosphohydrolase-associated domain; Region: HD_assoc; pfam13286
568708001032	serine endoprotease; Provisional; Region: PRK10942
568708001033	Trypsin-like peptidase domain; Region: Trypsin_2; pfam13365
568708001034	PDZ domain of tryspin-like serine proteases, such as DegP/HtrA, which are oligomeric proteins involved in heat-shock response, chaperone function, and apoptosis. May be responsible for substrate recognition and/or binding, as most PDZ domains bind...; Region: PDZ_serine_protease; cd00987
568708001035	protein binding site [polypeptide binding]; other site
568708001036	PDZ domain of tryspin-like serine proteases, such as DegP/HtrA, which are oligomeric proteins involved in heat-shock response, chaperone function, and apoptosis. May be responsible for substrate recognition and/or binding, as most PDZ domains bind...; Region: PDZ_serine_protease; cd00987
568708001037	Signal peptide predicted for STM_MW02151 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.996 between residues 26 and 27
568708001040	carbohydrate diacid transcriptional activator CdaR; Provisional; Region: PRK11477
568708001041	Putative sugar diacid recognition; Region: Diacid_rec; pfam05651
568708001042	PucR C-terminal helix-turn-helix domain; Region: HTH_30; pfam13556
568708001044	hypothetical protein; Provisional; Region: PRK13677
568708001045	shikimate transporter; Provisional; Region: PRK09952
568708001046	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708001047	putative substrate translocation pore; other site
568708001048	11 probable transmembrane helices predicted for STM_MW02181 by TMHMM2.0 at aa 27-46, 51-73, 85-107, 122-144, 151-173, 183-202, 244-266, 276-298, 310-329, 374-396 and 403-425
568708001050	2,3,4,5-tetrahydropyridine-2,6-carboxylate N-succinyltransferase; Provisional; Region: dapD; PRK11830
568708001051	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate (THDP) N-succinyltransferase (also called THP succinyltransferase): THDP N-succinyltransferase catalyzes the conversion of tetrahydrodipicolinate and succinyl-CoA to N-succinyltetrahydrodipicolinate and CoA; Region: LbH_THP_succinylT; cd03350
568708001052	trimer interface [polypeptide binding]; other site
568708001053	active site
568708001054	substrate binding site [chemical binding]; other site
568708001055	CoA binding site [chemical binding]; other site
568708001056	PII uridylyl-transferase; Provisional; Region: PRK05007
568708001057	Nucleotidyltransferase (NT) domain of Escherichia coli adenylyltransferase (GlnE), Escherichia coli uridylyl transferase (GlnD), and similar proteins; Region: NT_GlnE_GlnD_like; cd05401
568708001058	metal binding triad; other site
568708001059	GlnD PII-uridylyltransferase; Region: GlnD_UR_UTase; pfam08335
568708001060	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
568708001061	Zn2+ binding site [ion binding]; other site
568708001062	Mg2+ binding site [ion binding]; other site
568708001063	ACT domain family, ACT_UUR-like_1, includes the first of two C-terminal ACT domains of the bacterial signal-transducing uridylyltransferase /uridylyl-removing (UUR) enzyme, GlnD and related domains; Region: ACT_UUR-like_1; cd04900
568708001064	C-terminal ACT domains of the bacterial signal-transducing uridylyltransferase /uridylyl-removing (UUR) enzyme, GlnD and related domains; Region: ACT_ACR-UUR-like_2; cd04899
568708001069	Methionine Aminopeptidase 1. E.C. 3.4.11.18. Also known as methionyl aminopeptidase and Peptidase M. Catalyzes release of N-terminal amino acids, preferentially methionine, from peptides and arylamides; Region: MetAP1; cd01086
568708001070	active site
568708001072	Ribosomal protein S2 (RPS2), involved in formation of the translation initiation complex, where it might contact the messenger RNA and several components of the ribosome. It has been shown that in Escherichia coli RPS2 is essential for the binding of...; Region: RPS2; cd01425
568708001073	rRNA interaction site [nucleotide binding]; other site
568708001074	S8 interaction site; other site
568708001075	putative laminin-1 binding site; other site
568708001077	elongation factor Ts; Provisional; Region: tsf; PRK09377
568708001078	UBA/TS-N domain; Region: UBA; pfam00627
568708001079	Elongation factor TS; Region: EF_TS; pfam00889
568708001080	Elongation factor TS; Region: EF_TS; pfam00889
568708001083	UMP kinase (UMPK)-Ec, the microbial/chloroplast uridine monophosphate kinase (uridylate kinase) enzyme that catalyzes UMP phosphorylation and plays a key role in pyrimidine nucleotide biosynthesis; regulation of this process is via feed-back control and...; Region: AAK_UMPK-PyrH-Ec; cd04254
568708001084	putative nucleotide binding site [chemical binding]; other site
568708001085	uridine monophosphate binding site [chemical binding]; other site
568708001086	homohexameric interface [polypeptide binding]; other site
568708001088	ribosome recycling factor; Reviewed; Region: frr; PRK00083
568708001089	Ribosome recycling factor (RRF). Ribosome recycling factor dissociates the posttermination complex, composed of the ribosome, deacylated tRNA, and mRNA, after termination of translation.  Thus ribosomes are "recycled" and ready for another...; Region: RRF; cd00520
568708001090	hinge region; other site
568708001092	1-deoxy-D-xylulose 5-phosphate reductoisomerase; Provisional; Region: PRK05447
568708001093	1-deoxy-D-xylulose 5-phosphate reductoisomerase; Region: DXP_reductoisom; pfam02670
568708001094	1-deoxy-D-xylulose 5-phosphate reductoisomerase C-terminal; Region: DXP_redisom_C; pfam08436
568708001095	DXP reductoisomerase C-terminal domain; Region: DXPR_C; pfam13288
568708001098	Undecaprenyl pyrophosphate synthase [Lipid metabolism]; Region: UppS; COG0020
568708001099	Cis (Z)-Isoprenyl Diphosphate Synthases (cis-IPPS); homodimers which catalyze the successive 1'-4 condensation of the isopentenyl diphosphate (IPP) molecule to trans,trans-farnesyl diphosphate (FPP) or to cis,trans-FPP to form long-chain polyprenyl...; Region: CIS_IPPS; cd00475
568708001100	catalytic residue [active]
568708001101	putative FPP diphosphate  binding site; other site
568708001102	putative FPP binding hydrophobic cleft; other site
568708001103	dimer interface [polypeptide binding]; other site
568708001104	putative IPP diphosphate binding site; other site
568708001106	CDP-diglyceride synthase; Provisional; Region: cdsA; PRK11624
568708001107	CDP-diglyceride synthetase [Lipid metabolism]; Region: CdsA; COG0575
568708001108	Signal peptide predicted for STM_MW02281 by SignalP 2.0 HMM (Signal peptide probability 0.973) with cleavage site probability 0.760 between residues 29 and 30
568708001110	8 probable transmembrane helices predicted for STM_MW02281 by TMHMM2.0 at aa 7-41, 56-74, 87-106, 121-143, 150-172, 192-211, 218-240 and 260-282
568708001111	zinc metallopeptidase RseP; Provisional; Region: PRK10779
568708001112	RseP-like Site-2 proteases (S2P), zinc metalloproteases (MEROPS family M50A), cleave transmembrane domains of substrate proteins, regulating intramembrane proteolysis (RIP) of diverse signal transduction mechanisms. In Escherichia coli, the S2P homolog...; Region: S2P-M50_PDZ_RseP-like; cd06163
568708001113	active site
568708001114	PDZ domain of bacterial and plant zinc metalloprotases, presumably membrane-associated or integral membrane proteases, which may be involved in signalling and regulatory mechanisms. May be responsible for substrate recognition and/or binding, as most PDZ...; Region: PDZ_metalloprotease; cd00989
568708001115	protein binding site [polypeptide binding]; other site
568708001116	PDZ domain of bacterial and plant zinc metalloprotases, presumably membrane-associated or integral membrane proteases, which may be involved in signalling and regulatory mechanisms. May be responsible for substrate recognition and/or binding, as most PDZ...; Region: PDZ_metalloprotease; cd00989
568708001117	protein binding site [polypeptide binding]; other site
568708001118	RseP-like Site-2 proteases (S2P), zinc metalloproteases (MEROPS family M50A), cleave transmembrane domains of substrate proteins, regulating intramembrane proteolysis (RIP) of diverse signal transduction mechanisms. In Escherichia coli, the S2P homolog...; Region: S2P-M50_PDZ_RseP-like; cd06163
568708001119	putative substrate binding region [chemical binding]; other site
568708001120	4 probable transmembrane helices predicted for STM_MW02291 by TMHMM2.0 at aa 2-21, 98-120, 376-398 and 426-445
568708001123	outer membrane protein assembly factor YaeT; Provisional; Region: PRK11067
568708001124	Surface antigen variable number repeat; Region: Surf_Ag_VNR; pfam07244
568708001125	Surface antigen variable number repeat; Region: Surf_Ag_VNR; pfam07244
568708001126	Surface antigen variable number repeat; Region: Surf_Ag_VNR; pfam07244
568708001127	Surface antigen variable number repeat; Region: Surf_Ag_VNR; pfam07244
568708001128	Surface antigen variable number repeat; Region: Surf_Ag_VNR; pfam07244
568708001129	Surface antigen; Region: Bac_surface_Ag; pfam01103
568708001130	Signal peptide predicted for STM_MW02301 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.980 between residues 20 and 21
568708001133	periplasmic chaperone; Provisional; Region: PRK10780
568708001134	Outer membrane protein (OmpH-like); Region: OmpH; smart00935
568708001135	Signal peptide predicted for STM_MW02311 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 20 and 21
568708001137	UDP-3-O-[3-hydroxymyristoyl] glucosamine N-acyltransferase; Provisional; Region: lpxD; PRK00892
568708001138	UDP-3-O-[3-hydroxymyristoyl] glucosamine N-acyltransferase, LpxD; Region: LpxD; pfam04613
568708001139	UDP-3-O-acyl-glucosamine N-acyltransferase (LpxD): The enzyme catalyzes the transfer of 3-hydroxymyristic acid or 3-hydroxy-arachidic acid, depending on the organism, from the acyl carrier protein (ACP) to UDP-3-O-acyl-glucosamine to produce UDP-2; Region: LbH_LpxD; cd03352
568708001140	trimer interface [polypeptide binding]; other site
568708001141	active site
568708001142	UDP-GlcNAc binding site [chemical binding]; other site
568708001143	lipid binding site [chemical binding]; lipid-binding site
568708001146	FabZ is a 17kD beta-hydroxyacyl-acyl carrier protein (ACP) dehydratase that primarily catalyzes the dehydration of beta-hydroxyacyl-ACP to trans-2-acyl-ACP, the third step in the elongation phase of the bacterial/ plastid, type II, fatty-acid...; Region: FabZ; cd01288
568708001148	UDP-N-acetylglucosamine acyltransferase; Provisional; Region: PRK05289
568708001149	UDP-N-acetylglucosamine O-acyltransferase (UDP-GlcNAc acyltransferase): Proteins in this family catalyze the transfer of (R)-3-hydroxymyristic acid from its acyl carrier protein thioester to UDP-GlcNAc. It is the first enzyme in the lipid A biosynthetic...; Region: LbH_UDP-GlcNAc_AT; cd03351
568708001150	active site
568708001152	lipid-A-disaccharide synthase; Reviewed; Region: lpxB; PRK00025
568708001153	ipid-A-disaccharide synthase; Provisional; Region: PRK14089
568708001155	bacterial Ribonuclease HII-like; Region: RNase_HII_bacteria_HII_like; cd07182
568708001156	RNA/DNA hybrid binding site [nucleotide binding]; other site
568708001157	active site
568708001159	DNA polymerase III subunit alpha; Validated; Region: dnaE; PRK05673
568708001160	Polymerase and Histidinol Phosphatase domain of alpha-subunit of bacterial polymerase III DnaE1; Region: PHP_PolIIIA_DnaE1; cd07433
568708001161	putative active site [active]
568708001162	putative PHP Thumb interface [polypeptide binding]; other site
568708001163	DnaE_OBF: A subfamily of OB folds corresponding to the C-terminal OB-fold nucleic acid binding domain of Thermus aquaticus and Escherichia coli type C replicative DNA polymerase III alpha subunit (DnaE). The DNA polymerase holoenzyme of E. coli contains...; Region: DnaE_OBF; cd04485
568708001164	generic binding surface II; other site
568708001165	generic binding surface I; other site
568708001169	acetyl-CoA carboxylase carboxyltransferase subunit alpha; Validated; Region: PRK05724
568708001170	acetyl-CoA carboxylase carboxyltransferase alpha subunit; Provisional; Region: accA; CHL00198
568708001172	Uncharacterized protein contain chitin-binding domain type 3 [General function prediction only]; Region: COG3979
568708001173	Glycoside hydrolase family 19 chitinase domain. Chitinases are enzymes that catalyze the hydrolysis of the beta-1,4-N-acetyl-D-glucosamine linkages in chitin polymers. Family 19 chitinases are found primarily in plants (classes I, III, and IV), but some...; Region: chitinase_glyco_hydro_19; cd00325
568708001174	putative sugar binding site [chemical binding]; other site
568708001175	catalytic residues [active]
568708001176	PKD domain; Region: PKD; pfam00801
568708001177	Signal peptide predicted for STM_MW02391 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.990 between residues 25 and 26
568708001178	1 probable transmembrane helix predicted for STM_MW02391 by TMHMM2.0 at aa 7-29
568708001182	lysine decarboxylase LdcC; Provisional; Region: PRK15399
568708001183	Orn/Lys/Arg decarboxylase, N-terminal domain; Region: OKR_DC_1_N; pfam03709
568708001184	Ornithine decarboxylase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD corresponds to ornithine decarboxylase (ODC), arginine decarboxylase (ADC) and lysine...; Region: Orn_deC_like; cd00615
568708001185	homodimer interface [polypeptide binding]; other site
568708001186	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708001187	catalytic residue [active]
568708001188	Orn/Lys/Arg decarboxylase, C-terminal domain; Region: OKR_DC_1_C; pfam03711
568708001192	This conserved domain belongs to a superfamily including the bleomycin resistance protein, glyoxalase I, and type I ring-cleaving dioxygenases; Region: Glo_EDI_BRP_like_1; cd08352
568708001193	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
568708001194	putative metal binding site [ion binding]; other site
568708001196	tRNA(Ile)-lysidine synthetase; Provisional; Region: tilS; PRK10660
568708001197	N-terminal domain of predicted ATPase of the PP-loop faimly implicated in cell cycle control [Cell division and chromosome partitioning]. This is a subfamily of Adenine nucleotide alpha hydrolases superfamily.Adeninosine nucleotide alpha hydrolases...; Region: PP-ATPase; cd01992
568708001198	TilS substrate binding domain; Region: TilS; pfam09179
568708001199	TilS substrate C-terminal domain; Region: TilS_C; pfam11734
568708001203	Rho-binding antiterminator; Provisional; Region: PRK11625
568708001205	hypothetical protein; Provisional; Region: PRK04964
568708001207	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4681
568708001209	hypothetical protein; Provisional; Region: PRK09256
568708001210	Protein chain release factor B [Translation, ribosomal structure and biogenesis]; Region: PrfB; COG1186
568708001212	lipoprotein involved with copper homeostasis and adhesion; Provisional; Region: PRK10523
568708001213	NlpE N-terminal domain; Region: NlpE; pfam04170
568708001214	Signal peptide predicted for STM_MW02471 by SignalP 2.0 HMM (Signal peptide probability 0.949) with cleavage site probability 0.649 between residues 25 and 26
568708001216	prolyl-tRNA synthetase; Provisional; Region: PRK09194
568708001217	Prolyl-tRNA synthetase (ProRS) class II core catalytic domain. ProRS is a homodimer. It is responsible for the attachment of proline to the 3' OH group of ribose of the appropriate tRNA. This domain is primarily responsible for ATP-dependent...; Region: ProRS_core_prok; cd00779
568708001218	dimer interface [polypeptide binding]; other site
568708001219	motif 1; other site
568708001220	active site
568708001221	motif 2; other site
568708001222	INS is an amino acid-editing domain inserted (INS) into the bacterial class II prolyl-tRNA synthetase (ProRS) however, this CD is not exclusively bacterial. It is also found at the N-terminus of the eukaryotic/archaea-like ProRS's of yeasts and...; Region: ProRS-INS; cd04334
568708001223	putative deacylase active site [active]
568708001224	Class II tRNA amino-acyl synthetase-like catalytic core domain. Class II amino acyl-tRNA synthetases (aaRS) share a common fold and generally attach an amino acid to the 3' OH of ribose of the appropriate tRNA.   PheRS is an exception in that it...; Region: class_II_aaRS-like_core; cl00268
568708001225	active site
568708001226	motif 3; other site
568708001227	ProRS Prolyl-anticodon binding domain, short version found predominantly in bacteria. ProRS belongs to class II aminoacyl-tRNA synthetases (aaRS). This alignment contains the anticodon binding domain, which is responsible for specificity in tRNA-binding; Region: ProRS_anticodon_short; cd00861
568708001228	anticodon binding site; other site
568708001232	Escherichia coli YaeB and related proteins; Region: UPF0066; cd09281
568708001233	homodimer interaction site [polypeptide binding]; other site
568708001234	cofactor binding site; other site
568708001236	outer membrane lipoprotein; Reviewed; Region: rcsF; PRK10781
568708001237	Signal peptide predicted for STM_MW02501 by SignalP 2.0 HMM (Signal peptide probability 0.667) with cleavage site probability 0.306 between residues 19 and 20
568708001238	DL-methionine transporter substrate-binding subunit; Provisional; Region: metQ; PRK11063
568708001239	lipoprotein, YaeC family; Region: TIGR00363
568708001241	Signal peptide predicted for STM_MW02511 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.356 between residues 21 and 22
568708001242	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708001243	dimer interface [polypeptide binding]; other site
568708001244	conserved gate region; other site
568708001245	ABC-ATPase subunit interface; other site
568708001246	5 probable transmembrane helices predicted for STM_MW02521 by TMHMM2.0 at aa 20-42, 55-77, 81-103, 144-166 and 181-203
568708001248	DL-methionine transporter ATP-binding subunit; Provisional; Region: metN; PRK11153
568708001249	ATP-binding cassette domain of methionine transporter; Region: ABC_MetN_methionine_transporter; cd03258
568708001250	Walker A/P-loop; other site
568708001251	ATP binding site [chemical binding]; other site
568708001252	Q-loop/lid; other site
568708001253	ABC transporter signature motif; other site
568708001254	Walker B; other site
568708001255	D-loop; other site
568708001256	H-loop/switch region; other site
568708001257	This domain is found at the C-terminus of ABC transporter proteins involved in D-methionine transport as well as a number of ferredoxin-like proteins; Region: NIL; smart00930
568708001260	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660
568708001261	Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248
568708001262	active site
568708001263	catalytic tetrad [active]
568708001265	Transcriptional regulator [Transcription]; Region: LysR; COG0583
568708001266	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708001267	The C-terminal substrate binding domain of LysR-type transcriptional regulator CrgA, contains the type 2 periplasmic binding domain; Region: PBP2_CrgA; cd08478
568708001268	putative effector binding pocket; other site
568708001269	dimerization interface [polypeptide binding]; other site
568708001272	Arabinose efflux permease [Carbohydrate transport and metabolism]; Region: AraJ; COG2814
568708001273	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708001274	putative substrate translocation pore; other site
568708001275	12 probable transmembrane helices predicted for STM_MW02561 by TMHMM2.0 at aa 7-29, 39-61, 70-89, 99-121, 128-150, 160-182, 202-224, 234-256, 263-285, 289-311, 331-353 and 363-382
568708001277	hypothetical protein; Provisional; Region: PRK05421
568708001278	putative catalytic site [active]
568708001279	putative metal binding site [ion binding]; other site
568708001280	putative phosphate binding site [ion binding]; other site
568708001281	putative catalytic site [active]
568708001282	putative phosphate binding site [ion binding]; other site
568708001283	putative metal binding site [ion binding]; other site
568708001285	Methyltransferase domain; Region: Methyltransf_23; pfam13489
568708001286	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708001287	S-adenosylmethionine binding site [chemical binding]; other site
568708001289	membrane-bound lytic murein transglycosylase D; Provisional; Region: mltD; PRK10783
568708001290	Lytic Transglycosylase (LT)  and Goose Egg White Lysozyme (GEWL) domain. Members include the soluble and insoluble membrane-bound LTs in bacteria, the LTs in bacteriophage lambda, as well as, the eukaryotic "goose-type" lysozymes (GEWL).  LTs...; Region: LT_GEWL; cd00254
568708001291	N-acetyl-D-glucosamine binding site [chemical binding]; other site
568708001292	catalytic residue [active]
568708001293	Lysine Motif is a small domain involved in binding peptidoglycan; Region: LysM; cd00118
568708001294	Lysine Motif is a small domain involved in binding peptidoglycan; Region: LysM; cd00118
568708001298	Signal peptide predicted for STM_MW02591 by SignalP 2.0 HMM (Signal peptide probability 0.987) with cleavage site probability 0.403 between residues 21 and 22
568708001299	hydroxyacylglutathione hydrolase; Provisional; Region: PRK10241
568708001301	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708001303	RNase HI family found mainly in prokaryotes; Region: RNase_HI_prokaryote_like; cd09278
568708001304	RNA/DNA hybrid binding site [nucleotide binding]; other site
568708001305	active site
568708001307	DNA polymerase III, epsilon subunit, Proteobacterial; Region: dnaQ_proteo; TIGR01406
568708001308	DEDDh 3'-5' exonuclease domain of the epsilon subunit of Escherichia coli DNA polymerase III and similar proteins; Region: DNA_pol_III_epsilon_Ecoli_like; cd06131
568708001309	active site
568708001310	catalytic site [active]
568708001311	substrate binding site [chemical binding]; other site
568708001313	Predicted component of the type VI protein secretion system [Intracellular trafficking, secretion, and    vesicular transport]; Region: COG3515
568708001314	ImpA-related N-terminal; Region: ImpA-rel_N; pfam06812
568708001316	Predicted component of the type VI protein secretion system [Intracellular trafficking, secretion, and    vesicular transport]; Region: COG3520
568708001318	Type VI protein secretion system component VasA [Intracellular trafficking, secretion, and    vesicular transport]; Region: COG3519
568708001319	Bacterial protein of unknown function (DUF879); Region: DUF879; pfam05947
568708001321	Predicted component of the type VI protein secretion system [Intracellular trafficking, secretion, and    vesicular transport]; Region: COG3518
568708001323	Protein of avirulence locus involved in temperature-dependent protein secretion [General function prediction only]; Region: ImpE; COG4455
568708001324	ImpE protein; Region: ImpE; pfam07024
568708001326	type VI secretion ATPase, ClpV1 family; Region: VI_ClpV1; TIGR03345
568708001327	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708001328	Walker A motif; other site
568708001329	ATP binding site [chemical binding]; other site
568708001330	Walker B motif; other site
568708001331	arginine finger; other site
568708001332	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708001333	Walker A motif; other site
568708001334	ATP binding site [chemical binding]; other site
568708001335	Walker B motif; other site
568708001336	C-terminal, D2-small domain, of ClpB protein; Region: ClpB_D2-small; smart01086
568708001340	Predicted component of the type VI protein secretion system [Intracellular trafficking, secretion, and    vesicular transport]; Region: COG3516
568708001342	Predicted component of the type VI protein secretion system [Intracellular trafficking, secretion, and    vesicular transport]; Region: COG3517
568708001343	Protein of unknown function (DUF877); Region: DUF877; pfam05943
568708001345	Signal peptide predicted for STM_MW02771 by SignalP 2.0 HMM (Signal peptide probability 0.996) with cleavage site probability 0.996 between residues 23 and 24
568708001346	Type VI protein secretion system component Hcp (secreted cytotoxin) [Intracellular trafficking, secretion,    and vesicular transport]; Region: Hcp; COG3157
568708001348	Domain of unknown function (DUF4285); Region: DUF4285; pfam14113
568708001349	Signal peptide predicted for STM_MW02831 by SignalP 2.0 HMM (Signal peptide probability 0.979) with cleavage site probability 0.962 between residues 26 and 27
568708001350	1 probable transmembrane helix predicted for STM_MW02831 by TMHMM2.0 at aa 7-26
568708001351	Type VI protein secretion system component Hcp (secreted cytotoxin) [Intracellular trafficking, secretion,    and vesicular transport]; Region: Hcp; COG3157
568708001353	Predicted component of the type VI protein secretion system [Intracellular trafficking, secretion, and    vesicular transport]; Region: COG3521
568708001354	Signal peptide predicted for STM_MW02851 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.844 between residues 31 and 32
568708001355	Predicted component of the type VI protein secretion system [Intracellular trafficking, secretion, and    vesicular transport]; Region: COG3522
568708001356	Bacterial protein of unknown function (DUF876); Region: DUF876; pfam05936
568708001358	hypothetical protein; Provisional; Region: PRK08126
568708001359	Type VI protein secretion system component VasF [Intracellular    trafficking, secretion, and vesicular transport]; Region: COG3455
568708001360	Peptidoglycan binding domains similar to the C-terminal domain of outer-membrane protein OmpA; Region: OmpA_C-like; cd07185
568708001361	ligand binding site [chemical binding]; other site
568708001363	1 probable transmembrane helix predicted for STM_MW02871 by TMHMM2.0 at aa 243-265
568708001365	1 probable transmembrane helix predicted for STM_MW02881 by TMHMM2.0 at aa 34-56
568708001366	Signal peptide predicted for STM_MW02891 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.997 between residues 18 and 19
568708001367	Type VI protein secretion system component VasK [Intracellular trafficking, secretion, and    vesicular transport]; Region: IcmF; COG3523
568708001368	Intracellular multiplication and human macrophage-killing; Region: IcmF-related; pfam06761
568708001369	Protein of unknown function (DUF1215); Region: DUF1215; pfam06744
568708001370	Signal peptide predicted for STM_MW02901 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.985 between residues 34 and 35
568708001371	5 probable transmembrane helices predicted for STM_MW02901 by TMHMM2.0 at aa 13-35, 40-62, 69-88, 98-120 and 530-547
568708001374	Uncharacterized protein conserved in bacteria (DUF2094); Region: DUF2094; cl01611
568708001376	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4893
568708001377	Signal peptide predicted for STM_MW02921 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.847 between residues 23 and 24
568708001379	Uncharacterized protein conserved in bacteria [Function unknown]; Region: VgrG; COG3501
568708001380	Phage late control gene D protein (GPD); Region: Phage_GPD; pfam05954
568708001381	Phage-related baseplate assembly protein; Region: Phage_base_V; pfam04717
568708001384	Uncharacterized conserved protein [Function unknown]; Region: COG5435
568708001386	PAAR motif; Region: PAAR_motif; pfam05488
568708001387	RHS Repeat; Region: RHS_repeat; pfam05593
568708001388	Rhs family protein [Cell envelope biogenesis, outer membrane]; Region: RhsA; COG3209
568708001389	RHS Repeat; Region: RHS_repeat; pfam05593
568708001390	RHS Repeat; Region: RHS_repeat; pfam05593
568708001391	RHS protein; Region: RHS; pfam03527
568708001392	RHS repeat-associated core domain; Region: Rhs_assc_core; TIGR03696
568708001393	1 probable transmembrane helix predicted for STM_MW02961 by TMHMM2.0 at aa 17-39
568708001399	lacks N-terminal region
568708001400	Toxin SymE, type I toxin-antitoxin system; Region: SymE_toxin; cl07446
568708001402	has a frameshift after residue 81; pfam_scan;Pfam:PF08845; E()=3.7E-13;score=48.3;query17-49;description=DUF1813
568708001404	Transposase; Region: HTH_Tnp_1; cl17663
568708001406	lacks the N-terminal region and has three frameshifts after residues 43, 142 and 148; pfam_scan;Pfam:PF00665; E()=5.8E-19;score=68.1;query10-139;description=rve
568708001408	Saf-pilin pilus formation protein SafA; Provisional; Region: PRK15221
568708001409	Signal peptide predicted for STM_MW03091 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.988 between residues 26 and 27
568708001411	pili assembly chaperone protein SafB; Provisional; Region: PRK15224
568708001412	Gram-negative pili assembly chaperone, N-terminal domain; Region: Pili_assembly_N; pfam00345
568708001413	Gram-negative pili assembly chaperone, C-terminal domain; Region: Pili_assembly_C; pfam02753
568708001416	pilin outer membrane usher protein SafC; Provisional; Region: PRK15223
568708001417	PapC N-terminal domain; Region: PapC_N; pfam13954
568708001418	Type VII secretion system (T7SS), usher protein; Region: Usher; pfam00577
568708001419	PapC C-terminal domain; Region: PapC_C; pfam13953
568708001420	Signal peptide predicted for STM_MW03111 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.930 between residues 21 and 22
568708001422	putative pilin structural protein SafD; Provisional; Region: PRK15222
568708001423	Signal peptide predicted for STM_MW03121 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.996 between residues 30 and 31
568708001425	1 probable transmembrane helix predicted for STM_MW03121 by TMHMM2.0 at aa 12-31
568708001426	Predicted xylanase/chitin deacetylase [Carbohydrate transport and metabolism]; Region: CDA1; COG0726
568708001427	Putative catalytic NodB homology domain of a hypothetical protein Ecf1 from Escherichia coli and similar proteins; Region: CE4_Ecf1_like_5s; cd10969
568708001428	putative active site [active]
568708001429	putative metal binding site [ion binding]; other site
568708001431	PerC transcriptional activator; Region: PerC; pfam06069
568708001433	Transcriptional regulator [Transcription]; Region: LysR; COG0583
568708001434	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708001435	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
568708001436	dimerization interface [polypeptide binding]; other site
568708001439	Opacity protein and related surface antigens [Cell envelope biogenesis, outer membrane]; Region: COG3637
568708001441	Signal peptide predicted for STM_MW03171 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.976 between residues 22 and 23
568708001442	CpxP component of the bacterial Cpx-two-component system and related proteins; Region: CpxP_like; cd09916
568708001443	dimer interface [polypeptide binding]; other site
568708001444	Signal peptide predicted for STM_MW03181 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.733 between residues 23 and 24
568708001445	C-N hydrolase family amidase; Provisional; Region: PRK10438
568708001446	Xanthomonas campestris XC1258 and related proteins, members of the nitrilase superfamily (putative class 13 nitrilases); Region: Xc-1258_like; cd07575
568708001447	putative active site [active]
568708001448	catalytic triad [active]
568708001449	dimer interface [polypeptide binding]; other site
568708001450	multimer interface [polypeptide binding]; other site
568708001452	acyl-CoA dehydrogenase; Reviewed; Region: fadE; PRK09463
568708001453	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
568708001454	active site
568708001455	Domain of unknown function (DUF1974); Region: DUF1974; pfam09317
568708001459	2 probable transmembrane helices predicted for STM_MW03201 by TMHMM2.0 at aa 10-32 and 39-61
568708001460	Signal peptide predicted for STM_MW03201 by SignalP 2.0 HMM (Signal peptide probability 0.711) with cleavage site probability 0.289 between residues 32 and 33
568708001461	Phosphoheptose isomerase is a member of the SIS (Sugar ISomerase) superfamily. Phosphoheptose isomerase catalyzes the isomerization of sedoheptulose 7-phosphate into D-glycero-D-mannoheptose 7-phosphate. This is the first step of the biosynthesis of...; Region: SIS_GmhA; cd05006
568708001462	dimer interface [polypeptide binding]; other site
568708001463	active site
568708001465	Predicted glutamine amidotransferase [General function prediction only]; Region: COG0121
568708001466	Glutamine amidotransferases class-II (Gn-AT)_YafJ-type.  YafJ is a glutamine amidotransferase-like protein of unknown function found in prokaryotes, eukaryotes and archaea.  YafJ has a conserved structural fold similar to those of other class II...; Region: YafJ; cd01908
568708001467	putative active site [active]
568708001468	putative dimer interface [polypeptide binding]; other site
568708001470	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3034
568708001471	L,D-transpeptidase catalytic domain; Region: YkuD; pfam03734
568708001473	Signal peptide predicted for STM_MW03231 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.831 between residues 19 and 20
568708001474	DNA Polymerase IV/Kappa; Region: PolY_Pol_IV_kappa; cd03586
568708001475	active site
568708001476	DNA polymerase IV; Validated; Region: PRK02406
568708001477	DNA binding site [nucleotide binding]
568708001481	contains a frameshift after residue 297; pfam_scan;Pfam:PF01139; E()=1.4E-22;score=79.4;query13-108;description=UPF0027
568708001483	peptide chain release factor-like protein; Reviewed; Region: prfH; PRK08179
568708001484	Protein chain release factor B [Translation, ribosomal structure and biogenesis]; Region: PrfB; COG1186
568708001486	Xaa-His dipeptidase; Region: aa-his-dipept; TIGR01893
568708001487	M20 Peptidase D has specificity for beta-alanyl-L-histidine dipeptide; Region: M20_pepD; cd03890
568708001488	metal binding site [ion binding]; metal-binding site
568708001489	dimer interface [polypeptide binding]; other site
568708001492	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
568708001493	active site
568708001495	fermentation/respiration switch protein; Reviewed; Region: frsA; PRK05077
568708001497	DNA-binding transcriptional regulator Crl; Provisional; Region: PRK10984
568708001499	Outer membrane protein (porin) [Cell envelope biogenesis, outer membrane]; Region: OmpC; COG3203
568708001500	Porins form aqueous channels for the diffusion of small hydrophillic molecules across the outer membrane. Individual 16-strand anti-parallel beta-barrels form a central pore, and trimerizes thru mainly hydrophobic interactions at the interface. Trimers...; Region: gram_neg_porins; cd00342
568708001501	trimer interface [polypeptide binding]; other site
568708001502	eyelet of channel; other site
568708001504	Signal peptide predicted for STM_MW03311 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 20 and 21
568708001505	gamma-glutamyl kinase; Provisional; Region: PRK05429
568708001506	AAK_G5K_ProB: Glutamate-5-kinase (G5K) catalyzes glutamate-dependent ATP cleavage; G5K transfers the terminal phosphoryl group of ATP to the gamma-carboxyl group of glutamate, in the first and controlling step of proline (and, in mammals, ornithine)...; Region: AAK_G5K_ProB; cd04242
568708001507	nucleotide binding site [chemical binding]; other site
568708001508	homotetrameric interface [polypeptide binding]; other site
568708001509	putative phosphate binding site [ion binding]; other site
568708001510	putative allosteric binding site; other site
568708001511	PUA domain; Region: PUA; pfam01472
568708001514	Gamma-glutamyl phosphate reductase (GPR), aldehyde dehydrogenase families 18 and 19; Region: ALDH_F18-19_ProA-GPR; cd07079
568708001515	gamma-glutamyl phosphate reductase; Region: proA; TIGR00407
568708001516	putative catalytic cysteine [active]
568708001518	BTP1
568708001519	Integrase [DNA replication, recombination, and repair]; Region: XerC; COG0582
568708001520	P22-like integrases, site-specific recombinases, DNA breaking-rejoining enzymes, C-terminal catalytic domain. This CD includes various bacterial and phage integrases, including those similar to phage P22-like integrases, DLP12 and APSE-1; Region: INT_P22_C; cd01192
568708001521	Int/Topo IB signature motif; other site
568708001523	Helix-turn-helix domain; Region: HTH_17; pfam12728
568708001524	The ASCH domain adopts a beta-barrel fold similar to that of the PUA domain; Region: ASCH; smart01022
568708001525	Protein of unknown function (DUF550); Region: DUF550; pfam04447
568708001527	Ead/Ea22-like protein; Region: Ead_Ea22; pfam13935
568708001528	Protein of unknown function (DUF2737); Region: DUF2737; pfam10930
568708001530	Protein of unknown function (DUF2856); Region: DUF2856; pfam11043
568708001532	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cl17257
568708001534	Rad52/22 family double-strand break repair protein; Region: Rad52_Rad22; cl01936
568708001536	Lambda Phage CIII; Region: Lambda_CIII; pfam02061
568708001538	1 probable transmembrane helix predicted for STM_MW03491 by TMHMM2.0 at aa 15-37
568708001539	Antirestriction protein Ral; Region: Ral; pfam11058
568708001541	Protein of unknown function (DUF2767); Region: DUF2767; cl08104
568708001543	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
568708001544	non-specific DNA binding site [nucleotide binding]; other site
568708001545	Predicted transcriptional regulator [Transcription]; Region: COG2932
568708001546	salt bridge; other site
568708001547	sequence-specific DNA binding site [nucleotide binding]; other site
568708001548	Peptidase S24 LexA-like proteins are involved in the SOS response leading to the repair of single-stranded DNA within the bacterial cell. This family includes: the lambda repressor CI/C2 family and related bacterial prophage repressor proteins; LexA (EC...; Region: S24_LexA-like; cd06529
568708001549	Catalytic site [active]
568708001552	Uncharacterized protein conserved in bacteria, prophage-related [Function unknown]; Region: COG4197
568708001553	Bacteriophage CII protein; Region: Phage_CII; pfam05269
568708001555	Bacteriophage replication protein O; Region: Phage_rep_O; pfam04492
568708001557	DnaB-like helicase N terminal domain; Region: DnaB; pfam00772
568708001558	DnaB-like helicase C terminal domain; Region: DnaB_C; pfam03796
568708001559	DnaB helicase C terminal domain. The hexameric helicase DnaB unwinds the DNA duplex at the  chromosome replication fork. Although the mechanism by which DnaB both couples ATP hydrolysis to translocation along DNA and denatures the duplex is unknown, a...; Region: DnaB_C; cd00984
568708001560	Walker A motif; other site
568708001561	ATP binding site [chemical binding]; other site
568708001562	Walker B motif; other site
568708001563	DNA binding loops [nucleotide binding]
568708001566	1 probable transmembrane helix predicted for STM_MW03601 by TMHMM2.0 at aa 10-32
568708001567	NinB protein; Region: NinB; pfam05772
568708001569	NINE Protein; Region: NinE; pfam05322
568708001571	NinF protein; Region: NinF; pfam05810
568708001573	Bacteriophage Lambda NinG protein; Region: NinG; pfam05766
568708001575	Phage NinH protein; Region: Phage_NinH; pfam06322
568708001577	Phage antitermination protein Q; Region: Phage_antitermQ; pfam06530
568708001579	2 probable transmembrane helices predicted for STM_MW03711 by TMHMM2.0 at aa 7-26 and 30-49
568708001580	Endolysins and autolysins are found in viruses and bacteria, respectively. The ds DNA phages of eubacteria use endolysins or muralytic enzymes in conjunction with hollin, a small membrane protein, to degrade the peptidoglycan found in bacterial cell...; Region: endolysin_autolysin; cd00737
568708001581	catalytic residues [active]
568708001582	Signal peptide predicted for STM_MW03721 by SignalP 2.0 HMM (Signal peptide probability 0.625) with cleavage site probability 0.154 between residues 23 and 24
568708001583	1 probable transmembrane helix predicted for STM_MW03721 by TMHMM2.0 at aa 7-29
568708001585	Bacteriophage lysis protein; Region: Phage_lysis; pfam03245
568708001587	1 probable transmembrane helix predicted for STM_MW03731 by TMHMM2.0 at aa 15-37
568708001588	Uncharacterized phage-encoded protein [Function unknown]; Region: COG3646
568708001589	Phage regulatory protein Rha (Phage_pRha); Region: Phage_pRha; pfam09669
568708001590	ORF11CD3 domain; Region: ORF11CD3; pfam10549
568708001593	hypothetical protein; Region: PHA00780
568708001595	Terminase-like family; Region: Terminase_6; pfam03237
568708001596	Bacteriophage terminase large (ATPase) subunit and inactivated derivatives [General function prediction only]; Region: COG5565
568708001597	Phage terminase large subunit; Region: Terminase_3; cl12054
568708001599	Bacteriophage, scaffolding protein; Region: Phage-scaffold; pfam09306
568708001601	coat protein; Region: PHA01511
568708001602	P22 coat protein - gene protein 5; Region: P22_CoatProtein; pfam11651
568708001604	P22 tail accessory factor; Region: P22_Tail-4; pfam11650
568708001606	Phage stabilisation protein; Region: Phage_stabilise; pfam11134
568708001608	Protein of unknown function (DUF2824); Region: DUF2824; pfam11039
568708001610	Head binding; Region: Head_binding; pfam09008
568708001611	Salmonella phage P22 tail-spike; Region: PhageP22-tail; pfam09251
568708001614	Predicted acyltransferases [Lipid metabolism]; Region: COG1835
568708001616	11 probable transmembrane helices predicted for STM_MW03911 by TMHMM2.0 at aa 13-35, 40-59, 72-94, 135-157, 166-188, 201-218, 225-242, 246-268, 275-294, 314-333 and 345-367
568708001617	1 probable transmembrane helix predicted for STM_MW03921 by TMHMM2.0 at aa 10-32
568708001618	HTH-like domain; Region: HTH_21; pfam13276
568708001619	Integrase core domain; Region: rve; pfam00665
568708001620	Integrase core domain; Region: rve_2; pfam13333
568708001622	lacks the N-terminal region and has a frameshift after residue 92; pfam_scan;Pfam:PF08841; E()=9.3E-122;score=405.6;query 1-236;description=DDR
568708001624	Domain of unknown function (DUF1889); Region: DUF1889; pfam08986
568708001626	Arabinose efflux permease [Carbohydrate transport and metabolism]; Region: AraJ; COG2814
568708001627	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708001628	putative substrate translocation pore; other site
568708001629	12 probable transmembrane helices predicted for STM_MW03981 by TMHMM2.0 at aa 16-38, 53-75, 82-104, 108-130, 137-159, 169-191, 221-243, 253-275, 282-304, 308-330, 347-369 and 373-395
568708001631	3-isopropylmalate dehydratase large subunit; Reviewed; Region: PRK00402
568708001632	3-isopropylmalate dehydratase catalyzes the isomerization between 2-isopropylmalate and 3-isopropylmalate; Region: IPMI; cd01583
568708001633	substrate binding site [chemical binding]; other site
568708001634	ligand binding site [chemical binding]; other site
568708001636	3-isopropylmalate dehydratase small subunit [Amino acid transport and metabolism]; Region: LeuD; COG0066
568708001637	Aconatase-like swivel domain of 3-isopropylmalate dehydratase and related uncharacterized proteins. 3-isopropylmalate dehydratase catalyzes the isomerization between 2-isopropylmalate and 3-isopropylmalate, via the formation of 2-isopropylmaleate...; Region: IPMI_Swivel; cd01577
568708001638	hypothetical protein; Provisional; Region: PRK14812
568708001639	substrate binding site [chemical binding]; other site
568708001641	2-keto-4-pentenoate hydratase/2-oxohepta-3-ene-1,7-dioic acid hydratase (catechol pathway) [Secondary metabolites biosynthesis, transport, and catabolism]; Region: MhpD; COG0179
568708001642	Fumarylacetoacetate (FAA) hydrolase family; Region: FAA_hydrolase; pfam01557
568708001644	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
568708001646	transcriptional activator TtdR; Provisional; Region: PRK09801
568708001647	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708001648	The C-terminal substrate binding domain of an uncharacterized LysR-type transcriptional regulator CrgA-like, contains the type 2 periplasmic binding fold; Region: PBP2_CrgA_like_9; cd08479
568708001649	putative effector binding pocket; other site
568708001650	putative dimerization interface [polypeptide binding]; other site
568708001653	YjzC-like protein; Region: YjzC; pfam14168
568708001654	Signal peptide predicted for STM_MW04051 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.628 between residues 25 and 26
568708001655	fimbrial assembly chaperone StbE; Provisional; Region: PRK15246
568708001656	Gram-negative pili assembly chaperone, N-terminal domain; Region: Pili_assembly_N; pfam00345
568708001657	Gram-negative pili assembly chaperone, C-terminal domain; Region: Pili_assembly_C; pfam02753
568708001660	Signal peptide predicted for STM_MW04061 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.999 between residues 29 and 30
568708001661	1 probable transmembrane helix predicted for STM_MW04061 by TMHMM2.0 at aa 7-29
568708001662	putative fimbrial usher protein StbD; Provisional; Region: PRK15247
568708001663	Signal peptide predicted for STM_MW04071 by SignalP 2.0 HMM (Signal peptide probability 0.933) with cleavage site probability 0.750 between residues 18 and 19
568708001664	fimbrial outer membrane usher protein StbC; Provisional; Region: PRK15248
568708001665	PapC N-terminal domain; Region: PapC_N; pfam13954
568708001666	Type VII secretion system (T7SS), usher protein; Region: Usher; pfam00577
568708001667	PapC C-terminal domain; Region: PapC_C; pfam13953
568708001669	Signal peptide predicted for STM_MW04081 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 26 and 27
568708001670	fimbrial chaperone protein StbB; Provisional; Region: PRK15249
568708001671	Gram-negative pili assembly chaperone, N-terminal domain; Region: Pili_assembly_N; pfam00345
568708001672	Gram-negative pili assembly chaperone, C-terminal domain; Region: Pili_assembly_C; pfam02753
568708001675	1 probable transmembrane helix predicted for STM_MW04091 by TMHMM2.0 at aa 9-31
568708001676	Signal peptide predicted for STM_MW04091 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.791 between residues 28 and 29
568708001677	P pilus assembly protein, pilin FimA [Cell motility and secretion / Intracellular trafficking and secretion]; Region: FimA; COG3539
568708001679	Signal peptide predicted for STM_MW04101 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.991 between residues 22 and 23
568708001680	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cl17355
568708001681	1 probable transmembrane helix predicted for STM_MW04111 by TMHMM2.0 at aa 145-167
568708001682	Signal peptide predicted for STM_MW04121 by SignalP 2.0 HMM (Signal peptide probability 0.903) with cleavage site probability 0.632 between residues 26 and 27
568708001683	1 probable transmembrane helix predicted for STM_MW04121 by TMHMM2.0 at aa 7-29
568708001684	CSS motif domain associated with EAL; Region: CSS-motif; pfam12792
568708001685	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
568708001686	Signal peptide predicted for STM_MW04131 by SignalP 2.0 HMM (Signal peptide probability 0.992) with cleavage site probability 0.958 between residues 26 and 27
568708001687	2 probable transmembrane helices predicted for STM_MW04131 by TMHMM2.0 at aa 7-29 and 223-245
568708001689	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cl17355
568708001690	DNA binding site [nucleotide binding]
568708001691	Signal peptide predicted for STM_MW04151 by SignalP 2.0 HMM (Signal peptide probability 0.992) with cleavage site probability 0.718 between residues 25 and 26
568708001692	1 probable transmembrane helix predicted for STM_MW04151 by TMHMM2.0 at aa 7-29
568708001693	Outer membrane protein beta-barrel domain; Region: OMP_b-brl; cl17254
568708001694	Signal peptide predicted for STM_MW04161 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 22 and 23
568708001696	DNA-binding HTH domain-containing proteins [Transcription]; Region: CsgD; COG2771
568708001697	DNA binding residues [nucleotide binding]
568708001698	dimerization interface [polypeptide binding]; other site
568708001700	Domain of unknown function (DUF4156); Region: DUF4156; pfam13698
568708001701	Signal peptide predicted for STM_MW04191 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.408 between residues 20 and 21
568708001702	Outer membrane protein [Cell envelope biogenesis, outer membrane / Intracellular trafficking and secretion]; Region: TolC; COG1538
568708001704	Cation/multidrug efflux pump [Defense mechanisms]; Region: AcrB; COG0841
568708001706	12 probable transmembrane helices predicted for STM_MW04211 by TMHMM2.0 at aa 7-29, 339-361, 368-390, 394-416, 443-465, 475-497, 543-565, 882-899, 906-928, 933-955, 983-1005 and 1015-1037
568708001707	Signal peptide predicted for STM_MW04211 by SignalP 2.0 HMM (Signal peptide probability 0.996) with cleavage site probability 0.452 between residues 30 and 31
568708001708	RND family efflux transporter, MFP subunit; Region: RND_mfp; TIGR01730
568708001709	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
568708001710	HlyD family secretion protein; Region: HlyD_3; pfam13437
568708001712	1 probable transmembrane helix predicted for STM_MW04221 by TMHMM2.0 at aa 7-29
568708001713	Signal peptide predicted for STM_MW04221 by SignalP 2.0 HMM (Signal peptide probability 0.893) with cleavage site probability 0.796 between residues 24 and 25
568708001714	Cation transport ATPase [Inorganic ion transport and metabolism]; Region: ZntA; COG2217
568708001715	Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371
568708001716	metal-binding site [ion binding]
568708001717	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
568708001718	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708001719	motif II; other site
568708001721	8 probable transmembrane helices predicted for STM_MW04231 by TMHMM2.0 at aa 99-121, 136-156, 169-191, 201-219, 353-375, 380-402, 696-718 and 722-744
568708001724	Cu(I)-responsive transcriptional regulator; Region: CueR; TIGR02044
568708001725	Helix-Turn-Helix DNA binding domain of CueR-like transcription regulators; Region: HTH_CueR; cd01108
568708001726	DNA binding residues [nucleotide binding]
568708001727	dimer interface [polypeptide binding]; other site
568708001728	copper binding site [ion binding]; other site
568708001731	Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371
568708001732	metal-binding site [ion binding]
568708001734	putative sialic acid transporter; Region: 2A0112; TIGR00891
568708001735	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708001736	putative substrate translocation pore; other site
568708001737	10 probable transmembrane helices predicted for STM_MW04261 by TMHMM2.0 at aa 13-35, 50-72, 79-101, 105-127, 140-162, 172-194, 215-232, 252-274, 287-309 and 370-392
568708001739	Adenine specific DNA methylase Mod [DNA replication, recombination, and repair]; Region: COG2189
568708001740	DNA methylase; Region: N6_N4_Mtase; cl17433
568708001741	DNA methylase; Region: N6_N4_Mtase; pfam01555
568708001743	type III restriction-modification system StyLTI enzyme res; Provisional; Region: PRK15483
568708001744	Type III restriction enzyme, res subunit; Region: ResIII; pfam04851
568708001745	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cl17251
568708001746	VRR-NUC domain; Region: VRR_NUC; pfam08774
568708001749	Bacterial Cytochrome Ubiquinol Oxidase; Region: Bac_Ubq_Cox; pfam01654
568708001751	9 probable transmembrane helices predicted for STM_MW04301 by TMHMM2.0 at aa 20-42, 55-77, 97-119, 126-148, 185-207, 220-237, 322-344, 357-379 and 407-429
568708001752	Cytochrome oxidase subunit II; Region: Cyto_ox_2; pfam02322
568708001753	cytochrome d ubiquinol oxidase subunit 2; Provisional; Region: PRK15003; cl12219
568708001754	cytochrome d ubiquinol oxidase subunit 2; Provisional; Region: PRK15003; cl12219
568708001756	8 probable transmembrane helices predicted for STM_MW04311 by TMHMM2.0 at aa 7-26, 78-100, 121-143, 158-180, 193-215, 230-248, 261-283 and 303-325
568708001757	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
568708001758	ferrichrome outer membrane transporter; Provisional; Region: PRK10044
568708001759	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
568708001760	N-terminal plug; other site
568708001761	ligand-binding site [chemical binding]; other site
568708001762	Signal peptide predicted for STM_MW04341 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 30 and 31
568708001765	The Resistance to Homoserine/Threonine (RhtB) Family protein; Region: 2A76; TIGR00949
568708001766	6 probable transmembrane helices predicted for STM_MW04351 by TMHMM2.0 at aa 5-27, 39-61, 71-90, 123-140, 150-167 and 187-204
568708001768	hypothetical protein; Provisional; Region: PRK09929
568708001769	Signal peptide predicted for STM_MW04361 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 21 and 22
568708001771	propionate catabolism operon regulatory protein PrpR; Provisional; Region: PRK15424
568708001772	Propionate catabolism activator; Region: PrpR_N; pfam06506
568708001773	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708001774	Walker A motif; other site
568708001775	ATP binding site [chemical binding]; other site
568708001776	Walker B motif; other site
568708001777	arginine finger; other site
568708001778	Bacterial regulatory protein, Fis family; Region: HTH_8; pfam02954
568708001782	Members of the ICL/PEPM enzyme family catalyze either P-C or C-C bond formation/cleavage. Known members are phosphoenolpyruvate mutase (PEPM), phosphonopyruvate hydrolase (PPH), carboxyPEP mutase (CPEP mutase), oxaloacetate hydrolase (OAH), isocitrate...; Region: ICL_PEPM; cd00377
568708001783	Phosphoenolpyruvate phosphomutase; Region: PEP_mutase; pfam13714
568708001784	tetramer interface [polypeptide binding]; other site
568708001785	active site
568708001786	Mg2+/Mn2+ binding site [ion binding]; other site
568708001788	Citrate synthase [Energy production and conversion]; Region: GltA; COG0372
568708001789	Subgroup of Escherichia coli (Ec) 2-methylcitrate synthase (2MCS)_like. 2MCS catalyzes the condensation of propionyl-coenzyme A (PrCoA) and oxalacetate (OAA) to form 2-methylcitrate and coenzyme A (CoA) during propionate metabolism. Citrate synthase (CS)...; Region: Ec2MCS_like_1; cd06117
568708001790	dimer interface [polypeptide binding]; other site
568708001791	active site
568708001792	citrylCoA binding site [chemical binding]; other site
568708001793	oxalacetate/citrate binding site [chemical binding]; other site
568708001794	coenzyme A binding site [chemical binding]; other site
568708001795	catalytic triad [active]
568708001797	2-methylcitrate dehydratase; Provisional; Region: prpD; PRK09425
568708001798	2-methylcitrate dehydratase; Region: prpD; TIGR02330
568708001800	propionyl-CoA synthetase; Provisional; Region: prpE; PRK10524
568708001801	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
568708001802	acyl-activating enzyme (AAE) consensus motif; other site
568708001803	AMP binding site [chemical binding]; other site
568708001804	active site
568708001805	CoA binding site [chemical binding]; other site
568708001807	Porphobilinogen synthase (PBGS), which is also called delta-aminolevulinic acid dehydratase (ALAD), catalyzes the condensation of two 5-aminolevulinic acid (ALA) molecules to form the pyrrole porphobilinogen (PBG), which is the second step in the...; Region: ALAD_PBGS; cd00384
568708001808	dimer interface [polypeptide binding]; other site
568708001809	active site
568708001810	Schiff base residues; other site
568708001812	Pertactin-like passenger domains (virulence factors) of autotransporter proteins of the type V secretion system. Autotransporters are proteins used by Gram-negative bacteria to transport proteins across their outer membranes. The C-terminal (beta) domain...; Region: PL_Passenger_AT; cd00253
568708001813	outer membrane autotransporter barrel domain; Region: autotrans_barl; TIGR01414
568708001814	Autotransporter beta-domain; Region: Autotransporter; pfam03797
568708001815	Signal peptide predicted for STM_MW04431 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.920 between residues 27 and 28
568708001817	putative DNA-binding transcriptional regulator; Provisional; Region: PRK11832
568708001818	effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038
568708001819	ligand binding site [chemical binding]; other site
568708001820	flexible hinge region; other site
568708001822	beta-lactam binding protein AmpH; Provisional; Region: PRK10662
568708001823	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
568708001825	microcin B17 transporter; Reviewed; Region: PRK11098
568708001826	6 probable transmembrane helices predicted for STM_MW04461 by TMHMM2.0 at aa 23-45, 52-74, 104-126, 172-194, 209-231 and 299-321
568708001828	Protein of unknown function (DUF1615); Region: DUF1615; pfam07759
568708001829	Signal peptide predicted for STM_MW04471 by SignalP 2.0 HMM (Signal peptide probability 0.959) with cleavage site probability 0.527 between residues 26 and 27
568708001831	Protein of unknown function (DUF2755); Region: DUF2755; pfam10954
568708001833	2 probable transmembrane helices predicted for STM_MW04481 by TMHMM2.0 at aa 25-47 and 68-90
568708001834	Protein of unknown function (DUF2754); Region: DUF2754; pfam10953
568708001836	2 probable transmembrane helices predicted for STM_MW04491 by TMHMM2.0 at aa 13-32 and 37-59
568708001837	D-alanyl-alanine synthetase A; Reviewed; Region: ddl; PRK01966
568708001838	D-ala D-ala ligase N-terminus; Region: Dala_Dala_lig_N; pfam01820
568708001839	D-ala D-ala ligase C-terminus; Region: Dala_Dala_lig_C; pfam07478
568708001842	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3921
568708001843	Extensin-like protein C-terminus; Region: Extensin-like_C; pfam06904
568708001844	1 probable transmembrane helix predicted for STM_MW04511 by TMHMM2.0 at aa 13-35
568708001846	drug efflux system protein MdtG; Provisional; Region: PRK09874
568708001847	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708001848	putative substrate translocation pore; other site
568708001849	10 probable transmembrane helices predicted for STM_MW04521 by TMHMM2.0 at aa 7-29, 44-66, 79-101, 161-183, 204-226, 249-271, 283-302, 307-329, 342-364 and 369-391
568708001851	anti-RssB factor; Provisional; Region: PRK10244
568708001853	hypothetical protein; Provisional; Region: PRK11505
568708001854	psiF repeat; Region: PsiF_repeat; pfam07769
568708001855	psiF repeat; Region: PsiF_repeat; pfam07769
568708001856	Signal peptide predicted for STM_MW04541 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.516 between residues 20 and 21
568708001857	1 probable transmembrane helix predicted for STM_MW04541 by TMHMM2.0 at aa 5-22
568708001859	diguanylate cyclase AdrA; Provisional; Region: adrA; PRK10245
568708001860	MASE2 domain; Region: MASE2; pfam05230
568708001861	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
568708001862	metal binding site [ion binding]; metal-binding site
568708001863	active site
568708001864	I-site; other site
568708001866	4 probable transmembrane helices predicted for STM_MW04551 by TMHMM2.0 at aa 45-67, 105-127, 140-162 and 177-199
568708001868	pyrroline-5-carboxylate reductase; Reviewed; Region: PRK11880
568708001869	NADP oxidoreductase coenzyme F420-dependent; Region: F420_oxidored; cl17232
568708001871	hypothetical protein; Validated; Region: PRK00124
568708001873	Shikimate kinase [Amino acid transport and metabolism]; Region: AroK; COG0703
568708001874	Shikimate kinase (SK) is the fifth enzyme in the shikimate pathway, a seven-step biosynthetic pathway which converts erythrose-4-phosphate to chorismic acid, found in bacteria, fungi and plants. Chorismic acid is a important intermediate in the synthesis...; Region: SK; cd00464
568708001875	ADP binding site [chemical binding]; other site
568708001876	magnesium binding site [ion binding]; other site
568708001877	putative shikimate binding site; other site
568708001879	hypothetical protein; Provisional; Region: PRK10380
568708001880	hypothetical protein; Provisional; Region: PRK10481
568708001882	hypothetical protein; Provisional; Region: PRK10579
568708001884	DNA recombination-dependent growth factor C [DNA replication, recombination, and repair]; Region: RdgC; COG2974
568708001886	fructokinase; Reviewed; Region: PRK09557
568708001887	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cd00012
568708001888	nucleotide binding site [chemical binding]; other site
568708001890	MFS transport protein AraJ; Provisional; Region: PRK10091
568708001891	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708001892	putative substrate translocation pore; other site
568708001894	12 probable transmembrane helices predicted for STM_MW04641 by TMHMM2.0 at aa 5-27, 42-64, 71-93, 103-120, 125-147, 157-179, 200-222, 237-254, 266-288, 293-315, 320-342 and 352-374
568708001895	Signal peptide predicted for STM_MW04641 by SignalP 2.0 HMM (Signal peptide probability 0.864) with cleavage site probability 0.547 between residues 18 and 19
568708001896	exonuclease subunit SbcC; Provisional; Region: PRK10246
568708001897	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
568708001898	Walker A/P-loop; other site
568708001899	ATP binding site [chemical binding]; other site
568708001900	Q-loop/lid; other site
568708001901	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
568708001902	ABC transporter signature motif; other site
568708001903	Walker B; other site
568708001904	D-loop; other site
568708001905	H-loop/switch region; other site
568708001906	exonuclease subunit SbcD; Provisional; Region: PRK10966
568708001907	Mre11 nuclease, N-terminal metallophosphatase domain; Region: MPP_Mre11_N; cd00840
568708001908	active site
568708001909	metal binding site [ion binding]; metal-binding site
568708001910	DNA binding site [nucleotide binding]
568708001911	Type 5 capsule protein repressor C-terminal domain; Region: SbcD_C; pfam12320
568708001913	transcriptional regulator PhoB; Provisional; Region: PRK10161
568708001914	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708001915	active site
568708001916	phosphorylation site [posttranslational modification]
568708001917	intermolecular recognition site; other site
568708001918	dimerization interface [polypeptide binding]; other site
568708001919	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
568708001920	DNA binding site [nucleotide binding]
568708001923	phosphate regulon sensor protein; Provisional; Region: phoR; PRK11006
568708001924	Domain of unknown function (DUF3329); Region: DUF3329; pfam11808
568708001925	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
568708001926	putative active site [active]
568708001927	heme pocket [chemical binding]; other site
568708001928	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
568708001929	dimer interface [polypeptide binding]; other site
568708001930	phosphorylation site [posttranslational modification]
568708001931	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708001932	ATP binding site [chemical binding]; other site
568708001933	Mg2+ binding site [ion binding]; other site
568708001934	G-X-G motif; other site
568708001935	Signal peptide predicted for STM_MW04681 by SignalP 2.0 HMM (Signal peptide probability 0.909) with cleavage site probability 0.844 between residues 37 and 38
568708001936	1 probable transmembrane helix predicted for STM_MW04681 by TMHMM2.0 at aa 12-34
568708001940	branched-chain amino acid transport system 2 carrier protein BrnQ; Provisional; Region: PRK15433
568708001941	Signal peptide predicted for STM_MW04691 by SignalP 2.0 HMM (Signal peptide probability 0.823) with cleavage site probability 0.742 between residues 24 and 25
568708001943	12 probable transmembrane helices predicted for STM_MW04691 by TMHMM2.0 at aa 13-35, 41-63, 76-98, 118-140, 147-169, 189-211, 223-245, 276-298, 305-327, 337-359, 371-393 and 408-426
568708001944	putative proline-specific permease; Provisional; Region: proY; PRK10580
568708001945	Signal peptide predicted for STM_MW04701 by SignalP 2.0 HMM (Signal peptide probability 0.943) with cleavage site probability 0.472 between residues 36 and 37
568708001947	12 probable transmembrane helices predicted for STM_MW04701 by TMHMM2.0 at aa 16-34, 44-63, 83-105, 120-142, 154-176, 196-218, 239-261, 276-298, 329-351, 356-378, 399-421 and 426-445
568708001948	maltodextrin glucosidase; Provisional; Region: PRK10785
568708001949	N-terminal Early set domain associated with the catalytic domain of cyclomaltodextrinase and pullulan-degrading enzymes; Region: E_set_CDase_PDE_N; cd02857
568708001950	homodimer interface [polypeptide binding]; other site
568708001951	Alpha amylase catalytic domain found in cyclomaltodextrinases and related proteins; Region: AmyAc_CMD; cd11338
568708001952	active site
568708001953	homodimer interface [polypeptide binding]; other site
568708001954	catalytic site [active]
568708001956	peroxidase; Provisional; Region: PRK15000
568708001957	Peroxiredoxin (PRX) family, Typical 2-Cys PRX subfamily; PRXs are thiol-specific antioxidant (TSA) proteins, which confer a protective role in cells through its peroxidase activity by reducing hydrogen peroxide, peroxynitrite, and organic hydroperoxides; Region: PRX_Typ2cys; cd03015
568708001958	dimer interface [polypeptide binding]; other site
568708001959	decamer (pentamer of dimers) interface [polypeptide binding]; other site
568708001960	catalytic triad [active]
568708001961	peroxidatic and resolving cysteines [active]
568708001964	acyl carrier protein phosphodiesterase; Provisional; Region: PRK10045
568708001966	S-adenosylmethionine:tRNA ribosyltransferase-isomerase; Provisional; Region: queA; PRK00147
568708001967	S-adenosylmethionine:tRNA ribosyltransferase-isomerase; Region: queA; TIGR00113
568708001969	queuine tRNA-ribosyltransferase; Provisional; Region: tgt; PRK00112
568708001970	tRNA-guanine family transglycosylase; Region: tgt_general; TIGR00449
568708001972	preprotein translocase subunit YajC; Validated; Region: yajC; PRK05585
568708001973	1 probable transmembrane helix predicted for STM_MW04761 by TMHMM2.0 at aa 20-39
568708001975	SecD export protein N-terminal TM region; Region: SecD-TM1; pfam13721
568708001976	preprotein translocase subunit SecD; Reviewed; Region: secD; PRK05812
568708001977	SecD/SecF GG Motif; Region: Sec_GG; pfam07549
568708001978	protein-export membrane protein, SecD/SecF family; Region: 2A0604s01; TIGR00916
568708001979	Signal peptide predicted for STM_MW04771 by SignalP 2.0 HMM (Signal peptide probability 0.667) with cleavage site probability 0.508 between residues 30 and 31
568708001980	6 probable transmembrane helices predicted for STM_MW04771 by TMHMM2.0 at aa 7-29, 452-471, 476-498, 503-525, 546-568 and 583-605
568708001983	preprotein translocase subunit SecF; Reviewed; Region: secF; PRK13022
568708001984	SecD/SecF GG Motif; Region: Sec_GG; pfam07549
568708001985	Protein export membrane protein; Region: SecD_SecF; pfam02355
568708001986	6 probable transmembrane helices predicted for STM_MW04781 by TMHMM2.0 at aa 24-46, 143-162, 169-191, 195-217, 248-270 and 275-297
568708001989	N-terminal domain of Streptomyces griseus SgaA (suppression of growth disturbance caused by A-factor at a high concentration under high osmolality during early growth phase), and similar domains; Region: SgaA_N_like; cd07247
568708001990	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
568708001992	Predicted transcriptional regulator [Transcription]; Region: COG2378
568708001993	HTH domain; Region: HTH_11; pfam08279
568708001994	WYL domain; Region: WYL; pfam13280
568708001996	HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085
568708001997	active site
568708001999	nucleoside-specific channel-forming protein Tsx; Provisional; Region: PRK15106
568708002001	Signal peptide predicted for STM_MW04831 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 22 and 23
568708002002	hypothetical protein; Provisional; Region: PRK11530
568708002004	Signal peptide predicted for STM_MW04841 by SignalP 2.0 HMM (Signal peptide probability 0.986) with cleavage site probability 0.768 between residues 24 and 25
568708002005	transcriptional regulator NrdR; Validated; Region: nrdR; PRK00464
568708002006	ATP cone domain; Region: ATP-cone; pfam03477
568708002008	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase; Provisional; Region: ribD; PRK10786
568708002009	Riboflavin-specific deaminase. Riboflavin biosynthesis protein RibD (Diaminohydroxyphosphoribosylaminopyrimidine deaminase) catalyzes the deamination of 2,5-diamino-6-ribosylamino-4(3H)-pyrimidinone 5'-phosphate, which is an intermediate step in the...; Region: Riboflavin_deaminase-reductase; cd01284
568708002010	catalytic motif [active]
568708002011	Zn binding site [ion binding]; other site
568708002012	riboflavin-specific deaminase C-terminal domain; Region: ribD_Cterm; TIGR00227
568708002015	lumazine synthase (6,7-dimethyl-8-ribityllumazine synthase, LS), catalyzes the penultimate step in the biosynthesis of riboflavin (vitamin B2); type-I; Region: Lumazine_synthase-I; cd09209
568708002016	homopentamer interface [polypeptide binding]; other site
568708002017	active site
568708002019	Transcription termination factor NusB (N protein-Utilization Substance B). NusB plays a key role in the regulation of ribosomal RNA biosynthesis in eubacteria by modulating the efficiency of transcriptional antitermination. NusB along with other Nus...; Region: Terminator_NusB; cd00619
568708002020	putative RNA binding site [nucleotide binding]; other site
568708002022	thiamine monophosphate kinase; Provisional; Region: PRK05731
568708002023	ThiL (Thiamine-monophosphate kinase) plays a dual role in de novo biosynthesis and in salvage of exogenous thiamine. Thiamine salvage occurs in two steps, with thiamine kinase catalyzing the formation of thiamine phosphate, and ThiL catalyzing the...; Region: ThiL; cd02194
568708002024	ATP binding site [chemical binding]; other site
568708002025	dimerization interface [polypeptide binding]; other site
568708002028	Phosphatidylglycerophosphatase A; a bacterial membrane-associated enzyme involved in lipid metabolism; Region: PgpA; cd06971
568708002029	tetramer interfaces [polypeptide binding]; other site
568708002030	binuclear metal-binding site [ion binding]; other site
568708002031	Signal peptide predicted for STM_MW04901 by SignalP 2.0 HMM (Signal peptide probability 0.799) with cleavage site probability 0.677 between residues 44 and 45
568708002032	3 probable transmembrane helices predicted for STM_MW04901 by TMHMM2.0 at aa 21-43, 53-75 and 140-162
568708002034	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660
568708002035	Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248
568708002036	active site
568708002037	catalytic tetrad [active]
568708002039	1-deoxy-D-xylulose-5-phosphate synthase; Region: dxs; TIGR00204
568708002040	Thiamine pyrophosphate (TPP) family, DXS subfamily, TPP-binding module; 1-Deoxy-D-xylulose-5-phosphate synthase (DXS) is a regulatory enzyme of the mevalonate-independent pathway involved in terpenoid biosynthesis. Terpeniods are plant natural products...; Region: TPP_DXS; cd02007
568708002041	TPP-binding site; other site
568708002042	Pyrimidine (PYR) binding domain of 1-deoxy-D-xylulose-5-phosphate synthase (DXS), transketolase (TK), and related proteins; Region: TPP_PYR_DXS_TK_like; cd07033
568708002043	PYR/PP interface [polypeptide binding]; other site
568708002044	dimer interface [polypeptide binding]; other site
568708002045	TPP binding site [chemical binding]; other site
568708002046	Transketolase, C-terminal domain; Region: Transketolase_C; pfam02780
568708002050	Geranylgeranyl pyrophosphate synthase [Coenzyme metabolism]; Region: IspA; COG0142
568708002051	Trans-Isoprenyl Diphosphate Synthases, head-to-tail; Region: Trans_IPPS_HT; cd00685
568708002052	substrate binding pocket [chemical binding]; other site
568708002053	chain length determination region; other site
568708002054	substrate-Mg2+ binding site; other site
568708002055	catalytic residues [active]
568708002056	aspartate-rich region 1; other site
568708002057	active site lid residues [active]
568708002058	aspartate-rich region 2; other site
568708002060	exodeoxyribonuclease VII small subunit; Provisional; Region: PRK00977
568708002062	tRNA s(4)U8 sulfurtransferase; Provisional; Region: PRK01269
568708002063	THUMP domain of thiamine biosynthesis protein ThiI; Region: THUMP_ThiI; cd11716
568708002064	ThiI is required for thiazole synthesis in the thiamine biosynthesis pathway. It belongs to the Adenosine Nucleotide Hydrolysis suoerfamily and predicted to bind to Adenosine nucleotide; Region: ThiI; cd01712
568708002065	Ligand Binding Site [chemical binding]; other site
568708002066	Rhodanese Homology Domain (RHOD); an alpha beta fold domain found duplicated in the rhodanese protein. The cysteine containing enzymatically active version of the domain is also found in the Cdc25 class of protein phosphatases and a variety of proteins...; Region: RHOD; cd00158
568708002067	active site residue [active]
568708002070	ABC-type spermidine/putrescine transport system, permease component II [Amino acid transport and metabolism]; Region: PotC; COG1177
568708002071	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708002072	dimer interface [polypeptide binding]; other site
568708002073	conserved gate region; other site
568708002074	ABC-ATPase subunit interface; other site
568708002075	6 probable transmembrane helices predicted for STM_MW04961 by TMHMM2.0 at aa 12-34, 66-88, 101-123, 133-155, 187-209 and 234-253
568708002077	Signal peptide predicted for STM_MW04961 by SignalP 2.0 HMM (Signal peptide probability 0.955) with cleavage site probability 0.445 between residues 29 and 30
568708002078	2-aminoethylphosphonate transport system permease PhnU; Provisional; Region: PRK15050
568708002079	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708002080	dimer interface [polypeptide binding]; other site
568708002081	conserved gate region; other site
568708002082	putative PBP binding loops; other site
568708002083	ABC-ATPase subunit interface; other site
568708002084	7 probable transmembrane helices predicted for STM_MW04971 by TMHMM2.0 at aa 15-37, 74-96, 111-133, 140-162, 199-221, 226-245 and 255-277
568708002086	2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT; Region: PhnT; TIGR03258
568708002087	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
568708002088	Walker A/P-loop; other site
568708002089	ATP binding site [chemical binding]; other site
568708002090	Q-loop/lid; other site
568708002091	ABC transporter signature motif; other site
568708002092	Walker B; other site
568708002093	D-loop; other site
568708002094	H-loop/switch region; other site
568708002095	TOBE domain; Region: TOBE_2; pfam08402
568708002098	ABC-type Fe3+ transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: AfuA; COG1840
568708002099	Bacterial extracellular solute-binding protein; Region: SBP_bac_8; pfam13416
568708002101	transcriptional regulator protein; Region: phnR; TIGR03337
568708002102	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
568708002103	DNA-binding site [nucleotide binding]; DNA binding site
568708002104	UTRA domain; Region: UTRA; pfam07702
568708002107	2-aminoethylphosphonate--pyruvate transaminase; Region: transamin_PhnW; TIGR02326
568708002108	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
568708002109	catalytic residue [active]
568708002111	phosphonoacetaldehyde hydrolase; Provisional; Region: PRK13478
568708002112	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708002113	motif II; other site
568708002115	oxidative-stress-resistance chaperone; Provisional; Region: PRK11574
568708002116	Type 1 glutamine amidotransferase (GATase1)-like domain found in Human DJ-1; Region: GATase1_DJ-1; cd03135
568708002117	conserved cys residue [active]
568708002119	2-dehydropantoate 2-reductase; Reviewed; Region: PRK06522
568708002120	Ketopantoate reductase PanE/ApbA; Region: ApbA; pfam02558
568708002121	Ketopantoate reductase PanE/ApbA C terminal; Region: ApbA_C; pfam08546
568708002124	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG1666
568708002125	Proteins similar to Escherichia coli YajQ; Region: YajQ_like; cd11740
568708002127	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708002128	Major Facilitator Superfamily; Region: MFS_1; pfam07690
568708002129	putative substrate translocation pore; other site
568708002131	11 probable transmembrane helices predicted for STM_MW05061 by TMHMM2.0 at aa 15-37, 44-66, 76-98, 132-154, 159-181, 212-234, 249-268, 275-297, 301-323, 336-358 and 363-380
568708002133	Sel1-like repeats; Region: SEL1; smart00671
568708002134	FOG: TPR repeat, SEL1 subfamily [General function prediction only]; Region: COG0790
568708002135	Sel1 repeat; Region: Sel1; pfam08238
568708002136	Sel1-like repeats; Region: SEL1; smart00671
568708002137	Signal peptide predicted for STM_MW05081 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.938 between residues 22 and 23
568708002139	FOG: TPR repeat, SEL1 subfamily [General function prediction only]; Region: COG0790
568708002140	Sel1-like repeats; Region: SEL1; smart00671
568708002141	Sel1-like repeats; Region: SEL1; smart00671
568708002143	protoheme IX farnesyltransferase; Provisional; Region: PRK13362
568708002144	UbiA prenyltransferase family; Region: UbiA; pfam01040
568708002145	9 probable transmembrane helices predicted for STM_MW05101 by TMHMM2.0 at aa 12-34, 38-60, 81-103, 108-127, 134-156, 161-183, 209-231, 235-252 and 264-286
568708002147	cytochrome o ubiquinol oxidase subunit IV; Provisional; Region: PRK10582
568708002148	3 probable transmembrane helices predicted for STM_MW05111 by TMHMM2.0 at aa 15-37, 44-66 and 76-98
568708002150	Ubiquinol oxidase subunit III subfamily. Ubiquinol oxidase, the terminal oxidase in the respiratory chains of aerobic bacteria, is a multi-chain transmembrane protein located in the cell membrane.  It catalyzes the reduction of O2 and simultaneously...; Region: Ubiquinol_oxidase_III; cd02863
568708002151	Subunit III/IV interface [polypeptide binding]; other site
568708002152	Subunit I/III interface [polypeptide binding]; other site
568708002153	5 probable transmembrane helices predicted for STM_MW05121 by TMHMM2.0 at aa 5-24, 34-56, 63-85, 105-127 and 148-170
568708002155	Heme/copper-type cytochrome/quinol oxidases, subunit 1 [Energy production and conversion]; Region: CyoB; COG0843
568708002156	Ubiquinol oxidase subunit I.  Ubiquinol oxidase, the terminal oxidase in the respiratory chains of aerobic bacteria, is a multi-chain transmembrane protein located in the cell membrane.  It catalyzes the reduction of O2 and simultaneously pumps protons...; Region: Ubiquinol_Oxidase_I; cd01662
568708002157	D-pathway; other site
568708002158	Putative ubiquinol binding site [chemical binding]; other site
568708002159	Low-spin heme (heme b) binding site [chemical binding]; other site
568708002160	Putative water exit pathway; other site
568708002161	Binuclear center (heme o3/CuB) [ion binding]; other site
568708002162	K-pathway; other site
568708002163	Putative proton exit pathway; other site
568708002164	14 probable transmembrane helices predicted for STM_MW05131 by TMHMM2.0 at aa 15-37, 57-79, 105-127, 140-162, 191-213, 233-255, 275-297, 310-332, 347-369, 382-404, 414-436, 456-478, 498-520 and 590-612
568708002166	cytochrome o ubiquinol oxidase subunit II; Provisional; Region: PRK10525
568708002167	Cytochrome C oxidase subunit II, periplasmic domain; Region: COX2; pfam00116
568708002168	COX Aromatic Rich Motif; Region: COX_ARM; pfam06481
568708002170	3 probable transmembrane helices predicted for STM_MW05141 by TMHMM2.0 at aa 12-30, 45-67 and 88-110
568708002172	Signal peptide predicted for STM_MW05141 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.595 between residues 30 and 31
568708002173	muropeptide transporter; Reviewed; Region: ampG; PRK11902
568708002174	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708002175	putative substrate translocation pore; other site
568708002176	14 probable transmembrane helices predicted for STM_MW05151 by TMHMM2.0 at aa 13-35, 50-69, 82-104, 109-131, 144-166, 176-195, 223-245, 260-282, 287-309, 319-341, 354-376, 381-403, 424-446 and 466-485
568708002178	Signal peptide predicted for STM_MW05151 by SignalP 2.0 HMM (Signal peptide probability 0.995) with cleavage site probability 0.787 between residues 37 and 38
568708002179	hypothetical protein; Provisional; Region: PRK11627
568708002180	Uncharacterized lipoprotein; Region: Lipoprotein_16; pfam03923
568708002183	transcriptional regulator BolA; Provisional; Region: PRK11628
568708002185	trigger factor; Provisional; Region: tig; PRK01490
568708002186	FKBP-type peptidyl-prolyl cis-trans isomerase; Region: FKBP_C; pfam00254
568708002187	Bacterial trigger factor protein (TF) C-terminus; Region: Trigger_C; pfam05698
568708002191	Protease subunit of ATP-dependent Clp proteases [Posttranslational modification, protein turnover, chaperones / Intracellular trafficking and secretion]; Region: ClpP; COG0740
568708002192	Caseinolytic protease (ClpP) is an ATP-dependent, highly conserved serine protease; Region: S14_ClpP_2; cd07017
568708002193	oligomer interface [polypeptide binding]; other site
568708002194	active site residues [active]
568708002196	ATP-dependent protease ATP-binding subunit ClpX; Provisional; Region: clpX; PRK05342
568708002197	ClpX C4-type zinc finger; Region: zf-C4_ClpX; pfam06689
568708002198	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708002199	Walker A motif; other site
568708002200	ATP binding site [chemical binding]; other site
568708002201	Walker B motif; other site
568708002202	Iron permease FTR1 family; Region: FTR1; cl00475
568708002203	C-terminal, D2-small domain, of ClpB protein; Region: ClpB_D2-small; smart01086
568708002207	DNA-binding ATP-dependent protease La; Provisional; Region: PRK10787
568708002208	Found in ATP-dependent protease La (LON); Region: LON; smart00464
568708002209	Found in ATP-dependent protease La (LON); Region: LON; smart00464
568708002210	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708002211	Walker A motif; other site
568708002212	ATP binding site [chemical binding]; other site
568708002213	Walker B motif; other site
568708002214	arginine finger; other site
568708002215	Lon protease (S16) C-terminal proteolytic domain; Region: Lon_C; pfam05362
568708002219	Integration host factor (IHF) and HU are small heterodimeric members of the DNABII protein family that bind and bend DNA, functioning as architectural factors in many cellular processes including transcription, site-specific recombination, and...; Region: HU_IHF; cd00591
568708002220	IHF dimer interface [polypeptide binding]; other site
568708002221	IHF - DNA interface [nucleotide binding]; other site
568708002223	periplasmic folding chaperone; Provisional; Region: PRK10788
568708002224	SurA N-terminal domain; Region: SurA_N_3; cl07813
568708002225	PPIC-type PPIASE domain; Region: Rotamase_2; pfam13145
568708002226	1 probable transmembrane helix predicted for STM_MW05231 by TMHMM2.0 at aa 13-35
568708002229	competence protein ComEA helix-hairpin-helix repeat region; Region: TIGR00426
568708002230	Signal peptide predicted for STM_MW05241 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 25 and 26
568708002232	4-hydroxybenzoyl-CoA thioesterase (4HBT). Catalyzes the final step in the 4-chlorobenzoate degradation pathway in which 4-chlorobenzoate is converted to 4-hydroxybenzoate in certain soil-dwelling bacteria. 4HBT forms a homotetramer with four active sites; Region: 4HBT; cd00586
568708002233	active site
568708002235	ExsB is a transcription regulator related protein. It is a subfamily of a Adenosine nucleotide binding superfamily of proteins. This protein family is represented by a single member in nearly every completed large (> 1000 genes) prokaryotic genome. In...; Region: ExsB; cd01995
568708002236	Ligand Binding Site [chemical binding]; other site
568708002238	ABC-type uncharacterized transport system, periplasmic component [General function prediction only]; Region: COG4533
568708002239	Sugar transport-related sRNA regulator N-term; Region: SgrR_N; pfam12793
568708002240	The substrate-binding domain of an ABC-type nickel/oligopeptide-like import system contains the type 2 periplasmic binding fold; Region: PBP2_NikA_DppA_OppA_like; cl01709
568708002242	thiamin pyrimidine pyrophosphate hydrolase; Provisional; Region: PRK15126
568708002243	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708002244	active site
568708002245	motif I; other site
568708002246	motif II; other site
568708002248	Cysteine synthase [Amino acid transport and metabolism]; Region: CysK; COG0031
568708002249	Tryptophan synthase beta superfamily (fold type II); this family of pyridoxal phosphate (PLP)-dependent enzymes catalyzes beta-replacement and beta-elimination reactions. This CD corresponds to aminocyclopropane-1-carboxylate deaminase (ACCD), tryptophan...; Region: Trp-synth-beta_II; cl00342
568708002250	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
568708002251	catalytic residue [active]
568708002253	Transcriptional regulators [Transcription]; Region: Lrp; COG1522
568708002254	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
568708002255	putative DNA binding site [nucleotide binding]; other site
568708002256	putative Zn2+ binding site [ion binding]; other site
568708002257	AsnC family; Region: AsnC_trans_reg; pfam01037
568708002259	putative multidrug transporter membrane\ATP-binding components; Provisional; Region: PRK10789
568708002260	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
568708002261	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
568708002262	Walker A/P-loop; other site
568708002263	ATP binding site [chemical binding]; other site
568708002264	Q-loop/lid; other site
568708002265	ABC transporter signature motif; other site
568708002266	Walker B; other site
568708002267	D-loop; other site
568708002268	H-loop/switch region; other site
568708002269	6 probable transmembrane helices predicted for STM_MW05311 by TMHMM2.0 at aa 21-43, 58-77, 129-151, 156-175, 246-268 and 278-300
568708002272	putative multidrug transporter membrane\ATP-binding components; Provisional; Region: PRK10790
568708002273	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
568708002274	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
568708002275	Walker A/P-loop; other site
568708002276	ATP binding site [chemical binding]; other site
568708002277	Q-loop/lid; other site
568708002278	ABC transporter signature motif; other site
568708002279	Walker B; other site
568708002280	D-loop; other site
568708002281	H-loop/switch region; other site
568708002282	Signal peptide predicted for STM_MW05321 by SignalP 2.0 HMM (Signal peptide probability 0.766) with cleavage site probability 0.336 between residues 37 and 38
568708002283	4 probable transmembrane helices predicted for STM_MW05321 by TMHMM2.0 at aa 27-49, 138-160, 165-185 and 249-271
568708002286	nitrogen regulatory protein P-II 2; Provisional; Region: PRK10665
568708002287	Nitrogen regulatory protein P-II; Region: P-II; smart00938
568708002289	ammonium transporter; Provisional; Region: PRK10666
568708002290	Signal peptide predicted for STM_MW05341 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.954 between residues 27 and 28
568708002291	12 probable transmembrane helices predicted for STM_MW05341 by TMHMM2.0 at aa 9-26, 36-58, 63-85, 120-142, 149-171, 186-205, 218-237, 247-269, 281-303, 307-324, 337-359 and 374-396
568708002293	acyl-CoA thioesterase II; Provisional; Region: PRK10526
568708002294	Thioesterase II (TEII) is thought to regenerate misprimed nonribosomal peptide synthetases (NRPSs) as well as modular polyketide synthases (PKSs) by hydrolyzing acetyl groups bound to the peptidyl carrier protein (PCP) and acyl carrier protein (ACP)...; Region: Thioesterase_II_repeat2; cd03445
568708002295	active site
568708002296	Thioesterase II (TEII) is thought to regenerate misprimed nonribosomal peptide synthetases (NRPSs) as well as modular polyketide synthases (PKSs) by hydrolyzing acetyl groups bound to the peptidyl carrier protein (PCP) and acyl carrier protein (ACP)...; Region: Thioesterase_II_repeat1; cd03444
568708002297	catalytic triad [active]
568708002298	dimer interface [polypeptide binding]; other site
568708002300	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3126
568708002301	Signal peptide predicted for STM_MW05361 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.983 between residues 20 and 21
568708002302	Methylated DNA-protein cysteine methyltransferase [DNA replication, recombination, and repair]; Region: Ada; COG0350
568708002303	The DNA repair protein O6-alkylguanine-DNA alkyltransferase (ATase; also known as AGT, AGAT and MGMT) reverses O6-alkylation DNA damage by transferring O6-alkyl adducts to an active site cysteine irreversibly, without inducing DNA strand breaks. ATases...; Region: ATase; cd06445
568708002304	DNA binding site [nucleotide binding]
568708002305	active site
568708002307	Predicted signal transduction protein containing sensor and EAL domains [Signal transduction mechanisms]; Region: COG4943
568708002308	CSS motif domain associated with EAL; Region: CSS-motif; pfam12792
568708002309	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
568708002310	2 probable transmembrane helices predicted for STM_MW05381 by TMHMM2.0 at aa 6-28 and 243-265
568708002312	50S ribosomal protein L31 type B; Reviewed; Region: rpmE2; PRK01678
568708002314	50S ribosomal protein L36; Validated; Region: rpmJ; PRK00831
568708002316	sigma70 family sigma factor YlaC; Region: YlaC; pfam10777
568708002318	2 probable transmembrane helices predicted for STM_MW05411 by TMHMM2.0 at aa 36-55 and 60-79
568708002319	maltose O-acetyltransferase; Provisional; Region: PRK10092
568708002320	Maltose O-acetyltransferase (MAT) and Galactoside O-acetyltransferase (GAT): MAT and GAT catalyze the CoA-dependent acetylation of the 6-hydroxyl group of their respective sugar substrates. MAT acetylates maltose and glucose exclusively at the C6...; Region: LbH_MAT_GAT; cd03357
568708002321	active site
568708002322	substrate binding site [chemical binding]; other site
568708002323	trimer interface [polypeptide binding]; other site
568708002324	CoA binding site [chemical binding]; other site
568708002326	gene expression modulator; Provisional; Region: PRK10945
568708002328	Hha toxicity attenuator; Provisional; Region: PRK10667
568708002330	multidrug efflux system protein AcrB; Provisional; Region: PRK15127
568708002331	Protein export membrane protein; Region: SecD_SecF; cl14618
568708002332	Protein export membrane protein; Region: SecD_SecF; cl14618
568708002334	11 probable transmembrane helices predicted for STM_MW05451 by TMHMM2.0 at aa 10-32, 340-359, 369-391, 438-460, 470-492, 542-564, 873-892, 899-921, 926-948, 975-997 and 1007-1029
568708002335	multidrug efflux system transporter AcrA; Provisional; Region: PRK15030
568708002336	HlyD family secretion protein; Region: HlyD_3; pfam13437
568708002338	Signal peptide predicted for STM_MW05461 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.661 between residues 24 and 25
568708002339	DNA-binding transcriptional repressor AcrR; Provisional; Region: PRK10668
568708002340	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
568708002341	MAATS-type transcriptional repressor, C-terminal region; Region: TetR_C_2; pfam08361
568708002344	hypothetical protein; Provisional; Region: PRK11281
568708002345	Mechanosensitive ion channel inner membrane domain 1; Region: MscS_TM; pfam12794
568708002346	NQR2, RnfD, RnfE family; Region: NQR2_RnfD_RnfE; cl00779
568708002347	Mechanosensitive ion channel; Region: MS_channel; pfam00924
568708002348	Signal peptide predicted for STM_MW05481 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.835 between residues 33 and 34
568708002349	12 probable transmembrane helices predicted for STM_MW05481 by TMHMM2.0 at aa 13-32, 500-522, 557-579, 584-606, 630-647, 658-680, 693-715, 725-747, 795-817, 837-859, 880-902 and 917-939
568708002351	Uncharacterized conserved protein [Function unknown]; Region: COG5464
568708002352	Putative transposase, YhgA-like; Region: Transposase_31; pfam04754
568708002354	hypothetical protein; Provisional; Region: PRK11038
568708002356	primosomal replication protein N''; Provisional; Region: PRK10093
568708002358	hypothetical protein; Provisional; Region: PRK10527
568708002359	3 probable transmembrane helices predicted for STM_MW05521 by TMHMM2.0 at aa 5-27, 75-92 and 99-118
568708002361	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
568708002362	active site
568708002364	DNA polymerase III subunits gamma and tau; Validated; Region: PRK07994
568708002365	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708002366	Walker A motif; other site
568708002367	ATP binding site [chemical binding]; other site
568708002368	Walker B motif; other site
568708002369	DNA polymerase III subunit delta'; Validated; Region: PRK08485
568708002370	arginine finger; other site
568708002371	DNA polymerase III subunits gamma and tau domain III; Region: DNA_pol3_gamma3; pfam12169
568708002372	DNA polymerase III subunits tau domain IV DnaB-binding; Region: DNA_pol3_tau_4; pfam12168
568708002373	DNA polymerase III tau subunit V interacting with alpha; Region: DNA_pol3_tau_5; pfam12170
568708002375	hypothetical protein; Validated; Region: PRK00153
568708002377	recombination protein RecR; Reviewed; Region: recR; PRK00076
568708002378	RecR protein; Region: RecR; pfam02132
568708002379	TOPRIM_recR: topoisomerase-primase (TOPRIM) nucleotidyl transferase/hydrolase domain of the type found in Escherichia coli RecR.  RecR participates in the RecFOR pathway of homologous recombinational repair in prokaryotes. This pathway provides a...; Region: TOPRIM_recR; cd01025
568708002380	putative active site [active]
568708002381	putative metal-binding site [ion binding]; other site
568708002382	tetramer interface [polypeptide binding]; other site
568708002385	heat shock protein 90; Provisional; Region: PRK05218
568708002386	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708002387	ATP binding site [chemical binding]; other site
568708002388	Mg2+ binding site [ion binding]; other site
568708002389	G-X-G motif; other site
568708002392	adenylate kinase; Reviewed; Region: adk; PRK00279
568708002393	Adenylate kinase (ADK) catalyzes the reversible phosphoryl transfer from adenosine triphosphates (ATP) to adenosine monophosphates (AMP) and to yield adenosine diphosphates (ADP). This enzyme is required for the biosynthesis of ADP and is essential for...; Region: ADK; cd01428
568708002394	AMP-binding site [chemical binding]; other site
568708002395	ATP-AMP (Ap5A)-binding site [chemical binding]; other site
568708002398	ferrochelatase; Reviewed; Region: hemH; PRK00035
568708002399	Ferrochelatase, N-terminal domain: Ferrochelatase (protoheme ferrolyase or HemH) is the terminal enzyme of the heme biosynthetic pathway. It catalyzes the insertion of ferrous iron into the protoporphyrin IX ring yielding protoheme. This enzyme is...; Region: Ferrochelatase_N; cd03411
568708002400	C-terminal domain interface [polypeptide binding]; other site
568708002401	active site
568708002402	Ferrochelatase, C-terminal domain: Ferrochelatase (protoheme ferrolyase or HemH) is the terminal enzyme of the heme biosynthetic pathway. It catalyzes the insertion of ferrous iron into the protoporphyrin IX ring yielding protoheme. This enzyme is...; Region: Ferrochelatase_C; cd00419
568708002403	active site
568708002404	N-terminal domain interface [polypeptide binding]; other site
568708002406	acetyl esterase; Provisional; Region: PRK10162
568708002408	inosine/guanosine kinase; Provisional; Region: PRK15074
568708002409	Sugar kinases, ribokinase family [Carbohydrate transport and metabolism]; Region: RbsK; COG0524
568708002411	putative cation:proton antiport protein; Provisional; Region: PRK10669
568708002412	Kef-type K+ transport system, predicted NAD-binding component [Inorganic ion transport and metabolism]; Region: RosB; COG4651
568708002413	TrkA-N domain; Region: TrkA_N; pfam02254
568708002415	12 probable transmembrane helices predicted for STM_MW05621 by TMHMM2.0 at aa 4-26, 33-52, 56-78, 87-109, 114-136, 149-171, 191-213, 226-248, 280-299, 302-324, 339-361 and 368-387
568708002417	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708002418	Major Facilitator Superfamily; Region: MFS_1; pfam07690
568708002419	putative substrate translocation pore; other site
568708002420	10 probable transmembrane helices predicted for STM_MW05631 by TMHMM2.0 at aa 26-48, 58-80, 101-123, 180-202, 223-245, 265-287, 294-313, 317-339, 351-373 and 377-399
568708002422	bifunctional UDP-sugar hydrolase/5'-nucleotidase periplasmic precursor; Reviewed; Region: ushA; PRK09558
568708002423	Escherichia coli UshA and related proteins, N-terminal metallophosphatase domain; Region: MPP_UshA_N; cd07405
568708002424	active site
568708002425	metal binding site [ion binding]; metal-binding site
568708002426	5'-nucleotidase, C-terminal domain; Region: 5_nucleotid_C; pfam02872
568708002427	Signal peptide predicted for STM_MW05641 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 25 and 26
568708002430	This CD includes cysteinyl-tRNA(Pro) deacylases from Haemophilus influenzae and Escherichia coli and other related bacterial proteins. These trans-acting, single-domain proteins are homologs of ProX and also the cis-acting prolyl-tRNA synthetase (ProRS)...; Region: YbaK_deacylase; cd00002
568708002431	putative deacylase active site [active]
568708002433	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3735
568708002435	Protein of unknown function (DUF1311); Region: DUF1311; pfam07007
568708002437	Signal peptide predicted for STM_MW05671 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.993 between residues 19 and 20
568708002438	copper exporting ATPase; Provisional; Region: copA; PRK10671
568708002439	Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371
568708002440	metal-binding site [ion binding]
568708002441	Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371
568708002442	metal-binding site [ion binding]
568708002443	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
568708002444	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708002445	motif II; other site
568708002447	8 probable transmembrane helices predicted for STM_MW05681 by TMHMM2.0 at aa 188-205, 215-237, 244-266, 281-298, 435-457, 462-484, 777-796 and 801-823
568708002450	DNA-binding transcriptional regulator CueR; Provisional; Region: PRK10227
568708002451	Helix-Turn-Helix DNA binding domain of CueR-like transcription regulators; Region: HTH_CueR; cd01108
568708002452	DNA binding residues [nucleotide binding]
568708002453	dimer interface [polypeptide binding]; other site
568708002454	copper binding site [ion binding]; other site
568708002457	Membrane protein implicated in regulation of membrane protease activity [Posttranslational modification, protein turnover, chaperones / Intracellular trafficking and secretion]; Region: COG1585
568708002459	3 probable transmembrane helices predicted for STM_MW05701 by TMHMM2.0 at aa 4-23, 30-49 and 53-75
568708002460	Membrane protease subunits, stomatin/prohibitin homologs [Posttranslational modification, protein turnover, chaperones]; Region: HflC; COG0330
568708002461	Band_7_stomatin_like: A subgroup of the band 7 domain of flotillin (reggie) like proteins similar to stomatin and podicin (two lipid raft-associated integral membrane proteins). Individual proteins of this band 7 domain family may cluster to form...; Region: Band_7_stomatin_like; cd03403
568708002463	1 probable transmembrane helix predicted for STM_MW05711 by TMHMM2.0 at aa 7-29
568708002464	putative ABC transporter ATP-binding protein YbbL; Provisional; Region: PRK10247
568708002465	ATP-binding cassette domain of multidrug resistance protein-like transporters; Region: ABCC_MRP_Like; cd03228
568708002466	Walker A/P-loop; other site
568708002467	ATP binding site [chemical binding]; other site
568708002468	Q-loop/lid; other site
568708002469	ABC transporter signature motif; other site
568708002470	Walker B; other site
568708002471	D-loop; other site
568708002472	H-loop/switch region; other site
568708002474	ABC-type uncharacterized transport system, permease component [General function prediction only]; Region: COG0390
568708002475	Signal peptide predicted for STM_MW05731 by SignalP 2.0 HMM (Signal peptide probability 0.824) with cleavage site probability 0.719 between residues 27 and 28
568708002477	6 probable transmembrane helices predicted for STM_MW05731 by TMHMM2.0 at aa 7-24, 57-79, 92-114, 118-140, 192-209 and 219-241
568708002478	Thioredoxin domain-containing protein [Posttranslational modification, protein turnover, chaperones]; Region: COG3118
568708002479	ybbN protein family; ybbN is a hypothetical protein containing a redox-inactive TRX-like domain. Its gene has been sequenced from several gammaproteobacteria and actinobacteria; Region: ybbN; cd02956
568708002481	oxidoreductase; Provisional; Region: PRK08017
568708002482	17beta hydroxysteroid dehydrogenase-like, classical (c) SDRs; Region: 17beta-HSD-like_SDR_c; cd05374
568708002483	NADP binding site [chemical binding]; other site
568708002484	active site
568708002485	steroid binding site; other site
568708002487	Lysophospholipase L1-like subgroup of SGNH-hydrolases. The best characterized member in this family is TesA, an E. coli periplasmic protein with thioesterase, esterase, arylesterase, protease and lysophospholipase activity; Region: Lysophospholipase_L1_like; cd01822
568708002488	active site
568708002489	catalytic triad [active]
568708002490	oxyanion hole [active]
568708002491	switch loop; other site
568708002493	1 probable transmembrane helix predicted for STM_MW05761 by TMHMM2.0 at aa 7-26
568708002494	Signal peptide predicted for STM_MW05761 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.788 between residues 25 and 26
568708002495	putative ABC transporter ATP-binding protein YbbA; Provisional; Region: PRK10584
568708002496	ATP-binding cassette domain of the transporters involved in export of lipoprotein and macrolide, and cell division protein; Region: ABC_MJ0796_LolCDE_FtsE; cd03255
568708002497	Walker A/P-loop; other site
568708002498	ATP binding site [chemical binding]; other site
568708002499	Q-loop/lid; other site
568708002500	ABC transporter signature motif; other site
568708002501	Walker B; other site
568708002502	D-loop; other site
568708002503	H-loop/switch region; other site
568708002505	Predicted ABC-type transport system involved in lysophospholipase L1 biosynthesis, permease component [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3127
568708002506	FtsX-like permease family; Region: FtsX; pfam02687
568708002507	Signal peptide predicted for STM_MW05781 by SignalP 2.0 HMM (Signal peptide probability 0.989) with cleavage site probability 0.640 between residues 33 and 34
568708002508	10 probable transmembrane helices predicted for STM_MW05781 by TMHMM2.0 at aa 13-35, 243-262, 291-313, 333-355, 376-398, 403-425, 451-473, 676-698, 732-754 and 769-791
568708002510	Outer membrane protein (porin) [Cell envelope biogenesis, outer membrane]; Region: OmpC; COG3203
568708002511	Porin superfamily.  These outer membrane channels share a beta-barrel structure that differ in strand and shear number.  Classical (gram-negative ) porins are non-specific channels for small hydrophillic molecules and form 16 beta-stranded barrels (16,20)...; Region: OM_channels; cl17244
568708002512	Signal peptide predicted for STM_MW05791 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.899 between residues 25 and 26
568708002513	ABC-type metal ion transport system, periplasmic component/surface antigen [Inorganic ion transport and metabolism]; Region: NlpA; COG1464
568708002514	NLPA lipoprotein; Region: Lipoprotein_9; pfam03180
568708002515	Signal peptide predicted for STM_MW05801 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.986 between residues 25 and 26
568708002517	ABC-type metal ion transport system, ATPase component [Inorganic ion transport and metabolism]; Region: AbcC; COG1135
568708002518	ATP-binding cassette domain of methionine transporter; Region: ABC_MetN_methionine_transporter; cd03258
568708002519	Walker A/P-loop; other site
568708002520	ATP binding site [chemical binding]; other site
568708002521	Q-loop/lid; other site
568708002522	ABC transporter signature motif; other site
568708002523	Walker B; other site
568708002524	D-loop; other site
568708002525	H-loop/switch region; other site
568708002526	NIL domain; Region: NIL; pfam09383
568708002529	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708002530	dimer interface [polypeptide binding]; other site
568708002531	conserved gate region; other site
568708002532	ABC-ATPase subunit interface; other site
568708002533	6 probable transmembrane helices predicted for STM_MW05821 by TMHMM2.0 at aa 15-37, 50-72, 82-104, 117-139, 149-171 and 183-205
568708002535	Predicted ATPase [General function prediction only]; Region: COG2603
568708002536	Member of the Rhodanese Homology Domain superfamily. This CD includes several putative ATP /GTP binding proteins including E. coli YbbB; Region: RHOD_YbbB; cd01520
568708002537	active site residue [active]
568708002539	DNA-binding transcriptional activator AllS; Provisional; Region: PRK10094
568708002540	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708002541	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
568708002542	dimerization interface [polypeptide binding]; other site
568708002545	Ureidoglycolate hydrolase [Nucleotide transport and metabolism]; Region: DAL3; COG3194
568708002546	ureidoglycolate hydrolase; Provisional; Region: PRK03606
568708002548	DNA-binding transcriptional repressor AllR; Provisional; Region: PRK10163
568708002549	helix_turn_helix isocitrate lyase regulation; Region: HTH_ICLR; smart00346
568708002550	Bacterial transcriptional regulator; Region: IclR; pfam01614
568708002553	glyoxylate carboligase; Provisional; Region: PRK11269
568708002554	Pyrimidine (PYR) binding domain of POX and related proteins; Region: TPP_PYR_POX_like; cd07035
568708002555	PYR/PP interface [polypeptide binding]; other site
568708002556	dimer interface [polypeptide binding]; other site
568708002557	TPP binding site [chemical binding]; other site
568708002558	Thiamine pyrophosphate enzyme, central domain; Region: TPP_enzyme_M; pfam00205
568708002559	Thiamine pyrophosphate (TPP) family, Gcl subfamily, TPP-binding module; composed of proteins similar to Escherichia coli glyoxylate carboligase (Gcl). E. coli glyoxylate carboligase, plays a key role in glyoxylate metabolism where it catalyzes the...; Region: TPP_Gcl; cd02006
568708002560	TPP-binding site [chemical binding]; other site
568708002564	hydroxypyruvate isomerase; Provisional; Region: PRK09997
568708002566	tartronate semialdehyde reductase; Provisional; Region: PRK15059
568708002567	6-phosphogluconate dehydrogenase-like protein; Reviewed; Region: PRK09599
568708002569	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708002570	Major Facilitator Superfamily; Region: MFS_1; pfam07690
568708002571	putative substrate translocation pore; other site
568708002572	12 probable transmembrane helices predicted for STM_MW05901 by TMHMM2.0 at aa 21-40, 55-77, 84-101, 106-128, 141-163, 173-195, 223-245, 260-282, 295-313, 323-342, 355-377 and 387-406
568708002576	putative uracil/xanthine transporter; Provisional; Region: PRK11412
568708002578	11 probable transmembrane helices predicted for STM_MW05921 by TMHMM2.0 at aa 15-37, 42-64, 99-121, 128-150, 170-189, 196-213, 237-259, 280-302, 341-363, 375-397 and 407-426
568708002579	glycerate kinase II; Provisional; Region: PRK09932
568708002581	Uncharacterized protein, possibly involved in glyoxylate utilization [General function prediction only]; Region: GlxB; COG3257
568708002582	Mif2/CENP-C like; Region: Mif2; pfam11699
568708002583	Cupin domain; Region: Cupin_2; pfam07883
568708002586	allantoate amidohydrolase; Region: AllC; TIGR03176
568708002587	M20 Peptidase beta-alanine synthase, an amidohydrolase; Region: M20_bAS; cd03884
568708002588	active site
568708002589	metal binding site [ion binding]; metal-binding site
568708002590	dimer interface [polypeptide binding]; other site
568708002593	ureidoglycolate dehydrogenase; Provisional; Region: PRK15025
568708002595	membrane protein FdrA; Validated; Region: PRK06091
568708002596	CoA binding domain; Region: CoA_binding; pfam02629
568708002597	CoA-ligase; Region: Ligase_CoA; pfam00549
568708002600	Protein of unknown function (DUF1116); Region: DUF1116; pfam06545
568708002602	Protein of unknown function (DUF2877); Region: DUF2877; pfam11392
568708002604	carbamate kinase-like carbamoyl phosphate synthetase; Reviewed; Region: PRK12454
568708002605	AAK_CK: Carbamate kinase (CK) catalyzes both the ATP-phosphorylation of carbamate and carbamoyl phosphate (CP) utilization with the production of ATP from ADP and CP. Both CK (this CD) and nonhomologous CP synthetase synthesize carbamoyl phosphate, an...; Region: AAK_CK; cd04235
568708002606	putative substrate binding site [chemical binding]; other site
568708002607	nucleotide binding site [chemical binding]; other site
568708002608	nucleotide binding site [chemical binding]; other site
568708002609	homodimer interface [polypeptide binding]; other site
568708002611	phosphoribosylaminoimidazole carboxylase ATPase subunit; Reviewed; Region: PRK06019
568708002612	ATP-grasp domain; Region: ATP-grasp; pfam02222
568708002614	Phosphoribosylcarboxyaminoimidazole (NCAIR) mutase [Nucleotide transport and metabolism]; Region: PurE; COG0041
568708002616	Escherichia coli YbbF/LpxH and related proteins, metallophosphatase domain; Region: MPP_YbbF-LpxH; cd07398
568708002617	Calcineurin-like phosphoesterase; Region: Metallophos; pfam00149
568708002618	putative active site [active]
568708002619	putative metal binding site [ion binding]; other site
568708002621	cyclophilin_EcCYP_like: cyclophilin-type A-like peptidylprolyl cis- trans isomerase (PPIase) domain similar to the cytosolic E. coli cyclophilin A and Streptomyces antibioticus SanCyp18. Compared to the archetypal cyclophilin Human cyclophilin A, these...; Region: cyclophilin_EcCYP_like; cd01920
568708002622	substrate binding site [chemical binding]; other site
568708002624	cysteinyl-tRNA synthetase; Validated; Region: cysS; PRK00260
568708002625	catalytic core domain of cysteinyl tRNA synthetase; Region: CysRS_core; cd00672
568708002626	active site
568708002627	HIGH motif; other site
568708002628	catalytic core domain of cysteinyl tRNA synthetase; Region: CysRS_core; cd00672
568708002629	KMSKS motif; other site
568708002630	Anticodon-binding domain of cysteinyl tRNA synthetases; Region: Anticodon_Ia_Cys; cd07963
568708002631	tRNA binding surface [nucleotide binding]; other site
568708002632	anticodon binding site; other site
568708002635	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4727
568708002636	Uncharacterized protein conserved in bacteria (DUF2145); Region: DUF2145; pfam09916
568708002638	Signal peptide predicted for STM_MW06061 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 19 and 20
568708002639	Signal peptide predicted for STM_MW06071 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.971 between residues 21 and 22
568708002640	Predicted membrane-bound metal-dependent hydrolases [General function prediction only]; Region: COG1988
568708002641	4 probable transmembrane helices predicted for STM_MW06081 by TMHMM2.0 at aa 12-34, 54-76, 89-108 and 149-171
568708002643	ribosome-associated protein; Provisional; Region: PRK11507
568708002644	bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase; Provisional; Region: PRK10792
568708002645	Tetrahydrofolate dehydrogenase/cyclohydrolase, catalytic domain; Region: THF_DHG_CYH; pfam00763
568708002646	NADP binding domain of methylene-tetrahydrofolate dehydrogenase/cyclohydrolase; Region: NAD_bind_m-THF_DH_Cyclohyd; cd01080
568708002647	homodimer interface [polypeptide binding]; other site
568708002648	NADP binding site [chemical binding]; other site
568708002649	substrate binding site [chemical binding]; other site
568708002652	type-1 fimbrial protein subunit A; Provisional; Region: PRK15194
568708002653	Signal peptide predicted for STM_MW06111 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.987 between residues 22 and 23
568708002655	fimbrial protein FimI; Provisional; Region: PRK15200
568708002656	Signal peptide predicted for STM_MW06121 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.994 between residues 19 and 20
568708002658	fimbrial chaperone protein FimC; Provisional; Region: PRK15195
568708002659	Gram-negative pili assembly chaperone, N-terminal domain; Region: Pili_assembly_N; pfam00345
568708002660	Gram-negative pili assembly chaperone, C-terminal domain; Region: Pili_assembly_C; pfam02753
568708002661	Signal peptide predicted for STM_MW06131 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 23 and 24
568708002662	1 probable transmembrane helix predicted for STM_MW06131 by TMHMM2.0 at aa 7-29
568708002665	outer membrane usher protein FimD; Provisional; Region: PRK15198
568708002666	PapC N-terminal domain; Region: PapC_N; pfam13954
568708002667	Type VII secretion system (T7SS), usher protein; Region: Usher; pfam00577
568708002668	PapC C-terminal domain; Region: PapC_C; pfam13953
568708002669	Signal peptide predicted for STM_MW06141 by SignalP 2.0 HMM (Signal peptide probability 0.968) with cleavage site probability 0.471 between residues 27 and 28
568708002671	fimbrial-like adhesin; Provisional; Region: fimH; PRK15199
568708002672	Signal peptide predicted for STM_MW06151 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.997 between residues 22 and 23
568708002673	fimbrial-like adhesin protein SfmF; Provisional; Region: PRK09934
568708002674	Signal peptide predicted for STM_MW06161 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.990 between residues 21 and 22
568708002676	transcriptional regulator FimZ; Provisional; Region: PRK09935
568708002677	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708002678	active site
568708002679	phosphorylation site [posttranslational modification]
568708002680	intermolecular recognition site; other site
568708002681	dimerization interface [polypeptide binding]; other site
568708002682	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
568708002683	DNA binding residues [nucleotide binding]
568708002684	dimerization interface [polypeptide binding]; other site
568708002687	fimbriae regulatory protein FimW; Provisional; Region: PRK15201
568708002688	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
568708002689	DNA binding residues [nucleotide binding]
568708002690	dimerization interface [polypeptide binding]; other site
568708002694	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
568708002695	Transposase; Region: HTH_Tnp_1; pfam01527
568708002697	9 probable transmembrane helices predicted for STM_MW06231 by TMHMM2.0 at aa 13-32, 77-96, 108-130, 135-157, 201-223, 254-273, 280-302, 307-329 and 336-358
568708002698	Signal peptide predicted for STM_MW06231 by SignalP 2.0 HMM (Signal peptide probability 0.879) with cleavage site probability 0.554 between residues 27 and 28
568708002699	Glycosyltransferase like family 2; Region: Glyco_tranf_2_3; pfam13641
568708002700	Bacterial DPM1_like enzymes are related to eukaryotic DPM1; Region: DPM1_like_bac; cd04187
568708002701	Ligand binding site; other site
568708002702	Putative Catalytic site; other site
568708002703	DXD motif; other site
568708002705	2 probable transmembrane helices predicted for STM_MW06241 by TMHMM2.0 at aa 227-249 and 264-286
568708002706	Predicted membrane protein [Function unknown]; Region: COG2246
568708002707	GtrA-like protein; Region: GtrA; pfam04138
568708002708	4 probable transmembrane helices predicted for STM_MW06251 by TMHMM2.0 at aa 12-31, 35-54, 67-84 and 94-116
568708002714	Cupin; Region: Cupin_6; pfam12852
568708002715	AraC-type DNA-binding domain-containing proteins [Transcription]; Region: AraC; COG2207
568708002716	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708002717	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708002719	pyridine nucleotide-disulfide oxidoreductase; Provisional; Region: PRK08010
568708002720	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
568708002721	Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852
568708002725	Protein of unknown function (DUF1471); Region: DUF1471; pfam07338
568708002726	Signal peptide predicted for STM_MW06301 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.996 between residues 22 and 23
568708002728	Predicted membrane protein [Function unknown]; Region: COG3059
568708002730	4 probable transmembrane helices predicted for STM_MW06311 by TMHMM2.0 at aa 13-32, 87-106, 113-135 and 164-183
568708002731	DnaJ-domain-containing proteins 1 [Posttranslational modification, protein turnover, chaperones]; Region: DjlA; COG1076
568708002732	phenylalanine transporter; Provisional; Region: PRK10249
568708002734	12 probable transmembrane helices predicted for STM_MW06331 by TMHMM2.0 at aa 34-53, 57-74, 107-129, 139-161, 166-188, 210-232, 253-275, 295-317, 344-366, 370-392, 413-435 and 440-459
568708002735	Small-conductance mechanosensitive channel [Cell envelope biogenesis, outer membrane]; Region: MscS; COG0668
568708002736	Mechanosensitive ion channel; Region: MS_channel; pfam00924
568708002738	5 probable transmembrane helices predicted for STM_MW06341 by TMHMM2.0 at aa 21-43, 72-89, 102-124, 139-161 and 166-183
568708002739	Phospholipase/lecithinase/hemolysin [Lipid metabolism / General function prediction only]; Region: COG3240
568708002740	SGNH_hydrolase, or GDSL_hydrolase, is a diverse family of lipases and esterases. The tertiary fold of the enzyme is substantially different from that of the alpha/beta hydrolase family and unique among all known hydrolases; its active site closely...; Region: SGNH_hydrolase; cl01053
568708002741	active site
568708002742	oxyanion hole [active]
568708002743	SGNH_hydrolase, or GDSL_hydrolase, is a diverse family of lipases and esterases. The tertiary fold of the enzyme is substantially different from that of the alpha/beta hydrolase family and unique among all known hydrolases; its active site closely...; Region: SGNH_hydrolase; cl01053
568708002744	catalytic triad [active]
568708002745	Autotransporter protein or domain, integral membrane beta-barrel involved in protein secretion [Cell motility and secretion]; Region: COG5571
568708002746	Signal peptide predicted for STM_MW06351 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.992 between residues 25 and 26
568708002749	Transcriptional regulators containing an AAA-type ATPase domain and a DNA-binding domain [Transcription / Signal transduction mechanisms]; Region: PspF; COG1221
568708002750	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708002751	ATP binding site [chemical binding]; other site
568708002752	Walker B motif; other site
568708002753	arginine finger; other site
568708002754	Transcriptional antiterminator [Transcription]; Region: COG3933
568708002755	PTS_IIA, PTS system, mannose/sorbose specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIA_man; cd00006
568708002756	active pocket/dimerization site; other site
568708002757	active site
568708002758	phosphorylation site [posttranslational modification]
568708002759	PRD domain; Region: PRD; pfam00874
568708002760	Signal peptide predicted for STM_MW06361 by SignalP 2.0 HMM (Signal peptide probability 0.933) with cleavage site probability 0.457 between residues 31 and 32
568708002764	Predicted phosphosugar isomerases [Cell envelope biogenesis, outer membrane]; Region: AgaS; COG2222
568708002765	A subgroup of the SIS domain. SIS (Sugar ISomerase) domains are found in many phosphosugar isomerases and phosphosugar binding proteins. SIS domains are also found in proteins that regulate the expression of genes involved in synthesis of phosphosugars; Region: SIS_1; cd05710
568708002766	putative active site [active]
568708002767	SIS (Sugar ISomerase) domain repeat 2 found in Glucosamine 6-phosphate synthase (GlmS) and Glucosamine-6-phosphate deaminase (GlmD). The SIS domain is found in many phosphosugar isomerases and phosphosugar binding proteins. GlmS contains a N-terminal...; Region: SIS_GlmS_GlmD_2; cd05009
568708002768	dimer interface [polypeptide binding]; other site
568708002769	active site
568708002771	Predicted phosphosugar isomerases [Cell envelope biogenesis, outer membrane]; Region: AgaS; COG2222
568708002772	SIS (Sugar ISomerase) domain repeat 1 found in Glucosamine 6-phosphate synthase (GlmS) and Glucosamine-6-phosphate deaminase (GlmD). The SIS domain is found in many phosphosugar isomerases and phosphosugar binding proteins. GlmS contains a N-terminal...; Region: SIS_GlmS_GlmD_1; cd05008
568708002773	dimer interface [polypeptide binding]; other site
568708002774	active site
568708002775	SIS (Sugar ISomerase) domain repeat 2 found in Glucosamine 6-phosphate synthase (GlmS) and Glucosamine-6-phosphate deaminase (GlmD). The SIS domain is found in many phosphosugar isomerases and phosphosugar binding proteins. GlmS contains a N-terminal...; Region: SIS_GlmS_GlmD_2; cd05009
568708002776	dimer interface [polypeptide binding]; other site
568708002777	active site
568708002779	Phosphotransferase system, mannose/fructose/N-acetylgalactosamine-specific component IID [Carbohydrate transport and metabolism]; Region: ManZ; COG3716
568708002780	4 probable transmembrane helices predicted for STM_MW06391 by TMHMM2.0 at aa 152-174, 195-217, 237-254 and 261-283
568708002782	Phosphotransferase system, mannose/fructose/N-acetylgalactosamine-specific component IIC [Carbohydrate transport and metabolism]; Region: ManY; COG3715
568708002784	6 probable transmembrane helices predicted for STM_MW06401 by TMHMM2.0 at aa 7-29, 34-56, 69-91, 124-146, 153-175 and 190-212
568708002785	PTS_IIB, PTS system, Mannose/sorbose specific IIB subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIB_man; cd00001
568708002786	active site
568708002787	phosphorylation site [posttranslational modification]
568708002789	PTS_IIA, PTS system, mannose/sorbose specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIA_man; cd00006
568708002790	active pocket/dimerization site; other site
568708002791	active site
568708002792	phosphorylation site [posttranslational modification]
568708002794	NAD(P)H:FMN oxidoreductase family. This domain catalyzes the reduction of flavin, nitrocompound, quinones and azo compounds using NADH or NADPH as an electron donor. The enzyme is a homodimer, and each monomer binds a FMN as co-factor. This family...; Region: NfsB_like_nitroreductase; cd02149
568708002795	dimer interface [polypeptide binding]; other site
568708002796	FMN binding site [chemical binding]; other site
568708002798	hypothetical protein; Provisional; Region: PRK10250
568708002800	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
568708002801	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
568708002803	DNA-binding transcriptional regulator SoxS; Provisional; Region: PRK10219
568708002804	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708002806	Protein of unknown function (DUF1158); Region: DUF1158; pfam06643
568708002808	2 probable transmembrane helices predicted for STM_MW06472 by TMHMM2.0 at aa 13-35 and 50-72
568708002809	gamma-glutamyl:cysteine ligase; Provisional; Region: PRK13516
568708002810	carboxylate-amine ligase, YbdK family; Region: gshA_cyan_rel; TIGR02050
568708002812	phosphopantetheinyltransferase component of enterobactin synthase multienzyme complex; Provisional; Region: PRK10251
568708002813	4'-phosphopantetheinyl transferase superfamily; Region: ACPS; pfam01648
568708002815	outer membrane receptor FepA; Provisional; Region: PRK13524
568708002816	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
568708002817	N-terminal plug; other site
568708002818	ligand-binding site [chemical binding]; other site
568708002821	Signal peptide predicted for STM_MW06501 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 25 and 26
568708002822	enterobactin/ferric enterobactin esterase; Provisional; Region: PRK10439
568708002823	Domain of unknown function (DUF3327); Region: DUF3327; pfam11806
568708002824	Predicted hydrolase of the alpha/beta superfamily [General function prediction only]; Region: COG2819
568708002826	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3251
568708002828	enterobactin synthase subunit F; Provisional; Region: entF; PRK10252
568708002829	The adenylation domain of nonribosomal peptide synthetases (NRPS); Region: A_NRPS; cd05930
568708002830	acyl-activating enzyme (AAE) consensus motif; other site
568708002831	AMP binding site [chemical binding]; other site
568708002832	Phosphopantetheine attachment site; Region: PP-binding; pfam00550
568708002837	LPS O-antigen length regulator; Provisional; Region: PRK10381
568708002838	Chain length determinant protein; Region: Wzz; pfam02706
568708002840	2 probable transmembrane helices predicted for STM_MW06541 by TMHMM2.0 at aa 43-62 and 338-360
568708002841	iron-enterobactin transporter ATP-binding protein; Provisional; Region: PRK10253
568708002842	ATP-binding component of iron-siderophores, vitamin B12 and hemin transporters and related proteins; Region: ABC_Iron-Siderophores_B12_Hemin; cd03214
568708002843	Walker A/P-loop; other site
568708002844	ATP binding site [chemical binding]; other site
568708002845	Q-loop/lid; other site
568708002846	ABC transporter signature motif; other site
568708002847	Walker B; other site
568708002848	D-loop; other site
568708002849	H-loop/switch region; other site
568708002851	ABC-type enterobactin transport system, permease component [Inorganic ion transport and metabolism]; Region: FepG; COG4779
568708002852	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
568708002853	ABC-ATPase subunit  interface; other site
568708002854	dimer interface [polypeptide binding]; other site
568708002855	putative PBP binding regions; other site
568708002856	8 probable transmembrane helices predicted for STM_MW06561 by TMHMM2.0 at aa 7-26, 57-79, 92-111, 115-137, 144-166, 193-210, 239-261 and 301-323
568708002858	Signal peptide predicted for STM_MW06561 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.876 between residues 30 and 31
568708002859	iron-hydroxamate transporter permease subunit; Provisional; Region: PRK10577
568708002860	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
568708002861	ABC-ATPase subunit  interface; other site
568708002862	dimer interface [polypeptide binding]; other site
568708002863	putative PBP binding regions; other site
568708002864	9 probable transmembrane helices predicted for STM_MW06571 by TMHMM2.0 at aa 10-32, 65-82, 92-114, 121-140, 155-177, 198-220, 240-262, 282-304 and 308-326
568708002866	Signal peptide predicted for STM_MW06571 by SignalP 2.0 HMM (Signal peptide probability 0.989) with cleavage site probability 0.811 between residues 32 and 33
568708002867	enterobactin exporter EntS; Provisional; Region: PRK10489
568708002868	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708002869	putative substrate translocation pore; other site
568708002871	12 probable transmembrane helices predicted for STM_MW06581 by TMHMM2.0 at aa 22-44, 54-76, 83-105, 110-132, 153-175, 179-201, 214-236, 256-278, 285-307, 312-331, 351-373 and 377-399
568708002872	ABC-type Fe2+-enterobactin transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: FepB; COG4592
568708002873	Fe3+-siderophore binding domain FhuD.  These proteins have been shown to function as initial receptors in ABC transport of Fe3+-siderophores in many eubacterial species. They belong to the TroA-like superfamily of helical backbone metal receptor proteins...; Region: FhuD; cd01146
568708002874	siderophore binding site; other site
568708002876	Signal peptide predicted for STM_MW06591 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 24 and 25
568708002877	isochorismate synthase EntC; Provisional; Region: PRK15016
568708002878	chorismate binding enzyme; Region: Chorismate_bind; pfam00425
568708002880	enterobactin synthase subunit E; Provisional; Region: entE; PRK10946
568708002881	2,3-dihydroxybenzoate-AMP ligase; Region: 23DHB-AMP_lg; cd05920
568708002882	acyl-activating enzyme (AAE) consensus motif; other site
568708002883	active site
568708002884	AMP binding site [chemical binding]; other site
568708002885	substrate binding site [chemical binding]; other site
568708002887	Isochorismatase, also known as 2,3 dihydro-2,3 dihydroxybenzoate synthase, catalyses the conversion of isochorismate, in the presence of water, to 2,3-dihydroxybenzoate and pyruvate, via the hydrolysis of a vinyl ether, an uncommon reaction in biological...; Region: isochorismatase; cd01013
568708002888	hydrophobic substrate binding pocket; other site
568708002889	Isochorismatase family; Region: Isochorismatase; pfam00857
568708002890	active site
568708002891	conserved cis-peptide bond; other site
568708002892	Aryl carrier domain [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3433
568708002895	2,3-dihydroxybenzoate-2,3-dehydrogenase; Validated; Region: PRK08220
568708002896	2,3 dihydro-2,3 dihydrozybenzoate dehydrogenases, classical (c) SDRs; Region: DH-DHB-DH_SDR_c; cd05331
568708002897	putative NAD(P) binding site [chemical binding]; other site
568708002898	active site
568708002900	PaaI_thioesterase is a tetrameric acyl-CoA thioesterase with a hot dog fold and one of several proteins responsible for phenylacetic acid (PA) degradation in bacteria.  Although orthologs of PaaI exist in archaea and eukaryotes, their function has not...; Region: PaaI_thioesterase; cd03443
568708002901	CoenzymeA binding site [chemical binding]; other site
568708002902	subunit interaction site [polypeptide binding]; other site
568708002903	PHB binding site; other site
568708002905	carbon starvation protein A; Provisional; Region: PRK15015
568708002906	Carbon starvation protein CstA; Region: CstA; pfam02554
568708002907	C-terminal domain on CstA (DUF4161); Region: DUF4161; pfam13722
568708002908	Signal peptide predicted for STM_MW06651 by SignalP 2.0 HMM (Signal peptide probability 0.919) with cleavage site probability 0.540 between residues 22 and 23
568708002909	18 probable transmembrane helices predicted for STM_MW06651 by TMHMM2.0 at aa 7-26, 32-54, 89-111, 116-138, 159-181, 191-213, 218-240, 255-277, 284-306, 326-348, 361-383, 398-420, 441-463, 468-487, 514-533, 548-570, 577-599 and 649-671
568708002911	Uncharacterized small protein [Function unknown]; Region: COG2879
568708002913	Glycerol dehydrogenase and related enzymes [Energy production and conversion]; Region: GldA; COG0371
568708002914	Glycerol dehydrogenases-like; Region: GlyDH-like1; cd08172
568708002915	putative active site [active]
568708002916	metal binding site [ion binding]; metal-binding site
568708002918	methionine aminotransferase; Validated; Region: PRK09082
568708002919	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
568708002920	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708002921	homodimer interface [polypeptide binding]; other site
568708002922	catalytic residue [active]
568708002923	Signal peptide predicted for STM_MW06681 by SignalP 2.0 HMM (Signal peptide probability 0.626) with cleavage site probability 0.422 between residues 27 and 28
568708002925	Stage 0 sporulation protein J (antagonist of Soj) containing ParB-like nuclease domain [Transcription]; Region: Spo0J; COG1475
568708002926	ParB-like nuclease domain; Region: ParBc; pfam02195
568708002928	Predicted phosphoadenosine phosphosulfate sulfotransferase [General function prediction only]; Region: COG3969
568708002929	This domain is found in phosphoadenosine phosphosulphate (PAPS) reductase enzymes or PAPS sulphotransferase. PAPS reductase is part of the adenine nucleotide alpha hydrolases superfamily also including N type ATP PPases and ATP sulphurylases. A highly...; Region: PAPS_reductase; cd01713
568708002930	Active Sites [active]
568708002931	Domain of unknown function (DUF3440); Region: DUF3440; pfam11922
568708002933	putative DNA-binding transcriptional regulator; Provisional; Region: PRK11482
568708002934	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708002935	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
568708002936	dimerization interface [polypeptide binding]; other site
568708002939	disulfide isomerase/thiol-disulfide oxidase; Provisional; Region: dsbG; PRK11657
568708002940	DsbA family, DsbC and DsbG subfamily; V-shaped homodimeric proteins containing a redox active CXXC motif imbedded in a TRX fold. They function as protein disulfide isomerases and chaperones in the bacterial periplasm to correct non-native disulfide bonds...; Region: DsbA_DsbC_DsbG; cd03020
568708002941	dimerization domain [polypeptide binding]; other site
568708002942	dimer interface [polypeptide binding]; other site
568708002943	catalytic residues [active]
568708002944	Signal peptide predicted for STM_MW06721 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 17 and 18
568708002945	alkyl hydroperoxide reductase subunit C; Provisional; Region: PRK10382
568708002946	Peroxiredoxin (PRX) family, Typical 2-Cys PRX subfamily; PRXs are thiol-specific antioxidant (TSA) proteins, which confer a protective role in cells through its peroxidase activity by reducing hydrogen peroxide, peroxynitrite, and organic hydroperoxides; Region: PRX_Typ2cys; cd03015
568708002947	dimer interface [polypeptide binding]; other site
568708002948	decamer (pentamer of dimers) interface [polypeptide binding]; other site
568708002949	catalytic triad [active]
568708002950	peroxidatic and resolving cysteines [active]
568708002953	alkyl hydroperoxide reductase subunit F; Provisional; Region: PRK15317
568708002954	Alkyl hydroperoxide reductase F subunit (AhpF) N-terminal domain (NTD) family, N-terminal TRX-fold subdomain; AhpF is a homodimeric flavoenzyme which catalyzes the NADH-dependent reduction of the peroxiredoxin AhpC, which in turn catalyzes the reduction...; Region: AhpF_NTD_N; cd02974
568708002955	catalytic residue [active]
568708002956	TRX-GRX-like family, Alkyl hydroperoxide reductase F subunit (AhpF) N-terminal domain (NTD) subfamily, C-terminal TRX-fold subdomain; AhpF is a homodimeric flavoenzyme which catalyzes the NADH-dependent reduction of the peroxiredoxin AhpC, which then...; Region: AhpF_NTD_C; cd03026
568708002957	catalytic residues [active]
568708002958	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
568708002959	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
568708002962	Uncharacterized component of anaerobic dehydrogenases [General function prediction only]; Region: TorD; COG3381
568708002964	Anaerobic dehydrogenases, typically selenocysteine-containing [Energy production and conversion]; Region: BisC; COG0243
568708002965	The MopB_3 CD includes a group of related uncharacterized bacterial and archaeal molybdopterin-binding oxidoreductase-like domains with a putative N-terminal iron-sulfur [4Fe-4S] cluster binding site and molybdopterin cofactor binding site. These members...; Region: MopB_3; cd02766
568708002966	putative [4Fe-4S] binding site [ion binding]; other site
568708002967	putative molybdopterin cofactor binding site [chemical binding]; other site
568708002968	Molybdopterin-Binding, C-terminal (MopB_CT) domain of the MopB superfamily of proteins, a  large, diverse, heterogeneous superfamily of enzymes that, in general, bind molybdopterin as a cofactor. The MopB domain is found in a wide variety of molybdenum-...; Region: MopB_CT; cd02775
568708002969	molybdopterin cofactor binding site; other site
568708002970	Signal peptide predicted for STM_MW06761 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 38 and 39
568708002971	1 probable transmembrane helix predicted for STM_MW06761 by TMHMM2.0 at aa 13-32
568708002975	Fe-S-cluster-containing hydrogenase components 1 [Energy production and conversion]; Region: HybA; COG0437
568708002976	RPB11 and RPB3 subunits of RNA polymerase; Region: RNAP_RPB11_RPB3; cl11409
568708002978	DMSO reductase anchor subunit [General function prediction only]; Region: DmsC; COG3302
568708002980	8 probable transmembrane helices predicted for STM_MW06781 by TMHMM2.0 at aa 5-27, 39-61, 76-95, 102-124, 134-156, 163-185, 195-214 and 226-248
568708002981	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
568708002982	Ligand Binding Site [chemical binding]; other site
568708002984	Glutathione-dependent formaldehyde dehydrogenase related proteins, child 1; Region: FDH_like_1; cd08283
568708002985	Threonine dehydrogenase and related Zn-dependent dehydrogenases [Amino acid transport and metabolism / General function prediction only]; Region: Tdh; COG1063
568708002986	NAD binding site [chemical binding]; other site
568708002987	catalytic Zn binding site [ion binding]; other site
568708002988	structural Zn binding site [ion binding]; other site
568708002991	nucleoside diphosphate kinase regulator; Provisional; Region: PRK05753
568708002992	Transcription elongation factor, GreA/GreB, C-term; Region: GreA_GreB; pfam01272
568708002994	Ribonuclease T2 (RNase T2) is a widespread family of secreted RNases found in every organism examined thus far.  This family includes RNase Rh, RNase MC1, RNase LE, and self-incompatibility RNases (S-RNases).  Plant T2 RNases are expressed during leaf...; Region: RNase_T2_prok; cd01062
568708002995	B1 nucleotide binding pocket [chemical binding]; other site
568708002996	B2 nucleotide binding pocket [chemical binding]; other site
568708002997	CAS motifs; other site
568708002998	active site
568708003000	Signal peptide predicted for STM_MW06821 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.997 between residues 23 and 24
568708003001	Di- and tricarboxylate transporters [Inorganic ion transport and metabolism]; Region: CitT; COG0471
568708003002	Anion permease ArsB/NhaD.  These permeases have been shown to translocate sodium, arsenate, antimonite, sulfate and organic anions across biological membranes in all three kingdoms of life.  A typical anion permease contains 8-13 transmembrane helices...; Region: ArsB_NhaD_permease; cd00625
568708003003	transmembrane helices; other site
568708003004	13 probable transmembrane helices predicted for STM_MW06831 by TMHMM2.0 at aa 7-24, 34-53, 58-75, 95-117, 138-157, 198-220, 233-255, 288-305, 307-329, 339-361, 374-396, 428-450 and 463-485
568708003006	triphosphoribosyl-dephospho-CoA synthase; Provisional; Region: citG; PRK10096
568708003008	Phosphoribosyl-dephospho-CoA transferase (holo-ACP synthetase) [Coenzyme metabolism / Lipid metabolism]; Region: CitX; COG3697
568708003010	Citrate lyase, alpha subunit [Energy production and conversion]; Region: CitF; COG3051
568708003011	Acetyl-CoA hydrolase/transferase C-terminal domain; Region: AcetylCoA_hyd_C; pfam13336
568708003013	HpcH/HpaI aldolase/citrate lyase family; Region: HpcH_HpaI; cl17231
568708003015	Citrate lyase, gamma subunit [Energy production and conversion]; Region: CitD; COG3052
568708003017	Citrate lyase synthetase [Energy production and conversion]; Region: CitC; COG3053
568708003018	Citrate lyase ligase; Region: Citrate_lyase_ligase; cd02169
568708003019	putative active site [active]
568708003020	(T/H)XGH motif; other site
568708003022	sensor histidine kinase DpiB; Provisional; Region: dpiB; PRK15053
568708003023	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
568708003024	putative active site [active]
568708003025	heme pocket [chemical binding]; other site
568708003026	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708003027	ATP binding site [chemical binding]; other site
568708003028	Mg2+ binding site [ion binding]; other site
568708003029	G-X-G motif; other site
568708003030	Signal peptide predicted for STM_MW06901 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.927 between residues 38 and 39
568708003031	2 probable transmembrane helices predicted for STM_MW06901 by TMHMM2.0 at aa 20-42 and 180-202
568708003034	two-component response regulator DpiA; Provisional; Region: dpiA; PRK10046
568708003035	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708003036	active site
568708003037	phosphorylation site [posttranslational modification]
568708003038	intermolecular recognition site; other site
568708003039	dimerization interface [polypeptide binding]; other site
568708003040	Transcriptional regulator; Region: CitT; pfam12431
568708003042	C4-dicarboxylate transporter DcuC; Provisional; Region: dcuC; PRK10654
568708003043	C4-dicarboxylate anaerobic carrier; Region: DcuC; pfam03606
568708003045	10 probable transmembrane helices predicted for STM_MW06921 by TMHMM2.0 at aa 37-59, 80-102, 117-139, 152-174, 194-216, 223-245, 265-287, 299-321, 363-385 and 392-414
568708003046	phospholipid:lipid A palmitoyltransferase; Provisional; Region: pagP; PRK11045
568708003047	Signal peptide predicted for STM_MW06931 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.962 between residues 29 and 30
568708003048	1 probable transmembrane helix predicted for STM_MW06931 by TMHMM2.0 at aa 7-29
568708003050	Cold-Shock Protein (CSP) contains an S1-like cold-shock domain (CSD) that is found in eukaryotes, prokaryotes, and archaea.  CSP's include the major cold-shock proteins CspA and CspB in bacteria and the eukaryotic gene regulatory factor Y-box...; Region: CSP_CDS; cd04458
568708003051	DNA-binding site [nucleotide binding]; DNA binding site
568708003052	RNA-binding motif; other site
568708003054	chromosome condensation membrane protein; Provisional; Region: PRK14196
568708003056	4 probable transmembrane helices predicted for STM_MW06951 by TMHMM2.0 at aa 5-22, 32-54, 67-89 and 99-121
568708003057	Predicted amidohydrolase [General function prediction only]; Region: COG0388
568708003058	Uncharacterized subgroup of the nitrilase superfamily (putative class 13 nitrilases); Region: nitrilase_3; cd07581
568708003059	putative active site [active]
568708003060	catalytic triad [active]
568708003061	putative dimer interface [polypeptide binding]; other site
568708003063	twin arginine translocase protein E; Validated; Region: tatE; PRK03625
568708003064	1 probable transmembrane helix predicted for STM_MW06971 by TMHMM2.0 at aa 4-21
568708003066	lipoyl synthase; Provisional; Region: PRK05481
568708003067	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
568708003068	FeS/SAM binding site; other site
568708003070	putative DNA-binding transcriptional regulator; Provisional; Region: PRK11482
568708003071	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708003072	The C-terminal substrate binding domain of LysR-type transcriptional regulators that involved in the catabolism of nitroaromatic/naphthalene compounds and that of related regulators; contains the type 2 periplasmic binding fold; Region: PBP2_Nitroaromatics_like; cd08417
568708003073	substrate binding pocket [chemical binding]; other site
568708003074	dimerization interface [polypeptide binding]; other site
568708003077	lipoate-protein ligase B; Provisional; Region: PRK14342
568708003079	hypothetical protein; Provisional; Region: PRK04998
568708003081	D-alanyl-D-alanine carboxypeptidase fraction A; Provisional; Region: PRK10793
568708003082	Beta-lactamase enzyme family; Region: Beta-lactamase2; cl17872
568708003083	Penicillin-binding protein 5, C-terminal domain; Region: PBP5_C; pfam07943
568708003086	Signal peptide predicted for STM_MW07021 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 29 and 30
568708003087	rare lipoprotein A; Provisional; Region: PRK10672
568708003088	Rare lipoprotein A (RlpA)-like double-psi beta-barrel; Region: DPBB_1; pfam03330
568708003089	Sporulation related domain; Region: SPOR; pfam05036
568708003092	Signal peptide predicted for STM_MW07031 by SignalP 2.0 HMM (Signal peptide probability 0.967) with cleavage site probability 0.505 between residues 25 and 26
568708003093	cell wall shape-determining protein; Provisional; Region: PRK10794
568708003094	9 probable transmembrane helices predicted for STM_MW07041 by TMHMM2.0 at aa 15-37, 50-67, 77-99, 136-155, 160-179, 181-203, 272-294, 306-328 and 338-360
568708003096	Signal peptide predicted for STM_MW07041 by SignalP 2.0 HMM (Signal peptide probability 0.957) with cleavage site probability 0.604 between residues 40 and 41
568708003097	penicillin-binding protein 2; Provisional; Region: PRK10795
568708003098	Penicillin-binding Protein dimerisation domain; Region: PBP_dimer; pfam03717
568708003099	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; pfam00905
568708003102	1 probable transmembrane helix predicted for STM_MW07051 by TMHMM2.0 at aa 21-43
568708003103	Signal peptide predicted for STM_MW07051 by SignalP 2.0 HMM (Signal peptide probability 0.673) with cleavage site probability 0.546 between residues 37 and 38
568708003104	rRNA large subunit m3Psi methyltransferase RlmH; Region: tRNA_RlmH_YbeA; TIGR00246
568708003106	ribosome-associated protein; Provisional; Region: PRK11538
568708003108	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
568708003109	catalytic core [active]
568708003111	threonine-phosphate decarboxylase; Provisional; Region: PRK08056
568708003112	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
568708003113	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708003114	homodimer interface [polypeptide binding]; other site
568708003115	catalytic residue [active]
568708003117	nicotinic acid mononucleotide adenylyltransferase; Provisional; Region: nadD; PRK00071
568708003118	Nicotinamide/nicotinate mononucleotide adenylyltransferase; Region: NMNAT; cd02165
568708003119	active site
568708003120	(T/H)XGH motif; other site
568708003122	DNA polymerase III subunit delta; Reviewed; Region: holA; PRK05574
568708003123	DNA polymerase III, delta subunit; Region: DNA_pol3_delta; pfam06144
568708003125	LPS-assembly lipoprotein RlpB; Provisional; Region: PRK10796
568708003127	Signal peptide predicted for STM_MW07121 by SignalP 2.0 HMM (Signal peptide probability 0.810) with cleavage site probability 0.253 between residues 27 and 28
568708003128	leucyl-tRNA synthetase; Validated; Region: leuS; PRK00390
568708003129	catalytic core domain of leucyl-tRNA synthetases; Region: LeuRS_core; cd00812
568708003130	HIGH motif; other site
568708003131	Leucyl-tRNA synthetase, Domain 2; Region: tRNA-synt_1_2; pfam13603
568708003132	nucleotidyl transferase superfamily; Region: nt_trans; cl00015
568708003133	active site
568708003134	KMSKS motif; other site
568708003135	Anticodon-binding domain of bacterial and eukaryotic mitochondrial leucyl tRNA synthetases; Region: Anticodon_Ia_Leu_BEm; cd07958
568708003136	tRNA binding surface [nucleotide binding]; other site
568708003139	Domains similar to fish antifreeze type III protein; Region: SAF_AH_GD; cd11613
568708003141	D-galactarate dehydratase / Altronate hydrolase, C terminus; Region: GD_AH_C; pfam04295
568708003143	2-keto-3-deoxygluconate permease; Provisional; Region: PRK05274
568708003145	8 probable transmembrane helices predicted for STM_MW07161 by TMHMM2.0 at aa 7-25, 35-57, 70-92, 157-179, 192-211, 216-238, 247-269 and 279-301
568708003146	Propionate catabolism activator; Region: PrpR_N; pfam06506
568708003147	Transcriptional regulator containing PAS, AAA-type ATPase, and DNA-binding domains [Transcription / Signal transduction mechanisms]; Region: RocR; COG3829
568708003148	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708003149	Walker A motif; other site
568708003150	ATP binding site [chemical binding]; other site
568708003151	Walker B motif; other site
568708003152	arginine finger; other site
568708003153	Signal peptide predicted for STM_MW07171 by SignalP 2.0 HMM (Signal peptide probability 0.989) with cleavage site probability 0.960 between residues 24 and 25
568708003156	hypothetical protein; Provisional; Region: PRK11032
568708003157	4-hydroxybenzoate polyprenyltransferase and related prenyltransferases [Coenzyme metabolism]; Region: UbiA; cl00337
568708003159	FOG: TPR repeat, SEL1 subfamily [General function prediction only]; Region: COG0790
568708003160	Sel1-like repeats; Region: SEL1; smart00671
568708003161	Sel1-like repeats; Region: SEL1; smart00671
568708003162	Sel1-like repeats; Region: SEL1; smart00671
568708003163	Sel1-like repeats; Region: SEL1; smart00671
568708003164	Sel1-like repeats; Region: SEL1; smart00671
568708003166	Protein of unknown function (DUF1266); Region: DUF1266; pfam06889
568708003168	DnaJ molecular chaperone homology domain; Region: DnaJ; smart00271
568708003169	HSP70 interaction site [polypeptide binding]; other site
568708003171	1 probable transmembrane helix predicted for STM_MW07211 by TMHMM2.0 at aa 453-472
568708003172	Note the frameshift mutation following codon 46; pfam_scan;Pfam:PF06889; E()=8.6E-120;score=397.7;query 1-231;description=DUF1266
568708003174	DnaJ domain; Region: DnaJ; pfam00226
568708003175	HSP70 interaction site [polypeptide binding]; other site
568708003177	Molecular chaperone [Posttranslational modification, protein turnover, chaperones]; Region: DnaK; COG0443
568708003178	Nucleotide-binding domain of Escherichia coli HscC and similar proteins; Region: HscC_like_NBD; cd10235
568708003179	nucleotide binding site [chemical binding]; other site
568708003180	putative NEF/HSP70 interaction site [polypeptide binding]; other site
568708003181	SBD interface [polypeptide binding]; other site
568708003183	nuc_hydro_IU_UC_XIUA: inosine-uridine preferring, xanthosine-inosine-uridine-adenosine-preferring and, uridine-cytidine preferring nucleoside hydrolases. Nucleoside hydrolases cleave the N-glycosidic bond in nucleosides generating ribose and the...; Region: nuc_hydro_IU_UC_XIUA; cd02651
568708003184	active site
568708003185	tetramer interface [polypeptide binding]; other site
568708003187	ABC-type polar amino acid transport system, ATPase component [Amino acid transport and metabolism]; Region: GlnQ; COG1126
568708003188	ATP-binding cassette domain of the histidine and glutamine transporters; Region: ABC_HisP_GlnQ; cd03262
568708003189	Walker A/P-loop; other site
568708003190	ATP binding site [chemical binding]; other site
568708003191	Q-loop/lid; other site
568708003192	ABC transporter signature motif; other site
568708003193	Walker B; other site
568708003194	D-loop; other site
568708003195	H-loop/switch region; other site
568708003197	ABC-type arginine transport system, permease component [Amino acid transport and metabolism]; Region: ArtQ; COG4215
568708003198	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708003199	dimer interface [polypeptide binding]; other site
568708003200	conserved gate region; other site
568708003201	putative PBP binding loops; other site
568708003202	ABC-ATPase subunit interface; other site
568708003203	5 probable transmembrane helices predicted for STM_MW07281 by TMHMM2.0 at aa 15-37, 58-80, 95-112, 155-177 and 197-219
568708003205	ABC-type arginine transport system, permease component [Amino acid transport and metabolism]; Region: ArtQ; COG4215
568708003206	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708003207	dimer interface [polypeptide binding]; other site
568708003208	conserved gate region; other site
568708003209	putative PBP binding loops; other site
568708003210	ABC-ATPase subunit interface; other site
568708003211	5 probable transmembrane helices predicted for STM_MW07291 by TMHMM2.0 at aa 31-53, 66-88, 108-127, 179-196 and 211-233
568708003213	glutamate and aspartate transporter subunit; Provisional; Region: PRK10797
568708003214	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
568708003215	substrate binding pocket [chemical binding]; other site
568708003216	membrane-bound complex binding site; other site
568708003217	hinge residues; other site
568708003219	Signal peptide predicted for STM_MW07301 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 28 and 29
568708003220	apolipoprotein N-acyltransferase; Reviewed; Region: lnt; PRK00302
568708003221	Apolipoprotein N-acyl transferase (class 9 nitrilases); Region: ALP_N-acyl_transferase; cd07571
568708003222	putative active site [active]
568708003223	catalytic triad [active]
568708003224	putative dimer interface [polypeptide binding]; other site
568708003225	8 probable transmembrane helices predicted for STM_MW07311 by TMHMM2.0 at aa 12-29, 33-50, 57-79, 89-111, 124-146, 166-188, 195-213 and 489-507
568708003227	Signal peptide predicted for STM_MW07311 by SignalP 2.0 HMM (Signal peptide probability 0.892) with cleavage site probability 0.839 between residues 27 and 28
568708003228	magnesium/cobalt efflux protein CorC; Provisional; Region: PRK15094
568708003229	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains associated with the CorC_HlyC domain. CorC_HlyC is a transporter associated domain. This small domain is found in Na+/H+ antiporters, in proteins involved in...; Region: CBS_pair_CorC_HlyC_assoc; cd04590
568708003230	Transporter associated domain; Region: CorC_HlyC; smart01091
568708003233	metal-binding heat shock protein; Provisional; Region: PRK00016
568708003235	Phosphate starvation-inducible protein PhoH, predicted ATPase [Signal transduction mechanisms]; Region: PhoH; COG1702
568708003236	PhoH-like protein; Region: PhoH; pfam02562
568708003238	(dimethylallyl)adenosine tRNA methylthiotransferase; Provisional; Region: PRK14325
568708003239	Uncharacterized protein family UPF0004; Region: UPF0004; pfam00919
568708003240	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
568708003241	FeS/SAM binding site; other site
568708003242	TRAM domain; Region: TRAM; pfam01938
568708003246	2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase; Reviewed; Region: ubiF; PRK08020
568708003247	ubiquinone biosynthesis hydroxylase family protein; Provisional; Region: PRK07608; cl17314
568708003249	1 probable transmembrane helix predicted for STM_MW07361 by TMHMM2.0 at aa 7-29
568708003250	4 probable transmembrane helices predicted for STM_MW07371 by TMHMM2.0 at aa 7-28, 33-55, 99-121 and 131-153
568708003251	Signal peptide predicted for STM_MW07371 by SignalP 2.0 HMM (Signal peptide probability 0.730) with cleavage site probability 0.565 between residues 34 and 35
568708003252	asparagine synthetase B; Provisional; Region: asnB; PRK09431
568708003253	Glutamine amidotransferases class-II (GATase) asparagine synthase_B type.  Asparagine synthetase B catalyses the ATP-dependent conversion of aspartate to asparagine. This enzyme is a homodimer, with each monomer composed of a  glutaminase domain and a...; Region: AsnB; cd00712
568708003254	active site
568708003255	dimer interface [polypeptide binding]; other site
568708003256	The C-terminal domain of Asparagine Synthase B. This domain is always found associated n-terminal amidotransferase domain. Family members that contain this domain catalyse the conversion of aspartate to asparagine. Asparagine synthetase B  catalyzes the...; Region: Asn_Synthase_B_C; cd01991
568708003257	Ligand Binding Site [chemical binding]; other site
568708003258	Molecular Tunnel; other site
568708003260	UMP phosphatase; Provisional; Region: PRK10444
568708003261	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708003262	active site
568708003263	motif I; other site
568708003264	motif II; other site
568708003265	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708003267	MarR family; Region: MarR; pfam01047
568708003268	Transcriptional regulator/sugar kinase [Transcription / Carbohydrate transport and metabolism]; Region: NagC; COG1940
568708003269	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cd00012
568708003270	nucleotide binding site [chemical binding]; other site
568708003273	N-acetylglucosamine-6-phosphate deacetylase; Region: nagA; TIGR00221
568708003274	N-acetylglucosamine-6-phosphate deacetylase, NagA, catalyzes the hydrolysis of the N-acetyl group of N-acetyl-glucosamine-6-phosphate (GlcNAc-6-P) to glucosamine 6-phosphate and acetate. This is the first committed step in the biosynthetic pathway to...; Region: NagA; cd00854
568708003275	active site
568708003276	dimer interface [polypeptide binding]; other site
568708003278	6-phosphogluconolactonase/Glucosamine-6-phosphate isomerase/deaminase [Carbohydrate transport and metabolism]; Region: NagB; COG0363
568708003279	GlcN6P_deaminase: Glucosamine-6-phosphate (GlcN6P) deaminase subfamily; GlcN6P deaminase catalyzes the reversible conversion of GlcN6P to D-fructose-6-phosphate (Fru6P) and ammonium. The reaction is an aldo-keto isomerization coupled with an amination or...; Region: GlcN6P_deaminase; cd01399
568708003280	active site
568708003281	trimer interface [polypeptide binding]; other site
568708003282	allosteric site; other site
568708003283	active site lid [active]
568708003284	hexamer (dimer of trimers) interface [polypeptide binding]; other site
568708003286	PTS system N-acetyl glucosamine specific transporter subunits IIABC; Provisional; Region: PRK10255
568708003287	Phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific [Carbohydrate transport and metabolism]; Region: PtsG; COG1263
568708003288	PTS_IIB, PTS system, glucose/sucrose specific IIB subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIB_glc; cd00212
568708003289	active site turn [active]
568708003290	phosphorylation site [posttranslational modification]
568708003291	PTS_IIA, PTS system, glucose/sucrose specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIA_glc; cd00210
568708003292	HPr interaction site; other site
568708003293	glycerol kinase (GK) interaction site [polypeptide binding]; other site
568708003294	active site
568708003295	phosphorylation site [posttranslational modification]
568708003297	11 probable transmembrane helices predicted for STM_MW07431 by TMHMM2.0 at aa 13-30, 40-62, 69-91, 96-118, 131-153, 163-185, 192-214, 229-251, 258-280, 295-317 and 337-359
568708003300	glutaminyl-tRNA synthetase; Provisional; Region: PRK05347
568708003301	nucleotidyl transferase superfamily; Region: nt_trans; cl00015
568708003302	active site
568708003303	HIGH motif; other site
568708003304	nucleotide binding site [chemical binding]; other site
568708003305	catalytic core domain of glutaminyl-tRNA synthetase; Region: GlnRS_core; cd00807
568708003306	KMSKS motif; other site
568708003307	tRNA synthetases class I (E and Q), anti-codon binding domain; Region: tRNA-synt_1c_C; pfam03950
568708003310	outer membrane porin, OprD family; Region: OprD; pfam03573
568708003311	Signal peptide predicted for STM_MW07451 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.848 between residues 32 and 33
568708003312	1 probable transmembrane helix predicted for STM_MW07451 by TMHMM2.0 at aa 9-28
568708003314	Prokaryotic membrane lipoprotein lipid attachment site; Region: LPAM_1; pfam08139
568708003315	YbfN-like lipoprotein; Region: YbfN; pfam13982
568708003316	Signal peptide predicted for STM_MW07461 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.944 between residues 18 and 19
568708003317	citrate-proton symporter; Provisional; Region: PRK15075
568708003318	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708003319	putative substrate translocation pore; other site
568708003320	12 probable transmembrane helices predicted for STM_MW07471 by TMHMM2.0 at aa 20-42, 57-79, 88-110, 120-142, 163-185, 189-211, 239-261, 276-298, 305-327, 337-356, 369-391 and 401-423
568708003322	tricarballylate utilization protein B; Provisional; Region: PRK15033
568708003323	6 probable transmembrane helices predicted for STM_MW07481 by TMHMM2.0 at aa 112-134, 154-176, 230-252, 262-284, 305-322 and 327-349
568708003324	tricarballylate dehydrogenase; Validated; Region: PRK08274
568708003325	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
568708003327	Transcriptional regulator [Transcription]; Region: LysR; COG0583
568708003328	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708003329	The C-teminal substrate binding domain of LysR-like nitrogen assimilation control (NAC) protein, contains the type 2 periplasmic binding fold; Region: PBP2_Nac; cd08433
568708003330	putative dimerization interface [polypeptide binding]; other site
568708003333	ferric uptake regulator; Provisional; Region: fur; PRK09462
568708003334	Ferric uptake regulator(Fur) and related metalloregulatory proteins; typically iron-dependent, DNA-binding repressors and activators; Region: Fur_like; cd07153
568708003335	metal binding site 2 [ion binding]; metal-binding site
568708003336	putative DNA binding helix; other site
568708003337	metal binding site 1 [ion binding]; metal-binding site
568708003338	dimer interface [polypeptide binding]; other site
568708003339	structural Zn2+ binding site [ion binding]; other site
568708003341	flavodoxin FldA; Validated; Region: PRK09267
568708003343	LexA regulated protein; Provisional; Region: PRK11675
568708003345	acyl-CoA esterase; Provisional; Region: PRK10673
568708003346	PGAP1-like protein; Region: PGAP1; pfam07819
568708003348	replication initiation regulator SeqA; Provisional; Region: PRK11187
568708003350	phosphoglucomutase, alpha-D-glucose phosphate-specific; Region: pgm; TIGR01132
568708003351	This bacterial PGM-like (phosphoglucomutase-like) protein of unknown function belongs to the alpha-D-phosphohexomutase superfamily. The alpha-D-phosphohexomutases include several related enzymes that catalyze a reversible intramolecular phosphoryl...; Region: PGM_like3; cd05801
568708003352	active site
568708003353	substrate binding site [chemical binding]; other site
568708003354	metal binding site [ion binding]; metal-binding site
568708003359	Predicted flavin-nucleotide-binding protein [General function prediction only]; Region: COG3467
568708003361	putrescine transporter; Provisional; Region: potE; PRK10655
568708003362	12 probable transmembrane helices predicted for STM_MW07581 by TMHMM2.0 at aa 9-31, 37-59, 89-111, 121-143, 150-172, 187-206, 227-249, 269-291, 325-342, 352-374, 387-405 and 410-429
568708003364	ornithine decarboxylase; Provisional; Region: PRK13578
568708003365	Orn/Lys/Arg decarboxylase, N-terminal domain; Region: OKR_DC_1_N; pfam03709
568708003366	Ornithine decarboxylase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD corresponds to ornithine decarboxylase (ODC), arginine decarboxylase (ADC) and lysine...; Region: Orn_deC_like; cd00615
568708003367	homodimer interface [polypeptide binding]; other site
568708003368	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708003369	catalytic residue [active]
568708003370	Orn/Lys/Arg decarboxylase, C-terminal domain; Region: OKR_DC_1_C; pfam03711
568708003374	DNA-binding transcriptional activator KdpE; Provisional; Region: PRK10529
568708003375	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708003376	active site
568708003377	phosphorylation site [posttranslational modification]
568708003378	intermolecular recognition site; other site
568708003379	dimerization interface [polypeptide binding]; other site
568708003380	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
568708003381	DNA binding site [nucleotide binding]
568708003384	sensor protein KdpD; Provisional; Region: PRK10490
568708003385	Osmosensitive K+ channel His kinase sensor domain; Region: KdpD; pfam02702
568708003386	USP domain is located between the N-terminal sensor domain and C-terminal catalytic domain of this Osmosensitive K+ channel histidine kinase family. The family of KdpD sensor kinase proteins regulates the kdpFABC operon responsible for potassium...; Region: USP_OKCHK; cd01987
568708003387	Ligand Binding Site [chemical binding]; other site
568708003388	Domain of unknown function (DUF4118); Region: DUF4118; pfam13493
568708003389	GAF domain; Region: GAF_3; pfam13492
568708003390	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
568708003391	dimer interface [polypeptide binding]; other site
568708003392	phosphorylation site [posttranslational modification]
568708003393	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708003394	ATP binding site [chemical binding]; other site
568708003395	Mg2+ binding site [ion binding]; other site
568708003396	G-X-G motif; other site
568708003399	3 probable transmembrane helices predicted for STM_MW07611 by TMHMM2.0 at aa 399-421, 428-450 and 476-498
568708003402	potassium-transporting ATPase subunit C; Reviewed; Region: PRK00315
568708003404	1 probable transmembrane helix predicted for STM_MW07621 by TMHMM2.0 at aa 12-34
568708003405	Signal peptide predicted for STM_MW07621 by SignalP 2.0 HMM (Signal peptide probability 0.916) with cleavage site probability 0.662 between residues 28 and 29
568708003406	potassium-transporting ATPase subunit B; Provisional; Region: PRK01122
568708003407	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
568708003408	7 probable transmembrane helices predicted for STM_MW07631 by TMHMM2.0 at aa 37-59, 63-85, 220-242, 252-274, 578-600, 615-634 and 654-676
568708003411	potassium-transporting ATPase subunit A; Provisional; Region: PRK05482
568708003413	12 probable transmembrane helices predicted for STM_MW07641 by TMHMM2.0 at aa 5-27, 62-84, 130-152, 173-195, 253-275, 282-301, 325-347, 354-376, 380-399, 419-438, 483-505 and 526-548
568708003414	Signal peptide predicted for STM_MW07641 by SignalP 2.0 HMM (Signal peptide probability 0.982) with cleavage site probability 0.975 between residues 20 and 21
568708003415	Protein of unknown function (DUF2517); Region: DUF2517; pfam10725
568708003417	1 probable transmembrane helix predicted for STM_MW07651 by TMHMM2.0 at aa 12-33
568708003418	deoxyribodipyrimidine photolyase; Provisional; Region: PRK10674
568708003419	DNA photolyase; Region: DNA_photolyase; pfam00875
568708003422	Dipeptide/tripeptide permease [Amino acid transport and metabolism]; Region: PTR2; COG3104
568708003423	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708003424	putative substrate translocation pore; other site
568708003425	POT family; Region: PTR2; pfam00854
568708003426	14 probable transmembrane helices predicted for STM_MW07671 by TMHMM2.0 at aa 13-35, 50-67, 72-94, 98-117, 138-157, 167-189, 209-231, 235-254, 267-284, 310-332, 344-366, 376-398, 410-432 and 462-479
568708003428	Uncharacterized conserved protein [Function unknown]; Region: COG0327
568708003429	metal-binding protein; Provisional; Region: PRK10799
568708003431	Allophanate hydrolase subunit 1; Region: AHS1; pfam02682
568708003432	Allophanate hydrolase subunit 1 [Amino acid transport and metabolism]; Region: DUR1; cl00896
568708003434	Allophanate hydrolase subunit 2 [Amino acid transport and metabolism]; Region: DUR1; COG1984
568708003436	Escherichia coli putative lactam utilization protein YbgL and similar proteins; Region: LamB_YcsF_YbgL_like; cd10800
568708003437	putative active site [active]
568708003439	DNA breaking-rejoining enzymes, C-terminal catalytic domain. The DNA breaking-rejoining enzyme superfamily includes type IB topoisomerases and tyrosine recombinases that share the same fold in their catalytic domain containing six conserved active site...; Region: DNA_BRE_C; cl00213
568708003440	active site
568708003441	DNA binding site [nucleotide binding]
568708003442	Int/Topo IB signature motif; other site
568708003444	UDP-galactopyranose mutase [Cell envelope biogenesis, outer membrane]; Region: Glf; COG0562
568708003445	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
568708003446	UDP-galactopyranose mutase; Region: GLF; pfam03275
568708003447	Signal peptide predicted for STM_MW07761 by SignalP 2.0 HMM (Signal peptide probability 0.990) with cleavage site probability 0.536 between residues 19 and 20
568708003450	Predicted glycosyltransferases [General function prediction only]; Region: COG1216
568708003451	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394
568708003452	active site
568708003454	This family is most closely related to the GT1 family of glycosyltransferases. cap1E in Streptococcus pneumoniae is required for the synthesis of type 1 capsular polysaccharides; Region: GT1_cap1E_like; cd03808
568708003455	Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438
568708003456	putative ADP-binding pocket [chemical binding]; other site
568708003458	ABC-type polysaccharide/polyol phosphate export systems, permease component [Carbohydrate transport and metabolism / Cell envelope biogenesis, outer membrane]; Region: TagG; COG1682
568708003459	ABC-2 type transporter; Region: ABC2_membrane; pfam01061
568708003461	6 probable transmembrane helices predicted for STM_MW07791 by TMHMM2.0 at aa 29-51, 66-88, 108-130, 140-162, 169-188 and 224-246
568708003462	ABC-type polysaccharide/polyol phosphate transport system, ATPase component [Carbohydrate transport and metabolism / Cell envelope biogenesis, outer membrane]; Region: TagH; COG1134
568708003463	ATP-binding cassette component of polysaccharide transport system; Region: ABC_KpsT_Wzt; cd03220
568708003464	Walker A/P-loop; other site
568708003465	ATP binding site [chemical binding]; other site
568708003466	Q-loop/lid; other site
568708003467	ABC transporter signature motif; other site
568708003468	Walker B; other site
568708003469	D-loop; other site
568708003470	H-loop/switch region; other site
568708003472	Predicted glycosyltransferases [General function prediction only]; Region: COG1216
568708003473	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394
568708003474	active site
568708003476	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cd00761
568708003477	active site
568708003479	Predicted hydrolase (HAD superfamily) [General function prediction only]; Region: COG5610
568708003480	Haloacid dehalogenase-like hydrolase; Region: HAD_2; pfam13419
568708003481	endonuclease VIII; Provisional; Region: PRK10445
568708003482	N-terminal domain of Escherichia coli Nei/endonuclease VIII and related DNA glycosylases; Region: EcNei-like_N; cd08965
568708003483	DNA binding site [nucleotide binding]
568708003484	catalytic residue [active]
568708003485	putative catalytic residues [active]
568708003486	H2TH interface [polypeptide binding]; other site
568708003487	intercalation triad [nucleotide binding]; other site
568708003488	substrate specificity determining residue; other site
568708003489	Formamidopyrimidine-DNA glycosylase H2TH domain; Region: H2TH; pfam06831
568708003490	Zinc finger found in FPG and IleRS; Region: zf-FPG_IleRS; pfam06827
568708003494	Putative ammonia monooxygenase [General function prediction only]; Region: AbrB; COG3180
568708003495	membrane protein AbrB duplication; Region: Gneg_AbrB_dup; TIGR03082
568708003496	membrane protein AbrB duplication; Region: Gneg_AbrB_dup; TIGR03082
568708003498	6 probable transmembrane helices predicted for STM_MW07861 by TMHMM2.0 at aa 21-43, 53-75, 116-135, 145-167, 234-256 and 289-311
568708003499	Escherichia coli (Ec) citrate synthase (CS) GltA_like. CS catalyzes the condensation of acetyl coenzyme A (AcCoA) and oxalacetate (OAA) to form citrate and coenzyme A (CoA), the first step in the citric acid cycle (TCA or Krebs cycle). The overall CS...; Region: EcCS_like; cd06114
568708003500	Citrate synthase [Energy production and conversion]; Region: GltA; COG0372
568708003501	dimer interface [polypeptide binding]; other site
568708003502	active site
568708003503	citrylCoA binding site [chemical binding]; other site
568708003504	NADH binding [chemical binding]; other site
568708003505	cationic pore residues; other site
568708003506	oxalacetate/citrate binding site [chemical binding]; other site
568708003507	coenzyme A binding site [chemical binding]; other site
568708003508	catalytic triad [active]
568708003510	Succinate:quinone oxidoreductase (SQR) Type C subfamily, Succinate dehydrogenase C (SdhC) subunit; composed of bacterial SdhC and eukaryotic large cytochrome b binding (CybL) proteins. SQR catalyzes the oxidation of succinate to fumarate coupled to the...; Region: SQR_TypeC_SdhC; cd03499
568708003511	Iron-sulfur protein interface; other site
568708003512	proximal quinone binding site [chemical binding]; other site
568708003513	SdhD (CybS) interface [polypeptide binding]; other site
568708003514	proximal heme binding site [chemical binding]; other site
568708003516	3 probable transmembrane helices predicted for STM_MW07891 by TMHMM2.0 at aa 27-49, 69-88 and 109-128
568708003517	Succinate:quinone oxidoreductase (SQR) Type C subfamily, Succinate dehydrogenase D (SdhD) subunit; SQR catalyzes the oxidation of succinate to fumarate coupled to the reduction of quinone to quinol. E. coli SQR, a member of this subfamily, reduces the...; Region: SQR_TypeC_SdhD; cd03494
568708003518	SdhC subunit interface [polypeptide binding]; other site
568708003519	proximal heme binding site [chemical binding]; other site
568708003520	cardiolipin binding site; other site
568708003521	Iron-sulfur protein interface; other site
568708003522	proximal quinone binding site [chemical binding]; other site
568708003524	3 probable transmembrane helices predicted for STM_MW07901 by TMHMM2.0 at aa 16-38, 48-70 and 91-113
568708003525	succinate dehydrogenase flavoprotein subunit; Reviewed; Region: sdhA; PRK08958
568708003526	L-aspartate oxidase; Provisional; Region: PRK06175
568708003527	Fumarate reductase flavoprotein C-term; Region: Succ_DH_flav_C; pfam02910
568708003530	succinate dehydrogenase iron-sulfur subunit; Reviewed; Region: sdhB; PRK05950
568708003531	2Fe-2S iron-sulfur cluster binding domain; Region: Fer2_3; pfam13085
568708003532	2-oxoglutarate dehydrogenase E1 component; Reviewed; Region: sucA; PRK09404
568708003533	Thiamine pyrophosphate (TPP) family, E1 of OGDC-like subfamily, TPP-binding module; composed of proteins similar to the E1 component of the 2-oxoglutarate dehydrogenase multienzyme complex (OGDC). OGDC catalyzes the oxidative decarboxylation of...; Region: TPP_E1_OGDC_like; cd02016
568708003534	TPP-binding site [chemical binding]; other site
568708003535	Transketolase, pyrimidine binding domain; Region: Transket_pyr; pfam02779
568708003536	dimer interface [polypeptide binding]; other site
568708003537	PYR/PP interface [polypeptide binding]; other site
568708003538	TPP binding site [chemical binding]; other site
568708003541	dihydrolipoamide succinyltransferase; Validated; Region: PRK05704
568708003542	Lipoyl domain of the dihydrolipoyl acyltransferase component (E2) of 2-oxo acid dehydrogenases. 2-oxo acid dehydrogenase multienzyme complexes, like pyruvate dehydrogenase (PDH), 2-oxoglutarate dehydrogenase (OGDH) and branched-chain 2-oxo acid...; Region: lipoyl_domain; cd06849
568708003543	E3 interaction surface; other site
568708003544	lipoyl attachment site [posttranslational modification]; other site
568708003545	e3 binding domain; Region: E3_binding; pfam02817
568708003546	2-oxoacid dehydrogenases acyltransferase (catalytic domain); Region: 2-oxoacid_dh; pfam00198
568708003550	succinyl-CoA synthetase subunit beta; Provisional; Region: sucC; PRK00696
568708003551	ATP-grasp domain; Region: ATP-grasp_2; pfam08442
568708003552	CoA-ligase; Region: Ligase_CoA; pfam00549
568708003555	succinyl-CoA synthetase subunit alpha; Validated; Region: PRK05678
568708003556	CoA binding domain; Region: CoA_binding; smart00881
568708003557	CoA-ligase; Region: Ligase_CoA; pfam00549
568708003560	cytochrome d terminal oxidase subunit 1; Provisional; Region: PRK15097
568708003561	Bacterial Cytochrome Ubiquinol Oxidase; Region: Bac_Ubq_Cox; cl00562
568708003563	9 probable transmembrane helices predicted for STM_MW07971 by TMHMM2.0 at aa 20-42, 54-76, 96-118, 130-152, 184-206, 219-238, 387-409, 421-443 and 472-494
568708003564	cytochrome d ubiquinol oxidase subunit 2; Provisional; Region: PRK15003
568708003565	Cytochrome bd-type quinol oxidase, subunit 2 [Energy production and conversion]; Region: AppB; COG1294
568708003566	8 probable transmembrane helices predicted for STM_MW07981 by TMHMM2.0 at aa 7-24, 77-99, 122-144, 159-181, 202-224, 262-281, 293-315 and 335-357
568708003568	Predicted outer membrane lipoprotein [Function unknown]; Region: COG4890
568708003569	Signal peptide predicted for STM_MW07991 by SignalP 2.0 HMM (Signal peptide probability 0.985) with cleavage site probability 0.695 between residues 23 and 24
568708003571	1 probable transmembrane helix predicted for STM_MW07991 by TMHMM2.0 at aa 2-24
568708003572	hypothetical protein; Provisional; Region: PRK10588
568708003574	3 probable transmembrane helices predicted for STM_MW08001 by TMHMM2.0 at aa 13-32, 42-64 and 69-91
568708003575	4-hydroxybenzoyl-CoA thioesterase (4HBT). Catalyzes the final step in the 4-chlorobenzoate degradation pathway in which 4-chlorobenzoate is converted to 4-hydroxybenzoate in certain soil-dwelling bacteria. 4HBT forms a homotetramer with four active sites; Region: 4HBT; cd00586
568708003576	active site
568708003578	colicin uptake protein TolQ; Provisional; Region: PRK10801
568708003579	3 probable transmembrane helices predicted for STM_MW08021 by TMHMM2.0 at aa 15-37, 133-155 and 170-192
568708003581	Biopolymer transport protein [Intracellular trafficking and secretion]; Region: ExbD; COG0848
568708003582	colicin uptake protein TolR; Provisional; Region: PRK11024
568708003584	1 probable transmembrane helix predicted for STM_MW08031 by TMHMM2.0 at aa 17-39
568708003585	cell envelope integrity inner membrane protein TolA; Provisional; Region: tolA; PRK09510
568708003586	TolA C-terminal; Region: TolA; pfam06519
568708003587	1 probable transmembrane helix predicted for STM_MW08041 by TMHMM2.0 at aa 13-35
568708003589	translocation protein TolB; Provisional; Region: tolB; PRK03629
568708003590	TolB amino-terminal domain; Region: TolB_N; pfam04052
568708003591	WD40-like Beta Propeller Repeat; Region: PD40; pfam07676
568708003592	WD40-like Beta Propeller Repeat; Region: PD40; pfam07676
568708003593	WD40-like Beta Propeller Repeat; Region: PD40; pfam07676
568708003594	Signal peptide predicted for STM_MW08051 by SignalP 2.0 HMM (Signal peptide probability 0.995) with cleavage site probability 0.993 between residues 21 and 22
568708003597	peptidoglycan-associated outer membrane lipoprotein; Provisional; Region: PRK10802
568708003598	Peptidoglycan binding domains similar to the C-terminal domain of outer-membrane protein OmpA; Region: OmpA_C-like; cd07185
568708003599	ligand binding site [chemical binding]; other site
568708003600	Signal peptide predicted for STM_MW08061 by SignalP 2.0 HMM (Signal peptide probability 0.961) with cleavage site probability 0.451 between residues 26 and 27
568708003602	tol-pal system protein YbgF; Provisional; Region: PRK10803
568708003603	Tetratricopeptide repeat; Region: TPR_6; pfam13174
568708003604	Tetratricopeptide repeat; Region: TPR_6; pfam13174
568708003605	Signal peptide predicted for STM_MW08071 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.992 between residues 26 and 27
568708003606	quinolinate synthetase; Provisional; Region: PRK09375
568708003608	nicotinamide riboside transporter PnuC; Provisional; Region: PRK15397
568708003609	6 probable transmembrane helices predicted for STM_MW08091 by TMHMM2.0 at aa 20-42, 49-68, 72-89, 110-127, 158-177 and 184-206
568708003611	zinc transporter ZitB; Provisional; Region: PRK03557
568708003613	5 probable transmembrane helices predicted for STM_MW08101 by TMHMM2.0 at aa 21-43, 53-71, 84-106, 121-143 and 164-183
568708003614	YbgS-like protein; Region: YbgS; pfam13985
568708003615	Signal peptide predicted for STM_MW08111 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 24 and 25
568708003616	phospho-2-dehydro-3-deoxyheptonate aldolase; Validated; Region: PRK09261
568708003617	DAHP synthetase I family; Region: DAHP_synth_1; pfam00793
568708003619	Tartrate dehydratase beta subunit/Fumarate hydratase class I, C-terminal domain [Energy production and conversion]; Region: FumA; COG1838
568708003621	fumarate hydratase; Provisional; Region: PRK06246
568708003623	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708003624	Transcriptional regulator [Transcription]; Region: LysR; COG0583
568708003625	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
568708003626	dimerization interface [polypeptide binding]; other site
568708003629	cell density-dependent motility repressor; Provisional; Region: PRK10082
568708003630	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708003631	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
568708003632	dimerization interface [polypeptide binding]; other site
568708003635	Di- and tricarboxylate transporters [Inorganic ion transport and metabolism]; Region: CitT; COG0471
568708003636	Permease SLC13 (solute carrier 13).  The sodium/dicarboxylate cotransporter NaDC-1 has been shown to translocate Krebs cycle intermediates such as succinate, citrate, and alpha-ketoglutarate across plasma membranes rabbit, human, and rat kidney. It is...; Region: SLC13_permease; cd01115
568708003637	transmembrane helices; other site
568708003638	12 probable transmembrane helices predicted for STM_MW08171 by TMHMM2.0 at aa 2-19, 23-42, 54-76, 91-124, 137-159, 174-196, 221-240, 250-267, 272-294, 304-326, 360-379 and 399-421
568708003640	oxaloacetate decarboxylase subunit gamma; Provisional; Region: PRK02919
568708003642	1 probable transmembrane helix predicted for STM_MW08181 by TMHMM2.0 at aa 10-32
568708003643	oxaloacetate decarboxylase; Provisional; Region: PRK14040
568708003644	Pyruvate carboxylase and Transcarboxylase 5S, carboxyltransferase domain; Region: DRE_TIM_PC_TC_5S; cd07937
568708003645	active site
568708003646	catalytic residues [active]
568708003647	metal binding site [ion binding]; metal-binding site
568708003648	homodimer binding site [polypeptide binding]; other site
568708003649	The biotinyl-domain or biotin carboxyl carrier protein (BCCP) domain is present in all biotin-dependent enzymes, such as acetyl-CoA carboxylase, pyruvate carboxylase, propionyl-CoA carboxylase, methylcrotonyl-CoA carboxylase, geranyl-CoA carboxylase; Region: biotinyl_domain; cd06850
568708003650	carboxyltransferase (CT) interaction site; other site
568708003651	biotinylation site [posttranslational modification]; other site
568708003655	oxaloacetate decarboxylase subunit beta; Provisional; Region: PRK15476
568708003656	9 probable transmembrane helices predicted for STM_MW08201 by TMHMM2.0 at aa 13-35, 42-64, 125-147, 160-182, 214-236, 266-288, 308-327, 339-361 and 409-431
568708003658	Triphosphoribosyl-dephospho-CoA synthetase [Coenzyme metabolism]; Region: CitG; COG1767
568708003660	iron-hydroxamate transporter permease subunit; Provisional; Region: PRK10577
568708003661	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
568708003662	dimer interface [polypeptide binding]; other site
568708003663	putative PBP binding regions; other site
568708003664	ABC-ATPase subunit  interface; other site
568708003665	9 probable transmembrane helices predicted for STM_MW08221 by TMHMM2.0 at aa 30-49, 81-103, 115-137, 142-161, 174-196, 216-236, 268-290, 305-324 and 331-353
568708003667	ABC-type cobalamin/Fe3+-siderophores transport systems, ATPase components [Inorganic ion transport and metabolism / Coenzyme metabolism]; Region: FepC; COG1120
568708003668	ATP-binding component of iron-siderophores, vitamin B12 and hemin transporters and related proteins; Region: ABC_Iron-Siderophores_B12_Hemin; cd03214
568708003669	Walker A/P-loop; other site
568708003670	ATP binding site [chemical binding]; other site
568708003671	Q-loop/lid; other site
568708003672	ABC transporter signature motif; other site
568708003673	Walker B; other site
568708003674	D-loop; other site
568708003675	H-loop/switch region; other site
568708003677	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
568708003678	catalytic core [active]
568708003679	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
568708003681	galactose mutarotase_like; Region: galactose_mutarotase_like; cd09019
568708003682	active site
568708003683	catalytic residues [active]
568708003685	galactokinase; Provisional; Region: PRK05101
568708003686	Galactokinase galactose-binding signature; Region: GalKase_gal_bdg; pfam10509
568708003687	GHMP kinases N terminal domain; Region: GHMP_kinases_N; pfam00288
568708003688	GHMP kinases C terminal; Region: GHMP_kinases_C; pfam08544
568708003692	galactose-1-phosphate uridylyltransferase; Provisional; Region: PRK11720
568708003693	Galactose-1-phosphate uridyl transferase (GalT): This enzyme plays a key role in galactose metabolism by catalysing the transfer of a uridine 5'-phosphoryl group from UDP-galactose 1-phosphate. The structure of E.coli GalT reveals that the enzyme...; Region: GalT; cd00608
568708003694	dimer interface [polypeptide binding]; other site
568708003695	active site
568708003698	UDP-galactose-4-epimerase; Provisional; Region: PRK10675
568708003699	UDP-glucose 4 epimerase, subgroup 1, extended (e) SDRs; Region: UDP_G4E_1_SDR_e; cd05247
568708003700	NAD binding site [chemical binding]; other site
568708003701	homodimer interface [polypeptide binding]; other site
568708003702	active site
568708003703	substrate binding site [chemical binding]; other site
568708003705	Uncharacterized membrane-anchored protein conserved in bacteria [Function unknown]; Region: COG4714
568708003706	1 probable transmembrane helix predicted for STM_MW08291 by TMHMM2.0 at aa 271-293
568708003708	Signal peptide predicted for STM_MW08291 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 24 and 25
568708003709	putative molybdenum transport ATP-binding protein ModF; Provisional; Region: PRK10938
568708003710	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
568708003711	Walker A/P-loop; other site
568708003712	ATP binding site [chemical binding]; other site
568708003713	Q-loop/lid; other site
568708003714	ABC transporter signature motif; other site
568708003715	Walker B; other site
568708003716	D-loop; other site
568708003717	H-loop/switch region; other site
568708003718	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
568708003719	Walker A/P-loop; other site
568708003720	ATP binding site [chemical binding]; other site
568708003721	Q-loop/lid; other site
568708003722	ABC transporter signature motif; other site
568708003723	Walker B; other site
568708003724	D-loop; other site
568708003725	H-loop/switch region; other site
568708003727	DNA-binding transcriptional regulator ModE; Provisional; Region: PRK10676
568708003728	N-terminal domain of molybdenum-binding protein [General function prediction only]; Region: ModE; COG2005
568708003729	molybdenum-pterin binding domain; Region: Mop; TIGR00638
568708003730	TOBE domain; Region: TOBE; pfam03459
568708003733	Protein of unknown function (DUF2592); Region: DUF2592; pfam10766
568708003735	1 probable transmembrane helix predicted for STM_MW08321 by TMHMM2.0 at aa 42-64
568708003736	molybdate transporter periplasmic protein; Provisional; Region: modA; PRK10677
568708003737	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
568708003738	substrate binding pocket [chemical binding]; other site
568708003739	membrane-bound complex binding site; other site
568708003740	hinge residues; other site
568708003741	Signal peptide predicted for STM_MW08331 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 24 and 25
568708003743	ABC-type sulfate transport system, permease component [Posttranslational modification, protein turnover, chaperones]; Region: CysU; COG0555
568708003744	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708003745	dimer interface [polypeptide binding]; other site
568708003746	conserved gate region; other site
568708003747	putative PBP binding loops; other site
568708003748	ABC-ATPase subunit interface; other site
568708003749	5 probable transmembrane helices predicted for STM_MW08341 by TMHMM2.0 at aa 15-37, 49-71, 86-108, 136-158 and 197-219
568708003751	molybdate transporter ATP-binding protein; Provisional; Region: modC; PRK11144
568708003752	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
568708003753	Walker A/P-loop; other site
568708003754	ATP binding site [chemical binding]; other site
568708003755	Q-loop/lid; other site
568708003756	ABC transporter signature motif; other site
568708003757	Walker B; other site
568708003758	D-loop; other site
568708003759	H-loop/switch region; other site
568708003760	molybdenum-pterin binding domain; Region: Mop; TIGR00638
568708003763	pyridoxal phosphate (PLP) phosphatase; Provisional; Region: PRK10530
568708003764	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708003765	active site
568708003766	motif I; other site
568708003767	motif II; other site
568708003768	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708003770	6-phosphogluconolactonase; Provisional; Region: PRK11028
568708003772	acyl-CoA thioesterase; Provisional; Region: PRK10531
568708003773	putative pectinesterase; Region: PLN02432; cl01911
568708003775	Signal peptide predicted for STM_MW08381 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.861 between residues 23 and 24
568708003776	imidazolonepropionase; Validated; Region: PRK09356
568708003777	Imidazolonepropionase/imidazolone-5-propionate hydrolase (Imidazolone-5PH) catalyzes the third step in the histidine degradation pathway, the hydrolysis of (S)-3-(5-oxo-4,5-dihydro-3H-imidazol-4-yl)propanoate to N-formimidoyl-L-glutamate. In bacteria; Region: Imidazolone-5PH; cd01296
568708003778	active site
568708003780	Formimidoylglutamase or HutE; Region: Formimidoylglutamase; cd09988
568708003781	putative active site [active]
568708003782	putative metal binding site [ion binding]; other site
568708003784	histidine utilization repressor; Provisional; Region: PRK14999
568708003785	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
568708003786	DNA-binding site [nucleotide binding]; DNA binding site
568708003787	UTRA domain; Region: UTRA; pfam07702
568708003790	urocanate hydratase; Provisional; Region: PRK05414
568708003792	Phenylalanine ammonia-lyase (PAL) and histidine ammonia-lyase (HAL); Region: PAL-HAL; cd00332
568708003793	active sites [active]
568708003794	tetramer interface [polypeptide binding]; other site
568708003796	PhosphatidylEthanolamine-Binding Protein (PEBP) domain present in bacteria and archaea; Region: PEBP_bact_arch; cd00865
568708003797	substrate binding site [chemical binding]; other site
568708003799	adenosylmethionine--8-amino-7-oxononanoate transaminase; Validated; Region: PRK07986
568708003800	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
568708003801	inhibitor-cofactor binding pocket; inhibition site
568708003802	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708003803	catalytic residue [active]
568708003805	biotin synthase; Provisional; Region: PRK15108
568708003806	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
568708003807	FeS/SAM binding site; other site
568708003808	Biotin and Thiamin Synthesis associated domain; Region: BATS; smart00876
568708003811	pyridoxal phosphate-dependent acyltransferase, putative; Region: gly_Cac_T_rel; TIGR01825
568708003812	KBL_like; this family belongs to the pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD corresponds to serine palmitoyltransferase (SPT), 5-aminolevulinate synthase (ALAS); Region: KBL_like; cd06454
568708003813	substrate-cofactor binding pocket; other site
568708003814	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708003815	catalytic residue [active]
568708003817	biotin biosynthesis protein BioC; Region: BioC; TIGR02072
568708003818	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708003819	S-adenosylmethionine binding site [chemical binding]; other site
568708003821	AAA domain; Region: AAA_26; pfam13500
568708003822	dithiobiotin synthetase; Reviewed; Region: bioD; PRK00090
568708003824	excinuclease ABC subunit B; Provisional; Region: PRK05298
568708003825	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
568708003826	ATP binding site [chemical binding]; other site
568708003827	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
568708003828	nucleotide binding region [chemical binding]; other site
568708003829	ATP-binding site [chemical binding]; other site
568708003830	Ultra-violet resistance protein B; Region: UvrB; pfam12344
568708003831	UvrB/uvrC motif; Region: UVR; pfam02151
568708003835	E3 ubiquitin-protein ligase SlrP; Provisional; Region: PRK15370
568708003836	pathogenicity island 2 effector protein SseI; Provisional; Region: PRK15372
568708003837	Type III secretion system leucine rich repeat protein; Region: TTSSLRR; pfam12468
568708003838	Leucine-rich repeats (LRRs), ribonuclease inhibitor (RI)-like subfamily. LRRs are 20-29 residue sequence motifs present in many proteins that participate in protein-protein interactions and have different functions and cellular locations. LRRs correspond...; Region: LRR_RI; cl15309
568708003839	Leucine-rich repeats; other site
568708003840	Substrate binding site [chemical binding]; other site
568708003842	conserved hypothetical protein, cofD-related; Region: CofD_related; TIGR01826
568708003843	family of mostly uncharacterized proteins similar to B.subtilis YvcK; Region: YvcK_like; cd07187
568708003844	putative substrate binding pocket [chemical binding]; other site
568708003845	dimer interface [polypeptide binding]; other site
568708003846	phosphate binding site [ion binding]; other site
568708003848	molybdenum cofactor biosynthesis protein A; Reviewed; Region: moaA; PRK00164
568708003849	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
568708003850	FeS/SAM binding site; other site
568708003851	Molybdenum Cofactor Synthesis C; Region: Mob_synth_C; pfam06463
568708003854	MogA_MoaB family. Members of this family are involved in biosynthesis of the molybdenum cofactor (MoCF) an essential cofactor of a diverse group of redox enzymes. MoCF biosynthesis is an evolutionarily conserved pathway present in eubacteria, archaea; Region: MogA_MoaB; cd00886
568708003855	MPT binding site; other site
568708003856	trimer interface [polypeptide binding]; other site
568708003858	MoaC family, prokaryotic and eukaryotic. Members of this family are involved in molybdenum cofactor (Moco) biosynthesis, an essential cofactor of a diverse group of redox enzymes. MoaC, a small hexameric protein, converts, together with MoaA, a guanosine...; Region: MoaC_PE; cd01420
568708003859	trimer interface [polypeptide binding]; other site
568708003860	dimer interface [polypeptide binding]; other site
568708003861	putative active site [active]
568708003863	Ubiquitin domain of MoaD-like proteins; Region: MoaD; cd00754
568708003864	MoaE interaction surface [polypeptide binding]; other site
568708003865	MoeB interaction surface [polypeptide binding]; other site
568708003866	thiocarboxylated glycine; other site
568708003868	MoaE family. Members of this family are involved in biosynthesis of the molybdenum cofactor (Moco), an essential cofactor for a diverse group of redox enzymes. Moco biosynthesis is an evolutionarily conserved pathway present in eubacteria, archaea and...; Region: MoaE; cd00756
568708003869	MoaE homodimer interface [polypeptide binding]; other site
568708003870	MoaD interaction [polypeptide binding]; other site
568708003871	active site residues [active]
568708003873	Integral membrane protein, interacts with FtsH [General function prediction only]; Region: COG0670
568708003874	Bacterial BAX inhibitor (BI)-1/YccA-like proteins; Region: BI-1-like_bacterial; cd10432
568708003875	7 probable transmembrane helices predicted for STM_MW08591 by TMHMM2.0 at aa 20-42, 57-76, 88-107, 112-131, 138-160, 165-184 and 209-231
568708003877	Integral membrane protein, interacts with FtsH [General function prediction only]; Region: COG0670
568708003878	Bacterial BAX inhibitor (BI)-1/YccA-like proteins; Region: BI-1-like_bacterial; cd10432
568708003879	7 probable transmembrane helices predicted for STM_MW08601 by TMHMM2.0 at aa 21-43, 48-70, 77-99, 103-125, 132-154, 159-181 and 202-224
568708003880	4 probable transmembrane helices predicted for STM_MW08611 by TMHMM2.0 at aa 64-83, 93-115, 120-142 and 157-179
568708003881	4 probable transmembrane helices predicted for STM_MW08621 by TMHMM2.0 at aa 44-66, 81-103, 115-137 and 147-169
568708003882	Predicted integral membrane protein [Function unknown]; Region: COG0392
568708003883	8 probable transmembrane helices predicted for STM_MW08631 by TMHMM2.0 at aa 13-30, 50-72, 85-107, 127-149, 162-184, 204-226, 233-255 and 281-303
568708003885	Signal peptide predicted for STM_MW08631 by SignalP 2.0 HMM (Signal peptide probability 0.968) with cleavage site probability 0.923 between residues 31 and 32
568708003886	cardiolipin synthase 2; Provisional; Region: PRK11263
568708003887	Catalytic domain, repeat 1, of bacterial cardiolipin synthase and similar proteins; Region: PLDc_CLS_1; cd09110
568708003888	putative active site [active]
568708003889	catalytic site [active]
568708003890	Catalytic domain, repeat 2, of Escherichia coli cardiolipin synthase ybhO and similar proteins; Region: PLDc_ybhO_like_2; cd09159
568708003891	putative active site [active]
568708003892	catalytic site [active]
568708003894	Metal-dependent hydrolase [General function prediction only]; Region: ElsH; COG3568
568708003895	putative catalytic site [active]
568708003896	putative metal binding site [ion binding]; other site
568708003897	putative phosphate binding site [ion binding]; other site
568708003899	Putative inner membrane protein YbhQ; Region: YbhQ; pfam11076
568708003901	4 probable transmembrane helices predicted for STM_MW08661 by TMHMM2.0 at aa 13-32, 36-58, 79-96 and 100-119
568708003902	ABC-type multidrug transport system, permease component [Defense mechanisms]; Region: COG0842
568708003903	ABC-2 type transporter; Region: ABC2_membrane; pfam01061
568708003904	6 probable transmembrane helices predicted for STM_MW08671 by TMHMM2.0 at aa 24-46, 173-195, 223-245, 255-277, 284-303 and 338-360
568708003906	ABC-type multidrug transport system, permease component [Defense mechanisms]; Region: COG0842
568708003907	ABC-2 family transporter protein; Region: ABC2_membrane_2; pfam12679
568708003908	6 probable transmembrane helices predicted for STM_MW08681 by TMHMM2.0 at aa 26-48, 181-203, 230-252, 262-284, 291-313 and 347-369
568708003910	ABC-type multidrug transport system, ATPase component [Defense mechanisms]; Region: CcmA; COG1131
568708003911	ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230
568708003912	Walker A/P-loop; other site
568708003913	ATP binding site [chemical binding]; other site
568708003914	Q-loop/lid; other site
568708003915	ABC transporter signature motif; other site
568708003916	Walker B; other site
568708003917	D-loop; other site
568708003918	H-loop/switch region; other site
568708003919	ABC-type Na+ transport system, ATPase component [Energy production and conversion / Inorganic ion transport and metabolism]; Region: NatA; COG4555
568708003920	ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230
568708003921	Walker A/P-loop; other site
568708003922	ATP binding site [chemical binding]; other site
568708003923	Q-loop/lid; other site
568708003924	ABC transporter signature motif; other site
568708003925	Walker B; other site
568708003926	D-loop; other site
568708003927	H-loop/switch region; other site
568708003929	putative efflux pump membrane fusion protein; Provisional; Region: PRK03598
568708003930	Lipoyl domain of the dihydrolipoyl acyltransferase component (E2) of 2-oxo acid dehydrogenases. 2-oxo acid dehydrogenase multienzyme complexes, like pyruvate dehydrogenase (PDH), 2-oxoglutarate dehydrogenase (OGDH) and branched-chain 2-oxo acid...; Region: lipoyl_domain; cd06849
568708003931	HlyD family secretion protein; Region: HlyD_3; pfam13437
568708003933	1 probable transmembrane helix predicted for STM_MW08701 by TMHMM2.0 at aa 5-27
568708003934	Signal peptide predicted for STM_MW08701 by SignalP 2.0 HMM (Signal peptide probability 0.994) with cleavage site probability 0.948 between residues 19 and 20
568708003935	putative DNA-binding transcriptional regulator; Provisional; Region: PRK11552
568708003936	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
568708003937	Domain of unknown function (DUF1956); Region: DUF1956; pfam09209
568708003940	ATP-dependent RNA helicase RhlE; Provisional; Region: PRK10590
568708003941	DEAD-box helicases. A diverse family of proteins involved in ATP-dependent RNA unwinding, needed in a variety of cellular processes including splicing, ribosome biogenesis and RNA degradation. The name derives from the sequence of the Walker  B motif; Region: DEADc; cd00268
568708003942	ATP binding site [chemical binding]; other site
568708003943	Mg++ binding site [ion binding]; other site
568708003944	motif III; other site
568708003945	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
568708003946	nucleotide binding region [chemical binding]; other site
568708003947	ATP-binding site [chemical binding]; other site
568708003950	ATP-dependent DNA helicase DinG; Provisional; Region: dinG; PRK11747
568708003951	DEAD_2; Region: DEAD_2; pfam06733
568708003952	Helicase C-terminal domain; Region: Helicase_C_2; pfam13307
568708003955	glycosyl transferase family protein; Provisional; Region: PRK08136
568708003956	Glycosyl transferase family, helical bundle domain; Region: Glycos_trans_3N; pfam02885
568708003958	hypothetical protein; Provisional; Region: PRK10259
568708003960	Signal peptide predicted for STM_MW08751 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.997 between residues 22 and 23
568708003961	hypothetical protein; Provisional; Region: PRK11019
568708003963	23S rRNA mA1618 methyltransferase; Provisional; Region: PRK11727
568708003964	Protein of unknown function (DUF890); Region: Methyltransf_10; pfam05971
568708003966	putative mechanosensitive channel protein; Provisional; Region: PRK11465
568708003967	Mechanosensitive ion channel; Region: MS_channel; pfam00924
568708003968	11 probable transmembrane helices predicted for STM_MW08781 by TMHMM2.0 at aa 5-27, 136-158, 179-201, 216-238, 267-284, 294-313, 333-355, 370-392, 427-449, 464-486 and 507-529
568708003970	Signal peptide predicted for STM_MW08781 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.912 between residues 18 and 19
568708003971	glutamine ABC transporter ATP-binding protein; Reviewed; Region: glnQ; PRK09493
568708003972	ATP-binding cassette domain of the histidine and glutamine transporters; Region: ABC_HisP_GlnQ; cd03262
568708003973	Walker A/P-loop; other site
568708003974	ATP binding site [chemical binding]; other site
568708003975	Q-loop/lid; other site
568708003976	ABC transporter signature motif; other site
568708003977	Walker B; other site
568708003978	D-loop; other site
568708003979	H-loop/switch region; other site
568708003981	ABC-type arginine transport system, permease component [Amino acid transport and metabolism]; Region: ArtQ; COG4215
568708003982	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708003983	dimer interface [polypeptide binding]; other site
568708003984	conserved gate region; other site
568708003985	putative PBP binding loops; other site
568708003986	ABC-ATPase subunit interface; other site
568708003987	5 probable transmembrane helices predicted for STM_MW08801 by TMHMM2.0 at aa 20-42, 55-77, 92-114, 155-177 and 187-209
568708003989	glutamine ABC transporter periplasmic protein; Reviewed; Region: glnH; PRK09495
568708003990	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
568708003991	substrate binding pocket [chemical binding]; other site
568708003992	membrane-bound complex binding site; other site
568708003993	hinge residues; other site
568708003995	Signal peptide predicted for STM_MW08811 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 22 and 23
568708003996	DNA-binding ferritin-like protein (oxidative damage protectant) [Inorganic ion transport and metabolism]; Region: Dps; COG0783
568708003997	DPS protein, ferritin-like diiron-binding domain; Region: DPS; cd01043
568708003998	dimerization interface [polypeptide binding]; other site
568708003999	DPS ferroxidase diiron center [ion binding]; other site
568708004000	ion pore; other site
568708004002	threonine and homoserine efflux system; Provisional; Region: PRK10532
568708004003	EamA-like transporter family; Region: EamA; pfam00892
568708004004	10 probable transmembrane helices predicted for STM_MW08831 by TMHMM2.0 at aa 7-24, 37-59, 72-89, 93-115, 122-139, 143-165, 177-199, 203-225, 238-257 and 261-283
568708004006	Signal peptide predicted for STM_MW08831 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.891 between residues 31 and 32
568708004007	outer membrane protein X; Provisional; Region: ompX; PRK09408
568708004008	Signal peptide predicted for STM_MW08841 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 23 and 24
568708004010	1 probable transmembrane helix predicted for STM_MW08841 by TMHMM2.0 at aa 7-29
568708004011	pfam_scan;Pfam:PF00884; E()=1.9E-51;score=174.3;query 219-488;description=Sulfatase; tmhmm; query 1-526
568708004013	manganese transport regulator MntR; Provisional; Region: PRK11050
568708004014	Iron dependent repressor, N-terminal DNA binding domain; Region: Fe_dep_repress; pfam01325
568708004015	Iron dependent repressor, metal binding and dimerisation domain; Region: Fe_dep_repr_C; pfam02742
568708004018	Putative anion permease YbiR.  Based on sequence similarity, YbiR proteins are predicted to function as anion translocating permeases in eubacteria, archaea and plants. They belong to ArsB/NhaD superfamily of permeases that have been shown to translocate...; Region: YbiR_permease; cd01117
568708004019	transmembrane helices; other site
568708004020	Na+/H+ antiporter NhaD and related arsenite permeases [Inorganic ion transport and metabolism]; Region: ArsB; COG1055
568708004021	Signal peptide predicted for STM_MW08871 by SignalP 2.0 HMM (Signal peptide probability 0.971) with cleavage site probability 0.971 between residues 35 and 36
568708004022	9 probable transmembrane helices predicted for STM_MW08871 by TMHMM2.0 at aa 13-32, 42-64, 84-106, 165-187, 223-242, 246-268, 281-303, 313-335 and 347-369
568708004024	L,D-transpeptidase; Provisional; Region: PRK10260
568708004025	L,D-transpeptidase catalytic domain; Region: YkuD; pfam03734
568708004027	1 probable transmembrane helix predicted for STM_MW08881 by TMHMM2.0 at aa 7-29
568708004028	Signal peptide predicted for STM_MW08881 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.988 between residues 24 and 25
568708004029	ABC transporter ATP-binding protein; Provisional; Region: PRK15064
568708004030	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
568708004031	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
568708004032	Walker A/P-loop; other site
568708004033	ATP binding site [chemical binding]; other site
568708004034	ABC transporter signature motif; other site
568708004035	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
568708004036	Walker B; other site
568708004037	ABC transporter; Region: ABC_tran_2; pfam12848
568708004038	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
568708004040	Domain of unknown function (DUF4261); Region: DUF4261; pfam14080
568708004041	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708004043	Protein of unknown function (DUF1479); Region: DUF1479; pfam07350
568708004045	Cof subfamily of IIB subfamily of haloacid dehalogenase superfamily; Region: Cof-subfamily; TIGR00099
568708004046	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708004047	active site
568708004048	motif I; other site
568708004049	motif II; other site
568708004050	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708004052	glycyl radical enzyme, PFL2/glycerol dehydratase family; Region: PFL2-3; TIGR01774
568708004053	Pyruvate formate lyase 2 and related enzymes; Region: PFL2_DhaB_BssA; cd01677
568708004054	dimer interface [polypeptide binding]; other site
568708004055	active site
568708004056	glycine loop; other site
568708004059	glycyl-radical enzyme activating protein family; Region: PFLE_PFLC; TIGR02494
568708004060	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
568708004061	FeS/SAM binding site; other site
568708004063	molybdopterin biosynthesis protein MoeB; Provisional; Region: PRK05690
568708004064	ThiF_MoeB_HesA. Family of E1-like enzymes involved in molybdopterin and thiamine biosynthesis family. The common reaction mechanism catalyzed by MoeB and ThiF, like other E1 enzymes, begins with a nucleophilic attack of the C-terminal carboxylate of MoaD...; Region: ThiF_MoeB_HesA_family; cd00757
568708004065	ATP binding site [chemical binding]; other site
568708004066	substrate interface [chemical binding]; other site
568708004069	molybdopterin biosynthesis protein MoeA; Provisional; Region: PRK10680
568708004070	MoeA family. Members of this family are involved in biosynthesis of the molybdenum cofactor (MoCF), an essential cofactor of a diverse group of redox enzymes. MoCF biosynthesis is an evolutionarily conserved pathway present in eubacteria, archaea and...; Region: MoeA; cd00887
568708004071	dimer interface [polypeptide binding]; other site
568708004072	putative functional site; other site
568708004073	putative MPT binding site; other site
568708004077	L-Asparaginase type 2. L-Asparaginase hydrolyzes L-asparagine to L-aspartate and ammonia. The proenzyme undergoes an autoproteolytic cleavage into alpha and beta subunits to expose a threonine residue which becomes the N-terminal residue of the beta...; Region: Asparaginase_2; cd04701
568708004078	catalytic nucleophile [active]
568708004080	glutathione transporter ATP-binding protein; Provisional; Region: PRK10261
568708004081	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
568708004082	Walker A/P-loop; other site
568708004083	ATP binding site [chemical binding]; other site
568708004084	Q-loop/lid; other site
568708004085	ABC transporter signature motif; other site
568708004086	Walker B; other site
568708004087	D-loop; other site
568708004088	H-loop/switch region; other site
568708004089	Oligopeptide/dipeptide transporter, C-terminal region; Region: oligo_HPY; cl07097
568708004090	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
568708004091	Walker A/P-loop; other site
568708004092	ATP binding site [chemical binding]; other site
568708004093	Q-loop/lid; other site
568708004094	ABC transporter signature motif; other site
568708004095	Walker B; other site
568708004096	D-loop; other site
568708004097	H-loop/switch region; other site
568708004098	Oligopeptide/dipeptide transporter, C-terminal region; Region: oligo_HPY; pfam08352
568708004101	glutathione ABC transporter substrate-binding protein GsiB; Provisional; Region: PRK15413
568708004102	The substrate-binding component of an uncharacterized ABC-type peptide import system Ylib contains the type 2 periplasmic binding fold; Region: PBP2_Ylib_like; cd08499
568708004103	Signal peptide predicted for STM_MW09001 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.982 between residues 26 and 27
568708004105	glutathione ABC transporter permease GsiC; Provisional; Region: PRK15081
568708004106	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708004107	dimer interface [polypeptide binding]; other site
568708004108	conserved gate region; other site
568708004109	putative PBP binding loops; other site
568708004110	ABC-ATPase subunit interface; other site
568708004111	Signal peptide predicted for STM_MW09011 by SignalP 2.0 HMM (Signal peptide probability 0.619) with cleavage site probability 0.435 between residues 29 and 30
568708004112	6 probable transmembrane helices predicted for STM_MW09011 by TMHMM2.0 at aa 9-31, 101-123, 135-157, 172-189, 227-249 and 278-300
568708004114	glutathione ABC transporter permease GsiD; Provisional; Region: PRK15082
568708004115	N-terminal TM domain of oligopeptide transport permease C; Region: OppC_N; pfam12911
568708004116	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708004117	dimer interface [polypeptide binding]; other site
568708004118	conserved gate region; other site
568708004119	putative PBP binding loops; other site
568708004120	ABC-ATPase subunit interface; other site
568708004121	6 probable transmembrane helices predicted for STM_MW09021 by TMHMM2.0 at aa 39-61, 107-129, 136-158, 163-185, 209-231 and 266-288
568708004123	ribosomal protein S12 methylthiotransferase; Provisional; Region: rimO; PRK14862
568708004124	Uncharacterized protein family UPF0004; Region: UPF0004; pfam00919
568708004125	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
568708004126	FeS/SAM binding site; other site
568708004129	biofilm formation regulatory protein BssR; Reviewed; Region: bssR; PRK12302
568708004131	Citrate lyase beta subunit [Carbohydrate transport and metabolism]; Region: CitE; COG2301
568708004133	The electron transfer flavoprotein (ETF) serves as a specific electron acceptor for various mitochondrial dehydrogenases. ETF transfers electrons to the main respiratory chain via ETF-ubiquinone oxidoreductase. ETF is an heterodimer that consists of an...; Region: ETF_beta; cd01714
568708004134	Ligand binding site [chemical binding]; other site
568708004135	Electron transfer flavoprotein domain; Region: ETF; pfam01012
568708004137	Electron transfer flavoprotein, alpha subunit [Energy production and conversion]; Region: FixB; COG2025
568708004138	The electron transfer flavoprotein (ETF) serves as a specific electron acceptor for various mitochondrial dehydrogenases. ETF transfers electrons to the main respiratory chain via ETF-ubiquinone oxidoreductase. ETF is an heterodimer that consists of an...; Region: ETF_alpha; cd01715
568708004139	Electron transfer flavoprotein FAD-binding domain; Region: ETF_alpha; pfam00766
568708004142	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
568708004143	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
568708004144	active site
568708004148	Dehydrogenases (flavoproteins) [Energy production and conversion]; Region: FixC; COG0644
568708004149	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
568708004150	Electron transfer flavoprotein-ubiquinone oxidoreductase; Region: ETF_QO; pfam05187
568708004151	Ferredoxin-like protein [Energy production and conversion]; Region: FixX; COG2440
568708004154	Transcriptional regulator [Transcription]; Region: LysR; COG0583
568708004155	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708004156	The C-terminal substrate binding domain of an uncharacterized LysR-type transcriptional regulator, contains the type 2 periplasmic binding fold; Region: PBP2_LTTR_like_1; cd08421
568708004157	putative dimerization interface [polypeptide binding]; other site
568708004160	H+/gluconate symporter and related permeases [Carbohydrate transport and metabolism / Amino acid transport and metabolism]; Region: GntT; COG2610
568708004162	3 probable transmembrane helices predicted for STM_MW09111 by TMHMM2.0 at aa 7-29, 53-75 and 96-118
568708004163	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3677
568708004164	InsA N-terminal domain; Region: Zn_Tnp_IS1; pfam03811
568708004165	InsA C-terminal domain; Region: HTH_Tnp_IS1; pfam12759
568708004166	Glucose / Sorbosone dehydrogenase; Region: GSDH; pfam07995
568708004167	dehydrogenase, PQQ-dependent, s-GDH family; Region: non_repeat_PQQ; TIGR03606
568708004170	Glutathione S-transferase [Posttranslational modification, protein turnover, chaperones]; Region: Gst; COG0625
568708004171	GST_N family, unknown subfamily 2; composed of uncharacterized bacterial proteins with similarity to GSTs. GSTs are cytosolic dimeric proteins involved in cellular detoxification by catalyzing the conjugation of glutathione (GSH) with a wide range of...; Region: GST_N_2; cd03047
568708004172	putative C-terminal domain interface [polypeptide binding]; other site
568708004173	putative GSH binding site (G-site) [chemical binding]; other site
568708004174	putative dimer interface [polypeptide binding]; other site
568708004175	C-terminal, alpha helical domain of an unknown subfamily 2 of Glutathione S-transferases; Region: GST_C_2; cd03180
568708004176	putative N-terminal domain interface [polypeptide binding]; other site
568708004177	putative dimer interface [polypeptide binding]; other site
568708004178	putative substrate binding pocket (H-site) [chemical binding]; other site
568708004181	D-alanyl-D-alanine carboxypeptidase fraction C; Provisional; Region: PRK10001
568708004182	Beta-lactamase enzyme family; Region: Beta-lactamase2; cl17872
568708004183	Penicillin-binding protein 5, C-terminal domain; Region: PBP5_C; pfam07943
568708004184	Signal peptide predicted for STM_MW09141 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 27 and 28
568708004187	DNA-binding transcriptional repressor DeoR; Provisional; Region: PRK10681
568708004188	DeoR-like helix-turn-helix domain; Region: HTH_DeoR; pfam08220
568708004189	DeoR C terminal sensor domain; Region: DeoRC; pfam00455
568708004192	Membrane-associated phospholipid phosphatase [Lipid metabolism]; Region: PgpB; COG0671
568708004193	PAP2_like proteins, BcrC_like subfamily. Several members of this family have been annotated as bacitracin transport permeases, as it was suspected that they form the permease component of an ABC transporter system. It was shown, however, that BcrC from...; Region: PAP2_BcrC_like; cd03385
568708004194	active site
568708004195	4 probable transmembrane helices predicted for STM_MW09161 by TMHMM2.0 at aa 26-48, 60-82, 126-148 and 155-177
568708004197	multidrug efflux system translocase MdfA; Provisional; Region: PRK15402
568708004198	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708004199	putative substrate translocation pore; other site
568708004200	12 probable transmembrane helices predicted for STM_MW09171 by TMHMM2.0 at aa 16-38, 53-72, 84-101, 111-130, 142-164, 169-188, 220-242, 257-279, 286-308, 313-335, 348-367 and 377-399
568708004202	Predicted hydrolases of the HAD superfamily [General function prediction only]; Region: Cof; COG0561
568708004203	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708004204	active site
568708004205	motif I; other site
568708004206	motif II; other site
568708004207	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708004209	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708004210	putative substrate translocation pore; other site
568708004211	Major Facilitator Superfamily; Region: MFS_1; pfam07690
568708004212	12 probable transmembrane helices predicted for STM_MW09191 by TMHMM2.0 at aa 13-35, 50-72, 79-101, 105-124, 145-164, 168-190, 211-233, 253-275, 282-301, 305-327, 340-362 and 367-389
568708004214	Signal peptide predicted for STM_MW09191 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.955 between residues 29 and 30
568708004215	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3226
568708004216	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
568708004217	Bacterial transcriptional repressor; Region: TetR_C_6; pfam13977
568708004219	putative transporter; Provisional; Region: PRK04972
568708004220	Predicted Permease Membrane Region; Region: Asp-Al_Ex; pfam06826
568708004221	TrkA-C domain; Region: TrkA_C; pfam02080
568708004222	TrkA-C domain; Region: TrkA_C; pfam02080
568708004223	AspT/YidE/YbjL antiporter duplication domain; Region: YidE_YbjL_dupl; TIGR01625
568708004224	9 probable transmembrane helices predicted for STM_MW09211 by TMHMM2.0 at aa 13-35, 64-86, 93-115, 159-181, 383-402, 406-428, 449-471, 476-498 and 535-557
568708004227	Putative inner membrane protein of Enterobacteriaceae; Region: YbjM; pfam11045
568708004228	Signal peptide predicted for STM_MW09221 by SignalP 2.0 HMM (Signal peptide probability 0.883) with cleavage site probability 0.349 between residues 36 and 37
568708004230	4 probable transmembrane helices predicted for STM_MW09221 by TMHMM2.0 at aa 7-29, 34-56, 61-83 and 93-115
568708004231	Glutaredoxin (GRX) family; composed of GRX, approximately 10 kDa in size, and proteins containing a GRX or GRX-like domain. GRX is a glutathione (GSH) dependent reductase, catalyzing the disulfide reduction of target proteins such as ribonucleotide...; Region: GRX_family; cd02066
568708004232	GSH binding site [chemical binding]; other site
568708004233	catalytic residues [active]
568708004235	Protein of unknown function (DUF1418); Region: DUF1418; pfam07214
568708004237	2 probable transmembrane helices predicted for STM_MW09241 by TMHMM2.0 at aa 13-35 and 45-67
568708004238	This family contains NADPH-dependent flavin reductase and oxygen-insensitive nitroreductase. These enzymes are homodimeric flavoproteins that contain one FMN per monomer as a cofactor. Flavin reductase catalyzes the reduction of flavin by using NADPH as...; Region: NfsA_FRP; cd02146
568708004239	dimer interface [polypeptide binding]; other site
568708004240	FMN binding site [chemical binding]; other site
568708004241	NADPH bind site [chemical binding]; other site
568708004243	ribosomal protein S6 modification protein; Provisional; Region: PRK10446
568708004244	RimK-like ATP-grasp domain; Region: RimK; pfam08443
568708004246	Putative bacterial sensory transduction regulator; Region: YbjN; pfam10722
568708004248	putrescine transporter subunit: periplasmic-binding component of ABC superfamily; Provisional; Region: PRK10682
568708004249	Bacterial extracellular solute-binding protein; Region: SBP_bac_1; cl17199
568708004250	Signal peptide predicted for STM_MW09281 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.946 between residues 26 and 27
568708004252	putrescine transporter ATP-binding subunit; Provisional; Region: potG; PRK11607
568708004253	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
568708004254	Walker A/P-loop; other site
568708004255	ATP binding site [chemical binding]; other site
568708004256	Q-loop/lid; other site
568708004257	ABC transporter signature motif; other site
568708004258	Walker B; other site
568708004259	D-loop; other site
568708004260	H-loop/switch region; other site
568708004261	TOBE domain; Region: TOBE_2; pfam08402
568708004264	ABC-type Fe3+ transport system, permease component [Inorganic ion transport and metabolism]; Region: ThiP; COG1178
568708004265	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708004266	dimer interface [polypeptide binding]; other site
568708004267	conserved gate region; other site
568708004268	putative PBP binding loops; other site
568708004269	ABC-ATPase subunit interface; other site
568708004270	6 probable transmembrane helices predicted for STM_MW09301 by TMHMM2.0 at aa 31-52, 100-122, 135-157, 185-207, 228-250 and 284-306
568708004272	ABC-type spermidine/putrescine transport system, permease component II [Amino acid transport and metabolism]; Region: PotC; COG1177
568708004273	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708004274	dimer interface [polypeptide binding]; other site
568708004275	conserved gate region; other site
568708004276	putative PBP binding loops; other site
568708004277	ABC-ATPase subunit interface; other site
568708004278	6 probable transmembrane helices predicted for STM_MW09311 by TMHMM2.0 at aa 13-35, 69-91, 104-126, 141-163, 184-206 and 242-264
568708004280	Protein of unknown function (DUF2593); Region: DUF2593; pfam10767
568708004281	4 probable transmembrane helices predicted for STM_MW09321 by TMHMM2.0 at aa 13-35, 60-82, 89-111 and 126-148
568708004283	23S rRNA (uracil-5-)-methyltransferase RumB; Region: meth_trns_rumB; TIGR02085
568708004284	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708004285	S-adenosylmethionine binding site [chemical binding]; other site
568708004287	PTS system ascorbate-specific transporter subunit IIC; Reviewed; Region: PRK12997
568708004288	11 probable transmembrane helices predicted for STM_MW09341 by TMHMM2.0 at aa 15-37, 44-66, 103-125, 132-154, 159-181, 233-255, 270-292, 330-352, 356-378, 385-407 and 422-444
568708004290	PTS_IIB_ascorbate: subunit IIB of enzyme II (EII) of the L-ascorbate-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS). In this system, EII is an L-ascorbate-specific permease with two cytoplasmic subunits (IIA and IIB) and a...; Region: PTS_IIB_ascorbate; cd05563
568708004291	active site
568708004292	P-loop; other site
568708004293	phosphorylation site [posttranslational modification]
568708004295	Arylsulfatase A and related enzymes [Inorganic ion transport and metabolism]; Region: AslA; COG3119
568708004296	Sulfatase; Region: Sulfatase; cl17466
568708004298	putative ABC transporter arginine-biding protein; Provisional; Region: PRK15007
568708004299	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
568708004300	substrate binding pocket [chemical binding]; other site
568708004301	membrane-bound complex binding site; other site
568708004302	hinge residues; other site
568708004304	Signal peptide predicted for STM_MW09371 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.987 between residues 19 and 20
568708004305	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708004306	dimer interface [polypeptide binding]; other site
568708004307	conserved gate region; other site
568708004308	putative PBP binding loops; other site
568708004309	ABC-ATPase subunit interface; other site
568708004310	5 probable transmembrane helices predicted for STM_MW09381 by TMHMM2.0 at aa 15-37, 46-68, 83-105, 155-174 and 189-211
568708004312	ABC-type arginine transport system, permease component [Amino acid transport and metabolism]; Region: ArtQ; COG4215
568708004313	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708004314	dimer interface [polypeptide binding]; other site
568708004315	conserved gate region; other site
568708004316	putative PBP binding loops; other site
568708004317	ABC-ATPase subunit interface; other site
568708004318	4 probable transmembrane helices predicted for STM_MW09391 by TMHMM2.0 at aa 10-32, 45-67, 101-118 and 201-223
568708004320	Signal peptide predicted for STM_MW09391 by SignalP 2.0 HMM (Signal peptide probability 0.978) with cleavage site probability 0.719 between residues 29 and 30
568708004321	putative ABC transporter arginine-biding protein; Provisional; Region: PRK15007
568708004322	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
568708004323	substrate binding pocket [chemical binding]; other site
568708004324	membrane-bound complex binding site; other site
568708004325	hinge residues; other site
568708004327	Signal peptide predicted for STM_MW09401 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.997 between residues 19 and 20
568708004328	arginine transporter ATP-binding subunit; Provisional; Region: artP; PRK11124
568708004329	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
568708004330	Walker A/P-loop; other site
568708004331	ATP binding site [chemical binding]; other site
568708004332	Q-loop/lid; other site
568708004333	ABC transporter signature motif; other site
568708004334	Walker B; other site
568708004335	D-loop; other site
568708004336	H-loop/switch region; other site
568708004338	putative lipoprotein; Provisional; Region: PRK10533
568708004339	Signal peptide predicted for STM_MW09421 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.788 between residues 27 and 28
568708004340	hypothetical protein; Provisional; Region: PRK02877
568708004342	N-acetyl-anhydromuramyl-L-alanine amidase [Cell envelope biogenesis, outer membrane]; Region: ampD; COG3023
568708004343	Peptidoglycan recognition proteins (PGRPs) are pattern recognition receptors that bind, and in certain cases, hydrolyze peptidoglycans (PGNs) of bacterial cell walls. PGRPs have been divided into three classes: short PGRPs (PGRP-S), that are small (20...; Region: PGRP; cd06583
568708004344	amidase catalytic site [active]
568708004345	Zn binding residues [ion binding]; other site
568708004346	substrate binding site [chemical binding]; other site
568708004347	Signal peptide predicted for STM_MW09441 by SignalP 2.0 HMM (Signal peptide probability 0.928) with cleavage site probability 0.563 between residues 20 and 21
568708004349	Nucleoside-diphosphate-sugar epimerases [Cell envelope biogenesis, outer membrane / Carbohydrate transport and metabolism]; Region: WcaG; COG0451
568708004350	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
568708004351	NAD(P) binding site [chemical binding]; other site
568708004352	active site
568708004354	Predicted nucleoside-diphosphate-sugar epimerases [Cell envelope biogenesis, outer membrane / Carbohydrate transport and metabolism]; Region: COG0702
568708004355	atypical (a) SDRs, subgroup 2; Region: SDR_a2; cd05245
568708004356	putative NAD(P) binding site [chemical binding]; other site
568708004357	putative active site [active]
568708004358	Protein of unknown function (DUF2867); Region: DUF2867; pfam11066
568708004361	Threonine aldolase [Amino acid transport and metabolism]; Region: GLY1; COG2008
568708004362	Low-specificity threonine aldolase (TA). This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I).  TA catalyzes the conversion of L-threonine or L-allo-threonine to glycine and acetaldehyde in a...; Region: TA_like; cd06502
568708004363	tetramer interface [polypeptide binding]; other site
568708004364	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708004365	catalytic residue [active]
568708004367	pyruvate dehydrogenase; Provisional; Region: PRK09124
568708004368	Pyrimidine (PYR) binding domain of POX; Region: TPP_PYR_POX; cd07039
568708004369	PYR/PP interface [polypeptide binding]; other site
568708004370	dimer interface [polypeptide binding]; other site
568708004371	tetramer interface [polypeptide binding]; other site
568708004372	TPP binding site [chemical binding]; other site
568708004373	Thiamine pyrophosphate enzyme, central domain; Region: TPP_enzyme_M; pfam00205
568708004374	Thiamine pyrophosphate (TPP) family, Pyruvate oxidase (POX) subfamily, TPP-binding module; composed of proteins similar to Lactobacillus plantarum POX, which plays a key role in controlling acetate production under aerobic conditions. POX decarboxylates...; Region: TPP_POX; cd02014
568708004375	TPP-binding site [chemical binding]; other site
568708004379	HCP oxidoreductase, NADH-dependent; Provisional; Region: PRK10684
568708004380	Iron-sulfur binding ferredoxin reductase (FNR) proteins combine the FAD and NAD(P) binding regions of FNR with an iron-sulfur binding cluster domain. Ferredoxin-NADP+ (oxido)reductase is an FAD-containing enzyme that catalyzes the reversible electron...; Region: FNR_iron_sulfur_binding_1; cd06215
568708004381	FAD binding pocket [chemical binding]; other site
568708004382	FAD binding motif [chemical binding]; other site
568708004383	phosphate binding motif [ion binding]; other site
568708004384	beta-alpha-beta structure motif; other site
568708004385	NAD binding pocket [chemical binding]; other site
568708004386	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
568708004387	catalytic loop [active]
568708004388	iron binding site [ion binding]; other site
568708004392	hybrid cluster protein; Provisional; Region: PRK05290
568708004393	The HCP family of iron-sulfur proteins includes hybrid cluster protein (HCP), acetyl-CoA synthase (ACS), and carbon monoxide dehydrogenase (CODH), all of which contain [Fe4-S4] metal clusters at their active sites. These proteins have a conserved...; Region: HCP_like; cl14655
568708004394	ACS interaction site; other site
568708004395	CODH interaction site; other site
568708004396	Hybrid cluster protein (HCP), formerly known as prismane, is thought to play a role in nitrogen metabolism but its specific function is unknown. HCP has three structural domains, an N-terminal alpha-helical domain, and two similar domains comprising a...; Region: HCP; cd01914
568708004397	hybrid metal cluster; other site
568708004399	Predicted membrane protein [Function unknown]; Region: COG2431
568708004400	6 probable transmembrane helices predicted for STM_MW09511 by TMHMM2.0 at aa 25-47, 75-97, 102-119, 131-153, 168-190 and 239-261
568708004402	Predicted ATP-dependent endonuclease of the OLD family [DNA replication, recombination, and repair]; Region: COG3593
568708004403	Protein of unknown function (DUF2813); Region: DUF2813; pfam11398
568708004404	TOPRIM_OLD: topoisomerase-primase (TOPRIM) nucleotidyl transferase/hydrolase domain of the type found in bacterial and archaeal nucleases of the OLD (overcome lysogenization defect) family.  The bacteriophage P2 OLD protein, which has DNase as well as...; Region: TOPRIM_OLD; cd01026
568708004405	putative active site [active]
568708004406	putative metal-binding site [ion binding]; other site
568708004408	Uncharacterized protein conserved in bacteria [Function unknown]; Region: VirK; COG2990
568708004410	macrolide transporter subunit MacA; Provisional; Region: PRK11578
568708004411	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
568708004412	HlyD family secretion protein; Region: HlyD_3; pfam13437
568708004413	Signal peptide predicted for STM_MW09541 by SignalP 2.0 HMM (Signal peptide probability 0.838) with cleavage site probability 0.809 between residues 25 and 26
568708004414	1 probable transmembrane helix predicted for STM_MW09541 by TMHMM2.0 at aa 13-30
568708004416	pfam_scan;Pfam:PF00005; E()=1.8E-44;score=151.8;query 34-202;description=ABC_tran; pfam_scan;Pfam:PF02687; E()=2.0E-28;score=98.5;query469-640;description=FtsX; tmhmm; query 1-648
568708004419	Cold-Shock Protein (CSP) contains an S1-like cold-shock domain (CSD) that is found in eukaryotes, prokaryotes, and archaea.  CSP's include the major cold-shock proteins CspA and CspB in bacteria and the eukaryotic gene regulatory factor Y-box...; Region: CSP_CDS; cd04458
568708004420	DNA-binding site [nucleotide binding]; DNA binding site
568708004421	RNA-binding motif; other site
568708004423	ATP-dependent Clp protease adaptor protein ClpS; Reviewed; Region: clpS; PRK00033
568708004425	ATP-dependent Clp protease ATP-binding subunit; Provisional; Region: clpA; PRK11034
568708004426	Clp amino terminal domain; Region: Clp_N; pfam02861
568708004427	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708004428	Walker A motif; other site
568708004429	ATP binding site [chemical binding]; other site
568708004430	Walker B motif; other site
568708004431	arginine finger; other site
568708004432	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708004433	Walker A motif; other site
568708004434	ATP binding site [chemical binding]; other site
568708004435	Walker B motif; other site
568708004436	C-terminal, D2-small domain, of ClpB protein; Region: ClpB_D2-small; pfam10431
568708004441	Transposase IS200 like; Region: Y1_Tnp; pfam01797
568708004443	Integrase core domain; Region: rve; pfam00665
568708004444	Integrase core domain; Region: rve_3; pfam13683
568708004446	Helix-turn-helix domain; Region: HTH_28; pfam13518
568708004447	Isochorismatase family; Region: Isochorismatase; pfam00857
568708004448	YcaC related amidohydrolases; E.coli YcaC is an homooctameric hydrolase with unknown specificity. Despite its weak sequence similarity, it is structurally related to other amidohydrolases and shares conserved active site residues with them; Region: YcaC_related; cd01012
568708004449	catalytic triad [active]
568708004450	dimer interface [polypeptide binding]; other site
568708004451	conserved cis-peptide bond; other site
568708004453	Pirin-related protein [General function prediction only]; Region: COG1741
568708004454	Pirin; Region: Pirin; pfam02678
568708004455	Pirin C-terminal cupin domain; Region: Pirin_C; pfam05726
568708004458	LysR family transcriptional regulator; Provisional; Region: PRK14997
568708004459	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708004460	The C-terminal substrate binding domain of an uncharacterized LysR-type transcriptional regulator CrgA-like, contains the type 2 periplasmic binding fold; Region: PBP2_CrgA_like_4; cd08473
568708004461	putative effector binding pocket; other site
568708004462	putative dimerization interface [polypeptide binding]; other site
568708004465	S1_IF1: Translation Initiation Factor IF1, S1-like RNA-binding domain. IF1 contains an S1-like RNA-binding domain, which is found in a wide variety of RNA-associated proteins. Translation initiation includes a number of interrelated steps preceding the...; Region: S1_IF1; cd04451
568708004466	rRNA binding site [nucleotide binding]; other site
568708004467	predicted 30S ribosome binding site; other site
568708004469	1 probable transmembrane helix predicted for STM_MW09661 by TMHMM2.0 at aa 29-51
568708004470	leucyl/phenylalanyl-tRNA--protein transferase; Reviewed; Region: aat; PRK00301
568708004472	cysteine/glutathione ABC transporter membrane/ATP-binding component; Reviewed; Region: PRK11160
568708004473	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
568708004474	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
568708004475	Walker A/P-loop; other site
568708004476	ATP binding site [chemical binding]; other site
568708004477	Q-loop/lid; other site
568708004478	ABC transporter signature motif; other site
568708004479	Walker B; other site
568708004480	D-loop; other site
568708004481	H-loop/switch region; other site
568708004483	6 probable transmembrane helices predicted for STM_MW09681 by TMHMM2.0 at aa 20-42, 47-69, 133-155, 160-182, 246-268 and 278-300
568708004485	Signal peptide predicted for STM_MW09681 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.650 between residues 49 and 50
568708004486	cysteine/glutathione ABC transporter membrane/ATP-binding component; Reviewed; Region: PRK11174
568708004487	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
568708004488	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
568708004489	Walker A/P-loop; other site
568708004490	ATP binding site [chemical binding]; other site
568708004491	Q-loop/lid; other site
568708004492	ABC transporter signature motif; other site
568708004493	Walker B; other site
568708004494	D-loop; other site
568708004495	H-loop/switch region; other site
568708004497	6 probable transmembrane helices predicted for STM_MW09691 by TMHMM2.0 at aa 24-46, 61-80, 137-159, 163-185, 245-267 and 282-304
568708004499	Signal peptide predicted for STM_MW09691 by SignalP 2.0 HMM (Signal peptide probability 0.618) with cleavage site probability 0.535 between residues 42 and 43
568708004500	thioredoxin reductase; Provisional; Region: PRK10262
568708004501	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
568708004502	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
568708004505	Signal peptide predicted for STM_MW09701 by SignalP 2.0 HMM (Signal peptide probability 0.987) with cleavage site probability 0.968 between residues 25 and 26
568708004506	leucine-responsive transcriptional regulator; Provisional; Region: PRK11169
568708004507	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
568708004508	putative DNA binding site [nucleotide binding]; other site
568708004509	putative Zn2+ binding site [ion binding]; other site
568708004510	AsnC family; Region: AsnC_trans_reg; pfam01037
568708004512	DNA translocase FtsK; Provisional; Region: PRK10263
568708004513	Domain of unknown function (DUF4117); Region: DUF4117; pfam13491
568708004514	DNA translocase FtsK; Provisional; Region: PRK10263
568708004515	FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580
568708004516	Ftsk gamma domain; Region: Ftsk_gamma; pfam09397
568708004517	5 probable transmembrane helices predicted for STM_MW09721 by TMHMM2.0 at aa 41-63, 94-116, 129-151, 156-177 and 184-206
568708004520	periplasmic chaperone LolA; Region: lolA; TIGR00547
568708004521	lipoprotein chaperone; Reviewed; Region: lolA; PRK00031
568708004522	Signal peptide predicted for STM_MW09731 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.994 between residues 22 and 23
568708004524	recombination factor protein RarA; Reviewed; Region: PRK13342
568708004525	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708004526	Walker A motif; other site
568708004527	ATP binding site [chemical binding]; other site
568708004528	Walker B motif; other site
568708004529	arginine finger; other site
568708004530	MgsA AAA+ ATPase C terminal; Region: MgsA_C; pfam12002
568708004532	seryl-tRNA synthetase; Provisional; Region: PRK05431
568708004533	Seryl-tRNA synthetase N-terminal domain; Region: Seryl_tRNA_N; pfam02403
568708004534	Seryl-tRNA synthetase (SerRS) class II core catalytic domain. SerRS is responsible for the attachment of serine to the 3' OH group of ribose of the appropriate tRNA. This domain It is primarily responsible for ATP-dependent formation of the enzyme...; Region: SerRS_core; cd00770
568708004535	dimer interface [polypeptide binding]; other site
568708004536	active site
568708004537	motif 1; other site
568708004538	motif 2; other site
568708004539	motif 3; other site
568708004542	anaerobic dimethyl sulfoxide reductase subunit A; Provisional; Region: PRK14990
568708004543	This CD (MopB_DmsA-EC) includes the DmsA enzyme of the dmsABC operon encoding the anaerobic dimethylsulfoxide reductase (DMSOR) of Escherichia coli and other related DMSOR-like enzymes. Unlike other DMSOR-like enzymes, this group has a  predicted...; Region: MopB_DmsA-EC; cd02770
568708004544	putative [Fe4-S4] binding site [ion binding]; other site
568708004545	putative molybdopterin cofactor binding site [chemical binding]; other site
568708004546	The MopB_CT_DmsA-EC CD includes the DmsA enzyme of the dmsABC operon encoding the anaerobic dimethylsulfoxide reductase (DMSOR) of Escherichia coli and other related DMSOR-like enzymes. Unlike other DMSOR-like enzymes, this group has a  predicted...; Region: MopB_CT_DmsA-EC; cd02794
568708004547	putative molybdopterin cofactor binding site; other site
568708004548	Signal peptide predicted for STM_MW09761 by SignalP 2.0 HMM (Signal peptide probability 0.961) with cleavage site probability 0.950 between residues 45 and 46
568708004552	DMSO reductase, iron-sulfur subunit; Region: DMSO_dmsB; TIGR02951
568708004553	4Fe-4S binding domain; Region: Fer4; pfam00037
568708004555	DMSO reductase anchor subunit (DmsC); Region: DmsC; pfam04976
568708004557	8 probable transmembrane helices predicted for STM_MW09781 by TMHMM2.0 at aa 10-32, 44-66, 88-107, 114-134, 149-171, 178-200, 227-246 and 253-275
568708004558	putative MFS family transporter protein; Provisional; Region: PRK03633
568708004559	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708004560	putative substrate translocation pore; other site
568708004561	Signal peptide predicted for STM_MW09791 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.629 between residues 23 and 24
568708004562	12 probable transmembrane helices predicted for STM_MW09791 by TMHMM2.0 at aa 7-29, 44-66, 73-95, 100-119, 131-150, 160-182, 204-226, 231-253, 265-284, 289-311, 320-342 and 352-369
568708004564	inner membrane transporter YjeM; Provisional; Region: PRK15238
568708004565	11 probable transmembrane helices predicted for STM_MW09801 by TMHMM2.0 at aa 10-29, 36-58, 127-146, 158-180, 195-217, 238-260, 287-309, 340-362, 377-399, 412-434 and 444-466
568708004567	pyruvate formate lyase-activating enzyme 1; Provisional; Region: pflA; PRK11145
568708004568	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
568708004569	FeS/SAM binding site; other site
568708004571	pathogenicity island 1 protein SopD2; Provisional; Region: PRK15380
568708004573	formate acetyltransferase 1; Region: pyr_form_ly_1; TIGR01255
568708004574	Pyruvate formate lyase 1; Region: PFL1; cd01678
568708004575	coenzyme A binding site [chemical binding]; other site
568708004576	active site
568708004577	catalytic residues [active]
568708004578	glycine loop; other site
568708004581	formate transporter; Provisional; Region: PRK10805
568708004582	6 probable transmembrane helices predicted for STM_MW09851 by TMHMM2.0 at aa 35-57, 77-99, 119-141, 161-183, 195-217 and 256-278
568708004584	uncharacterized domain; Region: TIGR00702
568708004585	YcaO-like family; Region: YcaO; pfam02624
568708004587	Predicted membrane protein [Function unknown]; Region: COG2323
568708004588	3 probable transmembrane helices predicted for STM_MW09871 by TMHMM2.0 at aa 15-37, 50-69 and 74-91
568708004590	Phosphoserine aminotransferase (PSAT) family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major group in this CD corresponds to phosphoserine aminotransferase (PSAT).  PSAT is active as...; Region: PSAT_like; cd00611
568708004591	homodimer interface [polypeptide binding]; other site
568708004592	substrate-cofactor binding pocket; other site
568708004593	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708004594	catalytic residue [active]
568708004596	3-phosphoshikimate 1-carboxyvinyltransferase; Provisional; Region: PRK02427
568708004597	Enol pyruvate transferases family includes EPSP synthases and UDP-N-acetylglucosamine enolpyruvyl transferase. Both enzymes catalyze the reaction of enolpyruvyl transfer; Region: EPT-like; cd01554
568708004598	hinge; other site
568708004599	active site
568708004601	Zn-dependent protease with chaperone function [Posttranslational modification, protein turnover, chaperones]; Region: HtpX; COG0501
568708004602	Signal peptide predicted for STM_MW09901 by SignalP 2.0 HMM (Signal peptide probability 0.993) with cleavage site probability 0.678 between residues 18 and 19
568708004604	cytidylate kinase; Provisional; Region: cmk; PRK00023
568708004605	Cytidine monophosphate kinase (CMPK) catalyzes the reversible phosphorylation of cytidine monophosphate (CMP) to produce cytidine diphosphate (CDP), using ATP as the preferred phosphoryl donor; Region: CMPK; cd02020
568708004606	CMP-binding site; other site
568708004607	The sites determining sugar specificity; other site
568708004609	30S ribosomal protein S1; Reviewed; Region: rpsA; PRK06299
568708004610	S1_RPS1_repeat_ec2_hs2: Ribosomal protein S1 (RPS1) domain. RPS1 is a component of the small ribosomal subunit thought to be involved in the recognition and binding of mRNA's during translation initiation. The bacterial RPS1 domain architecture...; Region: S1_RPS1_repeat_ec2_hs2; cd04465
568708004611	RNA binding site [nucleotide binding]; other site
568708004612	S1_RPS1_repeat_ec3: Ribosomal protein S1 (RPS1) domain. RPS1 is a component of the small ribosomal subunit thought to be involved in the recognition and binding of mRNA's during translation initiation. The bacterial RPS1 domain architecture consists...; Region: S1_RPS1_repeat_ec3; cd05688
568708004613	RNA binding site [nucleotide binding]; other site
568708004614	S1_RPS1_repeat_ec4: Ribosomal protein S1 (RPS1) domain. RPS1 is a component of the small ribosomal subunit thought to be involved in the recognition and binding of mRNA's during translation initiation. The bacterial RPS1 domain architecture consists...; Region: S1_RPS1_repeat_ec4; cd05689
568708004615	RNA binding site [nucleotide binding]; other site
568708004616	S1_RPS1_repeat_ec5: Ribosomal protein S1 (RPS1) domain. RPS1 is a component of the small ribosomal subunit thought to be involved in the recognition and binding of mRNA's during translation initiation. The bacterial RPS1 domain architecture consists...; Region: S1_RPS1_repeat_ec5; cd05690
568708004617	RNA binding site [nucleotide binding]; other site
568708004618	S1_RPS1_repeat_ec6: Ribosomal protein S1 (RPS1) domain. RPS1 is a component of the small ribosomal subunit thought to be involved in the recognition and binding of mRNA's during translation initiation. The bacterial RPS1 domain architecture consists...; Region: S1_RPS1_repeat_ec6; cd05691
568708004619	RNA binding site [nucleotide binding]; other site
568708004621	Integration host factor (IHF) and HU are small heterodimeric members of the DNABII protein family that bind and bend DNA, functioning as architectural factors in many cellular processes including transcription, site-specific recombination, and...; Region: HU_IHF; cd00591
568708004622	IHF dimer interface [polypeptide binding]; other site
568708004623	IHF - DNA interface [nucleotide binding]; other site
568708004625	ComEC family competence protein; Provisional; Region: PRK11539
568708004626	Domain of unknown function (DUF4131); Region: DUF4131; pfam13567
568708004627	Competence protein; Region: Competence; pfam03772
568708004628	Metallo-beta-lactamase superfamily; Region: Lactamase_B; pfam00753
568708004629	11 probable transmembrane helices predicted for STM_MW09941 by TMHMM2.0 at aa 5-22, 26-43, 50-69, 224-246, 259-281, 301-323, 328-346, 361-383, 390-412, 427-449 and 469-491
568708004632	lipid transporter ATP-binding/permease protein; Provisional; Region: PRK11176
568708004633	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
568708004634	ATP-binding cassette domain of the bacterial lipid flippase and related proteins, subfamily C; Region: ABCC_MsbA; cd03251
568708004635	Walker A/P-loop; other site
568708004636	ATP binding site [chemical binding]; other site
568708004637	Q-loop/lid; other site
568708004638	ABC transporter signature motif; other site
568708004639	Walker B; other site
568708004640	D-loop; other site
568708004641	H-loop/switch region; other site
568708004642	Signal peptide predicted for STM_MW09951 by SignalP 2.0 HMM (Signal peptide probability 0.612) with cleavage site probability 0.371 between residues 38 and 39
568708004643	5 probable transmembrane helices predicted for STM_MW09951 by TMHMM2.0 at aa 21-43, 63-94, 140-162, 167-186 and 245-267
568708004646	tetraacyldisaccharide 4'-kinase; Reviewed; Region: lpxK; PRK00652
568708004647	tetraacyldisaccharide 4'-kinase; Region: lpxK; TIGR00682
568708004648	1 probable transmembrane helix predicted for STM_MW09961 by TMHMM2.0 at aa 12-34
568708004650	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3214
568708004651	Protein of unknown function (DUF1006); Region: DUF1006; pfam06224
568708004653	hypothetical protein; Provisional; Region: PRK11827
568708004655	3-deoxy-manno-octulosonate cytidylyltransferase; Provisional; Region: PRK05450
568708004656	CMP-KDO synthetase catalyzes the activation of KDO which is an essential component of the lipopolysaccharide; Region: CMP-KDO-Synthetase; cd02517
568708004657	Ligand binding site; other site
568708004658	oligomer interface; other site
568708004660	hypothetical protein; Provisional; Region: PRK10593
568708004662	Uncharacterized conserved protein [Function unknown]; Region: COG1434
568708004663	YdcF-like. YdcF-like is a large family of mainly bacterial proteins, with a few members found in fungi, plants, and archaea. Escherichia coli YdcF has been shown to bind S-adenosyl-L-methionine (AdoMet), but a biochemical function has not been...; Region: YdcF-like; cd06259
568708004664	putative active site [active]
568708004666	2 probable transmembrane helices predicted for STM_MW10011 by TMHMM2.0 at aa 10-32 and 41-58
568708004667	Signal peptide predicted for STM_MW10011 by SignalP 2.0 HMM (Signal peptide probability 0.897) with cleavage site probability 0.626 between residues 28 and 29
568708004668	SAM-dependent methyltransferases [Secondary metabolites biosynthesis, transport, and catabolism / General function prediction only]; Region: SmtA; COG0500
568708004669	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708004670	S-adenosylmethionine binding site [chemical binding]; other site
568708004672	condesin subunit F; Provisional; Region: PRK05260
568708004674	condesin subunit E; Provisional; Region: PRK05256
568708004676	Uncharacterized protein involved in chromosome partitioning [Cell division and chromosome partitioning]; Region: MukB; COG3096
568708004677	P-loop containing region of AAA domain; Region: AAA_29; cl17516
568708004678	Putative exonuclease SbcCD, C subunit; Region: SbcCD_C; pfam13558
568708004680	murein L,D-transpeptidase; Provisional; Region: PRK10594
568708004681	Putative peptidoglycan binding domain; Region: PG_binding_1; pfam01471
568708004682	L,D-transpeptidase catalytic domain; Region: YkuD; pfam03734
568708004683	L,D-transpeptidase catalytic domain; Region: YkuD; pfam03734
568708004684	Signal peptide predicted for STM_MW10061 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.991 between residues 30 and 31
568708004687	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3108
568708004688	Peptidase M15; Region: Peptidase_M15_3; cl01194
568708004689	Signal peptide predicted for STM_MW10071 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 30 and 31
568708004690	1 probable transmembrane helix predicted for STM_MW10071 by TMHMM2.0 at aa 12-34
568708004692	Zn-dependent hydrolases, including glyoxylases [General function prediction only]; Region: GloB; COG0491
568708004694	aromatic amino acid aminotransferase; Provisional; Region: PRK09257
568708004695	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
568708004696	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708004697	homodimer interface [polypeptide binding]; other site
568708004698	catalytic residue [active]
568708004700	Outer membrane protein (porin) [Cell envelope biogenesis, outer membrane]; Region: OmpC; COG3203
568708004701	Porins form aqueous channels for the diffusion of small hydrophillic molecules across the outer membrane. Individual 16-strand anti-parallel beta-barrels form a central pore, and trimerizes thru mainly hydrophobic interactions at the interface. Trimers...; Region: gram_neg_porins; cd00342
568708004702	trimer interface [polypeptide binding]; other site
568708004703	eyelet of channel; other site
568708004705	Signal peptide predicted for STM_MW10101 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 22 and 23
568708004706	asparaginyl-tRNA synthetase; Validated; Region: asnC; PRK03932
568708004707	EcAsnRS_like_N: N-terminal, anticodon recognition domain of the type found in Escherichia coli asparaginyl-tRNA synthetase (AsnRS) and, in Arabidopsis thaliana and Saccharomyces cerevisiae mitochondrial (mt) AsnRS. This domain is a beta-barrel domain (OB...; Region: EcAsnRS_like_N; cd04318
568708004708	putative dimer interface [polypeptide binding]; other site
568708004709	putative anticodon binding site; other site
568708004710	Asx tRNA synthetase (AspRS/AsnRS) class II core domain.  Assignment to class II aminoacyl-tRNA synthetases (aaRS) based upon its structure and the presence of three characteristic sequence motifs in the core domain. This family includes AsnRS as well as...; Region: AsxRS_core; cd00776
568708004711	homodimer interface [polypeptide binding]; other site
568708004712	motif 1; other site
568708004713	motif 2; other site
568708004714	active site
568708004715	motif 3; other site
568708004718	Transcriptional regulators [Transcription]; Region: Lrp; COG1522
568708004719	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
568708004720	putative DNA binding site [nucleotide binding]; other site
568708004721	putative Zn2+ binding site [ion binding]; other site
568708004722	AsnC family; Region: AsnC_trans_reg; pfam01037
568708004725	Threonine dehydratase [Amino acid transport and metabolism]; Region: IlvA; COG1171
568708004726	Tryptophan synthase beta superfamily (fold type II); this family of pyridoxal phosphate (PLP)-dependent enzymes catalyzes beta-replacement and beta-elimination reactions. This CD corresponds to aminocyclopropane-1-carboxylate deaminase (ACCD), tryptophan...; Region: Trp-synth-beta_II; cd00640
568708004727	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
568708004728	catalytic residue [active]
568708004730	Na+/alanine symporter [Amino acid transport and metabolism]; Region: AlsT; COG1115
568708004731	Sodium:alanine symporter family; Region: Na_Ala_symp; cl00548
568708004732	11 probable transmembrane helices predicted for STM_MW10141 by TMHMM2.0 at aa 13-35, 76-98, 103-125, 152-174, 189-211, 218-240, 250-272, 314-336, 356-378, 399-418 and 422-439
568708004734	nicotinate phosphoribosyltransferase; Region: NAPRTase; TIGR01514
568708004735	Nicotinate phosphoribosyltransferase (NAPRTase), related to PncB. Nicotinate phosphoribosyltransferase catalyses the formation of NAMN and PPi from 5-phosphoribosy -1-pyrophosphate (PRPP) and nicotinic acid, this is the first, and also rate limiting; Region: PncB_like; cd01401
568708004736	active site
568708004738	BTP2
568708004739	Domain of unknown function (DUF3596); Region: DUF3596; pfam12167
568708004740	Integrase [DNA replication, recombination, and repair]; Region: XerC; COG0582
568708004741	phiCTX phage and phage-related integrases, site-specific recombinases, DNA breaking-rejoining enzymes, C-terminal catalytic domain. This CD includes various phage and bacterial integrases, including those similar to phage integrases: Bordetella and...; Region: INT_phiCTX_C; cd01191
568708004742	Int/Topo IB signature motif; other site
568708004744	Putative excisionase (DUF1233); Region: DUF1233; pfam06806
568708004746	Protein of unknown function (DUF4060); Region: DUF4060; pfam13269
568708004747	RecT family; Region: RecT; pfam03837
568708004749	Enterobacterial exodeoxyribonuclease VIII; Region: Exonuc_VIII; pfam06630
568708004750	PDDEXK-like domain of unknown function (DUF3799); Region: DUF3799; pfam12684
568708004752	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
568708004753	non-specific DNA binding site [nucleotide binding]; other site
568708004754	salt bridge; other site
568708004755	sequence-specific DNA binding site [nucleotide binding]; other site
568708004757	Bacteriophage CII protein; Region: Phage_CII; pfam05269
568708004759	Bacteriophage replication protein O; Region: Phage_rep_O; pfam04492
568708004760	primosomal protein DnaI; Provisional; Region: PRK02854
568708004762	putative replication protein; Provisional; Region: PRK12377
568708004763	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708004764	Walker A motif; other site
568708004765	ATP binding site [chemical binding]; other site
568708004766	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cl17189
568708004768	Bacterial protein of unknown function (DUF977); Region: DUF977; pfam06163
568708004770	Ead/Ea22-like protein; Region: Ead_Ea22; pfam13935
568708004771	DinI-like family; Region: DinI; pfam06183
568708004773	Protein of unknown function (DUF1367); Region: DUF1367; pfam07105
568708004775	Bacteriophage Lambda NinG protein; Region: NinG; pfam05766
568708004777	Antitermination protein; Region: Antiterm; pfam03589
568708004778	Antitermination protein; Region: Antiterm; pfam03589
568708004781	Signal peptide predicted for STM_MW10371 by SignalP 2.0 HMM (Signal peptide probability 0.964) with cleavage site probability 0.767 between residues 31 and 32
568708004782	1 probable transmembrane helix predicted for STM_MW10371 by TMHMM2.0 at aa 9-31
568708004783	PipA protein; Region: PipA; pfam07108
568708004785	phage holin, lambda family; Region: holin_lambda; TIGR01594
568708004787	2 probable transmembrane helices predicted for STM_MW10392 by TMHMM2.0 at aa 20-37 and 50-72
568708004788	Endolysins and autolysins are found in viruses and bacteria, respectively. The ds DNA phages of eubacteria use endolysins or muralytic enzymes in conjunction with hollin, a small membrane protein, to degrade the peptidoglycan found in bacterial cell...; Region: endolysin_autolysin; cd00737
568708004789	catalytic residues [active]
568708004791	Bacteriophage lysis protein; Region: Phage_lysis; pfam03245
568708004792	Signal peptide predicted for STM_MW10401 by SignalP 2.0 HMM (Signal peptide probability 0.934) with cleavage site probability 0.701 between residues 24 and 25
568708004794	Protein of unknown function (DUF1441); Region: DUF1441; pfam07278
568708004796	Phage terminase, large subunit GpA [Replication, recombination and repair]; Region: COG5525
568708004797	Domain of unknown function (DUF1859); Region: DUF1859; pfam08948
568708004799	Bacteriophage capsid protein [General function prediction only]; Region: COG5511
568708004800	phage portal protein, lambda family; Region: portal_lambda; TIGR01539
568708004802	Protease subunit of ATP-dependent Clp proteases [Posttranslational modification, protein turnover, chaperones / Intracellular trafficking and secretion]; Region: ClpP; COG0740
568708004803	Caseinolytic protease (ClpP) is an ATP-dependent, highly conserved serine protease; Region: S14_ClpP_1; cd07016
568708004804	oligomer interface [polypeptide binding]; other site
568708004805	active site residues [active]
568708004806	Mu-like prophage major head subunit gpT; Region: Mu-like_gpT; cl01826
568708004809	Uncharacterized conserved protein [Function unknown]; Region: COG5471
568708004811	ATP-binding sugar transporter from pro-phage; Region: Gifsy-2; pfam13856
568708004812	Prophage minor tail protein Z (GPZ); Region: Minor_tail_Z; pfam06763
568708004814	Phage minor tail protein U; Region: Phage_tail_U; pfam06141
568708004816	Bacterial surface proteins containing Ig-like domains [Cell motility and secretion]; Region: COG5492
568708004818	phage minor tail protein G; Region: phage_lambda_G; TIGR01674
568708004820	Minor tail protein T; Region: Phage_tail_T; cl05636
568708004822	Phage-related minor tail protein [Function unknown]; Region: COG5281
568708004823	Prophage tail length tape measure protein; Region: TMP_2; pfam06791
568708004824	Lambda phage tail tape-measure protein (Tape_meas_lam_C); Region: Tape_meas_lam_C; pfam09718
568708004827	Phage-related protein [Function unknown]; Region: COG4718
568708004829	Outer membrane protein beta-barrel domain; Region: OMP_b-brl; cl17254
568708004830	Signal peptide predicted for STM_MW10541 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.997 between residues 22 and 23
568708004832	1 probable transmembrane helix predicted for STM_MW10541 by TMHMM2.0 at aa 4-25
568708004833	Cu/Zn superoxide dismutase [Inorganic ion transport and metabolism]; Region: SodC; COG2032
568708004834	Copper/zinc superoxide dismutase (SOD). superoxide dismutases catalyse the conversion of superoxide radicals to molecular oxygen. Three evolutionarily distinct families of SODs are known, of which the copper/zinc-binding family is one. Defects in the...; Region: Cu-Zn_Superoxide_Dismutase; cd00305
568708004835	E-class dimer interface [polypeptide binding]; other site
568708004836	P-class dimer interface [polypeptide binding]; other site
568708004837	active site
568708004838	Cu2+ binding site [ion binding]; other site
568708004839	Zn2+ binding site [ion binding]; other site
568708004841	Signal peptide predicted for STM_MW10551 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 20 and 21
568708004842	Phage-related protein [Function unknown]; Region: gp18; COG4672
568708004844	Mpr1p, Pad1p N-terminal (MPN) domains with catalytic isopeptidase activity (metal-binding) found in proteins also containing NlpC/P60 domains; Region: MPN_NLPC_P60; cd08073
568708004845	MPN+ (JAMM) motif; other site
568708004846	Zinc-binding site [ion binding]; other site
568708004847	Cell wall-associated hydrolases (invasion-associated proteins) [Cell envelope biogenesis, outer membrane]; Region: Spr; COG0791
568708004848	NlpC/P60 family; Region: NLPC_P60; cl17555
568708004850	Phage-related protein, tail component [Function unknown]; Region: COG4723
568708004852	1 probable transmembrane helix predicted for STM_MW10581 by TMHMM2.0 at aa 50-72
568708004853	Phage-related protein, tail component [Function unknown]; Region: COG4733
568708004854	Putative phage tail protein; Region: Phage-tail_3; pfam13550
568708004855	Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063
568708004856	Interdomain contacts; other site
568708004857	Cytokine receptor motif; other site
568708004858	Domain of unknown function (DUF1983); Region: DUF1983; pfam09327
568708004859	Fibronectin type III protein; Region: DUF3672; pfam12421
568708004862	Prophage tail fibre N-terminal; Region: phage_tail_N; pfam08400
568708004863	Phage tail fibre repeat; Region: Phage_fiber_2; pfam03406
568708004864	Phage Tail Collar Domain; Region: Collar; pfam07484
568708004868	Caudovirales tail fibre assembly protein; Region: Caudo_TAP; pfam02413
568708004873	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3316
568708004874	Transposase IS66 family; Region: DDE_Tnp_IS66; pfam03050
568708004875	Integrase core domain; Region: rve; pfam00665
568708004878	hypothetical protein; Provisional; Region: PRK09951
568708004880	DinI-like family; Region: DinI; cl11630
568708004882	aminopeptidase N; Provisional; Region: pepN; PRK14015
568708004883	Peptidase M1 family containing Aminopeptidase N; Region: M1_APN_1; cd09600
568708004884	active site
568708004885	Zn binding site [ion binding]; other site
568708004887	dihydroorotate dehydrogenase 2; Reviewed; Region: PRK05286
568708004888	Dihydroorotate dehydrogenase (DHOD) class 2. DHOD catalyzes the oxidation of (S)-dihydroorotate to orotate. This is the fourth step and the only redox reaction in the de novo biosynthesis of UMP, the precursor of all pyrimidine nucleotides. DHOD requires...; Region: DHOD_2_like; cd04738
568708004889	quinone interaction residues [chemical binding]; other site
568708004890	active site
568708004891	catalytic residues [active]
568708004892	FMN binding site [chemical binding]; other site
568708004893	substrate binding site [chemical binding]; other site
568708004895	Protein of unknown function (DUF1379); Region: DUF1379; pfam07126
568708004897	Uncharacterized Fe-S protein [General function prediction only]; Region: COG3217
568708004898	MOSC N-terminal beta barrel domain; Region: MOSC_N; pfam03476
568708004899	MOSC domain; Region: MOSC; pfam03473
568708004900	Ferredoxin [Energy production and conversion]; Region: Fdx; COG0633
568708004901	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
568708004902	catalytic loop [active]
568708004903	iron binding site [ion binding]; other site
568708004907	23S rRNA m(2)G2445 methyltransferase; Provisional; Region: rlmL; PRK11783
568708004908	THUMP domain associated with S-adenosylmethionine-dependent methyltransferases; Region: THUMP_AdoMetMT; cd11715
568708004909	Putative RNA methylase family UPF0020; Region: UPF0020; pfam01170
568708004910	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708004911	S-adenosylmethionine binding site [chemical binding]; other site
568708004915	ABC transporter ATPase component; Reviewed; Region: PRK11147
568708004916	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
568708004917	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
568708004918	Walker A/P-loop; other site
568708004919	Walker A/P-loop; other site
568708004920	ATP binding site [chemical binding]; other site
568708004921	ATP binding site [chemical binding]; other site
568708004922	Q-loop/lid; other site
568708004923	Q-loop/lid; other site
568708004924	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
568708004925	ABC transporter signature motif; other site
568708004926	Walker B; other site
568708004927	D-loop; other site
568708004928	ABC transporter; Region: ABC_tran_2; pfam12848
568708004929	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
568708004931	paraquat-inducible membrane protein A; Provisional; Region: PRK15103
568708004932	Paraquat-inducible protein A; Region: PqiA; pfam04403
568708004933	Paraquat-inducible protein A; Region: PqiA; pfam04403
568708004935	8 probable transmembrane helices predicted for STM_MW10761 by TMHMM2.0 at aa 54-76, 100-122, 135-157, 162-184, 255-277, 304-326, 350-372 and 377-399
568708004936	paraquat-inducible protein B; Provisional; Region: PRK10807
568708004937	mce related protein; Region: MCE; pfam02470
568708004938	mce related protein; Region: MCE; pfam02470
568708004939	mce related protein; Region: MCE; pfam02470
568708004940	1 probable transmembrane helix predicted for STM_MW10771 by TMHMM2.0 at aa 16-38
568708004942	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3009
568708004943	Protein of unknown function (DUF330); Region: DUF330; pfam03886
568708004944	Signal peptide predicted for STM_MW10781 by SignalP 2.0 HMM (Signal peptide probability 0.995) with cleavage site probability 0.634 between residues 19 and 20
568708004946	ribosome modulation factor; Provisional; Region: PRK14563
568708004948	FabA, beta-hydroxydecanoyl-acyl carrier protein (ACP)-dehydratase: Bacterial protein of the type II, fatty acid synthase system that binds ACP and catalyzes both dehydration and isomerization reactions, apparently in the same active site. The FabA...; Region: FabA; cd01287
568708004949	active site 1 [active]
568708004950	dimer interface [polypeptide binding]; other site
568708004951	active site 2 [active]
568708004953	Predicted ATP-dependent protease [Posttranslational modification, protein turnover, chaperones]; Region: LonB; COG1067
568708004954	Lon protease (S16) C-terminal proteolytic domain; Region: Lon_C; pfam05362
568708004956	Ter macrodomain organizer matS-binding protein; Provisional; Region: PRK05097
568708004958	outer membrane protein A; Reviewed; Region: PRK10808
568708004959	OmpA-like transmembrane domain; Region: OmpA_membrane; pfam01389
568708004960	Peptidoglycan binding domains similar to the C-terminal domain of outer-membrane protein OmpA; Region: OmpA_C-like; cd07185
568708004961	ligand binding site [chemical binding]; other site
568708004964	Signal peptide predicted for STM_MW10831 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.997 between residues 21 and 22
568708004965	cell division inhibitor SulA; Region: sula; TIGR00623
568708004967	Regulator of competence-specific genes [Transcription]; Region: TfoX; COG3070
568708004968	TfoX C-terminal domain; Region: TfoX_C; pfam04994
568708004971	TIGR01666 family membrane protein; Region: YCCS
568708004972	FUSC-like inner membrane protein yccS; Region: FUSC-like; pfam12805
568708004973	Fusaric acid resistance protein-like; Region: FUSC_2; pfam13515
568708004974	7 probable transmembrane helices predicted for STM_MW10861 by TMHMM2.0 at aa 13-35, 86-108, 115-137, 141-163, 438-460, 484-503 and 510-532
568708004976	Predicted membrane protein [Function unknown]; Region: COG3304
568708004977	Domain of unknown function (DUF307); Region: DUF307; pfam03733
568708004978	Domain of unknown function (DUF307); Region: DUF307; pfam03733
568708004980	3 probable transmembrane helices predicted for STM_MW10871 by TMHMM2.0 at aa 15-37, 77-99 and 104-126
568708004981	DNA helicase IV; Provisional; Region: helD; PRK11054
568708004982	DNA helicase IV / RNA helicase N terminal; Region: Nucleolin_N; pfam12462
568708004983	Part of AAA domain; Region: AAA_19; pfam13245
568708004984	Family description; Region: UvrD_C_2; pfam13538
568708004986	Methylglyoxal synthase catalyzes the enolization of dihydroxyacetone phosphate (DHAP) to produce methylglyoxal. The first part of the catalytic mechanism is believed to be similar to TIM (triosephosphate isomerase) in that both enzymes utilize DHAP to...; Region: MGS; cd01422
568708004987	active site
568708004988	dimer interfaces [polypeptide binding]; other site
568708004989	catalytic residues [active]
568708004991	hypothetical protein; Provisional; Region: PRK03641
568708004992	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3110
568708004994	Signal peptide predicted for STM_MW10901 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.996 between residues 20 and 21
568708004995	Predicted CoA-binding protein [General function prediction only]; Region: COG1832
568708004997	heat shock protein HspQ; Provisional; Region: PRK14129
568708004999	23S rRNA m(5)C1962 methyltransferase; Provisional; Region: PRK15128
568708005000	Putative RNA-binding Domain in PseudoUridine synthase and Archaeosine transglycosylase; Region: PUA; smart00359
568708005001	Middle domain of the SAM-dependent methyltransferase RlmI and related proteins; Region: RlmI_M_like; cd11572
568708005002	putative RNA binding site [nucleotide binding]; other site
568708005003	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708005004	S-adenosylmethionine binding site [chemical binding]; other site
568708005006	PhosphatidylEthanolamine-Binding Protein (PEBP) domain present in bacteria and archaea; Region: PEBP_bact_arch; cd00865
568708005007	substrate binding site [chemical binding]; other site
568708005008	Signal peptide predicted for STM_MW10941 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.602 between residues 21 and 22
568708005010	Cupin domain; Region: Cupin_2; cl17218
568708005011	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
568708005012	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708005014	acylphosphatase; Provisional; Region: PRK14426
568708005016	Dissimilatory sulfite reductase (desulfoviridin), gamma subunit [Inorganic ion transport and metabolism]; Region: DsrC; COG2920
568708005017	sulfur transfer protein TusE; Provisional; Region: PRK11508
568708005019	YccA-like proteins; Region: YccA_like; cd10433
568708005020	Integral membrane protein, interacts with FtsH [General function prediction only]; Region: COG0670
568708005022	6 probable transmembrane helices predicted for STM_MW10981 by TMHMM2.0 at aa 15-37, 49-71, 76-98, 105-127, 132-154 and 167-189
568708005023	PipA protein; Region: PipA; pfam07108
568708005025	secreted effector protein PipB; Provisional; Region: PRK15197
568708005026	Pentapeptide repeats (8 copies); Region: Pentapeptide; pfam00805
568708005027	Pentapeptide repeats (8 copies); Region: Pentapeptide; pfam00805
568708005028	Pentapeptide repeats (8 copies); Region: Pentapeptide; pfam00805
568708005030	type III secretion chaperone protein SigE; Provisional; Region: PRK15202
568708005032	inositol phosphate phosphatase SopB; Provisional; Region: PRK15378
568708005033	Enterobacterial virulence protein IpgD; Region: IpgD; pfam05925
568708005037	heavy metal sensor kinase; Region: cztS_silS_copS; TIGR01386
568708005038	HAMP domain; Region: HAMP; pfam00672
568708005039	dimerization interface [polypeptide binding]; other site
568708005040	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
568708005041	dimer interface [polypeptide binding]; other site
568708005042	phosphorylation site [posttranslational modification]
568708005043	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708005044	ATP binding site [chemical binding]; other site
568708005045	Mg2+ binding site [ion binding]; other site
568708005046	G-X-G motif; other site
568708005048	2 probable transmembrane helices predicted for STM_MW11051 by TMHMM2.0 at aa 10-32 and 162-181
568708005050	Signal peptide predicted for STM_MW11051 by SignalP 2.0 HMM (Signal peptide probability 0.964) with cleavage site probability 0.370 between residues 31 and 32
568708005051	transcriptional regulatory protein YedW; Provisional; Region: PRK11517
568708005052	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708005053	active site
568708005054	phosphorylation site [posttranslational modification]
568708005055	intermolecular recognition site; other site
568708005056	dimerization interface [polypeptide binding]; other site
568708005057	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
568708005058	DNA binding site [nucleotide binding]
568708005061	HIUase (5-hydroxyisourate hydrolase) catalyzes the second step in a three-step ureide pathway in which 5-hydroxyisourate (HIU), a product of the uricase (urate oxidase) reaction, is hydrolyzed to 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline (OHCU); Region: TLP_HIUase; cd05822
568708005062	active site
568708005063	homotetramer interface [polypeptide binding]; other site
568708005064	Signal peptide predicted for STM_MW11071 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.936 between residues 22 and 23
568708005065	1 probable transmembrane helix predicted for STM_MW11071 by TMHMM2.0 at aa 5-24
568708005067	4-hydroxyphenylacetate 3-monooxygenase reductase subunit; Provisional; Region: hpaC; PRK15486
568708005069	4-hydroxyphenylacetate 3-monooxygenase, oxygenase component; Region: HpaB-2; TIGR02310
568708005070	4-hydroxyphenylacetate 3-hydroxylase C terminal; Region: HpaB; pfam03241
568708005073	homoprotocatechuate degradation operon regulator, HpaR; Region: HpaR; TIGR02337
568708005074	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
568708005076	4-hydroxyphenylacetate degradation bifunctional isomerase/decarboxylase; Provisional; Region: PRK15203
568708005077	Fumarylacetoacetate (FAA) hydrolase family; Region: FAA_hydrolase; cl11421
568708005078	Fumarylacetoacetate (FAA) hydrolase family; Region: FAA_hydrolase; pfam01557
568708005080	5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase; Region: HpaE; TIGR02299
568708005081	Human aldehyde dehydrogenase family 8 member A1-like; Region: ALDH_F8_HMSADH; cd07093
568708005082	NAD binding site [chemical binding]; other site
568708005083	catalytic residues [active]
568708005085	The Class III extradiol dioxygenase, homoprotocatechuate 2,3-dioxygenase, catalyzes the key ring cleavage step in the metabolism of homoprotocatechuate; Region: HPCD; cd07370
568708005086	Catalytic LigB subunit of aromatic ring-opening dioxygenase; Region: LigB; pfam02900
568708005087	putative active site [active]
568708005088	putative metal binding site [ion binding]; other site
568708005090	5-carboxymethyl-2-hydroxymuconate isomerase (CHMI) is a trimeric enzyme catalyzing the isomerization of the unsaturated ketone 5-(carboxymethyl)-2-hydroxymuconate to 5-(carboxymethyl)-2-oxo-3-hexene-1,6-dionate. This is one step in the...; Region: CHMI; cd00580
568708005091	putative substrate binding pocket [chemical binding]; other site
568708005092	trimer interface [polypeptide binding]; other site
568708005094	2-oxo-hepta-3-ene-1,7-dioic acid hydratase; Region: HpaH; TIGR02312
568708005096	HpcH/HpaI aldolase/citrate lyase family; Region: HpcH_HpaI; cl17231
568708005098	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708005099	4-hydroxyphenylacetate permease; Region: HpaX; TIGR02332
568708005100	putative substrate translocation pore; other site
568708005101	12 probable transmembrane helices predicted for STM_MW11171 by TMHMM2.0 at aa 32-54, 69-88, 101-123, 133-155, 162-184, 194-216, 270-292, 305-327, 340-357, 361-383, 396-418 and 428-447
568708005103	4-hydroxyphenylacetate catabolism regulatory protein HpaA; Region: HpaA; TIGR02297
568708005104	Cupin domain; Region: Cupin_2; pfam07883
568708005105	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708005108	Metal-dependent hydrolases of the beta-lactamase superfamily III [General function prediction only]; Region: ElaC; COG1234
568708005110	anti-adapter protein IraM; Provisional; Region: PRK09919
568708005111	chaperone-modulator protein CbpM; Provisional; Region: PRK10265
568708005112	MerR HTH family regulatory protein; Region: MerR_2; pfam13591
568708005113	curved DNA-binding protein CbpA; Provisional; Region: PRK10266
568708005114	DnaJ domain or J-domain.  DnaJ/Hsp40 (heat shock protein 40) proteins are highly conserved and play crucial roles in protein translation, folding, unfolding, translocation, and degradation. They act primarily by stimulating the ATPase activity of Hsp70s; Region: DnaJ; cd06257
568708005115	HSP70 interaction site [polypeptide binding]; other site
568708005116	C-terminal substrate binding domain of DnaJ and HSP40; Region: DnaJ_C; cd10747
568708005117	substrate binding site [polypeptide binding]; other site
568708005118	dimer interface [polypeptide binding]; other site
568708005121	Signal peptide predicted for STM_MW11240 by SignalP 2.0 HMM (Signal peptide probability 0.928) with cleavage site probability 0.530 between residues 28 and 29
568708005122	2 probable transmembrane helices predicted for STM_MW11240 by TMHMM2.0 at aa 7-29 and 66-88
568708005123	Uncharacterized protein predicted to be involved in C-type cytochrome biogenesis [Posttranslational modification, protein turnover, chaperones / Energy production and conversion]; Region: COG4233
568708005124	Cytochrome c biogenesis protein [Posttranslational modification, protein turnover, chaperones]; Region: CcdA; COG0785
568708005125	Cytochrome C biogenesis protein transmembrane region; Region: DsbD; cl15788
568708005126	DsbD gamma family; DsbD gamma is the C-terminal periplasmic domain of the bacterial protein DsbD. It contains a CXXC motif in a TRX fold and shuttles the reducing potential from the membrane domain (DsbD beta) to the N-terminal periplasmic domain (DsbD...; Region: DsbDgamma; cd02953
568708005127	DsbD alpha interface [polypeptide binding]; other site
568708005128	catalytic residues [active]
568708005129	Signal peptide predicted for STM_MW11241 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.996 between residues 22 and 23
568708005130	6 probable transmembrane helices predicted for STM_MW11241 by TMHMM2.0 at aa 280-302, 323-345, 360-382, 409-431, 436-458 and 479-501
568708005133	conjugal transfer protein TrbB; Provisional; Region: PRK13728; cl17283
568708005134	DsbA family, Com1-like subfamily; composed of proteins similar to Com1, a 27-kDa outer membrane-associated immunoreactive protein originally found in both acute and chronic disease strains of the pathogenic bacteria Coxiella burnetti. It contains a CXXC...; Region: DsbA_Com1_like; cd03023
568708005135	DSBA-like thioredoxin domain; Region: DSBA; pfam01323
568708005136	catalytic residues [active]
568708005137	Signal peptide predicted for STM_MW11251 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.994 between residues 18 and 19
568708005139	TlpA-like family, suppressor for copper sensitivity D protein (ScsD) and actinobacterial DsbE homolog subfamily; composed of ScsD, the DsbE homolog of Mycobacterium tuberculosis (MtbDsbE) and similar proteins, all containing a redox-active CXXC motif; Region: TlpA_like_ScsD_MtbDsbE; cd03011
568708005140	Thioredoxin-like; Region: Thioredoxin_8; pfam13905
568708005141	catalytic residues [active]
568708005142	1 probable transmembrane helix predicted for STM_MW11261 by TMHMM2.0 at aa 12-29
568708005144	glucose-1-phosphatase/inositol phosphatase; Provisional; Region: PRK10173
568708005145	Histidine phosphatase domain found in histidine acid phosphatases and phytases; contains a His residue which is phosphorylated during the reaction; Region: HP_HAP_like; cd07061
568708005146	catalytic core [active]
568708005147	Histidine phosphatase domain found in histidine acid phosphatases and phytases; contains a His residue which is phosphorylated during the reaction; Region: HP_HAP_like; cd07061
568708005148	Signal peptide predicted for STM_MW11271 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 22 and 23
568708005150	hypothetical protein; Provisional; Region: PRK10174
568708005151	NAD(P)H:quinone oxidoreductase; Provisional; Region: PRK03767
568708005152	NADPH-dependent FMN reductase; Region: FMN_red; pfam03358
568708005154	General stress protein [General function prediction only]; Region: GsiB; COG3729
568708005156	HTH-type transcriptional regulator RutR; Provisional; Region: PRK15008
568708005157	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
568708005158	YcdC-like protein, C-terminal region; Region: TetR_C_3; pfam08362
568708005161	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3755
568708005163	Signal peptide predicted for STM_MW11321 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 19 and 20
568708005164	trifunctional transcriptional regulator/proline dehydrogenase/pyrroline-5-carboxylate dehydrogenase; Reviewed; Region: putA; PRK11809
568708005165	Predicted transcriptional regulator [Transcription]; Region: COG3905
568708005166	Proline dehydrogenase [Amino acid transport and metabolism]; Region: PutA; COG0506
568708005167	Delta(1)-pyrroline-5-carboxylate dehydrogenase, PutA; Region: ALDH_PutA-P5CDH; cd07125
568708005168	Glutamate binding site [chemical binding]; other site
568708005169	NAD binding site [chemical binding]; other site
568708005170	catalytic residues [active]
568708005173	Predicted symporter [General function prediction only]; Region: DhlC; COG4147
568708005174	Na(+)/proline cotransporter PutP and related proteins; solute binding domain; Region: SLC5sbd_PutP; cd11475
568708005175	Na binding site [ion binding]; other site
568708005176	12 probable transmembrane helices predicted for STM_MW11341 by TMHMM2.0 at aa 7-26, 66-88, 125-147, 162-184, 191-213, 233-255, 276-298, 313-335, 372-391, 401-423, 428-450 and 455-473
568708005178	Phosphate starvation-inducible protein PhoH, predicted ATPase [Signal transduction mechanisms]; Region: PhoH; COG1702
568708005179	hypothetical protein; Provisional; Region: PRK10536
568708005181	Transcriptional regulators [Transcription]; Region: RpiR; COG1737
568708005182	Helix-turn-helix domain, rpiR family; Region: HTH_6; pfam01418
568708005183	RpiR-like protein. RpiR contains a SIS (Sugar ISomerase) domain, which is found in many phosphosugar isomerases and phosphosugar binding proteins. In E. coli, rpiR negatively regulates the expression of rpiB gene. Both rpiB and rpiA are ribose phosphate...; Region: SIS_RpiR; cd05013
568708005184	putative active site [active]
568708005187	uncharacterized subgroup of the Na(+)/iodide (NIS) cotransporter subfamily; putative solute-binding domain; Region: SLC5sbd_NIS-like_u3; cd11495
568708005188	Na binding site [ion binding]; other site
568708005189	13 probable transmembrane helices predicted for STM_MW11371 by TMHMM2.0 at aa 6-28, 41-63, 78-100, 120-142, 157-179, 186-208, 228-247, 280-299, 314-336, 376-398, 403-425, 432-454 and 458-480
568708005191	Putative N-acetylmannosamine-6-phosphate epimerase [Carbohydrate transport and metabolism]; Region: NanE; COG3010
568708005192	N-acetylmannosamine-6-phosphate epimerase (NanE) converts N-acetylmannosamine-6-phosphate to N-acetylglucosamine-6-phosphate. This reaction is part of the pathway that allows the usage of sialic acid as a carbohydrate source. Sialic acids are a family of...; Region: NanE; cd04729
568708005193	putative active site cavity [active]
568708005195	N-acetylneuraminic acid mutarotase; Provisional; Region: PRK14131
568708005196	Galactose oxidase, central domain; Region: Kelch_3; pfam13415
568708005197	Signal peptide predicted for STM_MW11391 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.963 between residues 29 and 30
568708005198	1 probable transmembrane helix predicted for STM_MW11391 by TMHMM2.0 at aa 13-32
568708005200	Oligogalacturonate-specific porin protein (KdgM); Region: KdgM; pfam06178
568708005201	Signal peptide predicted for STM_MW11401 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 22 and 23
568708005203	putative sialic acid transporter; Provisional; Region: PRK12307
568708005204	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708005205	putative substrate translocation pore; other site
568708005206	12 probable transmembrane helices predicted for STM_MW11411 by TMHMM2.0 at aa 20-42, 57-76, 88-110, 114-136, 143-165, 169-188, 230-252, 267-286, 299-316, 321-343, 360-382 and 387-409
568708005208	Predicted dehydrogenases and related proteins [General function prediction only]; Region: MviM; COG0673
568708005209	Oxidoreductase family, NAD-binding Rossmann fold; Region: GFO_IDH_MocA; pfam01408
568708005210	Oxidoreductase family, C-terminal alpha/beta domain; Region: GFO_IDH_MocA_C; pfam02894
568708005213	bifunctional glyoxylate/hydroxypyruvate reductase A; Provisional; Region: ghrA; PRK15469
568708005214	Putative glycerate dehydrogenase and related proteins of the D-specific 2-hydroxy dehydrogenase family; Region: GDH_like_2; cd12164
568708005215	putative ligand binding site [chemical binding]; other site
568708005216	NAD binding site [chemical binding]; other site
568708005217	dimerization interface [polypeptide binding]; other site
568708005218	catalytic site [active]
568708005220	putative hydrolase; Validated; Region: PRK09248
568708005221	Polymerase and Histidinol Phosphatase domain of Ycdx like; Region: PHP_HisPPase_Ycdx_like; cd07437
568708005222	active site
568708005224	Uncharacterized component of anaerobic dehydrogenases [General function prediction only]; Region: TorD; COG3381
568708005226	Protein of unknown function (DUF1097); Region: DUF1097; pfam06496
568708005227	6 probable transmembrane helices predicted for STM_MW11461 by TMHMM2.0 at aa 12-31, 36-58, 65-84, 88-110, 115-134 and 144-166
568708005229	curli production assembly/transport protein CsgG; Provisional; Region: PRK15184
568708005231	curli assembly protein CsgF; Provisional; Region: PRK10050
568708005233	1 probable transmembrane helix predicted for STM_MW11481 by TMHMM2.0 at aa 7-26
568708005234	Signal peptide predicted for STM_MW11481 by SignalP 2.0 HMM (Signal peptide probability 0.996) with cleavage site probability 0.995 between residues 19 and 20
568708005235	curli assembly protein CsgE; Provisional; Region: PRK10386
568708005237	Signal peptide predicted for STM_MW11491 by SignalP 2.0 HMM (Signal peptide probability 0.903) with cleavage site probability 0.901 between residues 22 and 23
568708005238	DNA-binding transcriptional regulator CsgD; Provisional; Region: PRK10100
568708005239	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
568708005240	DNA binding residues [nucleotide binding]
568708005241	dimerization interface [polypeptide binding]; other site
568708005243	curlin minor subunit CsgB; Provisional; Region: csgB; PRK10101
568708005244	Curlin associated repeat; Region: Curlin_rpt; pfam07012
568708005245	Curlin associated repeat; Region: Curlin_rpt; pfam07012
568708005246	Signal peptide predicted for STM_MW11511 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.963 between residues 21 and 22
568708005248	major curlin subunit; Provisional; Region: csgA; PRK10051
568708005249	Curlin associated repeat; Region: Curlin_rpt; pfam07012
568708005250	Signal peptide predicted for STM_MW11521 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 20 and 21
568708005252	curli assembly protein CsgC; Provisional; Region: csgC; PRK10102
568708005254	P pilus assembly protein, pilin FimA [Cell motility and secretion / Intracellular trafficking and secretion]; Region: FimA; COG3539
568708005255	Signal peptide predicted for STM_MW11541 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.981 between residues 25 and 26
568708005256	1 probable transmembrane helix predicted for STM_MW11541 by TMHMM2.0 at aa 7-29
568708005257	Macro domain, Appr-1"-pase_like family. The macro domain is a high-affinity ADP-ribose binding module found in a variety of proteins as a stand-alone domain or in combination with other domains like in histone macroH2A and some PARPs (poly...; Region: Macro_Appr_pase_like; cd02908
568708005258	putative ADP-ribose binding site [chemical binding]; other site
568708005259	putative active site [active]
568708005261	Phosphatidylserine/phosphatidylglycerophosphate/car diolipin synthases and related enzymes [Lipid metabolism]; Region: Cls; COG1502
568708005262	Putative catalytic domain, repeat 1, of Escherichia coli uncharacterized protein ymdC and similar proteins; Region: PLDc_ymdC_like_1; cd09111
568708005263	putative active site [active]
568708005264	catalytic site [active]
568708005265	Putative catalytic domain, repeat 2, of Escherichia coli uncharacterized protein ymdC and similar proteins; Region: PLDc_ymdC_like_2; cd09113
568708005266	putative active site [active]
568708005267	catalytic site [active]
568708005268	glucans biosynthesis protein; Provisional; Region: opgC; PRK03854
568708005269	Acyltransferase family; Region: Acyl_transf_3; pfam01757
568708005271	10 probable transmembrane helices predicted for STM_MW11571 by TMHMM2.0 at aa 17-39, 54-76, 88-110, 138-160, 181-203, 213-232, 245-262, 277-299, 306-328 and 338-360
568708005272	glucan biosynthesis protein G; Provisional; Region: mdoG; PRK13274
568708005273	Periplasmic glucan biosynthesis protein, MdoG; Region: MdoG; pfam04349
568708005274	Signal peptide predicted for STM_MW11581 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.997 between residues 22 and 23
568708005276	Glycosyltransferase like family 2; Region: Glyco_tranf_2_3; pfam13641
568708005277	Glucan_BSP_ModH catalyzes the elongation of beta-1,2 polyglucose chains of glucan; Region: Glucan_BSP_ModH; cd04191
568708005278	Ligand binding site; other site
568708005279	DXD motif; other site
568708005280	6 probable transmembrane helices predicted for STM_MW11591 by TMHMM2.0 at aa 139-156, 194-216, 512-534, 568-590, 603-625 and 680-702
568708005282	lipoprotein; Provisional; Region: PRK10175
568708005284	secY/secA suppressor protein; Provisional; Region: PRK11467
568708005285	drug efflux system protein MdtG; Provisional; Region: PRK09874
568708005286	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708005287	putative substrate translocation pore; other site
568708005288	11 probable transmembrane helices predicted for STM_MW11621 by TMHMM2.0 at aa 15-37, 49-68, 83-101, 108-130, 140-162, 169-191, 222-244, 251-273, 288-306, 313-335 and 371-393
568708005290	Signal peptide predicted for STM_MW11621 by SignalP 2.0 HMM (Signal peptide probability 0.641) with cleavage site probability 0.479 between residues 29 and 30
568708005291	Bacterial lipid A biosynthesis acyltransferase; Region: Lip_A_acyltrans; pfam03279
568708005292	Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: LABLAT-like; Region: LPLAT_LABLAT-like; cd07984
568708005293	putative acyl-acceptor binding pocket; other site
568708005295	2 probable transmembrane helices predicted for STM_MW11631 by TMHMM2.0 at aa 20-42 and 123-145
568708005296	putative rhodanese-related sulfurtransferase; Provisional; Region: PRK00142
568708005297	Member of the Rhodanese Homology Domain superfamily. This CD includes Escherichia coli YceA, Bacillus subtilis YbfQ, and similar uncharacterized proteins; Region: RHOD_YceA; cd01518
568708005298	active site residue [active]
568708005300	hypothetical protein; Provisional; Region: PRK03757
568708005302	Signal peptide predicted for STM_MW11651 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 22 and 23
568708005303	Cytochrome B561 [Energy production and conversion]; Region: CybB; COG3038
568708005305	4 probable transmembrane helices predicted for STM_MW11661 by TMHMM2.0 at aa 13-35, 55-72, 92-114 and 147-169
568708005306	N-methyltryptophan oxidase; Provisional; Region: solA; PRK11259
568708005307	hydroxyglutarate oxidase; Provisional; Region: PRK11728
568708005309	biofilm formation regulatory protein BssS; Reviewed; Region: bssS; PRK12301
568708005310	DNA damage-inducible protein I; Provisional; Region: PRK10597
568708005312	Dihydroorotase (DHOase) catalyzes the reversible interconversion of carbamoyl aspartate to dihydroorotate, a key reaction in the pyrimidine biosynthesis. In contrast to the large polyfunctional CAD proteins of higher organisms, this group of DHOases is...; Region: DHOase; cd01294
568708005313	active site
568708005314	substrate binding pocket [chemical binding]; other site
568708005315	dimer interface [polypeptide binding]; other site
568708005316	lipoprotein; Provisional; Region: PRK10598
568708005318	Signal peptide predicted for STM_MW11721 by SignalP 2.0 HMM (Signal peptide probability 0.987) with cleavage site probability 0.483 between residues 18 and 19
568708005319	glutaredoxin 2; Provisional; Region: PRK10387
568708005320	GST_N family, Glutaredoxin 2 (GRX2) subfamily; composed of bacterial proteins similar to E. coli GRX2, an atypical GRX with a molecular mass of about 24kD, compared with other GRXs which are 9-12kD in size. GRX2 adopts a GST fold containing an N-terminal...; Region: GST_N_GRX2; cd03037
568708005321	C-terminal domain interface [polypeptide binding]; other site
568708005322	GSH binding site (G-site) [chemical binding]; other site
568708005323	catalytic residues [active]
568708005324	putative dimer interface [polypeptide binding]; other site
568708005325	C-terminal, alpha helical domain of Glutaredoxin 2; Region: GST_C_GRX2; cd03199
568708005326	N-terminal domain interface [polypeptide binding]; other site
568708005328	multidrug resistance protein MdtH; Provisional; Region: PRK11646
568708005329	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708005330	putative substrate translocation pore; other site
568708005331	10 probable transmembrane helices predicted for STM_MW11741 by TMHMM2.0 at aa 13-35, 99-116, 136-158, 163-185, 210-232, 247-264, 277-295, 300-322, 335-357 and 367-389
568708005333	ribosomal-protein-S5-alanine N-acetyltransferase; Provisional; Region: PRK10809
568708005334	Acetyltransferases, including N-acetylases of ribosomal proteins [Translation, ribosomal structure and biogenesis]; Region: RimL; COG1670
568708005336	hypothetical protein; Provisional; Region: PRK11239
568708005337	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3132
568708005339	Predicted dehydrogenases and related proteins [General function prediction only]; Region: MviM; COG0673
568708005340	Oxidoreductase family, NAD-binding Rossmann fold; Region: GFO_IDH_MocA; pfam01408
568708005341	Oxidoreductase family, C-terminal alpha/beta domain; Region: GFO_IDH_MocA_C; pfam02894
568708005344	Uncharacterized membrane protein, putative virulence factor [General function prediction only]; Region: MviN; COG0728
568708005345	MurJ/MviN, a subfamily of the multidrug and toxic compound extrusion (MATE)-like proteins; Region: MATE_MurJ_like; cd13123
568708005346	13 probable transmembrane helices predicted for STM_MW11781 by TMHMM2.0 at aa 39-58, 95-117, 143-165, 172-194, 199-221, 250-272, 287-309, 322-341, 361-383, 396-415, 420-442, 454-476 and 491-513
568708005348	flagella synthesis chaperone protein FlgN; Provisional; Region: PRK15459
568708005350	anti-sigma28 factor FlgM; Provisional; Region: PRK10810
568708005352	flagellar basal body P-ring biosynthesis protein FlgA; Reviewed; Region: flgA; PRK07018
568708005353	SAF domains of the flagella basal body P-ring formation protein FlgA and the flp pilus assembly CpaB; Region: SAF_CpaB_FlgA_like; cd11614
568708005354	Domains similar to fish antifreeze type III protein; Region: SAF; cl00555
568708005356	Signal peptide predicted for STM_MW11811 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 21 and 22
568708005357	flagellar basal body rod protein FlgB; Reviewed; Region: flgB; PRK05680
568708005358	flagellar basal body rod protein FlgB; Reviewed; Region: flgB; PRK07182
568708005360	flagellar basal body rod protein FlgC; Reviewed; Region: flgC; PRK05681
568708005361	Flagella basal body rod protein; Region: Flg_bb_rod; pfam00460
568708005362	Flagellar basal body rod FlgEFG protein C-terminal; Region: Flg_bbr_C; pfam06429
568708005365	Flagellar hook capping protein [Cell motility and secretion]; Region: FlgD; COG1843
568708005366	Flagellar hook capping protein - N-terminal region; Region: FlgD; pfam03963
568708005367	FlgD Tudor-like domain; Region: FLgD_tudor; pfam13861
568708005369	flagellar hook protein FlgE; Validated; Region: flgE; PRK05682
568708005370	Flagella basal body rod protein; Region: Flg_bb_rod; pfam00460
568708005371	Flagellar basal body protein FlaE; Region: FlaE; pfam07559
568708005372	Flagellar basal body rod FlgEFG protein C-terminal; Region: Flg_bbr_C; pfam06429
568708005376	Flagellar basal body rod protein [Cell motility and secretion]; Region: FlgF; COG4787
568708005377	Flagella basal body rod protein; Region: Flg_bb_rod; pfam00460
568708005378	flagellar basal-body rod protein FlgF; Region: flgF; TIGR02490
568708005381	flagellar basal body rod protein FlgG; Provisional; Region: flgG; PRK12693
568708005382	Flagella basal body rod protein; Region: Flg_bb_rod; pfam00460
568708005383	Flagellar basal body rod FlgEFG protein C-terminal; Region: Flg_bbr_C; pfam06429
568708005386	Flagellar basal body L-ring protein [Cell motility and secretion]; Region: FlgH; COG2063
568708005387	flagellar basal body L-ring protein; Reviewed; Region: flgH; PRK00249
568708005388	1 probable transmembrane helix predicted for STM_MW11881 by TMHMM2.0 at aa 5-27
568708005390	flagellar basal body P-ring protein; Provisional; Region: flgI; PRK05303
568708005391	flagellar basal body P-ring protein; Reviewed; Region: flgI; cl14622
568708005392	Signal peptide predicted for STM_MW11891 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.996 between residues 19 and 20
568708005394	flagellar rod assembly protein/muramidase FlgJ; Validated; Region: flgJ; PRK05684
568708005395	Rod binding protein [Cell envelope biogenesis, outer membrane / Cell motility and secretion / Posttranslational modification, protein turnover, chaperones]; Region: COG3951
568708005396	Muramidase (flagellum-specific) [Cell motility and secretion / Intracellular trafficking and secretion]; Region: FlgJ; COG1705
568708005399	flagellar hook-associated protein FlgK; Validated; Region: flgK; PRK08147
568708005400	Flagellar basal body rod FlgEFG protein C-terminal; Region: Flg_bbr_C; cl15855
568708005403	flagellar hook-associated protein FlgL; Reviewed; Region: flgL; PRK08027
568708005404	Bacterial flagellin N-terminal helical region; Region: Flagellin_N; pfam00669
568708005406	ribonuclease, Rne/Rng family; Region: RNaseEG; TIGR00757
568708005407	S1_RNase_E: RNase E and RNase G, S1-like RNA-binding domain. RNase E is an essential endoribonuclease in the processing and degradation of RNA. In addition to its role in mRNA degradation, RNase E has also been implicated in the processing of rRNA, and...; Region: S1_RNase_E; cd04453
568708005408	homodimer interface [polypeptide binding]; other site
568708005409	oligonucleotide binding site [chemical binding]; other site
568708005410	Polyribonucleotide phosphorylase C terminal; Region: PNPase_C; pfam12111
568708005413	Protein of unknown function (DUF2655); Region: DUF2655; pfam10848
568708005415	23S rRNA pseudouridylate synthase C; Provisional; Region: PRK11025
568708005416	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
568708005417	RNA binding surface [nucleotide binding]; other site
568708005418	Pseudouridine synthase, RsuA/RluD family; Region: PseudoU_synth_RluCD_like; cd02869
568708005419	active site
568708005422	Protein of unknown function (DUF3053); Region: DUF3053; pfam11254
568708005424	Maf-like protein; Region: Maf; pfam02545
568708005425	Nucleotide binding protein Maf. Maf has been implicated in inhibition of septum formation in eukaryotes, bacteria and archaea, but homologs in B.subtilis and S.cerevisiae are nonessential for cell division. Maf has been predicted to be a nucleotide- or...; Region: Maf; cd00555
568708005426	active site
568708005427	dimer interface [polypeptide binding]; other site
568708005429	hypothetical protein; Provisional; Region: PRK11193
568708005431	50S ribosomal protein L32; Validated; Region: rpmF; PRK01110
568708005433	putative phosphate acyltransferase; Provisional; Region: PRK05331
568708005435	3-oxoacyl-(acyl carrier protein) synthase III; Reviewed; Region: PRK09352
568708005436	Ketoacyl-acyl carrier protein synthase III (KASIII) initiates the elongation in type II fatty acid synthase systems. It is found in bacteria and plants. Elongation of fatty acids in the type II systems occurs by Claisen condensation of malonyl-acyl...; Region: KAS_III; cd00830
568708005437	dimer interface [polypeptide binding]; other site
568708005438	active site
568708005439	CoA binding pocket [chemical binding]; other site
568708005442	(acyl-carrier-protein) S-malonyltransferase [Lipid metabolism]; Region: FabD; COG0331
568708005443	malonyl CoA-acyl carrier protein transacylase; Region: fabD; TIGR00128
568708005445	3-ketoacyl-(acyl-carrier-protein) reductase; Validated; Region: fabG; PRK05557
568708005446	beta-Keto acyl carrier protein reductase (BKR), involved in Type II FAS, classical (c) SDRs; Region: BKR_SDR_c; cd05333
568708005447	NAD(P) binding site [chemical binding]; other site
568708005448	homotetramer interface [polypeptide binding]; other site
568708005449	homodimer interface [polypeptide binding]; other site
568708005450	active site
568708005452	acyl carrier protein; Provisional; Region: acpP; PRK00982
568708005454	3-oxoacyl-(acyl carrier protein) synthase II; Reviewed; Region: PRK07314
568708005455	Beta-ketoacyl-acyl carrier protein (ACP) synthase (KAS), type I and II. KASs are responsible for the elongation steps in fatty acid biosynthesis. KASIII catalyses the initial condensation and KAS I and II catalyze further elongation steps by Claisen...; Region: KAS_I_II; cd00834
568708005456	dimer interface [polypeptide binding]; other site
568708005457	active site
568708005460	Branched-chain amino acid aminotransferase/4-amino-4-deoxychorismate lyase [Amino acid transport and metabolism / Coenzyme metabolism]; Region: IlvE; COG0115
568708005461	ADCL_like: 4-Amino-4-deoxychorismate lyase:  is a member of the fold-type IV of PLP dependent enzymes that converts 4-amino-4-deoxychorismate (ADC) to p-aminobenzoate and pyruvate.  Based on the information available from the crystal structure, most...; Region: ADCL_like; cd01559
568708005462	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708005463	catalytic residue [active]
568708005465	conserved hypothetical protein, YceG family; Region: TIGR00247
568708005466	proteins similar to Escherichia coli yceG; Region: yceG_like; cd08010
568708005467	dimerization interface [polypeptide binding]; other site
568708005469	thymidylate kinase; Validated; Region: tmk; PRK00698
568708005470	Thymidine monophosphate kinase (TMPK), also known as thymidylate kinase, catalyzes the phosphorylation of thymidine monophosphate (TMP) to thymidine diphosphate (TDP) utilizing ATP as its preferred phophoryl donor. TMPK represents the rate-limiting step...; Region: TMPK; cd01672
568708005471	TMP-binding site; other site
568708005472	ATP-binding site [chemical binding]; other site
568708005474	DNA polymerase III subunit delta'; Validated; Region: PRK07993
568708005475	DNA polymerase III, delta subunit, C terminal; Region: DNApol3-delta_C; pfam09115
568708005477	TatD like proteins;  E.coli TatD is a cytoplasmic protein, shown to have magnesium dependent DNase activity; Region: TatD_DNAse; cd01310
568708005478	active site
568708005480	PTS system glucose-specific transporter subunits IIBC; Provisional; Region: PRK11089
568708005481	Phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific [Carbohydrate transport and metabolism]; Region: PtsG; COG1263
568708005482	PTS_IIB, PTS system, glucose/sucrose specific IIB subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIB_glc; cd00212
568708005483	active site turn [active]
568708005484	phosphorylation site [posttranslational modification]
568708005486	9 probable transmembrane helices predicted for STM_MW12121 by TMHMM2.0 at aa 15-37, 49-71, 81-103, 116-138, 153-175, 248-270, 280-302, 309-331 and 354-376
568708005488	ferric-rhodotorulic acid outer membrane transporter; Provisional; Region: PRK10003
568708005489	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
568708005490	N-terminal plug; other site
568708005491	ligand-binding site [chemical binding]; other site
568708005494	Signal peptide predicted for STM_MW12131 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 35 and 36
568708005495	Protein Kinase C Interacting protein related (PKCI): PKCI and related proteins belong to the ubiquitous HIT family of hydrolases that act on alpha-phosphates of ribonucleotides. The members of this subgroup have a conserved HxHxHxx motif (x is a...; Region: PKCI_related; cd01276
568708005496	nucleotide binding site/active site [active]
568708005497	HIT family signature motif; other site
568708005498	catalytic residue [active]
568708005500	Predicted periplasmic lipoprotein [General function prediction only]; Region: COG5633
568708005501	Putative periplasmic lipoprotein; Region: DUF1425; cd09030
568708005502	putative dimer interface [polypeptide binding]; other site
568708005503	Signal peptide predicted for STM_MW12151 by SignalP 2.0 HMM (Signal peptide probability 0.650) with cleavage site probability 0.635 between residues 20 and 21
568708005505	Collagen-binding surface adhesin SpaP (antigen I/II family) [General function prediction only]; Region: FlgN; COG3417
568708005506	Signal peptide predicted for STM_MW12161 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.999 between residues 22 and 23
568708005507	thiamine kinase; Region: ycfN_thiK; TIGR02721
568708005508	thiamine kinase; Provisional; Region: thiK; PRK10271
568708005509	substrate binding site [chemical binding]; other site
568708005511	Beta-glucosidase-related glycosidases [Carbohydrate transport and metabolism]; Region: BglX; COG1472
568708005512	beta-hexosaminidase; Provisional; Region: PRK05337
568708005514	hypothetical protein; Provisional; Region: PRK04940
568708005516	NADH dehydrogenase, FAD-containing subunit [Energy production and conversion]; Region: Ndh; COG1252
568708005517	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
568708005520	hypothetical protein; Provisional; Region: PRK11280
568708005521	Signal peptide predicted for STM_MW12211 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.671 between residues 23 and 24
568708005522	1 probable transmembrane helix predicted for STM_MW12211 by TMHMM2.0 at aa 5-27
568708005524	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
568708005525	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
568708005527	Protein of unknown function (DUF1471); Region: DUF1471; pfam07338
568708005528	Signal peptide predicted for STM_MW12231 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.973 between residues 22 and 23
568708005529	1 probable transmembrane helix predicted for STM_MW12231 by TMHMM2.0 at aa 7-29
568708005531	L,D-transpeptidase; Provisional; Region: PRK10190
568708005532	Lysine Motif is a small domain involved in binding peptidoglycan; Region: LysM; cd00118
568708005533	L,D-transpeptidase catalytic domain; Region: YkuD; pfam03734
568708005536	1 probable transmembrane helix predicted for STM_MW12241 by TMHMM2.0 at aa 7-29
568708005537	Signal peptide predicted for STM_MW12241 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.990 between residues 28 and 29
568708005538	transcription-repair coupling factor; Provisional; Region: PRK10689
568708005539	CarD-like/TRCF domain; Region: CarD_TRCF; smart01058
568708005540	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
568708005541	ATP binding site [chemical binding]; other site
568708005542	putative Mg++ binding site [ion binding]; other site
568708005543	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
568708005544	nucleotide binding region [chemical binding]; other site
568708005545	ATP-binding site [chemical binding]; other site
568708005546	This domain is found in proteins necessary for strand-specific repair in DNA such as TRCF in Escherichia coli; Region: TRCF; smart00982
568708005551	outer membrane-specific lipoprotein transporter subunit LolC; Provisional; Region: PRK10814
568708005552	MacB-like periplasmic core domain; Region: MacB_PCD; pfam12704
568708005553	FtsX-like permease family; Region: FtsX; pfam02687
568708005554	4 probable transmembrane helices predicted for STM_MW12261 by TMHMM2.0 at aa 62-84, 303-325, 355-377 and 397-419
568708005556	lipoprotein transporter ATP-binding subunit; Provisional; Region: lolD; PRK11629
568708005557	ATP-binding cassette domain of the transporters involved in export of lipoprotein and macrolide, and cell division protein; Region: ABC_MJ0796_LolCDE_FtsE; cd03255
568708005558	Walker A/P-loop; other site
568708005559	ATP binding site [chemical binding]; other site
568708005560	Q-loop/lid; other site
568708005561	ABC transporter signature motif; other site
568708005562	Walker B; other site
568708005563	D-loop; other site
568708005564	H-loop/switch region; other site
568708005566	outer membrane-specific lipoprotein transporter subunit LolE; Provisional; Region: PRK11146
568708005567	MacB-like periplasmic core domain; Region: MacB_PCD; pfam12704
568708005568	FtsX-like permease family; Region: FtsX; pfam02687
568708005569	4 probable transmembrane helices predicted for STM_MW12281 by TMHMM2.0 at aa 21-43, 270-292, 318-340 and 375-397
568708005571	fructokinase; Reviewed; Region: PRK09557
568708005572	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cd00012
568708005573	nucleotide binding site [chemical binding]; other site
568708005575	NAD-dependent deacetylase; Provisional; Region: PRK00481
568708005576	SIRT5_Af1_CobB: Eukaryotic, archaeal and prokaryotic group (class3) which includes human sirtuin SIRT5, Archaeoglobus fulgidus Sir2-Af1, and E. coli CobB; and are members of the SIR2 family of proteins, silent information regulator 2 (Sir2) enzymes which...; Region: SIRT5_Af1_CobB; cd01412
568708005577	NAD+ binding site [chemical binding]; other site
568708005578	substrate binding site [chemical binding]; other site
568708005579	Zn binding site [ion binding]; other site
568708005581	spermidine/putrescine ABC transporter periplasmic substrate-binding protein; Reviewed; Region: potD; PRK09501
568708005582	Bacterial extracellular solute-binding protein; Region: SBP_bac_6; pfam13343
568708005584	Signal peptide predicted for STM_MW12311 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 23 and 24
568708005585	ABC-type spermidine/putrescine transport system, permease component II [Amino acid transport and metabolism]; Region: PotC; COG1177
568708005586	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708005587	dimer interface [polypeptide binding]; other site
568708005588	conserved gate region; other site
568708005589	putative PBP binding loops; other site
568708005590	ABC-ATPase subunit interface; other site
568708005591	6 probable transmembrane helices predicted for STM_MW12321 by TMHMM2.0 at aa 5-27, 64-86, 99-121, 126-148, 176-195 and 230-252
568708005593	Sif protein; Region: Sif; pfam06767
568708005595	ABC-type sugar transport system, permease component [Carbohydrate transport and metabolism]; Region: UgpE; COG0395
568708005596	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708005597	dimer interface [polypeptide binding]; other site
568708005598	conserved gate region; other site
568708005599	putative PBP binding loops; other site
568708005600	ABC-ATPase subunit interface; other site
568708005601	6 probable transmembrane helices predicted for STM_MW12341 by TMHMM2.0 at aa 9-31, 69-91, 98-120, 151-173, 194-216 and 250-272
568708005603	putrescine/spermidine ABC transporter ATPase protein; Reviewed; Region: potA; PRK09452
568708005604	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
568708005605	Walker A/P-loop; other site
568708005606	ATP binding site [chemical binding]; other site
568708005607	Q-loop/lid; other site
568708005608	ABC transporter signature motif; other site
568708005609	Walker B; other site
568708005610	D-loop; other site
568708005611	H-loop/switch region; other site
568708005612	TOBE domain; Region: TOBE_2; pfam08402
568708005615	Di- and tripeptidases [Amino acid transport and metabolism]; Region: PepD; COG2195
568708005616	M20 Peptidase T specifically cleaves tripeptides; Region: M20_peptT; cd03892
568708005617	metal binding site [ion binding]; metal-binding site
568708005618	dimer interface [polypeptide binding]; other site
568708005621	Signal peptide; signalp; query 1-26;cleavage_site_probability=0.983; 0.983
568708005622	Transposase IS200 like; Region: Y1_Tnp; pfam01797
568708005624	Uncharacterized conserved protein [Function unknown]; Region: COG2850
568708005625	Cupin-like domain; Region: Cupin_8; pfam13621
568708005627	sensor protein PhoQ; Provisional; Region: PRK10815
568708005628	PhoQ Sensor; Region: PhoQ_Sensor; pfam08918
568708005629	His Kinase A (phospho-acceptor) domain; Region: HisKA; pfam00512
568708005630	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708005631	ATP binding site [chemical binding]; other site
568708005632	Mg2+ binding site [ion binding]; other site
568708005633	G-X-G motif; other site
568708005636	2 probable transmembrane helices predicted for STM_MW12401 by TMHMM2.0 at aa 20-42 and 194-216
568708005638	Signal peptide predicted for STM_MW12401 by SignalP 2.0 HMM (Signal peptide probability 0.982) with cleavage site probability 0.297 between residues 31 and 32
568708005639	DNA-binding transcriptional regulator PhoP; Provisional; Region: PRK10816
568708005640	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708005641	active site
568708005642	phosphorylation site [posttranslational modification]
568708005643	intermolecular recognition site; other site
568708005644	dimerization interface [polypeptide binding]; other site
568708005645	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
568708005646	DNA binding site [nucleotide binding]
568708005649	adenylosuccinate lyase; Provisional; Region: PRK09285
568708005650	PurB_like adenylosuccinases (adenylsuccinate lyase, ASL); Region: PurB; cd01598
568708005651	tetramer interface [polypeptide binding]; other site
568708005652	active site
568708005655	putative lysogenization regulator; Reviewed; Region: PRK00218
568708005657	tRNA methyl transferase. This family represents tRNA(5-methylaminomethyl-2-thiouridine)-methyltransferase which is involved in the biosynthesis of the modified nucleoside 5-methylaminomethyl-2-thiouridine present in the wobble position of some tRNAs; Region: tRNA_Me_trans; cd01998
568708005658	tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase; Region: trmU; TIGR00420
568708005660	Contains a crystal structure of the Nudix hydrolase from Nitrosomonas europaea, which has an unknown function. In general, members of the Nudix hydrolase superfamily catalyze the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes...; Region: Nudix_Hydrolase_2; cd03675
568708005661	nudix motif; other site
568708005663	Uncharacterized protein conserved in bacteria, putative lipoprotein [Function unknown]; Region: LprI; COG4461
568708005664	Protein of unknown function (DUF1311); Region: DUF1311; pfam07007
568708005666	Signal peptide predicted for STM_MW12461 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.986 between residues 18 and 19
568708005667	23S rRNA pseudouridine synthase E; Provisional; Region: PRK11394
568708005668	Pseudouridine synthase, Escherichia coli RluE; Region: PseudoU_synth_RluE; cd02566
568708005669	probable active site [active]
568708005671	isocitrate dehydrogenase; Validated; Region: PRK07362
568708005672	isocitrate dehydrogenase; Reviewed; Region: PRK07006
568708005674	Protein of unknown function (DUF3626); Region: DUF3626; pfam12294
568708005675	Signal peptide predicted for STM_MW12501 by SignalP 2.0 HMM (Signal peptide probability 0.963) with cleavage site probability 0.957 between residues 25 and 26
568708005676	DinI-like family; Region: DinI; pfam06183
568708005678	Ricin-type beta-trefoil; Region: RICIN; smart00458
568708005679	Ricin-type beta-trefoil; Carbohydrate-binding domain formed from presumed gene triplication. The domain is found in a variety of molecules serving diverse functions such as enzymatic activity, inhibitory toxicity and signal transduction. Highly specific...; Region: RICIN; cd00161
568708005680	putative sugar binding sites [chemical binding]; other site
568708005681	Q-X-W motif; other site
568708005683	Signal peptide predicted for STM_MW12521 by SignalP 2.0 HMM (Signal peptide probability 0.921) with cleavage site probability 0.763 between residues 25 and 26
568708005684	Cold-Shock Protein (CSP) contains an S1-like cold-shock domain (CSD) that is found in eukaryotes, prokaryotes, and archaea.  CSP's include the major cold-shock proteins CspA and CspB in bacteria and the eukaryotic gene regulatory factor Y-box...; Region: CSP_CDS; cd04458
568708005685	DNA-binding site [nucleotide binding]; DNA binding site
568708005686	RNA-binding motif; other site
568708005688	Signal peptide predicted for STM_MW12541 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.993 between residues 20 and 21
568708005689	Outer membrane protein beta-barrel domain; Region: OMP_b-brl; cl17254
568708005691	lysozyme inhibitor; Provisional; Region: PRK13791
568708005693	Signal peptide predicted for STM_MW12561 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.928 between residues 24 and 25
568708005694	Molecular chaperone (small heat shock protein) [Posttranslational modification, protein turnover, chaperones]; Region: IbpA; COG0071
568708005695	Alpha-crystallin domain (ACD) found in Escherichia coli inclusion body-associated proteins IbpA and IbpB, and similar proteins.  IbpA and IbpB are 16 kDa small heat shock proteins (sHsps). sHsps are molecular chaperones that suppress protein aggregation...; Region: ACD_IbpA-B_like; cd06470
568708005696	putative dimer interface [polypeptide binding]; other site
568708005698	Predicted neuraminidase (sialidase) [Carbohydrate transport and metabolism]; Region: COG4692
568708005699	BNR repeat-like domain; Region: BNR_2; pfam13088
568708005700	Cytochrome B561 [Energy production and conversion]; Region: CybB; COG3038
568708005702	4 probable transmembrane helices predicted for STM_MW12601 by TMHMM2.0 at aa 9-31, 46-63, 88-110 and 140-162
568708005703	Signal peptide predicted for STM_MW12601 by SignalP 2.0 HMM (Signal peptide probability 0.893) with cleavage site probability 0.892 between residues 24 and 25
568708005704	TRL-like protein family; Region: TRL; pfam13146
568708005705	1 probable transmembrane helix predicted for STM_MW12611 by TMHMM2.0 at aa 7-29
568708005706	Signal peptide predicted for STM_MW12611 by SignalP 2.0 HMM (Signal peptide probability 0.738) with cleavage site probability 0.321 between residues 28 and 29
568708005707	The substrate-binding component of an uncharacterized ABC-type nickel/dipeptide/oligopeptide-like import system contains the type 2 periplasmic binding fold; Region: PBP2_NikA_DppA_OppA_like_19; cd08518
568708005708	Bacterial extracellular solute-binding proteins, family 5 Middle; Region: SBP_bac_5; pfam00496
568708005709	Signal peptide predicted for STM_MW12621 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.976 between residues 39 and 40
568708005710	1 probable transmembrane helix predicted for STM_MW12621 by TMHMM2.0 at aa 21-40
568708005712	ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppB; COG0601
568708005713	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708005714	dimer interface [polypeptide binding]; other site
568708005715	conserved gate region; other site
568708005716	ABC-ATPase subunit interface; other site
568708005717	Signal peptide predicted for STM_MW12631 by SignalP 2.0 HMM (Signal peptide probability 0.985) with cleavage site probability 0.944 between residues 27 and 28
568708005718	4 probable transmembrane helices predicted for STM_MW12631 by TMHMM2.0 at aa 7-29, 104-126, 139-161 and 291-313
568708005720	ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppC; COG1173
568708005721	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708005722	dimer interface [polypeptide binding]; other site
568708005723	conserved gate region; other site
568708005724	putative PBP binding loops; other site
568708005725	ABC-ATPase subunit interface; other site
568708005726	Signal peptide predicted for STM_MW12641 by SignalP 2.0 HMM (Signal peptide probability 0.966) with cleavage site probability 0.858 between residues 28 and 29
568708005727	4 probable transmembrane helices predicted for STM_MW12641 by TMHMM2.0 at aa 7-29, 74-96, 117-139 and 236-253
568708005729	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
568708005730	nickel import ATP-binding protein NikD; Region: nickel_nikD; TIGR02770
568708005731	Walker A/P-loop; other site
568708005732	ATP binding site [chemical binding]; other site
568708005733	Q-loop/lid; other site
568708005734	ABC transporter signature motif; other site
568708005735	Walker B; other site
568708005736	D-loop; other site
568708005737	H-loop/switch region; other site
568708005739	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
568708005740	lipoprotein releasing system, ATP-binding protein; Region: LolD_lipo_ex; TIGR02211
568708005741	Walker A/P-loop; other site
568708005742	ATP binding site [chemical binding]; other site
568708005743	Q-loop/lid; other site
568708005744	ABC transporter signature motif; other site
568708005745	Walker B; other site
568708005746	D-loop; other site
568708005747	H-loop/switch region; other site
568708005749	Small-conductance mechanosensitive channel [Cell envelope biogenesis, outer membrane]; Region: MscS; COG0668
568708005750	Mechanosensitive ion channel; Region: MS_channel; pfam00924
568708005752	5 probable transmembrane helices predicted for STM_MW12671 by TMHMM2.0 at aa 20-42, 74-90, 97-114, 136-158 and 165-187
568708005753	Cysteine-rich 4 helical bundle widely conserved in bacteria; Region: DUF326; cd08026
568708005754	dimerization interface [polypeptide binding]; other site
568708005756	zinc/cadmium-binding protein; Provisional; Region: PRK10306
568708005757	Signal peptide predicted for STM_MW12691 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.968 between residues 22 and 23
568708005759	aminoglycoside resistance protein; Provisional; Region: PRK13746
568708005760	Nucleotidyltransferase (NT) domain of Staphylococcus aureus kanamycin nucleotidyltransferase, and similar proteins; Region: NT_KNTase_like; cd05403
568708005761	active site
568708005762	NTP binding site [chemical binding]; other site
568708005763	metal binding triad [ion binding]; metal-binding site
568708005764	antibiotic binding site [chemical binding]; other site
568708005765	Domain of unknown function (DUF4111); Region: DUF4111; pfam13427
568708005767	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
568708005768	DNA binding residues [nucleotide binding]
568708005770	transcriptional regulator MirA; Provisional; Region: PRK15043
568708005771	Helix-Turn-Helix DNA binding domain of MerR-like transcription regulators; Region: HTH_MerR-like; cd00592
568708005772	DNA binding residues [nucleotide binding]
568708005773	dimer interface [polypeptide binding]; other site
568708005775	Pleckstrin homology-like domain; Region: PH-like; cl17171
568708005776	Biofilm development protein YmgB/AriR; Region: YmgB; pfam10798
568708005778	chorismate mutase; Provisional; Region: PRK08055
568708005779	Signal peptide predicted for STM_MW12751 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.996 between residues 20 and 21
568708005781	leucine export protein LeuE; Provisional; Region: PRK10958
568708005782	6 probable transmembrane helices predicted for STM_MW12761 by TMHMM2.0 at aa 10-32, 45-67, 77-99, 120-142, 157-179 and 191-210
568708005784	Uncharacterized protein/domain, possibly involved in tellurite resistance [Inorganic ion transport and metabolism]; Region: TehB; COG3615
568708005786	Domain of unknown function (DUF1869); Region: DUF1869; pfam08956
568708005788	Signal peptide predicted for STM_MW12791 by SignalP 2.0 HMM (Signal peptide probability 0.987) with cleavage site probability 0.900 between residues 24 and 25
568708005789	4 probable transmembrane helices predicted for STM_MW12791 by TMHMM2.0 at aa 7-25, 40-59, 71-90 and 100-122
568708005790	hypothetical protein; Provisional; Region: PRK10457
568708005791	3 probable transmembrane helices predicted for STM_MW12811 by TMHMM2.0 at aa 4-21, 28-50 and 60-77
568708005793	Putative hemolysin [General function prediction only]; Region: Hlx; COG3042
568708005794	murein hydrolase B; Provisional; Region: PRK10760; cl17906
568708005795	Domain of unknown function (DUF333); Region: DUF333; pfam03891
568708005797	Uncharacterized conserved protein [Function unknown]; Region: COG3189
568708005799	Cyanate permease [Inorganic ion transport and metabolism]; Region: CynX; COG2807
568708005800	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708005801	12 probable transmembrane helices predicted for STM_MW12851 by TMHMM2.0 at aa 12-31, 46-68, 81-98, 103-125, 137-159, 163-185, 217-239, 249-271, 278-297, 302-324, 333-355 and 365-387
568708005803	Signal peptide predicted for STM_MW12851 by SignalP 2.0 HMM (Signal peptide probability 0.638) with cleavage site probability 0.471 between residues 33 and 34
568708005804	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
568708005805	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708005808	Predicted membrane protein [Function unknown]; Region: COG2707
568708005809	4 probable transmembrane helices predicted for STM_MW12862 by TMHMM2.0 at aa 12-34, 49-71, 76-98 and 124-146
568708005811	Signal peptide predicted for STM_MW12862 by SignalP 2.0 HMM (Signal peptide probability 0.975) with cleavage site probability 0.511 between residues 24 and 25
568708005812	YeaK is an uncharacterized Echerichia coli protein with a YbaK-like domain of unknown function.  The YbaK-like domain family includes the INS amino acid-editing domain of the bacterial class II prolyl tRNA synthetase (ProRS), and it's trans-acting...; Region: YeaK; cd04336
568708005813	putative deacylase active site [active]
568708005815	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
568708005816	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
568708005817	metal binding site [ion binding]; metal-binding site
568708005818	active site
568708005819	I-site; other site
568708005820	2 probable transmembrane helices predicted for STM_MW12891 by TMHMM2.0 at aa 7-29 and 305-327
568708005822	hypothetical protein; Provisional; Region: PRK05325
568708005824	PrkA family serine protein kinase; Provisional; Region: PRK15455
568708005825	AAA ATPase domain; Region: AAA_16; pfam13191
568708005826	Walker A motif; other site
568708005827	ATP binding site [chemical binding]; other site
568708005828	PrkA serine protein kinase C-terminal domain; Region: PrkA; pfam06798
568708005831	Outer membrane protein V [Cell envelope biogenesis, outer membrane]; Region: OmpV; COG3713
568708005832	Signal peptide predicted for STM_MW12921 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.990 between residues 22 and 23
568708005834	anaerobic sulfatase-maturating enzyme; Region: sulfatase_rSAM; TIGR03942
568708005835	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
568708005836	FeS/SAM binding site; other site
568708005837	radical SAM additional 4Fe4S-binding SPASM domain; Region: rSAM_more_4Fe4S; TIGR04085
568708005839	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660
568708005840	Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248
568708005841	active site
568708005842	catalytic tetrad [active]
568708005844	D-hexose-6-phosphate epimerase-like; Region: D-hex-6-P-epi_like; cd09020
568708005845	active site
568708005846	phosphate binding residues; other site
568708005847	catalytic residues [active]
568708005849	glyceraldehyde-3-phosphate dehydrogenase A; Provisional; Region: gapA; PRK15425
568708005850	Glyceraldehyde 3-phosphate dehydrogenase, NAD binding domain; Region: Gp_dh_N; pfam00044
568708005851	Glyceraldehyde 3-phosphate dehydrogenase, C-terminal domain; Region: Gp_dh_C; pfam02800
568708005854	methionine sulfoxide reductase B; Provisional; Region: PRK00222
568708005855	SelR domain; Region: SelR; pfam01641
568708005857	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3139
568708005859	Nicotinamidase/pyrazinamidase (PZase). Nicotinamidase, a ubiquitous enzyme in prokaryotes, converts nicotinamide to nicotinic acid (niacin) and ammonia, which in turn can be recycled to make nicotinamide adenine dinucleotide (NAD). The same enzyme is...; Region: nicotinamidase; cd01011
568708005860	Isochorismatase family; Region: Isochorismatase; pfam00857
568708005861	catalytic triad [active]
568708005862	metal binding site [ion binding]; metal-binding site
568708005863	conserved cis-peptide bond; other site
568708005865	Type I (cytosolic) bacterial L-asparaginase; Region: L-asparaginase_I; cd08963
568708005866	active site
568708005867	homodimer interface [polypeptide binding]; other site
568708005869	protease 4; Provisional; Region: PRK10949
568708005870	Signal peptide peptidase A (SppA) 67K type, a serine protease, has catalytic Ser-Lys dyad; Region: S49_SppA_67K_type; cd07018
568708005871	tandem repeat interface [polypeptide binding]; other site
568708005872	oligomer interface [polypeptide binding]; other site
568708005873	active site residues [active]
568708005874	Signal peptide peptidase A (SppA), a serine protease, has catalytic Ser-Lys dyad; Region: S49_SppA_1; cd07019
568708005875	tandem repeat interface [polypeptide binding]; other site
568708005876	oligomer interface [polypeptide binding]; other site
568708005877	active site residues [active]
568708005879	1 probable transmembrane helix predicted for STM_MW13021 by TMHMM2.0 at aa 21-43
568708005880	Nitroreductase-like family which includes NADH oxidase and arsenite oxidiase. NADH oxidase catalyses the oxidation of NAD(P)H and accepts a wide broad range of compounds as electron acceptors, such as nitrocompound. Arsenite oxidase in a...; Region: Arsenite_oxidase; cd02135
568708005881	putative FMN binding site [chemical binding]; other site
568708005883	selenophosphate synthetase; Provisional; Region: PRK00943
568708005884	Selenophosphate synthetase  (SelD) catalyzes the conversion of selenium to selenophosphate which is required by a number of bacterial, archaeal and eukaryotic organisms for synthesis of Secys-tRNA, the precursor of selenocysteine in selenoenzymes. The...; Region: SelD; cd02195
568708005885	dimerization interface [polypeptide binding]; other site
568708005886	putative ATP binding site [chemical binding]; other site
568708005889	DNA topoisomerase III; Provisional; Region: PRK07726
568708005890	TOPRIM_TopoIA_TopoIII: The topoisomerase-primase (TORPIM) domain found in members of the type IA family of DNA topoisomerases (Topo IA) similar to topoisomerase III. Type IA DNA topoisomerases remove (relax) negative supercoils in the DNA by: cleaving...; Region: TOPRIM_TopoIA_TopoIII; cd03362
568708005891	active site
568708005892	putative interdomain interaction site [polypeptide binding]; other site
568708005893	putative metal-binding site [ion binding]; other site
568708005894	putative nucleotide binding site [chemical binding]; other site
568708005895	DNA Topoisomerase, subtype IA; DNA-binding, ATP-binding and catalytic domain of bacterial DNA topoisomerases I and III, and eukaryotic DNA topoisomerase III and eubacterial and archael reverse gyrases. Topoisomerases clevage single or double stranded DNA...; Region: TOP1Ac; cd00186
568708005896	domain I; other site
568708005897	DNA binding groove [nucleotide binding]
568708005898	phosphate binding site [ion binding]; other site
568708005899	domain II; other site
568708005900	domain III; other site
568708005901	nucleotide binding site [chemical binding]; other site
568708005902	catalytic site [active]
568708005903	domain IV; other site
568708005906	glutamate dehydrogenase; Provisional; Region: PRK09414
568708005907	Glu/Leu/Phe/Val dehydrogenase, dimerisation domain; Region: ELFV_dehydrog_N; pfam02812
568708005908	NAD(P) binding domain of glutamate dehydrogenase, subgroup 2; Region: NAD_bind_2_Glu_DH; cd05313
568708005909	NAD(P) binding site [chemical binding]; other site
568708005912	Protein of unknown function (DUF1496); Region: DUF1496; pfam07383
568708005913	Signal peptide predicted for STM_MW13071 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.921 between residues 19 and 20
568708005915	The MutT pyrophosphohydrolase is a prototypical Nudix hydrolase that catalyzes the hydrolysis of nucleoside and deoxynucleoside triphosphates (NTPs and dNTPs) by substitution at a beta-phosphorus to yield a nucleotide monophosphate (NMP) and inorganic...; Region: MutT_pyrophosphohydrolase; cd03425
568708005916	active site
568708005917	8-oxo-dGMP binding site [chemical binding]; other site
568708005918	nudix motif; other site
568708005919	metal binding site [ion binding]; metal-binding site
568708005921	Escherichia coli exonuclease III (ExoIII) and Neisseria meningitides NExo-like subfamily of the ExoIII family purinic/apyrimidinic (AP) endonucleases; Region: ExoIII-like_AP-endo; cd09086
568708005922	putative catalytic site [active]
568708005923	putative phosphate binding site [ion binding]; other site
568708005924	active site
568708005925	metal binding site A [ion binding]; metal-binding site
568708005926	DNA binding site [nucleotide binding]
568708005927	putative AP binding site [nucleotide binding]; other site
568708005928	putative metal binding site B [ion binding]; other site
568708005930	bifunctional succinylornithine transaminase/acetylornithine transaminase; Provisional; Region: PRK12381
568708005931	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
568708005932	inhibitor-cofactor binding pocket; inhibition site
568708005933	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708005934	catalytic residue [active]
568708005936	arginine succinyltransferase; Provisional; Region: PRK10456
568708005937	Arginine/ornithine N-succinyltransferase beta subunit [Amino acid transport and metabolism]; Region: AstA; COG3138
568708005939	succinylglutamic semialdehyde dehydrogenase; Reviewed; Region: astD; PRK09457
568708005940	N-succinylglutamate 5-semialdehyde dehydrogenase, AstD-like; Region: ALDH_SGSD_AstD; cd07095
568708005941	NAD(P) binding site [chemical binding]; other site
568708005942	catalytic residues [active]
568708005944	succinylarginine dihydrolase; Provisional; Region: PRK13281
568708005946	Peptidase M14 Succinylglutamate desuccinylase (ASTE) subfamily; Region: M14_ASTE; cd03855
568708005947	Succinylglutamate desuccinylase / Aspartoacylase family; Region: AstE_AspA; pfam04952
568708005948	putative active site [active]
568708005949	Zn binding site [ion binding]; other site
568708005951	CpxP component of the bacterial Cpx-two-component system and related proteins; Region: CpxP_like; cd09916
568708005952	dimer interface [polypeptide binding]; other site
568708005953	Signal peptide predicted for STM_MW13151 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 23 and 24
568708005955	nucleotide excision repair endonuclease; Provisional; Region: PRK10545
568708005956	Catalytic GIY-YIG domain of nucleotide excision repair endonucleases UvrC, Cho, and similar proteins; Region: GIY-YIG_UvrC_Cho; cd10434
568708005957	GIY-YIG motif/motif A; other site
568708005958	active site
568708005959	catalytic site [active]
568708005960	putative DNA binding site [nucleotide binding]; other site
568708005961	metal binding site [ion binding]; metal-binding site
568708005963	NAD synthase [Coenzyme metabolism]; Region: NadE; COG0171
568708005964	NAD+ synthase is a homodimer, which catalyzes the final step in de novo nicotinamide adenine dinucleotide (NAD+) biosynthesis, an amide transfer from either ammonia or glutamine to nicotinic acid adenine dinucleotide (NaAD). The conversion of NaAD to NAD...; Region: NAD_synthase; cd00553
568708005965	homodimer interface [polypeptide binding]; other site
568708005966	NAD binding pocket [chemical binding]; other site
568708005967	ATP binding pocket [chemical binding]; other site
568708005968	Mg binding site [ion binding]; other site
568708005969	active-site loop [active]
568708005971	DNA-binding transcriptional activator OsmE; Provisional; Region: PRK11251
568708005972	Signal peptide predicted for STM_MW13181 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.918 between residues 23 and 24
568708005974	PTS_IIB_chitobiose_lichenan: subunit IIB of enzyme II (EII) of the N,N-diacetylchitobiose-specific and lichenan-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS). In these systems, EII is either a lichenan- or an N; Region: PTS_IIB_chitobiose_lichenan; cd05564
568708005975	active site
568708005976	P-loop; other site
568708005977	phosphorylation site [posttranslational modification]
568708005978	Signal peptide predicted for STM_MW13191 by SignalP 2.0 HMM (Signal peptide probability 0.688) with cleavage site probability 0.538 between residues 27 and 28
568708005980	PTS system N,N'-diacetylchitobiose-specific transporter subunit IIC; Provisional; Region: PRK10297
568708005981	cellobiose phosphotransferase system IIC component; Reviewed; Region: celD; PRK09592
568708005983	10 probable transmembrane helices predicted for STM_MW13201 by TMHMM2.0 at aa 31-53, 85-107, 114-133, 143-165, 186-208, 232-254, 302-321, 341-363, 370-392 and 407-429
568708005984	PTS_IIA, PTS system, lactose/cellobiose specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This...; Region: PTS_IIA_lac; cd00215
568708005985	methionine cluster; other site
568708005986	active site
568708005987	phosphorylation site [posttranslational modification]
568708005988	metal binding site [ion binding]; metal-binding site
568708005990	DNA-binding transcriptional regulator ChbR; Provisional; Region: PRK10296
568708005991	Cupin domain; Region: Cupin_2; pfam07883
568708005992	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708005995	Alpha-galactosidases/6-phospho-beta-glucosidases, family 4 of glycosyl hydrolases [Carbohydrate transport and metabolism]; Region: CelF; COG1486
568708005996	Glycoside Hydrolases Family 4; Phospho-beta-glucosidase; Region: GH4_P_beta_glucosidase; cd05296
568708005997	NAD binding site [chemical binding]; other site
568708005998	sugar binding site [chemical binding]; other site
568708005999	divalent metal binding site [ion binding]; other site
568708006000	tetramer (dimer of dimers) interface [polypeptide binding]; other site
568708006001	dimer interface [polypeptide binding]; other site
568708006003	Enterococcus faecalis EF3048 and similar proteins; Region: YdjC_EF3048_like; cd10803
568708006004	putative active site [active]
568708006005	YdjC motif; other site
568708006006	Mg binding site [ion binding]; other site
568708006007	putative homodimer interface [polypeptide binding]; other site
568708006009	hydroperoxidase II; Provisional; Region: katE; PRK11249
568708006010	Clade 2 of the heme-binding enzyme catalase; Region: catalase_clade_2; cd08155
568708006011	tetramer interface [polypeptide binding]; other site
568708006012	heme binding pocket [chemical binding]; other site
568708006013	Type 1 glutamine amidotransferase (GATase1)-like domain found in at the C-terminal of several large catalases; Region: GATase1_catalase; cd03132
568708006014	domain interactions; other site
568708006017	cell division modulator; Provisional; Region: PRK10113
568708006019	Predicted Na+/dicarboxylate symporter [General function prediction only]; Region: COG1823
568708006020	Na+/H+-dicarboxylate symporters [Energy production and conversion]; Region: GltP; COG1301
568708006022	9 probable transmembrane helices predicted for STM_MW13271 by TMHMM2.0 at aa 5-22, 34-51, 71-93, 105-127, 180-202, 260-282, 340-362, 369-391 and 395-417
568708006023	Signal peptide predicted for STM_MW13271 by SignalP 2.0 HMM (Signal peptide probability 0.887) with cleavage site probability 0.343 between residues 20 and 21
568708006024	inner membrane protein; Provisional; Region: PRK11648
568708006026	2 probable transmembrane helices predicted for STM_MW13281 by TMHMM2.0 at aa 72-94 and 109-131
568708006027	2-deoxyglucose-6-phosphatase; Provisional; Region: PRK10826
568708006028	haloacid dehalogenase-like hydrolase; Region: HAD; cl17202
568708006029	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708006030	motif II; other site
568708006032	YniB-like protein; Region: YniB; pfam14002
568708006033	3 probable transmembrane helices predicted for STM_MW13301 by TMHMM2.0 at aa 16-38, 79-101 and 150-172
568708006034	Phosphotransferase enzyme family; Region: APH; pfam01636
568708006035	Aminoglycoside 3'-phosphotransferase (APH) and Choline Kinase (ChoK) family. The APH/ChoK family is part of a larger superfamily that includes the catalytic domains of other kinases, such as the typical serine/threonine/tyrosine protein kinases (PKs)...; Region: APH_ChoK_like; cd05120
568708006036	active site
568708006037	ATP binding site [chemical binding]; other site
568708006038	Aminoglycoside 3'-phosphotransferase (APH) and Choline Kinase (ChoK) family. The APH/ChoK family is part of a larger superfamily that includes the catalytic domains of other kinases, such as the typical serine/threonine/tyrosine protein kinases (PKs)...; Region: APH_ChoK_like; cl17270
568708006040	Protein of unknown function (DUF2622); Region: DUF2622; pfam11080
568708006042	6-phosphofructokinase 2; Provisional; Region: PRK10294
568708006043	1-phosphofructokinase (FruK), minor 6-phosphofructokinase (pfkB) and related sugar kinases. FruK plays an important role in the predominant pathway for fructose utilisation.This group also contains tagatose-6-phophate kinase, an enzyme of the tagatose...; Region: FruK_PfkB_like; cd01164
568708006044	putative substrate binding site [chemical binding]; other site
568708006045	putative ATP binding site [chemical binding]; other site
568708006047	Putative salt-induced outer membrane protein [Cell envelope biogenesis, outer membrane]; Region: COG3137
568708006048	Signal peptide predicted for STM_MW13341 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.805 between residues 25 and 26
568708006049	1 probable transmembrane helix predicted for STM_MW13341 by TMHMM2.0 at aa 7-24
568708006051	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3528
568708006053	Signal peptide predicted for STM_MW13351 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.734 between residues 23 and 24
568708006054	2 probable transmembrane helices predicted for STM_MW13361 by TMHMM2.0 at aa 33-55 and 59-81
568708006055	DNA/RNA non-specific endonuclease; prokaryotic and eukaryotic double- and single-stranded DNA and RNA endonucleases also present in phosphodiesterases.  They exists as monomers and homodimers; Region: NUC; cd00091
568708006056	DNA/RNA non-specific endonuclease; Region: Endonuclease_NS; smart00892
568708006057	active site
568708006058	substrate binding site [chemical binding]; other site
568708006059	Mg2+ binding site [ion binding]; other site
568708006061	11 probable transmembrane helices predicted for STM_MW13391 by TMHMM2.0 at aa 4-24, 31-53, 63-82, 102-121, 141-163, 168-185, 190-204, 211-233, 321-343, 355-377 and 381-403
568708006062	threonyl-tRNA synthetase; Reviewed; Region: thrS; PRK00413
568708006063	TGS _ThrRS_N:  ThrRS (threonyl-tRNA Synthetase)  is a class II tRNA synthetase that couples threonine to its cognate tRNA.  In addition to its catalytic and anticodon-binding domains, ThrRS has an N-terminal TGS domain, named after the ThrRS, GTPase, and...; Region: TGS_ThrRS_N; cd01667
568708006064	Threonyl and Alanyl tRNA synthetase second additional domain; Region: tRNA_SAD; pfam07973
568708006065	Threonyl-tRNA synthetase (ThrRS) class II core catalytic domain. ThrRS is a homodimer. It is responsible for the attachment of threonine to the 3' OH group of ribose of the appropriate tRNA. This domain is primarily responsible for ATP-dependent...; Region: ThrRS_core; cd00771
568708006066	active site
568708006067	dimer interface [polypeptide binding]; other site
568708006068	motif 1; other site
568708006069	motif 2; other site
568708006070	motif 3; other site
568708006071	ThrRS Threonyl-anticodon binding domain. ThrRS belongs to class II aminoacyl-tRNA synthetases (aaRS). This alignment contains the anticodon binding domain, which is responsible for specificity in tRNA-binding, so that the activated amino acid is...; Region: ThrRS_anticodon; cd00860
568708006072	anticodon binding site; other site
568708006077	translation initiation factor IF-3; Reviewed; Region: infC; PRK00028
568708006078	Translation initiation factor IF-3, N-terminal domain; Region: IF3_N; pfam05198
568708006079	Translation initiation factor IF-3, C-terminal domain; Region: IF3_C; pfam00707
568708006082	50S ribosomal protein L35; Reviewed; Region: rpmI; PRK00172
568708006084	Ribosomal protein L20; Region: Ribosomal_L20; cd07026
568708006085	23S rRNA binding site [nucleotide binding]; other site
568708006086	L21 binding site [polypeptide binding]; other site
568708006087	L13 binding site [polypeptide binding]; other site
568708006089	phenylalanyl-tRNA synthetase subunit alpha; Validated; Region: pheS; PRK00488
568708006090	Aminoacyl tRNA synthetase class II, N-terminal domain; Region: Phe_tRNA-synt_N; pfam02912
568708006091	Phenylalanyl-tRNA synthetase (PheRS) alpha chain catalytic core domain. PheRS belongs to class II aminoacyl-tRNA synthetases (aaRS) based upon its structure and the presence of three characteristic sequence motifs. This domain is primarily responsible...; Region: PheRS_alpha_core; cd00496
568708006092	dimer interface [polypeptide binding]; other site
568708006093	motif 1; other site
568708006094	active site
568708006095	motif 2; other site
568708006096	motif 3; other site
568708006099	phenylalanyl-tRNA synthetase subunit beta; Reviewed; Region: pheT; PRK00629
568708006100	tRNA-binding-domain-containing prokaryotic phenylalanly tRNA synthetase (PheRS) beta chain.  PheRS aminoacylate phenylalanine transfer RNAs (tRNAphe). PheRSs belong structurally to class II aminoacyl tRNA synthetases (aaRSs) but, as they aminoacylate...; Region: tRNA_bind_bactPheRS; cd02796
568708006101	putative tRNA-binding site [nucleotide binding]; other site
568708006102	B3/4 domain; Region: B3_4; pfam03483
568708006103	tRNA synthetase B5 domain; Region: B5; smart00874
568708006104	Phenylalanyl-tRNA synthetase (PheRS) beta chain core domain. PheRS belongs to class II aminoacyl-tRNA synthetases (aaRS) based upon its structure. While class II aaRSs generally aminoacylate the 3'-OH ribose of the appropriate tRNA,  PheRS is an...; Region: PheRS_beta_core; cd00769
568708006105	dimer interface [polypeptide binding]; other site
568708006106	motif 1; other site
568708006107	motif 3; other site
568708006108	motif 2; other site
568708006109	Ferredoxin-fold anticodon binding domain; Region: FDX-ACB; pfam03147
568708006114	Integration host factor (IHF) and HU are small heterodimeric members of the DNABII protein family that bind and bend DNA, functioning as architectural factors in many cellular processes including transcription, site-specific recombination, and...; Region: HU_IHF; cd00591
568708006115	IHF dimer interface [polypeptide binding]; other site
568708006116	IHF - DNA interface [nucleotide binding]; other site
568708006118	iron-hydroxamate transporter permease subunit; Provisional; Region: PRK10577
568708006119	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
568708006120	ABC-ATPase subunit  interface; other site
568708006121	dimer interface [polypeptide binding]; other site
568708006122	putative PBP binding regions; other site
568708006123	Signal peptide predicted for STM_MW13471 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.950 between residues 36 and 37
568708006124	9 probable transmembrane helices predicted for STM_MW13471 by TMHMM2.0 at aa 20-42, 62-84, 91-110, 114-136, 149-171, 191-208, 245-267, 277-299 and 306-325
568708006126	Glutathione (GSH) peroxidase family; tetrameric selenoenzymes that catalyze the reduction of a variety of hydroperoxides including lipid peroxidases, using GSH as a specific electron donor substrate. GSH peroxidase contains one selenocysteine residue per...; Region: GSH_Peroxidase; cd00340
568708006127	catalytic residues [active]
568708006128	dimer interface [polypeptide binding]; other site
568708006130	ABC-type cobalamin transport system, ATPase component [Coenzyme metabolism]; Region: BtuD; COG4138
568708006131	ATP-binding component of iron-siderophores, vitamin B12 and hemin transporters and related proteins; Region: ABC_Iron-Siderophores_B12_Hemin; cd03214
568708006132	Walker A/P-loop; other site
568708006133	ATP binding site [chemical binding]; other site
568708006134	Q-loop/lid; other site
568708006135	ABC transporter signature motif; other site
568708006136	Walker B; other site
568708006137	D-loop; other site
568708006138	H-loop/switch region; other site
568708006140	NlpC/P60 family; Region: NLPC_P60; pfam00877
568708006141	Signal peptide predicted for STM_MW13501 by SignalP 2.0 HMM (Signal peptide probability 0.714) with cleavage site probability 0.492 between residues 26 and 27
568708006143	c-di-GMP phosphodiesterase class I (EAL domain) [Signal    transduction mechanisms]; Region: Rtn; COG2200
568708006145	Uncharacterized conserved protein [Function unknown]; Region: COG0397
568708006146	hypothetical protein; Validated; Region: PRK00029
568708006148	Hemin uptake protein [Inorganic ion transport and metabolism]; Region: HemP; COG4256
568708006150	phospho-2-dehydro-3-deoxyheptonate aldolase; Provisional; Region: PRK12756
568708006151	DAHP synthetase I family; Region: DAHP_synth_1; pfam00793
568708006153	PEP synthetase regulatory protein; Provisional; Region: PRK05339
568708006155	phosphoenolpyruvate synthase; Validated; Region: PRK06464
568708006156	Pyruvate phosphate dikinase, PEP/pyruvate binding domain; Region: PPDK_N; pfam01326
568708006157	PEP-utilising enzyme, mobile domain; Region: PEP-utilizers; pfam00391
568708006158	PEP-utilising enzyme, TIM barrel domain; Region: PEP-utilizers_C; pfam02896
568708006162	short chain acyl-CoA synthetase; Reviewed; Region: PRK06087
568708006163	Cyclohexanecarboxylate-CoA ligase (also called cyclohex-1-ene-1-carboxylate:CoA ligase); Region: CHC_CoA_lg; cd05903
568708006164	acyl-activating enzyme (AAE) consensus motif; other site
568708006165	putative AMP binding site [chemical binding]; other site
568708006166	putative active site [active]
568708006167	putative CoA binding site [chemical binding]; other site
568708006169	Ferredoxin-like protein [Energy production and conversion]; Region: FixX; COG2440
568708006170	oxidoreductase; Provisional; Region: PRK10015
568708006172	Signal peptide predicted for STM_MW13591 by SignalP 2.0 HMM (Signal peptide probability 0.711) with cleavage site probability 0.694 between residues 25 and 26
568708006173	electron transfer flavoprotein subunit YdiR; Provisional; Region: PRK11916
568708006174	Electron transfer flavoprotein domain; Region: ETF; smart00893
568708006175	Electron transfer flavoprotein FAD-binding domain; Region: ETF_alpha; pfam00766
568708006178	The electron transfer flavoprotein (ETF) serves as a specific electron acceptor for various mitochondrial dehydrogenases. ETF transfers electrons to the main respiratory chain via ETF-ubiquinone oxidoreductase. ETF is an heterodimer that consists of an...; Region: ETF_beta; cd01714
568708006179	Ligand binding site [chemical binding]; other site
568708006180	Electron transfer flavoprotein domain; Region: ETF; pfam01012
568708006182	Cupin domain; Region: Cupin_2; pfam07883
568708006183	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
568708006184	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708006187	putative acyl-CoA dehydrogenase; Provisional; Region: PRK12341
568708006188	Acyl-CoA dehydrogenase; Region: ACAD; cd00567
568708006189	active site
568708006193	Acyl CoA:acetate/3-ketoacid CoA transferase [Lipid metabolism]; Region: COG4670
568708006194	Coenzyme A transferase; Region: CoA_trans; smart00882
568708006195	Coenzyme A transferase; Region: CoA_trans; cl17247
568708006197	3-dehydroquinate dehydratase [Amino acid transport and metabolism]; Region: AroD; COG0710
568708006198	Type I 3-dehydroquinase, (3-dehydroquinate dehydratase or DHQase); Region: DHQase_I; cd00502
568708006199	active site
568708006200	catalytic residue [active]
568708006201	dimer interface [polypeptide binding]; other site
568708006203	quinate/shikimate dehydrogenase; Reviewed; Region: PRK12749
568708006204	Shikimate dehydrogenase substrate binding domain; Region: Shikimate_dh_N; pfam08501
568708006205	NAD(P) binding domain of Shikimate dehydrogenase; Region: NAD_bind_Shikimate_DH; cd01065
568708006206	shikimate binding site; other site
568708006207	NAD(P) binding site [chemical binding]; other site
568708006210	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708006211	putative transporter; Provisional; Region: PRK03699
568708006212	putative substrate translocation pore; other site
568708006214	12 probable transmembrane helices predicted for STM_MW13671 by TMHMM2.0 at aa 12-34, 49-71, 78-97, 101-118, 138-160, 164-186, 212-234, 254-273, 280-298, 308-330, 343-365 and 370-392
568708006215	Signal peptide predicted for STM_MW13671 by SignalP 2.0 HMM (Signal peptide probability 0.826) with cleavage site probability 0.803 between residues 33 and 34
568708006216	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708006217	Major Facilitator Superfamily; Region: MFS_1; pfam07690
568708006218	putative substrate translocation pore; other site
568708006220	11 probable transmembrane helices predicted for STM_MW13681 by TMHMM2.0 at aa 9-31, 41-63, 75-97, 133-155, 160-179, 207-229, 250-269, 273-295, 300-322, 337-356 and 363-385
568708006221	Domain of unknown function (DUF1870); Region: DUF1870; pfam08965
568708006223	putative inner membrane protein; Provisional; Region: PRK10983
568708006224	Domain of unknown function DUF20; Region: UPF0118; pfam01594
568708006226	8 probable transmembrane helices predicted for STM_MW13701 by TMHMM2.0 at aa 13-32, 36-53, 65-87, 159-181, 202-224, 237-259, 266-288 and 308-330
568708006227	Signal peptide predicted for STM_MW13701 by SignalP 2.0 HMM (Signal peptide probability 0.608) with cleavage site probability 0.597 between residues 41 and 42
568708006228	FAD/FMN-containing dehydrogenases [Energy production and conversion]; Region: GlcD; COG0277
568708006229	FAD binding domain; Region: FAD_binding_4; pfam01565
568708006230	Fe-S oxidoreductase [Energy production and conversion]; Region: GlpC; COG0247
568708006233	PaaI_thioesterase is a tetrameric acyl-CoA thioesterase with a hot dog fold and one of several proteins responsible for phenylacetic acid (PA) degradation in bacteria.  Although orthologs of PaaI exist in archaea and eukaryotes, their function has not...; Region: PaaI_thioesterase; cd03443
568708006234	CoenzymeA binding site [chemical binding]; other site
568708006235	subunit interaction site [polypeptide binding]; other site
568708006236	PHB binding site; other site
568708006238	Predicted Na+/dicarboxylate symporter [General function prediction only]; Region: COG1823
568708006239	Na+/H+-dicarboxylate symporters [Energy production and conversion]; Region: GltP; COG1301
568708006241	11 probable transmembrane helices predicted for STM_MW13741 by TMHMM2.0 at aa 4-19, 32-51, 66-88, 101-123, 170-192, 220-242, 252-274, 286-308, 336-353, 358-380 and 384-406
568708006242	iron-sulfur cluster assembly scaffold protein; Provisional; Region: sufA; PRK09504
568708006244	cysteine desulfurase activator complex subunit SufB; Provisional; Region: PRK11814
568708006245	putative ABC transporter; Region: ycf24; CHL00085
568708006247	cysteine desulfurase ATPase component; Reviewed; Region: sufC; PRK09580
568708006248	ABC-type transport system involved in Fe-S cluster assembly, ATPase component; Region: ABC_FeS_Assembly; cd03217
568708006249	Walker A/P-loop; other site
568708006250	ATP binding site [chemical binding]; other site
568708006251	Q-loop/lid; other site
568708006252	ABC transporter signature motif; other site
568708006253	Walker B; other site
568708006254	D-loop; other site
568708006255	H-loop/switch region; other site
568708006257	cysteine desulfurase activator complex subunit SufD; Provisional; Region: PRK10948
568708006258	FeS assembly protein SufD; Region: sufD; TIGR01981
568708006260	Selenocysteine lyase/Cysteine desulfurase [Posttranslational modification, protein turnover, chaperones]; Region: csdA; COG0520
568708006261	Cysteine desulfurase (SufS)-like. This family belongs to the pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to cysteine desulfurase (SufS) and selenocysteine lyase. SufS...; Region: SufS_like; cd06453
568708006262	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
568708006263	catalytic residue [active]
568708006265	cysteine desufuration protein SufE; Provisional; Region: PRK09296
568708006267	L,D-transpeptidase; Provisional; Region: PRK10190
568708006268	Lysine Motif is a small domain involved in binding peptidoglycan; Region: LysM; cd00118
568708006269	L,D-transpeptidase catalytic domain; Region: YkuD; pfam03734
568708006270	Signal peptide predicted for STM_MW13811 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.697 between residues 23 and 24
568708006273	pyruvate kinase; Provisional; Region: PRK09206
568708006274	Pyruvate kinase (PK):  Large allosteric enzyme that regulates glycolysis through binding of the substrate, phosphoenolpyruvate, and one or more allosteric effectors. Like other allosteric enzymes, PK has a high substrate affinity R state and a low...; Region: Pyruvate_Kinase; cd00288
568708006275	active site
568708006276	domain interfaces; other site
568708006279	Amino acid transporters [Amino acid transport and metabolism]; Region: PotE; COG0531
568708006280	13 probable transmembrane helices predicted for STM_MW13841 by TMHMM2.0 at aa 10-32, 39-61, 71-93, 95-114, 119-138, 147-169, 184-206, 227-249, 273-295, 330-347, 357-379, 386-405 and 409-428
568708006282	proline-specific peptidase, Bacillus coagulans-type subfamily; Region: pro_imino_pep_2; TIGR01250
568708006284	A4 beta-galactosidase middle domain: a type 1 glutamine amidotransferase (GATase1)-like domain; Region: A4_beta-galactosidase_middle_domain; cd03143
568708006286	Transcriptional regulators of sugar metabolism [Transcription / Carbohydrate transport and metabolism]; Region: GlpR; COG1349
568708006287	helix_turn_helix, Deoxyribose operon repressor; Region: HTH_DEOR; smart00420
568708006288	Sugar kinases, ribokinase family [Carbohydrate transport and metabolism]; Region: RbsK; COG0524
568708006289	Ribokinase catalyses the phosphorylation of ribose to ribose-5-phosphate using ATP. This reaction is the first step in the ribose metabolism. It traps ribose within the cell after uptake and also prepares the sugar for use in the synthesis of nucleotides...; Region: ribokinase; cd01174
568708006290	substrate binding site [chemical binding]; other site
568708006291	dimer interface [polypeptide binding]; other site
568708006292	ATP binding site [chemical binding]; other site
568708006295	tetrathionate reductase subunit A; Provisional; Region: PRK14991
568708006296	The MopB_Tetrathionate-Ra CD contains tetrathionate reductase, subunit A, (TtrA) and other related proteins. The Salmonella enterica tetrathionate reductase catalyses the reduction of trithionate but not sulfur or thiosulfate. Members of this CD belong...; Region: MopB_Tetrathionate-Ra; cd02758
568708006297	putative [Fe4-S4] binding site [ion binding]; other site
568708006298	putative molybdopterin cofactor binding site [chemical binding]; other site
568708006299	This CD contains the molybdopterin_binding C-terminal (MopB_CT) region of tetrathionate reductase, subunit A, (TtrA); respiratory arsenate As(V) reductase, catalytic subunit (ArrA); and other related proteins; Region: MopB_CT_Tetrathionate_Arsenate-R; cd02780
568708006300	putative molybdopterin cofactor binding site; other site
568708006303	tetrathionate reductase subunit C; Provisional; Region: PRK14992
568708006304	Polysulphide reductase, NrfD; Region: NrfD; pfam03916
568708006306	9 probable transmembrane helices predicted for STM_MW13891 by TMHMM2.0 at aa 23-45, 58-77, 92-114, 126-148, 163-185, 197-216, 236-255, 267-289 and 309-326
568708006307	tetrathionate reductase subunit B; Provisional; Region: PRK14993
568708006308	4Fe-4S binding domain; Region: Fer4; pfam00037
568708006310	ABC transporter, phosphonate, periplasmic substrate-binding protein; Region: Phosphonate-bd; pfam12974
568708006311	TRAP transporter solute receptor, TAXI family; Region: TRAP_TAXI; TIGR02122
568708006312	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
568708006313	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
568708006314	dimer interface [polypeptide binding]; other site
568708006315	phosphorylation site [posttranslational modification]
568708006316	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708006317	ATP binding site [chemical binding]; other site
568708006318	Mg2+ binding site [ion binding]; other site
568708006319	G-X-G motif; other site
568708006320	Signal peptide predicted for STM_MW13911 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 24 and 25
568708006321	2 probable transmembrane helices predicted for STM_MW13911 by TMHMM2.0 at aa 9-31 and 305-327
568708006324	Response regulator [Signal transduction mechanisms]; Region: TtrR; COG4566
568708006325	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708006326	active site
568708006327	phosphorylation site [posttranslational modification]
568708006328	intermolecular recognition site; other site
568708006329	dimerization interface [polypeptide binding]; other site
568708006330	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
568708006331	DNA binding residues [nucleotide binding]
568708006332	dimerization interface [polypeptide binding]; other site
568708006335	hypothetical protein; Provisional; Region: PRK10292
568708006337	Uncharacterized conserved protein [Function unknown]; Region: COG1683
568708006338	Uncharacterized conserved protein [Function unknown]; Region: COG3272
568708006339	Protein of unknown function (DUF1722); Region: DUF1722; cl01284
568708006342	transcriptional regulator MirA; Provisional; Region: PRK15043
568708006343	Helix-Turn-Helix DNA binding domain of the transcription regulators MlrA and CarA; Region: HTH_MlrA-CarA; cd01104
568708006344	DNA binding residues [nucleotide binding]
568708006346	two component system sensor kinase SsrB; Provisional; Region: PRK15369
568708006347	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708006348	active site
568708006349	phosphorylation site [posttranslational modification]
568708006350	intermolecular recognition site; other site
568708006351	dimerization interface [polypeptide binding]; other site
568708006352	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
568708006353	DNA binding residues [nucleotide binding]
568708006354	dimerization interface [polypeptide binding]; other site
568708006357	two component system sensor kinase SsrA; Provisional; Region: PRK15347
568708006358	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
568708006359	dimerization interface [polypeptide binding]; other site
568708006360	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
568708006361	dimer interface [polypeptide binding]; other site
568708006362	phosphorylation site [posttranslational modification]
568708006363	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708006364	ATP binding site [chemical binding]; other site
568708006365	Mg2+ binding site [ion binding]; other site
568708006366	G-X-G motif; other site
568708006367	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708006368	active site
568708006369	phosphorylation site [posttranslational modification]
568708006370	intermolecular recognition site; other site
568708006371	dimerization interface [polypeptide binding]; other site
568708006376	1 probable transmembrane helix predicted for STM_MW13971 by TMHMM2.0 at aa 20-42
568708006377	Signal peptide predicted for STM_MW13971 by SignalP 2.0 HMM (Signal peptide probability 0.976) with cleavage site probability 0.442 between residues 36 and 37
568708006378	pathogenicity island chaperone protein SpiC; Provisional; Region: PRK15368
568708006379	outer membrane secretin SsaC; Provisional; Region: PRK15346
568708006380	Bacterial type II/III secretion system short domain; Region: Secretin_N; pfam03958
568708006381	Bacterial type II and III secretion system protein; Region: Secretin; pfam00263
568708006384	type III secretion system protein SsaD; Provisional; Region: PRK15367
568708006385	type III secretion apparatus protein, YscD/HrpQ family; Region: type_III_yscD; TIGR02500
568708006386	1 probable transmembrane helix predicted for STM_MW14001 by TMHMM2.0 at aa 117-139
568708006387	type III secretion system chaperone SsaE; Provisional; Region: PRK15366
568708006389	type III secretion system chaperone SseA; Provisional; Region: PRK15365
568708006390	pathogenicity island 2 effector protein SseB; Provisional; Region: PRK15364
568708006392	pathogenicity island 2 chaperone protein SscA; Provisional; Region: PRK15363
568708006394	pathogenicity island 2 effector protein SseC; Provisional; Region: PRK15362
568708006396	pathogenicity island 2 effector protein SseD; Provisional; Region: PRK15361
568708006397	pathogenicity island 2 effector protein SseE; Provisional; Region: PRK15360
568708006399	type III secretion system chaperone protein SscB; Provisional; Region: PRK15359
568708006400	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
568708006401	TPR motif; other site
568708006402	binding surface
568708006404	pathogenicity island 2 effector protein SseF; Provisional; Region: PRK15358
568708006405	2 probable transmembrane helices predicted for STM_MW14091 by TMHMM2.0 at aa 64-86 and 90-112
568708006406	pathogenicity island 2 effector protein SseG; Provisional; Region: PRK15357
568708006407	2 probable transmembrane helices predicted for STM_MW14101 by TMHMM2.0 at aa 65-87 and 97-116
568708006408	type III secretion system needle protein SsaG; Provisional; Region: PRK15344
568708006410	type III secretion system protein SsaH; Provisional; Region: PRK15356
568708006412	type III secretion system protein SsaI; Provisional; Region: PRK15355
568708006414	type III secretion system lipoprotein SsaJ; Provisional; Region: PRK15348
568708006415	Signal peptide predicted for STM_MW14141 by SignalP 2.0 HMM (Signal peptide probability 0.756) with cleavage site probability 0.748 between residues 18 and 19
568708006417	1 probable transmembrane helix predicted for STM_MW14141 by TMHMM2.0 at aa 223-245
568708006418	Type III secretion system subunit; Region: T3SS_LEE_assoc; pfam13327
568708006419	type III secretion system protein SsaK; Provisional; Region: PRK15354
568708006420	type III secretion apparatus protein, HrpE/YscL family; Region: HrpE_YscL_not; TIGR02499
568708006421	type III secretion system protein SsaL; Provisional; Region: PRK15345
568708006422	HrpJ-like domain; Region: HrpJ; pfam07201
568708006423	TyeA; Region: TyeA; cl07611
568708006425	type III secretion system protein SsaM; Provisional; Region: PRK15353
568708006426	secretion system apparatus protein SsaV; Provisional; Region: PRK12720
568708006427	FHIPEP family; Region: FHIPEP; pfam00771
568708006428	6 probable transmembrane helices predicted for STM_MW14191 by TMHMM2.0 at aa 24-41, 48-67, 115-137, 206-228, 248-270 and 291-313
568708006430	type III secretion system ATPase SsaN; Validated; Region: PRK07594
568708006431	RecA-like NTPases. This family includes the NTP binding domain of F1 and V1 H+ATPases, DnaB and related helicases as well as bacterial RecA and related eukaryotic and archaeal recombinases. This group also includes bacterial conjugation proteins and...; Region: RecA-like_NTPases; cl17233
568708006432	Walker A motif; other site
568708006433	ATP binding site [chemical binding]; other site
568708006434	Walker B motif; other site
568708006436	type III secretion system protein SsaO; Provisional; Region: PRK15352
568708006437	type III secretion system protein SsaP; Provisional; Region: PRK15351
568708006438	type III secretion system protein SsaQ; Validated; Region: PRK08035
568708006439	Uncharacterized protein conserved in bacteria (DUF2057); Region: DUF2057; cl11437
568708006440	Flagellar motor switch/type III secretory pathway protein [Cell motility and secretion / Intracellular trafficking and secretion]; Region: FliN; COG1886
568708006442	Type III secretory pathway, component EscR [Intracellular trafficking and secretion]; Region: EscR; COG4790
568708006443	4 probable transmembrane helices predicted for STM_MW14241 by TMHMM2.0 at aa 10-31, 52-74, 154-176 and 189-211
568708006445	type III secretion system protein SsaS; Provisional; Region: PRK15350
568708006447	2 probable transmembrane helices predicted for STM_MW14251 by TMHMM2.0 at aa 13-35 and 55-77
568708006448	type III secretion system protein SsaT; Provisional; Region: PRK15349
568708006450	6 probable transmembrane helices predicted for STM_MW14261 by TMHMM2.0 at aa 7-29, 34-56, 68-90, 129-151, 183-205 and 215-237
568708006451	secretion system apparatus protein SsaU; Reviewed; Region: PRK12721
568708006452	Uncharacterized homolog of the cytoplasmic domain of flagellar protein FhlB [Function unknown]; Region: COG2257; cl15822
568708006454	4 probable transmembrane helices predicted for STM_MW14271 by TMHMM2.0 at aa 21-43, 86-108, 146-168 and 178-200
568708006455	multidrug efflux protein; Reviewed; Region: PRK01766
568708006456	Subfamily of the multidrug and toxic compound extrusion (MATE)-like proteins similar to Vibrio cholerae NorM; Region: MATE_NorM_like; cd13131
568708006457	cation binding site [ion binding]; other site
568708006459	12 probable transmembrane helices predicted for STM_MW14281 by TMHMM2.0 at aa 12-34, 44-66, 91-113, 128-147, 160-180, 190-212, 241-263, 278-300, 313-335, 350-367, 387-409 and 419-438
568708006460	Signal peptide predicted for STM_MW14281 by SignalP 2.0 HMM (Signal peptide probability 0.836) with cleavage site probability 0.480 between residues 26 and 27
568708006461	riboflavin synthase subunit alpha; Provisional; Region: PRK13020
568708006462	Lumazine binding domain; Region: Lum_binding; pfam00677
568708006463	Lumazine binding domain; Region: Lum_binding; pfam00677
568708006465	cyclopropane fatty acyl phospholipid synthase; Provisional; Region: PRK11705
568708006466	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708006467	S-adenosylmethionine binding site [chemical binding]; other site
568708006469	putative transporter; Provisional; Region: PRK11043
568708006470	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708006471	putative substrate translocation pore; other site
568708006473	11 probable transmembrane helices predicted for STM_MW14311 by TMHMM2.0 at aa 7-29, 39-61, 73-92, 97-119, 132-154, 159-178, 208-230, 235-257, 270-292, 296-318 and 339-361
568708006474	Signal peptide predicted for STM_MW14311 by SignalP 2.0 HMM (Signal peptide probability 0.933) with cleavage site probability 0.917 between residues 30 and 31
568708006475	putative DNA-binding transcriptional regulator; Provisional; Region: PRK11074
568708006476	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708006477	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
568708006478	dimerization interface [polypeptide binding]; other site
568708006481	DNA-binding transcriptional repressor PurR; Provisional; Region: PRK10703
568708006482	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
568708006483	DNA binding site [nucleotide binding]
568708006484	domain linker motif; other site
568708006485	Ligand-binding domain of purine repressor, PurR, which functions as the master regulatory protein of de novo purine nucleotide biosynthesis in Escherichia coli; Region: PBP1_PurR; cd06275
568708006486	dimerization interface [polypeptide binding]; other site
568708006487	ligand binding site [chemical binding]; other site
568708006490	superoxide dismutase; Provisional; Region: PRK10543
568708006491	Iron/manganese superoxide dismutases, alpha-hairpin domain; Region: Sod_Fe_N; pfam00081
568708006492	Iron/manganese superoxide dismutases, C-terminal domain; Region: Sod_Fe_C; pfam02777
568708006495	Cell wall-associated hydrolases (invasion-associated proteins) [Cell envelope biogenesis, outer membrane]; Region: Spr; COG0791
568708006496	NlpC/P60 family; Region: NLPC_P60; pfam00877
568708006498	Signal peptide predicted for STM_MW14351 by SignalP 2.0 HMM (Signal peptide probability 0.985) with cleavage site probability 0.814 between residues 38 and 39
568708006499	Glutaredoxin (GRX) family, PKC-interacting cousin of TRX (PICOT)-like subfamily; composed of PICOT and GRX-PICOT-like proteins. The non-PICOT members of this family contain only the GRX-like domain, whereas PICOT contains an N-terminal TRX-like domain...; Region: GRX_PICOT_like; cd03028
568708006500	putative GSH binding site [chemical binding]; other site
568708006501	catalytic residues [active]
568708006503	DNA polymerase III, epsilon subunit and related 3'-5' exonucleases [DNA replication, recombination, and repair]; Region: DnaQ; COG0847
568708006504	DEDDh 3'-5' exonuclease domain of RNase T; Region: RNaseT; cd06134
568708006505	dimer interface [polypeptide binding]; other site
568708006506	catalytic site [active]
568708006507	putative active site [active]
568708006508	putative substrate binding site [chemical binding]; other site
568708006510	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
568708006511	Glyoxalase I catalyzes the isomerization of the hemithioacetal, formed by a 2-oxoaldehyde and glutathione, to S-D-lactoylglutathione; Region: Glyoxalase_I; cd07233
568708006512	dimer interface [polypeptide binding]; other site
568708006513	active site
568708006514	metal binding site [ion binding]; metal-binding site
568708006515	glutathione binding site [chemical binding]; other site
568708006517	NADH:flavin oxidoreductases, Old Yellow Enzyme family [Energy production and conversion]; Region: NemA; COG1902
568708006518	Old yellow enzyme (OYE)-like FMN binding domain. OYE was the first flavin-dependent enzyme identified, however its true physiological role remains elusive to this day. Each monomer of OYE contains FMN as a non-covalently bound cofactor, uses NADPH as a...; Region: OYE_like_FMN; cd02933
568708006519	FMN binding site [chemical binding]; other site
568708006520	active site
568708006521	substrate binding site [chemical binding]; other site
568708006522	catalytic residue [active]
568708006524	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
568708006525	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
568708006527	Predicted Fe-S protein [General function prediction only]; Region: COG3313
568708006529	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660
568708006530	Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248
568708006531	active site
568708006532	catalytic tetrad [active]
568708006534	Cu/Zn superoxide dismutase [Inorganic ion transport and metabolism]; Region: SodC; COG2032
568708006535	Copper/zinc superoxide dismutase (SOD). superoxide dismutases catalyse the conversion of superoxide radicals to molecular oxygen. Three evolutionarily distinct families of SODs are known, of which the copper/zinc-binding family is one. Defects in the...; Region: Cu-Zn_Superoxide_Dismutase; cd00305
568708006536	E-class dimer interface [polypeptide binding]; other site
568708006537	P-class dimer interface [polypeptide binding]; other site
568708006538	active site
568708006539	Cu2+ binding site [ion binding]; other site
568708006540	Zn2+ binding site [ion binding]; other site
568708006541	Signal peptide predicted for STM_MW14431 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.974 between residues 19 and 20
568708006543	Fusaric acid resistance protein family; Region: FUSC; pfam04632
568708006544	Fusaric acid resistance protein-like; Region: FUSC_2; pfam13515
568708006546	12 probable transmembrane helices predicted for STM_MW14441 by TMHMM2.0 at aa 23-41, 46-65, 72-90, 94-113, 120-142, 157-179, 362-381, 385-404, 411-433, 438-455, 462-481 and 496-515
568708006547	Multidrug resistance efflux pump [Defense mechanisms]; Region: EmrA; COG1566
568708006548	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
568708006549	HlyD family secretion protein; Region: HlyD_3; pfam13437
568708006551	1 probable transmembrane helix predicted for STM_MW14451 by TMHMM2.0 at aa 20-42
568708006552	Protein of unknown function (DUF1656); Region: DUF1656; pfam07869
568708006553	2 probable transmembrane helices predicted for STM_MW14461 by TMHMM2.0 at aa 18-40 and 53-75
568708006555	transcriptional regulator SlyA; Provisional; Region: PRK03573
568708006556	Winged helix DNA-binding domain; Region: HTH_27; pfam13463
568708006558	Outer membrane lipoprotein [Cell envelope biogenesis, outer membrane]; Region: SlyB; COG3133
568708006559	Signal peptide predicted for STM_MW14481 by SignalP 2.0 HMM (Signal peptide probability 0.990) with cleavage site probability 0.725 between residues 21 and 22
568708006560	Uncharacterized protein family (UPF0075); Region: UPF0075; pfam03702
568708006562	lysozyme inhibitor; Provisional; Region: PRK11372
568708006563	Membrane-bound lysozyme-inhibitor of c-type lysozyme; Region: MliC; pfam09864
568708006564	Signal peptide predicted for STM_MW14501 by SignalP 2.0 HMM (Signal peptide probability 0.703) with cleavage site probability 0.553 between residues 22 and 23
568708006566	pyridoxamine 5'-phosphate oxidase; Provisional; Region: PRK05679
568708006567	Pyridoxamine 5'-phosphate oxidase; Region: Pyridox_oxidase; pfam01243
568708006568	Pyridoxine 5'-phosphate oxidase C-terminal dimerisation region; Region: PNPOx_C; pfam10590
568708006571	tyrosyl-tRNA synthetase; Validated; Region: PRK05912
568708006572	catalytic core domain of tyrosinyl-tRNA synthetase; Region: TyrRS_core; cd00805
568708006573	active site
568708006574	HIGH motif; other site
568708006575	dimer interface [polypeptide binding]; other site
568708006576	KMSKS motif; other site
568708006577	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
568708006578	RNA binding surface [nucleotide binding]; other site
568708006581	pyridoxamine kinase; Validated; Region: PRK05756
568708006582	Pyridoxal kinase plays a key role in the synthesis of the active coenzyme pyridoxal-5'-phosphate  (PLP), by catalyzing the phosphorylation of the precursor vitamin B6  in the presence of Zn2+ and ATP. Mammals are unable to synthesize PLP de novo and...; Region: pyridoxal_pyridoxamine_kinase; cd01173
568708006583	dimer interface [polypeptide binding]; other site
568708006584	pyridoxal binding site [chemical binding]; other site
568708006585	ATP binding site [chemical binding]; other site
568708006587	glutathionine S-transferase; Provisional; Region: PRK10542
568708006588	GST_N family, Class Beta subfamily; GSTs are cytosolic dimeric proteins involved in cellular detoxification by catalyzing the conjugation of glutathione (GSH) with a wide range of endogenous and xenobiotic alkylating agents, including carcinogens; Region: GST_N_Beta; cd03057
568708006589	C-terminal domain interface [polypeptide binding]; other site
568708006590	GSH binding site (G-site) [chemical binding]; other site
568708006591	dimer interface [polypeptide binding]; other site
568708006592	C-terminal, alpha helical domain of Class Beta Glutathione S-transferases; Region: GST_C_Beta; cd03188
568708006593	dimer interface [polypeptide binding]; other site
568708006594	N-terminal domain interface [polypeptide binding]; other site
568708006595	substrate binding pocket (H-site) [chemical binding]; other site
568708006598	Dipeptide/tripeptide permease [Amino acid transport and metabolism]; Region: PTR2; COG3104
568708006599	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708006600	putative substrate translocation pore; other site
568708006601	POT family; Region: PTR2; pfam00854
568708006602	14 probable transmembrane helices predicted for STM_MW14551 by TMHMM2.0 at aa 22-44, 59-81, 90-107, 112-129, 150-172, 177-199, 220-239, 244-261, 274-296, 323-340, 353-371, 386-408, 415-437 and 457-479
568708006604	endonuclease III; Provisional; Region: PRK10702
568708006605	endonuclease III; includes endonuclease III (DNA-(apurinic or apyrimidinic site) lyase), alkylbase DNA glycosidases (Alka-family) and other DNA glycosidases; Region: ENDO3c; cd00056
568708006606	minor groove reading motif; other site
568708006607	helix-hairpin-helix signature motif; other site
568708006608	substrate binding pocket [chemical binding]; other site
568708006609	active site
568708006610	iron-sulpphur binding domain in DNA-(apurinic or apyrimidinic site) lyase (subfamily of ENDO3); Region: FES; smart00525
568708006614	electron transport complex RsxE subunit; Provisional; Region: PRK12405
568708006616	5 probable transmembrane helices predicted for STM_MW14571 by TMHMM2.0 at aa 34-56, 69-87, 91-113, 126-148 and 183-205
568708006617	electron transport complex protein RnfG; Validated; Region: PRK01908
568708006619	Signal peptide predicted for STM_MW14581 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.958 between residues 24 and 25
568708006620	electron transport complex protein RnfD; Reviewed; Region: rnfD; PRK00816
568708006622	10 probable transmembrane helices predicted for STM_MW14591 by TMHMM2.0 at aa 20-39, 43-62, 69-91, 95-117, 124-146, 214-236, 243-262, 272-294, 301-318 and 323-342
568708006623	Signal peptide predicted for STM_MW14591 by SignalP 2.0 HMM (Signal peptide probability 0.971) with cleavage site probability 0.568 between residues 33 and 34
568708006624	Predicted NADH:ubiquinone oxidoreductase, subunit RnfC [Energy production and conversion]; Region: RnfC; COG4656
568708006625	SLBB domain; Region: SLBB; pfam10531
568708006626	The HCP family of iron-sulfur proteins includes hybrid cluster protein (HCP), acetyl-CoA synthase (ACS), and carbon monoxide dehydrogenase (CODH), all of which contain [Fe4-S4] metal clusters at their active sites. These proteins have a conserved...; Region: HCP_like; cl14655
568708006629	electron transport complex protein RnfB; Provisional; Region: PRK05113
568708006630	Putative Fe-S cluster; Region: FeS; cl17515
568708006631	4Fe-4S binding domain; Region: Fer4; pfam00037
568708006634	Signal peptide predicted for STM_MW14611 by SignalP 2.0 HMM (Signal peptide probability 0.995) with cleavage site probability 0.876 between residues 30 and 31
568708006635	1 probable transmembrane helix predicted for STM_MW14611 by TMHMM2.0 at aa 4-26
568708006636	electron transport complex protein RsxA; Provisional; Region: PRK05151
568708006638	6 probable transmembrane helices predicted for STM_MW14621 by TMHMM2.0 at aa 5-27, 42-64, 69-88, 103-125, 132-154 and 169-191
568708006639	Protein of unknown function (DUF2569); Region: DUF2569; pfam10754
568708006641	4 probable transmembrane helices predicted for STM_MW14631 by TMHMM2.0 at aa 13-35, 55-77, 90-109 and 114-133
568708006642	Signal peptide predicted for STM_MW14631 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.785 between residues 39 and 40
568708006643	oriC-binding nucleoid-associated protein; Provisional; Region: PRK10391
568708006645	putative oxidoreductase; Provisional; Region: PRK11579
568708006646	Oxidoreductase family, NAD-binding Rossmann fold; Region: GFO_IDH_MocA; pfam01408
568708006647	Oxidoreductase family, C-terminal alpha/beta domain; Region: GFO_IDH_MocA_C; pfam02894
568708006650	Adenosine deaminase [Nucleotide transport and metabolism]; Region: Add; COG1816
568708006651	Adenosine deaminase (ADA) is a monomeric zinc dependent enzyme which catalyzes the irreversible hydrolytic deamination of both adenosine, as well as desoxyadenosine, to ammonia and inosine or desoxyinosine, respectively. ADA plays an important role in...; Region: ADA; cd01320
568708006652	active site
568708006653	purine riboside binding site [chemical binding]; other site
568708006655	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG5339
568708006656	Bacterial protein of unknown function (DUF945); Region: DUF945; pfam06097
568708006658	Signal peptide predicted for STM_MW14671 by SignalP 2.0 HMM (Signal peptide probability 0.945) with cleavage site probability 0.863 between residues 19 and 20
568708006659	mannose-6-phosphate isomerase; Provisional; Region: PRK15131
568708006660	Alpha-Mannosidase Binding Domain of Atg19/34; Region: ABD; cl15429
568708006661	Alpha-Mannosidase Binding Domain of Atg19/34; Region: ABD; cl15429
568708006663	fumarate hydratase; Provisional; Region: PRK15389
568708006664	Tartrate dehydratase alpha subunit/Fumarate hydratase class I, N-terminal domain [Energy production and conversion]; Region: TtdA; COG1951
568708006665	Fumarase C-terminus; Region: Fumerase_C; pfam05683
568708006668	fumarate hydratase; Reviewed; Region: fumC; PRK00485
568708006669	Class II fumarases; Region: Fumarase_classII; cd01362
568708006670	active site
568708006671	tetramer interface [polypeptide binding]; other site
568708006674	DNA replication terminus site-binding protein; Provisional; Region: PRK02951
568708006676	sensor protein RstB; Provisional; Region: PRK10604
568708006677	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
568708006678	dimerization interface [polypeptide binding]; other site
568708006679	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
568708006680	dimer interface [polypeptide binding]; other site
568708006681	phosphorylation site [posttranslational modification]
568708006682	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708006683	ATP binding site [chemical binding]; other site
568708006684	Mg2+ binding site [ion binding]; other site
568708006685	G-X-G motif; other site
568708006687	2 probable transmembrane helices predicted for STM_MW14721 by TMHMM2.0 at aa 5-27 and 139-156
568708006689	Signal peptide predicted for STM_MW14721 by SignalP 2.0 HMM (Signal peptide probability 0.881) with cleavage site probability 0.715 between residues 28 and 29
568708006690	Predicted metal-dependent hydrolase with the TIM-barrel fold [General function prediction only]; Region: COG1574
568708006691	YtcJ_like metal dependent amidohydrolases. YtcJ is a Bacillus subtilis ORF of unknown function. The Arabidopsis homolog LAF3 has been identified as a factor required for photochrome A signalling; Region: YtcJ_like; cd01300
568708006692	active site
568708006694	Outer membrane protein (porin) [Cell envelope biogenesis, outer membrane]; Region: OmpC; COG3203
568708006695	Porins form aqueous channels for the diffusion of small hydrophillic molecules across the outer membrane. Individual 16-strand anti-parallel beta-barrels form a central pore, and trimerizes thru mainly hydrophobic interactions at the interface. Trimers...; Region: gram_neg_porins; cd00342
568708006696	trimer interface [polypeptide binding]; other site
568708006697	eyelet of channel; other site
568708006699	1 probable transmembrane helix predicted for STM_MW14741 by TMHMM2.0 at aa 5-22
568708006700	Signal peptide predicted for STM_MW14741 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 21 and 22
568708006701	DNA-binding transcriptional regulator RstA; Provisional; Region: PRK10701
568708006702	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708006703	active site
568708006704	phosphorylation site [posttranslational modification]
568708006705	intermolecular recognition site; other site
568708006706	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
568708006707	DNA binding site [nucleotide binding]
568708006710	GlpM protein; Region: GlpM; pfam06942
568708006711	4 probable transmembrane helices predicted for STM_MW14761 by TMHMM2.0 at aa 2-21, 25-47, 59-81 and 86-108
568708006713	transporter, basic amino acid/polyamine antiporter (APA) family; Region: 2A0302; TIGR00905
568708006714	Spore germination protein; Region: Spore_permease; cl17796
568708006715	13 probable transmembrane helices predicted for STM_MW14771 by TMHMM2.0 at aa 5-27, 37-59, 90-112, 127-149, 156-178, 205-222, 235-257, 277-299, 332-351, 356-378, 385-403, 408-427 and 440-459
568708006717	Signal peptide predicted for STM_MW14771 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.401 between residues 31 and 32
568708006718	Protein of unknown function (DUF1471); Region: DUF1471; pfam07338
568708006719	Protein of unknown function (DUF1471); Region: DUF1471; pfam07338
568708006720	Protein of unknown function (DUF1471); Region: DUF1471; pfam07338
568708006722	Signal peptide predicted for STM_MW14781 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 22 and 23
568708006723	NAD(P) transhydrogenase subunit alpha; Provisional; Region: pntA; PRK09424
568708006724	Rubrum transdehydrogenase NAD-binding and catalytic domains; Region: Rubrum_tdh; cd05304
568708006725	ligand binding site [chemical binding]; other site
568708006726	homodimer interface [polypeptide binding]; other site
568708006727	NAD(P) binding site [chemical binding]; other site
568708006728	trimer interface B [polypeptide binding]; other site
568708006729	trimer interface A [polypeptide binding]; other site
568708006730	Domain of unknown function (DUF3814); Region: DUF3814; pfam12769
568708006733	5 probable transmembrane helices predicted for STM_MW14791 by TMHMM2.0 at aa 169-191, 402-419, 423-445, 452-471 and 476-498
568708006734	pyridine nucleotide transhydrogenase; Provisional; Region: pntB; PRK09444
568708006735	NAD(P) transhydrogenase beta subunit; Region: PNTB; pfam02233
568708006736	9 probable transmembrane helices predicted for STM_MW14801 by TMHMM2.0 at aa 5-24, 33-50, 55-72, 85-107, 122-144, 164-181, 185-207, 214-236 and 240-259
568708006738	pheromone autoinducer 2 transporter; Reviewed; Region: tqsA; PRK12287
568708006739	Domain of unknown function DUF20; Region: UPF0118; pfam01594
568708006741	8 probable transmembrane helices predicted for STM_MW14811 by TMHMM2.0 at aa 5-24, 29-51, 63-85, 144-166, 196-218, 222-244, 257-279 and 299-321
568708006742	Signal peptide predicted for STM_MW14811 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.999 between residues 30 and 31
568708006743	multidrug efflux system protein MdtJ; Provisional; Region: PRK10452
568708006744	4 probable transmembrane helices predicted for STM_MW14821 by TMHMM2.0 at aa 2-19, 29-51, 56-78 and 82-101
568708006746	multidrug efflux system protein MdtI; Provisional; Region: PRK10650
568708006748	4 probable transmembrane helices predicted for STM_MW14831 by TMHMM2.0 at aa 10-29, 36-53, 63-85 and 92-106
568708006749	V8-like Glu-specific endopeptidase [Amino acid transport and metabolism]; Region: COG3591
568708006751	Signal peptide predicted for STM_MW14841 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.625 between residues 19 and 20
568708006753	1 probable transmembrane helix predicted for STM_MW14851 by TMHMM2.0 at aa 16-38
568708006754	Signal peptide predicted for STM_MW14851 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 33 and 34
568708006755	Arabinose efflux permease [Carbohydrate transport and metabolism]; Region: AraJ; COG2814
568708006756	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708006757	putative substrate translocation pore; other site
568708006758	12 probable transmembrane helices predicted for STM_MW14861 by TMHMM2.0 at aa 37-59, 74-95, 102-124, 128-150, 157-179, 189-211, 240-262, 272-291, 304-323, 328-350, 363-385 and 389-411
568708006760	DNA-binding transcriptional activator XapR; Provisional; Region: PRK09986
568708006761	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708006762	The C-terminal substrate binding domain of LysR-type transcriptional regulators involved in the catabolism of aromatic compounds and that of other related regulators, contains type 2 periplasmic binding fold; Region: PBP2_LTTR_aromatics_like; cd08414
568708006763	dimerization interface [polypeptide binding]; other site
568708006764	substrate binding pocket [chemical binding]; other site
568708006767	Iron dependent repressor, N-terminal DNA binding domain; Region: Fe_dep_repress; pfam01325
568708006768	Transcriptional regulator/sugar kinase [Transcription / Carbohydrate transport and metabolism]; Region: NagC; COG1940
568708006769	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cd00012
568708006771	putative dithiobiotin synthetase; Provisional; Region: PRK12374
568708006772	AAA domain; Region: AAA_26; pfam13500
568708006774	CLC voltage-gated chloride channel. The ClC chloride channels catalyse the selective flow of Cl- ions across cell membranes, thereby regulating electrical excitation in skeletal muscle and the flow of salt and water across epithelial barriers. This...; Region: Voltage_gated_ClC; cd00400
568708006775	Chloride channel protein EriC [Inorganic ion transport and metabolism]; Region: EriC; COG0038
568708006776	Cl- selectivity filter; other site
568708006777	Cl- binding residues [ion binding]; other site
568708006778	pore gating glutamate residue; other site
568708006779	dimer interface [polypeptide binding]; other site
568708006780	10 probable transmembrane helices predicted for STM_MW14901 by TMHMM2.0 at aa 12-34, 66-83, 158-180, 185-207, 234-256, 271-293, 300-322, 332-354, 361-383 and 398-416
568708006782	Signal peptide predicted for STM_MW14901 by SignalP 2.0 HMM (Signal peptide probability 0.995) with cleavage site probability 0.860 between residues 37 and 38
568708006783	ABC-type proline/glycine betaine transport systems, ATPase components [Amino acid transport and metabolism]; Region: OpuBA; COG1125
568708006784	ATP-binding cassette domain of the osmoprotectant transporter; Region: ABC_OpuCA_Osmoprotection; cd03295
568708006785	Walker A/P-loop; other site
568708006786	ATP binding site [chemical binding]; other site
568708006787	Q-loop/lid; other site
568708006788	ABC transporter signature motif; other site
568708006789	Walker B; other site
568708006790	D-loop; other site
568708006791	H-loop/switch region; other site
568708006792	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains in association with the ABC transporter OpuCA. OpuCA is the ATP binding component of a bacterial solute transporter that serves a protective role to cells growing...; Region: CBS_pair_ABC_OpuCA_assoc; cd04582
568708006795	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708006796	dimer interface [polypeptide binding]; other site
568708006797	conserved gate region; other site
568708006798	ABC-ATPase subunit interface; other site
568708006799	5 probable transmembrane helices predicted for STM_MW14921 by TMHMM2.0 at aa 22-44, 51-73, 78-100, 149-171 and 181-203
568708006801	Periplasmic glycine betaine/choline-binding (lipo)protein of an ABC-type transport system (osmoprotectant binding protein) [Cell envelope biogenesis, outer membrane]; Region: OpuBC; COG1732
568708006803	Signal peptide predicted for STM_MW14931 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 23 and 24
568708006804	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708006805	dimer interface [polypeptide binding]; other site
568708006806	conserved gate region; other site
568708006807	putative PBP binding loops; other site
568708006808	ABC-ATPase subunit interface; other site
568708006809	6 probable transmembrane helices predicted for STM_MW14941 by TMHMM2.0 at aa 9-31, 46-68, 89-111, 126-145, 173-195 and 205-227
568708006811	Signal peptide predicted for STM_MW14941 by SignalP 2.0 HMM (Signal peptide probability 0.819) with cleavage site probability 0.629 between residues 26 and 27
568708006812	twin-argninine leader-binding protein DmsD; Provisional; Region: PRK11621
568708006814	DMSO reductase anchor subunit [General function prediction only]; Region: DmsC; COG3302
568708006816	8 probable transmembrane helices predicted for STM_MW14961 by TMHMM2.0 at aa 10-32, 44-66, 88-107, 114-136, 151-173, 180-202, 222-244 and 251-273
568708006817	DMSO reductase, iron-sulfur subunit; Region: DMSO_dmsB; TIGR02951
568708006818	4Fe-4S binding domain; Region: Fer4; pfam00037
568708006820	anaerobic dimethyl sulfoxide reductase, A subunit, DmsA/YnfE family; Region: dmsA_ynfE; TIGR02166
568708006821	This CD (MopB_DmsA-EC) includes the DmsA enzyme of the dmsABC operon encoding the anaerobic dimethylsulfoxide reductase (DMSOR) of Escherichia coli and other related DMSOR-like enzymes. Unlike other DMSOR-like enzymes, this group has a  predicted...; Region: MopB_DmsA-EC; cd02770
568708006822	putative [Fe4-S4] binding site [ion binding]; other site
568708006823	putative molybdopterin cofactor binding site [chemical binding]; other site
568708006824	The MopB_CT_DmsA-EC CD includes the DmsA enzyme of the dmsABC operon encoding the anaerobic dimethylsulfoxide reductase (DMSOR) of Escherichia coli and other related DMSOR-like enzymes. Unlike other DMSOR-like enzymes, this group has a  predicted...; Region: MopB_CT_DmsA-EC; cd02794
568708006825	putative molybdopterin cofactor binding site; other site
568708006829	Signal peptide predicted for STM_MW14981 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.994 between residues 45 and 46
568708006830	anaerobic dimethyl sulfoxide reductase, A subunit, DmsA/YnfE family; Region: dmsA_ynfE; TIGR02166
568708006831	This CD (MopB_DmsA-EC) includes the DmsA enzyme of the dmsABC operon encoding the anaerobic dimethylsulfoxide reductase (DMSOR) of Escherichia coli and other related DMSOR-like enzymes. Unlike other DMSOR-like enzymes, this group has a  predicted...; Region: MopB_DmsA-EC; cd02770
568708006832	putative [Fe4-S4] binding site [ion binding]; other site
568708006833	putative molybdopterin cofactor binding site [chemical binding]; other site
568708006834	The MopB_CT_DmsA-EC CD includes the DmsA enzyme of the dmsABC operon encoding the anaerobic dimethylsulfoxide reductase (DMSOR) of Escherichia coli and other related DMSOR-like enzymes. Unlike other DMSOR-like enzymes, this group has a  predicted...; Region: MopB_CT_DmsA-EC; cd02794
568708006835	putative molybdopterin cofactor binding site; other site
568708006839	Signal peptide predicted for STM_MW14991 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.843 between residues 43 and 44
568708006840	1 probable transmembrane helix predicted for STM_MW14991 by TMHMM2.0 at aa 21-43
568708006841	Protein of unknown function (DUF1161); Region: DUF1161; pfam06649
568708006843	Signal peptide predicted for STM_MW15001 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 22 and 23
568708006844	Uncharacterized protein family (UPF0257); Region: UPF0257; pfam06788
568708006845	Signal peptide predicted for STM_MW15011 by SignalP 2.0 HMM (Signal peptide probability 0.756) with cleavage site probability 0.676 between residues 19 and 20
568708006847	spermidine N1-acetyltransferase; Provisional; Region: PRK15130
568708006848	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
568708006849	Coenzyme A binding pocket [chemical binding]; other site
568708006850	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
568708006852	hypothetical protein; Provisional; Region: PRK13659
568708006854	Signal peptide predicted for STM_MW15031 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 28 and 29
568708006855	hypothetical protein; Provisional; Region: PRK02237
568708006857	4 probable transmembrane helices predicted for STM_MW15041 by TMHMM2.0 at aa 7-26, 30-52, 59-78 and 83-105
568708006858	bifunctional D-altronate/D-mannonate dehydratase; Provisional; Region: PRK15072
568708006859	The starvation sensing protein RpsA from E.coli and its homologs are lactonizing enzymes whose putative targets are homoserine lactone (HSL)-derivative. They are part of the mandelate racemase (MR)-like subfamily of the enolase superfamily. Enzymes of...; Region: rpsA; cd03322
568708006860	putative active site pocket [active]
568708006861	putative metal binding site [ion binding]; other site
568708006864	putative oxidoreductase; Provisional; Region: PRK10083
568708006865	Alcohol dehydrogenases of the MDR family; Region: Zn_ADH7; cd08261
568708006866	putative NAD(P) binding site [chemical binding]; other site
568708006867	catalytic Zn binding site [ion binding]; other site
568708006868	structural Zn binding site [ion binding]; other site
568708006872	Mannitol-1-phosphate/altronate dehydrogenases [Carbohydrate transport and metabolism]; Region: MtlD; COG0246
568708006873	Mannitol dehydrogenase Rossmann domain; Region: Mannitol_dh; pfam01232
568708006874	Mannitol dehydrogenase C-terminal domain; Region: Mannitol_dh_C; pfam08125
568708006877	putative selenium-binding protein YdfZ; Region: YdfZ_fam; TIGR03318
568708006878	Transcriptional regulators [Transcription]; Region: GntR; COG1802
568708006879	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
568708006880	DNA-binding site [nucleotide binding]; DNA binding site
568708006881	FCD domain; Region: FCD; pfam07729
568708006884	malonic semialdehyde reductase; Provisional; Region: PRK10538
568708006885	classical (c) SDR, subgroup 5; Region: SDR_c5; cd05346
568708006886	putative NAD(P) binding site [chemical binding]; other site
568708006887	homodimer interface [polypeptide binding]; other site
568708006888	homotetramer interface [polypeptide binding]; other site
568708006889	active site
568708006891	dipeptidyl carboxypeptidase II; Provisional; Region: PRK10280
568708006892	Peptidase family M3 dipeptidyl carboxypeptidase (DCP); Region: M3A_DCP; cd06456
568708006893	active site
568708006894	Zn binding site [ion binding]; other site
568708006896	General stress protein [General function prediction only]; Region: GsiB; COG3729
568708006898	hypothetical protein; Validated; Region: PRK03657
568708006900	hypothetical protein; Provisional; Region: PRK10053
568708006901	Signal peptide predicted for STM_MW15151 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 19 and 20
568708006903	pfam_scan;Pfam:PF07690; E()=1.1E-27;score=97.0;query13-337;description=MFS_1; tmhmm; query 1-391
568708006905	O-acetylserine/cysteine export protein; Provisional; Region: PRK11453
568708006906	EamA-like transporter family; Region: EamA; pfam00892
568708006907	10 probable transmembrane helices predicted for STM_MW15171 by TMHMM2.0 at aa 7-24, 34-52, 59-81, 91-110, 117-136, 140-162, 174-196, 216-238, 245-264 and 268-290
568708006909	MarB protein; Region: MarB; pfam13999
568708006910	Signal peptide predicted for STM_MW15181 by SignalP 2.0 HMM (Signal peptide probability 0.996) with cleavage site probability 0.994 between residues 21 and 22
568708006911	DNA-binding transcriptional activator MarA; Provisional; Region: PRK11511
568708006912	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708006914	DNA-binding transcriptional repressor MarR; Provisional; Region: PRK11512
568708006915	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
568708006917	inner membrane protein; Provisional; Region: PRK10995
568708006919	6 probable transmembrane helices predicted for STM_MW15211 by TMHMM2.0 at aa 10-32, 44-66, 71-93, 117-139, 154-176 and 196-217
568708006920	putative arabinose transporter; Provisional; Region: PRK03545
568708006921	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708006922	putative substrate translocation pore; other site
568708006923	12 probable transmembrane helices predicted for STM_MW15221 by TMHMM2.0 at aa 12-34, 49-71, 80-99, 109-131, 138-160, 170-189, 210-229, 244-266, 273-292, 302-324, 331-350 and 360-382
568708006925	Transcriptional regulator [Transcription]; Region: LysR; COG0583
568708006926	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708006927	The C-terminal substrate binding domain of LysR-type transcriptional regulators, YofA and SoxR, contains the type 2 periplasmic binding fold; Region: PBP2_YofA_SoxR_like; cd08442
568708006928	putative dimerization interface [polypeptide binding]; other site
568708006931	putative succinate semialdehyde dehydrogenase; Provisional; Region: PRK13968
568708006932	Mycobacterium tuberculosis succinate-semialdehyde dehydrogenase 1-like; Region: ALDH_SSADH1_GabD1; cd07100
568708006933	NAD(P) binding site [chemical binding]; other site
568708006934	catalytic residues [active]
568708006936	Glutaminase [Amino acid transport and metabolism]; Region: GlsA; COG2066
568708006937	glutaminase; Provisional; Region: PRK00971
568708006939	Domain of unknown function (DUF4186); Region: DUF4186; pfam13811
568708006940	Predicted membrane protein [Function unknown]; Region: COG3781
568708006942	3 probable transmembrane helices predicted for STM_MW15271 by TMHMM2.0 at aa 39-58, 63-81 and 229-251
568708006943	Ketosteroid isomerase homolog [Function unknown]; Region: COG4319
568708006945	Signal peptide predicted for STM_MW15281 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.994 between residues 29 and 30
568708006946	Porins form aqueous channels for the diffusion of small hydrophillic molecules across the outer membrane. Individual 16-strand anti-parallel beta-barrels form a central pore, and trimerizes thru mainly hydrophobic interactions at the interface. Trimers...; Region: gram_neg_porins; cd00342
568708006947	Outer membrane protein (porin) [Cell envelope biogenesis, outer membrane]; Region: OmpC; COG3203
568708006948	eyelet of channel; other site
568708006949	trimer interface [polypeptide binding]; other site
568708006951	Zn finger protein HypA/HybF (possibly regulating hydrogenase expression) [General function prediction only]; Region: HybF; COG0375
568708006952	Hydrogenase expression/synthesis hypA family; Region: HypA; cl17671
568708006954	Coenzyme F420-reducing hydrogenase, alpha subunit [Energy production and conversion]; Region: FrhA; COG3259
568708006955	HupH hydrogenase expression protein, C-terminal conserved region; Region: HupH_C; pfam04809
568708006956	HupH hydrogenase expression protein, C-terminal conserved region; Region: HupH_C; pfam04809
568708006957	Rubredoxin [Energy production and conversion]; Region: COG1773
568708006958	Rubredoxin; nonheme iron binding domains containing a [Fe(SCys)4] center. Rubredoxins are small nonheme iron proteins. The iron atom is coordinated by four cysteine residues (Fe(S-Cys)4), but iron can also be replaced by cobalt, nickel or zinc. They are...; Region: rubredoxin; cd00730
568708006959	iron binding site [ion binding]; other site
568708006962	HyaE family; HyaE is also called HupG and HoxO. They are proteins serving a critical role in the assembly of multimeric [NiFe] hydrogenases, the enzymes that catalyze the oxidation of molecular hydrogen to enable microorganisms to utilize hydrogen as the...; Region: HyaE; cd02965
568708006964	HupF/HypC family; Region: HupF_HypC; cl00394
568708006966	coenzyme F420-reducing hydrogenase delta subunit (putative coenzyme F420 hydrogenase processing subunit); Region: frhD; TIGR00130
568708006967	Endopeptidases belonging to membrane-bound hydrogenases group. These hydrogenases transfer electrons from H2 to a cytochrome that is bound to a membrane-located complex coupling electron transfer to transmembrane proton translocation. Endopeptidase HybD...; Region: H2MP_MemB-H2up; cd06062
568708006968	putative substrate-binding site; other site
568708006969	nickel binding site [ion binding]; other site
568708006971	Ni,Fe-hydrogenase I cytochrome b subunit [Energy production and conversion]; Region: HyaC; COG1969
568708006972	4 probable transmembrane helices predicted for STM_MW15361 by TMHMM2.0 at aa 43-62, 82-104, 151-173 and 203-225
568708006974	hydrogenase 1 large subunit; Provisional; Region: PRK10170
568708006975	Ni,Fe-hydrogenase I large subunit [Energy production and conversion]; Region: HyaB; COG0374
568708006977	Ni,Fe-hydrogenase I small subunit [Energy production and conversion]; Region: HyaA; COG1740
568708006978	NADH ubiquinone oxidoreductase, 20 Kd subunit; Region: Oxidored_q6; pfam01058
568708006980	Signal peptide predicted for STM_MW15381 by SignalP 2.0 HMM (Signal peptide probability 0.974) with cleavage site probability 0.965 between residues 45 and 46
568708006981	1 probable transmembrane helix predicted for STM_MW15381 by TMHMM2.0 at aa 21-43
568708006982	Linear amide C-N hydrolases, choloylglycine hydrolase family; Region: CBAH; pfam02275
568708006983	Penicillin V acylase (PVA), also known as conjugated bile salt acid hydrolase (CBAH), catalyzes the hydrolysis of penicillin V to yield 6-amino penicillanic acid (6-APA), an important key intermediate of semisynthetic penicillins.  PVA has an N-terminal...; Region: Ntn_PVA; cd00542
568708006984	active site
568708006985	Signal peptide predicted for STM_MW15391 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.793 between residues 24 and 25
568708006987	Transcriptional regulators [Transcription]; Region: FadR; COG2186
568708006988	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
568708006989	DNA-binding site [nucleotide binding]; DNA binding site
568708006990	FCD domain; Region: FCD; pfam07729
568708006993	Threonine dehydrogenase and related Zn-dependent dehydrogenases [Amino acid transport and metabolism / General function prediction only]; Region: Tdh; COG1063
568708006994	Alcohol dehydrogenases of the MDR family; Region: Zn_ADH7; cd08261
568708006995	putative NAD(P) binding site [chemical binding]; other site
568708006996	catalytic Zn binding site [ion binding]; other site
568708006997	structural Zn binding site [ion binding]; other site
568708007000	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708007001	D-galactonate transporter; Region: 2A0114; TIGR00893
568708007002	putative substrate translocation pore; other site
568708007004	12 probable transmembrane helices predicted for STM_MW15421 by TMHMM2.0 at aa 7-26, 46-68, 75-97, 101-123, 135-157, 162-184, 228-250, 265-287, 303-325, 329-350, 362-384 and 394-413
568708007005	PhoPQ-activated pathogenicity-related protein [General function prediction only]; Region: PqaA; COG4287
568708007007	1 probable transmembrane helix predicted for STM_MW15431 by TMHMM2.0 at aa 26-45
568708007008	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708007009	Major Facilitator Superfamily; Region: MFS_1; pfam07690
568708007010	putative substrate translocation pore; other site
568708007011	11 probable transmembrane helices predicted for STM_MW15441 by TMHMM2.0 at aa 25-47, 57-79, 86-105, 110-132, 144-166, 171-193, 219-241, 261-283, 295-329, 349-371 and 378-400
568708007013	hypothetical protein; Provisional; Region: PRK06184
568708007014	ubiquinone biosynthesis hydroxylase family protein; Provisional; Region: PRK07608; cl17314
568708007015	ubiquinone biosynthesis hydroxylase family protein; Provisional; Region: PRK07608; cl17314
568708007017	Transcriptional regulators [Transcription]; Region: MarR; COG1846
568708007018	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
568708007019	putative DNA binding site [nucleotide binding]; other site
568708007020	putative Zn2+ binding site [ion binding]; other site
568708007025	Transcriptional regulators [Transcription]; Region: PurR; COG1609
568708007026	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
568708007027	DNA binding site [nucleotide binding]
568708007028	domain linker motif; other site
568708007029	Ligand binding domain of DNA transcription iso-repressor GalS, which is one of two regulatory proteins involved in galactose transport and metabolism; Region: PBP1_GalS_like; cd06270
568708007030	dimerization interface (closed form) [polypeptide binding]; other site
568708007031	ligand binding site [chemical binding]; other site
568708007034	Na+/H+ antiporter NhaC; Region: antiport_nhaC; TIGR00931
568708007035	Signal peptide predicted for STM_MW15511 by SignalP 2.0 HMM (Signal peptide probability 0.663) with cleavage site probability 0.221 between residues 27 and 28
568708007036	10 probable transmembrane helices predicted for STM_MW15511 by TMHMM2.0 at aa 13-35, 77-99, 112-134, 139-161, 195-217, 237-256, 263-285, 328-350, 357-379 and 444-466
568708007038	Bifunctional PLP-dependent enzyme with beta-cystathionase and maltose regulon repressor activities [Amino acid transport and metabolism]; Region: MalY; COG1168
568708007039	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
568708007040	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708007041	homodimer interface [polypeptide binding]; other site
568708007042	catalytic residue [active]
568708007044	glycogen debranching enzyme GlgX; Region: glgX_debranch; TIGR02100
568708007045	N-terminal Early set domain associated with the catalytic domain of Glycogen debranching enzyme and bacterial isoamylase (also called glycogen 6-glucanohydrolase); Region: E_set_GDE_Isoamylase_N; cd02856
568708007046	Alpha amylase catalytic domain found in glycogen debranching enzymes; Region: AmyAc_Glg_debranch; cd11326
568708007047	active site
568708007048	catalytic site [active]
568708007051	Maltooligosyl trehalose synthase [Carbohydrate transport and metabolism]; Region: TreY; COG3280
568708007052	Alpha amylase catalytic domain found in maltooligosyl trehalose synthase (MTSase); Region: AmyAc_MTSase; cd11336
568708007053	active site
568708007054	catalytic site [active]
568708007056	N-terminal Early set domain associated with the catalytic domain of Maltooligosyl trehalose trehalohydrolase (also called Glycosyltrehalose trehalohydrolase) and similar proteins; Region: E_set_MTHase_like_N; cd02853
568708007057	malto-oligosyltrehalose trehalohydrolase; Region: trehalose_TreZ; TIGR02402
568708007058	Alpha amylase catalytic domain found in Glycosyltrehalose trehalohydrolase (also called Maltooligosyl trehalose Trehalohydrolase); Region: AmyAc_GTHase; cd11325
568708007059	catalytic site [active]
568708007060	active site
568708007061	Domain of unknown function (DUF3459); Region: DUF3459; pfam11941
568708007063	Protein of unknown function (DUF1264); Region: DUF1264; pfam06884
568708007065	Signal peptide predicted for STM_MW15561 by SignalP 2.0 HMM (Signal peptide probability 0.842) with cleavage site probability 0.371 between residues 19 and 20
568708007066	acid-resistance protein; Provisional; Region: hdeB; PRK11566
568708007067	1 probable transmembrane helix predicted for STM_MW15571 by TMHMM2.0 at aa 4-26
568708007068	Signal peptide predicted for STM_MW15571 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 24 and 25
568708007069	peroxiredoxin, OsmC subfamily; Region: osmo_induc_OsmC; TIGR03562
568708007071	biofilm-dependent modulation protein; Provisional; Region: PRK11436
568708007073	30S ribosomal subunit S22; Reviewed; Region: rpsV; PRK10057
568708007075	malate dehydrogenase; Provisional; Region: PRK13529
568708007076	Malic enzyme, N-terminal domain; Region: malic; pfam00390
568708007077	NAD(P) binding domain of malic enzyme (ME), subgroup 1; Region: NAD_bind_1_malic_enz; cd05312
568708007078	NAD(P) binding site [chemical binding]; other site
568708007081	ethanol-active dehydrogenase/acetaldehyde-active reductase; Provisional; Region: PRK09422
568708007082	Cinnamyl alcohol dehydrogenases (CAD); Region: CAD3; cd08297
568708007083	NAD binding site [chemical binding]; other site
568708007084	substrate binding site [chemical binding]; other site
568708007085	catalytic Zn binding site [ion binding]; other site
568708007086	tetramer interface [polypeptide binding]; other site
568708007087	structural Zn binding site [ion binding]; other site
568708007090	formate dehydrogenase-N subunit gamma; Provisional; Region: PRK10179
568708007091	formate dehydrogenase, gamma subunit; Region: formate-DH-gamm; TIGR01583
568708007093	4 probable transmembrane helices predicted for STM_MW15631 by TMHMM2.0 at aa 13-35, 50-72, 112-134 and 149-171
568708007094	formate dehydrogenase, beta subunit, Fe-S containing; Region: FDH-beta; TIGR01582
568708007095	Formate dehydrogenase N, transmembrane; Region: Form-deh_trans; pfam09163
568708007098	formate dehydrogenase, alpha subunit, proteobacterial-type; Region: formate-DH-alph; TIGR01553
568708007099	Formate dehydrogenase N, alpha subunit (Formate-Dh-Na) is a major component of nitrate respiration in bacteria such as in the E. coli formate dehydrogenase N (Fdh-N). Fdh-N is a membrane protein that is a complex of three different subunits and is the...; Region: MopB_Formate-Dh-Na-like; cd02752
568708007100	[4Fe-4S] binding site [ion binding]; other site
568708007101	Molybdopterin-Binding (MopB) domain of the MopB superfamily of proteins, a  large, diverse, heterogeneous superfamily of enzymes that, in general, bind molybdopterin as a cofactor. The MopB domain is found in a wide variety of molybdenum- and...; Region: Molybdopterin-Binding; cl09928
568708007102	Formate dehydrogenase N, alpha subunit (Formate-Dh-Na) is a major component of nitrate respiration in bacteria such as in the E. coli formate dehydrogenase N (Fdh-N). Fdh-N is a membrane protein that is a complex of three different subunits and is the...; Region: MopB_Formate-Dh-Na-like; cd02752
568708007103	Formate dehydrogenase N, alpha subunit (Formate-Dh-Na) is a major component of nitrate respiration in bacteria such as in the E. coli formate dehydrogenase N (Fdh-N). Fdh-N is a membrane protein that is a complex of three different subunits and is the...; Region: MopB_CT_Formate-Dh-Na-like; cd02792
568708007104	molybdopterin cofactor binding site; other site
568708007108	Signal peptide predicted for STM_MW15651 by SignalP 2.0 HMM (Signal peptide probability 0.964) with cleavage site probability 0.781 between residues 33 and 34
568708007109	aromatic amino acid exporter; Provisional; Region: PRK11689
568708007111	9 probable transmembrane helices predicted for STM_MW15661 by TMHMM2.0 at aa 15-34, 46-68, 72-94, 101-119, 129-151, 163-185, 190-212, 219-241 and 251-270
568708007112	Outer membrane protein (porin) [Cell envelope biogenesis, outer membrane]; Region: OmpC; COG3203
568708007113	Porins form aqueous channels for the diffusion of small hydrophillic molecules across the outer membrane. Individual 16-strand anti-parallel beta-barrels form a central pore, and trimerizes thru mainly hydrophobic interactions at the interface. Trimers...; Region: gram_neg_porins; cd00342
568708007114	trimer interface [polypeptide binding]; other site
568708007115	eyelet of channel; other site
568708007116	Signal peptide predicted for STM_MW15671 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 21 and 22
568708007118	Uncharacterized conserved protein [Function unknown]; Region: COG3791
568708007120	methyl viologen resistance protein SmvA; Provisional; Region: PRK14995
568708007121	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708007122	putative substrate translocation pore; other site
568708007123	14 probable transmembrane helices predicted for STM_MW15691 by TMHMM2.0 at aa 7-29, 44-66, 73-92, 97-119, 132-154, 158-180, 193-212, 222-240, 261-283, 298-320, 322-344, 354-376, 389-411 and 468-490
568708007125	TetR family transcriptional regulator; Provisional; Region: PRK14996
568708007126	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
568708007128	1 probable transmembrane helix predicted for STM_MW15701 by TMHMM2.0 at aa 151-170
568708007129	nitrate/nitrite transport protein NarU; Provisional; Region: PRK15034
568708007130	Signal peptide predicted for STM_MW15711 by SignalP 2.0 HMM (Signal peptide probability 0.611) with cleavage site probability 0.599 between residues 57 and 58
568708007131	12 probable transmembrane helices predicted for STM_MW15711 by TMHMM2.0 at aa 36-58, 73-95, 102-121, 131-153, 174-196, 211-233, 254-276, 286-308, 313-335, 345-367, 401-418 and 433-455
568708007133	Nitrate reductase alpha subunit [Energy production and conversion]; Region: NarG; COG5013
568708007134	Respiratory nitrate reductase A (NarGHI), alpha chain (NarG) and related proteins. Under anaerobic conditions in the presence of nitrate, E. coli synthesizes the cytoplasmic membrane-bound quinol-nitrate oxidoreductase (NarGHI), which reduces nitrate to...; Region: MopB_Nitrate-R-NarG-like; cd02750
568708007135	[4Fe-4S] binding site [ion binding]; other site
568708007136	Molybdopterin-Binding (MopB) domain of the MopB superfamily of proteins, a  large, diverse, heterogeneous superfamily of enzymes that, in general, bind molybdopterin as a cofactor. The MopB domain is found in a wide variety of molybdenum- and...; Region: Molybdopterin-Binding; cl09928
568708007137	Molybdopterin-Binding (MopB) domain of the MopB superfamily of proteins, a  large, diverse, heterogeneous superfamily of enzymes that, in general, bind molybdopterin as a cofactor. The MopB domain is found in a wide variety of molybdenum- and...; Region: Molybdopterin-Binding; cl09928
568708007138	Molybdopterin-Binding (MopB) domain of the MopB superfamily of proteins, a  large, diverse, heterogeneous superfamily of enzymes that, in general, bind molybdopterin as a cofactor. The MopB domain is found in a wide variety of molybdenum- and...; Region: Molybdopterin-Binding; cl09928
568708007139	Respiratory nitrate reductase A (NarGHI), alpha chain (NarG) and related proteins. Under anaerobic conditions in the presence of nitrate, E. coli synthesizes the cytoplasmic membrane-bound quinol-nitrate oxidoreductase (NarGHI), which reduces nitrate to...; Region: MopB_CT_Nitrate-R-NarG-like; cd02776
568708007140	molybdopterin cofactor binding site; other site
568708007143	Nitrate reductase beta subunit [Energy production and conversion]; Region: NarY; COG1140
568708007144	nitrate reductase 2 subunit delta; Provisional; Region: PRK15054
568708007146	respiratory nitrate reductase, gamma subunit; Region: narI; TIGR00351
568708007147	5 probable transmembrane helices predicted for STM_MW15751 by TMHMM2.0 at aa 5-27, 48-70, 90-112, 128-150 and 185-207
568708007149	hypothetical protein; Provisional; Region: PRK10281
568708007151	N-hydroxyarylamine O-acetyltransferase; Provisional; Region: PRK15047
568708007153	L-asparagine permease; Provisional; Region: PRK15049
568708007155	12 probable transmembrane helices predicted for STM_MW15791 by TMHMM2.0 at aa 37-59, 64-86, 107-129, 144-166, 171-193, 218-240, 260-282, 302-324, 351-373, 377-399, 420-442 and 446-468
568708007156	Bacterial protein of unknown function (DUF903); Region: DUF903; pfam06004
568708007158	1 probable transmembrane helix predicted for STM_MW15801 by TMHMM2.0 at aa 4-26
568708007159	Signal peptide predicted for STM_MW15801 by SignalP 2.0 HMM (Signal peptide probability 0.986) with cleavage site probability 0.417 between residues 19 and 20
568708007160	Uncharacterized conserved protein [Function unknown]; Region: COG3391
568708007161	40-residue YVTN family beta-propeller repeat; Region: beta_rpt_yvtn; TIGR02276
568708007162	Signal peptide predicted for STM_MW15811 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.987 between residues 30 and 31
568708007163	Outer membrane receptor proteins, mostly Fe transport [Inorganic ion transport and metabolism]; Region: CirA; COG1629
568708007164	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
568708007165	N-terminal plug; other site
568708007166	ligand-binding site [chemical binding]; other site
568708007167	Signal peptide predicted for STM_MW15821 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.983 between residues 26 and 27
568708007170	colanic acid/biofilm transcriptional regulator; Provisional; Region: PRK11414
568708007171	DNA-binding site [nucleotide binding]; DNA binding site
568708007172	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cl17414
568708007173	FCD domain; Region: FCD; pfam07729
568708007176	Putative NADP-dependent oxidoreductases [General function prediction only]; Region: COG2130
568708007177	Prostaglandin dehydrogenases; Region: PGDH; cd05288
568708007178	NAD(P) binding site [chemical binding]; other site
568708007179	substrate binding site [chemical binding]; other site
568708007180	dimer interface [polypeptide binding]; other site
568708007182	Sortase and related acyltransferases [Cell envelope biogenesis, outer membrane]; Region: COG1247
568708007183	Acetyltransferase (GNAT) family; Region: Acetyltransf_1; pfam00583
568708007185	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3238
568708007186	Signal peptide predicted for STM_MW15861 by SignalP 2.0 HMM (Signal peptide probability 0.633) with cleavage site probability 0.255 between residues 21 and 22
568708007187	5 probable transmembrane helices predicted for STM_MW15861 by TMHMM2.0 at aa 5-25, 32-54, 69-88, 95-117 and 122-144
568708007189	Protein of unknown function (DUF2526); Region: DUF2526; pfam10735
568708007191	Uncharacterized protein conserved in bacteria, putative virulence factor [Function unknown]; Region: SrfB; COG4457
568708007193	Uncharacterized protein conserved in bacteria, putative virulence factor [Function unknown]; Region: SrfC; COG4458
568708007195	Protein of unknown function (DUF2566); Region: DUF2566; pfam10753
568708007196	2 probable transmembrane helices predicted for STM_MW15911 by TMHMM2.0 at aa 33-55 and 62-84
568708007198	1-pyrroline dehydrogenase; Region: ABALDH; TIGR03374
568708007199	Escherichia coli NAD+-dependent gamma-aminobutyraldehyde dehydrogenase YdcW-like; Region: ALDH_ABALDH-YdcW; cd07092
568708007200	tetrameric interface [polypeptide binding]; other site
568708007201	NAD binding site [chemical binding]; other site
568708007202	catalytic residues [active]
568708007203	substrate binding site [chemical binding]; other site
568708007205	Transcriptional regulators containing a DNA-binding HTH domain and an aminotransferase domain (MocR family) and their eukaryotic orthologs [Transcription / Amino acid transport and metabolism]; Region: ARO8; COG1167
568708007206	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
568708007207	DNA-binding site [nucleotide binding]; DNA binding site
568708007208	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
568708007209	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708007210	homodimer interface [polypeptide binding]; other site
568708007211	catalytic residue [active]
568708007214	D-alanyl-D-alanine dipeptidase [Cell envelope biogenesis, outer membrane]; Region: DdpX; COG2173
568708007216	Signal peptide predicted for STM_MW15941 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.991 between residues 20 and 21
568708007217	2 probable transmembrane helices predicted for STM_MW15961 by TMHMM2.0 at aa 33-67 and 82-104
568708007218	secreted effector protein SifB; Provisional; Region: sifB; PRK09499
568708007220	Protein of unknown function (DUF2554); Region: DUF2554; pfam10829
568708007221	Signal peptide predicted for STM_MW15981 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 22 and 23
568708007223	Collagenase and related proteases [Posttranslational modification, protein turnover, chaperones]; Region: COG0826
568708007224	Peptidase family U32; Region: Peptidase_U32; pfam01136
568708007225	Collagenase; Region: DUF3656; pfam12392
568708007227	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
568708007228	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
568708007229	non-specific DNA binding site [nucleotide binding]; other site
568708007230	salt bridge; other site
568708007231	sequence-specific DNA binding site [nucleotide binding]; other site
568708007232	Cupin domain; Region: Cupin_2; pfam07883
568708007235	Uncharacterized protein involved in benzoate metabolism [Secondary metabolites biosynthesis, transport, and catabolism]; Region: BenE; COG3135
568708007236	benzoate transporter; Region: benE; TIGR00843
568708007237	Signal peptide predicted for STM_MW16011 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.663 between residues 35 and 36
568708007239	11 probable transmembrane helices predicted for STM_MW16011 by TMHMM2.0 at aa 10-30, 43-65, 93-112, 119-138, 143-165, 172-194, 209-231, 252-274, 289-311, 318-340 and 360-382
568708007240	Protein of unknown function (DUF3313); Region: DUF3313; pfam11769
568708007242	Signal peptide predicted for STM_MW16021 by SignalP 2.0 HMM (Signal peptide probability 0.989) with cleavage site probability 0.785 between residues 24 and 25
568708007243	tellurite resistance protein TehB; Provisional; Region: PRK11207
568708007244	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708007245	S-adenosylmethionine binding site [chemical binding]; other site
568708007247	Tellurite resistance protein and related permeases [Inorganic ion transport and metabolism]; Region: TehA; COG1275
568708007248	Tellurite-resistance/Dicarboxylate Transporter (TDT) family includes TehA protein; Region: TDT_TehA; cd09324
568708007249	gating phenylalanine in ion channel; other site
568708007251	10 probable transmembrane helices predicted for STM_MW16041 by TMHMM2.0 at aa 13-32, 47-69, 82-104, 108-130, 143-165, 169-188, 200-222, 237-254, 261-280 and 290-312
568708007252	Left-handed parallel beta-Helix (LbetaH or LbH) domain: The alignment contains 5 turns, each containing three imperfect tandem repeats of a hexapeptide repeat motif (X-[STAV]-X-[LIV]-[GAED]-X). Proteins containing hexapeptide repeats are often enzymes...; Region: LbetaH; cl00160
568708007253	putative trimer interface [polypeptide binding]; other site
568708007254	Left-handed parallel beta-Helix (LbetaH or LbH) domain: The alignment contains 5 turns, each containing three imperfect tandem repeats of a hexapeptide repeat motif (X-[STAV]-X-[LIV]-[GAED]-X). Proteins containing hexapeptide repeats are often enzymes...; Region: LbetaH; cl00160
568708007255	putative trimer interface [polypeptide binding]; other site
568708007256	putative CoA binding site [chemical binding]; other site
568708007257	putative CoA binding site [chemical binding]; other site
568708007258	Left-handed parallel beta-Helix (LbetaH or LbH) domain: The alignment contains 5 turns, each containing three imperfect tandem repeats of a hexapeptide repeat motif (X-[STAV]-X-[LIV]-[GAED]-X). Proteins containing hexapeptide repeats are often enzymes...; Region: LbetaH; cd00208
568708007259	putative trimer interface [polypeptide binding]; other site
568708007260	putative CoA binding site [chemical binding]; other site
568708007261	Acetyltransferases, including N-acetylases of ribosomal proteins [Translation, ribosomal structure and biogenesis]; Region: RimL; COG1670
568708007262	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
568708007263	Coenzyme A binding pocket [chemical binding]; other site
568708007265	Cellulase M and related proteins [Carbohydrate transport and metabolism]; Region: FrvX; COG1363
568708007266	M42 Peptidase, Endoglucanases; Region: M42_Frv; cd05656
568708007267	oligomer interface [polypeptide binding]; other site
568708007268	active site
568708007269	metal binding site [ion binding]; metal-binding site
568708007271	PTS_IIB_galactitol: subunit IIB of enzyme II (EII) of the galactitol-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS).  In this system, EII is a galactitol-specific permease with two cytoplasmic domains (IIA and IIB) and a...; Region: PTS_IIB_galactitol; cd05566
568708007272	active site
568708007273	P-loop; other site
568708007274	phosphorylation site [posttranslational modification]
568708007275	Signal peptide predicted for STM_MW16081 by SignalP 2.0 HMM (Signal peptide probability 0.832) with cleavage site probability 0.593 between residues 22 and 23
568708007277	PTS system sugar-specific permease component; Region: EIIC-GAT; cl04451
568708007278	Phosphotransferase system, galactitol-specific IIC component [Carbohydrate transport and metabolism]; Region: GatC; COG3775
568708007280	7 probable transmembrane helices predicted for STM_MW16091 by TMHMM2.0 at aa 35-57, 78-100, 169-188, 195-217, 251-273, 302-324 and 361-383
568708007281	membrane complex biogenesis protein, BtpA family; Region: thylakoid_BtpA; TIGR00259
568708007283	PTS_IIA, PTS system, fructose/mannitol specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This...; Region: PTS_IIA_fru; cd00211
568708007284	active site
568708007285	phosphorylation site [posttranslational modification]
568708007287	Pentose-5-phosphate-3-epimerase [Carbohydrate transport and metabolism]; Region: Rpe; COG0036
568708007288	Ribulose-5-phosphate 3-epimerase (RPE). This enzyme catalyses the interconversion of D-ribulose 5-phosphate (Ru5P) into D-xylulose 5-phosphate, as part of the Calvin cycle (reductive pentose phosphate pathway) in chloroplasts and in the oxidative pentose...; Region: RPE; cd00429
568708007289	substrate binding site [chemical binding]; other site
568708007290	hexamer interface [polypeptide binding]; other site
568708007291	metal binding site [ion binding]; metal-binding site
568708007293	Transcriptional regulators of sugar metabolism [Transcription / Carbohydrate transport and metabolism]; Region: GlpR; COG1349
568708007294	DeoR-like helix-turn-helix domain; Region: HTH_DeoR; pfam08220
568708007295	DeoR C terminal sensor domain; Region: DeoRC; pfam00455
568708007298	Acetyltransferase (GNAT) domain; Region: Acetyltransf_8; pfam13523
568708007299	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
568708007300	Coenzyme A binding pocket [chemical binding]; other site
568708007302	L-lactate oxidase; Region: L_lactate_ox; TIGR02708
568708007303	L-Lactate oxidase (LOX) FMN-binding domain. LOX is a member of the family of FMN-containing alpha-hydroxyacid oxidases and catalyzes the oxidation of l-lactate using molecular oxygen to generate pyruvate and H2O2.  This family occurs in both prokaryotes...; Region: LOX_like_FMN; cd04737
568708007304	teramer interface [polypeptide binding]; other site
568708007305	active site
568708007306	FMN binding site [chemical binding]; other site
568708007307	catalytic residues [active]
568708007309	Signal peptide predicted for STM_MW16151 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 24 and 25
568708007310	Uncharacterized conserved protein [Function unknown]; Region: COG2353
568708007312	Signal peptide predicted for STM_MW16161 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.995 between residues 23 and 24
568708007313	Periplasmic glucans biosynthesis protein [Inorganic ion transport and metabolism]; Region: MdoG; COG3131
568708007314	glucan biosynthesis protein D; Provisional; Region: mdoD; PRK13273
568708007316	Signal peptide predicted for STM_MW16171 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 32 and 33
568708007317	Carboxylesterase type B [Lipid metabolism]; Region: PnbA; COG2272
568708007318	Esterases and lipases (includes fungal lipases, cholinesterases, etc.)  These enzymes act on carboxylic esters (EC: 3.1.1.-). The catalytic apparatus involves three residues (catalytic triad): a serine, a glutamate or aspartate and a histidine.These...; Region: Esterase_lipase; cd00312
568708007319	substrate binding pocket [chemical binding]; other site
568708007320	catalytic triad [active]
568708007322	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG5383
568708007323	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG5383
568708007325	pca operon transcription factor PcaQ; Region: TF_pcaQ; TIGR02424
568708007326	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708007327	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
568708007328	dimerization interface [polypeptide binding]; other site
568708007331	ligand binding domain of Tar- and Tsr-related chemoreceptors; Region: Tar_Tsr_LBD; cd00181
568708007332	dimer interface [polypeptide binding]; other site
568708007333	ligand binding site [chemical binding]; other site
568708007334	Methyl-accepting chemotaxis protein [Cell motility and secretion / Signal transduction mechanisms]; Region: Tar; COG0840
568708007335	HAMP domain; Region: HAMP; pfam00672
568708007336	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
568708007337	dimer interface [polypeptide binding]; other site
568708007338	putative CheW interface [polypeptide binding]; other site
568708007341	2 probable transmembrane helices predicted for STM_MW16211 by TMHMM2.0 at aa 26-48 and 203-225
568708007343	Signal peptide predicted for STM_MW16211 by SignalP 2.0 HMM (Signal peptide probability 0.742) with cleavage site probability 0.234 between residues 50 and 51
568708007344	class III alcohol dehydrogenases; Region: alcohol_DH_class_III; cd08300
568708007345	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase; Region: adh_III_F_hyde; TIGR02818
568708007346	substrate binding site [chemical binding]; other site
568708007347	catalytic Zn binding site [ion binding]; other site
568708007348	NAD binding site [chemical binding]; other site
568708007349	structural Zn binding site [ion binding]; other site
568708007350	dimer interface [polypeptide binding]; other site
568708007353	Transcriptional regulators RcnR and FrmR, and related domains; this domain family was previously known as part of DUF156; Region: RcnR-FrmR-like_DUF156; cd10153
568708007354	putative metal binding site [ion binding]; other site
568708007355	putative homodimer interface [polypeptide binding]; other site
568708007356	putative homotetramer interface [polypeptide binding]; other site
568708007357	putative homodimer-homodimer interface [polypeptide binding]; other site
568708007358	putative allosteric switch controlling residues; other site
568708007360	5 probable transmembrane helices predicted for STM_MW16251 by TMHMM2.0 at aa 12-34, 54-76, 88-110, 114-136 and 155-177
568708007361	Sif protein; Region: Sif; cl11505
568708007362	Phospholipase/lecithinase/hemolysin [Lipid metabolism / General function prediction only]; Region: COG3240
568708007363	Fatty acyltransferase-like subfamily of the SGNH hydrolases, a diverse family of lipases and esterases. The tertiary fold of the enzyme is substantially different from that of the alpha/beta hydrolase family and unique among all known hydrolases; its...; Region: fatty_acyltransferase_like; cd01846
568708007364	active site
568708007365	catalytic triad [active]
568708007366	oxyanion hole [active]
568708007369	Predicted membrane protein [Function unknown]; Region: COG3326
568708007370	3 probable transmembrane helices predicted for STM_MW16271 by TMHMM2.0 at aa 2-21, 25-42 and 89-111
568708007372	Signal peptide predicted for STM_MW16271 by SignalP 2.0 HMM (Signal peptide probability 0.941) with cleavage site probability 0.622 between residues 26 and 27
568708007373	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
568708007374	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
568708007375	substrate binding pocket [chemical binding]; other site
568708007376	membrane-bound complex binding site; other site
568708007377	hinge residues; other site
568708007378	Signal peptide predicted for STM_MW16281 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 22 and 23
568708007380	ABC-type arginine transport system, permease component [Amino acid transport and metabolism]; Region: ArtQ; COG4215
568708007381	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708007382	dimer interface [polypeptide binding]; other site
568708007383	conserved gate region; other site
568708007384	putative PBP binding loops; other site
568708007385	ABC-ATPase subunit interface; other site
568708007386	4 probable transmembrane helices predicted for STM_MW16291 by TMHMM2.0 at aa 20-42, 55-74, 79-101 and 186-208
568708007388	ABC-type polar amino acid transport system, ATPase component [Amino acid transport and metabolism]; Region: GlnQ; COG1126
568708007389	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
568708007390	Walker A/P-loop; other site
568708007391	ATP binding site [chemical binding]; other site
568708007392	Q-loop/lid; other site
568708007393	ABC transporter signature motif; other site
568708007394	Walker B; other site
568708007395	D-loop; other site
568708007396	H-loop/switch region; other site
568708007398	ABC-type arginine transport system, permease component [Amino acid transport and metabolism]; Region: ArtQ; COG4215
568708007399	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708007400	dimer interface [polypeptide binding]; other site
568708007401	conserved gate region; other site
568708007402	putative PBP binding loops; other site
568708007403	ABC-ATPase subunit interface; other site
568708007404	5 probable transmembrane helices predicted for STM_MW16311 by TMHMM2.0 at aa 30-49, 61-83, 93-115, 136-158 and 192-214
568708007406	contains an internal stop codon; tmhmm; query 1-516
568708007407	SAM-dependent methyltransferases [Secondary metabolites biosynthesis, transport, and catabolism / General function prediction only]; Region: SmtA; COG0500
568708007408	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708007409	S-adenosylmethionine binding site [chemical binding]; other site
568708007411	cytochrome b561; Provisional; Region: PRK11513
568708007413	4 probable transmembrane helices predicted for STM_MW16341 by TMHMM2.0 at aa 5-27, 40-62, 83-105 and 140-162
568708007414	Uncharacterized conserved protein [Function unknown]; Region: COG1434
568708007415	YdcF-like. YdcF-like is a large family of mainly bacterial proteins, with a few members found in fungi, plants, and archaea. Escherichia coli YdcF has been shown to bind S-adenosyl-L-methionine (AdoMet), but a biochemical function has not been...; Region: YdcF-like; cd06259
568708007416	putative active site [active]
568708007418	ATP-dependent RNA helicase HrpA; Provisional; Region: PRK11131
568708007419	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
568708007420	ATP binding site [chemical binding]; other site
568708007421	putative Mg++ binding site [ion binding]; other site
568708007422	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
568708007423	nucleotide binding region [chemical binding]; other site
568708007424	ATP-binding site [chemical binding]; other site
568708007425	Helicase associated domain (HA2); Region: HA2; pfam04408
568708007426	Oligonucleotide/oligosaccharide-binding (OB)-fold; Region: OB_NTP_bind; pfam07717
568708007427	Domain of unknown function (DUF3418); Region: DUF3418; pfam11898
568708007432	azoreductase; Reviewed; Region: PRK00170
568708007433	NADPH-dependent FMN reductase; Region: FMN_red; pfam03358
568708007435	Uncharacterized conserved protein [Function unknown]; Region: COG3791
568708007437	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3784
568708007439	1 probable transmembrane helix predicted for STM_MW16391 by TMHMM2.0 at aa 5-24
568708007440	Signal peptide predicted for STM_MW16391 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 21 and 22
568708007441	YnbE-like lipoprotein; Region: Lipoprotein_19; pfam13617
568708007442	Signal peptide predicted for STM_MW16401 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.526 between residues 18 and 19
568708007443	hypothetical protein; Provisional; Region: PRK10695
568708007445	Signal peptide predicted for STM_MW16411 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.652 between residues 34 and 35
568708007446	1 probable transmembrane helix predicted for STM_MW16411 by TMHMM2.0 at aa 7-29
568708007447	D-Lactate and related Dehydrogenases, NAD-binding and catalytic domains; Region: LDH_like_2; cd12183
568708007448	Lactate dehydrogenase and related dehydrogenases [Energy production and conversion / Coenzyme metabolism / General function prediction only]; Region: LdhA; COG1052
568708007449	putative ligand binding site [chemical binding]; other site
568708007450	putative NAD binding site [chemical binding]; other site
568708007451	catalytic site [active]
568708007454	heat-inducible protein; Provisional; Region: PRK10449
568708007455	Signal peptide predicted for STM_MW16431 by SignalP 2.0 HMM (Signal peptide probability 0.986) with cleavage site probability 0.429 between residues 20 and 21
568708007457	Putative hemolysin [General function prediction only]; Region: Hlx; COG3042
568708007458	Domain of unknown function (DUF333); Region: DUF333; pfam03891
568708007460	pyruvate:ferredoxin (flavodoxin) oxidoreductase, homodimeric; Region: pyruv_ox_red; TIGR02176
568708007461	Pyrimidine (PYR) binding domain of pyruvate ferredoxin oxidoreductase (PFOR), indolepyruvate ferredoxin oxidoreductase alpha subunit (IOR-alpha), and related proteins; Region: TPP_PYR_PFOR_IOR-alpha_like; cd07034
568708007462	dimer interface [polypeptide binding]; other site
568708007463	PYR/PP interface [polypeptide binding]; other site
568708007464	TPP binding site [chemical binding]; other site
568708007465	substrate binding site [chemical binding]; other site
568708007466	Pyruvate:ferredoxin oxidoreductase and related 2-oxoacid:ferredoxin oxidoreductases, gamma subunit [Energy production and conversion]; Region: PorG; COG1014
568708007467	Domain of unknown function; Region: EKR; smart00890
568708007468	4Fe-4S binding domain; Region: Fer4_6; pfam12837
568708007469	4Fe-4S binding domain; Region: Fer4; pfam00037
568708007470	Thiamine pyrophosphate (TPP family), PFOR_PNO subfamily, TPP-binding module; composed of proteins similar to the single subunit pyruvate ferredoxin oxidoreductase (PFOR) of Desulfovibrio Africanus, present in bacteria and amitochondriate eukaryotes. This...; Region: TPP_PFOR_PNO; cd03377
568708007471	TPP-binding site [chemical binding]; other site
568708007472	dimer interface [polypeptide binding]; other site
568708007477	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
568708007478	Ligand Binding Site [chemical binding]; other site
568708007480	Membrane transporters of cations and cationic drugs [Inorganic ion transport and metabolism]; Region: EmrE; COG2076
568708007482	4 probable transmembrane helices predicted for STM_MW16481 by TMHMM2.0 at aa 5-22, 32-51, 58-80 and 85-107
568708007485	tRNA 2-thiocytidine biosynthesis protein TtcA; Provisional; Region: PRK10696
568708007486	This is a subfamily of Adenine nucleotide alpha hydrolases superfamily.Adeninosine nucleotide alpha hydrolases superfamily  includes N type ATP PPases and ATP sulphurylases. It forms a apha/beta/apha fold which  binds to Adenosine group.  This subfamily; Region: Alpha_ANH_like_II; cd01993
568708007487	Ligand Binding Site [chemical binding]; other site
568708007489	ATP-dependent RNA helicase DbpA; Provisional; Region: PRK11776
568708007490	DEAD-box helicases. A diverse family of proteins involved in ATP-dependent RNA unwinding, needed in a variety of cellular processes including splicing, ribosome biogenesis and RNA degradation. The name derives from the sequence of the Walker  B motif; Region: DEADc; cd00268
568708007491	ATP binding site [chemical binding]; other site
568708007492	Mg++ binding site [ion binding]; other site
568708007493	motif III; other site
568708007494	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
568708007495	nucleotide binding region [chemical binding]; other site
568708007496	ATP-binding site [chemical binding]; other site
568708007497	RNA recognition motif in Escherichia coli RNA helicase dbpA and similar proteins; Region: RRM_EcDbpA_like; cd12501
568708007498	putative RNA binding site [nucleotide binding]; other site
568708007502	Mg2+ and Co2+ transporters [Inorganic ion transport and metabolism]; Region: CorA; COG0598
568708007503	Salmonella typhimurium Zn2+ transporter ZntB-like subgroup; Region: ZntB-like_1; cd12833
568708007504	Cl binding site [ion binding]; other site
568708007505	oligomer interface [polypeptide binding]; other site
568708007506	2 probable transmembrane helices predicted for STM_MW16521 by TMHMM2.0 at aa 272-294 and 299-321
568708007508	HAMP domain; Region: HAMP; pfam00672
568708007509	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
568708007510	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
568708007511	dimer interface [polypeptide binding]; other site
568708007512	putative CheW interface [polypeptide binding]; other site
568708007514	2 probable transmembrane helices predicted for STM_MW16531 by TMHMM2.0 at aa 7-29 and 33-55
568708007515	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2840
568708007516	Smr domain; Region: Smr; pfam01713
568708007518	O-6-alkylguanine-DNA:cysteine-protein methyltransferase; Provisional; Region: PRK10286
568708007519	6-O-methylguanine DNA methyltransferase, ribonuclease-like domain; Region: Methyltransf_1N; pfam02870
568708007520	The DNA repair protein O6-alkylguanine-DNA alkyltransferase (ATase; also known as AGT, AGAT and MGMT) reverses O6-alkylation DNA damage by transferring O6-alkyl adducts to an active site cysteine irreversibly, without inducing DNA strand breaks. ATases...; Region: ATase; cd06445
568708007521	DNA binding site [nucleotide binding]
568708007522	active site
568708007525	fumarate/nitrate reduction transcriptional regulator; Provisional; Region: PRK11161
568708007526	effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038
568708007527	ligand binding site [chemical binding]; other site
568708007528	flexible hinge region; other site
568708007529	helix_turn_helix, cAMP Regulatory protein C-terminus; DNA binding domain of prokaryotic regulatory proteins belonging to the catabolite activator protein family; Region: HTH_CRP; cd00092
568708007530	putative switch regulator; other site
568708007531	non-specific DNA interactions [nucleotide binding]; other site
568708007532	DNA binding site [nucleotide binding]
568708007533	sequence specific DNA binding site [nucleotide binding]; other site
568708007534	putative cAMP binding site [chemical binding]; other site
568708007537	universal stress protein UspE; Provisional; Region: PRK11175
568708007538	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
568708007539	Ligand Binding Site [chemical binding]; other site
568708007540	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
568708007541	Ligand Binding Site [chemical binding]; other site
568708007543	Protein of unknown function (DUF2534); Region: DUF2534; pfam10749
568708007545	2 probable transmembrane helices predicted for STM_MW16581 by TMHMM2.0 at aa 13-35 and 60-82
568708007546	Signal peptide predicted for STM_MW16581 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.822 between residues 32 and 33
568708007547	Small-conductance mechanosensitive channel [Cell envelope biogenesis, outer membrane]; Region: MscS; COG0668
568708007548	Mechanosensitive ion channel; Region: MS_channel; pfam00924
568708007549	5 probable transmembrane helices predicted for STM_MW16591 by TMHMM2.0 at aa 10-30, 39-61, 76-98, 117-134 and 138-160
568708007551	DNA-binding transcriptional repressor PuuR; Provisional; Region: PRK09943
568708007552	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
568708007553	non-specific DNA binding site [nucleotide binding]; other site
568708007554	salt bridge; other site
568708007555	sequence-specific DNA binding site [nucleotide binding]; other site
568708007556	Cupin domain; Region: Cupin_2; pfam07883
568708007559	Solo B3/4 domain (OB-fold DNA/RNA-binding) of Phe-aaRS-beta [General function prediction only]; Region: COG3382
568708007560	B3/4 domain; Region: B3_4; pfam03483
568708007562	Peroxiredoxin [Posttranslational modification, protein turnover, chaperones]; Region: Tpx; COG2077
568708007564	1 probable transmembrane helix predicted for STM_MW16631 by TMHMM2.0 at aa 7-29
568708007565	Signal peptide predicted for STM_MW16631 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.639 between residues 24 and 25
568708007566	Protein of unknown function (DUF3442); Region: DUF3442; pfam11924
568708007567	Signal peptide predicted for STM_MW16651 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.535 between residues 21 and 22
568708007568	pfam_scan;Pfam:PF06445; E()=1.1E-16;score=60.6;query125- 282;description=AraC_E_bind; pfam_scan;Pfam:PF00165; E()=1.4E-10;score=40.5;query66-104;description=HTH_AraC
568708007571	Bacterial protein of unknown function (DUF903); Region: DUF903; pfam06004
568708007573	1 probable transmembrane helix predicted for STM_MW16681 by TMHMM2.0 at aa 12-34
568708007574	Signal peptide predicted for STM_MW16681 by SignalP 2.0 HMM (Signal peptide probability 0.933) with cleavage site probability 0.580 between residues 31 and 32
568708007575	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
568708007576	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
568708007578	oxidoreductase; Provisional; Region: PRK12742
568708007579	classical (c) SDRs; Region: SDR_c; cd05233
568708007580	NAD(P) binding site [chemical binding]; other site
568708007581	active site
568708007583	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660
568708007584	Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248
568708007585	active site
568708007586	catalytic tetrad [active]
568708007588	Transcriptional regulator [Transcription]; Region: LysR; COG0583
568708007589	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708007590	The C-terminal substrate binding domain of an uncharacterized LysR-type transcriptional regulator CrgA-like, contains the type 2 periplasmic binding fold; Region: PBP2_CrgA_like_3; cd08472
568708007591	putative effector binding pocket; other site
568708007592	putative dimerization interface [polypeptide binding]; other site
568708007595	phenylcoumaran benzylic ether reductase (PCBER) like, atypical (a) SDRs; Region: PCBER_SDR_a; cd05259
568708007596	NmrA-like family; Region: NmrA; pfam05368
568708007597	NAD(P) binding site [chemical binding]; other site
568708007598	active site lysine
568708007599	1 probable transmembrane helix predicted for STM_MW16731 by TMHMM2.0 at aa 12-34
568708007601	oligopeptide ABC transporter substrate-binding protein OppA; Provisional; Region: PRK15104
568708007602	The substrate-binding component of an ABC-type oligopetide import system contains the type 2 periplasmic binding fold; Region: PBP2_OppA; cd08504
568708007603	peptide binding site [polypeptide binding]; other site
568708007605	Signal peptide predicted for STM_MW16741 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.961 between residues 22 and 23
568708007606	Predicted carboxypeptidase [Amino acid transport and metabolism]; Region: COG2866
568708007607	Peptidase M14-like domain of Escherichia coli Murein Peptide Amidase A and related proteins; Region: M14_MpaA_like; cd06904
568708007608	putative active site [active]
568708007609	Zn binding site [ion binding]; other site
568708007611	L-Ala-D/L-Glu epimerase; Provisional; Region: PRK15129
568708007612	L-Ala-D/L-Glu epimerase catalyzes the epimerization of L-Ala-D/L-Glu and other dipeptides. The genomic context and the substrate specificity of characterized members of this family from E.coli and B.subtilis indicates a possible role in the metabolism of...; Region: L-Ala-DL-Glu_epimerase; cd03319
568708007613	active site
568708007616	Peroxiredoxin (PRX) family, Atypical 2-cys PRX subfamily; composed of PRXs containing peroxidatic and resolving cysteines, similar to the homodimeric thiol specific antioxidant (TSA) protein also known as TRX-dependent thiol peroxidase (Tpx). Tpx is a...; Region: PRX_Atyp2cys; cd03014
568708007617	dimer interface [polypeptide binding]; other site
568708007618	catalytic triad [active]
568708007619	peroxidatic and resolving cysteines [active]
568708007621	DNA-binding transcriptional regulator TyrR; Provisional; Region: PRK10820
568708007622	N-terminal ACT domain of the TyrR protein; Region: ACT_TyrR; cd04877
568708007623	putative aromatic amino acid binding site; other site
568708007624	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708007625	Walker A motif; other site
568708007626	ATP binding site [chemical binding]; other site
568708007627	Walker B motif; other site
568708007628	arginine finger; other site
568708007630	hypothetical protein; Provisional; Region: PRK05415
568708007631	TIGR01620 family protein; Region: hyp_HI0043
568708007632	3 probable transmembrane helices predicted for STM_MW16791 by TMHMM2.0 at aa 70-89, 99-121 and 210-232
568708007634	Predicted ATPase [General function prediction only]; Region: COG3106
568708007636	Rhodanese Homology Domain (RHOD); an alpha beta fold domain found duplicated in the rhodanese protein. The cysteine containing enzymatically active version of the domain is also found in the Cdc25 class of protein phosphatases and a variety of proteins...; Region: RHOD; cd00158
568708007637	active site residue [active]
568708007639	1 probable transmembrane helix predicted for STM_MW16811 by TMHMM2.0 at aa 5-24
568708007640	Signal peptide predicted for STM_MW16811 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 19 and 20
568708007641	peripheral inner membrane phage-shock protein; Provisional; Region: PRK10497
568708007643	DNA-binding transcriptional activator PspC; Provisional; Region: PRK10697
568708007644	phage shock protein C; Region: phageshock_pspC; TIGR02978
568708007646	1 probable transmembrane helix predicted for STM_MW16831 by TMHMM2.0 at aa 39-61
568708007647	phage shock protein B; Provisional; Region: pspB; PRK09458
568708007649	1 probable transmembrane helix predicted for STM_MW16841 by TMHMM2.0 at aa 4-26
568708007650	phage shock protein PspA; Provisional; Region: PRK10698
568708007652	phage shock protein operon transcriptional activator; Provisional; Region: pspF; PRK11608
568708007653	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708007654	Walker A motif; other site
568708007655	ATP binding site [chemical binding]; other site
568708007656	Walker B motif; other site
568708007657	arginine finger; other site
568708007658	Bacterial regulatory protein, Fis family; Region: HTH_8; cl17420
568708007661	ABC-type oligopeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: OppA; COG4166
568708007662	The substrate-binding component of an ABC-type dipeptide import system contains the type 2 periplasmic binding fold; Region: PBP2_DppA_like; cd08493
568708007663	peptide binding site [polypeptide binding]; other site
568708007664	Signal peptide predicted for STM_MW16871 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 21 and 22
568708007666	antimicrobial peptide ABC transporter permease SapB; Provisional; Region: PRK15110
568708007667	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708007668	dimer interface [polypeptide binding]; other site
568708007669	conserved gate region; other site
568708007670	putative PBP binding loops; other site
568708007671	ABC-ATPase subunit interface; other site
568708007672	4 probable transmembrane helices predicted for STM_MW16881 by TMHMM2.0 at aa 23-45, 57-79, 194-216 and 229-251
568708007674	antimicrobial peptide ABC transporter permease SapC; Provisional; Region: PRK15111
568708007675	N-terminal TM domain of oligopeptide transport permease C; Region: OppC_N; pfam12911
568708007676	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708007677	dimer interface [polypeptide binding]; other site
568708007678	conserved gate region; other site
568708007679	putative PBP binding loops; other site
568708007680	ABC-ATPase subunit interface; other site
568708007681	6 probable transmembrane helices predicted for STM_MW16891 by TMHMM2.0 at aa 30-52, 99-121, 134-156, 198-217, 224-243 and 258-280
568708007683	antimicrobial peptide ABC transporter ATP-binding protein; Provisional; Region: PRK15093
568708007684	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
568708007685	Walker A/P-loop; other site
568708007686	ATP binding site [chemical binding]; other site
568708007687	Q-loop/lid; other site
568708007688	ABC transporter signature motif; other site
568708007689	Walker B; other site
568708007690	D-loop; other site
568708007691	H-loop/switch region; other site
568708007692	Oligopeptide/dipeptide transporter, C-terminal region; Region: oligo_HPY; cl07097
568708007695	antimicrobial peptide ABC system ATP-binding protein SapF; Provisional; Region: PRK15112
568708007696	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
568708007697	Walker A/P-loop; other site
568708007698	ATP binding site [chemical binding]; other site
568708007699	Q-loop/lid; other site
568708007700	ABC transporter signature motif; other site
568708007701	Walker B; other site
568708007702	D-loop; other site
568708007703	H-loop/switch region; other site
568708007705	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cl00290
568708007707	Protein kinase domain; Region: Pkinase; pfam00069
568708007708	enoyl-(acyl carrier protein) reductase; Provisional; Region: PRK07984
568708007709	Enoyl acyl carrier protein (ACP) reductase (ENR), divergent SDR; Region: ENR_SDR; cd05372
568708007710	NAD binding site [chemical binding]; other site
568708007711	homotetramer interface [polypeptide binding]; other site
568708007712	homodimer interface [polypeptide binding]; other site
568708007713	substrate binding site [chemical binding]; other site
568708007714	active site
568708007716	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4950
568708007717	Uncharacterized conserved protein [Function unknown]; Region: COG2128
568708007718	exoribonuclease II; Provisional; Region: PRK05054
568708007719	Ribonuclease B OB domain; Region: OB_RNB; pfam08206
568708007720	RNB domain; Region: RNB; pfam00773
568708007721	S1 RNA binding domain; Region: S1; pfam00575
568708007725	RNase II stability modulator; Provisional; Region: PRK10060
568708007726	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
568708007727	putative active site [active]
568708007728	heme pocket [chemical binding]; other site
568708007729	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
568708007730	metal binding site [ion binding]; metal-binding site
568708007731	active site
568708007732	I-site; other site
568708007733	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
568708007737	Transcriptional regulators of sugar metabolism [Transcription / Carbohydrate transport and metabolism]; Region: GlpR; COG1349
568708007738	helix_turn_helix, Deoxyribose operon repressor; Region: HTH_DEOR; smart00420
568708007739	DeoR C terminal sensor domain; Region: DeoRC; pfam00455
568708007742	translation initiation factor Sui1; Validated; Region: PRK06824
568708007743	Homologs of eIF1/SUI1 including Escherichia coli YciH; Region: YciH_like; cd11567
568708007744	putative rRNA binding site [nucleotide binding]; other site
568708007746	Orotidine 5'-phosphate decarboxylase (ODCase) is a dimeric enzyme that decarboxylates orotidine 5'-monophosphate (OMP) to form uridine 5'-phosphate (UMP), an essential step in the pyrimidine biosynthetic pathway. In mammals, UMP synthase...; Region: OMP_decarboxylase_like; cd04725
568708007747	active site
568708007748	dimer interface [polypeptide binding]; other site
568708007750	Signal peptide predicted for STM_MW17021 by SignalP 2.0 HMM (Signal peptide probability 0.780) with cleavage site probability 0.772 between residues 20 and 21
568708007751	Predicted N-acetylglucosaminyl transferase [Carbohydrate transport and metabolism]; Region: COG2956
568708007752	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cl02429
568708007753	TPR motif; other site
568708007754	binding surface
568708007755	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
568708007756	binding surface
568708007757	TPR motif; other site
568708007758	Predicted membrane protein [Function unknown]; Region: COG3771
568708007760	2 probable transmembrane helices predicted for STM_MW17041 by TMHMM2.0 at aa 5-23 and 43-65
568708007761	Signal peptide predicted for STM_MW17041 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.704 between residues 22 and 23
568708007762	Membrane-associated phospholipid phosphatase [Lipid metabolism]; Region: PgpB; COG0671
568708007763	PAP2_like proteins, a super-family of histidine phosphatases and vanadium haloperoxidases, includes type 2 phosphatidic acid phosphatase or lipid phosphate phosphatase (LPP), Glucose-6-phosphatase, Phosphatidylglycerophosphatase B and bacterial acid...; Region: PAP2_like; cd01610
568708007764	active site
568708007765	6 probable transmembrane helices predicted for STM_MW17051 by TMHMM2.0 at aa 9-31, 51-68, 75-92, 157-179, 186-208 and 212-229
568708007767	Signal peptide predicted for STM_MW17051 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.977 between residues 24 and 25
568708007768	GTP cyclohydrolase II (RibA).  GTP cyclohydrolase II catalyzes the conversion of GTP to 2,5-diamino-6-ribosylamino-4(3H)-pyrimidinone 5' phosphate, formate, pyrophosphate (APy), and GMP in the biosynthetic pathway of riboflavin. Riboflavin is the...; Region: GTP_cyclohydro2; cd00641
568708007769	dimerization interface [polypeptide binding]; other site
568708007770	active site
568708007772	aconitate hydratase; Validated; Region: PRK09277
568708007773	Aconitase A catalytic domain; Region: AcnA_IRP; cd01586
568708007774	substrate binding site [chemical binding]; other site
568708007775	ligand binding site [chemical binding]; other site
568708007776	Aconitase A swivel domain. This is the major form of the TCA cycle enzyme aconitate hydratase, also known as aconitase and citrate hydro-lyase. It includes bacterial and archaeal aconitase A, and the eukaryotic cytosolic form of aconitase. This group...; Region: AcnA_IRP_Swivel; cd01580
568708007777	substrate binding site [chemical binding]; other site
568708007780	transcriptional regulator CysB; Reviewed; Region: cysB; PRK12681
568708007781	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708007782	The C-terminal substrate domain of LysR-type transcriptional regulator CysB contains type 2 periplasmic binding fold; Region: PBP2_CysB; cd08443
568708007783	substrate binding site [chemical binding]; other site
568708007784	putative dimerization interface [polypeptide binding]; other site
568708007787	DNA topoisomerase I subunit omega; Validated; Region: PRK07561
568708007788	TOPRIM_TopoIA_TopoI: The topoisomerase-primase (TORPIM) domain found in members of the type IA family of DNA topoisomerases (Topo IA) similar to Escherichia coli DNA topoisomerase I.   Type IA DNA topoisomerases remove (relax) negative supercoils in the...; Region: TOPRIM_TopoIA_TopoI; cd03363
568708007789	active site
568708007790	interdomain interaction site; other site
568708007791	putative metal-binding site [ion binding]; other site
568708007792	nucleotide binding site [chemical binding]; other site
568708007793	DNA Topoisomerase, subtype IA; DNA-binding, ATP-binding and catalytic domain of bacterial DNA topoisomerases I and III, and eukaryotic DNA topoisomerase III and eubacterial and archael reverse gyrases. Topoisomerases clevage single or double stranded DNA...; Region: TOP1Ac; cd00186
568708007794	domain I; other site
568708007795	DNA binding groove [nucleotide binding]
568708007796	phosphate binding site [ion binding]; other site
568708007797	domain II; other site
568708007798	domain III; other site
568708007799	nucleotide binding site [chemical binding]; other site
568708007800	catalytic site [active]
568708007801	domain IV; other site
568708007802	Topoisomerase DNA binding C4 zinc finger; Region: zf-C4_Topoisom; pfam01396
568708007803	Topoisomerase DNA binding C4 zinc finger; Region: zf-C4_Topoisom; pfam01396
568708007804	Topoisomerase I zinc-ribbon-like; Region: Topo_Zn_Ribbon; pfam08272
568708007805	Topoisomerase I zinc-ribbon-like; Region: Topo_Zn_Ribbon; pfam08272
568708007810	hypothetical protein; Provisional; Region: PRK11037
568708007812	Peptidase family S49 N-terminal; Region: Peptidase_S49_N; pfam08496
568708007813	putative inner membrane peptidase; Provisional; Region: PRK11778
568708007814	Signal peptide peptidase A (SppA), a serine protease, has catalytic Ser-Lys dyad; Region: S49_Sppa_N_C; cd07023
568708007815	tandem repeat interface [polypeptide binding]; other site
568708007816	oligomer interface [polypeptide binding]; other site
568708007817	active site residues [active]
568708007819	2 probable transmembrane helices predicted for STM_MW17121 by TMHMM2.0 at aa 10-32 and 189-206
568708007821	putative oxoacyl-(acyl carrier protein) reductase; Provisional; Region: PRK08945
568708007822	Escherichia coli K-12 YCIK-like, classical (c) SDRs; Region: Ycik_SDR_c; cd05340
568708007823	NADP binding site [chemical binding]; other site
568708007824	homodimer interface [polypeptide binding]; other site
568708007825	active site
568708007827	ATP:corrinoid adenosyltransferase [Coenzyme metabolism]; Region: BtuR; COG2109
568708007828	ATP:corrinoid adenosyltransferase BtuR/CobO/CobP; Region: CobA_CobO_BtuR; cl17276
568708007829	ATP:corrinoid adenosyltransferase BtuR/CobO/CobP. This family consists of the BtuR, CobO, CobP proteins all of which are Cob(I)alamin (vitamin B12) adenosyltransferase, which is involved in cobalamin (vitamin B12) biosynthesis. This enzyme is a homodimer; Region: CobA_CobO_BtuR; cd00561
568708007830	homodimer interface [polypeptide binding]; other site
568708007831	Walker A motif; other site
568708007832	ATP binding site [chemical binding]; other site
568708007833	hydroxycobalamin binding site [chemical binding]; other site
568708007834	Walker B motif; other site
568708007836	23S rRNA pseudouridylate synthase B; Provisional; Region: PRK10700
568708007837	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
568708007838	RNA binding surface [nucleotide binding]; other site
568708007839	Pseudouridine synthase, Escherichia coli RluB like; Region: PseudoU_synth_RluB; cd02556
568708007840	probable active site [active]
568708007843	hypothetical protein; Provisional; Region: PRK11630
568708007845	Predicted metal-dependent phosphoesterases (PHP family) [General function prediction only]; Region: COG0613
568708007846	Polymerase and Histidinol Phosphatase domain of Histidinol phosphate phosphatase (HisPPase) AMP bound; Region: PHP_HisPPase_AMP; cd07438
568708007847	active site
568708007848	Polymerase and Histidinol Phosphatase domain of Histidinol phosphate phosphatase (HisPPase) AMP bound; Region: PHP_HisPPase_AMP; cd07438
568708007850	anthranilate synthase component I; Provisional; Region: PRK13564
568708007851	Anthranilate synthase component I, N terminal region; Region: Anth_synt_I_N; pfam04715
568708007852	chorismate binding enzyme; Region: Chorismate_bind; pfam00425
568708007855	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase; Provisional; Region: PRK09522
568708007856	Type 1 glutamine amidotransferase (GATase1) domain found in Anthranilate synthase; Region: GATase1_Anthranilate_Synthase; cd01743
568708007857	glutamine binding [chemical binding]; other site
568708007858	catalytic triad [active]
568708007859	Glycosyl transferase family, helical bundle domain; Region: Glycos_trans_3N; pfam02885
568708007860	Glycosyl transferase family, a/b domain; Region: Glycos_transf_3; pfam00591
568708007864	bifunctional indole-3-glycerol phosphate synthase/phosphoribosylanthranilate isomerase; Provisional; Region: PRK09427
568708007865	Indole-3-glycerol phosphate synthase (IGPS); an enzyme in the tryptophan biosynthetic pathway, catalyzing the ring closure reaction of 1-(o-carboxyphenylamino)-1-deoxyribulose-5-phosphate (CdRP) to indole-3-glycerol phosphate (IGP), accompanied by the...; Region: IGPS; cd00331
568708007866	active site
568708007867	ribulose/triose binding site [chemical binding]; other site
568708007868	phosphate binding site [ion binding]; other site
568708007869	substrate (anthranilate) binding pocket [chemical binding]; other site
568708007870	product (indole) binding pocket [chemical binding]; other site
568708007871	Phosphoribosylanthranilate isomerase (PRAI) catalyzes the fourth step of the tryptophan biosynthesis, the conversion of N-(5'- phosphoribosyl)-anthranilate (PRA) to 1-(o-carboxyphenylamino)- 1-deoxyribulose 5-phosphate (CdRP). Most PRAIs are...; Region: PRAI; cd00405
568708007872	active site
568708007875	tryptophan synthase, beta subunit; Region: trpB; TIGR00263
568708007876	Tryptophan synthase-beta:  Trptophan synthase is a bifunctional enzyme that catalyses the last two steps in the biosynthesis of L-tryptophan via its alpha and beta reactions. In the alpha reaction, indole 3-glycerol phosphate is cleaved reversibly to...; Region: Trp-synth_B; cd06446
568708007877	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708007878	catalytic residue [active]
568708007880	tryptophan synthase alpha subunit; Provisional; Region: trpA; CHL00200
568708007881	Ttryptophan synthase (TRPS) alpha subunit (TSA). TPRS is a bifunctional tetrameric enzyme (2 alpha and 2 beta subunits) that catalyzes the last two steps of L-tryptophan biosynthesis. Alpha and beta subunit catalyze two distinct reactions which are both...; Region: Tryptophan_synthase_alpha; cd04724
568708007882	substrate binding site [chemical binding]; other site
568708007883	active site
568708007884	catalytic residues [active]
568708007885	heterodimer interface [polypeptide binding]; other site
568708007887	General stress protein [General function prediction only]; Region: GsiB; COG3729
568708007889	YciF bacterial stress response protein, ferritin-like iron-binding domain; Region: YciF; cd07909
568708007890	dimerization interface [polypeptide binding]; other site
568708007891	metal binding site [ion binding]; metal-binding site
568708007893	Ferritin-like superfamily of diiron-containing four-helix-bundle proteins; Region: Ferritin_like; cd00657
568708007894	dinuclear metal binding motif [ion binding]; other site
568708007896	Manganese catalase, ferritin-like diiron-binding domain; Region: Mn_catalase; cd01051
568708007897	dimanganese center [ion binding]; other site
568708007899	outer membrane protein W; Provisional; Region: PRK10959
568708007901	Signal peptide predicted for STM_MW17271 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 21 and 22
568708007902	Predicted Fe-S-cluster oxidoreductase [General function prediction only]; Region: COG0727
568708007904	hypothetical protein; Provisional; Region: PRK02868
568708007905	Signal peptide predicted for STM_MW17291 by SignalP 2.0 HMM (Signal peptide probability 0.946) with cleavage site probability 0.435 between residues 38 and 39
568708007907	6 probable transmembrane helices predicted for STM_MW17291 by TMHMM2.0 at aa 20-42, 89-111, 118-140, 144-166, 187-209 and 219-241
568708007908	intracellular septation protein A; Reviewed; Region: PRK00259
568708007910	5 probable transmembrane helices predicted for STM_MW17301 by TMHMM2.0 at aa 20-42, 51-68, 78-95, 119-141 and 151-170
568708007911	Brown fat-inducible thioesterase (BFIT).  Brain acyl-CoA hydrolase (BACH).  These enzymes deacylate long-chain fatty acids by hydrolyzing acyl-CoA thioesters to free fatty acids and CoA-SH. Eukaryotic members of this family are expressed in brain, testis; Region: BFIT_BACH; cd03442
568708007913	transport protein TonB; Provisional; Region: PRK10819
568708007914	Gram-negative bacterial tonB protein; Region: TonB; pfam03544
568708007916	YciI-like protein; Reviewed; Region: PRK11370
568708007918	cardiolipin synthetase; Reviewed; Region: cls; PRK01642
568708007919	Phospholipase_D-nuclease N-terminal; Region: PLDc_N; pfam13396
568708007920	Catalytic domain, repeat 1, of Escherichia coli cardiolipin synthase and similar proteins; Region: PLDc_EcCLS_like_1; cd09152
568708007921	putative active site [active]
568708007922	catalytic site [active]
568708007923	Catalytic domain, repeat 2, of Escherichia coli cardiolipin synthase and similar proteins; Region: PLDc_EcCLS_like_2; cd09158
568708007924	putative active site [active]
568708007925	catalytic site [active]
568708007926	2 probable transmembrane helices predicted for STM_MW17341 by TMHMM2.0 at aa 10-29 and 36-58
568708007928	dsDNA-mimic protein; Reviewed; Region: PRK05094
568708007930	Ion transport protein; Region: Ion_trans; pfam00520
568708007931	Ion channel; Region: Ion_trans_2; pfam07885
568708007932	zinc-ribbon domain; Region: zf-ribbon_3; pfam13248
568708007933	Double zinc ribbon; Region: DZR; pfam12773
568708007934	6 probable transmembrane helices predicted for STM_MW17361 by TMHMM2.0 at aa 12-34, 44-66, 73-95, 139-161, 166-188 and 198-220
568708007936	Signal peptide predicted for STM_MW17361 by SignalP 2.0 HMM (Signal peptide probability 0.899) with cleavage site probability 0.369 between residues 28 and 29
568708007937	oligopeptide ABC transporter ATP-binding protein OppF; Provisional; Region: PRK15079
568708007938	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
568708007939	Walker A/P-loop; other site
568708007940	ATP binding site [chemical binding]; other site
568708007941	Q-loop/lid; other site
568708007942	ABC transporter signature motif; other site
568708007943	Walker B; other site
568708007944	D-loop; other site
568708007945	H-loop/switch region; other site
568708007946	oligopeptide/dipeptide ABC transporter, ATP-binding protein, C-terminal domain; Region: oligo_HPY; TIGR01727
568708007949	oligopeptide transporter ATP-binding component; Provisional; Region: oppD; PRK09473
568708007950	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
568708007951	Walker A/P-loop; other site
568708007952	ATP binding site [chemical binding]; other site
568708007953	Q-loop/lid; other site
568708007954	ABC transporter signature motif; other site
568708007955	Walker B; other site
568708007956	D-loop; other site
568708007957	H-loop/switch region; other site
568708007958	Oligopeptide/dipeptide transporter, C-terminal region; Region: oligo_HPY; cl07097
568708007961	oligopeptide ABC transporter permease OppC; Provisional; Region: PRK15406
568708007962	N-terminal TM domain of oligopeptide transport permease C; Region: OppC_N; pfam12911
568708007963	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708007964	dimer interface [polypeptide binding]; other site
568708007965	conserved gate region; other site
568708007966	ABC-ATPase subunit interface; other site
568708007967	6 probable transmembrane helices predicted for STM_MW17391 by TMHMM2.0 at aa 40-62, 103-125, 138-160, 164-183, 214-236 and 268-290
568708007969	oligopeptide transporter permease; Reviewed; Region: oppB; PRK09471
568708007970	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708007971	dimer interface [polypeptide binding]; other site
568708007972	conserved gate region; other site
568708007973	putative PBP binding loops; other site
568708007974	ABC-ATPase subunit interface; other site
568708007975	6 probable transmembrane helices predicted for STM_MW17401 by TMHMM2.0 at aa 13-30, 102-121, 134-156, 166-188, 228-250 and 278-300
568708007977	oligopeptide ABC transporter substrate-binding protein OppA; Provisional; Region: PRK15104
568708007978	The substrate-binding component of an ABC-type oligopetide import system contains the type 2 periplasmic binding fold; Region: PBP2_OppA; cd08504
568708007979	peptide binding site [polypeptide binding]; other site
568708007981	1 probable transmembrane helix predicted for STM_MW17411 by TMHMM2.0 at aa 48-70
568708007982	hypothetical protein; Provisional; Region: PRK11111
568708007983	6 probable transmembrane helices predicted for STM_MW17431 by TMHMM2.0 at aa 10-32, 52-74, 78-100, 120-142, 146-168 and 189-211
568708007985	bifunctional acetaldehyde-CoA/alcohol dehydrogenase; Provisional; Region: PRK13805
568708007986	Coenzyme A acylating aldehyde dehydrogenase (ACDH), ALDH family 20-like; Region: ALDH_F20_ACDH; cd07122
568708007987	putative catalytic cysteine [active]
568708007988	C-terminal alcohol dehydrogenase domain of the acetaldehyde dehydrogenase-alcohol dehydrogenase bifunctional two-domain protein (AAD); Region: AAD_C; cd08178
568708007989	putative active site [active]
568708007990	metal binding site [ion binding]; metal-binding site
568708007993	thymidine kinase; Provisional; Region: PRK04296
568708007995	global DNA-binding transcriptional dual regulator H-NS; Provisional; Region: PRK10947
568708007996	Domain in histone-like proteins of HNS family; Region: HNS; smart00528
568708007998	Prokaryotic UGPase catalyses the synthesis of UDP-glucose; Region: UGPase_prokaryotic; cd02541
568708007999	dTDP-glucose pyrophosphorylase [Cell envelope biogenesis, outer membrane]; Region: RfbA; COG1209
568708008000	active site
568708008001	tetramer interface; other site
568708008003	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708008004	active site
568708008005	response regulator of RpoS; Provisional; Region: PRK10693
568708008006	phosphorylation site [posttranslational modification]
568708008007	intermolecular recognition site; other site
568708008008	dimerization interface [polypeptide binding]; other site
568708008010	hypothetical protein; Provisional; Region: PRK10279
568708008011	Bacterial patatin-like phospholipase domain containing protein 6; Region: Pat_NTE_like_bacteria; cd07228
568708008012	active site
568708008013	nucleophile elbow; other site
568708008015	SEC-C motif; Region: SEC-C; pfam02810
568708008016	hypothetical protein; Provisional; Region: PRK04233
568708008018	formyltetrahydrofolate deformylase; Reviewed; Region: purU; PRK06027
568708008019	N-terminal ACT domain of formyltetrahydrofolate deformylase (F4HF-DF; formyltetrahydrofolate hydrolase); Region: ACT_F4HF-DF; cd04875
568708008020	Formyltetrahydrofolate deformylase (Formyl-FH4 hydrolase), C-terminal hydrolase domain; Region: FMT_core_Formyl-FH4-Hydrolase_C; cd08648
568708008021	putative active site [active]
568708008022	putative substrate binding site [chemical binding]; other site
568708008023	putative cosubstrate binding site; other site
568708008024	catalytic site [active]
568708008027	FOG: TPR repeat, SEL1 subfamily [General function prediction only]; Region: COG0790
568708008028	Sel1-like repeats; Region: SEL1; smart00671
568708008029	FOG: TPR repeat, SEL1 subfamily [General function prediction only]; Region: COG0790
568708008030	Sel1-like repeats; Region: SEL1; smart00671
568708008031	Sel1-like repeats; Region: SEL1; smart00671
568708008032	Sel1-like repeats; Region: SEL1; smart00671
568708008033	Sel1-like repeats; Region: SEL1; smart00671
568708008034	Sel1-like repeats; Region: SEL1; smart00671
568708008035	Sel1-like repeats; Region: SEL1; smart00671
568708008036	Sel1-like repeats; Region: SEL1; smart00671
568708008038	respiratory nitrate reductase, gamma subunit; Region: narI; TIGR00351
568708008040	5 probable transmembrane helices predicted for STM_MW17531 by TMHMM2.0 at aa 4-26, 47-69, 89-108, 127-149 and 184-206
568708008041	Nitrate reductase delta subunit; Region: Nitrate_red_del; cl00958
568708008043	Nitrate reductase beta subunit [Energy production and conversion]; Region: NarY; COG1140
568708008044	4Fe-4S binding domain; Region: Fer4; cl02805
568708008045	respiratory nitrate reductase, alpha subunit; Region: narG; TIGR01580
568708008046	Respiratory nitrate reductase A (NarGHI), alpha chain (NarG) and related proteins. Under anaerobic conditions in the presence of nitrate, E. coli synthesizes the cytoplasmic membrane-bound quinol-nitrate oxidoreductase (NarGHI), which reduces nitrate to...; Region: MopB_Nitrate-R-NarG-like; cd02750
568708008047	[4Fe-4S] binding site [ion binding]; other site
568708008048	Molybdopterin-Binding (MopB) domain of the MopB superfamily of proteins, a  large, diverse, heterogeneous superfamily of enzymes that, in general, bind molybdopterin as a cofactor. The MopB domain is found in a wide variety of molybdenum- and...; Region: Molybdopterin-Binding; cl09928
568708008049	Molybdopterin-Binding (MopB) domain of the MopB superfamily of proteins, a  large, diverse, heterogeneous superfamily of enzymes that, in general, bind molybdopterin as a cofactor. The MopB domain is found in a wide variety of molybdenum- and...; Region: Molybdopterin-Binding; cl09928
568708008050	Molybdopterin-Binding (MopB) domain of the MopB superfamily of proteins, a  large, diverse, heterogeneous superfamily of enzymes that, in general, bind molybdopterin as a cofactor. The MopB domain is found in a wide variety of molybdenum- and...; Region: Molybdopterin-Binding; cl09928
568708008051	Respiratory nitrate reductase A (NarGHI), alpha chain (NarG) and related proteins. Under anaerobic conditions in the presence of nitrate, E. coli synthesizes the cytoplasmic membrane-bound quinol-nitrate oxidoreductase (NarGHI), which reduces nitrate to...; Region: MopB_CT_Nitrate-R-NarG-like; cd02776
568708008052	molybdopterin cofactor binding site; other site
568708008055	nitrate/nitrite transport protein NarU; Provisional; Region: PRK15034
568708008056	12 probable transmembrane helices predicted for STM_MW17571 by TMHMM2.0 at aa 38-60, 75-97, 104-123, 133-155, 176-198, 213-235, 256-278, 288-310, 322-344, 348-370, 404-421 and 436-458
568708008058	nitrate/nitrite sensor protein NarX; Provisional; Region: PRK10600
568708008059	Type IV pili methyl-accepting chemotaxis transducer N-term; Region: PilJ; pfam13675
568708008060	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
568708008061	dimerization interface [polypeptide binding]; other site
568708008062	Histidine kinase; Region: HisKA_3; pfam07730
568708008063	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708008064	ATP binding site [chemical binding]; other site
568708008065	Mg2+ binding site [ion binding]; other site
568708008066	G-X-G motif; other site
568708008067	Signal peptide predicted for STM_MW17581 by SignalP 2.0 HMM (Signal peptide probability 0.990) with cleavage site probability 0.674 between residues 33 and 34
568708008068	2 probable transmembrane helices predicted for STM_MW17581 by TMHMM2.0 at aa 15-37 and 154-176
568708008072	transcriptional regulator NarL; Provisional; Region: PRK10651
568708008073	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708008074	active site
568708008075	phosphorylation site [posttranslational modification]
568708008076	intermolecular recognition site; other site
568708008077	dimerization interface [polypeptide binding]; other site
568708008078	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
568708008079	DNA binding residues [nucleotide binding]
568708008080	dimerization interface [polypeptide binding]; other site
568708008083	putative invasin; Provisional; Region: PRK10177
568708008084	Protein of unknown function (DUF3442); Region: DUF3442; pfam11924
568708008085	Signal peptide predicted for STM_MW17601 by SignalP 2.0 HMM (Signal peptide probability 0.990) with cleavage site probability 0.839 between residues 40 and 41
568708008086	Uncharacterized conserved protein involved in intracellular sulfur reduction [Inorganic ion transport and metabolism]; Region: DsrE; COG1553
568708008088	cation transport regulator; Reviewed; Region: chaB; PRK09582
568708008090	calcium/sodium:proton antiporter; Provisional; Region: PRK10599
568708008091	Sodium/calcium exchanger protein; Region: Na_Ca_ex; pfam01699
568708008092	11 probable transmembrane helices predicted for STM_MW17631 by TMHMM2.0 at aa 13-32, 36-58, 71-93, 108-127, 139-161, 166-188, 220-237, 247-269, 290-312, 317-339 and 346-365
568708008094	3-deoxy-D-manno-octulosonic acid (KDO) 8-phosphate synthase [Cell envelope biogenesis, outer membrane]; Region: KdsA; COG2877
568708008095	DAHP synthetase I family; Region: DAHP_synth_1; pfam00793
568708008097	hypothetical protein; Provisional; Region: PRK10941
568708008098	Transglutaminase-like superfamily; Region: Transglut_core2; pfam13369
568708008099	hypothetical protein; Provisional; Region: PRK10278
568708008101	4 probable transmembrane helices predicted for STM_MW17661 by TMHMM2.0 at aa 5-27, 39-60, 70-92 and 104-123
568708008102	Signal peptide predicted for STM_MW17661 by SignalP 2.0 HMM (Signal peptide probability 0.644) with cleavage site probability 0.455 between residues 22 and 23
568708008103	N5-glutamine S-adenosyl-L-methionine-dependent methyltransferase; Provisional; Region: PRK09328
568708008104	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708008106	peptide chain release factor 1; Validated; Region: prfA; PRK00591
568708008107	This domain is found in peptide chain release factors; Region: PCRF; smart00937
568708008108	RF-1 domain; Region: RF-1; pfam00472
568708008111	glutamyl-tRNA reductase; Reviewed; Region: hemA; PRK00045
568708008112	NADP-binding domain of glutamyl-tRNA reductase; Region: NAD_bind_Glutamyl_tRNA_reduct; cd05213
568708008113	tRNA; other site
568708008114	putative tRNA binding site [nucleotide binding]; other site
568708008115	putative NADP binding site [chemical binding]; other site
568708008116	Glutamyl-tRNAGlu reductase, dimerisation domain; Region: GlutR_dimer; pfam00745
568708008120	Outer membrane lipoprotein involved in outer membrane biogenesis [Cell envelope biogenesis, outer membrane]; Region: LolB; COG3017
568708008121	Outer membrane lipoprotein LolB; Region: LolB; pfam03550
568708008122	Signal peptide predicted for STM_MW17701 by SignalP 2.0 HMM (Signal peptide probability 0.782) with cleavage site probability 0.633 between residues 28 and 29
568708008124	4-diphosphocytidyl-2-C-methyl-D-erythritol kinase; Provisional; Region: ipk; PRK00343
568708008125	GHMP kinases N terminal domain; Region: GHMP_kinases_N; pfam00288
568708008128	ribose-phosphate pyrophosphokinase; Provisional; Region: PRK01259
568708008129	N-terminal domain of ribose phosphate pyrophosphokinase; Region: Pribosyltran_N; pfam13793
568708008130	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
568708008131	active site
568708008133	putative transporter; Provisional; Region: PRK11660
568708008134	Sulfate transporter N-terminal domain with GLY motif; Region: Sulfate_tra_GLY; pfam13792
568708008135	Sulfate transporter family; Region: Sulfate_transp; pfam00916
568708008136	Sulphate Transporter and Anti-Sigma factor antagonist domain of SulP-like sulfate transporters, plays a role in the function and regulation of the transport activity, proposed general NTP binding function; Region: STAS_SulP_like_sulfate_transporter; cd07042
568708008137	11 probable transmembrane helices predicted for STM_MW17731 by TMHMM2.0 at aa 25-47, 54-76, 91-113, 122-144, 169-191, 204-226, 269-291, 311-333, 338-360, 362-380 and 400-431
568708008140	hypothetical protein; Provisional; Region: PRK10692
568708008142	2 probable transmembrane helices predicted for STM_MW17741 by TMHMM2.0 at aa 7-29 and 39-61
568708008143	Signal peptide predicted for STM_MW17741 by SignalP 2.0 HMM (Signal peptide probability 0.830) with cleavage site probability 0.300 between residues 24 and 25
568708008144	Peptidyl-tRNA hydrolase (PTH) is a monomeric protein that cleaves the ester bond linking the nascent peptide and tRNA when peptidyl-tRNA is released prematurely from the ribosome. This ensures the recycling of peptidyl-tRNAs into tRNAs produced through...; Region: PTH; cd00462
568708008145	putative active site [active]
568708008146	catalytic residue [active]
568708008148	GTP-binding protein YchF; Reviewed; Region: PRK09601
568708008149	YchF GTPase; Region: YchF; cd01900
568708008150	G1 box; other site
568708008151	GTP/Mg2+ binding site [chemical binding]; other site
568708008152	Switch I region; other site
568708008153	G2 box; other site
568708008154	Switch II region; other site
568708008155	G3 box; other site
568708008156	G4 box; other site
568708008157	G5 box; other site
568708008158	TGS_YchF_C: This subfamily represents TGS domain-containing YchF GTP-binding protein, a universally conserved GTPase whose function is unknown. The N-terminal domain of the YchF protein belongs to the Obg-like family of GTPases, and some members of the...; Region: TGS_YchF_C; cd04867
568708008162	Protein of unknown function (DUF2743); Region: DUF2743; pfam10899
568708008163	Protein of unknown function (DUF4427); Region: DUF4427; pfam14468
568708008165	hydrogenase (NiFe) small subunit (hydA); Region: hydA; TIGR00391
568708008166	Tat (twin-arginine translocation) pathway signal sequence; Region: TAT_signal_seq; TIGR01409
568708008167	NADH ubiquinone oxidoreductase, 20 Kd subunit; Region: Oxidored_q6; pfam01058
568708008168	Signal peptide predicted for STM_MW17781 by SignalP 2.0 HMM (Signal peptide probability 0.931) with cleavage site probability 0.921 between residues 45 and 46
568708008169	2 probable transmembrane helices predicted for STM_MW17781 by TMHMM2.0 at aa 20-39 and 326-348
568708008171	hydrogenase 1 large subunit; Provisional; Region: PRK10170
568708008172	Ni,Fe-hydrogenase I large subunit [Energy production and conversion]; Region: HyaB; COG0374
568708008174	hydrogenase 1 b-type cytochrome subunit; Provisional; Region: PRK10171
568708008176	4 probable transmembrane helices predicted for STM_MW17801 by TMHMM2.0 at aa 28-47, 67-89, 141-160 and 194-211
568708008177	Endopeptidases belonging to membrane-bound hydrogenases group. These hydrogenases transfer electrons from H2 to a cytochrome that is bound to a membrane-located complex coupling electron transfer to transmembrane proton translocation. Endopeptidase HybD...; Region: H2MP_MemB-H2up; cd06062
568708008178	putative substrate-binding site; other site
568708008179	nickel binding site [ion binding]; other site
568708008181	HyaE family; HyaE is also called HupG and HoxO. They are proteins serving a critical role in the assembly of multimeric [NiFe] hydrogenases, the enzymes that catalyze the oxidation of molecular hydrogen to enable microorganisms to utilize hydrogen as the...; Region: HyaE; cd02965
568708008183	HupH hydrogenase expression protein, C-terminal conserved region; Region: HupH_C; pfam04809
568708008184	HupH hydrogenase expression protein, C-terminal conserved region; Region: HupH_C; pfam04809
568708008186	cytochrome bd-II oxidase subunit 1; Provisional; Region: PRK15035
568708008187	cytochrome d terminal oxidase subunit 1; Provisional; Region: PRK15097
568708008189	9 probable transmembrane helices predicted for STM_MW17841 by TMHMM2.0 at aa 20-42, 54-76, 96-118, 125-147, 186-208, 215-237, 387-409, 421-443 and 471-493
568708008190	cytochrome bd-II oxidase subunit 2; Provisional; Region: PRK15028
568708008191	Cytochrome bd-type quinol oxidase, subunit 2 [Energy production and conversion]; Region: AppB; COG1294
568708008193	8 probable transmembrane helices predicted for STM_MW17851 by TMHMM2.0 at aa 7-24, 80-102, 123-145, 160-182, 203-225, 258-280, 292-314 and 334-356
568708008194	Glutamate dehydrogenase/leucine dehydrogenase [Amino acid transport and metabolism]; Region: GdhA; COG0334
568708008195	Glu/Leu/Phe/Val dehydrogenase, dimerisation domain; Region: ELFV_dehydrog_N; pfam02812
568708008196	NAD(P) binding domain of glutamate dehydrogenase, subgroup 1; Region: NAD_bind_1_Glu_DH; cd01076
568708008197	NAD(P) binding site [chemical binding]; other site
568708008200	trehalase; Provisional; Region: treA; PRK13271
568708008201	Neutral trehalase [Carbohydrate transport and metabolism]; Region: TreA; COG1626
568708008202	Signal peptide predicted for STM_MW17881 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.996 between residues 34 and 35
568708008204	Transglycosylase associated protein; Region: Transgly_assoc; cl00978
568708008205	3 probable transmembrane helices predicted for STM_MW17891 by TMHMM2.0 at aa 4-22, 27-49 and 59-81
568708008207	c-di-GMP-binding protein [Signal transduction mechanisms]; Region: COG5581
568708008208	Flagellar regulator YcgR; Region: YcgR; pfam07317
568708008209	PilZ domain; Region: PilZ; pfam07238
568708008212	lytic murein endotransglycosylase E; Provisional; Region: emtA; PRK15470
568708008213	Lytic Transglycosylase (LT)  and Goose Egg White Lysozyme (GEWL) domain. Members include the soluble and insoluble membrane-bound LTs in bacteria, the LTs in bacteriophage lambda, as well as, the eukaryotic "goose-type" lysozymes (GEWL).  LTs...; Region: LT_GEWL; cd00254
568708008214	N-acetyl-D-glucosamine binding site [chemical binding]; other site
568708008215	catalytic residue [active]
568708008217	Signal peptide predicted for STM_MW17911 by SignalP 2.0 HMM (Signal peptide probability 0.861) with cleavage site probability 0.723 between residues 19 and 20
568708008218	LD-Carboxypeptidase, a serine protease, includes microcin C7 self immunity protein; Region: Peptidase_S66; cd07025
568708008219	dimer interface [polypeptide binding]; other site
568708008220	catalytic triad [active]
568708008222	NhaP-type Na+/H+ and K+/H+ antiporters with a unique C-terminal domain [Inorganic ion transport and metabolism]; Region: COG3263
568708008223	Kef-type K+ transport systems, membrane components [Inorganic ion transport and metabolism]; Region: KefB; cl10482
568708008224	TrkA-C domain; Region: TrkA_C; pfam02080
568708008225	Transporter associated domain; Region: CorC_HlyC; smart01091
568708008226	11 probable transmembrane helices predicted for STM_MW17931 by TMHMM2.0 at aa 4-26, 31-53, 57-74, 87-109, 119-141, 187-209, 232-254, 267-289, 299-321, 334-356 and 361-383
568708008230	alanine racemase; Reviewed; Region: dadX; PRK03646
568708008231	Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzymes, Proteobacterial Alanine Racemases; Region: PLPDE_III_AR_proteobact; cd06827
568708008232	active site
568708008233	pyridoxal 5'-phosphate (PLP) binding site [chemical binding]; other site
568708008234	substrate binding site [chemical binding]; other site
568708008235	catalytic residues [active]
568708008236	dimer interface [polypeptide binding]; other site
568708008239	D-amino acid dehydrogenase small subunit; Validated; Region: PRK00711
568708008240	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
568708008242	SpoVR family protein; Provisional; Region: PRK11767
568708008243	Uncharacterized conserved protein [Function unknown]; Region: SpoVR; COG2719
568708008245	fatty acid metabolism regulator; Provisional; Region: PRK04984
568708008246	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
568708008247	DNA-binding site [nucleotide binding]; DNA binding site
568708008248	FadR C-terminal domain; Region: FadR_C; pfam07840
568708008251	Anion permease ArsB/NhaD.  These permeases have been shown to translocate sodium, arsenate, antimonite, sulfate and organic anions across biological membranes in all three kingdoms of life.  A typical anion permease contains 8-13 transmembrane helices...; Region: ArsB_NhaD_permease; cd00625
568708008252	transmembrane helices; other site
568708008254	12 probable transmembrane helices predicted for STM_MW17981 by TMHMM2.0 at aa 26-48, 61-83, 93-115, 128-145, 150-169, 197-219, 239-261, 299-331, 346-368, 389-411, 453-472 and 479-501
568708008255	disulfide bond formation protein B; Provisional; Region: PRK01749
568708008256	Signal peptide predicted for STM_MW17991 by SignalP 2.0 HMM (Signal peptide probability 0.854) with cleavage site probability 0.827 between residues 24 and 25
568708008258	4 probable transmembrane helices predicted for STM_MW17991 by TMHMM2.0 at aa 13-32, 42-64, 71-93 and 144-166
568708008259	Uncharacterized protein/domain, possibly involved in tellurite resistance [Inorganic ion transport and metabolism]; Region: TehB; COG3615
568708008261	GnsA/GnsB family; Region: GnsAB; pfam08178
568708008263	hypothetical protein; Provisional; Region: PRK05170
568708008265	2-keto-4-pentenoate hydratase/2-oxohepta-3-ene-1,7-dioic acid hydratase (catechol pathway) [Secondary metabolites biosynthesis, transport, and catabolism]; Region: MhpD; COG0179
568708008266	hypothetical protein; Provisional; Region: PRK10691
568708008268	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3100
568708008270	septum formation inhibitor; Reviewed; Region: minC; PRK03511
568708008271	Septum formation inhibitor MinC, N-terminal domain; Region: MinC_N; pfam05209
568708008272	Septum formation inhibitor MinC, C-terminal domain; Region: MinC_C; pfam03775
568708008275	cell division inhibitor MinD; Provisional; Region: PRK10818
568708008276	Bacterial cell division requires the formation of a septum at mid-cell. The site is determined by the min operon products MinC, MinD and MinE. MinC is a nonspecific inhibitor of the septum protein FtsZ. MinE is the supressor of MinC. MinD plays a pivotal...; Region: MinD; cd02036
568708008277	Switch I; other site
568708008278	Switch II; other site
568708008280	cell division topological specificity factor MinE; Reviewed; Region: minE; PRK00296
568708008282	ribonuclease D; Provisional; Region: PRK10829
568708008283	DEDDy 3'-5' exonuclease domain of Ribonuclease D and similar proteins; Region: RNaseD_exo; cd06142
568708008284	catalytic site [active]
568708008285	putative active site [active]
568708008286	putative substrate binding site [chemical binding]; other site
568708008287	HRDC domain; Region: HRDC; cl02578
568708008290	long-chain-fatty-acid--CoA ligase; Validated; Region: PRK08974
568708008291	Prokaryotic long-chain fatty acid CoA synthetases similar to Escherichia coli FadD; Region: FC-FACS_FadD_like; cd05936
568708008292	acyl-activating enzyme (AAE) consensus motif; other site
568708008293	putative AMP binding site [chemical binding]; other site
568708008294	putative active site [active]
568708008295	putative CoA binding site [chemical binding]; other site
568708008297	Starvation-inducible outer membrane lipoprotein [Cell envelope biogenesis, outer membrane]; Region: Slp; COG3065
568708008299	Signal peptide predicted for STM_MW18111 by SignalP 2.0 HMM (Signal peptide probability 0.888) with cleavage site probability 0.393 between residues 25 and 26
568708008300	Inactive homolog of metal-dependent proteases, putative molecular chaperone [Posttranslational modification, protein turnover, chaperones]; Region: COG1214
568708008301	Glycoprotease family; Region: Peptidase_M22; pfam00814
568708008303	Rad3-related DNA helicases [Transcription / DNA replication, recombination, and repair]; Region: DinG; COG1199
568708008304	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cl17251
568708008305	DEAD_2; Region: DEAD_2; pfam06733
568708008306	Helicase C-terminal domain; Region: Helicase_C_2; pfam13307
568708008309	This group of proteins belong to a large family of YjgF/YER057c/UK114-like proteins present in bacteria, archaea, and eukaryotes with no definitive function.  The conserved domain is similar in structure to chorismate mutase but there is no sequence...; Region: YjgF_YER057c_UK114_like_2; cd06150
568708008310	homotrimer interaction site [polypeptide binding]; other site
568708008311	putative active site [active]
568708008313	hypothetical protein; Provisional; Region: PRK05114
568708008315	aminodeoxychorismate synthase subunit I; Provisional; Region: pabB; PRK15465
568708008316	Anthranilate synthase component I, N terminal region; Region: Anth_synt_I_N; pfam04715
568708008317	aminodeoxychorismate synthase, component I, bacterial clade; Region: pabB; TIGR00553
568708008320	Coenzyme A pyrophosphatase (CoAse), a member of the Nudix hydrolase superfamily, functions to catalyze the elimination of oxidized inactive CoA, which can inhibit CoA-utilizing enzymes. The need of CoAses mainly arises under conditions of oxidative...; Region: CoAse; cd03426
568708008321	putative active site [active]
568708008322	putative CoA binding site [chemical binding]; other site
568708008323	nudix motif; other site
568708008324	metal binding site [ion binding]; metal-binding site
568708008326	L-serine deaminase; Provisional; Region: PRK15023
568708008327	Serine dehydratase beta chain; Region: SDH_beta; pfam03315
568708008328	Serine dehydratase alpha chain; Region: SDH_alpha; pfam03313
568708008331	phage resistance protein; Provisional; Region: PRK10551
568708008332	CSS motif domain associated with EAL; Region: CSS-motif; pfam12792
568708008333	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
568708008335	Membrane protein TerC, possibly involved in tellurium resistance [Inorganic ion transport and metabolism]; Region: TerC; COG0861
568708008336	Hemolysins and related proteins containing CBS domains [General function prediction only]; Region: TlyC; COG1253
568708008337	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains associated with the CorC_HlyC domain. CorC_HlyC is a transporter associated domain. This small domain is found in Na+/H+ antiporters, in proteins involved in...; Region: CBS_pair_CorC_HlyC_assoc; cd04590
568708008338	Transporter associated domain; Region: CorC_HlyC; smart01091
568708008340	7 probable transmembrane helices predicted for STM_MW18201 by TMHMM2.0 at aa 13-35, 48-70, 85-102, 123-145, 150-172, 185-207 and 212-231
568708008343	PTS system mannose-specific transporter subunits IIAB; Provisional; Region: PRK15088
568708008344	PTS_IIA, PTS system, mannose/sorbose specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIA_man; cd00006
568708008345	active pocket/dimerization site; other site
568708008346	active site
568708008347	phosphorylation site [posttranslational modification]
568708008348	PTS_IIB, PTS system, Mannose/sorbose specific IIB subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIB_man; cd00001
568708008349	active site
568708008350	phosphorylation site [posttranslational modification]
568708008353	PTS system mannose-specific transporter subunit IIC; Provisional; Region: PRK15065
568708008355	7 probable transmembrane helices predicted for STM_MW18231 by TMHMM2.0 at aa 5-27, 34-56, 66-88, 95-117, 143-165, 178-200 and 215-237
568708008356	PTS system mannose-specific transporter subunit IID; Provisional; Region: PRK11103
568708008358	5 probable transmembrane helices predicted for STM_MW18241 by TMHMM2.0 at aa 105-127, 142-164, 185-207, 236-258 and 265-284
568708008359	hypothetical protein; Provisional; Region: PRK02913
568708008360	Signal peptide predicted for STM_MW18251 by SignalP 2.0 HMM (Signal peptide probability 0.693) with cleavage site probability 0.613 between residues 19 and 20
568708008362	2 probable transmembrane helices predicted for STM_MW18251 by TMHMM2.0 at aa 7-26 and 65-87
568708008363	hypothetical protein; Provisional; Region: PRK11469
568708008364	Domain of unknown function DUF; Region: DUF204; pfam02659
568708008365	Domain of unknown function DUF; Region: DUF204; pfam02659
568708008366	Signal peptide predicted for STM_MW18261 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.998 between residues 19 and 20
568708008367	6 probable transmembrane helices predicted for STM_MW18261 by TMHMM2.0 at aa 4-26, 39-61, 71-93, 106-128, 133-155 and 168-187
568708008369	23S rRNA methyltransferase A; Provisional; Region: rrmA; PRK11088
568708008370	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708008371	S-adenosylmethionine binding site [chemical binding]; other site
568708008373	peptidoglycan synthase FtsI; Provisional; Region: PRK15105
568708008374	Penicillin-binding Protein dimerisation domain; Region: PBP_dimer; pfam03717
568708008375	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; pfam00905
568708008378	Signal peptide predicted for STM_MW18281 by SignalP 2.0 HMM (Signal peptide probability 0.995) with cleavage site probability 0.700 between residues 38 and 39
568708008379	1 probable transmembrane helix predicted for STM_MW18281 by TMHMM2.0 at aa 16-38
568708008380	Cold-Shock Protein (CSP) contains an S1-like cold-shock domain (CSD) that is found in eukaryotes, prokaryotes, and archaea.  CSP's include the major cold-shock proteins CspA and CspB in bacteria and the eukaryotic gene regulatory factor Y-box...; Region: CSP_CDS; cd04458
568708008381	DNA-binding site [nucleotide binding]; DNA binding site
568708008382	RNA-binding motif; other site
568708008384	YobH-like protein; Region: YobH; pfam13996
568708008385	Signal peptide predicted for STM_MW18301 by SignalP 2.0 HMM (Signal peptide probability 0.987) with cleavage site probability 0.962 between residues 33 and 34
568708008386	1 probable transmembrane helix predicted for STM_MW18301 by TMHMM2.0 at aa 7-29
568708008387	DNA-binding transcriptional regulator KdgR; Provisional; Region: PRK15090
568708008388	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
568708008389	dimerization interface [polypeptide binding]; other site
568708008390	putative Zn2+ binding site [ion binding]; other site
568708008391	putative DNA binding site [nucleotide binding]; other site
568708008392	Bacterial transcriptional regulator; Region: IclR; pfam01614
568708008395	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708008396	Major Facilitator Superfamily; Region: MFS_1; pfam07690
568708008397	putative substrate translocation pore; other site
568708008398	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708008399	12 probable transmembrane helices predicted for STM_MW18321 by TMHMM2.0 at aa 21-43, 53-75, 87-109, 113-132, 144-166, 171-193, 205-227, 231-249, 269-291, 306-328, 335-357 and 426-448
568708008401	heat shock protein HtpX; Provisional; Region: PRK05457
568708008403	4 probable transmembrane helices predicted for STM_MW18331 by TMHMM2.0 at aa 5-27, 32-54, 158-180 and 195-217
568708008405	Signal peptide predicted for STM_MW18331 by SignalP 2.0 HMM (Signal peptide probability 0.958) with cleavage site probability 0.237 between residues 32 and 33
568708008406	carboxy-terminal protease; Provisional; Region: PRK11186
568708008407	PDZ domain of C-terminal processing-, tail-specific-, and tricorn proteases, which function in posttranslational protein processing, maturation, and disassembly or degradation, in Bacteria, Archaea, and plant chloroplasts. May be responsible for...; Region: PDZ_CTP_protease; cd00988
568708008408	protein binding site [polypeptide binding]; other site
568708008409	C-terminal processing peptidase; serine protease family S41; Region: Peptidase_S41_CPP; cd07560
568708008410	Catalytic dyad [active]
568708008411	C-terminal domain of tail specific protease (DUF3340); Region: DUF3340; pfam11818
568708008414	Signal peptide predicted for STM_MW18341 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 22 and 23
568708008415	ProP expression regulator; Provisional; Region: PRK04950
568708008416	ProQ/FINO family; Region: ProQ; pfam04352
568708008418	GAF domain-containing protein [Signal transduction mechanisms]; Region: COG1956
568708008419	GAF domain; Region: GAF_2; pfam13185
568708008421	Uncharacterized paraquat-inducible protein A [Function unknown]; Region: PqiA; COG2995
568708008422	Paraquat-inducible protein A; Region: PqiA; pfam04403
568708008423	Paraquat-inducible protein A; Region: PqiA; pfam04403
568708008424	8 probable transmembrane helices predicted for STM_MW18371 by TMHMM2.0 at aa 65-84, 119-141, 162-184, 188-210, 268-290, 310-339, 351-373 and 383-405
568708008426	Paraquat-inducible protein B [General function prediction only]; Region: PqiB; COG3008
568708008427	mce related protein; Region: MCE; pfam02470
568708008428	mce related protein; Region: MCE; pfam02470
568708008429	mce related protein; Region: MCE; pfam02470
568708008430	mce related protein; Region: MCE; pfam02470
568708008431	mce related protein; Region: MCE; pfam02470
568708008432	mce related protein; Region: MCE; pfam02470
568708008433	1 probable transmembrane helix predicted for STM_MW18381 by TMHMM2.0 at aa 22-41
568708008435	rRNA (cytosine-C(5)-)-methyltransferase RsmF; Reviewed; Region: yebU; PRK11933
568708008436	NOL1/NOP2/sun family putative RNA methylase; Region: nop2p; TIGR00446
568708008437	pre-rRNA processing and ribosome biogenesis; Region: Nol1_Nop2_Fmu_2; pfam13636
568708008439	Protein of unknown function (DUF1480); Region: DUF1480; pfam07351
568708008441	Protein of unknown function (DUF1482); Region: DUF1482; pfam07358
568708008443	serine/threonine protein phosphatase 1; Provisional; Region: pphA; PRK11439
568708008444	Calcineurin-like phosphoesterase; Region: Metallophos; pfam00149
568708008446	type III secretion protein SopE2; Provisional; Region: PRK15280
568708008447	Salmonella type III secretion SopE effector N-terminus; Region: SecIII_SopE_N; pfam05364
568708008448	SopE GEF domain; Region: SopE_GEF; pfam07487
568708008451	Protein of unknown function (DUF1398); Region: DUF1398; cl11576
568708008453	1 probable transmembrane helix predicted for STM_MW18471 by TMHMM2.0 at aa 55-77
568708008454	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
568708008455	Coenzyme A binding pocket [chemical binding]; other site
568708008457	pfam_scan;Pfam:PF00872; E()=1.7E-98;score=329.2;query 9-372;description=Transposase_mut
568708008460	prophage 3 remnant
568708008462	Protein of unknown function (DUF2511); Region: DUF2511; pfam10709
568708008464	Signal peptide predicted for STM_MW18541 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 19 and 20
568708008465	Putative copper export protein [Inorganic ion transport and metabolism]; Region: PcoD; COG1276
568708008466	8 probable transmembrane helices predicted for STM_MW18551 by TMHMM2.0 at aa 10-32, 52-74, 94-113, 120-137, 152-174, 195-217, 227-249 and 270-288
568708008468	hypothetical protein; Provisional; Region: PRK10301
568708008470	Signal peptide predicted for STM_MW18561 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.834 between residues 26 and 27
568708008471	DNA polymerase III subunit theta; Reviewed; Region: PRK10969
568708008473	Predicted amidohydrolase [General function prediction only]; Region: COG0388
568708008474	Carbon-nitrogen hydrolase; Region: CN_hydrolase; pfam00795
568708008476	exodeoxyribonuclease X; Provisional; Region: PRK07983
568708008477	DEDDh 3'-5' exonuclease domain family; Region: DEDDh; cd06127
568708008478	active site
568708008479	catalytic site [active]
568708008480	substrate binding site [chemical binding]; other site
568708008482	protease 2; Provisional; Region: PRK10115
568708008483	Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326
568708008486	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2979
568708008487	tellurium resistance terB-like protein, subgroup 3; Region: terB_like_YebE; cd07178
568708008488	putative metal binding site [ion binding]; other site
568708008490	1 probable transmembrane helix predicted for STM_MW18611 by TMHMM2.0 at aa 52-74
568708008491	hypothetical protein; Provisional; Region: PRK13680
568708008492	Signal peptide predicted for STM_MW18621 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.995 between residues 21 and 22
568708008493	DNA damage-inducible protein YebG; Provisional; Region: PRK10061
568708008495	phosphoribosylglycinamide formyltransferase 2; Validated; Region: purT; PRK09288
568708008496	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
568708008497	ATP-grasp domain; Region: ATP-grasp; pfam02222
568708008499	keto-hydroxyglutarate-aldolase/keto-deoxy- phosphogluconate aldolase; Provisional; Region: PRK05718
568708008500	KDPG and KHG aldolase; Region: KDPG_aldolase; cd00452
568708008501	active site
568708008502	intersubunit interface [polypeptide binding]; other site
568708008503	catalytic residue [active]
568708008505	phosphogluconate dehydratase; Validated; Region: PRK09054
568708008506	6-phosphogluconate dehydratase; Region: edd; TIGR01196
568708008508	glucose-6-phosphate 1-dehydrogenase; Validated; Region: PRK05722
568708008509	Glucose-6-phosphate dehydrogenase, NAD binding domain; Region: G6PD_N; pfam00479
568708008510	Glucose-6-phosphate dehydrogenase, C-terminal domain; Region: G6PD_C; pfam02781
568708008513	DNA-binding transcriptional regulator HexR; Provisional; Region: PRK11302
568708008514	Helix-turn-helix domain, rpiR family; Region: HTH_6; pfam01418
568708008515	RpiR-like protein. RpiR contains a SIS (Sugar ISomerase) domain, which is found in many phosphosugar isomerases and phosphosugar binding proteins. In E. coli, rpiR negatively regulates the expression of rpiB gene. Both rpiB and rpiA are ribose phosphate...; Region: SIS_RpiR; cd05013
568708008516	putative active site [active]
568708008519	pyruvate kinase; Provisional; Region: PRK05826
568708008520	Pyruvate kinase (PK):  Large allosteric enzyme that regulates glycolysis through binding of the substrate, phosphoenolpyruvate, and one or more allosteric effectors. Like other allosteric enzymes, PK has a high substrate affinity R state and a low...; Region: Pyruvate_Kinase; cl17342
568708008521	domain interfaces; other site
568708008522	active site
568708008525	Bacterial lipid A biosynthesis acyltransferase; Region: Lip_A_acyltrans; pfam03279
568708008526	Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: LABLAT-like; Region: LPLAT_LABLAT-like; cd07984
568708008527	putative acyl-acceptor binding pocket; other site
568708008529	1 probable transmembrane helix predicted for STM_MW18701 by TMHMM2.0 at aa 21-43
568708008530	putative peptidase; Provisional; Region: PRK11649
568708008531	Opacity-associated protein A N-terminal motif; Region: OapA_N; pfam08525
568708008532	Lysine Motif is a small domain involved in binding peptidoglycan; Region: LysM; cd00118
568708008533	Peptidase family M23; Region: Peptidase_M23; pfam01551
568708008537	high-affinity zinc transporter periplasmic component; Reviewed; Region: znuA; PRK09545
568708008538	Zinc binding protein ZnuA. These proteins have been shown to function as initial receptors in the ABC uptake of Zn2+.  They belong to the TroA superfamily of periplasmic metal binding proteins that share a distinct fold and ligand binding mechanism; Region: ZnuA; cd01019
568708008539	metal binding site [ion binding]; metal-binding site
568708008541	Signal peptide predicted for STM_MW18721 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.924 between residues 42 and 43
568708008542	high-affinity zinc transporter ATPase; Reviewed; Region: znuC; PRK09544
568708008543	ATP-binding cassette domain of the metal-type transporters; Region: ABC_Metallic_Cations; cd03235
568708008545	ABC-type Mn2+/Zn2+ transport systems, permease components [Inorganic ion transport and metabolism]; Region: ZnuB; COG1108
568708008546	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
568708008547	ABC-ATPase subunit  interface; other site
568708008548	dimer interface [polypeptide binding]; other site
568708008549	putative PBP binding regions; other site
568708008550	Signal peptide predicted for STM_MW18741 by SignalP 2.0 HMM (Signal peptide probability 0.958) with cleavage site probability 0.581 between residues 18 and 19
568708008552	7 probable transmembrane helices predicted for STM_MW18741 by TMHMM2.0 at aa 5-27, 48-70, 85-107, 127-145, 170-192, 213-235 and 239-256
568708008553	Holliday junction DNA helicase RuvB; Reviewed; Region: ruvB; PRK00080
568708008554	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708008555	Walker A motif; other site
568708008556	ATP binding site [chemical binding]; other site
568708008557	Walker B motif; other site
568708008558	arginine finger; other site
568708008559	Holliday junction DNA helicase ruvB C-terminus; Region: RuvB_C; pfam05491
568708008562	Holliday junction DNA helicase RuvA; Reviewed; Region: ruvA; PRK00116
568708008563	RuvA N terminal domain; Region: RuvA_N; pfam01330
568708008564	RuvA, C-terminal domain; Region: RuvA_C; pfam07499
568708008567	contains a frameshift after residue 80
568708008568	contains two frameshifts after residues 55 and 104; tmhmm; query 1-147
568708008569	hypothetical protein; Provisional; Region: PRK11470
568708008571	Holliday junction resolvases (HJRs) are endonucleases that specifically resolve Holliday junction DNA intermediates during homologous recombination. HJR's occur in archaea, bacteria, and in the mitochondria of certain fungi, however this CD...; Region: RuvC_resolvase; cd00529
568708008572	active site
568708008573	putative DNA-binding cleft [nucleotide binding]; other site
568708008574	dimer interface [polypeptide binding]; other site
568708008576	hypothetical protein; Validated; Region: PRK00110
568708008578	Members of the Nudix hydrolase superfamily catalyze the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+, for their activity and contain a highly...; Region: Nudix_Hydrolase_7; cd04664
568708008579	nudix motif; other site
568708008581	aspartyl-tRNA synthetase; Validated; Region: aspS; PRK00476
568708008582	EcAspRS_like_N: N-terminal, anticodon recognition domain of the type found in Escherichia coli aspartyl-tRNA synthetase (AspRS), the human mitochondrial (mt) AspRS-2, the discriminating (D) Thermus thermophilus AspRS-1, and the nondiscriminating (ND)...; Region: EcAspRS_like_N; cd04317
568708008583	dimer interface [polypeptide binding]; other site
568708008584	anticodon binding site; other site
568708008585	Asp tRNA synthetase (aspRS) class II core domain. Class II assignment is based upon its structure and the presence of three characteristic sequence motifs. AspRS is a homodimer, which attaches a specific amino acid to the 3' OH group of ribose of...; Region: AspRS_core; cd00777
568708008586	homodimer interface [polypeptide binding]; other site
568708008587	motif 1; other site
568708008588	active site
568708008589	motif 2; other site
568708008590	GAD domain; Region: GAD; pfam02938
568708008591	Class II tRNA amino-acyl synthetase-like catalytic core domain. Class II amino acyl-tRNA synthetases (aaRS) share a common fold and generally attach an amino acid to the 3' OH of ribose of the appropriate tRNA.   PheRS is an exception in that it...; Region: class_II_aaRS-like_core; cl00268
568708008592	active site
568708008593	motif 3; other site
568708008597	Isochorismatase family; Region: Isochorismatase; pfam00857
568708008598	Cysteine hydrolases; This family contains amidohydrolases, like CSHase (N-carbamoylsarcosine amidohydrolase), involved in creatine metabolism and nicotinamidase, converting nicotinamide to nicotinic acid and ammonia in the pyridine nucleotide cycle. It...; Region: cysteine_hydrolases; cd00431
568708008599	catalytic triad [active]
568708008600	conserved cis-peptide bond; other site
568708008602	hypothetical protein; Provisional; Region: PRK10302
568708008604	Uncharacterized relative of glutathione S-transferase, MAPEG superfamily [General function prediction only]; Region: COG3788
568708008605	4 probable transmembrane helices predicted for STM_MW18871 by TMHMM2.0 at aa 4-22, 43-62, 72-89 and 102-124
568708008607	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708008608	S-adenosylmethionine binding site [chemical binding]; other site
568708008610	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708008611	S-adenosylmethionine binding site [chemical binding]; other site
568708008613	copper homeostasis protein CutC; Provisional; Region: PRK11572
568708008615	This conserved domain belongs to a superfamily including the bleomycin resistance protein, glyoxalase I, and type I ring-cleaving dioxygenases; Region: Glo_EDI_BRP_like_4; cd07268
568708008616	putative metal binding site [ion binding]; other site
568708008618	Arginyl tRNA synthetase N terminal dom; Region: Arg_tRNA_synt_N; smart01016
568708008619	arginyl-tRNA synthetase; Region: argS; TIGR00456
568708008620	catalytic core domain of arginyl-tRNA synthetases; Region: ArgRS_core; cd00671
568708008621	active site
568708008622	HIGH motif; other site
568708008623	KMSK motif region; other site
568708008624	Anticodon-binding domain of arginyl tRNA synthetases; Region: Anticodon_Ia_Arg; cd07956
568708008625	tRNA binding surface [nucleotide binding]; other site
568708008626	anticodon binding site; other site
568708008630	penicillin-binding protein 2; Provisional; Region: PRK10795
568708008631	Penicillin-binding Protein dimerisation domain; Region: PBP_dimer; pfam03717
568708008632	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; pfam00905
568708008633	1 probable transmembrane helix predicted for STM_MW18931 by TMHMM2.0 at aa 12-34
568708008636	Predicted unsaturated glucuronyl hydrolase involved in regulation of bacterial surface properties, and related proteins [General function prediction only]; Region: COG4225
568708008638	Flagellar protein FlhE; Region: FlhE; pfam06366
568708008640	Signal peptide predicted for STM_MW18951 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.916 between residues 16 and 17
568708008641	flagellar biosynthesis protein FlhA; Validated; Region: flhA; PRK06012
568708008642	FHIPEP family; Region: FHIPEP; pfam00771
568708008644	7 probable transmembrane helices predicted for STM_MW18961 by TMHMM2.0 at aa 21-43, 47-64, 76-98, 118-140, 213-235, 250-272 and 293-315
568708008645	flagellar biosynthesis protein FlhB; Reviewed; Region: flhB; PRK05702
568708008646	Uncharacterized homolog of the cytoplasmic domain of flagellar protein FhlB [Function unknown]; Region: COG2257
568708008648	4 probable transmembrane helices predicted for STM_MW18971 by TMHMM2.0 at aa 33-50, 93-115, 146-168 and 189-211
568708008649	chemotaxis regulator CheZ; Provisional; Region: PRK11166
568708008651	chemotaxis regulatory protein CheY; Provisional; Region: PRK10610
568708008652	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708008653	active site
568708008654	phosphorylation site [posttranslational modification]
568708008655	intermolecular recognition site; other site
568708008656	dimerization interface [polypeptide binding]; other site
568708008658	chemotaxis-specific methylesterase; Provisional; Region: PRK00742
568708008659	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708008660	active site
568708008661	phosphorylation site [posttranslational modification]
568708008662	intermolecular recognition site; other site
568708008663	dimerization interface [polypeptide binding]; other site
568708008664	CheB methylesterase; Region: CheB_methylest; pfam01339
568708008667	chemotaxis methyltransferase CheR; Provisional; Region: PRK10611
568708008668	CheR methyltransferase, all-alpha domain; Region: CheR_N; pfam03705
568708008669	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708008670	S-adenosylmethionine binding site [chemical binding]; other site
568708008673	methyl-accepting chemotaxis protein II; Provisional; Region: PRK15048
568708008674	ligand binding domain of Tar- and Tsr-related chemoreceptors; Region: Tar_Tsr_LBD; cd00181
568708008675	dimer interface [polypeptide binding]; other site
568708008676	ligand binding site [chemical binding]; other site
568708008677	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
568708008678	dimerization interface [polypeptide binding]; other site
568708008679	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
568708008680	dimer interface [polypeptide binding]; other site
568708008681	putative CheW interface [polypeptide binding]; other site
568708008684	2 probable transmembrane helices predicted for STM_MW19021 by TMHMM2.0 at aa 85-107 and 271-293
568708008686	CheW, a small regulator protein, unique to the chemotaxis signalling in prokaryotes and archea. CheW interacts with the histidine kinase CheA, most likely with the related regulatory domain of CheA. CheW is proposed to form signalling arrays together...; Region: CheW; cd00732
568708008687	putative CheA interaction surface; other site
568708008689	chemotaxis protein CheA; Provisional; Region: PRK10547
568708008690	Histidine Phosphotransfer domain, involved in signalling through a two part component systems in which an autophosphorylating histidine protein kinase serves as a phosphoryl donor to a response regulator protein; the response regulator protein is...; Region: HPT; cd00088
568708008691	putative binding surface; other site
568708008692	active site
568708008693	CheY binding; Region: CheY-binding; pfam09078
568708008694	Signal transducing histidine kinase, homodimeric domain; Region: H-kinase_dim; pfam02895
568708008695	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708008696	ATP binding site [chemical binding]; other site
568708008697	Mg2+ binding site [ion binding]; other site
568708008698	G-X-G motif; other site
568708008699	CheA regulatory domain; CheA is a histidine protein kinase present in bacteria and archea. Activated by the chemotaxis receptor a histidine phosphoryl group from CheA is passed directly to an aspartate in the response regulator CheY. This signalling...; Region: CheA_reg; cd00731
568708008705	Membrane MotB of proton-channel complex MotA/MotB; Region: MotB_plug; pfam13677
568708008706	Flagellar motor protein [Cell motility and secretion]; Region: MotB; COG1360
568708008707	Peptidoglycan binding domains similar to the C-terminal domain of outer-membrane protein OmpA; Region: OmpA_C-like; cd07185
568708008708	ligand binding site [chemical binding]; other site
568708008710	1 probable transmembrane helix predicted for STM_MW19051 by TMHMM2.0 at aa 29-51
568708008711	Flagellar motor component [Cell motility and secretion]; Region: MotA; COG1291
568708008712	flagellar motor protein MotA; Validated; Region: PRK09110
568708008713	3 probable transmembrane helices predicted for STM_MW19061 by TMHMM2.0 at aa 10-32, 152-171 and 186-208
568708008715	transcriptional activator FlhC; Provisional; Region: PRK12722
568708008717	transcriptional activator FlhD; Provisional; Region: PRK02909
568708008719	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
568708008720	Ligand Binding Site [chemical binding]; other site
568708008722	alpha,alpha-trehalose-phosphate synthase [UDP-forming]; Region: trehalose_OtsA; TIGR02400
568708008723	Trehalose-6-Phosphate Synthase (TPS) is a glycosyltransferase that catalyses the synthesis of alpha,alpha-1,1-trehalose-6-phosphate from glucose-6-phosphate using a UDP-glucose donor. It is a key enzyme in the trehalose synthesis pathway. Trehalose is a...; Region: GT1_TPS; cd03788
568708008724	active site
568708008725	homotetramer interface [polypeptide binding]; other site
568708008727	trehalose-6-phosphate phosphatase; Provisional; Region: PRK10187
568708008728	Trehalose-6-phosphatase [Carbohydrate transport and metabolism]; Region: OtsB; COG1877
568708008730	DJ-1 family protein; Region: not_thiJ; TIGR01383
568708008731	Type 1 glutamine amidotransferase (GATase1)-like domain found in Human DJ-1; Region: GATase1_DJ-1; cd03135
568708008732	conserved cys residue [active]
568708008734	nonheme-containing ferritins; Region: Nonheme_Ferritin; cd01055
568708008735	Ferritin-like domain; Region: Ferritin; pfam00210
568708008736	ferroxidase diiron center [ion binding]; other site
568708008738	hypothetical protein; Provisional; Region: PRK09273
568708008739	Ribose 5-phosphate isomerase RpiB [Carbohydrate transport and metabolism]; Region: RpiB; COG0698
568708008740	Ribose-5-phosphate isomerase; Region: DUF3666; pfam12408
568708008742	YecR-like lipoprotein; Region: YecR; pfam13992
568708008743	Signal peptide predicted for STM_MW19161 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.508 between residues 24 and 25
568708008744	nonheme-containing ferritins; Region: Nonheme_Ferritin; cd01055
568708008745	Ferritin-like domain; Region: Ferritin; pfam00210
568708008746	ferroxidase diiron center [ion binding]; other site
568708008748	probable metal-binding protein; Region: matur_matur; TIGR03853
568708008750	tyrosine transporter TyrP; Provisional; Region: PRK15132
568708008751	aromatic amino acid transport protein; Region: araaP; TIGR00837
568708008752	Signal peptide predicted for STM_MW19191 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.653 between residues 28 and 29
568708008754	11 probable transmembrane helices predicted for STM_MW19191 by TMHMM2.0 at aa 7-29, 33-55, 81-103, 113-135, 148-167, 182-204, 216-235, 273-295, 308-330, 335-357 and 377-399
568708008755	hypothetical protein; Provisional; Region: PRK10396
568708008756	yecA family protein; Region: ygfB_yecA; TIGR02292
568708008757	SEC-C motif; Region: SEC-C; pfam02810
568708008759	glucose-6-phosphate 1-dehydrogenase; Region: PLN02640
568708008760	Signal peptide; signalp; query 1-23;cleavage_site_probability=0.249; 0.687
568708008761	1 probable transmembrane helix predicted for STM_MW19231 by TMHMM2.0 at aa 25-47
568708008762	it has a frameshift after residue 17
568708008763	phosphatidylglycerophosphate synthetase; Provisional; Region: PRK10832
568708008764	4 probable transmembrane helices predicted for STM_MW19241 by TMHMM2.0 at aa 7-29, 33-52, 121-143 and 147-169
568708008766	excinuclease ABC subunit C; Validated; Region: uvrC; PRK00558
568708008767	Catalytic GIY-YIG domain of nucleotide excision repair endonucleases UvrC, Cho, and similar proteins; Region: GIY-YIG_UvrC_Cho; cd10434
568708008768	GIY-YIG motif/motif A; other site
568708008769	active site
568708008770	catalytic site [active]
568708008771	putative DNA binding site [nucleotide binding]; other site
568708008772	metal binding site [ion binding]; metal-binding site
568708008773	UvrB/uvrC motif; Region: UVR; pfam02151
568708008774	UvrC Helix-hairpin-helix N-terminal; Region: UvrC_HhH_N; pfam08459
568708008775	Helix-hairpin-helix motif; Region: HHH; pfam00633
568708008780	response regulator; Provisional; Region: PRK09483
568708008781	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708008782	active site
568708008783	phosphorylation site [posttranslational modification]
568708008784	intermolecular recognition site; other site
568708008785	dimerization interface [polypeptide binding]; other site
568708008786	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
568708008787	DNA binding residues [nucleotide binding]
568708008788	dimerization interface [polypeptide binding]; other site
568708008791	hypothetical protein; Provisional; Region: PRK10613
568708008793	DNA-binding transcriptional activator SdiA; Provisional; Region: PRK10188
568708008794	Autoinducer binding domain; Region: Autoind_bind; pfam03472
568708008795	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
568708008796	DNA binding residues [nucleotide binding]
568708008797	dimerization interface [polypeptide binding]; other site
568708008800	putative amino-acid ABC transporter ATP-binding protein YecC; Provisional; Region: PRK11264
568708008801	ATP-binding cassette domain of the histidine and glutamine transporters; Region: ABC_HisP_GlnQ; cd03262
568708008802	Walker A/P-loop; other site
568708008803	ATP binding site [chemical binding]; other site
568708008804	Q-loop/lid; other site
568708008805	ABC transporter signature motif; other site
568708008806	Walker B; other site
568708008807	D-loop; other site
568708008808	H-loop/switch region; other site
568708008809	Oligopeptide/dipeptide transporter, C-terminal region; Region: oligo_HPY; cl07097
568708008811	ABC-type arginine transport system, permease component [Amino acid transport and metabolism]; Region: ArtQ; COG4215
568708008812	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708008813	dimer interface [polypeptide binding]; other site
568708008814	conserved gate region; other site
568708008815	putative PBP binding loops; other site
568708008816	ABC-ATPase subunit interface; other site
568708008817	3 probable transmembrane helices predicted for STM_MW19311 by TMHMM2.0 at aa 20-42, 54-76 and 185-207
568708008819	D-cysteine desulfhydrase; Validated; Region: PRK03910
568708008820	Aminocyclopropane-1-carboxylate deaminase (ACCD): Pyridoxal phosphate (PLP)-dependent enzyme which catalyzes the conversion of 1-aminocyclopropane-L-carboxylate (ACC), a precursor of the plant hormone ethylene, to alpha-ketobutyrate and ammonia; Region: ACCD; cd06449
568708008821	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708008822	catalytic residue [active]
568708008824	cystine transporter subunit; Provisional; Region: PRK11260
568708008825	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
568708008826	substrate binding pocket [chemical binding]; other site
568708008827	membrane-bound complex binding site; other site
568708008828	hinge residues; other site
568708008830	Signal peptide predicted for STM_MW19331 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 29 and 30
568708008831	flagella biosynthesis protein FliZ; Provisional; Region: PRK11582
568708008833	flagellar biosynthesis sigma factor; Validated; Region: fliA; PRK06986
568708008834	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
568708008835	Sigma-70 region 3; Region: Sigma70_r3; pfam04539
568708008836	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
568708008837	DNA binding residues [nucleotide binding]
568708008841	Transposase IS200 like; Region: Y1_Tnp; pfam01797
568708008843	flagellin; Validated; Region: PRK08026
568708008844	Bacterial flagellin N-terminal helical region; Region: Flagellin_N; pfam00669
568708008845	Flagellin D3 domain; Region: Flagellin_D3; pfam08884
568708008846	Bacterial flagellin C-terminal helical region; Region: Flagellin_C; pfam00700
568708008850	flagellar capping protein; Reviewed; Region: fliD; PRK08032
568708008851	Flagellar hook-associated protein 2 C-terminus; Region: FliD_N; pfam02465
568708008852	Flagellar hook-associated protein 2 C-terminus; Region: FliD_C; pfam07195
568708008856	flagellar protein FliS; Validated; Region: fliS; PRK05685
568708008858	flagellar biosynthesis protein FliT; Provisional; Region: PRK10548
568708008860	cytoplasmic alpha-amylase; Reviewed; Region: PRK09441
568708008861	Alpha amylase catalytic domain found in bacterial and fungal Alpha amylases (also called 1,4-alpha-D-glucan-4-glucanohydrolase); Region: AmyAc_bac_fung_AmyA; cd11318
568708008862	active site
568708008863	Na/Ca binding site [ion binding]; other site
568708008864	catalytic site [active]
568708008866	lipoprotein; Provisional; Region: PRK10397
568708008867	Signal peptide predicted for STM_MW19441 by SignalP 2.0 HMM (Signal peptide probability 0.972) with cleavage site probability 0.835 between residues 19 and 20
568708008868	putative inner membrane protein; Provisional; Region: PRK11099
568708008869	10 probable transmembrane helices predicted for STM_MW19451 by TMHMM2.0 at aa 30-52, 96-118, 139-161, 166-188, 217-234, 244-266, 279-301, 306-328, 341-360 and 380-402
568708008871	YedF is a bacterial SirA-like protein of unknown function.  SirA  (also known as UvrY,  and YhhP) belongs to a family of a two-component response regulators that controls secondary metabolism and virulence. The other member of this two-component system...; Region: YedF; cd03422
568708008872	CPxP  motif; other site
568708008874	1 probable transmembrane helix predicted for STM_MW19471 by TMHMM2.0 at aa 12-34
568708008875	flagellar hook-basal body protein FliE; Reviewed; Region: fliE; PRK00253
568708008877	flagellar MS-ring protein; Reviewed; Region: fliF; PRK06007
568708008878	Secretory protein of YscJ/FliF family; Region: YscJ_FliF; pfam01514
568708008879	Flagellar M-ring protein C-terminal; Region: YscJ_FliF_C; pfam08345
568708008880	Signal peptide predicted for STM_MW19491 by SignalP 2.0 HMM (Signal peptide probability 0.955) with cleavage site probability 0.949 between residues 46 and 47
568708008881	1 probable transmembrane helix predicted for STM_MW19491 by TMHMM2.0 at aa 26-45
568708008884	flagellar motor switch protein FliG; Region: fliG; TIGR00207
568708008885	FliG C-terminal domain; Region: FliG_C; pfam01706
568708008887	flagellar assembly protein H; Validated; Region: fliH; PRK05687
568708008888	Flagellar assembly protein FliH; Region: FliH; pfam02108
568708008890	flagellum-specific ATP synthase; Validated; Region: fliI; PRK07960
568708008891	Flagellum-specific ATPase/type III secretory pathway virulence-related protein. This group of ATPases are responsible for the export of flagellum and virulence-related proteins. The bacterial flagellar motor is similar to the F0F1-ATPase, in that they...; Region: ATPase_flagellum-secretory_path_III; cd01136
568708008892	Walker A motif/ATP binding site; other site
568708008893	Walker B motif; other site
568708008895	Flagellar biosynthesis chaperone [Cell motility and secretion / Intracellular trafficking and secretion / Posttranslational modification, protein turnover, chaperones]; Region: FliJ; COG2882
568708008896	flagellar biosynthesis chaperone; Validated; Region: fliJ; PRK05689
568708008898	Flagellar hook-length control protein [Cell motility and secretion]; Region: FliK; COG3144
568708008899	flagellar hook-length control protein; Provisional; Region: PRK10118
568708008901	flagellar basal body-associated protein FliL; Reviewed; Region: fliL; PRK07021
568708008902	Signal peptide predicted for STM_MW19551 by SignalP 2.0 HMM (Signal peptide probability 0.995) with cleavage site probability 0.450 between residues 30 and 31
568708008903	1 probable transmembrane helix predicted for STM_MW19551 by TMHMM2.0 at aa 13-35
568708008905	flagellar motor switch protein FliM; Validated; Region: fliM; PRK06666
568708008906	Surface presentation of antigens (SPOA); Region: SpoA; pfam01052
568708008909	flagellar motor switch protein FliN; Validated; Region: fliN; PRK07963
568708008910	flagellar motor switch protein; Validated; Region: fliN; PRK05698
568708008912	flagellar biosynthesis protein FliO; Provisional; Region: PRK11486
568708008913	1 probable transmembrane helix predicted for STM_MW19581 by TMHMM2.0 at aa 18-40
568708008915	flagellar biosynthesis protein FliP; Reviewed; Region: fliP; PRK05699
568708008916	Signal peptide predicted for STM_MW19591 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.511 between residues 20 and 21
568708008917	5 probable transmembrane helices predicted for STM_MW19591 by TMHMM2.0 at aa 5-27, 47-69, 88-105, 185-207 and 214-236
568708008919	flagellar biosynthesis protein FliQ; Validated; Region: fliQ; PRK05700
568708008920	Signal peptide predicted for STM_MW19601 by SignalP 2.0 HMM (Signal peptide probability 0.961) with cleavage site probability 0.942 between residues 40 and 41
568708008922	2 probable transmembrane helices predicted for STM_MW19601 by TMHMM2.0 at aa 20-42 and 52-74
568708008923	flagellar biosynthesis protein FliR; Reviewed; Region: fliR; PRK05701
568708008925	6 probable transmembrane helices predicted for STM_MW19611 by TMHMM2.0 at aa 15-34, 41-58, 73-95, 132-154, 179-201 and 214-236
568708008926	colanic acid capsular biosynthesis activation protein A; Provisional; Region: rcsA; PRK15411
568708008927	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
568708008928	DNA binding residues [nucleotide binding]
568708008929	dimerization interface [polypeptide binding]; other site
568708008931	hypothetical protein; Provisional; Region: PRK10708
568708008933	Protein of unknown function (DUF2525); Region: DUF2525; pfam10733
568708008935	mannosyl-3-phosphoglycerate phosphatase; Reviewed; Region: PRK03669
568708008936	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708008937	active site
568708008938	motif I; other site
568708008939	motif II; other site
568708008941	putative diguanylate cyclase YedQ; Provisional; Region: PRK15426
568708008942	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
568708008943	metal binding site [ion binding]; metal-binding site
568708008944	active site
568708008945	I-site; other site
568708008946	2 probable transmembrane helices predicted for STM_MW19661 by TMHMM2.0 at aa 20-42 and 358-380
568708008948	Uncharacterized small protein [Function unknown]; Region: COG5475
568708008950	hypothetical protein; Provisional; Region: PRK10062
568708008952	5 probable transmembrane helices predicted for STM_MW19681 by TMHMM2.0 at aa 78-100, 150-169, 173-195, 230-252 and 267-289
568708008953	putative DMT superfamily transporter inner membrane protein; Provisional; Region: PRK11272
568708008954	EamA-like transporter family; Region: EamA; pfam00892
568708008955	EamA-like transporter family; Region: EamA; pfam00892
568708008956	10 probable transmembrane helices predicted for STM_MW19691 by TMHMM2.0 at aa 7-29, 39-57, 69-87, 97-119, 126-145, 149-168, 175-197, 212-234, 241-260 and 270-292
568708008958	Very Short Patch Repair (Vsr) Endonuclease. Endonucleases in DNA repair that recognize damaged DNA and cleave the phosphodiester backbone. Vsr endonucleases have a common endonuclease topology that has been tailored for recognition of TG mismatches; Region: Vsr; cd00221
568708008959	additional DNA contacts [nucleotide binding]; other site
568708008960	mismatch recognition site; other site
568708008961	active site
568708008962	zinc binding site [ion binding]; other site
568708008963	DNA intercalation site [nucleotide binding]; other site
568708008965	DNA cytosine methylase; Provisional; Region: PRK10458
568708008966	Cytosine-C5 specific DNA methylases; Methyl transfer reactions play an important role in many aspects of biology. Cytosine-specific DNA methylases are found both in prokaryotes and eukaryotes. DNA methylation, or the covalent addition of a methyl group...; Region: Cyt_C5_DNA_methylase; cd00315
568708008967	cofactor binding site; other site
568708008968	DNA binding site [nucleotide binding]
568708008969	substrate interaction site [chemical binding]; other site
568708008971	Predicted HD superfamily hydrolase [General function prediction only]; Region: COG1418
568708008972	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
568708008973	Zn2+ binding site [ion binding]; other site
568708008974	Mg2+ binding site [ion binding]; other site
568708008976	2 probable transmembrane helices predicted for STM_MW19731 by TMHMM2.0 at aa 19-41 and 61-80
568708008977	Outer membrane protein (porin) [Cell envelope biogenesis, outer membrane]; Region: OmpC; COG3203
568708008978	Porins form aqueous channels for the diffusion of small hydrophillic molecules across the outer membrane. Individual 16-strand anti-parallel beta-barrels form a central pore, and trimerizes thru mainly hydrophobic interactions at the interface. Trimers...; Region: gram_neg_porins; cd00342
568708008979	trimer interface [polypeptide binding]; other site
568708008980	eyelet of channel; other site
568708008981	Signal peptide predicted for STM_MW19741 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 21 and 22
568708008983	Cold-Shock Protein (CSP) contains an S1-like cold-shock domain (CSD) that is found in eukaryotes, prokaryotes, and archaea.  CSP's include the major cold-shock proteins CspA and CspB in bacteria and the eukaryotic gene regulatory factor Y-box...; Region: CSP_CDS; cd04458
568708008984	DNA-binding site [nucleotide binding]; DNA binding site
568708008985	RNA-binding motif; other site
568708008987	DNA polymerase V subunit UmuC; Reviewed; Region: umuC; PRK03609
568708008988	umuC subunit of DNA Polymerase V; Region: PolY_Pol_V_umuC; cd01700
568708008989	active site
568708008990	DNA binding site [nucleotide binding]
568708008991	Domain of unknown function (DUF4113); Region: DUF4113; pfam13438
568708008995	SOS-response transcriptional repressors (RecA-mediated autopeptidases) [Transcription / Signal transduction mechanisms]; Region: LexA; COG1974
568708008996	Peptidase S24 LexA-like proteins are involved in the SOS response leading to the repair of single-stranded DNA within the bacterial cell. This family includes: the lambda repressor CI/C2 family and related bacterial prophage repressor proteins; LexA (EC...; Region: S24_LexA-like; cd06529
568708008997	Catalytic site [active]
568708008999	1 probable transmembrane helix predicted for STM_MW19801 by TMHMM2.0 at aa 21-43
568708009000	BTP3
568708009003	type III secretion system protein; Provisional; Region: PRK15383
568708009004	non-LEE encoded effector protein NleB; Provisional; Region: PRK15382
568708009005	Caudovirales tail fibre assembly protein; Region: Caudo_TAP; pfam02413
568708009007	Phage-related tail fibre protein [General function prediction only]; Region: COG5301
568708009008	Uncharacterized protein conserved in bacteria (DUF2313); Region: DUF2313; pfam10076
568708009010	Uncharacterized homolog of phage Mu protein gp47 [Function unknown]; Region: XkdT; COG3299
568708009012	Baseplate J-like protein; Region: Baseplate_J; cl01294
568708009014	Phage protein GP46; Region: GP46; pfam07409
568708009016	Bacteriophage Mu Gp45 protein; Region: Phage_Mu_Gp45; pfam06890
568708009018	Mu-like prophage tail protein gpP [General function prediction only]; Region: COG4379
568708009019	Phage late control gene D protein (GPD); Region: Phage_GPD; pfam05954
568708009021	Mu-like prophage DNA circulation protein [General function prediction only]; Region: COG4228
568708009022	DNA circulation protein N-terminus; Region: DNA_circ_N; pfam07157
568708009024	phage tail tape measure protein, TP901 family, core region; Region: tape_meas_TP901; TIGR01760
568708009026	1 probable transmembrane helix predicted for STM_MW19921 by TMHMM2.0 at aa 35-57
568708009027	Mu-like prophage FluMu protein gp41; Region: FluMu_gp41; pfam10109
568708009028	Phage tail tube protein; Region: Tail_tube; pfam10618
568708009030	Mu-like prophage tail sheath protein gpL [General function prediction only]; Region: COG4386
568708009031	Phage tail sheath protein; Region: Phage_sheath_1; pfam04984
568708009033	Phage head-tail joining protein; Region: Phage_H_T_join; pfam05521
568708009035	Head-Tail Connector Protein gp6 of Bacteriophage HK97 and similar proteins; Region: gp6; cd08054
568708009036	oligomerization interface [polypeptide binding]; other site
568708009038	phage major capsid protein, HK97 family; Region: major_cap_HK97; TIGR01554
568708009039	Phage capsid family; Region: Phage_capsid; pfam05065
568708009041	Caudovirus prohead protease; Region: Peptidase_U35; cl01521
568708009043	Phage-related protein [Function unknown]; Region: COG4695
568708009044	Phage portal protein; Region: Phage_portal; pfam04860
568708009046	Phage terminase-like protein, large subunit [General function prediction only]; Region: COG4626
568708009048	Phage terminase, small subunit; Region: Terminase_4; pfam05119
568708009050	Restriction endonuclease [Defense mechanisms]; Region: McrA; COG1403
568708009051	HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085
568708009052	active site
568708009054	KilA-N domain; Region: KilA-N; pfam04383
568708009056	Bacteriophage lysis protein; Region: Phage_lysis; pfam03245
568708009058	Predicted chitinase [General function prediction only]; Region: COG3179
568708009059	catalytic residue [active]
568708009061	Phage holin family (Lysis protein S); Region: Phage_holin_3; pfam05106
568708009063	3 probable transmembrane helices predicted for STM_MW20111 by TMHMM2.0 at aa 20-39, 52-69 and 79-101
568708009064	Protein of unknown function (DUF968); Region: DUF968; pfam06147
568708009066	KilA-N domain; Region: KilA-N; pfam04383
568708009068	Endodeoxyribonuclease RusA; Region: RusA; pfam05866
568708009070	DNA N-6-adenine-methyltransferase (Dam); Region: Dam; pfam05869
568708009072	PerC transcriptional activator; Region: PerC; pfam06069
568708009074	Helix-turn-helix domain; Region: HTH_36; pfam13730
568708009075	Ash protein family; Region: Phage_ASH; pfam10554
568708009076	Phage regulatory protein Rha (Phage_pRha); Region: Phage_pRha; pfam09669
568708009079	Predicted transcriptional regulator [Transcription]; Region: COG2932
568708009080	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
568708009081	non-specific DNA binding site [nucleotide binding]; other site
568708009082	salt bridge; other site
568708009083	sequence-specific DNA binding site [nucleotide binding]; other site
568708009084	Peptidase S24 LexA-like proteins are involved in the SOS response leading to the repair of single-stranded DNA within the bacterial cell. This family includes: the lambda repressor CI/C2 family and related bacterial prophage repressor proteins; LexA (EC...; Region: S24_LexA-like; cd06529
568708009085	Catalytic site [active]
568708009088	Uncharacterized conserved protein (DUF2303); Region: DUF2303; pfam10065
568708009090	HD domain; Region: HD_3; cl17350
568708009091	Protein of unknown function DUF262; Region: DUF262; pfam03235
568708009092	Uncharacterized conserved protein [Function unknown]; Region: COG1479
568708009094	Ead/Ea22-like protein; Region: Ead_Ea22; pfam13935
568708009095	DnaQ-like (or DEDD) 3'-5' exonuclease domain superfamily; Region: DnaQ_like_exo; cl10012
568708009096	active site
568708009097	catalytic site [active]
568708009098	substrate binding site [chemical binding]; other site
568708009099	Domain of unknown function (DUF4224); Region: DUF4224; pfam13986
568708009100	DNA breaking-rejoining enzymes, C-terminal catalytic domain. The DNA breaking-rejoining enzyme superfamily includes type IB topoisomerases and tyrosine recombinases that share the same fold in their catalytic domain containing six conserved active site...; Region: DNA_BRE_C; cl00213
568708009101	Lambda integrase, C-terminal catalytic domain. Lambda-type integrases catalyze site-specific integration and excision of temperate bacteriophages and other mobile genetic elements to and from the bacterial host chromosome.  They belong to the superfamily...; Region: INT_Lambda_C; cd00800
568708009102	dimer interface [polypeptide binding]; other site
568708009103	active site
568708009104	Int/Topo IB signature motif; other site
568708009106	DgsA anti-repressor MtfA; Provisional; Region: PRK15410
568708009108	putative protease; Region: PHA00666
568708009109	Phage integrase, N-terminal; Region: Integrase_l_N; pfam12834
568708009110	Integrase; Region: Integrase_1; pfam12835
568708009112	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2849
568708009113	FOG: TPR repeat, SEL1 subfamily [General function prediction only]; Region: COG0790
568708009114	Sel1-like repeats; Region: SEL1; smart00671
568708009115	Sel1-like repeats; Region: SEL1; smart00671
568708009118	A family including aminopeptidase P, aminopeptidase M, and prolidase. Also known as metallopeptidase family M24. This family of enzymes is able to cleave amido-, imido- and amidino-containing bonds. Members exibit relatively narrow substrate specificity...; Region: APP_MetAP; cl00279
568708009119	Signal peptide predicted for STM_MW20391 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.547 between residues 22 and 23
568708009120	AMP nucleosidase; Provisional; Region: PRK08292
568708009121	Bacterial AMP nucleoside phosphorylase N-terminus; Region: AMNp_N; pfam10423
568708009122	Nucleoside phosphorylase [Nucleotide transport and metabolism]; Region: Pfs; COG0775
568708009125	Protein of unknown function (DUF1493); Region: DUF1493; pfam07377
568708009127	MATE family multidrug exporter; Provisional; Region: PRK10189
568708009128	Subfamily of the multidrug and toxic compound extrusion (MATE)-like proteins similar to Thermotoga marina NorM; Region: MATE_NorM_like; cd13137
568708009129	11 probable transmembrane helices predicted for STM_MW20451 by TMHMM2.0 at aa 49-71, 86-108, 128-150, 160-182, 194-216, 231-253, 266-286, 296-318, 353-375, 390-412 and 434-456
568708009131	L,D-transpeptidase; Provisional; Region: PRK10190
568708009132	L,D-transpeptidase catalytic domain; Region: YkuD; pfam03734
568708009134	1 probable transmembrane helix predicted for STM_MW20461 by TMHMM2.0 at aa 7-26
568708009135	Signal peptide predicted for STM_MW20461 by SignalP 2.0 HMM (Signal peptide probability 0.942) with cleavage site probability 0.772 between residues 21 and 22
568708009136	Phosphoribosyltransferase; Region: DBI_PRT; pfam02277
568708009137	Nicotinate-nucleotide-dimethylbenzimidazole phosphoribosyltransferase (DMB-PRT), also called CobT; Region: DMB-PRT_CobT; cd02439
568708009138	putative dimer interface [polypeptide binding]; other site
568708009139	active site pocket [active]
568708009140	putative cataytic base [active]
568708009142	cobalamin synthase; Reviewed; Region: cobS; PRK00235
568708009144	5 probable transmembrane helices predicted for STM_MW20481 by TMHMM2.0 at aa 33-55, 59-81, 109-131, 136-158 and 185-207
568708009145	Signal peptide predicted for STM_MW20481 by SignalP 2.0 HMM (Signal peptide probability 0.655) with cleavage site probability 0.651 between residues 22 and 23
568708009146	Adenosylcobinamide kinase / adenosylcobinamide phosphate guanyltransferase (CobU). CobU is bifunctional cobalbumin biosynthesis enzymes which display adenosylcobinamide kinase and adenosylcobinamide phosphate guanyltransferase activity. This enzyme is a...; Region: CobU; cd00544
568708009147	homotrimer interface [polypeptide binding]; other site
568708009148	Walker A motif; other site
568708009149	GTP binding site [chemical binding]; other site
568708009150	Walker B motif; other site
568708009152	cobyric acid synthase; Provisional; Region: PRK00784
568708009153	Dethiobiotin synthetase [Coenzyme metabolism]; Region: BioD; COG0132
568708009154	Type 1 glutamine amidotransferase (GATase1) domain found in Cobyric Acid Synthase (CobQ); Region: GATase1_CobQ; cd01750
568708009155	catalytic triad [active]
568708009158	cobalt transporter ATP-binding subunit; Provisional; Region: cbiO; PRK13638
568708009159	First domain of the ATP-binding cassette component of cobalt transport system; Region: ABC_cobalt_CbiO_domain1; cd03225
568708009160	Walker A/P-loop; other site
568708009161	ATP binding site [chemical binding]; other site
568708009162	Q-loop/lid; other site
568708009163	ABC transporter signature motif; other site
568708009164	Walker B; other site
568708009165	D-loop; other site
568708009166	H-loop/switch region; other site
568708009168	cobalt transport protein CbiQ; Provisional; Region: PRK15485
568708009170	4 probable transmembrane helices predicted for STM_MW20521 by TMHMM2.0 at aa 22-47, 62-84, 91-110 and 120-142
568708009171	cobalt transport protein CbiN; Provisional; Region: PRK02898
568708009173	2 probable transmembrane helices predicted for STM_MW20531 by TMHMM2.0 at aa 5-22 and 60-82
568708009174	Signal peptide predicted for STM_MW20531 by SignalP 2.0 HMM (Signal peptide probability 0.934) with cleavage site probability 0.796 between residues 24 and 25
568708009175	cobalt transport protein CbiM; Validated; Region: PRK08319
568708009176	Cobalt uptake substrate-specific transmembrane region; Region: CbiM; pfam01891
568708009177	7 probable transmembrane helices predicted for STM_MW20541 by TMHMM2.0 at aa 15-34, 41-63, 78-100, 107-129, 139-161, 174-193 and 213-235
568708009179	Signal peptide predicted for STM_MW20541 by SignalP 2.0 HMM (Signal peptide probability 0.973) with cleavage site probability 0.732 between residues 35 and 36
568708009180	Precorrin-2 C20-methyltransferase, also named CobI or CbiL; Region: Precorrin_2_C20_MT; cd11645
568708009181	active site
568708009182	SAM binding site [chemical binding]; other site
568708009183	homodimer interface [polypeptide binding]; other site
568708009185	Cobalamin biosynthesis protein CbiK, Co2+ chelatase [Coenzyme metabolism]; Region: CbiK; COG4822
568708009186	Anaerobic cobalamin biosynthetic cobalt chelatase (CbiK), N-terminal domain. CbiK is part of the cobalt-early path for cobalamin biosynthesis. It catalyzes the insertion of cobalt into the oxidized form of precorrin-2, factor II (sirohydrochlorin), the...; Region: CbiK_N; cd03412
568708009187	active site
568708009188	C-terminal domain interface [polypeptide binding]; other site
568708009189	Anaerobic cobalamin biosynthetic cobalt chelatase (CbiK), C-terminal domain. CbiK is part of the cobalt-early path for cobalamin biosynthesis. It catalyzes the insertion of cobalt into the oxidized form of precorrin-2, factor II (sirohydrochlorin), the...; Region: CbiK_C; cd03413
568708009190	active site
568708009191	N-terminal domain interface [polypeptide binding]; other site
568708009193	Precorrin-6x reductase [Coenzyme metabolism]; Region: CobK; COG2099
568708009194	cobalt-precorrin-6x reductase; Reviewed; Region: PRK08057
568708009196	Precorrin-3B C(17)-methyltransferase (CobJ/CbiH); Region: Precorrin_3B_C17_MT; cd11646
568708009197	active site
568708009198	SAM binding site [chemical binding]; other site
568708009199	homodimer interface [polypeptide binding]; other site
568708009201	cobalamin biosynthesis protein CbiG; Validated; Region: PRK05788
568708009202	Cobalamin synthesis G N-terminal; Region: CbiG_N; pfam11760
568708009203	Cobalamin biosynthesis central region; Region: CbiG_mid; pfam11761
568708009204	Cobalamin synthesis G C-terminus; Region: CbiG_C; pfam01890
568708009208	1 probable transmembrane helix predicted for STM_MW20591 by TMHMM2.0 at aa 58-80
568708009209	Signal peptide predicted for STM_MW20591 by SignalP 2.0 HMM (Signal peptide probability 0.827) with cleavage site probability 0.735 between residues 22 and 23
568708009210	Precorrin-4 C11-methyltransferase (CbiF/CobM); Region: Precorrin-4_C11-MT; cd11641
568708009211	active site
568708009212	SAM binding site [chemical binding]; other site
568708009213	homodimer interface [polypeptide binding]; other site
568708009215	cobalt-precorrin-6Y C(15)-methyltransferase; Validated; Region: PRK08287
568708009216	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708009217	S-adenosylmethionine binding site [chemical binding]; other site
568708009219	Precorrin-6Y methyltransferase, the cobalamin biosynthesis enzyme CbiE; Region: Precorrin-6Y-methylase; cd11644
568708009220	active site
568708009221	putative homodimer interface [polypeptide binding]; other site
568708009222	SAM binding site [chemical binding]; other site
568708009224	cobalt-precorrin-6A synthase; Reviewed; Region: cbiD; PRK00075
568708009226	cobalt-precorrin-8X methylmutase; Validated; Region: cbiC; PRK08286
568708009227	Precorrin-8X methylmutase; Region: CbiC; pfam02570
568708009229	cobalamin biosynthesis protein; Provisional; Region: cobD; PRK01209
568708009230	5 probable transmembrane helices predicted for STM_MW20651 by TMHMM2.0 at aa 52-74, 79-101, 155-177, 207-229 and 296-318
568708009232	cobyrinic acid a,c-diamide synthase; Validated; Region: PRK01077
568708009233	dithiobiotin synthetase; Reviewed; Region: bioD; PRK00090
568708009234	Type 1 glutamine amidotransferase (GATase1) domain found in Cobyrinic Acid a,c-Diamide Synthase; Region: GATase1_CobB; cd03130
568708009235	catalytic triad [active]
568708009238	Predicted sensor domain [Signal transduction mechanisms / Transcription]; Region: PocR; COG4936
568708009239	Sensory domain found in PocR; Region: PocR; pfam10114
568708009240	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708009241	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
568708009242	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708009245	Major intrinsic protein (MIP) superfamily. Members of the MIP superfamily function as membrane channels that selectively transport water, small neutral molecules, and ions out of and between cells. The channel proteins share a common fold: the N-terminal...; Region: MIP; cd00333
568708009246	amphipathic channel; other site
568708009247	Asn-Pro-Ala signature motifs; other site
568708009249	6 probable transmembrane helices predicted for STM_MW20681 by TMHMM2.0 at aa 13-35, 55-77, 84-106, 143-165, 178-200 and 230-252
568708009250	Carbon dioxide concentrating mechanism/carboxysome shell protein [Secondary metabolites biosynthesis, transport, and catabolism / Energy production and conversion]; Region: CcmK; COG4577
568708009251	1,2-propanediol utilization protein A (PduA), Bacterial Micro-Compartment (BMC) domain; Region: BMC_PduA; cd07059
568708009252	Hexamer interface [polypeptide binding]; other site
568708009253	Putative hexagonal pore residue; other site
568708009255	Ethanolamine utilization protein [Amino acid transport and metabolism]; Region: EutL; COG4816
568708009256	1,2-propanediol utilization protein B (PduB), Bacterial Micro-Compartment (BMC) domain repeat 1; Region: BMC_PduB_repeat1; cd07047
568708009257	putative hexamer interface [polypeptide binding]; other site
568708009258	putative hexagonal pore; other site
568708009259	1,2-propanediol utilization protein B (PduB), Bacterial Micro-Compartment (BMC) domain repeat 2; Region: BMC_PduB_repeat2; cd07048
568708009260	putative hexamer interface [polypeptide binding]; other site
568708009261	putative hexagonal pore; other site
568708009263	Propanediol dehydratase, large subunit [Secondary metabolites biosynthesis, transport, and catabolism]; Region: PduC; COG4909
568708009264	Dehydratase large subunit. This family contains the large (alpha) subunit of B12-dependent glycerol dehydratases (GDHs) and B12-dependent diol dehydratases (DDHs). GDH is isofunctional with DDH. These enzymes can each catalyze the conversion of 1; Region: Dehydratase_LU; cd03687
568708009265	alpha-alpha subunit/dimer interface [polypeptide binding]; other site
568708009266	alpha-beta subunit interface [polypeptide binding]; other site
568708009267	alpha-gamma subunit interface [polypeptide binding]; other site
568708009268	active site
568708009269	substrate and K+ binding site; other site
568708009270	K+ binding site [ion binding]; other site
568708009271	cobalamin binding site [chemical binding]; other site
568708009273	propanediol dehydratase medium subunit; Provisional; Region: pduD; PRK15042
568708009275	Propanediol dehydratase, small subunit [Secondary metabolites biosynthesis, transport, and catabolism]; Region: PduE; COG4910
568708009277	Cell division protein FtsA; Region: FtsA; cl17206
568708009278	Diol dehydratase reactivase ATPase-like domain; Region: DDR; pfam08841
568708009280	Dehydratase medium subunit; Region: Dehydratase_MU; pfam02288
568708009281	Carbon dioxide concentrating mechanism/carboxysome shell protein [Secondary metabolites biosynthesis, transport, and catabolism / Energy production and conversion]; Region: CcmK; COG4577
568708009282	1,2-propanediol utilization protein K (PduK), Bacterial Micro-Compartment (BMC) domain repeat 1l; Region: BMC_PduK; cd07056
568708009283	putative hexamer interface [polypeptide binding]; other site
568708009284	putative hexagonal pore; other site
568708009286	1 probable transmembrane helix predicted for STM_MW20761 by TMHMM2.0 at aa 12-31
568708009287	propanediol utilization phosphotransacylase; Provisional; Region: PRK15070
568708009288	Propanediol utilisation protein PduL; Region: PduL; pfam06130
568708009289	Propanediol utilisation protein PduL; Region: PduL; pfam06130
568708009291	putative propanediol utilization protein PduM; Provisional; Region: PRK15428
568708009292	Ethanolamine utilisation protein and carboxysome structural protein domain family; Region: EutN_CcmL; cd01614
568708009293	Hexamer/Pentamer interface [polypeptide binding]; other site
568708009294	central pore; other site
568708009296	cob(I)alamin adenosyltransferase [Coenzyme transport and    metabolism]; Region: COG2096
568708009297	Uncharacterized protein, possibly involved in utilization of glycolate and propanediol [General function prediction only]; Region: GlcG; COG3193
568708009300	Ethanolamine utilization protein EutE-like; Region: ALDH_EutE; cd07121
568708009301	putative catalytic cysteine [active]
568708009303	Alcohol dehydrogenase, class IV [Energy production and conversion]; Region: EutG; COG1454
568708009304	1,3-propanediol dehydrogenase (PPD) catalyzes the reduction of 3-hydroxypropionaldehyde (3-HPA) to 1,3-propanediol in glycerol metabolism; Region: PDD; cd08180
568708009305	putative active site [active]
568708009306	metal binding site [ion binding]; metal-binding site
568708009308	Respiratory-chain NADH dehydrogenase 51 Kd subunit; Region: Complex1_51K; pfam01512
568708009309	SLBB domain; Region: SLBB; pfam10531
568708009310	4Fe-4S dicluster domain; Region: Fer4_17; pfam13534
568708009311	RnfC Barrel sandwich hybrid domain; Region: RnfC_N; pfam13375
568708009314	PduT-like ethanolamine utilization protein; Region: eut_PduT; TIGR02526
568708009315	1,2-propanediol utilization protein T (PduT), Bacterial Micro-Compartment (BMC) domain repeat 1; Region: BMC_PduT_repeat1; cd07053
568708009316	putative hexamer interface [polypeptide binding]; other site
568708009317	putative hexagonal pore; other site
568708009318	1,2-propanediol utilization protein T (PduT), Bacterial Micro-Compartment (BMC) domain repeat 2; Region: BMC_PduT_repeat2; cd07054
568708009319	putative hexamer interface [polypeptide binding]; other site
568708009320	putative hexagonal pore; other site
568708009322	1,2-propanediol utilization protein U (PduU)/ethanolamine utilization protein S (EutS), Bacterial Micro-Compartment (BMC) domain; Region: BMC_PduU-EutS; cd07046
568708009323	putative hexamer interface [polypeptide binding]; other site
568708009324	putative hexagonal pore; other site
568708009326	Ethanolamine utilisation - propanediol utilisation; Region: PduV-EutP; pfam10662
568708009327	G3 box; other site
568708009328	Switch II region; other site
568708009329	GTP/Mg2+ binding site [chemical binding]; other site
568708009330	G4 box; other site
568708009331	G5 box; other site
568708009333	propionate kinase; Reviewed; Region: PRK12397
568708009334	propionate/acetate kinase; Provisional; Region: PRK12379
568708009336	Protein involved in propanediol utilization, and related proteins (includes coumermycin biosynthetic protein), possible kinase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: PduX; COG4542
568708009338	hypothetical protein; Provisional; Region: PRK05423
568708009340	Predicted membrane protein [Function unknown]; Region: COG1289
568708009341	Fusaric acid resistance protein-like; Region: FUSC_2; pfam13515
568708009343	6 probable transmembrane helices predicted for STM_MW20901 by TMHMM2.0 at aa 20-42, 47-66, 73-92, 96-113, 118-135 and 140-162
568708009344	DNA gyrase inhibitor; Provisional; Region: PRK10016
568708009346	D-alanyl-D-alanine carboxypeptidase; Provisional; Region: dacD; PRK11397
568708009347	Beta-lactamase enzyme family; Region: Beta-lactamase2; cl17872
568708009348	Penicillin-binding protein 5, C-terminal domain; Region: PBP5_C; smart00936
568708009351	Signal peptide predicted for STM_MW20921 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.997 between residues 23 and 24
568708009352	thiosulfate reductase cytochrome B subunit; Provisional; Region: PRK15006
568708009353	Thiosulfate reductase cytochrome B subunit (membrane anchoring protein) [Energy production and conversion]; Region: COG4117
568708009354	5 probable transmembrane helices predicted for STM_MW20931 by TMHMM2.0 at aa 15-37, 66-88, 93-115, 169-191 and 201-223
568708009356	Fe-S-cluster-containing hydrogenase components 1 [Energy production and conversion]; Region: HybA; COG0437
568708009357	4Fe-4S binding domain; Region: Fer4; cl02805
568708009359	thiosulfate reductase PhsA; Provisional; Region: PRK15488
568708009360	Tat (twin-arginine translocation) pathway signal sequence; Region: TAT_signal_seq; TIGR01409
568708009361	The MopB_Thiosulfate-R-like CD contains thiosulfate-, sulfur-, and polysulfide-reductases, and other related proteins. Thiosulfate reductase catalyzes the cleavage of sulfur-sulfur bonds in thiosulfate. Polysulfide reductase is a membrane-bound enzyme...; Region: MopB_Thiosulfate-R-like; cd02755
568708009362	putative [Fe4-S4] binding site [ion binding]; other site
568708009363	putative molybdopterin cofactor binding site [chemical binding]; other site
568708009364	Molybdopterin-Binding (MopB) domain of the MopB superfamily of proteins, a  large, diverse, heterogeneous superfamily of enzymes that, in general, bind molybdopterin as a cofactor. The MopB domain is found in a wide variety of molybdenum- and...; Region: Molybdopterin-Binding; cl09928
568708009365	The MopB_CT_Thiosulfate-R-like CD contains thiosulfate-, sulfur-, and polysulfide-reductases, and other related proteins. Thiosulfate reductase catalyzes the cleavage of sulfur-sulfur bonds in thiosulfate. Polysulfide reductase is a membrane-bound enzyme...; Region: MopB_CT_Thiosulfate-R-like; cd02778
568708009366	putative molybdopterin cofactor binding site; other site
568708009370	Signal peptide predicted for STM_MW20951 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.994 between residues 30 and 31
568708009373	E3 ubiquitin-protein ligase SopA; Provisional; Region: PRK15377
568708009374	SopA-like central domain; Region: SopA; pfam13981
568708009375	SopA-like catalytic domain; Region: SopA_C; pfam13979
568708009376	exonuclease I; Provisional; Region: sbcB; PRK11779
568708009377	N-terminal DEDDh 3'-5' exonuclease domain of Escherichia coli exonuclease I and similar proteins; Region: ExoI_N; cd06138
568708009378	active site
568708009379	catalytic site [active]
568708009380	substrate binding site [chemical binding]; other site
568708009381	Exonuclease C-terminal; Region: Exonuc_X-T_C; pfam08411
568708009384	Amino acid transporters [Amino acid transport and metabolism]; Region: PotE; COG0531
568708009385	12 probable transmembrane helices predicted for STM_MW20991 by TMHMM2.0 at aa 20-38, 53-75, 96-118, 133-151, 158-180, 200-219, 240-262, 289-311, 342-364, 368-385, 398-417 and 422-439
568708009387	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708009388	putative DNA-binding transcriptional regulator; Provisional; Region: PRK11074
568708009389	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
568708009390	dimerization interface [polypeptide binding]; other site
568708009393	Nucleoside-diphosphate-sugar epimerases [Cell envelope biogenesis, outer membrane / Carbohydrate transport and metabolism]; Region: WcaG; COG0451
568708009394	atypical (a) SDRs, subgroup 4; Region: SDR_a4; cd05266
568708009395	putative NAD(P) binding site [chemical binding]; other site
568708009397	ATP phosphoribosyltransferase; Reviewed; Region: hisG; PRK00489
568708009398	ATP phosphoribosyltransferase; Region: hisG; TIGR00070
568708009399	ATP phosphoribosyltransferase, C-terminal domain; Region: HisG_C-term; TIGR03455
568708009402	Histidinol dehydrogenase [Amino acid transport and metabolism]; Region: HisD; COG0141
568708009403	Histidinol dehydrogenase, HisD, E.C 1.1.1.23. Histidinol dehydrogenase catalyzes the last two steps in the L-histidine biosynthesis pathway, which is conserved in bacteria, archaea, fungi, and plants. These last two steps are (i) the NAD-dependent...; Region: Histidinol_dh; cd06572
568708009404	NAD binding site [chemical binding]; other site
568708009405	dimerization interface [polypeptide binding]; other site
568708009406	product binding site; other site
568708009407	substrate binding site [chemical binding]; other site
568708009408	zinc binding site [ion binding]; other site
568708009409	catalytic residues [active]
568708009411	histidinol-phosphate aminotransferase; Provisional; Region: PRK01688
568708009412	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
568708009413	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708009414	homodimer interface [polypeptide binding]; other site
568708009415	catalytic residue [active]
568708009417	imidazole glycerol-phosphate dehydratase/histidinol phosphatase; Provisional; Region: PRK05446
568708009418	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708009419	active site
568708009420	motif I; other site
568708009421	motif II; other site
568708009422	Imidazoleglycerol-phosphate dehydratase; Region: IGPD; cd07914
568708009423	putative active site pocket [active]
568708009424	4-fold oligomerization interface [polypeptide binding]; other site
568708009425	metal binding residues [ion binding]; metal-binding site
568708009426	3-fold/trimer interface [polypeptide binding]; other site
568708009429	imidazole glycerol phosphate synthase subunit HisH; Provisional; Region: hisH; PRK13170
568708009430	Type 1 glutamine amidotransferase (GATase1) domain found in imidazole glycerol phosphate synthase (IGPS); Region: GATase1_IGP_Synthase; cd01748
568708009431	putative active site [active]
568708009432	oxyanion strand; other site
568708009433	catalytic triad [active]
568708009435	HisA.  Phosphoribosylformimino-5-aminoimidazole carboxamide ribonucleotide (ProFAR) isomerase catalyzes the fourth step in histidine biosynthesis, an isomerisation of the aminoaldose moiety of ProFAR to the aminoketose of PRFAR (N-(5'-phospho-D-1...; Region: HisA; cd04732
568708009436	phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase; Region: TIGR00007
568708009437	catalytic residues [active]
568708009439	The cyclase subunit of imidazoleglycerol phosphate synthase (HisF). Imidazole glycerol phosphate synthase (IGPS) catalyzes the fifth step of histidine biosynthesis, the formation of the imidazole ring. IGPS converts N1-(5'-phosphoribulosyl)...; Region: HisF; cd04731
568708009440	Histidine biosynthesis protein; Region: His_biosynth; pfam00977
568708009441	substrate binding site [chemical binding]; other site
568708009442	glutamase interaction surface [polypeptide binding]; other site
568708009444	Phosphoribosyl-AMP cyclohydrolase [Amino acid transport and metabolism]; Region: HisI; COG0139
568708009445	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP pyrophosphatase protein; Reviewed; Region: PRK02759
568708009446	Nucleoside Triphosphate Pyrophosphohydrolase (EC 3.6.1.8) MazG-like domain found in Escherichia coli phosphoribosyl-ATP pyrophosphohydrolase (HisIE or PRATP-PH) and its homologs; Region: NTP-PPase_HisIE_like; cd11534
568708009447	metal binding site [ion binding]; metal-binding site
568708009450	chain length determinant protein WzzB; Provisional; Region: PRK15471
568708009451	Chain length determinant protein; Region: Wzz; pfam02706
568708009452	G-rich domain on putative tyrosine kinase; Region: GNVR; pfam13807
568708009453	2 probable transmembrane helices predicted for STM_MW21101 by TMHMM2.0 at aa 33-52 and 296-315
568708009455	UDP-glucose 6-dehydrogenase; Provisional; Region: PRK15057
568708009456	NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus; Region: NAD_Gly3P_dh_N; pfam01210
568708009457	UDP-glucose/GDP-mannose dehydrogenase family, central domain; Region: UDPG_MGDP_dh; pfam00984
568708009458	UDP binding domain; Region: UDPG_MGDP_dh_C; smart00984
568708009462	6-phosphogluconate dehydrogenase-like protein; Reviewed; Region: PRK09599
568708009463	6-phosphogluconate dehydrogenase; Validated; Region: PRK09287
568708009464	6-phosphogluconate dehydrogenase, C-terminal domain; Region: 6PGD; pfam00393
568708009467	undecaprenyl-phosphate galactose phosphotransferase; Provisional; Region: PRK15204
568708009468	Left-handed parallel beta-Helix (LbetaH or LbH) domain: The alignment contains 5 turns, each containing three imperfect tandem repeats of a hexapeptide repeat motif (X-[STAV]-X-[LIV]-[GAED]-X). Proteins containing hexapeptide repeats are often enzymes...; Region: LbetaH; cl00160
568708009469	Bacterial sugar transferase; Region: Bac_transf; pfam02397
568708009470	5 probable transmembrane helices predicted for STM_MW21131 by TMHMM2.0 at aa 15-37, 57-74, 89-108, 115-134 and 282-304
568708009472	Phosphomannomutase [Carbohydrate transport and metabolism]; Region: {ManB}; COG1109
568708009473	ManB is a bacterial phosphomannomutase (PMM) that catalyzes the conversion of mannose 6-phosphate to mannose-1-phosphate in the second of three steps in the GDP-mannose pathway, in which GDP-D-mannose is synthesized from fructose-6-phosphate. In...; Region: ManB; cd03088
568708009474	active site
568708009475	substrate binding site [chemical binding]; other site
568708009476	metal binding site [ion binding]; metal-binding site
568708009480	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase; Region: GMP_PMI; TIGR01479
568708009481	GDP-M1P_Guanylyltransferase catalyzes the formation of GDP-Mannose; Region: GDP-M1P_Guanylyltransferase; cd02509
568708009482	Substrate binding site; other site
568708009483	Mannose-6-phosphate isomerase; Region: MannoseP_isomer; pfam01050
568708009486	Glycosyltransferase like family 2; Region: Glyco_tranf_2_3; pfam13641
568708009487	Glycosyl transferase family 2; Region: Glycos_transf_2; pfam00535
568708009488	active site
568708009489	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394
568708009491	Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438
568708009492	This family is most closely related to the GT1 family of glycosyltransferases. mtfB (mannosyltransferase B) in E. coli has been shown to direct the growth of the O9-specific polysaccharide chain. It transfers two mannoses into the position 3 of the...; Region: GT1_mtfB_like; cd03809
568708009494	Glycosyltransferases involved in cell wall biogenesis [Cell envelope biogenesis, outer membrane]; Region: WcaA; COG0463
568708009495	Glycosyl transferase family 2; Region: Glycos_transf_2; pfam00535
568708009496	active site
568708009498	Multidrug and toxic compound extrusion family and similar proteins; Region: MATE_like; cd12082
568708009499	Membrane protein involved in the export of O-antigen and teichoic acid [General function prediction only]; Region: RfbX; COG2244
568708009500	12 probable transmembrane helices predicted for STM_MW21191 by TMHMM2.0 at aa 12-34, 47-69, 90-112, 132-154, 161-180, 190-212, 233-250, 270-292, 304-326, 341-360, 372-394 and 399-421
568708009502	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
568708009503	NAD dependent epimerase/dehydratase family; Region: Epimerase; pfam01370
568708009504	NAD(P) binding site [chemical binding]; other site
568708009505	active site
568708009507	lipopolysaccharide biosynthesis protein RfbH; Provisional; Region: PRK15407
568708009508	3-amino-5-hydroxybenzoic acid synthase family (AHBA_syn). AHBA_syn family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The members of this CD are involved in various biosynthetic pathways for secondary...; Region: AHBA_syn; cd00616
568708009509	inhibitor-cofactor binding pocket; inhibition site
568708009510	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708009511	catalytic residue [active]
568708009513	CDP-glucose 4,6-dehydratase; Region: CDP_4_6_dhtase; TIGR02622
568708009514	CDP-D-glucose 4,6-dehydratase, extended (e) SDRs; Region: CDP_GD_SDR_e; cd05252
568708009515	NAD binding site [chemical binding]; other site
568708009516	homotetramer interface [polypeptide binding]; other site
568708009517	homodimer interface [polypeptide binding]; other site
568708009518	substrate binding site [chemical binding]; other site
568708009519	active site
568708009521	Nucleoside-diphosphate-sugar pyrophosphorylase involved in lipopolysaccharide biosynthesis/translation initiation factor 2B, gamma/epsilon subunits (eIF-2Bgamma/eIF-2Bepsilon) [Cell envelope biogenesis, outer membrane / Translation, ribosomal structure...; Region: GCD1; COG1208
568708009522	G1P_cytidylyltransferase catalyzes the production of CDP-D-Glucose; Region: G1P_cytidylyltransferase; cd02524
568708009523	substrate binding site; other site
568708009525	CDP-6-deoxy-delta-3,4-glucoseen reductase; Validated; Region: PRK07609
568708009526	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
568708009527	catalytic loop [active]
568708009528	iron binding site [ion binding]; other site
568708009529	NAD(P)H dependent flavin oxidoreductases use flavin as a substrate in mediating electron transfer from iron complexes or iron proteins. Structurally similar to ferredoxin reductases, but with only 15% sequence identity, flavin reductases reduce FAD, FMN; Region: flavin_oxioreductase; cd06189
568708009530	FAD binding pocket [chemical binding]; other site
568708009531	FAD binding motif [chemical binding]; other site
568708009532	phosphate binding motif [ion binding]; other site
568708009533	beta-alpha-beta structure motif; other site
568708009534	NAD binding pocket [chemical binding]; other site
568708009538	dTDP-4-dehydrorhamnose 3,5-epimerase; Region: dTDP_sugar_isom; pfam00908
568708009540	glucose-1-phosphate thymidylyltransferase RfbA; Provisional; Region: PRK15480
568708009541	G1P_TT_short is the short form of glucose-1-phosphate thymidylyltransferase; Region: G1P_TT_short; cd02538
568708009542	substrate binding site; other site
568708009543	tetramer interface; other site
568708009545	dTDP-4-dehydrorhamnose reductase; Provisional; Region: PRK09987
568708009546	dTDP-6-deoxy-L-lyxo-4-hexulose reductase and related proteins, extended (e) SDRs; Region: dTDP_HR_like_SDR_e; cd05254
568708009547	NADP binding site [chemical binding]; other site
568708009548	active site
568708009549	putative substrate binding site [chemical binding]; other site
568708009551	dTDP-glucose 4,6 dehydratase; Provisional; Region: PRK10084
568708009552	dTDP-D-glucose 4,6-dehydratase, extended (e) SDRs; Region: dTDP_GD_SDR_e; cd05246
568708009553	NAD binding site [chemical binding]; other site
568708009554	substrate binding site [chemical binding]; other site
568708009555	homodimer interface [polypeptide binding]; other site
568708009556	active site
568708009558	dTDP-glucose pyrophosphorylase [Cell envelope biogenesis, outer membrane]; Region: RfbA; COG1209
568708009559	Prokaryotic UGPase catalyses the synthesis of UDP-glucose; Region: UGPase_prokaryotic; cd02541
568708009560	active site
568708009561	tetramer interface; other site
568708009563	Signal peptide predicted for STM_MW21291 by SignalP 2.0 HMM (Signal peptide probability 0.730) with cleavage site probability 0.694 between residues 22 and 23
568708009564	colanic acid biosynthesis protein WcaM; Region: WcaM; TIGR04004
568708009565	Signal peptide predicted for STM_MW21301 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.968 between residues 31 and 32
568708009566	colanic acid biosynthesis glycosyltransferase WcaL; Provisional; Region: PRK15427
568708009567	This is a family of GT1 glycosyltransferases found specifically in certain bacteria. amsK in Erwinia amylovora, has been reported to be involved in the biosynthesis of amylovoran, a exopolysaccharide acting as a virulence factor; Region: GT1_amsK_like; cd03799
568708009568	putative ADP-binding pocket [chemical binding]; other site
568708009570	Polysaccharide pyruvyl transferase family protein [Cell wall/membrane/envelope biogenesis]; Region: WcaK; COG2327
568708009571	colanic acid biosynthesis pyruvyl transferase WcaK; Region: wcaK; TIGR04006
568708009573	colanic acid exporter; Provisional; Region: PRK10459
568708009574	Uncharacterized subfamily of the multidrug and toxic compound extrusion (MATE) proteins; Region: MATE_tuaB_like; cd13127
568708009576	10 probable transmembrane helices predicted for STM_MW21331 by TMHMM2.0 at aa 13-35, 45-67, 80-102, 165-187, 286-308, 323-340, 361-383, 387-409, 416-435 and 450-472
568708009577	Signal peptide predicted for STM_MW21331 by SignalP 2.0 HMM (Signal peptide probability 0.754) with cleavage site probability 0.750 between residues 33 and 34
568708009578	putative UDP-glucose lipid carrier transferase; Provisional; Region: PRK10124
568708009579	Sugar transferases involved in lipopolysaccharide synthesis [Cell envelope biogenesis, outer membrane]; Region: WcaJ; COG2148
568708009580	5 probable transmembrane helices predicted for STM_MW21341 by TMHMM2.0 at aa 12-34, 44-66, 79-101, 111-130 and 279-300
568708009582	phosphomannomutase CpsG; Provisional; Region: PRK15414
568708009583	The phosphomannomutase/phosphoglucomutase (PMM/PGM) bifunctional enzyme catalyzes the reversible conversion of 1-phospho to 6-phospho-sugars (e.g. between mannose-1-phosphate and mannose-6-phosphate or glucose-1-phosphate and glucose-6-phosphate) via a...; Region: PMM_PGM; cd03089
568708009584	active site
568708009585	substrate binding site [chemical binding]; other site
568708009586	metal binding site [ion binding]; metal-binding site
568708009591	mannose-1-phosphate guanyltransferase; Provisional; Region: cpsB; PRK15460
568708009592	GDP-M1P_Guanylyltransferase catalyzes the formation of GDP-Mannose; Region: GDP-M1P_Guanylyltransferase; cd02509
568708009593	Substrate binding site; other site
568708009594	Mannose-6-phosphate isomerase; Region: MannoseP_isomer; pfam01050
568708009597	colanic acid biosynthesis glycosyl transferase WcaI; Region: wcaI; TIGR04007
568708009598	This family is most closely related to the GT1 family of glycosyltransferases. wbuB in E. coli is involved in the biosynthesis of the O26 O-antigen.  It has been proposed to function as an N-acetyl-L-fucosamine (L-FucNAc) transferase; Region: GT1_wbuB_like; cd03794
568708009600	GDP-mannose glycosyl hydrolase (AKA GDP-mannose mannosyl hydrolase (GDPMH)) is a member of the Nudix hydrolase superfamily. This class of enzymes is unique from other members of the superfamily in two aspects. First, it contains a modified Nudix...; Region: GDPMH; cd03430
568708009601	active site
568708009602	GDP-Mannose binding site [chemical binding]; other site
568708009603	dimer interface [polypeptide binding]; other site
568708009604	modified nudix motif
568708009605	metal binding site [ion binding]; metal-binding site
568708009607	GDP-fucose synthetase, extended (e) SDRs; Region: GDP_FS_SDR_e; cd05239
568708009608	GDP-4-keto-6-deoxymannose-3, 5-epimerase-4-reductase; Region: PLN02725
568708009609	NADP binding site [chemical binding]; other site
568708009610	active site
568708009611	putative substrate binding site [chemical binding]; other site
568708009613	GDP-D-mannose dehydratase [Cell envelope biogenesis, outer membrane]; Region: Gmd; COG1089
568708009614	GDP-mannose 4,6 dehydratase, extended (e) SDRs; Region: GDP_MD_SDR_e; cd05260
568708009615	NADP-binding site; other site
568708009616	homotetramer interface [polypeptide binding]; other site
568708009617	substrate binding site [chemical binding]; other site
568708009618	homodimer interface [polypeptide binding]; other site
568708009619	active site
568708009621	colanic acid biosynthesis acetyltransferase WcaF; Region: WcaF; TIGR04008
568708009622	wcaF-like: This group is composed of the protein product of the E. coli wcaF gene and similar proteins. WcaF is part of the gene cluster responsible for the biosynthesis of the extracellular polysaccharide colanic acid. The wcaF protein is predicted to...; Region: LbH_wcaF_like; cd05825
568708009623	putative trimer interface [polypeptide binding]; other site
568708009624	putative active site [active]
568708009625	putative substrate binding site [chemical binding]; other site
568708009626	putative CoA binding site [chemical binding]; other site
568708009627	putative glycosyl transferase; Provisional; Region: PRK10063
568708009628	WfgS and WfeV are involved in O-antigen biosynthesis; Region: GT_2_WfgS_like; cd06433
568708009629	metal-binding site
568708009631	putative colanic acid biosynthesis protein; Provisional; Region: wcaD; cl08075
568708009632	12 probable transmembrane helices predicted for STM_MW21441 by TMHMM2.0 at aa 7-25, 30-47, 54-76, 81-103, 116-138, 143-165, 172-189, 204-226, 246-268, 283-305, 326-348 and 368-390
568708009633	colanic acid biosynthesis glycosyl transferase WcaC; Region: WcaC; TIGR04015
568708009634	Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. The acceptor molecule can be a lipid, a protein, a heterocyclic compound, or another carbohydrate...; Region: Glycosyltransferase_GTB_type; cl10013
568708009635	Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. The acceptor molecule can be a lipid, a protein, a heterocyclic compound, or another carbohydrate...; Region: Glycosyltransferase_GTB_type; cl10013
568708009637	putative acyl transferase; Provisional; Region: PRK10191
568708009638	Serine acetyltransferase (SAT): SAT catalyzes the CoA-dependent acetylation of the side chain hydroxyl group of L-serine to form O-acetylserine, as the first step of a two-step biosynthetic pathway in bacteria and plants leading to the formation of...; Region: LbH_SAT; cd03354
568708009639	trimer interface [polypeptide binding]; other site
568708009640	active site
568708009641	substrate binding site [chemical binding]; other site
568708009642	CoA binding site [chemical binding]; other site
568708009643	putative glycosyl transferase; Provisional; Region: PRK10018
568708009644	Glycosyl transferase family 2; Region: Glycos_transf_2; pfam00535
568708009645	active site
568708009647	tyrosine kinase; Provisional; Region: PRK11519
568708009648	Chain length determinant protein; Region: Wzz; pfam02706
568708009649	Chain length determinant protein; Region: Wzz; cl15801
568708009650	G-rich domain on putative tyrosine kinase; Region: GNVR; pfam13807
568708009651	The Fer4_NifH superfamily contains a variety of proteins which share a common ATP-binding domain. Functionally, proteins in this superfamily use the energy from hydrolysis of NTP to transfer electron or ion; Region: Fer4_NifH; cl17203
568708009653	2 probable transmembrane helices predicted for STM_MW21481 by TMHMM2.0 at aa 31-53 and 426-448
568708009655	Low molecular weight phosphatase family; Region: LMWPc; cd00115
568708009656	Low molecular weight phosphotyrosine protein phosphatase; Region: LMWPc; pfam01451
568708009657	active site
568708009659	polysaccharide export protein Wza; Provisional; Region: PRK15078
568708009660	Polysaccharide biosynthesis/export protein; Region: Poly_export; pfam02563
568708009663	Membrane protein TerC, possibly involved in tellurium resistance [Inorganic ion transport and metabolism]; Region: TerC; COG0861
568708009664	FOG: CBS domain [General function prediction only]; Region: COG0517
568708009665	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains associated with the CorC_HlyC domain. CorC_HlyC is a transporter associated domain. This small domain is found in Na+/H+ antiporters, in proteins involved in...; Region: CBS_pair_CorC_HlyC_assoc; cd04590
568708009666	Transporter associated domain; Region: CorC_HlyC; smart01091
568708009667	7 probable transmembrane helices predicted for STM_MW21511 by TMHMM2.0 at aa 13-35, 48-70, 80-99, 126-148, 153-172, 185-207 and 212-234
568708009671	putative assembly protein; Provisional; Region: PRK10833
568708009672	AsmA-like C-terminal region; Region: AsmA_2; pfam13502
568708009674	1 probable transmembrane helix predicted for STM_MW21521 by TMHMM2.0 at aa 7-26
568708009675	Signal peptide predicted for STM_MW21521 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.492 between residues 25 and 26
568708009676	Trimeric dUTP diphosphatases; Region: trimeric_dUTPase; cd07557
568708009677	trimer interface [polypeptide binding]; other site
568708009678	active site
568708009680	Uridine kinase [Nucleotide transport and metabolism]; Region: Udk; COG0572
568708009681	Uridine monophosphate kinase (UMPK, EC 2.7.1.48), also known as uridine kinase or uridine-cytidine kinase (UCK), catalyzes the reversible phosphoryl transfer from ATP to uridine or cytidine to yield UMP or CMP. In the primidine nucleotide-salvage pathway; Region: UMPK; cd02023
568708009682	ATP-binding site [chemical binding]; other site
568708009683	Sugar specificity; other site
568708009684	Pyrimidine base specificity; other site
568708009686	Predicted integral membrane sensor domain [Signal transduction mechanisms]; Region: COG3447
568708009687	PAS domain S-box; Region: sensory_box; TIGR00229
568708009688	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
568708009689	putative active site [active]
568708009690	heme pocket [chemical binding]; other site
568708009691	PAS domain S-box; Region: sensory_box; TIGR00229
568708009692	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
568708009693	putative active site [active]
568708009694	heme pocket [chemical binding]; other site
568708009695	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
568708009696	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
568708009697	metal binding site [ion binding]; metal-binding site
568708009698	active site
568708009699	I-site; other site
568708009700	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
568708009701	10 probable transmembrane helices predicted for STM_MW21551 by TMHMM2.0 at aa 15-37, 64-86, 90-112, 124-146, 156-177, 189-208, 212-229, 236-258, 268-290 and 310-327
568708009707	3-methyl-adenine DNA glycosylase II; Provisional; Region: PRK10308
568708009708	AlkA N-terminal domain; Region: AlkA_N; pfam06029
568708009709	endonuclease III; includes endonuclease III (DNA-(apurinic or apyrimidinic site) lyase), alkylbase DNA glycosidases (Alka-family) and other DNA glycosidases; Region: ENDO3c; cd00056
568708009710	minor groove reading motif; other site
568708009711	helix-hairpin-helix signature motif; other site
568708009712	substrate binding pocket [chemical binding]; other site
568708009713	active site
568708009716	putative chaperone; Provisional; Region: PRK11678
568708009717	Escherichia coli YegD, a putative chaperone protein, and related proteins; Region: YegD_like; cd10231
568708009718	nucleotide binding site [chemical binding]; other site
568708009719	putative NEF/HSP70 interaction site [polypeptide binding]; other site
568708009720	SBD interface [polypeptide binding]; other site
568708009722	multidrug efflux system subunit MdtA; Provisional; Region: PRK11556
568708009723	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
568708009724	HlyD family secretion protein; Region: HlyD_3; pfam13437
568708009725	Signal peptide predicted for STM_MW21581 by SignalP 2.0 HMM (Signal peptide probability 0.928) with cleavage site probability 0.356 between residues 34 and 35
568708009726	1 probable transmembrane helix predicted for STM_MW21581 by TMHMM2.0 at aa 7-26
568708009728	multidrug efflux system subunit MdtB; Provisional; Region: PRK10503
568708009729	Protein export membrane protein; Region: SecD_SecF; cl14618
568708009731	11 probable transmembrane helices predicted for STM_MW21591 by TMHMM2.0 at aa 15-37, 345-362, 367-389, 396-418, 438-460, 472-494, 535-557, 867-889, 909-931, 968-990 and 1000-1022
568708009732	multidrug efflux system subunit MdtC; Provisional; Region: PRK10614
568708009734	10 probable transmembrane helices predicted for STM_MW21601 by TMHMM2.0 at aa 7-29, 336-353, 360-382, 434-456, 463-485, 525-547, 853-875, 895-917, 948-970 and 985-1007
568708009735	putative transporter; Provisional; Region: PRK10504
568708009736	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708009737	putative substrate translocation pore; other site
568708009738	13 probable transmembrane helices predicted for STM_MW21611 by TMHMM2.0 at aa 12-34, 47-69, 76-98, 102-124, 136-158, 168-190, 197-214, 224-243, 255-277, 287-309, 330-352, 395-417 and 430-452
568708009740	signal transduction histidine-protein kinase BaeS; Provisional; Region: PRK10549
568708009741	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
568708009742	dimerization interface [polypeptide binding]; other site
568708009743	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
568708009744	dimer interface [polypeptide binding]; other site
568708009745	phosphorylation site [posttranslational modification]
568708009746	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708009747	ATP binding site [chemical binding]; other site
568708009748	Mg2+ binding site [ion binding]; other site
568708009749	G-X-G motif; other site
568708009750	2 probable transmembrane helices predicted for STM_MW21621 by TMHMM2.0 at aa 13-35 and 168-190
568708009754	DNA-binding transcriptional regulator BaeR; Provisional; Region: PRK10710
568708009755	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708009756	active site
568708009757	phosphorylation site [posttranslational modification]
568708009758	intermolecular recognition site; other site
568708009759	dimerization interface [polypeptide binding]; other site
568708009760	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
568708009761	DNA binding site [nucleotide binding]
568708009764	PcfJ-like protein; Region: PcfJ; pfam14284
568708009765	Protein of unknown function (DUF1266); Region: DUF1266; pfam06889
568708009767	Domain of unknown function (DUF4034); Region: DUF4034; pfam13226
568708009768	putative protease; Provisional; Region: PRK15452
568708009769	Peptidase family U32; Region: Peptidase_U32; pfam01136
568708009771	type III secretion system protein; Provisional; Region: PRK15383
568708009772	non-LEE encoded effector protein NleB; Provisional; Region: PRK15382
568708009773	Tir chaperone protein (CesT) family; Region: CesT; pfam05932
568708009775	2 probable transmembrane helices predicted for STM_MW21701 by TMHMM2.0 at aa 48-70 and 85-107
568708009776	lipid kinase; Reviewed; Region: PRK13054
568708009777	Diacylglycerol kinase catalytic domain; Region: DAGK_cat; pfam00781
568708009779	fructose-bisphosphate aldolase; Provisional; Region: PRK09250
568708009780	Class I fructose-1,6-bisphosphate (FBP) aldolases of the archaeal type (DhnA homologs); Region: DhnA; cd00958
568708009781	putative active site; other site
568708009782	catalytic residue [active]
568708009784	nucleoside transporter; Region: 2A0110; TIGR00889
568708009785	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708009786	putative substrate translocation pore; other site
568708009788	12 probable transmembrane helices predicted for STM_MW21731 by TMHMM2.0 at aa 7-29, 39-61, 70-87, 97-119, 132-154, 159-181, 211-233, 243-265, 274-293, 297-319, 339-358 and 378-400
568708009789	ADP-ribosylglycohydrolase [Posttranslational modification, protein turnover, chaperones]; Region: DraG; COG1397
568708009791	Sugar kinases, ribokinase family [Carbohydrate transport and metabolism]; Region: RbsK; COG0524
568708009792	ribokinase/pfkB superfamily: Kinases that accept a wide variety of substrates, including carbohydrates and aromatic small molecules, all are phosphorylated at a hydroxyl group. The superfamily includes ribokinase, fructokinase, ketohexokinase; Region: ribokinase_pfkB_like; cl00192
568708009793	substrate binding site [chemical binding]; other site
568708009794	ATP binding site [chemical binding]; other site
568708009796	Transcriptional regulators [Transcription]; Region: PhnF; COG2188
568708009797	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
568708009798	DNA-binding site [nucleotide binding]; DNA binding site
568708009799	UTRA domain; Region: UTRA; pfam07702
568708009802	4-amino-5-hydroxymethyl-2-methyl-pyrimidine phosphate kinase (HMPP-kinase) catalyzes two consecutive phosphorylation steps in the thiamine phosphate biosynthesis pathway, leading to the synthesis of vitamin B1. The first step is the phosphorylation of...; Region: HMPP_kinase; cd01169
568708009803	dimer interface [polypeptide binding]; other site
568708009804	substrate binding site [chemical binding]; other site
568708009805	ATP binding site [chemical binding]; other site
568708009807	4-methyl-5-beta-hydroxyethylthiazole (Thz) kinase catalyzes the phosphorylation of the hydroxylgroup of Thz. A reaction that allows cells to recycle Thz into the thiamine biosynthesis pathway, as an alternative to its synthesis from cysteine, tyrosine...; Region: THZ_kinase; cd01170
568708009808	substrate binding site [chemical binding]; other site
568708009809	multimerization interface [polypeptide binding]; other site
568708009810	ATP binding site [chemical binding]; other site
568708009812	Predicted integral membrane protein [Function unknown]; Region: COG5455
568708009813	Signal peptide predicted for STM_MW21791 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 19 and 20
568708009815	putative fimbrial biosynthesis regulatory protein; Provisional; Region: PRK15216
568708009816	putative fimbrial-like adhesin protein StcD; Provisional; Region: PRK15252
568708009817	Signal peptide predicted for STM_MW21801 by SignalP 2.0 HMM (Signal peptide probability 0.783) with cleavage site probability 0.726 between residues 19 and 20
568708009818	fimbrial outer membrane usher protein; Provisional; Region: PRK15217
568708009819	PapC N-terminal domain; Region: PapC_N; pfam13954
568708009820	Type VII secretion system (T7SS), usher protein; Region: Usher; pfam00577
568708009821	PapC C-terminal domain; Region: PapC_C; pfam13953
568708009823	Signal peptide predicted for STM_MW21811 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.557 between residues 24 and 25
568708009824	fimbrial chaperone protein PegB; Provisional; Region: PRK15218
568708009825	Gram-negative pili assembly chaperone, N-terminal domain; Region: Pili_assembly_N; pfam00345
568708009826	Gram-negative pili assembly chaperone, C-terminal domain; Region: Pili_assembly_C; pfam02753
568708009829	1 probable transmembrane helix predicted for STM_MW21821 by TMHMM2.0 at aa 7-29
568708009830	Signal peptide predicted for STM_MW21821 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 18 and 19
568708009831	fimbrial chaperone protein; Provisional; Region: PRK15220
568708009833	Signal peptide predicted for STM_MW21831 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 22 and 23
568708009834	Protein of unknown function (DUF2574); Region: DUF2574; pfam10836
568708009836	antiporter inner membrane protein; Provisional; Region: PRK11670
568708009837	MRP (Multiple Resistance and pH adaptation) is a homologue of the Fer4_NifH superfamily. Like the other members of the superfamily, MRP contains a ATP-binding domain at the N-termini. It is found in bacteria as a membrane-spanning protein and functions...; Region: MRP-like; cd02037
568708009838	Walker A motif; other site
568708009840	methionyl-tRNA synthetase; Reviewed; Region: metG; PRK00133
568708009841	catalytic core domain of methioninyl-tRNA synthetases; Region: MetRS_core; cd00814
568708009842	active site
568708009843	HIGH motif; other site
568708009844	KMSKS motif; other site
568708009845	Anticodon-binding domain of methionyl tRNA synthetases; Region: Anticodon_Ia_Met; cd07957
568708009846	tRNA binding surface [nucleotide binding]; other site
568708009847	anticodon binding site; other site
568708009848	tRNA-binding-domain-containing Escherichia coli methionyl-tRNA synthetase (EcMetRS)-like proteins.  This family includes EcMetRS and Aquifex aeolicus Trbp111 (AaTrbp111). This domain has general tRNA binding properties.  MetRS aminoacylates methionine...; Region: tRNA_bind_EcMetRS_like; cd02800
568708009849	dimer interface [polypeptide binding]; other site
568708009850	putative tRNA-binding site [nucleotide binding]; other site
568708009853	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4808
568708009854	Signal peptide predicted for STM_MW21871 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.426 between residues 24 and 25
568708009856	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4808
568708009857	Signal peptide predicted for STM_MW21881 by SignalP 2.0 HMM (Signal peptide probability 0.947) with cleavage site probability 0.839 between residues 22 and 23
568708009859	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4807
568708009860	Protein of unknown function (DUF1456); Region: DUF1456; pfam07308
568708009861	Protein of unknown function (DUF1456); Region: DUF1456; pfam07308
568708009863	putative two-component response-regulatory protein YehT; Provisional; Region: PRK11697
568708009864	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708009865	active site
568708009866	phosphorylation site [posttranslational modification]
568708009867	intermolecular recognition site; other site
568708009868	dimerization interface [polypeptide binding]; other site
568708009869	LytTr DNA-binding domain; Region: LytTR; pfam04397
568708009872	Putative regulator of cell autolysis [Signal transduction mechanisms]; Region: LytS; COG3275
568708009873	5TMR of 5TMR-LYT; Region: 5TM-5TMR_LYT; pfam07694
568708009874	GAF domain; Region: GAF; pfam01590
568708009875	Histidine kinase; Region: His_kinase; pfam06580
568708009876	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708009877	ATP binding site [chemical binding]; other site
568708009878	Mg2+ binding site [ion binding]; other site
568708009879	G-X-G motif; other site
568708009883	6 probable transmembrane helices predicted for STM_MW21911 by TMHMM2.0 at aa 4-23, 44-63, 73-95, 107-129, 139-161 and 168-190
568708009885	transcriptional regulator MirA; Provisional; Region: PRK15043
568708009886	Helix-Turn-Helix DNA binding domain of MlrA-like transcription regulators; Region: HTH_MlrA-like; cd04763
568708009887	DNA binding residues [nucleotide binding]
568708009889	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708009890	putative PBP binding loops; other site
568708009891	ABC-ATPase subunit interface; other site
568708009892	6 probable transmembrane helices predicted for STM_MW21941 by TMHMM2.0 at aa 46-68, 92-114, 127-149, 159-181, 202-224 and 239-261
568708009894	ABC-type proline/glycine betaine transport systems, ATPase components [Amino acid transport and metabolism]; Region: OpuBA; COG1125
568708009895	ATP-binding cassette domain of the osmoprotectant transporter; Region: ABC_OpuCA_Osmoprotection; cd03295
568708009896	Walker A/P-loop; other site
568708009897	ATP binding site [chemical binding]; other site
568708009898	Q-loop/lid; other site
568708009899	ABC transporter signature motif; other site
568708009900	Walker B; other site
568708009901	D-loop; other site
568708009902	H-loop/switch region; other site
568708009903	CBS domain; Region: CBS; pfam00571
568708009906	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708009907	dimer interface [polypeptide binding]; other site
568708009908	conserved gate region; other site
568708009909	ABC-ATPase subunit interface; other site
568708009910	10 probable transmembrane helices predicted for STM_MW21961 by TMHMM2.0 at aa 13-33, 48-70, 75-97, 107-126, 139-161, 187-209, 216-238, 248-270, 328-350 and 360-382
568708009912	Signal peptide predicted for STM_MW21961 by SignalP 2.0 HMM (Signal peptide probability 0.931) with cleavage site probability 0.866 between residues 26 and 27
568708009913	Substrate binding domain of ABC-type glycine betaine transport system; Region: OpuAC; pfam04069
568708009915	Signal peptide predicted for STM_MW21971 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 23 and 24
568708009916	beta-D-glucoside glucohydrolase; Provisional; Region: PRK15098
568708009917	Glycosyl hydrolase family 3 N terminal domain; Region: Glyco_hydro_3; pfam00933
568708009918	Fibronectin type III-like domain; Region: Fn3-like; pfam14310
568708009921	Signal peptide predicted for STM_MW21981 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 20 and 21
568708009922	D-lactate dehydrogenase; Provisional; Region: PRK11183
568708009923	FAD binding domain; Region: FAD_binding_4; pfam01565
568708009924	D-lactate dehydrogenase, membrane binding; Region: Lact-deh-memb; pfam09330
568708009927	D-alanyl-D-alanine carboxypeptidase; Region: Peptidase_S11; pfam00768
568708009928	D-alanyl-D-alanine endopeptidase; Provisional; Region: pbpG; PRK11669
568708009930	Protein of unknown function (DUF1282); Region: DUF1282; pfam06930
568708009931	5 probable transmembrane helices predicted for STM_MW22011 by TMHMM2.0 at aa 33-55, 65-87, 108-130, 135-157 and 170-192
568708009933	Uncharacterized membrane-associated protein [Function unknown]; Region: DedA; COG0586
568708009934	SNARE associated Golgi protein; Region: SNARE_assoc; pfam09335
568708009935	5 probable transmembrane helices predicted for STM_MW22021 by TMHMM2.0 at aa 21-43, 53-72, 100-122, 137-159 and 172-189
568708009937	oxidoreductase; Provisional; Region: PRK12743
568708009938	classical (c) SDRs; Region: SDR_c; cd05233
568708009939	NAD(P) binding site [chemical binding]; other site
568708009940	active site
568708009942	multidrug resistance outer membrane protein MdtQ; Provisional; Region: PRK11459
568708009944	Signal peptide predicted for STM_MW22041 by SignalP 2.0 HMM (Signal peptide probability 0.951) with cleavage site probability 0.550 between residues 20 and 21
568708009945	tRNA-dihydrouridine synthase C; Provisional; Region: PRK10550
568708009946	Dihydrouridine synthase-like (DUS-like) FMN-binding domain. Members of this family catalyze the reduction of the 5,6-double bond of a uridine residue on tRNA. Dihydrouridine modification of tRNA is widely observed in prokaryotes and eukaryotes, and also...; Region: DUS_like_FMN; cd02801
568708009947	FMN binding site [chemical binding]; other site
568708009948	active site
568708009949	catalytic residues [active]
568708009950	substrate binding site [chemical binding]; other site
568708009952	salicylate hydroxylase; Provisional; Region: PRK08163
568708009953	ubiquinone biosynthesis hydroxylase family protein; Provisional; Region: PRK07608; cl17314
568708009955	Signal peptide predicted for STM_MW22071 by SignalP 2.0 HMM (Signal peptide probability 0.896) with cleavage site probability 0.421 between residues 24 and 25
568708009956	1 probable transmembrane helix predicted for STM_MW22071 by TMHMM2.0 at aa 7-24
568708009957	GST_N family, Class Zeta subfamily; GSTs are cytosolic dimeric proteins involved in cellular detoxification by catalyzing the conjugation of glutathione (GSH) with a wide range of endogenous and xenobiotic alkylating agents, including carcinogens; Region: GST_N_Zeta; cd03042
568708009958	maleylacetoacetate isomerase; Region: maiA; TIGR01262
568708009959	C-terminal domain interface [polypeptide binding]; other site
568708009960	GSH binding site (G-site) [chemical binding]; other site
568708009961	putative dimer interface [polypeptide binding]; other site
568708009962	C-terminal, alpha helical domain of Class Zeta Glutathione S-transferases; Region: GST_C_Zeta; cd03191
568708009963	dimer interface [polypeptide binding]; other site
568708009964	N-terminal domain interface [polypeptide binding]; other site
568708009965	maleylacetoacetate (MAA) substrate binding site (H site) [chemical binding]; other site
568708009968	2-keto-4-pentenoate hydratase/2-oxohepta-3-ene-1,7-dioic acid hydratase (catechol pathway) [Secondary metabolites biosynthesis, transport, and catabolism]; Region: MhpD; COG0179
568708009969	Fumarylacetoacetate (FAA) hydrolase family; Region: FAA_hydrolase; pfam01557
568708009971	gentisate 1,2-dioxygenase; Region: gentisate_1_2; TIGR02272
568708009972	Cupin domain; Region: Cupin_2; pfam07883
568708009973	Cupin domain; Region: Cupin_2; pfam07883
568708009975	benzoate transport; Region: 2A0115; TIGR00895
568708009976	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708009977	putative substrate translocation pore; other site
568708009978	12 probable transmembrane helices predicted for STM_MW22111 by TMHMM2.0 at aa 23-45, 60-82, 89-108, 113-135, 148-170, 175-197, 253-275, 290-312, 319-338, 342-364, 385-407 and 412-434
568708009981	pca operon transcription factor PcaQ; Region: TF_pcaQ; TIGR02424
568708009982	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708009983	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
568708009984	dimerization interface [polypeptide binding]; other site
568708009987	hypothetical protein; Provisional; Region: PRK01821
568708009988	4 probable transmembrane helices predicted for STM_MW22131 by TMHMM2.0 at aa 7-29, 34-56, 63-85 and 95-117
568708009990	hypothetical protein; Provisional; Region: PRK10711
568708009991	Signal peptide predicted for STM_MW22141 by SignalP 2.0 HMM (Signal peptide probability 0.908) with cleavage site probability 0.836 between residues 23 and 24
568708009992	5 probable transmembrane helices predicted for STM_MW22141 by TMHMM2.0 at aa 5-24, 34-56, 91-113, 140-162 and 206-228
568708009994	cytidine deaminase; Provisional; Region: PRK09027
568708009995	Cytidine deaminase zinc-binding domain. These enzymes are Zn dependent. The zinc ion in the active site plays a central role in the proposed catalytic mechanism, activating a water molecule to form a hydroxide ion that performs a nucleophilic attack on...; Region: cytidine_deaminase; cd01283
568708009996	active site
568708009997	catalytic motif [active]
568708009998	Zn binding site [ion binding]; other site
568708009999	Cytidine deaminase zinc-binding domain. These enzymes are Zn dependent. The zinc ion in the active site plays a central role in the proposed catalytic mechanism, activating a water molecule to form a hydroxide ion that performs a nucleophilic attack on...; Region: cytidine_deaminase; cd01283
568708010000	active site
568708010001	catalytic motif [active]
568708010002	Zn binding site [ion binding]; other site
568708010005	YdcF-like. YdcF-like is a large family of mainly bacterial proteins, with a few members found in fungi, plants, and archaea. Escherichia coli YdcF has been shown to bind S-adenosyl-L-methionine (AdoMet), but a biochemical function has not been...; Region: YdcF-like; cd06259
568708010006	putative active site [active]
568708010007	Signal peptide predicted for STM_MW22161 by SignalP 2.0 HMM (Signal peptide probability 0.917) with cleavage site probability 0.904 between residues 22 and 23
568708010008	1 probable transmembrane helix predicted for STM_MW22161 by TMHMM2.0 at aa 5-27
568708010010	Protein of unknown function (DUF2542); Region: DUF2542; pfam10808
568708010012	2 probable transmembrane helices predicted for STM_MW22171 by TMHMM2.0 at aa 7-26 and 57-79
568708010013	dihydropyrimidine dehydrogenase subunit A; Provisional; Region: PRK11749
568708010014	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
568708010015	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
568708010018	dihydropyrimidine dehydrogenase subunit B; Validated; Region: PRK08318
568708010019	Dihydropyrimidine dehydrogenase (DHPD) FMN-binding domain.  DHPD catalyzes the first step in pyrimidine degradation: the NADPH-dependent reduction of uracil and thymine to the corresponding 5,6-dihydropyrimidines. DHPD contains two FAD, two FMN, and...; Region: DHPD_FMN; cd02940
568708010020	homodimer interface [polypeptide binding]; other site
568708010021	active site
568708010022	FMN binding site [chemical binding]; other site
568708010023	substrate binding site [chemical binding]; other site
568708010025	Branched-chain amino acid transport system / permease component; Region: BPD_transp_2; pfam02653
568708010026	Transmembrane subunit (TM) of Escherichia coli AraH and related proteins. E. coli AraH is the TM of a Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporter involved in the uptake of the monosaccharide arabinose. This group...; Region: TM_PBP1_transp_AraH_like; cd06579
568708010027	TM-ABC transporter signature motif; other site
568708010028	9 probable transmembrane helices predicted for STM_MW22201 by TMHMM2.0 at aa 20-42, 49-68, 100-122, 127-149, 179-201, 222-244, 259-281, 286-308 and 312-330
568708010030	First domain of the ATP-binding cassette component of monosaccharide transport system; Region: ABC_Carb_Monos_I; cd03216
568708010031	galactose/methyl galaxtoside transporter ATP-binding protein; Provisional; Region: PRK10982
568708010032	Walker A/P-loop; other site
568708010033	ATP binding site [chemical binding]; other site
568708010034	Q-loop/lid; other site
568708010035	ABC transporter signature motif; other site
568708010036	Walker B; other site
568708010037	D-loop; other site
568708010038	H-loop/switch region; other site
568708010039	Second domain of the ATP-binding cassette component of monosaccharide transport system; Region: ABC_Carb_Monos_II; cd03215
568708010041	methyl-galactoside ABC transporter galactose-binding periplasmic protein MglB; Provisional; Region: PRK15395
568708010042	Periplasmic glucose/galactose-binding protein (GGBP) involved in chemotaxis towards, and active transport of, glucose and galactose in various bacterial species; Region: PBP1_GGBP; cd01539
568708010043	ligand binding site [chemical binding]; other site
568708010044	calcium binding site [ion binding]; other site
568708010046	Signal peptide predicted for STM_MW22221 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.967 between residues 23 and 24
568708010047	DNA-binding transcriptional regulator GalS; Provisional; Region: PRK10401
568708010048	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
568708010049	DNA binding site [nucleotide binding]
568708010050	domain linker motif; other site
568708010051	Ligand binding domain of DNA transcription iso-repressor GalS, which is one of two regulatory proteins involved in galactose transport and metabolism; Region: PBP1_GalS_like; cd06270
568708010052	dimerization interface (closed form) [polypeptide binding]; other site
568708010053	ligand binding site [chemical binding]; other site
568708010056	Predicted membrane protein [Function unknown]; Region: COG2311
568708010057	hypothetical protein; Provisional; Region: PRK10835
568708010058	9 probable transmembrane helices predicted for STM_MW22241 by TMHMM2.0 at aa 12-34, 49-71, 83-102, 107-123, 130-152, 199-221, 233-255, 308-330 and 337-359
568708010060	Tunnelling fold (T-fold). The five known T-folds are found in five different enzymes with different functions: dihydroneopterin-triphosphate epimerase (DHNTPE), dihydroneopterin aldolase (DHNA) , GTP cyclohydrolase I (GTPCH-1),  6-pyrovoyl...; Region: TFold; cl00263
568708010061	GTP cyclohydrolase I; Provisional; Region: PLN03044
568708010062	active site
568708010064	S-formylglutathione hydrolase; Region: fghA_ester_D; TIGR02821
568708010065	S-formylglutathione hydrolase; Region: PLN02442
568708010067	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
568708010068	non-specific DNA binding site [nucleotide binding]; other site
568708010069	salt bridge; other site
568708010070	sequence-specific DNA binding site [nucleotide binding]; other site
568708010072	L-serine dehydratase, iron-sulfur-dependent, single chain form; Region: sda_mono; TIGR00720
568708010073	Serine dehydratase beta chain; Region: SDH_beta; pfam03315
568708010074	Serine dehydratase alpha chain; Region: SDH_alpha; pfam03313
568708010077	Phosphoserine phosphatase [Amino acid transport and metabolism]; Region: SerB; COG0560
568708010078	haloacid dehalogenase-like hydrolase; Region: HAD; cl17202
568708010079	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708010080	motif II; other site
568708010082	Sugar phosphate permease [Carbohydrate transport and metabolism]; Region: UhpC; COG2271
568708010083	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708010084	putative substrate translocation pore; other site
568708010085	11 probable transmembrane helices predicted for STM_MW22301 by TMHMM2.0 at aa 29-46, 69-91, 103-125, 160-182, 189-208, 240-262, 295-314, 324-343, 348-370, 385-407 and 412-434
568708010087	catecholate siderophore receptor CirA; Provisional; Region: PRK10064
568708010088	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
568708010089	N-terminal plug; other site
568708010090	ligand-binding site [chemical binding]; other site
568708010093	Signal peptide predicted for STM_MW22311 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.794 between residues 25 and 26
568708010094	lysine transporter; Provisional; Region: PRK10836
568708010096	12 probable transmembrane helices predicted for STM_MW22321 by TMHMM2.0 at aa 21-43, 53-75, 103-125, 130-152, 159-181, 196-218, 245-267, 287-309, 343-365, 369-391, 412-434 and 444-466
568708010097	Signal peptide predicted for STM_MW22321 by SignalP 2.0 HMM (Signal peptide probability 0.888) with cleavage site probability 0.755 between residues 46 and 47
568708010098	putative DNA-binding transcriptional regulator; Provisional; Region: PRK10837
568708010099	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708010100	C-terminal substrate binding domain of LysR-type transcriptional regulator CysL, which activates the transcription of the cysJI operon encoding sulfite reductase, contains the type 2 periplasmic binding fold; Region: PBP2_CysL_like; cd08420
568708010101	putative dimerization interface [polypeptide binding]; other site
568708010104	Conserved hypothetical protein 698; Region: Cons_hypoth698; cl01075
568708010105	Signal peptide predicted for STM_MW22341 by SignalP 2.0 HMM (Signal peptide probability 0.940) with cleavage site probability 0.753 between residues 40 and 41
568708010106	8 probable transmembrane helices predicted for STM_MW22341 by TMHMM2.0 at aa 13-35, 39-61, 100-122, 132-151, 163-185, 262-284, 291-313 and 323-345
568708010108	endonuclease IV; Provisional; Region: PRK01060
568708010109	AP endonuclease family 2; These endonucleases play a role in DNA repair. Cleave phosphodiester bonds at apurinic or apyrimidinic sites; the alignment also contains hexulose-6-phosphate isomerases, enzymes that catalyze the epimerization of...; Region: AP2Ec; cd00019
568708010110	AP (apurinic/apyrimidinic) site pocket; other site
568708010111	DNA interaction; other site
568708010112	Metal-binding active site; metal-binding site
568708010113	Signal peptide predicted for STM_MW22351 by SignalP 2.0 HMM (Signal peptide probability 0.985) with cleavage site probability 0.981 between residues 21 and 22
568708010115	PTS system fructose-specific transporter subunits IIBC; Provisional; Region: PRK10712
568708010116	N-terminal domain of the phosphotransferase system fructose-specific component IIB [Carbohydrate transport and metabolism]; Region: COG3925
568708010117	PTS_IIB_fructose: subunit IIB of enzyme II (EII) of the fructose-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS). In this system, EII (also referred to as FruAB) is a fructose-specific permease made up of two proteins (FruA and...; Region: PTS_IIB_fructose; cd05569
568708010118	active site
568708010119	P-loop; other site
568708010120	phosphorylation site [posttranslational modification]
568708010121	PTS system, fructose subfamily, IIC component; Region: PTS_IIC_fructo; TIGR01427
568708010122	9 probable transmembrane helices predicted for STM_MW22361 by TMHMM2.0 at aa 236-258, 271-293, 303-325, 345-367, 377-399, 412-434, 464-481, 488-508 and 528-550
568708010125	Fructose-1-phosphate kinase and related fructose-6-phosphate kinase (PfkB) [Carbohydrate transport and metabolism]; Region: FruK; COG1105
568708010126	1-phosphofructokinase (FruK), minor 6-phosphofructokinase (pfkB) and related sugar kinases. FruK plays an important role in the predominant pathway for fructose utilisation.This group also contains tagatose-6-phophate kinase, an enzyme of the tagatose...; Region: FruK_PfkB_like; cd01164
568708010127	putative substrate binding site [chemical binding]; other site
568708010128	putative ATP binding site [chemical binding]; other site
568708010130	bifunctional PTS system fructose-specific transporter subunit IIA/HPr protein; Provisional; Region: PRK11109
568708010131	PTS_IIA, PTS system, fructose/mannitol specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This...; Region: PTS_IIA_fru; cd00211
568708010132	active site
568708010133	phosphorylation site [posttranslational modification]
568708010134	Histidine-containing phosphocarrier protein (HPr)-like proteins. HPr is a central component of the bacterial phosphoenolpyruvate sugar phosphotransferase system (PTS). The PTS catalyses the phosphorylation of sugar substrates during their translocation...; Region: PTS-HPr_like; cd00367
568708010135	dimerization domain swap beta strand [polypeptide binding]; other site
568708010136	regulatory protein interface [polypeptide binding]; other site
568708010137	active site
568708010138	regulatory phosphorylation site [posttranslational modification]; other site
568708010141	sugar efflux transporter B; Provisional; Region: PRK15011
568708010142	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708010143	putative substrate translocation pore; other site
568708010144	Signal peptide predicted for STM_MW22391 by SignalP 2.0 HMM (Signal peptide probability 0.639) with cleavage site probability 0.599 between residues 32 and 33
568708010145	12 probable transmembrane helices predicted for STM_MW22391 by TMHMM2.0 at aa 20-42, 52-71, 84-101, 105-124, 145-167, 172-194, 221-243, 253-275, 282-304, 308-330, 350-367 and 371-390
568708010147	G-rich domain on putative tyrosine kinase; Region: GNVR; pfam13807
568708010148	2 probable transmembrane helices predicted for STM_MW22401 by TMHMM2.0 at aa 21-43 and 184-203
568708010149	elongation factor P; Provisional; Region: PRK04542
568708010150	Elongation factor P (EF-P) KOW-like domain; Region: EFP_N; pfam08207
568708010151	S1_EF-P_repeat_1: Translation elongation factor P (EF-P), S1-like RNA-binding domain, repeat 1. EF-P stimulates the peptidyltransferase activity in the prokaryotic 70S ribosome. EF-P enhances the synthesis of certain dipeptides with...; Region: S1_EF-P_repeat_1; cd04470
568708010152	RNA binding site [nucleotide binding]; other site
568708010153	S1_EF-P_repeat_2: Translation elongation factor P (EF-P), S1-like RNA-binding domain, repeat 1. EF-P stimulates the peptidyltransferase activity in the prokaryotic 70S ribosome. EF-P enhances the synthesis of certain dipeptides with...; Region: S1_EF-P_repeat_2; cd05794
568708010154	RNA binding site [nucleotide binding]; other site
568708010158	Putative GTPases (G3E family) [General function prediction only]; Region: COG0523
568708010159	CobW/HypB/UreG, nucleotide-binding domain; Region: cobW; pfam02492
568708010160	Cobalamin synthesis protein cobW C-terminal domain; Region: CobW_C; smart00833
568708010162	Membrane-associated phospholipid phosphatase [Lipid metabolism]; Region: PgpB; COG0671
568708010163	PAP2_like proteins, a super-family of histidine phosphatases and vanadium haloperoxidases, includes type 2 phosphatidic acid phosphatase or lipid phosphate phosphatase (LPP), Glucose-6-phosphatase, Phosphatidylglycerophosphatase B and bacterial acid...; Region: PAP2_like; cd01610
568708010164	active site
568708010165	5 probable transmembrane helices predicted for STM_MW22441 by TMHMM2.0 at aa 7-26, 64-83, 95-117, 162-184 and 191-213
568708010167	outer membrane lipoprotein; Provisional; Region: spr; PRK10838
568708010168	NlpC/P60 family; Region: NLPC_P60; pfam00877
568708010169	Signal peptide predicted for STM_MW22451 by SignalP 2.0 HMM (Signal peptide probability 0.929) with cleavage site probability 0.402 between residues 33 and 34
568708010171	phage resistance protein; Provisional; Region: PRK10551
568708010172	CSS motif domain associated with EAL; Region: CSS-motif; pfam12792
568708010173	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
568708010174	2 probable transmembrane helices predicted for STM_MW22461 by TMHMM2.0 at aa 12-34 and 236-258
568708010176	ABC-type oligopeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: OppA; COG4166
568708010177	The substrate-binding component of an uncharacterized ABC-type nickel/dipeptide/oligopeptide-like import system contains the type 2 periplasmic binding fold; Region: PBP2_NikA_DppA_OppA_like_14; cd08497
568708010178	Signal peptide predicted for STM_MW22471 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 19 and 20
568708010180	ABC-type uncharacterized transport system, permease component [General function prediction only]; Region: COG4174
568708010181	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708010182	dimer interface [polypeptide binding]; other site
568708010183	conserved gate region; other site
568708010184	putative PBP binding loops; other site
568708010185	ABC-ATPase subunit interface; other site
568708010186	6 probable transmembrane helices predicted for STM_MW22481 by TMHMM2.0 at aa 9-31, 133-155, 168-190, 224-246, 283-305 and 329-348
568708010188	microcin C ABC transporter permease; Provisional; Region: PRK15021
568708010189	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708010190	dimer interface [polypeptide binding]; other site
568708010191	conserved gate region; other site
568708010192	ABC-ATPase subunit interface; other site
568708010193	Signal peptide predicted for STM_MW22491 by SignalP 2.0 HMM (Signal peptide probability 0.788) with cleavage site probability 0.585 between residues 38 and 39
568708010194	6 probable transmembrane helices predicted for STM_MW22491 by TMHMM2.0 at aa 21-43, 142-164, 177-199, 203-222, 254-276 and 306-328
568708010196	microcin C ABC transporter ATP-binding protein YejF; Provisional; Region: PRK15134
568708010197	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
568708010198	Walker A/P-loop; other site
568708010199	ATP binding site [chemical binding]; other site
568708010200	Q-loop/lid; other site
568708010201	ABC transporter signature motif; other site
568708010202	Walker B; other site
568708010203	D-loop; other site
568708010204	H-loop/switch region; other site
568708010205	Oligopeptide/dipeptide transporter, C-terminal region; Region: oligo_HPY; pfam08352
568708010206	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
568708010207	Walker A/P-loop; other site
568708010208	ATP binding site [chemical binding]; other site
568708010209	Q-loop/lid; other site
568708010210	ABC transporter signature motif; other site
568708010211	Walker B; other site
568708010212	D-loop; other site
568708010213	H-loop/switch region; other site
568708010216	hypothetical protein; Provisional; Region: PRK11835
568708010217	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708010218	bicyclomycin/multidrug efflux system; Provisional; Region: PRK11102
568708010219	putative substrate translocation pore; other site
568708010220	12 probable transmembrane helices predicted for STM_MW22521 by TMHMM2.0 at aa 7-26, 41-63, 76-98, 102-124, 137-159, 163-185, 219-241, 251-273, 286-308, 313-332, 344-366 and 370-389
568708010222	Signal peptide predicted for STM_MW22521 by SignalP 2.0 HMM (Signal peptide probability 0.870) with cleavage site probability 0.504 between residues 25 and 26
568708010223	16S rRNA pseudouridylate synthase A; Provisional; Region: PRK10839
568708010224	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
568708010225	RNA binding surface [nucleotide binding]; other site
568708010226	Pseudouridine synthase, Escherichia coli RsuA like; Region: PseudoU_synth_RsuA; cd02553
568708010227	active site
568708010228	uracil binding [chemical binding]; other site
568708010231	DNA or RNA helicases of superfamily II [Transcription / DNA replication, recombination, and repair]; Region: SSL2; COG1061
568708010232	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
568708010233	ATP binding site [chemical binding]; other site
568708010234	putative Mg++ binding site [ion binding]; other site
568708010235	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
568708010236	nucleotide binding region [chemical binding]; other site
568708010237	ATP-binding site [chemical binding]; other site
568708010238	Ribosomal L40e family; Region: Ribosomal_L40e; cl00671
568708010241	Ribosomal L25/TL5/CTC N-terminal 5S rRNA binding domain; Region: Ribosomal_L25_TL5_CTC; cd00495
568708010242	5S rRNA interface [nucleotide binding]; other site
568708010243	CTC domain interface [polypeptide binding]; other site
568708010244	L16 interface [polypeptide binding]; other site
568708010246	2 probable transmembrane helices predicted for STM_MW22561 by TMHMM2.0 at aa 20-42 and 52-74
568708010247	Nucleoid-associated protein [General function prediction only]; Region: COG3081
568708010248	nucleoid-associated protein NdpA; Validated; Region: PRK00378
568708010250	Predicted hydrolase of alkaline phosphatase superfamily [General function prediction only]; Region: COG3083
568708010251	Domain of unknown function (DUF3413); Region: DUF3413; pfam11893
568708010252	Sulfatase; Region: Sulfatase; cl17466
568708010253	5 probable transmembrane helices predicted for STM_MW22581 by TMHMM2.0 at aa 21-43, 58-80, 85-103, 135-157 and 169-191
568708010255	SOS-response transcriptional repressors (RecA-mediated autopeptidases) [Transcription / Signal transduction mechanisms]; Region: LexA; COG1974
568708010256	Peptidase S24 LexA-like proteins are involved in the SOS response leading to the repair of single-stranded DNA within the bacterial cell. This family includes: the lambda repressor CI/C2 family and related bacterial prophage repressor proteins; LexA (EC...; Region: S24_LexA-like; cd06529
568708010257	Catalytic site [active]
568708010258	DinI-like family; Region: DinI; cl11630
568708010260	Predicted acyltransferases [Lipid metabolism]; Region: COG1835
568708010262	9 probable transmembrane helices predicted for STM_MW22611 by TMHMM2.0 at aa 12-31, 35-57, 70-92, 133-155, 162-184, 188-210, 223-245, 299-321 and 334-353
568708010263	Caudovirales tail fibre assembly protein; Region: Caudo_TAP; pfam02413
568708010265	Caudovirales tail fibre assembly protein; Region: Caudo_TAP; pfam02413
568708010267	Phage T4 tail fibre; Region: Phage_T4_gp36; pfam03903
568708010268	Phage head maturation protease [General function prediction only]; Region: COG3740
568708010270	Phage holin family (Lysis protein S); Region: Phage_holin_3; cl04938
568708010271	Phage-related protein [Function unknown]; Region: COG4695; cl01923
568708010273	2 probable transmembrane helices predicted for STM_MW22671 by TMHMM2.0 at aa 26-48 and 55-74
568708010274	pfam_scan;Pfam:PF07693; E()=3.2E-66;score=223.2;query 15-316;description=KAP_NTPase
568708010276	Phage antitermination protein Q; Region: Phage_antitermQ; pfam06530
568708010278	Protein of unknown function (DUF968); Region: DUF968; pfam06147
568708010280	E3 ubiquitin-protein ligase SspH2; Provisional; Region: PRK15387
568708010281	pathogenicity island 2 effector protein SseI; Provisional; Region: PRK15372
568708010282	Type III secretion system leucine rich repeat protein; Region: TTSSLRR; pfam12468
568708010283	Leucine-rich repeats (LRRs), ribonuclease inhibitor (RI)-like subfamily. LRRs are 20-29 residue sequence motifs present in many proteins that participate in protein-protein interactions and have different functions and cellular locations. LRRs correspond...; Region: LRR_RI; cl15309
568708010284	Leucine-rich repeats; other site
568708010285	Substrate binding site [chemical binding]; other site
568708010289	DinI-like family; Region: DinI; cl11630
568708010291	Lipid A 3-O-deacylase (PagL); Region: PagL; pfam09411
568708010293	2 probable transmembrane helices predicted for STM_MW22761 by TMHMM2.0 at aa 7-26 and 108-126
568708010294	Signal peptide predicted for STM_MW22761 by SignalP 2.0 HMM (Signal peptide probability 0.994) with cleavage site probability 0.956 between residues 20 and 21
568708010295	transcriptional regulator NarP; Provisional; Region: PRK10403
568708010296	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708010297	active site
568708010298	phosphorylation site [posttranslational modification]
568708010299	intermolecular recognition site; other site
568708010300	dimerization interface [polypeptide binding]; other site
568708010301	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
568708010302	DNA binding residues [nucleotide binding]
568708010303	dimerization interface [polypeptide binding]; other site
568708010306	Uncharacterized protein involved in biosynthesis of c-type cytochromes [Posttranslational modification, protein turnover, chaperones]; Region: CcmH; COG3088
568708010307	Cytochrome c biogenesis factor [Posttranslational modification, protein turnover, chaperones]; Region: COG4235
568708010309	3 probable transmembrane helices predicted for STM_MW22781 by TMHMM2.0 at aa 2-24, 103-125 and 150-169
568708010310	Signal peptide predicted for STM_MW22781 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.985 between residues 22 and 23
568708010311	thiol:disulfide interchange protein DsbE; Provisional; Region: PRK15412
568708010312	TlpA-like family, DsbE (also known as CcmG and CycY) subfamily; DsbE is a membrane-anchored, periplasmic TRX-like reductase containing a CXXC motif that specifically donates reducing equivalents to apocytochrome c via CcmH, another cytochrome c...; Region: TlpA_like_DsbE; cd03010
568708010313	catalytic residues [active]
568708010314	central insert; other site
568708010316	Signal peptide predicted for ATM_MW22782 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.742 between residues 30 and 31
568708010317	1 probable transmembrane helix predicted for ATM_MW22782 by TMHMM2.0 at aa 5-24
568708010318	c-type cytochrome biogenesis protein CcmF; Region: nrfE; TIGR00353
568708010319	15 probable transmembrane helices predicted for STM_MW22783 by TMHMM2.0 at aa 5-27, 40-62, 95-114, 121-143, 176-198, 211-233, 248-265, 277-299, 314-332, 353-375, 390-412, 425-444, 449-468, 481-503 and 610-629
568708010321	cytochrome c-type biogenesis protein CcmE; Reviewed; Region: PRK13150
568708010323	Signal peptide predicted for STM_MW22784 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.877 between residues 29 and 30
568708010324	1 probable transmembrane helix predicted for STM_MW22784 by TMHMM2.0 at aa 7-29
568708010325	heme exporter protein CcmC; Region: ccmC; TIGR01191
568708010327	6 probable transmembrane helices predicted for STM_MW22785 by TMHMM2.0 at aa 24-46, 66-88, 95-117, 132-151, 158-180 and 207-229
568708010328	heme exporter protein CcmB; Region: ccmB; TIGR01190
568708010330	6 probable transmembrane helices predicted for STM_MW22786 by TMHMM2.0 at aa 20-39, 43-65, 96-118, 128-150, 157-179 and 194-216
568708010331	cytochrome c biogenesis protein CcmA; Provisional; Region: PRK13538
568708010332	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
568708010333	Walker A/P-loop; other site
568708010334	ATP binding site [chemical binding]; other site
568708010335	Q-loop/lid; other site
568708010336	ABC transporter signature motif; other site
568708010337	Walker B; other site
568708010338	D-loop; other site
568708010339	H-loop/switch region; other site
568708010341	cytochrome c-type protein NapC; Provisional; Region: PRK10617
568708010342	Nitrate/TMAO reductases, membrane-bound tetraheme cytochrome c subunit [Energy production and conversion]; Region: TorC; COG3005
568708010344	1 probable transmembrane helix predicted for STM_MW22801 by TMHMM2.0 at aa 21-43
568708010345	nitrate reductase cytochrome C550 subunit; Provisional; Region: napB; PRK11586
568708010347	Signal peptide predicted for STM_MW22811 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 27 and 28
568708010348	quinol dehydrogenase membrane component; Provisional; Region: napH; PRK09477
568708010349	4Fe-4S binding domain; Region: Fer4_5; pfam12801
568708010350	The HCP family of iron-sulfur proteins includes hybrid cluster protein (HCP), acetyl-CoA synthase (ACS), and carbon monoxide dehydrogenase (CODH), all of which contain [Fe4-S4] metal clusters at their active sites. These proteins have a conserved...; Region: HCP_like; cl14655
568708010351	4 probable transmembrane helices predicted for STM_MW22821 by TMHMM2.0 at aa 33-55, 75-97, 138-160 and 170-192
568708010352	quinol dehydrogenase periplasmic component; Provisional; Region: napG; PRK09476
568708010354	Signal peptide predicted for STM_MW22831 by SignalP 2.0 HMM (Signal peptide probability 0.733) with cleavage site probability 0.366 between residues 41 and 42
568708010355	nitrate reductase catalytic subunit; Provisional; Region: PRK13532
568708010356	Nitrate reductases, NapA (Nitrate-R-NapA), NasA, and NarB catalyze the reduction of nitrate to nitrite. Monomeric Nas is located in the cytoplasm and participates in nitrogen assimilation. Dimeric Nap is located in the periplasm and is coupled to quinol...; Region: MopB_Nitrate-R-NapA-like; cd02754
568708010357	[4Fe-4S] binding site [ion binding]; other site
568708010358	molybdopterin cofactor binding site; other site
568708010359	Nitrate reductases, NapA (Nitrate-R-NapA), NasA, and NarB catalyze the reduction of nitrate to nitrite. Monomeric Nas is located in the cytoplasm and participates in nitrogen assimilation. Dimeric Nap is located in the periplasm and is coupled to quinol...; Region: MopB_CT_Nitrate-R-NapA-like; cd02791
568708010360	molybdopterin cofactor binding site; other site
568708010364	Signal peptide predicted for STM_MW22841 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.977 between residues 31 and 32
568708010365	assembly protein for periplasmic nitrate reductase; Provisional; Region: PRK10553
568708010367	ferredoxin-type protein; Provisional; Region: PRK10194
568708010368	4Fe-4S binding domain; Region: Fer4; cl02805
568708010370	Protease Inhibitor Ecotin; homodimeric protease inhibitor; Region: Ecotin; cd00242
568708010371	secondary substrate binding site; other site
568708010372	primary substrate binding site; other site
568708010373	inhibition loop; other site
568708010374	dimerization interface [polypeptide binding]; other site
568708010375	Signal peptide predicted for STM_MW22871 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 20 and 21
568708010377	multidrug transporter membrane component/ATP-binding component; Provisional; Region: PRK10522
568708010378	ATP-binding cassette domain of multidrug resistance protein-like transporters; Region: ABCC_MRP_Like; cd03228
568708010379	Walker A/P-loop; other site
568708010380	ATP binding site [chemical binding]; other site
568708010381	Q-loop/lid; other site
568708010382	ABC transporter signature motif; other site
568708010383	Walker B; other site
568708010384	D-loop; other site
568708010385	H-loop/switch region; other site
568708010386	6 probable transmembrane helices predicted for STM_MW22881 by TMHMM2.0 at aa 15-37, 50-72, 120-142, 149-171, 238-260 and 272-294
568708010388	Signal peptide predicted for STM_MW22881 by SignalP 2.0 HMM (Signal peptide probability 0.714) with cleavage site probability 0.503 between residues 29 and 30
568708010389	alpha-ketoglutarate-dependent dioxygenase AlkB; Provisional; Region: PRK15401
568708010390	bifunctional DNA-binding transcriptional dual regulator/O6-methylguanine-DNA methyltransferase; Provisional; Region: PRK15435
568708010391	Metal binding domain of Ada; Region: Ada_Zn_binding; pfam02805
568708010392	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708010393	6-O-methylguanine DNA methyltransferase, ribonuclease-like domain; Region: Methyltransf_1N; pfam02870
568708010394	The DNA repair protein O6-alkylguanine-DNA alkyltransferase (ATase; also known as AGT, AGAT and MGMT) reverses O6-alkylation DNA damage by transferring O6-alkyl adducts to an active site cysteine irreversibly, without inducing DNA strand breaks. ATases...; Region: ATase; cd06445
568708010395	DNA binding site [nucleotide binding]
568708010396	active site
568708010401	thiamine biosynthesis lipoprotein ApbE; Provisional; Region: PRK10461
568708010402	ApbE family; Region: ApbE; pfam02424
568708010404	Signal peptide predicted for STM_MW22911 by SignalP 2.0 HMM (Signal peptide probability 0.969) with cleavage site probability 0.796 between residues 19 and 20
568708010405	Porin superfamily.  These outer membrane channels share a beta-barrel structure that differ in strand and shear number.  Classical (gram-negative ) porins are non-specific channels for small hydrophillic molecules and form 16 beta-stranded barrels (16,20)...; Region: OM_channels; cl17244
568708010406	Outer membrane protein (porin) [Cell envelope biogenesis, outer membrane]; Region: OmpC; COG3203
568708010408	phosphotransfer intermediate protein in two-component regulatory system with RcsBC; Provisional; Region: PRK10618
568708010409	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708010410	ATP binding site [chemical binding]; other site
568708010411	G-X-G motif; other site
568708010412	Histidine Phosphotransfer domain, involved in signalling through a two part component systems in which an autophosphorylating histidine protein kinase serves as a phosphoryl donor to a response regulator protein; the response regulator protein is...; Region: HPT; cd00088
568708010413	putative binding surface; other site
568708010414	active site
568708010415	Signal peptide predicted for STM_MW22931 by SignalP 2.0 HMM (Signal peptide probability 0.980) with cleavage site probability 0.489 between residues 40 and 41
568708010416	2 probable transmembrane helices predicted for STM_MW22931 by TMHMM2.0 at aa 20-42 and 308-330
568708010419	transcriptional regulator RcsB; Provisional; Region: PRK10840
568708010420	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708010421	active site
568708010422	phosphorylation site [posttranslational modification]
568708010423	intermolecular recognition site; other site
568708010424	dimerization interface [polypeptide binding]; other site
568708010425	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
568708010426	DNA binding residues [nucleotide binding]
568708010427	dimerization interface [polypeptide binding]; other site
568708010430	hybrid sensory kinase in two-component regulatory system with RcsB and YojN; Provisional; Region: PRK10841
568708010431	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
568708010432	dimer interface [polypeptide binding]; other site
568708010433	phosphorylation site [posttranslational modification]
568708010434	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708010435	ATP binding site [chemical binding]; other site
568708010436	Mg2+ binding site [ion binding]; other site
568708010437	G-X-G motif; other site
568708010438	RcsC Alpha-Beta-Loop (ABL); Region: RcsC; pfam09456
568708010439	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708010440	active site
568708010441	phosphorylation site [posttranslational modification]
568708010442	intermolecular recognition site; other site
568708010443	dimerization interface [polypeptide binding]; other site
568708010446	2 probable transmembrane helices predicted for STM_MW22951 by TMHMM2.0 at aa 20-42 and 314-333
568708010449	Signal peptide predicted for STM_MW22951 by SignalP 2.0 HMM (Signal peptide probability 0.907) with cleavage site probability 0.300 between residues 32 and 33
568708010450	DNA gyrase subunit A; Validated; Region: PRK05560
568708010451	DNA Topoisomerase, subtype IIA; domain A'; bacterial DNA topoisomerase IV (C subunit, ParC), bacterial DNA gyrases (A subunit, GyrA),mammalian DNA toposiomerases II. DNA topoisomerases are essential enzymes that regulate the conformational changes...; Region: TOP4c; cd00187
568708010452	CAP-like domain; other site
568708010453	active site
568708010454	primary dimer interface [polypeptide binding]; other site
568708010455	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
568708010456	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
568708010457	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
568708010458	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
568708010459	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
568708010460	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
568708010463	L-alanine-DL-glutamate epimerase and related enzymes of enolase superfamily [Cell envelope biogenesis, outer membrane / General function prediction only]; Region: COG4948
568708010464	Mandelate racemase (MR)-like subfamily of the enolase superfamily. Enzymes of this subgroup share three conserved carboxylate ligands for the essential divalent metal ion (usually Mg2+), two aspartates and a glutamate, and conserved catalytic residues; Region: MR_like; cd03316
568708010465	active site pocket [active]
568708010468	4-hydroxyphenylacetate permease; Region: HpaX; TIGR02332
568708010469	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708010470	putative substrate translocation pore; other site
568708010471	12 probable transmembrane helices predicted for STM_MW22981 by TMHMM2.0 at aa 20-42, 55-77, 84-103, 109-131, 144-166, 176-198, 247-269, 284-306, 315-334, 339-361, 368-390 and 400-422
568708010473	Transcriptional regulators [Transcription]; Region: GntR; COG1802
568708010474	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
568708010475	DNA-binding site [nucleotide binding]; DNA binding site
568708010476	FCD domain; Region: FCD; pfam07729
568708010479	bifunctional 3-demethylubiquinone-9 3-methyltransferase/ 2-octaprenyl-6-hydroxy phenol methylase; Provisional; Region: PRK05134
568708010480	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708010481	S-adenosylmethionine binding site [chemical binding]; other site
568708010483	ribonucleotide-diphosphate reductase subunit alpha; Validated; Region: PRK09103
568708010484	ATP cone domain; Region: ATP-cone; pfam03477
568708010485	Class I ribonucleotide reductase; Region: RNR_I; cd01679
568708010486	active site
568708010487	dimer interface [polypeptide binding]; other site
568708010488	catalytic residues [active]
568708010489	effector binding site; other site
568708010490	R2 peptide binding site; other site
568708010494	Ribonucleotide Reductase, R2/beta subunit, ferritin-like diiron-binding domain; Region: RNRR2; cd01049
568708010495	dimer interface [polypeptide binding]; other site
568708010496	putative radical transfer pathway; other site
568708010497	diiron center [ion binding]; other site
568708010498	tyrosyl radical; other site
568708010500	Ferredoxin [Energy production and conversion]; Region: Fdx; COG0633
568708010501	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
568708010502	catalytic loop [active]
568708010503	iron binding site [ion binding]; other site
568708010505	Major Facilitator Superfamily; Region: MFS_1; pfam07690
568708010506	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708010507	putative substrate translocation pore; other site
568708010509	12 probable transmembrane helices predicted for STM_MW23041 by TMHMM2.0 at aa 13-35, 45-64, 76-95, 100-122, 135-154, 164-186, 212-234, 239-261, 273-290, 295-317, 330-352 and 357-379
568708010510	DNA-binding transcriptional regulator CynR; Provisional; Region: PRK11242
568708010511	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708010512	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
568708010513	dimerization interface [polypeptide binding]; other site
568708010516	glycerophosphodiester phosphodiesterase; Provisional; Region: glpQ; PRK11143
568708010517	Glycerophosphodiester phosphodiesterase domain of Escherichia coli (GlpQ) and similar proteins; Region: GDPD_EcGlpQ_like; cd08600
568708010518	active site
568708010519	catalytic site [active]
568708010520	metal binding site [ion binding]; metal-binding site
568708010522	1 probable transmembrane helix predicted for STM_MW23061 by TMHMM2.0 at aa 7-26
568708010523	Signal peptide predicted for STM_MW23061 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.882 between residues 25 and 26
568708010524	sn-glycerol-3-phosphate transporter; Provisional; Region: glpT; PRK11273
568708010525	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708010526	putative substrate translocation pore; other site
568708010527	12 probable transmembrane helices predicted for STM_MW23071 by TMHMM2.0 at aa 28-45, 65-87, 94-116, 120-142, 161-183, 188-207, 254-273, 293-312, 319-341, 351-373, 386-408 and 418-437
568708010529	sn-glycerol-3-phosphate dehydrogenase subunit A; Provisional; Region: glpA; PRK11101
568708010530	hydroxyglutarate oxidase; Provisional; Region: PRK11728
568708010531	BFD-like [2Fe-2S] binding domain; Region: Fer2_BFD; pfam04324
568708010534	Anaerobic glycerol-3-phosphate dehydrogenase [Amino acid transport and metabolism]; Region: GlpB; COG3075
568708010535	anaerobic glycerol-3-phosphate dehydrogenase subunit B; Validated; Region: PRK05329
568708010537	glycerol-3-phosphate dehydrogenase, anaerobic, C subunit; Region: glycerol3P_GlpC; TIGR03379
568708010538	The HCP family of iron-sulfur proteins includes hybrid cluster protein (HCP), acetyl-CoA synthase (ACS), and carbon monoxide dehydrogenase (CODH), all of which contain [Fe4-S4] metal clusters at their active sites. These proteins have a conserved...; Region: HCP_like; cl14655
568708010539	Cysteine-rich domain; Region: CCG; pfam02754
568708010540	Cysteine-rich domain; Region: CCG; pfam02754
568708010542	deubiquitinase SseL; Provisional; Region: PRK14848
568708010543	hypothetical protein; Provisional; Region: PRK03673
568708010544	2-keto-3-deoxy-L-rhamnonate aldolase; Provisional; Region: PRK10128
568708010546	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708010547	D-galactonate transporter; Region: 2A0114; TIGR00893
568708010548	putative substrate translocation pore; other site
568708010549	12 probable transmembrane helices predicted for STM_MW23141 by TMHMM2.0 at aa 13-30, 52-74, 79-101, 107-129, 142-164, 174-196, 241-263, 273-295, 308-325, 329-351, 358-380 and 395-417
568708010551	L-rhamnonate dehydratase; Provisional; Region: PRK15440
568708010552	Mandelate racemase (MR)-like subfamily of the enolase superfamily, subgroup 2. Enzymes of this subgroup share three conserved carboxylate ligands for the essential divalent metal ion (usually Mg2+), two aspartates and a glutamate, and conserved catalytic...; Region: MR_like_2; cd03327
568708010553	putative active site pocket [active]
568708010554	putative metal binding site [ion binding]; other site
568708010557	helix_turn_helix isocitrate lyase regulation; Region: HTH_ICLR; smart00346
568708010558	Transcriptional regulator [Transcription]; Region: IclR; COG1414
568708010559	Bacterial transcriptional regulator; Region: IclR; pfam01614
568708010562	hypothetical protein; Provisional; Region: PRK03673
568708010563	Competence-damaged protein. CinA is the first gene in the competence- inducible (cin) operon and is thought to be specifically required at some stage in the process of transformation. This domain is closely related to a domain, found in a variety of...; Region: cinA; cd00885
568708010564	putative MPT binding site; other site
568708010565	Competence-damaged protein; Region: CinA; cl00666
568708010567	YfaZ precursor; Region: YfaZ; pfam07437
568708010568	outer membrane protein; Region: OMP_w_GlyGly; TIGR04219
568708010570	nucleoside triphosphatase NudI; Provisional; Region: PRK15472
568708010572	Histidine phosphatase domain found in a functionally diverse set of proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP; cd07040
568708010573	catalytic core [active]
568708010575	1 probable transmembrane helix predicted for STM_MW23201 by TMHMM2.0 at aa 13-35
568708010576	Signal peptide predicted for STM_MW23201 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.614 between residues 33 and 34
568708010577	Predicted pyridoxal phosphate-dependent enzyme apparently involved in regulation of cell wall biogenesis [Cell envelope biogenesis, outer membrane]; Region: WecE; COG0399
568708010578	3-amino-5-hydroxybenzoic acid synthase family (AHBA_syn). AHBA_syn family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The members of this CD are involved in various biosynthetic pathways for secondary...; Region: AHBA_syn; cd00616
568708010579	inhibitor-cofactor binding pocket; inhibition site
568708010580	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708010581	catalytic residue [active]
568708010583	undecaprenyl phosphate 4-deoxy-4-formamido-L-arabinose transferase; Provisional; Region: PRK10714
568708010584	Bacterial DPM1_like enzymes are related to eukaryotic DPM1; Region: DPM1_like_bac; cd04187
568708010585	Ligand binding site; other site
568708010586	Putative Catalytic site; other site
568708010587	DXD motif; other site
568708010589	2 probable transmembrane helices predicted for STM_MW23221 by TMHMM2.0 at aa 235-257 and 272-294
568708010590	bifunctional UDP-glucuronic acid decarboxylase/UDP-4-amino-4-deoxy-L-arabinose formyltransferase; Validated; Region: PRK08125
568708010591	Formyltransferase, catalytic core domain; Region: FMT_core; cl00395
568708010592	active site
568708010593	substrate binding site [chemical binding]; other site
568708010594	cosubstrate binding site; other site
568708010595	catalytic site [active]
568708010596	C-terminal subdomain of the formyltransferase domain on ArnA, which modifies lipid A with 4-amino-4-deoxy-l-arabinose; Region: Arna_FMT_C; cd08702
568708010597	active site
568708010598	hexamer interface [polypeptide binding]; other site
568708010599	Arna decarboxylase_like, extended (e) SDRs; Region: Arna_like_SDR_e; cd05257
568708010600	NAD binding site [chemical binding]; other site
568708010601	substrate binding site [chemical binding]; other site
568708010602	active site
568708010606	4-deoxy-4-formamido-L-arabinose-phosphoundecaprenol deformylase ArnD; Provisional; Region: PRK15394
568708010607	Catalytic domain of Escherichia coli 4-deoxy-4-formamido-L-arabinose-phosphoundecaprenol deformylase ArnD and other bacterial homologs; Region: CE4_ArnD; cd10939
568708010608	putative active site [active]
568708010609	putative catalytic site [active]
568708010610	putative Zn binding site [ion binding]; other site
568708010612	4-amino-4-deoxy-L-arabinose transferase; Provisional; Region: arnT; PRK13279
568708010613	4-amino-4-deoxy-L-arabinose transferase and related glycosyltransferases of PMT family [Cell envelope biogenesis, outer membrane]; Region: ArnT; COG1807
568708010615	12 probable transmembrane helices predicted for STM_MW23251 by TMHMM2.0 at aa 7-29, 82-104, 113-135, 139-156, 163-185, 205-227, 258-280, 290-307, 314-331, 346-368, 381-400 and 405-424
568708010616	4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnE; Provisional; Region: PRK15051
568708010618	3 probable transmembrane helices predicted for STM_MW23261 by TMHMM2.0 at aa 36-58, 63-85 and 92-110
568708010619	4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnF; Provisional; Region: PRK02971
568708010620	Signal peptide predicted for STM_MW23271 by SignalP 2.0 HMM (Signal peptide probability 0.940) with cleavage site probability 0.916 between residues 31 and 32
568708010621	4 probable transmembrane helices predicted for STM_MW23271 by TMHMM2.0 at aa 5-27, 42-64, 71-90 and 100-122
568708010622	signal transduction protein PmrD; Provisional; Region: PRK15450
568708010624	O-succinylbenzoic acid--CoA ligase; Provisional; Region: PRK09029
568708010625	O-succinylbenzoate-CoA ligase (also known as O-succinylbenzoate-CoA synthase, OSB-CoA synthetase, or MenE); Region: OSB_CoA_lg; cd05912
568708010626	acyl-activating enzyme (AAE) consensus motif; other site
568708010627	putative AMP binding site [chemical binding]; other site
568708010628	putative active site [active]
568708010629	putative CoA binding site [chemical binding]; other site
568708010631	O-succinylbenzoate synthase [Coenzyme metabolism]; Region: MenC; COG1441
568708010632	o-Succinylbenzoate synthase (OSBS) catalyzes the conversion of 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate (SHCHC) to 4-(2'-carboxyphenyl)-4-oxobutyrate (o-succinylbenzoate or OSB), a reaction in the menaquinone biosynthetic pathway; Region: OSBS; cd03320
568708010633	active site
568708010635	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
568708010636	Enoyl-CoA hydratase/isomerase family; Region: ECH; pfam00378
568708010637	substrate binding site [chemical binding]; other site
568708010638	oxyanion hole (OAH) forming residues; other site
568708010639	trimer interface [polypeptide binding]; other site
568708010641	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase; Provisional; Region: PRK11126
568708010643	2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1- carboxylate synthase; Validated; Region: PRK07449
568708010644	Pyrimidine (PYR) binding domain of 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexadiene-1- carboxylate synthase (MenD) and related proteins; Region: TPP_PYR_MenD; cd07037
568708010645	dimer interface [polypeptide binding]; other site
568708010646	tetramer interface [polypeptide binding]; other site
568708010647	PYR/PP interface [polypeptide binding]; other site
568708010648	TPP binding site [chemical binding]; other site
568708010649	Thiamine pyrophosphate (TPP) family, SHCHC synthase subfamily, TPP-binding module; composed of proteins similar to Escherichia coli 2-succinyl-6-hydroxyl-2,4-cyclohexadiene-1-carboxylic acid (SHCHC) synthase (also called MenD). SHCHC synthase plays a key...; Region: TPP_SHCHC_synthase; cd02009
568708010650	TPP-binding site; other site
568708010653	menaquinone-specific isochorismate synthase; Provisional; Region: PRK15012
568708010654	isochorismate synthases; Region: isochor_syn; TIGR00543
568708010656	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
568708010657	Coenzyme A binding pocket [chemical binding]; other site
568708010659	ribonuclease BN; Region: true_RNase_BN; TIGR02649
568708010661	Chemotaxis signal transduction protein [Cell motility and secretion / Signal transduction mechanisms]; Region: CheW; COG0835
568708010662	FOG: CheY-like receiver [Signal transduction mechanisms]; Region: CheY; COG0784
568708010663	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708010664	active site
568708010665	phosphorylation site [posttranslational modification]
568708010666	intermolecular recognition site; other site
568708010667	dimerization interface [polypeptide binding]; other site
568708010670	von Willebrand factor; Region: vWF_A; pfam12450
568708010671	Uncharacterized protein containing a von Willebrand factor type A (vWA) domain [General function prediction only]; Region: COG2304
568708010672	VWA subgroup: Von Willebrand factor type A (vWA) domain was originally found in the blood coagulation protein von Willebrand factor (vWF). Typically, the vWA domain is made up of approximately 200 amino acid residues folded into a classic a/b...; Region: vWA_subgroup; cd01465
568708010673	metal ion-dependent adhesion site (MIDAS); other site
568708010674	Domain of unknown function (DUF3520); Region: DUF3520; pfam12034
568708010676	NADH:ubiquinone oxidoreductase subunit N; Provisional; Region: PRK05777
568708010677	NADH-Ubiquinone/plastoquinone (complex I), various chains; Region: Oxidored_q1; pfam00361
568708010678	11 probable transmembrane helices predicted for STM_MW23391 by TMHMM2.0 at aa 12-34, 65-87, 99-121, 141-163, 176-198, 208-230, 237-259, 269-291, 311-333, 348-370 and 390-412
568708010680	NADH:ubiquinone oxidoreductase subunit M; Reviewed; Region: PRK05846
568708010681	NADH-Ubiquinone/plastoquinone (complex I), various chains; Region: Oxidored_q1; pfam00361
568708010682	14 probable transmembrane helices predicted for STM_MW23401 by TMHMM2.0 at aa 4-18, 30-49, 81-103, 115-134, 139-161, 174-196, 222-244, 251-273, 288-307, 314-336, 341-363, 384-406, 416-438 and 459-481
568708010684	NADH:ubiquinone oxidoreductase subunit L; Reviewed; Region: PRK06590
568708010685	NADH-Ubiquinone oxidoreductase (complex I), chain 5 N-terminus; Region: Oxidored_q1_N; pfam00662
568708010686	NADH-Ubiquinone/plastoquinone (complex I), various chains; Region: Oxidored_q1; pfam00361
568708010687	16 probable transmembrane helices predicted for STM_MW23411 by TMHMM2.0 at aa 4-21, 28-50, 84-106, 113-132, 136-158, 171-193, 213-235, 248-267, 277-299, 306-328, 332-354, 375-397, 412-434, 455-477, 492-514 and 590-612
568708010690	Signal peptide predicted for STM_MW23411 by SignalP 2.0 HMM (Signal peptide probability 0.948) with cleavage site probability 0.565 between residues 26 and 27
568708010691	NADH:ubiquinone oxidoreductase subunit J; Provisional; Region: PRK06638
568708010692	NADH dehydrogenase subunit J; Provisional; Region: PRK06433
568708010694	5 probable transmembrane helices predicted for STM_MW23421 by TMHMM2.0 at aa 4-22, 29-51, 56-78, 91-113 and 133-155
568708010695	NADH dehydrogenase subunit I; Provisional; Region: PRK05888
568708010696	4Fe-4S binding domain; Region: Fer4; pfam00037
568708010697	4Fe-4S binding domain; Region: Fer4; pfam00037
568708010699	NADH:ubiquinone oxidoreductase subunit H; Provisional; Region: PRK06076
568708010700	9 probable transmembrane helices predicted for STM_MW23441 by TMHMM2.0 at aa 13-35, 50-69, 81-103, 113-135, 155-174, 184-206, 235-257, 267-289 and 302-324
568708010702	NADH dehydrogenase/NADH:ubiquinone oxidoreductase 75 kD subunit (chain G) [Energy production and conversion]; Region: NuoG; COG1034
568708010703	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
568708010704	catalytic loop [active]
568708010705	iron binding site [ion binding]; other site
568708010706	NADH-ubiquinone oxidoreductase-G iron-sulfur binding region; Region: NADH-G_4Fe-4S_3; pfam10588
568708010707	MopB_NDH-1_NuoG2-N7: The second domain of the NuoG subunit (with a [4Fe-4S] cluster, N7) of the NADH-quinone oxidoreductase/NADH dehydrogenase-1 (NDH-1) found in various bacteria. The NDH-1 is the first energy-transducting complex in the respiratory...; Region: MopB_NDH-1_NuoG2-N7; cd02771
568708010708	[4Fe-4S] binding site [ion binding]; other site
568708010709	MopB_CT_NDH-1_NuoG2-N7: C-terminal region of the NuoG-like subunit (of the variant with a [4Fe-4S] cluster, N7) of the NADH-quinone oxidoreductase/NADH dehydrogenase-1 (NDH-1) found in various bacteria. The NDH-1 is the first energy-transducting complex...; Region: MopB_CT_NDH-1_NuoG2-N7; cd02788
568708010715	NADH dehydrogenase I subunit F; Provisional; Region: PRK11278
568708010716	SLBB domain; Region: SLBB; pfam10531
568708010717	NADH-ubiquinone oxidoreductase-F iron-sulfur binding region; Region: NADH_4Fe-4S; pfam10589
568708010721	NADH dehydrogenase subunit E; Validated; Region: PRK07539
568708010722	TRX-like [2Fe-2S] Ferredoxin (Fd) family, NADH:ubiquinone oxidoreductase (Nuo) subunit E subfamily; Nuo, also called respiratory chain Complex 1, is the entry point for electrons into the respiratory chains of bacteria and the mitochondria of eukaryotes; Region: TRX_Fd_NuoE; cd03064
568708010723	putative dimer interface [polypeptide binding]; other site
568708010724	[2Fe-2S] cluster binding site [ion binding]; other site
568708010726	bifunctional NADH:ubiquinone oxidoreductase subunit C/D; Provisional; Region: PRK11742
568708010727	NADH (or F420H2) dehydrogenase, subunit C; Region: NuoC_fam; TIGR01961
568708010728	NADH dehydrogenase subunit D; Validated; Region: PRK06075
568708010731	NADH:ubiquinone oxidoreductase 20 kD subunit and related Fe-S oxidoreductases [Energy production and conversion]; Region: NuoB; COG0377
568708010733	NADH:ubiquinone oxidoreductase subunit A; Validated; Region: PRK06602
568708010735	3 probable transmembrane helices predicted for STM_MW23501 by TMHMM2.0 at aa 15-37, 68-90 and 100-122
568708010736	DNA-binding transcriptional repressor LrhA; Provisional; Region: PRK15092
568708010737	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708010738	The C-terminal substrate domain of LysR-like regulator LrhA (LysR homologue A) and that of closely related homologs, contains the type 2 periplasmic binding fold; Region: PBP2_LrhA_like; cd08439
568708010739	putative dimerization interface [polypeptide binding]; other site
568708010742	aminotransferase AlaT; Validated; Region: PRK09265
568708010743	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
568708010744	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708010745	homodimer interface [polypeptide binding]; other site
568708010746	catalytic residue [active]
568708010748	5'-nucleotidase; Provisional; Region: PRK03826
568708010750	Permease SLC13 (solute carrier 13).  The sodium/dicarboxylate cotransporter NaDC-1 has been shown to translocate Krebs cycle intermediates such as succinate, citrate, and alpha-ketoglutarate across plasma membranes rabbit, human, and rat kidney. It is...; Region: SLC13_permease; cd01115
568708010751	transmembrane helices; other site
568708010752	Di- and tricarboxylate transporters [Inorganic ion transport and metabolism]; Region: CitT; COG0471
568708010753	TrkA-C domain; Region: TrkA_C; pfam02080
568708010754	TrkA-C domain; Region: TrkA_C; pfam02080
568708010755	Permease SLC13 (solute carrier 13).  The sodium/dicarboxylate cotransporter NaDC-1 has been shown to translocate Krebs cycle intermediates such as succinate, citrate, and alpha-ketoglutarate across plasma membranes rabbit, human, and rat kidney. It is...; Region: SLC13_permease; cd01115
568708010756	11 probable transmembrane helices predicted for STM_MW23551 by TMHMM2.0 at aa 5-22, 29-51, 61-83, 96-118, 138-160, 173-195, 427-449, 462-480, 500-522, 542-564 and 584-606
568708010759	Signal peptide predicted for STM_MW23551 by SignalP 2.0 HMM (Signal peptide probability 0.836) with cleavage site probability 0.754 between residues 20 and 21
568708010760	putative phosphatase; Provisional; Region: PRK11587
568708010761	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708010762	motif II; other site
568708010764	hypothetical protein; Validated; Region: PRK05445
568708010766	hypothetical protein; Provisional; Region: PRK01816
568708010768	2 probable transmembrane helices predicted for STM_MW23581 by TMHMM2.0 at aa 46-65 and 69-91
568708010769	propionate/acetate kinase; Provisional; Region: PRK12379
568708010770	acetate kinase A/propionate kinase 2; Reviewed; Region: PRK00180
568708010772	phosphate acetyltransferase; Reviewed; Region: PRK05632
568708010773	The Fer4_NifH superfamily contains a variety of proteins which share a common ATP-binding domain. Functionally, proteins in this superfamily use the energy from hydrolysis of NTP to transfer electron or ion; Region: Fer4_NifH; cl17203
568708010774	DRTGG domain; Region: DRTGG; pfam07085
568708010775	phosphate acetyltransferase; Region: pta; TIGR00651
568708010778	hypothetical protein; Provisional; Region: PRK11588
568708010779	C4-dicarboxylate anaerobic carrier; Region: DcuC; pfam03606
568708010781	11 probable transmembrane helices predicted for STM_MW23611 by TMHMM2.0 at aa 19-41, 106-127, 148-165, 175-197, 204-226, 230-252, 287-309, 314-336, 349-371, 398-415 and 481-503
568708010782	Transketolase, C-terminal subunit [Carbohydrate transport and metabolism]; Region: COG3958
568708010783	Pyrimidine (PYR) binding domain of 1-deoxy-D-xylulose-5-phosphate synthase (DXS), transketolase (TK), and related proteins; Region: TPP_PYR_DXS_TK_like; cd07033
568708010784	PYR/PP interface [polypeptide binding]; other site
568708010785	dimer interface [polypeptide binding]; other site
568708010786	TPP binding site [chemical binding]; other site
568708010787	Transketolase, C-terminal domain; Region: Transketolase_C; pfam02780
568708010790	Thiamine pyrophosphate (TPP) family, Transketolase (TK) subfamily, TPP-binding module; TK catalyzes the transfer of a two-carbon unit from ketose phosphates to aldose phosphates. In heterotrophic organisms, TK provides a link between glycolysis and the...; Region: TPP_TK; cd02012
568708010791	TPP-binding site [chemical binding]; other site
568708010792	dimer interface [polypeptide binding]; other site
568708010794	PTS system ascorbate-specific transporter subunit IIC; Reviewed; Region: ulaA; PRK12996
568708010796	11 probable transmembrane helices predicted for STM_MW23641 by TMHMM2.0 at aa 10-32, 39-61, 95-114, 121-143, 147-169, 226-243, 258-280, 310-332, 342-364, 377-399 and 423-445
568708010797	PTS_IIB_ascorbate: subunit IIB of enzyme II (EII) of the L-ascorbate-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS). In this system, EII is an L-ascorbate-specific permease with two cytoplasmic subunits (IIA and IIB) and a...; Region: PTS_IIB_ascorbate; cd05563
568708010798	active site
568708010799	P-loop; other site
568708010800	phosphorylation site [posttranslational modification]
568708010802	PTS_IIA, PTS system, fructose/mannitol specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This...; Region: PTS_IIA_fru; cd00211
568708010803	active site
568708010804	phosphorylation site [posttranslational modification]
568708010806	Transcriptional regulators [Transcription]; Region: PurR; COG1609
568708010807	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
568708010808	DNA binding site [nucleotide binding]
568708010809	Ligand-binding domain of DNA transcription repressor GntR specific for gluconate, a member of the LacI-GalR family of bacterial transcription regulators; Region: PBP1_GntR; cd01575
568708010810	putative dimerization interface [polypeptide binding]; other site
568708010811	putative ligand binding site [chemical binding]; other site
568708010814	NUDIX hydrolase YfcD; Provisional; Region: PRK15393
568708010815	Members of the Nudix hydrolase superfamily catalyze the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+, for their activity and contain a highly...; Region: Nudix_Hydrolase_38; cd04697
568708010816	nudix motif; other site
568708010818	Escherichia coli YfcE and related proteins, metallophosphatase domain; Region: MPP_YfcE; cd00841
568708010819	active site
568708010820	metal binding site [ion binding]; metal-binding site
568708010821	homotetramer interface [polypeptide binding]; other site
568708010823	glutathione S-transferase; Provisional; Region: PRK15113
568708010824	Glutathione S-transferase (GST) family, N-terminal domain; a large, diverse group of cytosolic dimeric proteins involved in cellular detoxification by catalyzing the conjugation of  glutathione (GSH) with a wide range of endogenous and xenobiotic...; Region: GST_N_family; cd00570
568708010825	C-terminal domain interface [polypeptide binding]; other site
568708010826	GSH binding site (G-site) [chemical binding]; other site
568708010827	dimer interface [polypeptide binding]; other site
568708010828	C-terminal, alpha helical domain of an unknown subfamily 4 of Glutathione S-transferases; Region: GST_C_4; cd03195
568708010829	N-terminal domain interface [polypeptide binding]; other site
568708010830	putative dimer interface [polypeptide binding]; other site
568708010831	putative substrate binding pocket (H-site) [chemical binding]; other site
568708010833	GSH-dependent disulfide bond oxidoreductase; Provisional; Region: PRK13972
568708010834	GST_N family, Ure2p-like subfamily; composed of the Saccharomyces cerevisiae Ure2p and related GSTs. Ure2p is a regulator for nitrogen catabolism in yeast. It represses the expression of several gene products involved in the use of poor nitrogen sources...; Region: GST_N_Ure2p_like; cd03048
568708010835	C-terminal domain interface [polypeptide binding]; other site
568708010836	GSH binding site (G-site) [chemical binding]; other site
568708010837	dimer interface [polypeptide binding]; other site
568708010838	C-terminal, alpha helical domain of Escherichia coli YfcG Glutathione S-transferases and related uncharacterized proteins; Region: GST_C_YfcG_like; cd10291
568708010839	N-terminal domain interface [polypeptide binding]; other site
568708010840	putative dimer interface [polypeptide binding]; other site
568708010841	active site
568708010844	Predicted nucleoside-diphosphate sugar epimerase [General function prediction only]; Region: COG1090
568708010845	atypical (a) SDRs, subgroup 8; Region: SDR_a8; cd05242
568708010846	putative NAD(P) binding site [chemical binding]; other site
568708010847	putative active site [active]
568708010850	histidine/lysine/arginine/ornithine transporter subunit; Provisional; Region: PRK10619
568708010851	ATP-binding cassette domain of the histidine and glutamine transporters; Region: ABC_HisP_GlnQ; cd03262
568708010852	Walker A/P-loop; other site
568708010853	ATP binding site [chemical binding]; other site
568708010854	Q-loop/lid; other site
568708010855	ABC transporter signature motif; other site
568708010856	Walker B; other site
568708010857	D-loop; other site
568708010858	H-loop/switch region; other site
568708010860	ABC-type arginine transport system, permease component [Amino acid transport and metabolism]; Region: ArtQ; COG4215
568708010861	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708010862	dimer interface [polypeptide binding]; other site
568708010863	conserved gate region; other site
568708010864	putative PBP binding loops; other site
568708010865	ABC-ATPase subunit interface; other site
568708010866	4 probable transmembrane helices predicted for STM_MW23741 by TMHMM2.0 at aa 25-47, 57-79, 167-189 and 199-221
568708010868	ABC-type arginine transport system, permease component [Amino acid transport and metabolism]; Region: ArtQ; COG4215
568708010869	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708010870	dimer interface [polypeptide binding]; other site
568708010871	conserved gate region; other site
568708010872	putative PBP binding loops; other site
568708010873	ABC-ATPase subunit interface; other site
568708010874	5 probable transmembrane helices predicted for STM_MW23751 by TMHMM2.0 at aa 15-37, 58-80, 90-108, 149-171 and 191-213
568708010876	histidine ABC transporter substrate-binding protein HisJ; Provisional; Region: PRK15437
568708010877	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
568708010878	substrate binding pocket [chemical binding]; other site
568708010879	membrane-bound complex binding site; other site
568708010880	hinge residues; other site
568708010882	Signal peptide predicted for STM_MW23761 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.993 between residues 22 and 23
568708010883	ABC transporter lysine/arginine/ornithine binding periplasmic protein; Provisional; Region: PRK15010
568708010884	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
568708010885	substrate binding pocket [chemical binding]; other site
568708010886	membrane-bound complex binding site; other site
568708010887	hinge residues; other site
568708010889	1 probable transmembrane helix predicted for STM_MW23771 by TMHMM2.0 at aa 5-24
568708010890	Signal peptide predicted for STM_MW23771 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.969 between residues 22 and 23
568708010891	3-octaprenyl-4-hydroxybenzoate carboxy-lyase; Provisional; Region: PRK06029
568708010892	Flavoprotein; Region: Flavoprotein; pfam02441
568708010894	Gamma-aminobutyrate permease and related permeases [Amino acid transport and metabolism]; Region: AnsP; COG1113
568708010895	12 probable transmembrane helices predicted for STM_MW23791 by TMHMM2.0 at aa 25-47, 57-79, 86-108, 128-150, 163-185, 209-231, 243-265, 292-314, 334-356, 366-388, 409-431 and 435-457
568708010897	Predicted amino acid racemase [Amino acid transport and metabolism]; Region: COG3457
568708010898	Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzyme Alanine Racemase-like 1; Region: PLPDE_III_AR_like_1; cd06815
568708010899	dimer interface [polypeptide binding]; other site
568708010900	active site
568708010901	pyridoxal 5'-phosphate (PLP) binding site [chemical binding]; other site
568708010902	substrate binding site [chemical binding]; other site
568708010903	catalytic residue [active]
568708010905	putative glutamate/gamma-aminobutyrate antiporter; Region: put_Glu_GABA_T; TIGR03813
568708010906	12 probable transmembrane helices predicted for STM_MW23811 by TMHMM2.0 at aa 7-29, 39-61, 82-101, 116-138, 151-173, 193-215, 235-257, 281-303, 332-354, 358-380, 403-425 and 435-457
568708010908	Diaminopimelate decarboxylase [Amino acid transport and metabolism]; Region: LysA; COG0019
568708010909	Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzymes; Region: PLPDE_III; cl00261
568708010910	pyridoxal 5'-phosphate (PLP) binding site [chemical binding]; other site
568708010911	catalytic residue [active]
568708010914	PAS fold; Region: PAS_4; pfam08448
568708010915	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cl02459
568708010916	putative active site [active]
568708010917	heme pocket [chemical binding]; other site
568708010918	psp operon transcriptional activator PspF; Region: phageshock_pspF; TIGR02974
568708010919	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708010920	Walker A motif; other site
568708010921	ATP binding site [chemical binding]; other site
568708010922	Walker B motif; other site
568708010923	arginine finger; other site
568708010924	Bacterial regulatory protein, Fis family; Region: HTH_8; pfam02954
568708010928	amidophosphoribosyltransferase; Provisional; Region: PRK09246
568708010929	Glutamine amidotransferases class-II (GN-AT)_GPAT- type. This domain is found at the N-terminus of  glutamine phosphoribosylpyrophosphate (Prpp) amidotransferase (GPATase) . The glutaminase domain catalyzes amide nitrogen transfer from glutamine to the...; Region: GPATase_N; cd00715
568708010930	active site
568708010931	tetramer interface [polypeptide binding]; other site
568708010932	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
568708010933	active site
568708010936	colicin V production protein; Provisional; Region: PRK10845
568708010937	Uncharacterized membrane protein, required for colicin V production [General function prediction only]; Region: CvpA; COG1286
568708010939	4 probable transmembrane helices predicted for STM_MW23851 by TMHMM2.0 at aa 4-26, 31-53, 63-85 and 98-120
568708010940	cell division protein DedD; Provisional; Region: PRK11633
568708010941	Sporulation related domain; Region: SPOR; pfam05036
568708010943	1 probable transmembrane helix predicted for STM_MW23861 by TMHMM2.0 at aa 10-27
568708010944	bifunctional folylpolyglutamate synthase/ dihydrofolate synthase; Provisional; Region: PRK10846
568708010945	Mur ligase middle domain; Region: Mur_ligase_M; pfam08245
568708010946	Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875
568708010949	acetyl-CoA carboxylase subunit beta; Validated; Region: PRK05654
568708010950	malonate decarboxylase subunit beta; Reviewed; Region: PRK07189; cl17682
568708010952	hypothetical protein; Provisional; Region: PRK10847
568708010953	Uncharacterized membrane-associated protein [Function unknown]; Region: DedA; COG0586
568708010954	4 probable transmembrane helices predicted for STM_MW23891 by TMHMM2.0 at aa 27-49, 71-93, 158-180 and 190-208
568708010956	Pseudouridylate synthase [Translation, ribosomal structure and biogenesis]; Region: TruA; COG0101
568708010957	Eukaryotic and bacterial pseudouridine synthases similar to E.  coli TruA; Region: PseudoU_synth_EcTruA; cd02570
568708010958	dimerization interface 3.5A [polypeptide binding]; other site
568708010959	active site
568708010961	putative semialdehyde dehydrogenase; Provisional; Region: PRK08040
568708010962	Semialdehyde dehydrogenase, NAD binding domain; Region: Semialdhyde_dh; smart00859
568708010965	erythronate-4-phosphate dehydrogenase PdxB; Provisional; Region: PRK15438
568708010966	D-Erythronate-4-Phosphate Dehydrogenase NAD-binding and catalytic domains; Region: ErythrP_dh; cd12158
568708010967	ligand binding site [chemical binding]; other site
568708010968	NAD binding site [chemical binding]; other site
568708010969	catalytic site [active]
568708010970	homodimer interface [polypeptide binding]; other site
568708010973	flagella biosynthesis regulator; Provisional; Region: flk; PRK10715
568708010974	1 probable transmembrane helix predicted for STM_MW23931 by TMHMM2.0 at aa 310-332
568708010975	putative transporter; Provisional; Region: PRK12382
568708010976	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708010977	putative substrate translocation pore; other site
568708010978	12 probable transmembrane helices predicted for STM_MW23941 by TMHMM2.0 at aa 20-42, 52-71, 83-105, 120-142, 149-171, 176-198, 210-232, 247-269, 276-298, 303-325, 338-360 and 370-389
568708010980	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
568708010981	non-specific DNA binding site [nucleotide binding]; other site
568708010982	salt bridge; other site
568708010983	sequence-specific DNA binding site [nucleotide binding]; other site
568708010985	Protein of unknown function (DUF3828); Region: DUF3828; pfam12883
568708010986	Signal peptide predicted for STM_MW23981 by SignalP 2.0 HMM (Signal peptide probability 0.967) with cleavage site probability 0.546 between residues 24 and 25
568708010987	CAAX protease self-immunity; Region: Abi; pfam02517
568708010988	7 probable transmembrane helices predicted for STM_MW23991 by TMHMM2.0 at aa 12-31, 41-63, 75-97, 117-139, 146-163, 168-187 and 194-216
568708010990	Signal peptide predicted for STM_MW23991 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.858 between residues 36 and 37
568708010991	3-oxoacyl-(acyl carrier protein) synthase I; Reviewed; Region: PRK07967
568708010992	Beta-ketoacyl-acyl carrier protein (ACP) synthase (KAS), type I and II. KASs are responsible for the elongation steps in fatty acid biosynthesis. KASIII catalyses the initial condensation and KAS I and II catalyze further elongation steps by Claisen...; Region: KAS_I_II; cd00834
568708010993	dimer interface [polypeptide binding]; other site
568708010994	active site
568708010997	Uncharacterized conserved protein [Function unknown]; Region: COG4121
568708010998	bifunctional tRNA (mnm(5)s(2)U34)-methyltransferase/FAD-dependent cmnm(5)s(2)U34 oxidoreductase; Reviewed; Region: mnmC; PRK01747
568708011001	YfcL protein; Region: YfcL; pfam08891
568708011003	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3101
568708011005	hypothetical protein; Provisional; Region: PRK10621
568708011006	Sulfite exporter TauE/SafE; Region: TauE; pfam01925
568708011007	8 probable transmembrane helices predicted for STM_MW24041 by TMHMM2.0 at aa 7-28, 32-54, 85-104, 108-127, 139-158, 163-182, 195-217 and 237-255
568708011009	Signal peptide predicted for STM_MW24041 by SignalP 2.0 HMM (Signal peptide probability 0.847) with cleavage site probability 0.756 between residues 25 and 26
568708011010	Murein endopeptidase [Cell envelope biogenesis, outer membrane]; Region: MepA; COG3770
568708011011	penicillin-insensitive murein endopeptidase; Reviewed; Region: mepA; PRK09429
568708011013	Signal peptide predicted for STM_MW24051 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.995 between residues 19 and 20
568708011014	Chorismate synthase [Amino acid transport and metabolism]; Region: AroC; COG0082
568708011015	Chorismase synthase, the enzyme catalyzing the final step of the shikimate pathway; Region: Chorismate_synthase; cd07304
568708011016	Tetramer interface [polypeptide binding]; other site
568708011017	active site
568708011018	FMN-binding site [chemical binding]; other site
568708011020	HemK family putative methylases; Region: hemK_fam; TIGR00536
568708011021	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708011022	S-adenosylmethionine binding site [chemical binding]; other site
568708011024	hypothetical protein; Provisional; Region: PRK04946
568708011025	Smr domain; Region: Smr; pfam01713
568708011027	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
568708011028	catalytic core [active]
568708011030	multifunctional fatty acid oxidation complex subunit alpha; Reviewed; Region: fadJ; PRK11154
568708011031	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
568708011032	substrate binding site [chemical binding]; other site
568708011033	oxyanion hole (OAH) forming residues; other site
568708011034	trimer interface [polypeptide binding]; other site
568708011035	3-hydroxyacyl-CoA dehydrogenase, NAD binding domain; Region: 3HCDH_N; pfam02737
568708011036	3-hydroxyacyl-CoA dehydrogenase, C-terminal domain; Region: 3HCDH; pfam00725
568708011040	3-ketoacyl-CoA thiolase; Reviewed; Region: fadI; PRK08963
568708011041	Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751
568708011042	dimer interface [polypeptide binding]; other site
568708011043	active site
568708011046	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3691
568708011048	long-chain fatty acid outer membrane transporter; Provisional; Region: PRK10716
568708011049	Signal peptide predicted for STM_MW24131 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 27 and 28
568708011051	ABC transporter outer membrane lipoprotein; Provisional; Region: PRK15091
568708011053	Signal peptide predicted for STM_MW24141 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.383 between residues 21 and 22
568708011054	Formate/nitrite family of transporters [Inorganic ion transport and metabolism]; Region: FocA; COG2116
568708011056	6 probable transmembrane helices predicted for STM_MW24151 by TMHMM2.0 at aa 62-84, 94-116, 137-159, 190-209, 216-235 and 255-277
568708011057	outer membrane protease; Reviewed; Region: PRK10993
568708011059	Signal peptide predicted for STM_MW24161 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 20 and 21
568708011060	Response regulator containing CheY-like receiver, AAA-type ATPase, and DNA-binding domains [Signal transduction mechanisms]; Region: AtoC; COG2204
568708011061	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708011062	active site
568708011063	phosphorylation site [posttranslational modification]
568708011064	intermolecular recognition site; other site
568708011065	dimerization interface [polypeptide binding]; other site
568708011066	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cl17189
568708011067	Bacterial regulatory protein, Fis family; Region: HTH_8; pfam02954
568708011071	Signal transduction histidine kinase regulating phosphoglycerate transport system [Signal transduction mechanisms]; Region: COG4192
568708011072	HAMP (Histidine kinases, Adenylyl cyclases, Methyl binding proteins, Phosphatases) domain; Region: HAMP; smart00304
568708011073	dimerization interface [polypeptide binding]; other site
568708011074	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
568708011075	dimer interface [polypeptide binding]; other site
568708011076	phosphorylation site [posttranslational modification]
568708011077	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708011078	ATP binding site [chemical binding]; other site
568708011079	Mg2+ binding site [ion binding]; other site
568708011080	G-X-G motif; other site
568708011081	2 probable transmembrane helices predicted for STM_MW24181 by TMHMM2.0 at aa 20-39 and 335-357
568708011084	Signal peptide predicted for STM_MW24181 by SignalP 2.0 HMM (Signal peptide probability 0.869) with cleavage site probability 0.640 between residues 39 and 40
568708011085	ABC-type Fe3+ transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: AfuA; COG1840
568708011086	Bacterial extracellular solute-binding protein; Region: SBP_bac_11; pfam13531
568708011088	Sugar phosphate permease [Carbohydrate transport and metabolism]; Region: UhpC; COG2271
568708011089	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708011090	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708011091	12 probable transmembrane helices predicted for STM_MW24201 by TMHMM2.0 at aa 21-43, 63-85, 98-120, 124-146, 158-180, 190-207, 260-282, 297-315, 327-344, 348-370, 377-399 and 414-436
568708011093	Protein of unknown function (DUF2545); Region: DUF2545; pfam10810
568708011095	3 probable transmembrane helices predicted for STM_MW24231 by TMHMM2.0 at aa 2-24, 29-48 and 55-77
568708011096	Bacterial lipid A biosynthesis acyltransferase; Region: Lip_A_acyltrans; pfam03279
568708011097	Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: LABLAT-like; Region: LPLAT_LABLAT-like; cd07984
568708011098	putative acyl-acceptor binding pocket; other site
568708011100	1 probable transmembrane helix predicted for STM_MW24241 by TMHMM2.0 at aa 20-42
568708011101	aminotransferase; Validated; Region: PRK08175
568708011102	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
568708011103	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708011104	homodimer interface [polypeptide binding]; other site
568708011105	catalytic residue [active]
568708011107	glucokinase; Provisional; Region: glk; PRK00292
568708011108	glucokinase, proteobacterial type; Region: glk; TIGR00749
568708011110	Chloride channel protein EriC [Inorganic ion transport and metabolism]; Region: EriC; COG0038
568708011111	CLC voltage-gated chloride channel. The ClC chloride channels catalyse the selective flow of Cl- ions across cell membranes, thereby regulating electrical excitation in skeletal muscle and the flow of salt and water across epithelial barriers. This...; Region: Voltage_gated_ClC; cd00400
568708011112	Cl- selectivity filter; other site
568708011113	Cl- binding residues [ion binding]; other site
568708011114	pore gating glutamate residue; other site
568708011115	dimer interface [polypeptide binding]; other site
568708011116	Signal peptide predicted for STM_MW24281 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.898 between residues 29 and 30
568708011117	11 probable transmembrane helices predicted for STM_MW24281 by TMHMM2.0 at aa 9-31, 57-74, 95-117, 148-170, 186-208, 223-245, 258-280, 295-317, 322-341, 345-363 and 376-398
568708011119	indolepyruvate decarboxylase, Erwinia family; Region: indolpyr_decarb; TIGR03393
568708011120	Pyrimidine (PYR) binding domain of pyruvate decarboxylase (PDC), indolepyruvate decarboxylase (IPDC) and related proteins; Region: TPP_PYR_PDC_IPDC_like; cd07038
568708011121	dimer interface [polypeptide binding]; other site
568708011122	PYR/PP interface [polypeptide binding]; other site
568708011123	TPP binding site [chemical binding]; other site
568708011124	Thiamine pyrophosphate enzyme, central domain; Region: TPP_enzyme_M; pfam00205
568708011125	Thiamine pyrophosphate (TPP) family, PDC_IPDC subfamily, TPP-binding module; composed of proteins similar to pyruvate decarboxylase (PDC) and indolepyruvate decarboxylase (IPDC). PDC, a key enzyme in alcoholic fermentation, catalyzes the conversion of...; Region: TPP_PDC_IPDC; cd02005
568708011126	TPP-binding site [chemical binding]; other site
568708011127	dimer interface [polypeptide binding]; other site
568708011131	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660
568708011132	Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248
568708011133	active site
568708011134	catalytic tetrad [active]
568708011136	Protein of unknown function (DUF2502); Region: DUF2502; pfam10697
568708011137	Signal peptide predicted for STM_MW24311 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.992 between residues 21 and 22
568708011139	manganese transport protein MntH; Reviewed; Region: PRK00701
568708011140	Natural resistance-associated macrophage protein; Region: Nramp; pfam01566
568708011141	11 probable transmembrane helices predicted for STM_MW24321 by TMHMM2.0 at aa 17-39, 54-76, 96-118, 123-145, 157-176, 196-218, 239-261, 281-303, 324-343, 348-370 and 390-412
568708011143	Nucleoside permease [Nucleotide transport and metabolism]; Region: NupC; COG1972
568708011144	Na+ dependent nucleoside transporter N-terminus; Region: Nucleos_tra2_N; pfam01773
568708011145	Nucleoside recognition; Region: Gate; pfam07670
568708011146	Na+ dependent nucleoside transporter C-terminus; Region: Nucleos_tra2_C; pfam07662
568708011147	Signal peptide predicted for STM_MW24331 by SignalP 2.0 HMM (Signal peptide probability 0.620) with cleavage site probability 0.416 between residues 23 and 24
568708011148	8 probable transmembrane helices predicted for STM_MW24331 by TMHMM2.0 at aa 4-23, 30-48, 86-108, 194-216, 249-271, 278-300, 342-364 and 377-399
568708011152	MASE1; Region: MASE1; pfam05231
568708011153	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
568708011154	diguanylate cyclase; Region: GGDEF; smart00267
568708011155	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
568708011158	8 probable transmembrane helices predicted for STM_MW24341 by TMHMM2.0 at aa 10-32, 39-61, 86-108, 121-143, 163-185, 214-236, 246-268 and 289-311
568708011160	Putative transcription regulator (DUF1323); Region: DUF1323; pfam07037
568708011162	Putative transcription regulator (DUF1323); Region: DUF1323; pfam07037
568708011164	glutamyl-tRNA synthetase; Reviewed; Region: gltX; PRK01406
568708011165	catalytic core domain of discriminating glutamyl-tRNA synthetase; Region: GluRS_core; cd00808
568708011166	active site
568708011167	HIGH motif; other site
568708011168	catalytic core domain of discriminating glutamyl-tRNA synthetase; Region: GluRS_core; cd00808
568708011169	active site
568708011170	KMSKS motif; other site
568708011172	DNA-binding transcriptional activator XapR; Provisional; Region: PRK09986
568708011173	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708011174	The C-terminal substrate binding domain of LysR-type transcriptional regulator XapR involved in xanthosine catabolism, contains the type 2 periplasmic binding fold; Region: PBP2_XapR; cd08449
568708011175	putative dimerization interface [polypeptide binding]; other site
568708011176	putative substrate binding pocket [chemical binding]; other site
568708011179	nucleoside transporter; Region: 2A0110; TIGR00889
568708011180	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708011181	putative substrate translocation pore; other site
568708011183	12 probable transmembrane helices predicted for STM_MW24391 by TMHMM2.0 at aa 12-30, 40-62, 71-90, 94-116, 128-150, 160-179, 211-233, 253-275, 282-301, 306-328, 348-370 and 380-402
568708011184	purine nucleoside phosphorylase; Provisional; Region: PRK08202
568708011186	hypothetical protein; Provisional; Region: PRK11528
568708011188	Transcriptional regulator [Transcription]; Region: LysR; COG0583
568708011189	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708011190	TThe C-terminal substrate binding domain of an uncharacterized LysR-type transcriptional regulator, contains the type 2 periplasmic binding fold; Region: PBP2_LTTR_like_4; cd08440
568708011191	putative dimerization interface [polypeptide binding]; other site
568708011194	Predicted Na+-dependent transporter [General function prediction only]; Region: COG0385
568708011195	SBF-like CPA transporter family (DUF4137); Region: DUF4137; pfam13593
568708011196	Signal peptide predicted for STM_MW24441 by SignalP 2.0 HMM (Signal peptide probability 0.932) with cleavage site probability 0.870 between residues 28 and 29
568708011197	9 probable transmembrane helices predicted for STM_MW24441 by TMHMM2.0 at aa 7-24, 29-48, 69-91, 101-123, 130-152, 167-189, 202-224, 229-251 and 272-294
568708011199	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3530
568708011200	NAD-dependent DNA ligase LigA; Validated; Region: ligA; PRK07956
568708011201	NAD+ dependent DNA ligase adenylation domain. DNA ligases catalyze the crucial step of joining the breaks in duplex DNA during DNA replication, repair and recombination, utilizing either ATP or NAD(+) as a cofactor, but using the same basic reaction...; Region: LIGANc; cd00114
568708011202	nucleotide binding pocket [chemical binding]; other site
568708011203	K-X-D-G motif; other site
568708011204	catalytic site [active]
568708011205	NAD-dependent DNA ligase OB-fold domain; Region: DNA_ligase_OB; pfam03120
568708011206	NAD-dependent DNA ligase C4 zinc finger domain; Region: DNA_ligase_ZBD; pfam03119
568708011207	Breast Cancer Suppressor Protein (BRCA1), carboxy-terminal domain. The BRCT domain is found within many DNA damage repair and cell cycle checkpoint proteins. The unique diversity of this domain superfamily allows BRCT modules to interact forming homo...; Region: BRCT; cd00027
568708011208	Dimer interface [polypeptide binding]; other site
568708011209	BRCT sequence motif; other site
568708011215	ZipA C-terminal domain. ZipA, a membrane-anchored protein, is one of at least nine essential gene products necessary for assembly of the septal ring which mediates cell division in E.coli. ZipA and FtsA directly bind FtsZ, a homolog of eukaryotic...; Region: ZipA; cl12038
568708011216	cell division protein ZipA; Provisional; Region: PRK03427
568708011217	ZipA C-terminal domain. ZipA, a membrane-anchored protein, is one of at least nine essential gene products necessary for assembly of the septal ring which mediates cell division in E.coli. ZipA and FtsA directly bind FtsZ, a homolog of eukaryotic...; Region: ZipA; cd00231
568708011218	FtsZ protein binding site [polypeptide binding]; other site
568708011220	1 probable transmembrane helix predicted for STM_MW24471 by TMHMM2.0 at aa 22-44
568708011221	putative sulfate transport protein CysZ; Validated; Region: PRK04949
568708011222	4 probable transmembrane helices predicted for STM_MW24481 by TMHMM2.0 at aa 31-53, 68-90, 151-173 and 220-242
568708011224	Cysteine synthase [Amino acid transport and metabolism]; Region: CysK; COG0031
568708011225	CBS_like: This subgroup includes Cystathionine beta-synthase (CBS) and Cysteine synthase. CBS is a unique heme-containing enzyme that catalyzes a pyridoxal 5'-phosphate (PLP)-dependent condensation of serine and homocysteine to give cystathionine; Region: CBS_like; cd01561
568708011226	dimer interface [polypeptide binding]; other site
568708011227	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708011228	catalytic residue [active]
568708011230	Histidine-containing phosphocarrier protein (HPr)-like proteins. HPr is a central component of the bacterial phosphoenolpyruvate sugar phosphotransferase system (PTS). The PTS catalyses the phosphorylation of sugar substrates during their translocation...; Region: PTS-HPr_like; cd00367
568708011231	dimerization domain swap beta strand [polypeptide binding]; other site
568708011232	regulatory protein interface [polypeptide binding]; other site
568708011233	active site
568708011234	regulatory phosphorylation site [posttranslational modification]; other site
568708011236	phosphoenolpyruvate-protein phosphotransferase; Provisional; Region: PRK11177
568708011237	PEP-utilising enzyme, N-terminal; Region: PEP-utilisers_N; pfam05524
568708011238	PEP-utilising enzyme, mobile domain; Region: PEP-utilizers; pfam00391
568708011239	PEP-utilising enzyme, TIM barrel domain; Region: PEP-utilizers_C; pfam02896
568708011243	PTS_IIA, PTS system, glucose/sucrose specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIA_glc; cd00210
568708011244	HPr interaction site; other site
568708011245	glycerol kinase (GK) interaction site [polypeptide binding]; other site
568708011246	active site
568708011247	phosphorylation site [posttranslational modification]
568708011249	Pyridoxal kinase plays a key role in the synthesis of the active coenzyme pyridoxal-5'-phosphate  (PLP), by catalyzing the phosphorylation of the precursor vitamin B6  in the presence of Zn2+ and ATP. Mammals are unable to synthesize PLP de novo and...; Region: pyridoxal_pyridoxamine_kinase; cd01173
568708011250	dimer interface [polypeptide binding]; other site
568708011251	pyridoxamine kinase; Validated; Region: PRK05756
568708011252	pyridoxal binding site [chemical binding]; other site
568708011253	ATP binding site [chemical binding]; other site
568708011255	transcriptional regulatory protein PtsJ; Provisional; Region: PRK15481
568708011256	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
568708011257	DNA-binding site [nucleotide binding]; DNA binding site
568708011258	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
568708011259	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708011260	homodimer interface [polypeptide binding]; other site
568708011261	catalytic residue [active]
568708011264	GMP synthase - Glutamine amidotransferase domain [Nucleotide transport and metabolism]; Region: GuaA; COG0518
568708011265	Subgroup of proteins having the Type 1 glutamine amidotransferase (GATase1) domain; Region: GATase1_1; cd01741
568708011266	catalytic triad [active]
568708011268	hypothetical protein; Provisional; Region: PRK10318
568708011269	Signal peptide predicted for STM_MW24571 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.990 between residues 25 and 26
568708011270	Membrane carboxypeptidase (penicillin-binding protein) [Cell envelope biogenesis, outer membrane]; Region: MrcB; COG0744
568708011271	Transglycosylase; Region: Transgly; cl17702
568708011272	1 probable transmembrane helix predicted for STM_MW24581 by TMHMM2.0 at aa 7-29
568708011274	cysteine synthase B; Region: cysM; TIGR01138
568708011275	CBS_like: This subgroup includes Cystathionine beta-synthase (CBS) and Cysteine synthase. CBS is a unique heme-containing enzyme that catalyzes a pyridoxal 5'-phosphate (PLP)-dependent condensation of serine and homocysteine to give cystathionine; Region: CBS_like; cd01561
568708011276	dimer interface [polypeptide binding]; other site
568708011277	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708011278	catalytic residue [active]
568708011280	sulfate/thiosulfate transporter subunit; Provisional; Region: PRK10851
568708011281	ATP-binding cassette domain of the sulfate transporter; Region: ABC_CysA_sulfate_importer; cd03296
568708011282	Walker A/P-loop; other site
568708011283	ATP binding site [chemical binding]; other site
568708011284	Q-loop/lid; other site
568708011285	ABC transporter signature motif; other site
568708011286	Walker B; other site
568708011287	D-loop; other site
568708011288	H-loop/switch region; other site
568708011289	TOBE-like domain; Region: TOBE_3; pfam12857
568708011291	sulfate transport protein; Provisional; Region: cysT; CHL00187
568708011292	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708011293	dimer interface [polypeptide binding]; other site
568708011294	conserved gate region; other site
568708011295	putative PBP binding loops; other site
568708011296	ABC-ATPase subunit interface; other site
568708011297	6 probable transmembrane helices predicted for STM_MW24611 by TMHMM2.0 at aa 21-43, 66-88, 101-123, 143-162, 201-223 and 246-268
568708011299	ABC-type sulfate transport system, permease component [Posttranslational modification, protein turnover, chaperones]; Region: CysU; COG0555
568708011300	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708011301	dimer interface [polypeptide binding]; other site
568708011302	conserved gate region; other site
568708011303	putative PBP binding loops; other site
568708011304	ABC-ATPase subunit interface; other site
568708011305	7 probable transmembrane helices predicted for STM_MW24621 by TMHMM2.0 at aa 15-37, 62-84, 104-126, 138-160, 188-205, 212-234 and 244-266
568708011307	Signal peptide predicted for STM_MW24621 by SignalP 2.0 HMM (Signal peptide probability 0.987) with cleavage site probability 0.461 between residues 45 and 46
568708011308	thiosulfate transporter subunit; Provisional; Region: PRK10852
568708011309	Bacterial extracellular solute-binding protein; Region: SBP_bac_11; pfam13531
568708011311	Signal peptide predicted for STM_MW24631 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 25 and 26
568708011312	short chain dehydrogenase; Provisional; Region: PRK08226
568708011313	human DHRS6-like, classical (c) SDRs; Region: DHRS6_like_SDR_c; cd05368
568708011314	NAD binding site [chemical binding]; other site
568708011315	homotetramer interface [polypeptide binding]; other site
568708011316	homodimer interface [polypeptide binding]; other site
568708011317	active site
568708011319	Dyp-type peroxidase family; Region: Dyp_perox; pfam04261
568708011321	RpoE-regulated lipoprotein; Provisional; Region: PRK10718
568708011322	Protein of unknown function (DUF1131); Region: DUF1131; pfam06572
568708011324	Signal peptide predicted for STM_MW24661 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.566 between residues 27 and 28
568708011325	Protein of unknown function (DUF2919); Region: DUF2919; pfam11143
568708011327	4 probable transmembrane helices predicted for STM_MW24671 by TMHMM2.0 at aa 19-41, 61-78, 90-112 and 116-135
568708011328	putative acetyltransferase; Provisional; Region: PRK03624
568708011329	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
568708011330	Coenzyme A binding pocket [chemical binding]; other site
568708011332	N-acetylmuramoyl-l-alanine amidase I; Provisional; Region: PRK10319
568708011333	N-acetylmuramoyl-L-alanine amidase or MurNAc-LAA (also known as peptidoglycan aminohydrolase, NAMLA amidase, NAMLAA, Amidase 3, and peptidoglycan amidase; EC 3.5.1.28) is an autolysin that hydrolyzes the amide bond between N-acetylmuramoyl and L-amino...; Region: MurNAc-LAA; cd02696
568708011334	active site
568708011335	metal binding site [ion binding]; metal-binding site
568708011336	Signal peptide predicted for STM_MW24691 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.900 between residues 34 and 35
568708011338	coproporphyrinogen III oxidase; Provisional; Region: PRK05330
568708011339	Coproporphyrinogen III oxidase; Region: Coprogen_oxidas; pfam01218
568708011341	3 probable transmembrane helices predicted for STM_MW24711 by TMHMM2.0 at aa 19-36, 51-73 and 86-108
568708011342	transcriptional regulator EutR; Provisional; Region: PRK10130
568708011343	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708011344	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708011346	carboxysome structural protein EutK; Provisional; Region: PRK15466
568708011347	Carbon dioxide concentrating mechanism K (CcmK)-like proteins, Bacterial Micro-Compartment (BMC) domain; Region: BMC_CcmK_like; cd07045
568708011348	Hexamer interface [polypeptide binding]; other site
568708011349	Hexagonal pore residue; other site
568708011352	ethanolamine utilization protein EutL; Provisional; Region: PRK15405
568708011353	ethanolamine utilization protein S (EutS), Bacterial Micro-Compartment (BMC) domain repeat 1; Region: BMC_EutL_repeat1; cd07049
568708011354	putative hexamer interface [polypeptide binding]; other site
568708011355	putative hexagonal pore; other site
568708011356	ethanolamine utilization protein S (EutS), Bacterial Micro-Compartment (BMC) domain repeat 2; Region: BMC_EutL_repeat2; cd07050
568708011357	putative hexamer interface [polypeptide binding]; other site
568708011358	putative hexagonal pore; other site
568708011360	Ethanolamine ammonia-lyase, small subunit [Amino acid transport and metabolism]; Region: EutC; COG4302
568708011362	Ethanolamine ammonia-lyase, large subunit [Amino acid transport and metabolism]; Region: EutB; COG4303
568708011363	Ethanolamine ammonia lyase large subunit (EutB); Region: EutB; pfam06751
568708011365	reactivating factor for ethanolamine ammonia lyase; Provisional; Region: eutA; PRK10719
568708011367	Ethanolamine utilization protein [Amino acid transport and metabolism]; Region: EutH; COG3192
568708011369	10 probable transmembrane helices predicted for STM_MW24791 by TMHMM2.0 at aa 7-29, 58-80, 87-109, 124-146, 153-175, 190-212, 231-253, 273-295, 308-330 and 370-392
568708011370	ethanol dehydrogenase EutG; Provisional; Region: PRK15454
568708011371	iron-containing alcohol dehydrogenases (Fe-ADH)-like; Region: Fe-ADH; cd08551
568708011372	active site
568708011373	metal binding site [ion binding]; metal-binding site
568708011375	Ethanolamine utilization protein, possible chaperonin [Amino acid transport and metabolism]; Region: EutJ; COG4820
568708011376	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cd00012
568708011377	nucleotide binding site [chemical binding]; other site
568708011379	Ethanolamine utilization protein EutE-like; Region: ALDH_EutE; cd07121
568708011380	putative catalytic cysteine [active]
568708011382	Ethanolamine utilisation protein and carboxysome structural protein domain family; Region: EutN_CcmL; cd01614
568708011383	Hexamer/Pentamer interface [polypeptide binding]; other site
568708011384	central pore; other site
568708011386	Carbon dioxide concentrating mechanism/carboxysome shell protein [Secondary metabolites biosynthesis, transport, and catabolism / Energy production and conversion]; Region: CcmK; COG4577
568708011387	1,2-propanediol utilization protein A (PduA), Bacterial Micro-Compartment (BMC) domain; Region: BMC_PduA; cd07059
568708011388	Hexamer interface [polypeptide binding]; other site
568708011389	Putative hexagonal pore residue; other site
568708011391	phosphotransacetylase; Reviewed; Region: eutD; PRK09653
568708011393	ethanolamine utilization cobalamin adenosyltransferase; Provisional; Region: PRK15020
568708011395	ethanolamine utilization protein EutQ; Provisional; Region: PRK15457
568708011396	Ethanolamine utilization protein [Amino acid transport and metabolism]; Region: EutQ; COG4766
568708011398	Rat sarcoma (Ras)-like superfamily of small guanosine triphosphatases (GTPases); Region: Ras_like_GTPase; cd00882
568708011399	G1 box; other site
568708011400	GTP/Mg2+ binding site [chemical binding]; other site
568708011401	G2 box; other site
568708011402	Switch I region; other site
568708011403	G3 box; other site
568708011404	Switch II region; other site
568708011405	G4 box; other site
568708011406	G5 box; other site
568708011408	1,2-propanediol utilization protein U (PduU)/ethanolamine utilization protein S (EutS), Bacterial Micro-Compartment (BMC) domain; Region: BMC_PduU-EutS; cd07046
568708011409	putative hexamer interface [polypeptide binding]; other site
568708011410	putative hexagonal pore; other site
568708011412	Transposase IS200 like; Region: Y1_Tnp; pfam01797
568708011414	bifunctional malic enzyme oxidoreductase/phosphotransacetylase; Reviewed; Region: PRK07232
568708011415	Malic enzyme, N-terminal domain; Region: malic; pfam00390
568708011416	NAD(P) binding domain of malic enzyme (ME), subgroup 2; Region: NAD_bind_2_malic_enz; cd05311
568708011417	putative NAD(P) binding site [chemical binding]; other site
568708011418	Phosphotransacetylase [Energy production and conversion]; Region: Pta; COG0280
568708011422	transaldolase-like protein; Provisional; Region: PTZ00411
568708011423	Transaldolases including both TalA and TalB; Region: Transaldolase_TalAB; cd00957
568708011424	active site
568708011425	dimer interface [polypeptide binding]; other site
568708011426	catalytic residue [active]
568708011428	transketolase; Reviewed; Region: PRK12753
568708011429	Thiamine pyrophosphate (TPP) family, Transketolase (TK) subfamily, TPP-binding module; TK catalyzes the transfer of a two-carbon unit from ketose phosphates to aldose phosphates. In heterotrophic organisms, TK provides a link between glycolysis and the...; Region: TPP_TK; cd02012
568708011430	TPP-binding site [chemical binding]; other site
568708011431	dimer interface [polypeptide binding]; other site
568708011432	Pyrimidine (PYR) binding domain of 1-deoxy-D-xylulose-5-phosphate synthase (DXS), transketolase (TK), and related proteins; Region: TPP_PYR_DXS_TK_like; cd07033
568708011433	PYR/PP interface [polypeptide binding]; other site
568708011434	dimer interface [polypeptide binding]; other site
568708011435	TPP binding site [chemical binding]; other site
568708011436	Transketolase, C-terminal domain; Region: Transketolase_C; pfam02780
568708011440	Protein of unknown function (DUF1176); Region: DUF1176; pfam06674
568708011442	1 probable transmembrane helix predicted for STM_MW24951 by TMHMM2.0 at aa 5-24
568708011443	Signal peptide predicted for STM_MW24951 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.999 between residues 21 and 22
568708011444	GDP-mannose pyrophosphatase NudK; Provisional; Region: PRK15009
568708011445	ADP-ribose pyrophosphatase (ADPRase) catalyzes the hydrolysis of ADP-ribose and a variety of additional ADP-sugar conjugates to AMP and ribose-5-phosphate. Like other members of the Nudix hydrolase superfamily, it requires a divalent cation, such as Mg2+; Region: ADPRase_NUDT5; cd03424
568708011446	dimer interface [polypeptide binding]; other site
568708011447	ADP-ribose binding site [chemical binding]; other site
568708011448	active site
568708011449	nudix motif; other site
568708011450	metal binding site [ion binding]; metal-binding site
568708011452	putative periplasmic esterase; Provisional; Region: PRK03642
568708011453	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
568708011454	Signal peptide predicted for STM_MW24971 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 19 and 20
568708011456	putative oxidoreductase Fe-S binding subunit; Reviewed; Region: PRK12769
568708011457	4Fe-4S binding domain; Region: Fer4; pfam00037
568708011458	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
568708011459	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
568708011462	nitrate/nitrite sensor protein NarQ; Provisional; Region: PRK10935
568708011463	Type IV pili methyl-accepting chemotaxis transducer N-term; Region: PilJ; pfam13675
568708011464	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
568708011465	dimerization interface [polypeptide binding]; other site
568708011466	Histidine kinase; Region: HisKA_3; pfam07730
568708011467	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708011468	ATP binding site [chemical binding]; other site
568708011469	Mg2+ binding site [ion binding]; other site
568708011470	G-X-G motif; other site
568708011471	Signal peptide predicted for STM_MW24991 by SignalP 2.0 HMM (Signal peptide probability 0.901) with cleavage site probability 0.731 between residues 40 and 41
568708011472	2 probable transmembrane helices predicted for STM_MW24991 by TMHMM2.0 at aa 15-37 and 147-169
568708011476	aminoglycoside/multidrug efflux system; Provisional; Region: PRK10555
568708011477	Protein export membrane protein; Region: SecD_SecF; cl14618
568708011478	Signal peptide predicted for STM_MW25001 by SignalP 2.0 HMM (Signal peptide probability 0.914) with cleavage site probability 0.584 between residues 34 and 35
568708011480	11 probable transmembrane helices predicted for STM_MW25001 by TMHMM2.0 at aa 10-32, 337-359, 364-386, 438-460, 470-492, 538-560, 868-890, 897-919, 924-946, 972-994 and 1004-1026
568708011481	Arsenate Reductase (ArsC) family, Yffb subfamily; Yffb is an uncharacterized bacterial protein encoded by the yffb gene, related to the thioredoxin-fold arsenic reductases, ArsC. The structure of Yffb and the conservation of the catalytic cysteine...; Region: ArsC_Yffb; cd03035
568708011482	ArsC family; Region: ArsC; pfam03960
568708011483	putative catalytic residues [active]
568708011485	succinyl-diaminopimelate desuccinylase; Reviewed; Region: PRK13009
568708011486	M20 Peptidase proteobacterial DapE encoded N-succinyl-L,L-diaminopimelic acid desuccinylase; Region: M20_DapE_proteobac; cd03891
568708011487	metal binding site [ion binding]; metal-binding site
568708011488	dimer interface [polypeptide binding]; other site
568708011491	Predicted P-loop ATPase fused to an acetyltransferase [General function prediction only]; Region: COG1444
568708011492	Helicase; Region: Helicase_RecD; pfam05127
568708011493	GNAT acetyltransferase 2; Region: GNAT_acetyltr_2; pfam13718
568708011494	Possible tRNA binding domain; Region: tRNA_bind_2; pfam13725
568708011498	Predicted metalloprotease [General function prediction only]; Region: COG2321
568708011499	Putative neutral zinc metallopeptidase; Region: Zn_peptidase; pfam04228
568708011501	1 probable transmembrane helix predicted for STM_MW25041 by TMHMM2.0 at aa 38-60
568708011502	phosphoribosylaminoimidazole-succinocarboxamide synthase; Reviewed; Region: PRK09362
568708011503	bacterial and archaeal 5-aminoimidazole-4-(N-succinylcarboxamide) ribonucleotide (SAICAR) synthase; Region: SAICAR_synt_PurC; cd01415
568708011504	ATP binding site [chemical binding]; other site
568708011505	active site
568708011506	substrate binding site [chemical binding]; other site
568708011508	lipoprotein; Provisional; Region: PRK11679
568708011509	NlpB/DapX lipoprotein; Region: Lipoprotein_18; pfam06804
568708011511	Dihydrodipicolinate synthase (DHDPS); Region: DHDPS; cd00950
568708011512	dihydrodipicolinate synthase; Region: dapA; TIGR00674
568708011513	dimer interface [polypeptide binding]; other site
568708011514	active site
568708011515	catalytic residue [active]
568708011517	glycine cleavage system transcriptional repressor; Provisional; Region: gcvR; PRK11589
568708011518	ACT domains that comprise the Glycine Cleavage System Transcriptional Repressor (GcvR) protein, and other related domains; Region: ACT_GcvR_1; cd04893
568708011519	ACT domains are commonly involved in specifically binding an amino acid or other small ligand leading to regulation of the enzyme; Region: ACT; cl09141
568708011521	Peroxiredoxin [Posttranslational modification, protein turnover, chaperones]; Region: AhpC; COG0450
568708011522	Peroxiredoxin (PRX) family, Bacterioferritin comigratory protein (BCP) subfamily; composed of thioredoxin-dependent thiol peroxidases, widely expressed in pathogenic bacteria, that protect cells against toxicity from reactive oxygen species by reducing...; Region: PRX_BCP; cd03017
568708011523	catalytic triad [active]
568708011525	Predicted permease, member of the PurR regulon [General function prediction only]; Region: yhhT; COG0628
568708011526	Domain of unknown function DUF20; Region: UPF0118; pfam01594
568708011527	7 probable transmembrane helices predicted for STM_MW25101 by TMHMM2.0 at aa 25-59, 79-101, 162-184, 224-243, 258-280, 285-307 and 317-339
568708011529	Putative Zn-dependent protease, contains TPR repeats [General function prediction only]; Region: COG4783
568708011530	Peptidase family M48; Region: Peptidase_M48; cl12018
568708011531	Signal peptide predicted for STM_MW25111 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 27 and 28
568708011533	Arsenate Reductase (ArsC) family, ArsC subfamily; arsenic reductases similar to that encoded by arsC on the R733 plasmid of Escherichia coli. E. coli ArsC catalyzes the reduction of arsenate [As(V)] to arsenite [As(III)], the first step in the...; Region: ArsC_ArsC; cd03034
568708011534	ArsC family; Region: ArsC; pfam03960
568708011535	catalytic residues [active]
568708011537	ATPase involved in DNA replication initiation [DNA replication, recombination, and repair]; Region: DnaA; COG0593
568708011538	DNA replication initiation factor; Provisional; Region: PRK08084
568708011540	uracil transporter; Provisional; Region: PRK10720
568708011542	12 probable transmembrane helices predicted for STM_MW25141 by TMHMM2.0 at aa 13-35, 39-61, 68-85, 89-108, 121-143, 158-180, 185-207, 227-249, 304-326, 331-353, 365-387 and 392-411
568708011543	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
568708011544	active site
568708011546	phosphoribosylaminoimidazole synthetase; Provisional; Region: PRK05385
568708011547	PurM (Aminoimidazole Ribonucleotide [AIR] synthetase), one of eleven enzymes required for purine biosynthesis, catalyzes the conversion of formylglycinamide ribonucleotide (FGAM) and ATP to AIR, ADP, and Pi, the fifth step in de novo purine biosynthesis; Region: PurM; cd02196
568708011548	dimerization interface [polypeptide binding]; other site
568708011549	putative ATP binding site [chemical binding]; other site
568708011552	phosphoribosylglycinamide formyltransferase; Reviewed; Region: purN; PRK05647
568708011553	Phosphoribosylglycinamide formyltransferase (GAR transformylase, GART); Region: FMT_core_GART; cd08645
568708011554	active site
568708011555	substrate binding site [chemical binding]; other site
568708011556	cosubstrate binding site; other site
568708011557	catalytic site [active]
568708011559	Polyphosphate kinase [Inorganic ion transport and metabolism]; Region: Ppk; COG0855
568708011560	Polyphosphate kinase N-terminal domain; Region: PP_kinase_N; pfam13089
568708011561	Polyphosphate kinase middle domain; Region: PP_kinase; pfam02503
568708011562	Catalytic domain of phospholipase D superfamily proteins; Region: PLDc_SF; cl15239
568708011563	putative active site [active]
568708011564	catalytic site [active]
568708011565	Catalytic C-terminal domain, second repeat, of Escherichia coli polyphosphate kinase 1 and similar proteins; Region: PLDc_EcPPK1_C2_like; cd09167
568708011566	domain interface [polypeptide binding]; other site
568708011567	active site
568708011568	catalytic site [active]
568708011570	exopolyphosphatase; Provisional; Region: PRK10854
568708011571	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cd00012
568708011572	nucleotide binding site [chemical binding]; other site
568708011574	MASE1; Region: MASE1; pfam05231
568708011575	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
568708011576	diguanylate cyclase; Region: GGDEF; smart00267
568708011577	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
568708011579	8 probable transmembrane helices predicted for STM_MW25201 by TMHMM2.0 at aa 15-37, 44-66, 81-103, 124-146, 166-188, 216-238, 253-275 and 295-317
568708011581	Signal peptide predicted for STM_MW25201 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.653 between residues 36 and 37
568708011582	Protein of unknown function (DUF1493); Region: DUF1493; pfam07377
568708011584	Integrase core domain; Region: rve; pfam00665
568708011586	GMP synthase; Reviewed; Region: guaA; PRK00074
568708011587	Type 1 glutamine amidotransferase (GATase1) domain found in GMP synthetase; Region: GATase1_GMP_Synthase; cd01742
568708011588	AMP/PPi binding site [chemical binding]; other site
568708011589	candidate oxyanion hole; other site
568708011590	catalytic triad [active]
568708011591	potential glutamine specificity residues [chemical binding]; other site
568708011592	The C-terminal domain of GMP synthetase. It contains two subdomains; the ATP pyrophosphatase domain which closes to the N-termial and the dimerization domain at C-terminal end. The ATP-PPase is a twisted, five-stranded parallel beta-sheet sandwiched...; Region: GMP_synthase_C; cd01997
568708011593	ATP Binding subdomain [chemical binding]; other site
568708011594	Ligand Binding sites [chemical binding]; other site
568708011595	Dimerization subdomain; other site
568708011599	inosine 5'-monophosphate dehydrogenase; Reviewed; Region: PRK05567
568708011600	TIM barrel proteins share a structurally conserved phosphate binding motif and in general share an eight beta/alpha closed barrel structure. Specific for this family is the conserved phosphate binding site at the edges of strands 7 and 8. The phosphate...; Region: TIM_phosphate_binding; cl17186
568708011601	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains in the inosine 5' monophosphate dehydrogenase (IMPDH) protein.  IMPDH is an essential enzyme that catalyzes the first step unique to GTP synthesis, playing a...; Region: CBS_pair_IMPDH; cd04601
568708011602	IMPDH: The catalytic domain of the inosine monophosphate dehydrogenase. IMPDH catalyzes the NAD-dependent oxidation of inosine 5'-monophosphate (IMP) to xanthosine 5' monophosphate (XMP). It is a rate-limiting step in the de novo synthesis of...; Region: IMPDH; cd00381
568708011603	active site
568708011606	exodeoxyribonuclease VII large subunit; Reviewed; Region: xseA; PRK00286
568708011607	ExoVII_LU_OBF: A subfamily of OB folds corresponding to the N-terminal OB-fold domain of Escherichia coli exodeoxyribonuclease VII (ExoVII) large subunit. E. coli ExoVII is composed of two non-identical subunits. E. coli ExoVII is a...; Region: ExoVII_LU_OBF; cd04489
568708011608	generic binding surface II; other site
568708011609	generic binding surface I; other site
568708011612	AIDA autotransporter-like protein ShdA; Provisional; Region: PRK15319
568708011613	Autotransporter-associated beta strand repeat; Region: Autotrns_rpt; pfam12951
568708011614	Autotransporter-associated beta strand repeat; Region: Autotrns_rpt; pfam12951
568708011615	Pertactin-like passenger domains (virulence factors), C-terminal, subgroup 2, of autotransporter proteins of the type V secretion system of Gram-negative bacteria. This subgroup includes the passenger domains of the nonprotease autotransporters, Ag43; Region: PL2_Passenger_AT; cd01344
568708011616	Autotransporter beta-domain; Region: Autotransporter; smart00869
568708011618	pfam_scan;Pfam:PF05688; E()=9.7E-20;score=69.3;query209-255;description=DUF824; pfam_scan;Pfam:PF05689; E()=6.9E-52;score=175.2;query 278-459;description=DUF823; tmhmm; query 1-2434
568708011621	outer membrane protein RatA; Provisional; Region: PRK15315
568708011622	Salmonella repeat of unknown function (DUF824); Region: DUF824; pfam05688
568708011623	Salmonella repeat of unknown function (DUF823); Region: DUF823; pfam05689
568708011624	Salmonella repeat of unknown function (DUF823); Region: DUF823; pfam05689
568708011625	Salmonella repeat of unknown function (DUF824); Region: DUF824; pfam05688
568708011626	Salmonella repeat of unknown function (DUF823); Region: DUF823; pfam05689
568708011627	Salmonella repeat of unknown function (DUF824); Region: DUF824; pfam05688
568708011628	Salmonella repeat of unknown function (DUF823); Region: DUF823; pfam05689
568708011629	Salmonella repeat of unknown function (DUF824); Region: DUF824; pfam05688
568708011630	Salmonella repeat of unknown function (DUF823); Region: DUF823; pfam05689
568708011631	Salmonella repeat of unknown function (DUF824); Region: DUF824; pfam05688
568708011632	Salmonella repeat of unknown function (DUF823); Region: DUF823; pfam05689
568708011635	1 probable transmembrane helix predicted for STM_MW25321 by TMHMM2.0 at aa 13-32
568708011636	Signal peptide predicted for STM_MW25321 by SignalP 2.0 HMM (Signal peptide probability 0.994) with cleavage site probability 0.905 between residues 30 and 31
568708011637	intimin-like protein SinH; Provisional; Region: PRK15318
568708011638	1 probable transmembrane helix predicted for STM_MW25331 by TMHMM2.0 at aa 12-29
568708011639	Signal peptide predicted for STM_MW25331 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.951 between residues 28 and 29
568708011640	intimin-like protein SinH; Provisional; Region: PRK15318
568708011641	Protein of unknown function (DUF3442); Region: DUF3442; pfam11924
568708011642	Signal peptide predicted for STM_MW25341 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.828 between residues 22 and 23
568708011643	Protein of unknown function (DUF1407); Region: DUF1407; pfam07191
568708011645	GTP-binding protein Der; Reviewed; Region: PRK00093
568708011646	EngA1 GTPase contains the first domain of EngA; Region: EngA1; cd01894
568708011647	G1 box; other site
568708011648	GTP/Mg2+ binding site [chemical binding]; other site
568708011649	Switch I region; other site
568708011650	G2 box; other site
568708011651	Switch II region; other site
568708011652	G3 box; other site
568708011653	G4 box; other site
568708011654	G5 box; other site
568708011655	EngA2 GTPase contains the second domain of EngA; Region: EngA2; cd01895
568708011656	G1 box; other site
568708011657	GTP/Mg2+ binding site [chemical binding]; other site
568708011658	Switch I region; other site
568708011659	G2 box; other site
568708011660	G3 box; other site
568708011661	Switch II region; other site
568708011662	G4 box; other site
568708011663	G5 box; other site
568708011666	outer membrane biogenesis protein BamB; Provisional; Region: PRK11138
568708011667	PQQ-dependent dehydrogenases and related proteins; Region: PQQ_DH_like; cl11493
568708011668	Trp docking motif [polypeptide binding]; other site
568708011669	active site
568708011671	Signal peptide predicted for STM_MW25371 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.942 between residues 24 and 25
568708011672	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2976
568708011673	Uncharacterized protein conserved in bacteria (DUF2133); Region: DUF2133; pfam09976
568708011675	1 probable transmembrane helix predicted for STM_MW25381 by TMHMM2.0 at aa 21-43
568708011676	histidyl-tRNA synthetase; Reviewed; Region: hisS; PRK00037
568708011677	Class II Histidinyl-tRNA synthetase (HisRS)-like catalytic core domain. HisRS is a homodimer. It is responsible for the attachment of histidine to the 3' OH group of ribose of the appropriate tRNA. This domain is primarily responsible for...; Region: HisRS-like_core; cd00773
568708011678	dimer interface [polypeptide binding]; other site
568708011679	motif 1; other site
568708011680	active site
568708011681	motif 2; other site
568708011682	motif 3; other site
568708011683	HisRS Histidyl-anticodon binding domain. HisRS belongs to class II aminoacyl-tRNA synthetases (aaRS). This alignment contains the anticodon binding domain, which is responsible for specificity in tRNA-binding, so that the activated amino acid is...; Region: HisRS_anticodon; cd00859
568708011684	anticodon binding site; other site
568708011687	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase; Reviewed; Region: ispG; PRK00366
568708011688	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase; Validated; Region: PRK00694
568708011689	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase; Validated; Region: PRK00694
568708011691	cytoskeletal protein RodZ; Provisional; Region: PRK10856
568708011692	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
568708011693	non-specific DNA binding site [nucleotide binding]; other site
568708011694	salt bridge; other site
568708011695	sequence-specific DNA binding site [nucleotide binding]; other site
568708011696	Domain of unknown function (DUF4115); Region: DUF4115; pfam13464
568708011698	1 probable transmembrane helix predicted for STM_MW25411 by TMHMM2.0 at aa 111-133
568708011699	ribosomal RNA large subunit methyltransferase N; Provisional; Region: PRK11194
568708011700	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
568708011701	FeS/SAM binding site; other site
568708011703	Nucleoside diphosphate kinase Group I (NDPk_I)-like: NDP kinase domains are present in a large family of structurally and functionally conserved proteins from bacteria to humans that generally catalyze the transfer of gamma-phosphates of a nucleoside...; Region: NDPk_I; cd04413
568708011704	active site
568708011705	multimer interface [polypeptide binding]; other site
568708011707	4Fe-4S binding domain; Region: Fer4; pfam00037
568708011708	hydrogenase 4 subunit H; Validated; Region: PRK08222
568708011710	DMSO reductase anchor subunit [General function prediction only]; Region: DmsC; COG3302
568708011712	8 probable transmembrane helices predicted for STM_MW25451 by TMHMM2.0 at aa 4-26, 47-69, 84-103, 110-132, 142-164, 171-193, 221-240 and 247-266
568708011713	DMSO reductase, iron-sulfur subunit; Region: DMSO_dmsB; TIGR02951
568708011714	4Fe-4S binding domain; Region: Fer4; pfam00037
568708011716	anaerobic dimethyl sulfoxide reductase, A subunit, DmsA/YnfE family; Region: dmsA_ynfE; TIGR02166
568708011717	This CD (MopB_DmsA-EC) includes the DmsA enzyme of the dmsABC operon encoding the anaerobic dimethylsulfoxide reductase (DMSOR) of Escherichia coli and other related DMSOR-like enzymes. Unlike other DMSOR-like enzymes, this group has a  predicted...; Region: MopB_DmsA-EC; cd02770
568708011718	putative [Fe4-S4] binding site [ion binding]; other site
568708011719	putative molybdopterin cofactor binding site [chemical binding]; other site
568708011720	The MopB_CT_DmsA-EC CD includes the DmsA enzyme of the dmsABC operon encoding the anaerobic dimethylsulfoxide reductase (DMSOR) of Escherichia coli and other related DMSOR-like enzymes. Unlike other DMSOR-like enzymes, this group has a  predicted...; Region: MopB_CT_DmsA-EC; cd02794
568708011721	putative molybdopterin cofactor binding site; other site
568708011725	Signal peptide predicted for STM_MW25471 by SignalP 2.0 HMM (Signal peptide probability 0.981) with cleavage site probability 0.650 between residues 48 and 49
568708011726	penicillin-binding protein 1C; Provisional; Region: PRK11240
568708011727	Transglycosylase; Region: Transgly; pfam00912
568708011728	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; cl17760
568708011729	Penicillin-Binding Protein C-terminus Family; Region: BiPBP_C; pfam06832
568708011733	1 probable transmembrane helix predicted for STM_MW25481 by TMHMM2.0 at aa 9-28
568708011734	Signal peptide predicted for STM_MW25481 by SignalP 2.0 HMM (Signal peptide probability 0.996) with cleavage site probability 0.996 between residues 27 and 28
568708011735	Large extracellular alpha-helical protein [General function prediction only]; Region: COG2373
568708011736	MG2 domain; Region: A2M_N; pfam01835
568708011737	Proteins similar to alpha2-macroglobulin (alpha (2)-M).  Alpha (2)-M is a major carrier protein in serum. It is a broadly specific proteinase inhibitor.  The structural thioester of alpha (2)-M, is involved in the immobilization and entrapment of...; Region: A2M_like; cd02891
568708011738	surface patch; other site
568708011739	thioester region; other site
568708011740	specificity defining residues; other site
568708011743	Signal peptide predicted for STM_MW25491 by SignalP 2.0 HMM (Signal peptide probability 0.715) with cleavage site probability 0.464 between residues 21 and 22
568708011744	3-mercaptopyruvate sulfurtransferase; Provisional; Region: sseA; PRK11493
568708011745	Thiosulfate sulfurtransferase (TST), N-terminal, inactive domain. TST contains 2 copies of the Rhodanese Homology Domain; this is the 1st repeat, which does not contain the catalytically active Cys residue. The role of the 1st repeat is uncertain, but it...; Region: TST_Repeat_1; cd01448
568708011746	active site residue [active]
568708011747	Thiosulfate sulfurtransferase (TST), C-terminal, catalytic domain. TST contains 2 copies of the Rhodanese Homology Domain; this is the second repeat. Only the second repeat contains the catalytically active Cys residue; Region: TST_Repeat_2; cd01449
568708011748	active site residue [active]
568708011750	enhanced serine sensitivity protein SseB; Provisional; Region: PRK11611
568708011752	aminopeptidase B; Provisional; Region: PRK05015
568708011753	Peptidase; Region: DUF3663; pfam12404
568708011754	Cytosol aminopeptidase family, N-terminal and catalytic domains.  Family M17 contains zinc- and manganese-dependent exopeptidases ( EC  3.4.11.1), including leucine aminopeptidase. They catalyze removal of amino acids from the N-terminus of a protein and...; Region: Peptidase_M17; cd00433
568708011755	interface (dimer of trimers) [polypeptide binding]; other site
568708011756	Substrate-binding/catalytic site; other site
568708011757	Zn-binding sites [ion binding]; other site
568708011759	hypothetical protein; Provisional; Region: PRK10721
568708011761	Ferredoxin [Energy production and conversion]; Region: Fdx; COG0633
568708011762	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
568708011763	catalytic loop [active]
568708011764	iron binding site [ion binding]; other site
568708011766	chaperone protein HscA; Provisional; Region: hscA; PRK05183
568708011767	Nucleotide-binding domain of HscA and similar proteins; Region: HscA_like_NBD; cd10236
568708011768	nucleotide binding site [chemical binding]; other site
568708011769	putative NEF/HSP70 interaction site [polypeptide binding]; other site
568708011770	SBD interface [polypeptide binding]; other site
568708011772	co-chaperone HscB; Provisional; Region: hscB; PRK05014
568708011773	DnaJ domain; Region: DnaJ; pfam00226
568708011774	HSP70 interaction site [polypeptide binding]; other site
568708011775	HSCB C-terminal oligomerisation domain; Region: HSCB_C; pfam07743
568708011778	iron-sulfur cluster assembly protein; Provisional; Region: iscA; PRK09502
568708011780	NifU homolog involved in Fe-S cluster formation [Energy production and conversion]; Region: IscU; COG0822
568708011781	Iron-sulfur cluster scaffold-like proteins; Region: IscU_like; cd06664
568708011782	trimerization site [polypeptide binding]; other site
568708011783	active site
568708011785	cysteine desulfurase; Provisional; Region: PRK14012
568708011786	cysteine desulfurase NifS; Region: FeS_nifS; TIGR03402
568708011787	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
568708011788	catalytic residue [active]
568708011790	DNA-binding transcriptional regulator IscR; Provisional; Region: PRK10857
568708011791	Rrf2 family protein; Region: rrf2_super; TIGR00738
568708011793	tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ; Provisional; Region: PRK15114
568708011794	SpoU rRNA Methylase family; Region: SpoU_methylase; cl17307
568708011796	Archaeal fructose-1,6-bisphosphatase and related enzymes of inositol monophosphatase family [Carbohydrate transport and metabolism]; Region: SuhB; COG0483
568708011797	IMPase, inositol monophosphatase and related domains. A family of Mg++ dependent phosphatases, inhibited by lithium, many of which may act on inositol monophosphate substrate. They dephosphorylate inositol phosphate to generate inositol, which may be...; Region: IMPase; cd01639
568708011798	active site
568708011799	dimerization interface [polypeptide binding]; other site
568708011801	Hydrolases of the alpha/beta superfamily [General function prediction only]; Region: COG1073
568708011802	Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326
568708011803	1 probable transmembrane helix predicted for STM_MW25641 by TMHMM2.0 at aa 13-35
568708011805	sulfite reductase, subunit A; Region: sulfite_red_A; TIGR02910
568708011806	The HCP family of iron-sulfur proteins includes hybrid cluster protein (HCP), acetyl-CoA synthase (ACS), and carbon monoxide dehydrogenase (CODH), all of which contain [Fe4-S4] metal clusters at their active sites. These proteins have a conserved...; Region: HCP_like; cl14655
568708011807	anaerobic sulfite reductase subunit B; Provisional; Region: PRK08221
568708011808	Anaerobic sulfite reductase contains an FAD and NADPH binding module with structural similarity to ferredoxin reductase and sequence similarity to dihydroorotate dehydrogenases. Clostridium pasteurianum inducible dissimilatory type sulfite reductase is...; Region: sulfite_reductase_like; cd06221
568708011809	FAD binding pocket [chemical binding]; other site
568708011810	FAD binding motif [chemical binding]; other site
568708011811	phosphate binding motif [ion binding]; other site
568708011812	beta-alpha-beta structure motif; other site
568708011813	NAD binding pocket [chemical binding]; other site
568708011814	Iron coordination center [ion binding]; other site
568708011818	sulfite reductase, subunit C; Region: sulfite_red_C; TIGR02912
568708011819	Nitrite/Sulfite reductase ferredoxin-like half domain; Region: NIR_SIR_ferr; pfam03460
568708011820	The HCP family of iron-sulfur proteins includes hybrid cluster protein (HCP), acetyl-CoA synthase (ACS), and carbon monoxide dehydrogenase (CODH), all of which contain [Fe4-S4] metal clusters at their active sites. These proteins have a conserved...; Region: HCP_like; cl14655
568708011824	ABC-type uncharacterized transport system, permease component [General function prediction only]; Region: COG2215
568708011825	7 probable transmembrane helices predicted for STM_MW25681 by TMHMM2.0 at aa 13-35, 75-97, 110-132, 147-169, 225-247, 251-273 and 294-316
568708011827	ABC-type uncharacterized transport system, periplasmic component [General function prediction only]; Region: COG3683
568708011829	1 probable transmembrane helix predicted for STM_MW25691 by TMHMM2.0 at aa 7-24
568708011830	Signal peptide predicted for STM_MW25691 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.957 between residues 22 and 23
568708011831	stationary phase inducible protein CsiE; Provisional; Region: PRK11564
568708011832	PRD domain; Region: PRD; pfam00874
568708011833	PRD domain; Region: PRD; pfam00874
568708011835	putative 3-phenylpropionic acid transporter; Provisional; Region: PRK11128
568708011836	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708011837	putative substrate translocation pore; other site
568708011839	12 probable transmembrane helices predicted for STM_MW25711 by TMHMM2.0 at aa 9-31, 41-63, 70-89, 93-111, 132-154, 158-180, 207-229, 234-256, 269-288, 293-315, 328-350 and 354-371
568708011840	serine hydroxymethyltransferase; Reviewed; Region: glyA; PRK00011
568708011841	Serine-glycine hydroxymethyltransferase (SHMT). This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). SHMT carries out interconversion of serine and glycine; it catalyzes the transfer of hydroxymethyl...; Region: SHMT; cd00378
568708011842	dimer interface [polypeptide binding]; other site
568708011843	active site
568708011844	glycine-pyridoxal phosphate binding site [chemical binding]; other site
568708011845	folate binding site [chemical binding]; other site
568708011847	bifunctional nitric oxide dioxygenase/dihydropteridine reductase 2; Provisional; Region: PRK13289
568708011848	Globins are heme proteins, which bind and transport oxygen. This family summarizes a diverse set of homologous protein domains, including: (1) tetrameric vertebrate hemoglobins, which are the major protein component of erythrocytes and transport oxygen...; Region: globin; cd01040
568708011849	heme-binding site [chemical binding]; other site
568708011850	FAD_NAD(P)H binding domain of flavohemoglobin. Flavohemoglobins have a globin domain containing a B-type heme fused with a ferredoxin reductase-like FAD/NAD-binding domain. Flavohemoglobins detoxify nitric oxide (NO) via an NO dioxygenase reaction. The...; Region: flavohem_like_fad_nad_binding; cd06184
568708011851	FAD binding pocket [chemical binding]; other site
568708011852	FAD binding motif [chemical binding]; other site
568708011853	phosphate binding motif [ion binding]; other site
568708011854	beta-alpha-beta structure motif; other site
568708011855	NAD binding pocket [chemical binding]; other site
568708011856	Heme binding  pocket [chemical binding]; other site
568708011860	DNA-binding transcriptional activator CadC; Provisional; Region: PRK10153
568708011861	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
568708011862	DNA binding site [nucleotide binding]
568708011864	1 probable transmembrane helix predicted for STM_MW25741 by TMHMM2.0 at aa 162-184
568708011865	lysine/cadaverine antiporter; Provisional; Region: cadB; PRK10435
568708011866	Signal peptide predicted for STM_MW25751 by SignalP 2.0 HMM (Signal peptide probability 0.857) with cleavage site probability 0.420 between residues 26 and 27
568708011867	12 probable transmembrane helices predicted for STM_MW25751 by TMHMM2.0 at aa 7-29, 39-58, 93-115, 120-142, 149-171, 186-208, 220-242, 265-287, 322-344, 354-371, 384-403 and 407-424
568708011869	lysine decarboxylase CadA; Provisional; Region: PRK15400
568708011870	Orn/Lys/Arg decarboxylase, N-terminal domain; Region: OKR_DC_1_N; pfam03709
568708011871	Ornithine decarboxylase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD corresponds to ornithine decarboxylase (ODC), arginine decarboxylase (ADC) and lysine...; Region: Orn_deC_like; cd00615
568708011872	homodimer interface [polypeptide binding]; other site
568708011873	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708011874	catalytic residue [active]
568708011875	Orn/Lys/Arg decarboxylase, C-terminal domain; Region: OKR_DC_1_C; pfam03711
568708011879	Dipeptide/tripeptide permease [Amino acid transport and metabolism]; Region: PTR2; COG3104
568708011880	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708011881	putative substrate translocation pore; other site
568708011882	POT family; Region: PTR2; pfam00854
568708011883	14 probable transmembrane helices predicted for STM_MW25771 by TMHMM2.0 at aa 9-31, 46-68, 71-93, 103-125, 138-160, 164-186, 207-229, 234-251, 264-281, 307-329, 341-363, 373-395, 407-429 and 449-471
568708011885	nitrogen regulatory protein P-II 1; Provisional; Region: PRK10858
568708011886	Nitrogen regulatory protein P-II; Region: P-II; smart00938
568708011888	response regulator GlrR; Provisional; Region: PRK15115
568708011889	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708011890	active site
568708011891	phosphorylation site [posttranslational modification]
568708011892	intermolecular recognition site; other site
568708011893	dimerization interface [polypeptide binding]; other site
568708011894	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708011895	Walker A motif; other site
568708011896	ATP binding site [chemical binding]; other site
568708011897	Walker B motif; other site
568708011898	arginine finger; other site
568708011901	hypothetical protein; Provisional; Region: PRK10722
568708011902	Signal peptide predicted for STM_MW25801 by SignalP 2.0 HMM (Signal peptide probability 0.780) with cleavage site probability 0.716 between residues 41 and 42
568708011903	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
568708011904	HAMP domain; Region: HAMP; pfam00672
568708011905	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
568708011906	dimer interface [polypeptide binding]; other site
568708011907	phosphorylation site [posttranslational modification]
568708011908	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708011909	ATP binding site [chemical binding]; other site
568708011910	Mg2+ binding site [ion binding]; other site
568708011911	G-X-G motif; other site
568708011913	2 probable transmembrane helices predicted for STM_MW25811 by TMHMM2.0 at aa 15-37 and 179-201
568708011915	Signal peptide predicted for STM_MW25811 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.921 between residues 34 and 35
568708011916	phosphoribosylformylglycinamidine synthase; Provisional; Region: PRK05297
568708011917	PurL subunit of the formylglycinamide ribonucleotide amidotransferase (FGAR-AT), first repeat. FGAR-AT catalyzes the ATP-dependent conversion of formylglycinamide ribonucleotide (FGAR) and glutamine to formylglycinamidine ribonucleotide (FGAM), ADP; Region: PurL_repeat1; cd02203
568708011918	dimerization interface [polypeptide binding]; other site
568708011919	ATP binding site [chemical binding]; other site
568708011920	Formylglycinamide ribonucleotide amidotransferase (FGAR-AT) catalyzes the ATP-dependent conversion of formylglycinamide ribonucleotide (FGAR) and glutamine to formylglycinamidine ribonucleotide (FGAM), ADP, phosphate, and glutamate in the fourth step of...; Region: PurL; cd02193
568708011921	dimerization interface [polypeptide binding]; other site
568708011922	ATP binding site [chemical binding]; other site
568708011923	Type 1 glutamine amidotransferase (GATase1)-like domain found in Formylglycinamide ribonucleotide amidotransferase; Region: GATase1_FGAR_AT; cd01740
568708011924	putative active site [active]
568708011925	catalytic triad [active]
568708011928	membrane-bound lytic transglycosylase F; Provisional; Region: PRK10859
568708011929	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
568708011930	substrate binding pocket [chemical binding]; other site
568708011931	membrane-bound complex binding site; other site
568708011932	hinge residues; other site
568708011933	Lytic Transglycosylase (LT)  and Goose Egg White Lysozyme (GEWL) domain. Members include the soluble and insoluble membrane-bound LTs in bacteria, the LTs in bacteriophage lambda, as well as, the eukaryotic "goose-type" lysozymes (GEWL).  LTs...; Region: LT_GEWL; cd00254
568708011934	N-acetyl-D-glucosamine binding site [chemical binding]; other site
568708011935	catalytic residue [active]
568708011936	Signal peptide predicted for STM_MW25831 by SignalP 2.0 HMM (Signal peptide probability 0.941) with cleavage site probability 0.504 between residues 21 and 22
568708011937	1 probable transmembrane helix predicted for STM_MW25831 by TMHMM2.0 at aa 7-29
568708011940	Nucleoside deaminases include adenosine, guanine and cytosine deaminases. These enzymes are Zn dependent and catalyze the deamination of nucleosides. The zinc ion in the active site plays a central role in the proposed catalytic mechanism, activating a...; Region: nucleoside_deaminase; cd01285
568708011941	nucleoside/Zn binding site; other site
568708011942	dimer interface [polypeptide binding]; other site
568708011943	catalytic motif [active]
568708011945	hypothetical protein; Provisional; Region: PRK11590
568708011946	Phosphoserine phosphatase [Amino acid transport and metabolism]; Region: SerB; COG0560
568708011947	1 probable transmembrane helix predicted for STM_MW25851 by TMHMM2.0 at aa 35-54
568708011948	PTS system N-acetylmuramic acid transporter subunits EIIBC; Reviewed; Region: murP; PRK09586
568708011949	PTS_IIB, PTS system, glucose/sucrose specific IIB subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIB_glc; cd00212
568708011950	active site turn [active]
568708011951	phosphorylation site [posttranslational modification]
568708011952	Phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific [Carbohydrate transport and metabolism]; Region: PtsG; COG1263
568708011953	9 probable transmembrane helices predicted for STM_MW25861 by TMHMM2.0 at aa 116-138, 153-175, 182-204, 214-231, 287-309, 324-346, 359-381, 396-418 and 425-447
568708011956	N-acetylmuramic acid-6-phosphate etherase; Reviewed; Region: murQ; PRK05441
568708011957	N-acetylmuramic acid 6-phosphate etherase. Members of this family contain the SIS (Sugar ISomerase) domain. The SIS domain is found in many phosphosugar isomerases and phosphosugar binding proteins. The bacterial cell wall sugar N-acetylmuramic acid...; Region: SIS_Etherase; cd05007
568708011958	putative active site [active]
568708011960	Helix-turn-helix domain, rpiR family; Region: HTH_6; pfam01418
568708011961	putative DNA-binding transcriptional regulator; Provisional; Region: PRK11557
568708011962	RpiR-like protein. RpiR contains a SIS (Sugar ISomerase) domain, which is found in many phosphosugar isomerases and phosphosugar binding proteins. In E. coli, rpiR negatively regulates the expression of rpiB gene. Both rpiB and rpiA are ribose phosphate...; Region: SIS_RpiR; cd05013
568708011963	putative active site [active]
568708011966	2-dehydropantoate 2-reductase; Provisional; Region: PRK12921
568708011967	Ketopantoate reductase PanE/ApbA; Region: ApbA; pfam02558
568708011968	Ketopantoate reductase PanE/ApbA C terminal; Region: ApbA_C; pfam08546
568708011971	oxalate/formate antiporter family transporter; Region: 2A0111; TIGR00890
568708011972	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708011973	putative substrate translocation pore; other site
568708011974	12 probable transmembrane helices predicted for STM_MW25901 by TMHMM2.0 at aa 10-29, 42-64, 74-93, 98-115, 130-152, 165-184, 213-235, 242-264, 274-296, 301-323, 338-357 and 364-386
568708011976	Transcriptional regulator [Transcription]; Region: LysR; COG0583
568708011977	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708011978	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
568708011979	dimerization interface [polypeptide binding]; other site
568708011982	4Fe-4S dicluster domain; Region: Fer4_7; pfam12838
568708011984	4'-phosphopantetheinyl transferase; Provisional; Region: acpS; PRK00070
568708011986	Pyridoxine 5'-phosphate (PNP) synthase domain; pyridoxal 5'-phosphate is the active form of vitamin B6 that acts as an essential, ubiquitous coenzyme in amino acid metabolism. In bacteria, formation of pyridoxine 5'-phosphate is a step in...; Region: PNPsynthase; cd00003
568708011987	active site
568708011988	hydrophilic channel; other site
568708011989	dimerization interface [polypeptide binding]; other site
568708011990	catalytic residues [active]
568708011991	active site lid [active]
568708011993	DNA repair protein RecO; Reviewed; Region: recO; PRK00085
568708011994	Recombination protein O N terminal; Region: RecO_N; pfam11967
568708011995	Recombination protein O C terminal; Region: RecO_C; pfam02565
568708011997	GTPase Era; Reviewed; Region: era; PRK00089
568708011998	E. coli Ras-like protein (Era) is a multifunctional GTPase; Region: Era; cd04163
568708011999	G1 box; other site
568708012000	GTP/Mg2+ binding site [chemical binding]; other site
568708012001	Switch I region; other site
568708012002	G2 box; other site
568708012003	Switch II region; other site
568708012004	G3 box; other site
568708012005	G4 box; other site
568708012006	G5 box; other site
568708012007	KH domain; Region: KH_2; pfam07650
568708012011	ribonuclease III; Reviewed; Region: rnc; PRK00102
568708012012	RIBOc. Ribonuclease III C terminal domain. This group consists of eukaryotic, bacterial and archeal ribonuclease III (RNAse III) proteins. RNAse III is a double stranded RNA-specific endonuclease. Prokaryotic RNAse III is important in...; Region: RIBOc; cd00593
568708012013	dimerization interface [polypeptide binding]; other site
568708012014	active site
568708012015	metal binding site [ion binding]; metal-binding site
568708012016	Double-stranded RNA binding motif. Binding is not sequence specific but is highly specific for double stranded RNA. Found in a variety of proteins including dsRNA dependent protein kinase PKR, RNA helicases, Drosophila staufen protein, E. coli RNase III; Region: DSRM; cd00048
568708012017	dsRNA binding site [nucleotide binding]; other site
568708012020	signal peptidase I; Provisional; Region: PRK10861
568708012021	The S26 Type I signal peptidase (SPase; LepB; leader peptidase B; leader peptidase I; EC 3.4.21.89) family members are essential membrane-bound serine proteases that function to cleave the amino-terminal signal peptide extension from proteins that are...; Region: S26_SPase_I; cd06530
568708012022	Catalytic site [active]
568708012023	The S26 Type I signal peptidase (SPase; LepB; leader peptidase B; leader peptidase I; EC 3.4.21.89) family members are essential membrane-bound serine proteases that function to cleave the amino-terminal signal peptide extension from proteins that are...; Region: S26_SPase_I; cd06530
568708012025	2 probable transmembrane helices predicted for STM_MW25981 by TMHMM2.0 at aa 5-27 and 60-82
568708012027	GTP-binding protein LepA; Provisional; Region: PRK05433
568708012028	LepA also known as Elongation Factor 4 (EF4); Region: LepA; cd01890
568708012029	G1 box; other site
568708012030	putative GEF interaction site [polypeptide binding]; other site
568708012031	GTP/Mg2+ binding site [chemical binding]; other site
568708012032	Switch I region; other site
568708012033	G2 box; other site
568708012034	G3 box; other site
568708012035	Switch II region; other site
568708012036	G4 box; other site
568708012037	G5 box; other site
568708012038	lepA_II: This subfamily represents the domain II of LepA, a GTP-binding protein localized in the cytoplasmic membrane. The N-terminal domain of LepA shares regions of homology to translation factors. In terms of interaction with the ribosome, EF-G, EF-Tu...; Region: lepA_II; cd03699
568708012039	lepA_C: This family represents the C-terminal region of LepA, a GTP-binding protein localized in the cytoplasmic membrane.   LepA is ubiquitous in Bacteria and Eukaryota (e.g. Saccharomyces cerevisiae GUF1p), but is missing from Archaea. LepA exhibits...; Region: lepA_C; cd03709
568708012040	GTP-binding protein LepA C-terminus; Region: LepA_C; pfam06421
568708012045	BTP4
568708012046	type III secretion protein GogB; Provisional; Region: PRK15386
568708012047	1 probable transmembrane helix predicted for STM_MW26011 by TMHMM2.0 at aa 4-26
568708012048	Helix-turn-helix domain of Hin and related proteins, a family of DNA-binding domains unique to bacteria and represented by the Hin protein of Salmonella. The basic HTH domain is a simple fold comprised of three core helices that form a right-handed...; Region: HTH_Hin_like; cl17393
568708012049	DNA-binding interface [nucleotide binding]; DNA binding site
568708012051	Caudovirales tail fibre assembly protein; Region: Caudo_TAP; pfam02413
568708012053	Macro domain, Appr-1"-pase family. The macro domain is a high-affinity ADP-ribose binding module found in a variety of proteins as a stand-alone domain or in combination with other domains like in histone macroH2A and some PARPs (poly ADP-ribose...; Region: Macro_Appr_pase; cd02900
568708012054	ADP-ribose binding site [chemical binding]; other site
568708012055	putative active site [active]
568708012056	dimer interface [polypeptide binding]; other site
568708012058	Signal peptide predicted for STM_MW26071 by SignalP 2.0 HMM (Signal peptide probability 0.769) with cleavage site probability 0.442 between residues 18 and 19
568708012059	Prophage tail fibre N-terminal; Region: phage_tail_N; pfam08400
568708012060	Phage tail fibre repeat; Region: Phage_fiber_2; pfam03406
568708012061	Phage Tail Collar Domain; Region: Collar; pfam07484
568708012065	Signal peptide predicted for STM_MW26071 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.978 between residues 25 and 26
568708012066	Phage-related protein, tail component [Function unknown]; Region: COG4733
568708012067	Putative phage tail protein; Region: Phage-tail_3; pfam13550
568708012068	Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063
568708012069	Interdomain contacts; other site
568708012070	Cytokine receptor motif; other site
568708012071	Domain of unknown function (DUF1983); Region: DUF1983; pfam09327
568708012072	Fibronectin type III protein; Region: DUF3672; pfam12421
568708012074	Phage-related protein, tail component [Function unknown]; Region: COG4723
568708012076	2 probable transmembrane helices predicted for STM_MW26101 by TMHMM2.0 at aa 100-117 and 122-144
568708012077	Mpr1p, Pad1p N-terminal (MPN) domains with catalytic isopeptidase activity (metal-binding) found in proteins also containing NlpC/P60 domains; Region: MPN_NLPC_P60; cd08073
568708012078	MPN+ (JAMM) motif; other site
568708012079	Zinc-binding site [ion binding]; other site
568708012080	Cell wall-associated hydrolases (invasion-associated proteins) [Cell envelope biogenesis, outer membrane]; Region: Spr; COG0791
568708012081	NlpC/P60 family; Region: NLPC_P60; cl17555
568708012083	Phage-related protein [Function unknown]; Region: gp18; COG4672
568708012085	Phage-related protein [Function unknown]; Region: COG4718
568708012087	Phage-related minor tail protein [Function unknown]; Region: COG5281
568708012088	Prophage tail length tape measure protein; Region: TMP_2; pfam06791
568708012089	Lambda phage tail tape-measure protein (Tape_meas_lam_C); Region: Tape_meas_lam_C; pfam09718
568708012092	Minor tail protein T; Region: Phage_tail_T; pfam06223
568708012094	Bacteriophage lambda minor tail protein (GpG); Region: Phage_lambd_GpG; pfam06894
568708012096	Bacterial surface proteins containing Ig-like domains [Cell motility and secretion]; Region: COG5492
568708012097	Phage tail protein; Region: Phage_tail_3; pfam08813
568708012099	Phage minor tail protein U; Region: Phage_tail_U; pfam06141
568708012101	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG0675
568708012102	Helix-turn-helix domain; Region: HTH_OrfB_IS605; pfam12323
568708012103	Probable transposase; Region: OrfB_IS605; pfam01385
568708012104	transposase, IS605 OrfB family, central region; Region: tspaseT_teng_C; TIGR01766
568708012107	Prophage minor tail protein Z (GPZ); Region: Minor_tail_Z; pfam06763
568708012109	ATP-binding sugar transporter from pro-phage; Region: Gifsy-2; cl05094
568708012111	DNA packaging protein FI; Region: Packaging_FI; pfam14000
568708012112	Phage major capsid protein E; Region: Phage_cap_E; pfam03864
568708012114	Bacteriophage lambda head decoration protein D; Region: HDPD; pfam02924
568708012116	Signal peptide peptidase A (SppA) 36K type, a serine protease, has catalytic Ser-Lys dyad; Region: S49_Sppa_36K_type; cd07022
568708012117	signal peptide peptidase SppA, 36K type; Region: SppA_dom; TIGR00706
568708012118	tandem repeat interface [polypeptide binding]; other site
568708012119	oligomer interface [polypeptide binding]; other site
568708012120	active site residues [active]
568708012122	Bacteriophage capsid protein [General function prediction only]; Region: COG5511
568708012123	phage portal protein, lambda family; Region: portal_lambda; TIGR01539
568708012125	gpW; Region: gpW; pfam02831
568708012127	Phage terminase, large subunit GpA [Replication, recombination and repair]; Region: COG5525
568708012129	Phage DNA packaging protein Nu1; Region: Phage_Nu1; pfam07471
568708012131	Bacterial pre-peptidase C-terminal domain; Region: PPC; pfam04151
568708012132	Signal peptide predicted for STM_MW26301 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.945 between residues 24 and 25
568708012134	Bacteriophage lysis protein; Region: Phage_lysis; pfam03245
568708012136	Signal peptide predicted for STM_MW26311 by SignalP 2.0 HMM (Signal peptide probability 0.934) with cleavage site probability 0.701 between residues 24 and 25
568708012137	Endolysins and autolysins are found in viruses and bacteria, respectively. The ds DNA phages of eubacteria use endolysins or muralytic enzymes in conjunction with hollin, a small membrane protein, to degrade the peptidoglycan found in bacterial cell...; Region: endolysin_autolysin; cd00737
568708012138	catalytic residues [active]
568708012140	phage holin, lambda family; Region: holin_lambda; TIGR01594
568708012142	2 probable transmembrane helices predicted for STM_MW26322 by TMHMM2.0 at aa 21-43 and 70-92
568708012143	PipA protein; Region: PipA; pfam07108
568708012145	ORF6N domain; Region: ORF6N; pfam10543
568708012147	Phage antitermination protein Q; Region: Phage_antiter_Q; pfam06323
568708012149	Bacteriophage Lambda NinG protein; Region: NinG; pfam05766
568708012151	Protein of unknown function (DUF1367); Region: DUF1367; pfam07105
568708012153	cggtaggcatcgaatgatttac; Pr21F
568708012154	gtcagaagatagctggtatgac; Pr21R
568708012155	DinI-like family; Region: DinI; pfam06183
568708012157	1 probable transmembrane helix predicted for STM_MW26411 by TMHMM2.0 at aa 170-189
568708012158	Protein of unknown function (DUF550); Region: DUF550; pfam04447
568708012160	Replication protein P; Region: Phage_lambda_P; pfam06992
568708012162	Bacteriophage replication protein O; Region: Phage_rep_O; pfam04492
568708012164	Bacteriophage CII protein; Region: Phage_CII; pfam05269
568708012166	transcriptional repressor DicA; Reviewed; Region: PRK09706
568708012167	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
568708012168	non-specific DNA binding site [nucleotide binding]; other site
568708012169	salt bridge; other site
568708012170	sequence-specific DNA binding site [nucleotide binding]; other site
568708012172	AAA domain; Region: AAA_31; pfam13614
568708012173	ParA and ParB of Caulobacter crescentus belong to a conserved family of bacterial proteins implicated in chromosome segregation. ParB binds to DNA sequences adjacent to the origin of replication and localizes to opposite cell poles shortly following the...; Region: ParA; cd02042
568708012174	P-loop; other site
568708012175	Magnesium ion binding site [ion binding]; other site
568708012176	ParA and ParB of Caulobacter crescentus belong to a conserved family of bacterial proteins implicated in chromosome segregation. ParB binds to DNA sequences adjacent to the origin of replication and localizes to opposite cell poles shortly following the...; Region: ParA; cd02042
568708012177	Magnesium ion binding site [ion binding]; other site
568708012180	Enterobacterial exodeoxyribonuclease VIII; Region: Exonuc_VIII; pfam06630
568708012181	exonuclease VIII; Reviewed; Region: PRK09709
568708012182	PDDEXK-like domain of unknown function (DUF3799); Region: DUF3799; pfam12684
568708012184	RecT family; Region: RecT; pfam03837
568708012186	Protein of unknown function (DUF4060); Region: DUF4060; pfam13269
568708012187	integrase; Provisional; Region: PRK09692
568708012188	Bacteriophage P4 integrase. P4-like integrases are found in temperate bacteriophages, integrative plasmids, pathogenicity and symbiosis islands, and other mobile genetic elements.  They share the same fold in their catalytic domain and the overall...; Region: INT_P4; cd00801
568708012189	active site
568708012190	Int/Topo IB signature motif; other site
568708012192	SoxR reducing system protein RseC; Provisional; Region: PRK10862
568708012194	2 probable transmembrane helices predicted for STM_MW26571 by TMHMM2.0 at aa 78-100 and 104-121
568708012195	Negative regulator of sigma E activity [Signal transduction mechanisms]; Region: RseB; COG3026
568708012196	anti-sigma E factor; Provisional; Region: rseB; PRK09455
568708012198	Signal peptide predicted for STM_MW26581 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.948 between residues 23 and 24
568708012199	anti-RNA polymerase sigma factor SigE; Provisional; Region: PRK10863
568708012200	Anti sigma-E protein RseA, N-terminal domain; Region: RseA_N; pfam03872
568708012201	Anti sigma-E protein RseA, C-terminal domain; Region: RseA_C; pfam03873
568708012204	RNA polymerase sigma factor RpoE; Region: RpoE_Sigma70; TIGR02939
568708012205	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
568708012206	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
568708012207	DNA binding residues [nucleotide binding]
568708012210	L-aspartate oxidase; Provisional; Region: PRK09077
568708012211	L-aspartate oxidase; Provisional; Region: PRK06175
568708012212	Fumarate reductase flavoprotein C-term; Region: Succ_DH_flav_C; pfam02910
568708012215	Predicted O-methyltransferase [General function prediction only]; Region: COG4123
568708012216	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708012217	S-adenosylmethionine binding site [chemical binding]; other site
568708012219	ATP-dependent RNA helicase SrmB; Provisional; Region: PRK11192
568708012220	DEAD-box helicases. A diverse family of proteins involved in ATP-dependent RNA unwinding, needed in a variety of cellular processes including splicing, ribosome biogenesis and RNA degradation. The name derives from the sequence of the Walker  B motif; Region: DEADc; cd00268
568708012221	ATP binding site [chemical binding]; other site
568708012222	Mg++ binding site [ion binding]; other site
568708012223	motif III; other site
568708012224	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
568708012225	nucleotide binding region [chemical binding]; other site
568708012226	ATP-binding site [chemical binding]; other site
568708012229	Transcriptional regulator [Transcription]; Region: LysR; COG0583
568708012230	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708012231	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
568708012232	dimerization interface [polypeptide binding]; other site
568708012235	cysteine/O-acetylserine exporter; Provisional; Region: PRK10323
568708012236	6 probable transmembrane helices predicted for STM_MW26651 by TMHMM2.0 at aa 10-32, 44-66, 70-92, 105-127, 142-164 and 177-194
568708012238	autonomous glycyl radical cofactor GrcA; Provisional; Region: PRK11127
568708012240	Family 1 of Uracil-DNA glycosylase (UDG) enzymes; Region: UDG_F1; cd10027
568708012241	ligand binding site [chemical binding]; other site
568708012242	active site
568708012243	UGI interface [polypeptide binding]; other site
568708012244	catalytic site [active]
568708012246	putative methyltransferase; Provisional; Region: PRK10864
568708012247	RNA 2'-O ribose methyltransferase substrate binding; Region: SpoU_sub_bind; pfam08032
568708012248	SpoU rRNA Methylase family; Region: SpoU_methylase; pfam00588
568708012251	thioredoxin 2; Provisional; Region: PRK10996
568708012252	zinc-ribbon domain; Region: zinc_ribbon_5; cl11777
568708012253	TRX family; composed of two groups: Group I, which includes proteins that exclusively encode a TRX domain; and Group II, which are composed of fusion proteins of TRX and additional domains. Group I TRX is a small ancient protein that alter the redox...; Region: TRX_family; cd02947
568708012254	catalytic residues [active]
568708012256	Uncharacterized conserved protein [Function unknown]; Region: COG3148
568708012258	Acyl-CoA synthetase (NDP forming) [Energy production and conversion]; Region: COG1042
568708012259	CoA binding domain; Region: CoA_binding_2; pfam13380
568708012260	Succinyl-CoA ligase like flavodoxin domain; Region: Succ_CoA_lig; pfam13607
568708012261	ATP-grasp domain; Region: ATP-grasp_5; pfam13549
568708012262	Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302
568708012263	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
568708012264	Coenzyme A binding pocket [chemical binding]; other site
568708012266	phosphatidylserine synthase; Provisional; Region: pssA; PRK09428
568708012267	Catalytic domain, repeat 1, of phosphatidylserine synthases from gram-negative bacteria; Region: PLDc_PSS_G_neg_1; cd09134
568708012268	domain interface [polypeptide binding]; other site
568708012269	putative active site [active]
568708012270	catalytic site [active]
568708012271	Catalytic domain, repeat 2, of phosphatidylserine synthases from gram-negative bacteria; Region: PLDc_PSS_G_neg_2; cd09136
568708012272	domain interface [polypeptide binding]; other site
568708012273	putative active site [active]
568708012274	catalytic site [active]
568708012276	lipoprotein; Provisional; Region: PRK10759
568708012278	alpha-ketoglutarate transporter; Provisional; Region: PRK10406
568708012279	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708012280	putative substrate translocation pore; other site
568708012281	12 probable transmembrane helices predicted for STM_MW26741 by TMHMM2.0 at aa 21-43, 63-85, 97-114, 119-141, 161-183, 198-215, 245-267, 282-304, 311-328, 338-360, 373-395 and 405-424
568708012283	Domain of unknown function (DUF4385); Region: DUF4385; pfam14328
568708012284	protein disaggregation chaperone; Provisional; Region: PRK10865
568708012285	Clp amino terminal domain; Region: Clp_N; pfam02861
568708012286	Clp amino terminal domain; Region: Clp_N; pfam02861
568708012287	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708012288	Walker A motif; other site
568708012289	ATP binding site [chemical binding]; other site
568708012290	Walker B motif; other site
568708012291	arginine finger; other site
568708012292	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708012293	Walker A motif; other site
568708012294	ATP binding site [chemical binding]; other site
568708012295	Walker B motif; other site
568708012296	arginine finger; other site
568708012297	C-terminal, D2-small domain, of ClpB protein; Region: ClpB_D2-small; pfam10431
568708012302	hypothetical protein; Provisional; Region: PRK10723
568708012303	Multicopper polyphenol oxidase (laccase) [Secondary metabolites biosynthesis, transport and catabolism]; Region: yfiH; COG1496
568708012305	23S rRNA pseudouridine synthase D; Provisional; Region: rluD; PRK11180
568708012306	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
568708012307	RNA binding surface [nucleotide binding]; other site
568708012308	Pseudouridine synthase, RsuA/RluD family; Region: PseudoU_synth_RluCD_like; cd02869
568708012309	active site
568708012312	outer membrane biogenesis protein BamD; Provisional; Region: PRK10866
568708012313	Protein of unknown function (DUF3897); Region: DUF3897; cl17494
568708012314	Signal peptide predicted for STM_MW26791 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.476 between residues 23 and 24
568708012315	RaiA ("ribosome-associated inhibitor A", also known as Protein Y (PY), YfiA, and SpotY,  is a stress-response protein that binds the ribosomal subunit interface and arrests translation by interfering with aminoacyl-tRNA binding to the ribosomal...; Region: RaiA; cd00552
568708012316	30S subunit binding site; other site
568708012318	bifunctional chorismate mutase/prephenate dehydratase; Provisional; Region: pheA; PRK10622
568708012319	chorismate mutase domain of proteobacterial P-protein, clade 1; Region: CM_P_1; TIGR01797
568708012320	Prephenate dehydratase; Region: PDT; pfam00800
568708012321	C-terminal ACT domain of the bifunctional chorismate mutase-prephenate dehydratase (CM-PDT) enzyme and the prephenate dehydratase (PDT) enzyme; Region: ACT_CM-PDT; cd04905
568708012322	putative L-Phe binding site [chemical binding]; other site
568708012325	SMP-30/Gluconolaconase/LRE-like region; Region: SGL; pfam08450
568708012327	bifunctional chorismate mutase/prephenate dehydrogenase; Provisional; Region: tyrA; PRK11199
568708012328	chorismate mutase domain of T-protein; Region: CM_T; TIGR01799
568708012329	prephenate dehydrogenase; Validated; Region: PRK08507
568708012332	phospho-2-dehydro-3-deoxyheptonate aldolase; Provisional; Region: PRK12755
568708012333	DAHP synthetase I family; Region: DAHP_synth_1; pfam00793
568708012335	Domain of unknown function (DUF4154); Region: DUF4154; pfam13689
568708012336	Signal peptide predicted for STM_MW26851 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 22 and 23
568708012337	putative inner membrane diguanylate cyclase; Provisional; Region: PRK09966
568708012338	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
568708012339	metal binding site [ion binding]; metal-binding site
568708012340	active site
568708012341	I-site; other site
568708012342	Signal peptide predicted for STM_MW26861 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.512 between residues 38 and 39
568708012343	2 probable transmembrane helices predicted for STM_MW26861 by TMHMM2.0 at aa 21-43 and 153-175
568708012345	50S ribosomal protein L19; Provisional; Region: rplS; PRK05338
568708012347	tRNA (guanine-N(1)-)-methyltransferase; Reviewed; Region: trmD; PRK00026
568708012349	16S rRNA-processing protein RimM; Provisional; Region: rimM; PRK00122
568708012350	RimM N-terminal domain; Region: RimM; pfam01782
568708012351	PRC-barrel domain; Region: PRC; pfam05239
568708012354	30S ribosomal protein S16; Reviewed; Region: rpsP; PRK00040
568708012356	signal recognition particle protein; Provisional; Region: PRK10867
568708012357	SRP54-type protein, helical bundle domain; Region: SRP54_N; smart00963
568708012358	The signal recognition particle (SRP) mediates the transport to or across the plasma membrane in bacteria and the endoplasmic reticulum in eukaryotes. SRP recognizes N-terminal sighnal sequences of newly synthesized polypeptides at the ribosome. The...; Region: SRP; cd03115
568708012359	P loop; other site
568708012360	GTP binding site [chemical binding]; other site
568708012361	Signal peptide binding domain; Region: SRP_SPB; pfam02978
568708012365	ABC-type uncharacterized transport system, permease component [General function prediction only]; Region: COG4137
568708012366	Signal peptide predicted for STM_MW26921 by SignalP 2.0 HMM (Signal peptide probability 0.764) with cleavage site probability 0.439 between residues 17 and 18
568708012367	8 probable transmembrane helices predicted for STM_MW26921 by TMHMM2.0 at aa 2-24, 34-56, 63-85, 90-109, 129-151, 176-198, 210-227 and 237-254
568708012369	hypothetical protein; Provisional; Region: PRK11573
568708012370	Domain of unknown function DUF21; Region: DUF21; pfam01595
568708012371	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains associated with the CorC_HlyC domain. CorC_HlyC is a transporter associated domain. This small domain is found in Na+/H+ antiporters, in proteins involved in...; Region: CBS_pair_CorC_HlyC_assoc; cd04590
568708012372	Transporter associated domain; Region: CorC_HlyC; smart01091
568708012374	3 probable transmembrane helices predicted for STM_MW26931 by TMHMM2.0 at aa 33-55, 65-83 and 95-117
568708012378	Molecular chaperone GrpE (heat shock protein) [Posttranslational modification, protein turnover, chaperones]; Region: GrpE; COG0576
568708012379	GrpE is the adenine nucleotide exchange factor of DnaK (Hsp70)-type ATPases. The GrpE dimer binds to the ATPase domain of Hsp70 catalyzing the dissociation of ADP, which enables rebinding of ATP, one step in the Hsp70 reaction cycle in protein folding; Region: GrpE; cd00446
568708012380	dimer interface [polypeptide binding]; other site
568708012381	hsp70 (ATPase domain) interactions [polypeptide binding]; other site
568708012383	inorganic polyphosphate/ATP-NAD kinase; Provisional; Region: ppnK; PRK03378
568708012384	inorganic polyphosphate/ATP-NAD kinase; Provisional; Region: ppnK; PRK02231
568708012386	recombination and repair protein; Provisional; Region: PRK10869
568708012387	ATP-binding cassette domain of RecN; Region: ABC_RecN; cd03241
568708012388	Walker A/P-loop; other site
568708012389	ATP binding site [chemical binding]; other site
568708012390	Q-loop/lid; other site
568708012391	ATP-binding cassette domain of RecN; Region: ABC_RecN; cd03241
568708012392	ABC transporter signature motif; other site
568708012393	Walker B; other site
568708012394	D-loop; other site
568708012395	H-loop/switch region; other site
568708012397	outer membrane biogenesis protein BamE; Provisional; Region: PRK11548
568708012398	SmpA / OmlA family; Region: SmpA_OmlA; pfam04355
568708012399	Signal peptide predicted for STM_MW26991 by SignalP 2.0 HMM (Signal peptide probability 0.981) with cleavage site probability 0.424 between residues 22 and 23
568708012401	hypothetical protein; Validated; Region: PRK01777
568708012403	Coenzyme Q-binding protein COQ10p and similar proteins; Region: COQ10p_like; cd07813
568708012404	putative coenzyme Q binding site [chemical binding]; other site
568708012406	Small protein B (SmpB) is a component of the trans-translation system in prokaryotes for releasing stalled ribosome from damaged messenger RNAs; Region: SmpB; cd09294
568708012407	SmpB-tmRNA interface; other site
568708012409	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708012410	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708012411	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708012412	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708012413	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708012414	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708012415	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708012416	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708012417	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708012418	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708012419	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708012420	Putative flagellar system-associated repeat; Region: SWM_repeat; pfam13753
568708012421	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708012422	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708012423	Putative flagellar system-associated repeat; Region: SWM_repeat; pfam13753
568708012424	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708012425	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708012426	type I secretion C-terminal target domain (VC_A0849 subclass); Region: T1SS_VCA0849; TIGR03661
568708012427	type I secretion outer membrane protein, TolC family; Region: type_I_sec_TolC; TIGR01844
568708012428	Signal peptide predicted for STM_MW27041 by SignalP 2.0 HMM (Signal peptide probability 0.774) with cleavage site probability 0.556 between residues 22 and 23
568708012430	type I secretion system ATPase, LssB family; Region: type_I_sec_LssB; TIGR03375
568708012431	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
568708012432	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
568708012433	Walker A/P-loop; other site
568708012434	ATP binding site [chemical binding]; other site
568708012435	Q-loop/lid; other site
568708012436	ABC transporter signature motif; other site
568708012437	Walker B; other site
568708012438	D-loop; other site
568708012439	H-loop/switch region; other site
568708012440	5 probable transmembrane helices predicted for STM_MW27051 by TMHMM2.0 at aa 168-190, 205-222, 281-303, 307-324 and 389-411
568708012443	type I secretion membrane fusion protein, HlyD family; Region: type_I_hlyD; TIGR01843
568708012444	HlyD family secretion protein; Region: HlyD_3; pfam13437
568708012445	1 probable transmembrane helix predicted for STM_MW27061 by TMHMM2.0 at aa 13-35
568708012447	phage insertion
568708012448	pfam_scan;Pfam:PF00589; E()=2.4E-18;score=66.3;query229- 382;description=Phage_integrase
568708012450	SEC-C motif; Region: SEC-C; pfam02810
568708012452	Predicted transcriptional regulator [Transcription]; Region: AlpA; COG3311
568708012454	Superfamily II helicase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG5519
568708012456	Predicted ATP-binding protein involved in virulence [General function prediction only]; Region: COG3950
568708012458	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
568708012459	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
568708012460	non-specific DNA binding site [nucleotide binding]; other site
568708012461	salt bridge; other site
568708012462	sequence-specific DNA binding site [nucleotide binding]; other site
568708012464	Winged helix-turn-helix DNA-binding; Region: HTH_35; pfam13693
568708012465	Phosphotransferase system sorbitol-specific component IIC [Carbohydrate transport and metabolism]; Region: SrlA; COG3730
568708012467	3 probable transmembrane helices predicted for STM_MW27171 by TMHMM2.0 at aa 20-42, 63-85 and 142-164
568708012468	Phosphotransferase system sorbitol-specific component IIA [Carbohydrate transport and metabolism]; Region: SrlB; COG3731
568708012470	Phosphotransferase system sorbitol-specific component IIBC [Carbohydrate transport and metabolism]; Region: SrlE; COG3732
568708012471	Sorbitol phosphotransferase enzyme II N-terminus; Region: EIIBC-GUT_N; pfam03612
568708012472	Sorbitol phosphotransferase enzyme II C-terminus; Region: EIIBC-GUT_C; pfam07663
568708012474	4 probable transmembrane helices predicted for STM_MW27191 by TMHMM2.0 at aa 190-212, 219-241, 256-278 and 299-321
568708012476	Predicted dehydrogenases and related proteins [General function prediction only]; Region: MviM; COG0673
568708012477	Oxidoreductase family, NAD-binding Rossmann fold; Region: GFO_IDH_MocA; pfam01408
568708012478	Oxidoreductase family, C-terminal alpha/beta domain; Region: GFO_IDH_MocA_C; pfam02894
568708012481	Domain of unknown function (DUF3883); Region: DUF3883; pfam13020
568708012482	3-Keto-L-gulonate 6-phosphate decarboxylase (KGPDC) and D-arabino-3-hexulose-6-phosphate synthase (HPS). KGPDC catalyzes the formation of L-xylulose 5-phosphate and carbon dioxide from 3-keto-L-gulonate 6-phosphate as part of the anaerobic pathway for...; Region: KGPDC_HPS; cd04726
568708012483	active site
568708012484	dimer interface [polypeptide binding]; other site
568708012485	magnesium binding site [ion binding]; other site
568708012487	Hexulose-6-phosphate isomerase (PHI). PHI is a member of the SIS (Sugar ISomerase domain) superfamily. In the ribulose monophosphate pathway of formaldehyde fixation, hexulose-6-phosphate synthase catalyzes the condensation of ribulose-5-phosphate with...; Region: SIS_PHI; cd05005
568708012488	tetramer interface [polypeptide binding]; other site
568708012489	Transcriptional regulators [Transcription]; Region: RpiR; COG1737
568708012490	active site
568708012492	Thermophilic glucose-6-phosphate isomerase and related metalloenzymes [Carbohydrate transport and metabolism / General function prediction only]; Region: COG2140
568708012493	Glucose-6-phosphate isomerase (GPI); Region: GPI; pfam06560
568708012495	Phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific [Carbohydrate transport and metabolism]; Region: PtsG; COG1263
568708012496	PTS system, glucose-specific IIBC component; Region: PTS-II-BC-glcB; TIGR02002
568708012497	PTS_IIB, PTS system, glucose/sucrose specific IIB subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIB_glc; cd00212
568708012498	active site turn [active]
568708012499	phosphorylation site [posttranslational modification]
568708012501	10 probable transmembrane helices predicted for STM_MW27261 by TMHMM2.0 at aa 13-35, 61-83, 90-112, 127-149, 170-192, 271-293, 306-324, 328-350, 352-374 and 380-402
568708012503	Signal peptide predicted for STM_MW27261 by SignalP 2.0 HMM (Signal peptide probability 0.983) with cleavage site probability 0.462 between residues 38 and 39
568708012504	ABC-type uncharacterized transport system, periplasmic component [General function prediction only]; Region: COG4533
568708012505	Sugar transport-related sRNA regulator N-term; Region: SgrR_N; pfam12793
568708012506	The substrate-binding domain of an ABC-type nickel/oligopeptide-like import system contains the type 2 periplasmic binding fold; Region: PBP2_NikA_DppA_OppA_like; cl01709
568708012508	Phage integrase, N-terminal; Region: Integrase_l_N; pfam12834
568708012509	Integrase; Region: Integrase_1; pfam12835
568708012510	4 probable transmembrane helices predicted for STM_MW27301 by TMHMM2.0 at aa 30-52, 110-132, 145-167 and 177-199
568708012512	pfam_scan;Pfam:PF00665; E()=1.2E-19;score=70.3;query61-195;description=rve
568708012514	Helix-turn-helix domain of Hin and related proteins, a family of DNA-binding domains unique to bacteria and represented by the Hin protein of Salmonella. The basic HTH domain is a simple fold comprised of three core helices that form a right-handed...; Region: HTH_Hin_like; cd00569
568708012515	DNA-binding interface [nucleotide binding]; DNA binding site
568708012517	Superfamily I DNA and RNA helicases [General function prediction only]; Region: COG3972
568708012518	Family description; Region: UvrD_C_2; pfam13538
568708012519	Transposase; Region: HTH_Tnp_1; cl17663
568708012520	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
568708012522	putative transposase OrfB; Reviewed; Region: PHA02517
568708012523	HTH-like domain; Region: HTH_21; pfam13276
568708012524	Integrase core domain; Region: rve; pfam00665
568708012525	Integrase core domain; Region: rve_2; pfam13333
568708012527	Repressor of phase-1 flagellin; Region: Flag1_repress; pfam03614
568708012529	flagellin; Validated; Region: PRK08026
568708012530	Bacterial flagellin N-terminal helical region; Region: Flagellin_N; pfam00669
568708012531	Flagellin D3 domain; Region: Flagellin_D3; pfam08884
568708012532	Bacterial flagellin C-terminal helical region; Region: Flagellin_C; pfam00700
568708012536	Site-specific recombinases, DNA invertase Pin homologs [DNA replication, recombination, and repair]; Region: PinR; COG1961
568708012537	Serine Recombinase (SR) family, Resolvase and Invertase subfamily, catalytic domain; members contain a C-terminal DNA binding domain. Serine recombinases catalyze site-specific recombination of DNA molecules by a concerted, four-strand cleavage and...; Region: SR_ResInv; cd03768
568708012538	catalytic residues [active]
568708012539	catalytic nucleophile [active]
568708012540	Presynaptic Site I dimer interface [polypeptide binding]; other site
568708012541	Synaptic Antiparallel dimer interface [polypeptide binding]; other site
568708012542	Synaptic Flat tetramer interface [polypeptide binding]; other site
568708012543	Synaptic Site I dimer interface [polypeptide binding]; other site
568708012544	DNA binding site [nucleotide binding]
568708012545	Helix-turn-helix domain of Hin and related proteins, a family of DNA-binding domains unique to bacteria and represented by the Hin protein of Salmonella. The basic HTH domain is a simple fold comprised of three core helices that form a right-handed...; Region: HTH_Hin_like; cd00569
568708012546	DNA-binding interface [nucleotide binding]; DNA binding site
568708012549	1 probable transmembrane helix predicted for STM_MW27391 by TMHMM2.0 at aa 165-182
568708012550	Glycosyl transferases, related to UDP-glucuronosyltransferase [Carbohydrate transport and metabolism / Signal transduction mechanisms]; Region: COG1819
568708012551	This family includes the Gtfs, a group of homologous glycosyltransferases involved in the final stages of the biosynthesis of antibiotics vancomycin and related chloroeremomycin. Gtfs transfer sugar moieties from an activated NDP-sugar donor to the...; Region: GT1_Gtf_like; cd03784
568708012552	homodimer interface [polypeptide binding]; other site
568708012553	active site
568708012554	TDP-binding site; other site
568708012555	acceptor substrate-binding pocket; other site
568708012558	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
568708012559	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
568708012560	ABC-type cobalt transport system, ATPase component [Inorganic ion transport and metabolism]; Region: CbiO; COG1122
568708012561	Walker A/P-loop; other site
568708012562	ATP binding site [chemical binding]; other site
568708012563	Q-loop/lid; other site
568708012564	ABC transporter signature motif; other site
568708012565	Walker B; other site
568708012566	D-loop; other site
568708012567	H-loop/switch region; other site
568708012568	ABC-type multidrug transport system, ATPase and permease components [Defense mechanisms]; Region: MdlB; COG1132
568708012569	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
568708012570	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
568708012571	Walker A/P-loop; other site
568708012572	ATP binding site [chemical binding]; other site
568708012573	Q-loop/lid; other site
568708012574	ABC transporter signature motif; other site
568708012575	Walker B; other site
568708012576	D-loop; other site
568708012577	H-loop/switch region; other site
568708012578	11 probable transmembrane helices predicted for STM_MW27411 by TMHMM2.0 at aa 27-49, 64-83, 138-160, 165-182, 243-265, 280-302, 649-671, 686-708, 767-786, 790-809 and 871-893
568708012581	Domain of unknown function (DUF3327); Region: DUF3327; pfam11806
568708012582	Enterochelin esterase and related enzymes [Inorganic ion transport and metabolism]; Region: Fes; COG2382
568708012583	Predicted hydrolase of the alpha/beta superfamily [General function prediction only]; Region: COG2819
568708012585	Predicted hydrolase of the alpha/beta superfamily [General function prediction only]; Region: COG2819
568708012586	Signal peptide predicted for STM_MW27431 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.992 between residues 28 and 29
568708012587	1 probable transmembrane helix predicted for STM_MW27431 by TMHMM2.0 at aa 13-30
568708012589	outer membrane receptor FepA; Provisional; Region: PRK13528
568708012590	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
568708012591	N-terminal plug; other site
568708012592	ligand-binding site [chemical binding]; other site
568708012595	Signal peptide predicted for STM_MW27441 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.937 between residues 25 and 26
568708012596	secreted effector protein PipB2; Provisional; Region: PRK15196
568708012597	Pentapeptide repeats (8 copies); Region: Pentapeptide; pfam00805
568708012598	Pentapeptide repeats (8 copies); Region: Pentapeptide; pfam00805
568708012599	Pentapeptide repeats (8 copies); Region: Pentapeptide; pfam00805
568708012600	Pentapeptide repeats (8 copies); Region: Pentapeptide; pfam00805
568708012601	Pentapeptide repeats (8 copies); Region: Pentapeptide; pfam00805
568708012603	Uncharacterized protein conserved in bacteria [Function unknown]; Region: VirK; COG2990
568708012605	antimicrobial resistance protein Mig-14; Provisional; Region: PRK15312
568708012606	Acetyltransferase (GNAT) domain; Region: Acetyltransf_6; pfam13480
568708012608	High-affinity nickel permease [Inorganic ion transport and metabolism]; Region: HoxN; COG3376
568708012609	7 probable transmembrane helices predicted for STM_MW27501 by TMHMM2.0 at aa 10-32, 76-98, 118-140, 176-198, 213-235, 256-278 and 306-325
568708012611	Signal peptide predicted for STM_MW27501 by SignalP 2.0 HMM (Signal peptide probability 0.871) with cleavage site probability 0.611 between residues 23 and 24
568708012612	Two-component sensor kinase N-terminal; Region: 2CSK_N; pfam08521
568708012613	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
568708012614	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cl01054
568708012615	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
568708012616	dimer interface [polypeptide binding]; other site
568708012617	phosphorylation site [posttranslational modification]
568708012618	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708012619	ATP binding site [chemical binding]; other site
568708012620	Mg2+ binding site [ion binding]; other site
568708012621	G-X-G motif; other site
568708012624	2 probable transmembrane helices predicted for STM_MW27511 by TMHMM2.0 at aa 15-37 and 170-192
568708012626	Signal peptide predicted for STM_MW27511 by SignalP 2.0 HMM (Signal peptide probability 0.996) with cleavage site probability 0.532 between residues 36 and 37
568708012627	transcriptional regulatory protein TctD; Provisional; Region: PRK15479
568708012628	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708012629	active site
568708012630	phosphorylation site [posttranslational modification]
568708012631	intermolecular recognition site; other site
568708012632	dimerization interface [polypeptide binding]; other site
568708012633	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
568708012634	DNA binding site [nucleotide binding]
568708012637	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3181
568708012638	Signal peptide predicted for STM_MW27531 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 22 and 23
568708012640	Tripartite tricarboxylate transporter TctB family; Region: TctB; pfam07331
568708012641	4 probable transmembrane helices predicted for STM_MW27541 by TMHMM2.0 at aa 7-24, 39-56, 69-91 and 106-128
568708012642	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3333
568708012644	12 probable transmembrane helices predicted for STM_MW27551 by TMHMM2.0 at aa 20-42, 47-69, 110-132, 142-164, 171-193, 208-230, 260-282, 321-343, 356-378, 388-410, 415-433 and 470-492
568708012645	Clavaminic acid synthetase (CAS) -like;  CAS is a trifunctional Fe(II)/ 2-oxoglutarate (2OG) oxygenase carrying out three reactions in the biosynthesis of clavulanic acid, an inhibitor of class A serine beta-lactamases. In general, Fe(II)-2OG oxygenases...; Region: CAS_like; cd00250
568708012646	substrate binding pocket [chemical binding]; other site
568708012647	active site
568708012648	iron coordination sites [ion binding]; other site
568708012650	Predicted dehydrogenase [General function prediction only]; Region: COG0579
568708012651	hydroxyglutarate oxidase; Provisional; Region: PRK11728
568708012653	succinate-semialdehyde dehydrogenase I; Provisional; Region: gabD; PRK11241
568708012654	Mitochondrial succinate-semialdehyde dehydrogenase and ALDH family members 5A1 and 5F1-like; Region: ALDH_F5_SSADH_GabD; cd07103
568708012655	tetramerization interface [polypeptide binding]; other site
568708012656	NAD(P) binding site [chemical binding]; other site
568708012657	catalytic residues [active]
568708012659	4-aminobutyrate aminotransferase; Validated; Region: PRK08088
568708012660	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
568708012661	inhibitor-cofactor binding pocket; inhibition site
568708012662	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708012663	catalytic residue [active]
568708012665	gamma-aminobutyrate transporter; Provisional; Region: PRK10197
568708012666	Signal peptide predicted for STM_MW27601 by SignalP 2.0 HMM (Signal peptide probability 0.617) with cleavage site probability 0.573 between residues 41 and 42
568708012668	12 probable transmembrane helices predicted for STM_MW27601 by TMHMM2.0 at aa 19-41, 46-65, 86-108, 123-145, 152-174, 202-224, 245-267, 287-309, 335-357, 362-381, 401-423 and 427-449
568708012669	DNA-binding transcriptional regulator CsiR; Provisional; Region: PRK11534
568708012670	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
568708012671	DNA-binding site [nucleotide binding]; DNA binding site
568708012672	This entry represents the C-terminal ligand binding domain of many members of the GntR family; Region: FCD; smart00895
568708012675	LysM domain/BON superfamily protein; Provisional; Region: PRK11198
568708012676	bacterial OsmY and nodulation domain; Region: BON; smart00749
568708012677	Lysine Motif is a small domain involved in binding peptidoglycan; Region: LysM; cd00118
568708012680	Uncharacterized homolog of Blt101 [Function unknown]; Region: COG0401
568708012682	2 probable transmembrane helices predicted for STM_MW27631 by TMHMM2.0 at aa 2-20 and 25-47
568708012683	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
568708012684	dimerization interface [polypeptide binding]; other site
568708012685	putative DNA binding site [nucleotide binding]; other site
568708012686	Transcriptional regulators [Transcription]; Region: MarR; COG1846
568708012687	putative Zn2+ binding site [ion binding]; other site
568708012689	Rhodanese Homology Domain (RHOD); an alpha beta fold domain found duplicated in the rhodanese protein. The cysteine containing enzymatically active version of the domain is also found in the Cdc25 class of protein phosphatases and a variety of proteins...; Region: RHOD; cl00125
568708012690	active site residue [active]
568708012691	Protein of unknown function (DUF2892); Region: DUF2892; pfam11127
568708012694	2 probable transmembrane helices predicted for STM_MW27651 by TMHMM2.0 at aa 117-139 and 143-165
568708012695	DNA binding protein, nucleoid-associated; Provisional; Region: PRK10328
568708012696	Domain in histone-like proteins of HNS family; Region: HNS; smart00528
568708012698	Protein of unknown function (DUF1144); Region: DUF1144; pfam06610
568708012700	4 probable transmembrane helices predicted for STM_MW27671 by TMHMM2.0 at aa 12-34, 44-62, 83-105 and 110-132
568708012701	hypothetical protein; Provisional; Region: PRK10556
568708012703	hypothetical protein; Provisional; Region: PRK10132
568708012705	Transcriptional regulators containing a DNA-binding HTH domain and an aminotransferase domain (MocR family) and their eukaryotic orthologs [Transcription / Amino acid transport and metabolism]; Region: ARO8; COG1167
568708012706	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
568708012707	DNA-binding site [nucleotide binding]; DNA binding site
568708012708	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
568708012709	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708012710	homodimer interface [polypeptide binding]; other site
568708012711	catalytic residue [active]
568708012714	Carboxymuconolactone decarboxylase family; Region: CMD; pfam02627
568708012715	Uncharacterized conserved protein [Function unknown]; Region: COG2128
568708012717	NrdH-redoxin (NrdH) family; NrdH is a small monomeric protein with a conserved redox active CXXC motif within a TRX fold, characterized by a glutaredoxin (GRX)-like sequence and TRX-like activity profile. In vitro, it displays protein disulfide reductase...; Region: NrdH; cd02976
568708012718	catalytic residues [active]
568708012720	ribonucleotide reductase stimulatory protein; Reviewed; Region: nrdI; PRK03600
568708012722	ribonucleotide-diphosphate reductase subunit alpha; Validated; Region: PRK08188
568708012723	Ribonucleotide reductase N-terminal; Region: RNR_N; pfam08343
568708012724	Class I ribonucleotide reductase; Region: RNR_I; cd01679
568708012725	active site
568708012726	dimer interface [polypeptide binding]; other site
568708012727	catalytic residues [active]
568708012728	effector binding site; other site
568708012729	Ribonucleotide reductase and Pyruvate formate lyase; Region: RNR_PFL; cl09939
568708012733	ribonucleotide-diphosphate reductase subunit beta; Provisional; Region: nrdF2; PRK13966
568708012734	Ribonucleotide Reductase, R2/beta subunit, ferritin-like diiron-binding domain; Region: RNRR2; cd01049
568708012735	dimer interface [polypeptide binding]; other site
568708012736	putative radical transfer pathway; other site
568708012737	diiron center [ion binding]; other site
568708012738	tyrosyl radical; other site
568708012740	glycine betaine transporter ATP-binding subunit; Provisional; Region: PRK10070
568708012741	ATP-binding cassette domain of the osmoprotectant proline/glycine betaine uptake system; Region: ABC_Pro_Gly_Betaine; cd03294
568708012742	Walker A/P-loop; other site
568708012743	ATP binding site [chemical binding]; other site
568708012744	Q-loop/lid; other site
568708012745	ABC transporter signature motif; other site
568708012746	Walker B; other site
568708012747	D-loop; other site
568708012748	H-loop/switch region; other site
568708012749	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains in association with the ABC transporter OpuCA. OpuCA is the ATP binding component of a bacterial solute transporter that serves a protective role to cells growing...; Region: CBS_pair_ABC_OpuCA_assoc2; cd04583
568708012752	glycine betaine transporter membrane protein; Provisional; Region: PRK10952
568708012753	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708012754	dimer interface [polypeptide binding]; other site
568708012755	conserved gate region; other site
568708012756	putative PBP binding loops; other site
568708012757	ABC-ATPase subunit interface; other site
568708012758	6 probable transmembrane helices predicted for STM_MW27771 by TMHMM2.0 at aa 94-116, 120-142, 149-171, 197-219, 272-294 and 298-320
568708012760	glycine betaine transporter periplasmic subunit; Provisional; Region: proX; PRK11119
568708012761	Substrate binding domain of ABC-type glycine betaine transport system; Region: OpuAC; pfam04069
568708012762	Signal peptide predicted for STM_MW27781 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 21 and 22
568708012764	Arabinose efflux permease [Carbohydrate transport and metabolism]; Region: AraJ; COG2814
568708012765	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708012766	Signal peptide predicted for STM_MW27791 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.590 between residues 25 and 26
568708012767	12 probable transmembrane helices predicted for STM_MW27791 by TMHMM2.0 at aa 11-33, 48-70, 77-94, 104-126, 133-155, 160-182, 217-239, 249-271, 278-295, 300-322, 335-357 and 362-384
568708012769	transcriptional repressor MprA; Provisional; Region: PRK10870
568708012770	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
568708012772	multidrug efflux system protein EmrA; Provisional; Region: PRK15136
568708012773	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
568708012774	HlyD family secretion protein; Region: HlyD_3; pfam13437
568708012775	Signal peptide predicted for STM_MW27811 by SignalP 2.0 HMM (Signal peptide probability 0.966) with cleavage site probability 0.948 between residues 37 and 38
568708012776	1 probable transmembrane helix predicted for STM_MW27811 by TMHMM2.0 at aa 23-45
568708012778	drug resistance transporter, EmrB/QacA subfamily; Region: efflux_EmrB; TIGR00711
568708012779	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708012780	putative substrate translocation pore; other site
568708012781	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708012782	13 probable transmembrane helices predicted for STM_MW27821 by TMHMM2.0 at aa 13-35, 50-72, 79-101, 106-128, 140-162, 167-189, 201-218, 228-250, 270-292, 302-324, 336-353, 368-390 and 480-498
568708012784	Maltoporin periplasmic N-terminal extension; Region: Sugarporin_N; pfam11471
568708012785	Signal peptide predicted for STM_MW27831 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 20 and 21
568708012786	S-ribosylhomocysteinase; Provisional; Region: PRK02260
568708012788	glutamate--cysteine ligase; Provisional; Region: PRK02107
568708012790	Predicted membrane protein [Function unknown]; Region: COG1238
568708012791	4 probable transmembrane helices predicted for STM_MW27861 by TMHMM2.0 at aa 15-37, 42-64, 84-106 and 118-140
568708012793	Signal peptide predicted for STM_MW27861 by SignalP 2.0 HMM (Signal peptide probability 0.965) with cleavage site probability 0.824 between residues 18 and 19
568708012794	fructose-1-P/6-phosphogluconate phosphatase; Provisional; Region: PRK10725
568708012795	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708012796	motif II; other site
568708012798	carbon storage regulator; Provisional; Region: PRK01712
568708012800	alanyl-tRNA synthetase; Reviewed; Region: alaS; PRK00252
568708012801	Alanyl-tRNA synthetase (AlaRS) class II core catalytic domain. AlaRS is a homodimer. It is responsible for the attachment of alanine to the 3' OH group of ribose of the appropriate tRNA. This domain is primarily responsible for ATP-dependent...; Region: AlaRS_core; cd00673
568708012802	motif 1; other site
568708012803	active site
568708012804	motif 2; other site
568708012805	motif 3; other site
568708012806	Threonyl and Alanyl tRNA synthetase second additional domain; Region: tRNA_SAD; smart00863
568708012807	DHHA1 domain; Region: DHHA1; pfam02272
568708012811	recombination regulator RecX; Reviewed; Region: recX; PRK00117
568708012813	recombinase A; Provisional; Region: recA; PRK09354
568708012814	RecA is a  bacterial enzyme which has roles in homologous recombination, DNA repair, and the induction of the SOS response.  RecA couples ATP hydrolysis to DNA strand exchange; Region: recA; cd00983
568708012815	hexamer interface [polypeptide binding]; other site
568708012816	Walker A motif; other site
568708012817	ATP binding site [chemical binding]; other site
568708012818	Walker B motif; other site
568708012820	hypothetical protein; Validated; Region: PRK03661
568708012822	Transglycosylase SLT domain; Region: SLT_2; pfam13406
568708012823	Lytic Transglycosylase (LT)  and Goose Egg White Lysozyme (GEWL) domain. Members include the soluble and insoluble membrane-bound LTs in bacteria, the LTs in bacteriophage lambda, as well as, the eukaryotic "goose-type" lysozymes (GEWL).  LTs...; Region: LT_GEWL; cd00254
568708012824	N-acetyl-D-glucosamine binding site [chemical binding]; other site
568708012825	Signal peptide predicted for STM_MW27931 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.784 between residues 25 and 26
568708012826	PTS system, glucitol/sorbitol-specific, IIC component; Region: EII-GUT; TIGR00821
568708012828	3 probable transmembrane helices predicted for STM_MW27941 by TMHMM2.0 at aa 26-48, 68-90 and 134-156
568708012829	Phosphotransferase system sorbitol-specific component IIBC [Carbohydrate transport and metabolism]; Region: SrlE; COG3732
568708012830	Sorbitol phosphotransferase enzyme II N-terminus; Region: EIIBC-GUT_N; pfam03612
568708012831	Nucleoside recognition; Region: Gate; pfam07670
568708012832	Sorbitol phosphotransferase enzyme II C-terminus; Region: EIIBC-GUT_C; pfam07663
568708012834	4 probable transmembrane helices predicted for STM_MW27951 by TMHMM2.0 at aa 181-203, 218-240, 247-269 and 300-322
568708012836	PTS system glucitol/sorbitol-specific transporter subunit IIA; Provisional; Region: PRK10377
568708012838	sorbitol-6-phosphate dehydrogenase; Provisional; Region: PRK12384
568708012839	Sorbitol 6-phosphate dehydrogenase (SDH), classical (c) SDRs; Region: SDH_SDR_c_like; cd05322
568708012840	putative NAD(P) binding site [chemical binding]; other site
568708012841	active site
568708012843	DNA-binding transcriptional activator GutM; Provisional; Region: PRK10234
568708012844	Signal peptide predicted for STM_MW27981 by SignalP 2.0 HMM (Signal peptide probability 0.907) with cleavage site probability 0.897 between residues 20 and 21
568708012845	1 probable transmembrane helix predicted for STM_MW27981 by TMHMM2.0 at aa 2-24
568708012847	DNA-bindng transcriptional repressor SrlR; Provisional; Region: srlR; PRK10434
568708012848	DeoR-like helix-turn-helix domain; Region: HTH_DeoR; pfam08220
568708012849	DeoR C terminal sensor domain; Region: DeoRC; pfam00455
568708012852	D-arabinose 5-phosphate isomerase; Provisional; Region: gutQ; PRK11543
568708012853	KpsF-like protein. KpsF is an arabinose-5-phosphate isomerase which contains SIS (Sugar ISomerase) domains. SIS domains are found in many phosphosugar isomerases and phosphosugar binding proteins. KpsF catalyzes the reversible reaction of ribulose...; Region: SIS_Kpsf; cd05014
568708012854	putative active site [active]
568708012855	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains associated with KpsF/GutQ domains in the API [A5P (D-arabinose 5-phosphate) isomerase] protein.  These APIs catalyze the conversion of the pentose pathway...; Region: CBS_pair_KpsF_GutQ_assoc; cd04604
568708012858	anaerobic nitric oxide reductase transcription regulator; Provisional; Region: PRK05022
568708012859	GAF domain; Region: GAF; pfam01590
568708012860	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708012861	Walker A motif; other site
568708012862	ATP binding site [chemical binding]; other site
568708012863	Walker B motif; other site
568708012864	arginine finger; other site
568708012867	anaerobic nitric oxide reductase flavorubredoxin; Provisional; Region: PRK05452
568708012868	Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849
568708012869	Flavodoxin-like fold; Region: Flavodoxin_2; cl00438
568708012870	Rubredoxin; nonheme iron binding domains containing a [Fe(SCys)4] center. Rubredoxins are small nonheme iron proteins. The iron atom is coordinated by four cysteine residues (Fe(S-Cys)4), but iron can also be replaced by cobalt, nickel or zinc. They are...; Region: rubredoxin; cd00730
568708012871	iron binding site [ion binding]; other site
568708012875	NADH:flavorubredoxin oxidoreductase; Provisional; Region: PRK04965
568708012876	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
568708012877	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
568708012880	Acylphosphatase; Region: Acylphosphatase; pfam00708
568708012881	Hydrogenase maturation factor [Posttranslational modification, protein turnover, chaperones]; Region: HypF; COG0068
568708012882	HypF finger; Region: zf-HYPF; pfam07503
568708012883	HypF finger; Region: zf-HYPF; pfam07503
568708012884	Telomere recombination; Region: Sua5_yciO_yrdC; pfam01300
568708012888	formate dehydrogenase-H ferredoxin subunit; Provisional; Region: PRK10330
568708012889	RPB11 and RPB3 subunits of RNA polymerase; Region: RNAP_RPB11_RPB3; cl11409
568708012891	1 probable transmembrane helix predicted for STM_MW28061 by TMHMM2.0 at aa 13-35
568708012892	Signal peptide predicted for STM_MW28061 by SignalP 2.0 HMM (Signal peptide probability 0.969) with cleavage site probability 0.849 between residues 30 and 31
568708012893	Endopeptidases belonging to membrane-bound hydrogen evolving hydrogenase group. In hydrogenase 3 from E coli, the maturation of the large subunit (HycE) requires the cleavage of a C-terminal peptide by the endopeptidase HycI, before the final formation...; Region: H2MP_MemB-H2evol; cd06067
568708012894	coenzyme F420-reducing hydrogenase delta subunit (putative coenzyme F420 hydrogenase processing subunit); Region: frhD; TIGR00130
568708012895	nickel binding site [ion binding]; other site
568708012897	formate hydrogenlyase maturation protein HycH; Provisional; Region: PRK15084
568708012899	Ni,Fe-hydrogenase III small subunit [Energy production and conversion]; Region: COG3260
568708012901	formate hydrogenlyase complex iron-sulfur subunit; Provisional; Region: PRK12387
568708012902	The HCP family of iron-sulfur proteins includes hybrid cluster protein (HCP), acetyl-CoA synthase (ACS), and carbon monoxide dehydrogenase (CODH), all of which contain [Fe4-S4] metal clusters at their active sites. These proteins have a conserved...; Region: HCP_like; cl14655
568708012904	Ni,Fe-hydrogenase III component G [Energy production and conversion]; Region: HycE; COG3262
568708012905	Ni,Fe-hydrogenase III large subunit [Energy production and conversion]; Region: HycE; COG3261
568708012906	NADH dehydrogenase subunit D; Validated; Region: PRK06075; cl17338
568708012910	Formate hydrogenlyase subunit 4 [Energy production and conversion]; Region: HyfC; COG0650
568708012911	NADH dehydrogenase; Region: NADHdh; cl00469
568708012912	7 probable transmembrane helices predicted for STM_MW28121 by TMHMM2.0 at aa 5-27, 62-84, 94-111, 132-154, 169-188, 252-274 and 289-306
568708012914	formate hydrogenlyase subunit 3; Reviewed; Region: PRK08042
568708012915	NADH-Ubiquinone/plastoquinone (complex I), various chains; Region: Oxidored_q1; pfam00361
568708012916	15 probable transmembrane helices predicted for STM_MW28131 by TMHMM2.0 at aa 4-26, 31-53, 73-95, 108-125, 129-148, 155-177, 197-219, 231-253, 257-279, 292-311, 326-348, 373-395, 415-437, 457-479 and 499-521
568708012918	Signal peptide predicted for STM_MW28131 by SignalP 2.0 HMM (Signal peptide probability 0.996) with cleavage site probability 0.571 between residues 31 and 32
568708012919	Fe-S-cluster-containing hydrogenase components 2 [Energy production and conversion]; Region: HycB; COG1142
568708012921	formate hydrogenlyase regulatory protein HycA; Provisional; Region: PRK10198
568708012923	Hydrogenase expression/synthesis hypA family; Region: HypA; cl17671
568708012924	hydrogenase nickel incorporation protein; Validated; Region: hypA; PRK03681
568708012926	hydrogenase nickel incorporation protein HypB; Provisional; Region: PRK10463
568708012928	hydrogenase assembly chaperone; Provisional; Region: PRK10409
568708012930	hydrogenase isoenzymes formation protein HypD; Provisional; Region: PRK15062
568708012931	hydrogenase expression/formation protein HypD; Region: hypD; TIGR00075
568708012933	hydrogenase expression/formation protein HypE; Region: hypE; TIGR02124
568708012934	HypE (Hydrogenase expression/formation protein). HypE is involved in Ni-Fe hydrogenase biosynthesis.  HypE dehydrates its own carbamoyl moiety in an ATP-dependent process to yield the enzyme thiocyanate. The N-terminal domain of HypE is related to the...; Region: HypE; cd02197
568708012935	dimerization interface [polypeptide binding]; other site
568708012936	ATP binding site [chemical binding]; other site
568708012939	formate hydrogenlyase transcriptional activator FhlA; Provisional; Region: PRK15429
568708012940	Domain present in phytochromes and cGMP-specific phosphodiesterases; Region: GAF; smart00065
568708012941	Domain present in phytochromes and cGMP-specific phosphodiesterases; Region: GAF; smart00065
568708012942	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708012943	Walker A motif; other site
568708012944	ATP binding site [chemical binding]; other site
568708012945	Walker B motif; other site
568708012946	arginine finger; other site
568708012947	Bacterial regulatory protein, Fis family; Region: HTH_8; pfam02954
568708012951	Nitrous oxide-stimulated promoter; Region: YgbA_NO; pfam11756
568708012953	ABC-type metal ion transport system, periplasmic component/surface adhesin [Inorganic ion transport and metabolism]; Region: LraI; COG0803
568708012954	Metal binding protein PsaA.  These proteins have been shown to function as initial receptors in ABC transport of Mn2+ and as surface adhesins in some eubacterial species.  They belong to the TroA superfamily of periplasmic metal binding proteins that...; Region: PsaA; cd01137
568708012955	metal binding site [ion binding]; metal-binding site
568708012956	Signal peptide predicted for STM_MW28231 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 26 and 27
568708012957	1 probable transmembrane helix predicted for STM_MW28231 by TMHMM2.0 at aa 7-26
568708012959	manganese/iron transporter ATP-binding protein; Provisional; Region: PRK15056
568708012960	ATP-binding cassette domain of the metal-type transporters; Region: ABC_Metallic_Cations; cd03235
568708012962	ABC-type Mn2+/Zn2+ transport systems, permease components [Inorganic ion transport and metabolism]; Region: ZnuB; COG1108
568708012963	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
568708012964	ABC-ATPase subunit  interface; other site
568708012965	dimer interface [polypeptide binding]; other site
568708012966	putative PBP binding regions; other site
568708012968	7 probable transmembrane helices predicted for STM_MW28251 by TMHMM2.0 at aa 15-37, 50-72, 92-114, 121-143, 182-204, 217-239 and 249-271
568708012969	ABC-type Mn2+/Zn2+ transport systems, permease components [Inorganic ion transport and metabolism]; Region: ZnuB; COG1108
568708012970	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
568708012971	ABC-ATPase subunit  interface; other site
568708012972	dimer interface [polypeptide binding]; other site
568708012973	putative PBP binding regions; other site
568708012975	8 probable transmembrane helices predicted for STM_MW28261 by TMHMM2.0 at aa 21-43, 58-80, 93-115, 130-152, 169-191, 196-215, 222-244 and 248-267
568708012976	effector protein YopJ; Provisional; Region: PRK15371
568708012978	transcriptional activator SprB; Provisional; Region: PRK15320
568708012979	DNA-binding HTH domain-containing proteins [Transcription]; Region: CsgD; COG2771
568708012980	transcriptional regulator SirC; Provisional; Region: PRK15044
568708012981	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708012983	putative type III secretion system effector protein OrgC; Provisional; Region: PRK15321
568708012984	invasion protein OrgB; Provisional; Region: PRK15322
568708012985	type III secretion apparatus protein OrgA/MxiK; Region: OrgA_MxiK; TIGR02555
568708012986	invasion protein OrgA; Provisional; Region: PRK15323
568708012988	type III secretion system lipoprotein PrgK; Provisional; Region: PRK15324
568708012990	1 probable transmembrane helix predicted for STM_MW28331 by TMHMM2.0 at aa 207-229
568708012991	type III secretion system needle complex protein PrgJ; Provisional; Region: PRK15325
568708012993	type III secretion system needle complex protein PrgI; Provisional; Region: PRK15326
568708012995	type III secretion system needle complex protein PrgH; Provisional; Region: PRK15327
568708012996	Type III secretion system protein PrgH-EprH (PrgH); Region: PrgH; pfam09480
568708012998	1 probable transmembrane helix predicted for STM_MW28361 by TMHMM2.0 at aa 141-163
568708012999	transcriptional regulator HilD; Provisional; Region: PRK15185
568708013000	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708013002	invasion protein regulator; Provisional; Region: PRK12370
568708013003	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
568708013004	DNA binding site [nucleotide binding]
568708013005	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
568708013006	binding surface
568708013007	TPR motif; other site
568708013009	Soluble lytic murein transglycosylase and related regulatory proteins (some contain LysM/invasin domains) [Cell envelope biogenesis, outer membrane]; Region: MltE; COG0741
568708013010	Lytic Transglycosylase (LT)  and Goose Egg White Lysozyme (GEWL) domain. Members include the soluble and insoluble membrane-bound LTs in bacteria, the LTs in bacteriophage lambda, as well as, the eukaryotic "goose-type" lysozymes (GEWL).  LTs...; Region: LT_GEWL; cd00254
568708013011	N-acetyl-D-glucosamine binding site [chemical binding]; other site
568708013012	catalytic residue [active]
568708013014	pathogenicity island 1 effector protein StpP; Provisional; Region: PRK15375
568708013015	SicP binding; Region: SicP-binding; pfam09119
568708013016	GTPase-activating protein (GAP) domain found in bacterial cytotoxins, ExoS, SptP, and YopE. Part of protein secretion system; stimulates Rac1- dependent cytoskeletal changes that promote bacterial internalization; Region: ToxGAP; cd00219
568708013017	switch II binding region; other site
568708013018	Rac1 P-loop interaction site [polypeptide binding]; other site
568708013019	GTP binding residues [chemical binding]; other site
568708013020	switch I binding region; other site
568708013021	Protein tyrosine phosphatases (PTP) catalyze the dephosphorylation of phosphotyrosine peptides; they regulate phosphotyrosine levels in signal transduction pathways. The depth of the active site cleft renders the enzyme specific for phosphorylated Tyr; Region: PTPc; cd00047
568708013022	active site
568708013026	chaperone protein SicP; Provisional; Region: PRK15329
568708013028	putative acyl carrier protein IacP; Validated; Region: PRK08172
568708013030	pathogenicity island 1 effector protein SipA; Provisional; Region: PRK15376
568708013032	cell invasion protein SipD; Provisional; Region: PRK15330
568708013034	pathogenicity island 1 effector protein SipC; Provisional; Region: PRK15373
568708013036	pathogenicity island 1 effector protein SipB; Provisional; Region: PRK15374
568708013037	2 probable transmembrane helices predicted for STM_MW28471 by TMHMM2.0 at aa 320-342 and 408-430
568708013039	chaperone protein SicA; Provisional; Region: PRK15331
568708013040	Tetratricopeptide repeat; Region: TPR_3; pfam07720
568708013041	Tetratricopeptide repeat; Region: TPR_3; pfam07720
568708013043	type III secretion system protein SpaS; Validated; Region: PRK08156
568708013045	4 probable transmembrane helices predicted for STM_MW28491 by TMHMM2.0 at aa 29-51, 72-94, 136-153 and 178-200
568708013046	type III secretion system protein SpaR; Provisional; Region: PRK15332
568708013048	6 probable transmembrane helices predicted for STM_MW28501 by TMHMM2.0 at aa 10-32, 37-59, 79-101, 128-150, 181-203 and 210-232
568708013049	type III secretion system protein SpaQ; Provisional; Region: PRK15333
568708013051	2 probable transmembrane helices predicted for STM_MW28511 by TMHMM2.0 at aa 12-34 and 49-71
568708013052	type III secretion system protein SpaP; Provisional; Region: spaP; PRK12796
568708013054	3 probable transmembrane helices predicted for STM_MW28521 by TMHMM2.0 at aa 15-37, 50-69 and 161-183
568708013055	type III secretion system protein SpaO; Validated; Region: PRK08158
568708013056	Flagellar motor switch/type III secretory pathway protein [Cell motility and secretion / Intracellular trafficking and secretion]; Region: FliN; COG1886
568708013058	antigen presentation protein SpaN; Provisional; Region: PRK15334
568708013059	Surface presentation of antigens protein; Region: SPAN; pfam02510
568708013061	Salmonella surface presentation of antigen gene type M protein; Region: SPAM; pfam02090
568708013063	ATP synthase SpaL; Validated; Region: PRK08149
568708013064	ATP synthase alpha/beta family, beta-barrel domain; Region: ATP-synt_ab_N; pfam02874
568708013065	RecA-like NTPases. This family includes the NTP binding domain of F1 and V1 H+ATPases, DnaB and related helicases as well as bacterial RecA and related eukaryotic and archaeal recombinases. This group also includes bacterial conjugation proteins and...; Region: RecA-like_NTPases; cl17233
568708013066	Walker A motif; other site
568708013067	ATP binding site [chemical binding]; other site
568708013068	Walker B motif; other site
568708013070	type III secretion system chaperone SpaK; Provisional; Region: PRK15336
568708013072	Type III secretory pathway, component EscV [Intracellular trafficking and secretion]; Region: EscV; COG4789
568708013073	type III secretion system protein InvA; Provisional; Region: PRK15337
568708013075	8 probable transmembrane helices predicted for STM_MW28581 by TMHMM2.0 at aa 13-30, 35-57, 69-91, 106-128, 197-219, 239-261, 274-291 and 296-315
568708013076	type III secretion system regulator InvE; Provisional; Region: PRK15338
568708013077	type III secretion regulator YopN/LcrE/InvE/MxiC; Region: LcrE; TIGR02568
568708013079	type III secretion system outer membrane pore InvG; Provisional; Region: PRK15339
568708013080	Bacterial type II/III secretion system short domain; Region: Secretin_N; pfam03958
568708013081	Bacterial type II/III secretion system short domain; Region: Secretin_N; pfam03958
568708013082	Bacterial type II and III secretion system protein; Region: Secretin; pfam00263
568708013085	Signal peptide predicted for STM_MW28601 by SignalP 2.0 HMM (Signal peptide probability 0.992) with cleavage site probability 0.635 between residues 24 and 25
568708013086	transcriptional regulator InvF; Provisional; Region: PRK15340
568708013087	InvH outer membrane lipoprotein; Region: InvH; pfam04741
568708013088	Signal peptide predicted for STM_MW28621 by SignalP 2.0 HMM (Signal peptide probability 0.697) with cleavage site probability 0.323 between residues 26 and 27
568708013090	Protein of unknown function (DUF1493); Region: DUF1493; pfam07377
568708013092	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4453
568708013096	PrpA and PrpB, metallophosphatase domain; Region: MPP_PrpA_PrpB; cd07424
568708013097	Calcineurin-like phosphoesterase; Region: Metallophos; pfam00149
568708013098	active site
568708013099	metal binding site [ion binding]; metal-binding site
568708013101	DNA mismatch repair protein MutS; Provisional; Region: PRK05399
568708013102	MutS domain I; Region: MutS_I; pfam01624
568708013103	MutS domain II; Region: MutS_II; pfam05188
568708013104	MutS domain III; Region: MutS_III; pfam05192
568708013105	ATP-binding cassette domain of MutS1 homolog; Region: ABC_MutS1; cd03284
568708013106	Walker A/P-loop; other site
568708013107	ATP binding site [chemical binding]; other site
568708013108	Q-loop/lid; other site
568708013109	ABC transporter signature motif; other site
568708013110	Walker B; other site
568708013111	D-loop; other site
568708013112	H-loop/switch region; other site
568708013118	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4460
568708013119	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708013120	Major Facilitator Superfamily; Region: MFS_1; pfam07690
568708013121	putative substrate translocation pore; other site
568708013123	12 probable transmembrane helices predicted for STM_MW28741 by TMHMM2.0 at aa 7-29, 42-64, 69-88, 98-120, 129-151, 161-183, 203-225, 235-257, 270-289, 299-321, 342-361 and 366-388
568708013124	Transcriptional regulator [Transcription]; Region: LysR; COG0583
568708013125	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708013126	The C-terminal substrate binding domain of LysR-type transcriptional regulator CrgA and its related homologs, contains the type 2 periplasmic binding domain; Region: PBP2_CrgA_like; cd08422
568708013127	putative effector binding pocket; other site
568708013128	dimerization interface [polypeptide binding]; other site
568708013129	Signal peptide predicted for STM_MW28751 by SignalP 2.0 HMM (Signal peptide probability 0.838) with cleavage site probability 0.374 between residues 30 and 31
568708013132	GntP family permease; Region: GntP_permease; pfam02447
568708013133	fructuronate transporter; Provisional; Region: PRK10034; cl15264
568708013135	12 probable transmembrane helices predicted for STM_MW28761 by TMHMM2.0 at aa 4-23, 30-48, 58-80, 104-126, 176-198, 241-263, 278-300, 320-337, 357-379, 392-414, 434-456 and 463-485
568708013136	Nucleoside-diphosphate-sugar epimerases [Cell envelope biogenesis, outer membrane / Carbohydrate transport and metabolism]; Region: WcaG; COG0451
568708013137	Escherichia coli Gne (a nucleoside-diphosphate-sugar 4-epimerase)-like, extended (e) SDRs; Region: Gne_like_SDR_e; cd05238
568708013138	putative NAD(P) binding site [chemical binding]; other site
568708013139	active site
568708013140	putative substrate binding site [chemical binding]; other site
568708013142	hypothetical protein; Provisional; Region: PRK09989
568708013144	putative aldolase; Validated; Region: PRK08130
568708013145	intersubunit interface [polypeptide binding]; other site
568708013146	active site
568708013147	Zn2+ binding site [ion binding]; other site
568708013149	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3395
568708013151	3-hydroxyisobutyrate dehydrogenase and related beta-hydroxyacid dehydrogenases [Lipid metabolism]; Region: MmsB; COG2084
568708013152	6-phosphogluconate dehydrogenase-like protein; Reviewed; Region: PRK09599
568708013154	Transcriptional regulators of sugar metabolism [Transcription / Carbohydrate transport and metabolism]; Region: GlpR; COG1349
568708013155	helix_turn_helix, Deoxyribose operon repressor; Region: HTH_DEOR; smart00420
568708013156	DeoR C terminal sensor domain; Region: DeoRC; pfam00455
568708013159	MarR family; Region: MarR_2; cl17246
568708013160	Transcriptional regulators [Transcription]; Region: MarR; COG1846
568708013162	3-polyprenyl-4-hydroxybenzoate decarboxylase [Coenzyme metabolism]; Region: UbiX; COG0163
568708013163	Flavoprotein; Region: Flavoprotein; pfam02441
568708013165	3-polyprenyl-4-hydroxybenzoate decarboxylase and related decarboxylases [Coenzyme metabolism]; Region: UbiD; COG0043
568708013167	RNA polymerase sigma factor RpoS; Validated; Region: PRK05657
568708013168	Sigma-70 factor, region 1.2; Region: Sigma70_r1_2; pfam00140
568708013169	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
568708013170	Sigma-70 region 3; Region: Sigma70_r3; pfam04539
568708013171	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
568708013172	DNA binding residues [nucleotide binding]
568708013177	lipoprotein NlpD; Provisional; Region: nlpD; PRK10871
568708013178	Lysine Motif is a small domain involved in binding peptidoglycan; Region: LysM; cd00118
568708013179	Peptidase family M23; Region: Peptidase_M23; pfam01551
568708013182	Signal peptide predicted for STM_MW28881 by SignalP 2.0 HMM (Signal peptide probability 0.964) with cleavage site probability 0.522 between residues 30 and 31
568708013183	protein-L-isoaspartate O-methyltransferase; Reviewed; Region: pcm; PRK00312
568708013184	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708013185	S-adenosylmethionine binding site [chemical binding]; other site
568708013187	5'(3')-nucleotidase/polyphosphatase; Provisional; Region: surE; PRK00346
568708013189	tRNA pseudouridine synthase D; Reviewed; Region: truD; PRK00984
568708013190	Pseudouridine synthase, similar to Escherichia coli TruD; Region: PseudoU_synth_EcTruD; cd02575
568708013191	Permutation of conserved domain; other site
568708013192	active site
568708013193	Pseudouridine synthases catalyze the isomerization of specific uridines in an RNA molecule to pseudouridines (5-ribosyluracil, psi); Region: PseudoU_synth; cl00130
568708013195	MECDP_synthase (2-C-methyl-D-erythritol-2,4-cyclodiphosphate synthase), encoded by the ispF gene, catalyzes the formation of 2-C-methyl-D-erythritol 2,4-cyclodiphosphate (MEC) in the non-mevalonate deoxyxylulose (DOXP) pathway for isoprenoid biosynthesis; Region: MECDP_synthase; cd00554
568708013196	homotrimer interaction site [polypeptide binding]; other site
568708013197	zinc binding site [ion binding]; other site
568708013198	CDP-binding sites; other site
568708013200	CDP-ME synthetase is involved in mevalonate-independent isoprenoid production; Region: CDP-ME_synthetase; cd02516
568708013201	substrate binding site; other site
568708013202	dimer interface; other site
568708013204	cell division protein FtsB; Reviewed; Region: ftsB; PRK00888
568708013205	Septum formation initiator [Cell division and chromosome partitioning]; Region: COG2919
568708013207	tmhmm; query 1-118
568708013208	Adenosine 5'-phosphosulfate kinase (APSK) catalyzes the phosphorylation of adenosine 5'-phosphosulfate to form 3'-phosphoadenosine 5'-phosphosulfate (PAPS). The end-product PAPS is a biologically "activated" sulfate form...; Region: APSK; cd02027
568708013209	ligand-binding site [chemical binding]; other site
568708013211	sulfate adenylyltransferase subunit 1; Provisional; Region: cysN; PRK05124
568708013212	CysN, together with protein CysD, forms the ATP sulfurylase (ATPS) complex; Region: CysN_ATPS; cd04166
568708013213	CysD dimerization site [polypeptide binding]; other site
568708013214	G1 box; other site
568708013215	putative GEF interaction site [polypeptide binding]; other site
568708013216	GTP/Mg2+ binding site [chemical binding]; other site
568708013217	Switch I region; other site
568708013218	G2 box; other site
568708013219	G3 box; other site
568708013220	Switch II region; other site
568708013221	G4 box; other site
568708013222	G5 box; other site
568708013223	CysN_NodQ_II: This subfamily represents the domain II of the large subunit of ATP sulfurylase (ATPS): CysN or the N-terminal portion of NodQ, found mainly in proteobacteria and homologous to the domain II of EF-Tu. Escherichia coli ATPS consists of CysN...; Region: CysN_NodQ_II; cd03695
568708013224	TCysN_NoDQ_II: This subfamily represents the domain II of the large subunit of ATP sulfurylase (ATPS): CysN or the N-terminal portion of NodQ, found mainly in proteobacteria and homologous to the domain II of EF-Tu. Escherichia coli ATPS consists of CysN...; Region: CysN_NoDQ_III; cd04095
568708013227	sulfate adenylyltransferase, small subunit; Region: CysD; TIGR02039
568708013228	This domain is found in phosphoadenosine phosphosulphate (PAPS) reductase enzymes or PAPS sulphotransferase. PAPS reductase is part of the adenine nucleotide alpha hydrolases superfamily also including N type ATP PPases and ATP sulphurylases. A highly...; Region: PAPS_reductase; cd01713
568708013229	Active Sites [active]
568708013231	alkaline phosphatase isozyme conversion aminopeptidase; Provisional; Region: PRK10199
568708013232	M28 Zn-peptidases include aminopeptidases and carboxypeptidases; Region: M28; cd02690
568708013233	metal binding site [ion binding]; metal-binding site
568708013234	Signal peptide predicted for STM_MW28991 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 24 and 25
568708013236	CRISPR/Cas system-associated protein Cas2; Region: Cas2_I-E; cd09648
568708013238	CRISPR/Cas system-associated protein Cas1; Region: Cas1_I-E; cd09719
568708013240	CRISPR/Cas system-associated RAMP superfamily protein Cas6e; Region: Cas6_I-E; cd09727
568708013242	CRISPR-associated protein (Cas_Cas5); Region: Cas_Cas5d; pfam09704
568708013243	CRISPR/Cas system-associated RAMP superfamily protein Cas5; Region: Cas5_I-E; cd09645
568708013244	CRISPR/Cas system-associated RAMP superfamily protein Cas7; Region: Cas7_I-E; cd09646
568708013246	CRISPR/Cas system-associated protein Cse2; Region: Cse2_I-E; cd09731
568708013248	CRISPR/Cas system-associated protein Cse1; Region: Cse1_I-E; cd09669
568708013250	CRISPR/Cas system-associated protein Cas3'' Region: Cas3''_I; cd09641
568708013251	CRISPR-associated helicase Cas3 [Defense mechanisms]; Region: COG1203
568708013252	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cl17251
568708013253	pathogenicity island 1 effector protein SopD; Provisional; Region: PRK15379
568708013255	3'-phosphoadenosine 5'-phosphosulfate sulfotransferase (PAPS reductase)/FAD synthetase and related enzymes [Amino acid transport and metabolism / Coenzyme metabolism]; Region: CysH; COG0175
568708013256	This domain is found in phosphoadenosine phosphosulphate (PAPS) reductase enzymes or PAPS sulphotransferase. PAPS reductase is part of the adenine nucleotide alpha hydrolases superfamily also including N type ATP PPases and ATP sulphurylases. A highly...; Region: PAPS_reductase; cd01713
568708013257	Active Sites [active]
568708013259	sulfite reductase subunit beta; Provisional; Region: PRK13504
568708013260	Nitrite/Sulfite reductase ferredoxin-like half domain; Region: NIR_SIR_ferr; pfam03460
568708013261	Nitrite/Sulfite reductase ferredoxin-like half domain; Region: NIR_SIR_ferr; pfam03460
568708013264	Sulfite reductase, alpha subunit (flavoprotein) [Inorganic ion transport and metabolism]; Region: CysJ; COG0369
568708013265	Flavodoxin; Region: Flavodoxin_1; pfam00258
568708013266	Cytochrome p450- like alpha subunits of E. coli sulfite reductase (SiR) multimerize with beta subunits to catalyze the NADPH dependent reduction of sulfite to sulfide. Beta subunits have an Fe4S4 cluster and a siroheme, while the alpha subunits (cysJ...; Region: SiR; cd06199
568708013267	FAD binding pocket [chemical binding]; other site
568708013268	FAD binding motif [chemical binding]; other site
568708013269	catalytic residues [active]
568708013270	NAD binding pocket [chemical binding]; other site
568708013271	phosphate binding motif [ion binding]; other site
568708013272	beta-alpha-beta structure motif; other site
568708013276	Tunnelling fold (T-fold). The five known T-folds are found in five different enzymes with different functions: dihydroneopterin-triphosphate epimerase (DHNTPE), dihydroneopterin aldolase (DHNA) , GTP cyclohydrolase I (GTPCH-1),  6-pyrovoyl...; Region: TFold; cl00263
568708013277	active site
568708013279	Metal-dependent hydrolases of the beta-lactamase superfamily II [General function prediction only]; Region: COG1237
568708013281	Organic radical activating enzymes [Posttranslational modification, protein turnover, chaperones]; Region: NrdG; COG0602
568708013282	putative 7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE; Region: rSAM_QueE_Ecoli; TIGR04322
568708013284	enolase; Provisional; Region: eno; PRK00077
568708013285	Enolase: Enolases are homodimeric enzymes that catalyse the reversible dehydration of 2-phospho-D-glycerate to phosphoenolpyruvate as part of the glycolytic and gluconeogenesis pathways. The reaction is facilitated by the presence of metal ions; Region: enolase; cd03313
568708013286	dimer interface [polypeptide binding]; other site
568708013287	metal binding site [ion binding]; metal-binding site
568708013288	substrate binding pocket [chemical binding]; other site
568708013291	CTP synthetase; Validated; Region: pyrG; PRK05380
568708013292	CTP synthetase (CTPs) is a two-domain protein, which consists of an N-terminal synthetase domain and C-terminal glutaminase domain. The enzymes hydrolyze the amide bond of glutamine to ammonia and glutamate at the glutaminase domains and transfer nascent...; Region: CTGs; cd03113
568708013293	Catalytic site [active]
568708013294	active site
568708013295	UTP binding site [chemical binding]; other site
568708013296	Type 1 glutamine amidotransferase (GATase1) domain found in Cytidine Triphosphate Synthetase; Region: GATase1_CTP_Synthase; cd01746
568708013297	active site
568708013298	putative oxyanion hole; other site
568708013299	catalytic triad [active]
568708013302	1 probable transmembrane helix predicted for STM_MW29161 by TMHMM2.0 at aa 7-29
568708013303	Signal peptide predicted for STM_MW29161 by SignalP 2.0 HMM (Signal peptide probability 0.616) with cleavage site probability 0.525 between residues 26 and 27
568708013304	nucleoside triphosphate pyrophosphohydrolase; Reviewed; Region: mazG; PRK09562
568708013305	Nucleoside Triphosphate Pyrophosphohydrolase (EC 3.6.1.8) N-terminal tandem-domain of MazG proteins from Escherichia coli and bacterial homologs; Region: NTP-PPase_MazG_Nterm; cd11528
568708013306	homodimer interface [polypeptide binding]; other site
568708013307	metal binding site [ion binding]; metal-binding site
568708013308	Nucleoside Triphosphate Pyrophosphohydrolase (EC 3.6.1.8) C-terminal tandem-domain of MazG proteins from Escherichia coli and bacterial homologs' Region: NTP-PPase_MazG_Cterm; cd11529
568708013309	homodimer interface [polypeptide binding]; other site
568708013310	active site
568708013311	putative chemical substrate binding site [chemical binding]; other site
568708013312	metal binding site [ion binding]; metal-binding site
568708013314	Plasmid stabilization system protein [General function prediction only]; Region: ParE; COG3668
568708013316	Predicted transcriptional regulators containing the CopG/Arc/MetJ DNA-binding domain [Transcription]; Region: COG3609
568708013318	(p)ppGpp synthetase I/GTP pyrophosphokinase; Provisional; Region: relA; PRK10872
568708013319	HD domain; Region: HD_4; pfam13328
568708013320	Nucleotidyltransferase (NT) domain of RelA- and SpoT-like ppGpp synthetases and hydrolases; Region: NT_Rel-Spo_like; cd05399
568708013321	synthetase active site [active]
568708013322	NTP binding site [chemical binding]; other site
568708013323	metal binding site [ion binding]; metal-binding site
568708013324	TGS_RelA_SpoT: The RelA (SpoT) protein, also referred to as ppGpp hydrolase/synthetase, is a ribosome-associated protein that is activated during amino acid starvation and thought to mediate the stringent response. RelA contains a TGS domain, named after...; Region: TGS_RelA_SpoT; cd01668
568708013325	ACT  domain found C-terminal of the RelA/SpoT domains; Region: ACT_RelA-SpoT; cd04876
568708013329	23S rRNA m(5)U1939 methyltransferase; Reviewed; Region: rumA; PRK13168
568708013330	TRAM domain; Region: TRAM; pfam01938
568708013331	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708013332	S-adenosylmethionine binding site [chemical binding]; other site
568708013335	hybrid sensory histidine kinase BarA; Provisional; Region: PRK11107
568708013336	Uncharacterized signal transduction histidine kinase domain (DUF2222); Region: DUF2222; pfam09984
568708013337	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
568708013338	dimerization interface [polypeptide binding]; other site
568708013339	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
568708013340	dimer interface [polypeptide binding]; other site
568708013341	phosphorylation site [posttranslational modification]
568708013342	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708013343	ATP binding site [chemical binding]; other site
568708013344	Mg2+ binding site [ion binding]; other site
568708013345	G-X-G motif; other site
568708013346	Uncharacterized domain of BarA-like signal transduction histidine kinases [Signal transduction mechanisms]; Region: COG4999
568708013347	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708013348	active site
568708013349	phosphorylation site [posttranslational modification]
568708013350	intermolecular recognition site; other site
568708013351	dimerization interface [polypeptide binding]; other site
568708013352	Histidine Phosphotransfer domain, involved in signalling through a two part component systems in which an autophosphorylating histidine protein kinase serves as a phosphoryl donor to a response regulator protein; the response regulator protein is...; Region: HPT; cd00088
568708013353	putative binding surface; other site
568708013354	active site
568708013355	2 probable transmembrane helices predicted for STM_MW29211 by TMHMM2.0 at aa 10-32 and 177-199
568708013362	Glycerate kinase [Carbohydrate transport and metabolism]; Region: COG1929
568708013364	glucarate dehydratase; Region: glucar-dehydr; TIGR03247
568708013365	D-Glucarate dehydratase (GlucD) catalyzes the dehydration of both D-glucarate and L-idarate to form 5-keto-4-deoxy-D-glucarate (5-KDG) , the initial reaction of the catabolic pathway for (D)-glucarate. GlucD belongs to the enolase superfamily of enzymes; Region: D-glucarate_dehydratase; cd03323
568708013366	active site
568708013367	tetramer interface [polypeptide binding]; other site
568708013369	glucarate dehydratase; Region: glucar-dehydr; TIGR03247
568708013370	D-Glucarate dehydratase (GlucD) catalyzes the dehydration of both D-glucarate and L-idarate to form 5-keto-4-deoxy-D-glucarate (5-KDG) , the initial reaction of the catabolic pathway for (D)-glucarate. GlucD belongs to the enolase superfamily of enzymes; Region: D-glucarate_dehydratase; cd03323
568708013371	active site
568708013372	tetramer interface [polypeptide binding]; other site
568708013375	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708013376	D-galactonate transporter; Region: 2A0114; TIGR00893
568708013377	putative substrate translocation pore; other site
568708013378	12 probable transmembrane helices predicted for STM_MW29251 by TMHMM2.0 at aa 20-42, 57-79, 86-105, 110-132, 152-174, 179-201, 256-278, 293-315, 328-348, 352-374, 387-409 and 414-436
568708013380	flavodoxin; Provisional; Region: PRK08105
568708013382	Pseudouridylate synthases, 23S RNA-specific [Translation, ribosomal structure and biogenesis]; Region: RluA; COG0564
568708013383	tRNA pseudouridine isomerase C; Region: PseudoU_synth_TruC; cd02563
568708013384	probable active site [active]
568708013386	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3098
568708013388	SecY interacting protein Syd; Provisional; Region: PRK04968
568708013390	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2904
568708013391	7-cyano-7-deazaguanine reductase; Provisional; Region: queF; PRK11792
568708013392	Enzyme related to GTP cyclohydrolase I [General function prediction only]; Region: COG0780
568708013394	Predicted Rossmann fold nucleotide-binding protein [General function prediction only]; Region: COG1611
568708013395	Domain of unknown function (DUF3412); Region: DUF3412; pfam11892
568708013397	Amino acid permeases [Amino acid transport and metabolism]; Region: SdaC; COG0814
568708013398	serine transporter; Region: stp; TIGR00814
568708013399	11 probable transmembrane helices predicted for STM_MW29331 by TMHMM2.0 at aa 24-41, 45-67, 103-125, 140-157, 164-186, 206-228, 249-271, 300-322, 351-373, 377-394 and 406-428
568708013401	L-serine dehydratase, iron-sulfur-dependent, single chain form; Region: sda_mono; TIGR00720
568708013402	Serine dehydratase beta chain; Region: SDH_beta; pfam03315
568708013403	Serine dehydratase alpha chain; Region: SDH_alpha; pfam03313
568708013406	flap endonuclease-like protein; Provisional; Region: PRK09482
568708013407	PIN domain of the 5'-3' exonuclease of Taq DNA polymerase I and homologs; Region: PIN_53EXO; cd09859
568708013408	active site
568708013409	metal binding site 1 [ion binding]; metal-binding site
568708013410	putative 5' ssDNA interaction site; other site
568708013411	metal binding site 3; metal-binding site
568708013412	metal binding site 2 [ion binding]; metal-binding site
568708013413	H3TH domain of the 5'-3' exonuclease of Taq DNA polymerase I and homologs; Region: H3TH_53EXO; cd09898
568708013414	putative DNA binding site [nucleotide binding]; other site
568708013415	putative metal binding site [ion binding]; other site
568708013418	L-1,2-propanediol oxidoreductase; Provisional; Region: PRK10624
568708013419	Lactadehyde:propanediol oxidoreductase (LPO) catalyzes the interconversion between L-lactaldehyde and L-1,2-propanediol in Escherichia coli and other enterobacteria; Region: LPO; cd08176
568708013420	dimer interface [polypeptide binding]; other site
568708013421	active site
568708013422	metal binding site [ion binding]; metal-binding site
568708013424	Class II Aldolase and Adducin head (N-terminal) domain. Aldolases are ubiquitous enzymes catalyzing central steps of carbohydrate metabolism. Based on enzymatic mechanisms, this superfamily has been divided into two distinct classes (Class I and II); Region: Aldolase_II; cd00398
568708013425	L-ribulose-5-phosphate 4-epimerase; Reviewed; Region: araD; PRK08193
568708013426	intersubunit interface [polypeptide binding]; other site
568708013427	active site
568708013428	Zn2+ binding site [ion binding]; other site
568708013430	Fucose permease [Carbohydrate transport and metabolism]; Region: FucP; COG0738
568708013431	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708013432	putative substrate translocation pore; other site
568708013433	12 probable transmembrane helices predicted for STM_MW29381 by TMHMM2.0 at aa 24-41, 61-83, 88-110, 120-142, 155-177, 212-234, 260-282, 292-314, 327-346, 351-373, 382-404 and 414-431
568708013435	L-fucose isomerase; Provisional; Region: fucI; PRK10991
568708013436	L-fucose isomerase (FucIase); FucIase converts L-fucose, an aldohexose, to its ketose form, which prepares it for aldol cleavage (similar to the isomerization of glucose during glycolysis). L-fucose (or 6-deoxy-L-galactose) is found in blood group...; Region: L-fucose_isomerase; cd03556
568708013437	hexamer (dimer of trimers) interface [polypeptide binding]; other site
568708013438	trimer interface [polypeptide binding]; other site
568708013439	substrate binding site [chemical binding]; other site
568708013440	Mn binding site [ion binding]; other site
568708013444	L-fuculokinase; Provisional; Region: PRK10331
568708013445	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cl17037
568708013446	nucleotide binding site [chemical binding]; other site
568708013449	L-fucose mutarotase; Provisional; Region: fucU; PRK15420
568708013451	DNA-binding transcriptional activator FucR; Provisional; Region: PRK10411
568708013452	DeoR-like helix-turn-helix domain; Region: HTH_DeoR; pfam08220
568708013453	DeoR C terminal sensor domain; Region: DeoRC; pfam00455
568708013456	putative 23S rRNA C2498 ribose 2'-O-ribose methyltransferase; Provisional; Region: PRK11760
568708013457	FtsJ-like methyltransferase; Region: FtsJ; pfam01728
568708013459	hypothetical protein; Provisional; Region: PRK10873
568708013460	4 probable transmembrane helices predicted for STM_MW29441 by TMHMM2.0 at aa 5-27, 37-59, 66-88 and 98-120
568708013462	Signal peptide predicted for STM_MW29441 by SignalP 2.0 HMM (Signal peptide probability 0.993) with cleavage site probability 0.682 between residues 24 and 25
568708013463	DNA-binding transcriptional activator GcvA; Provisional; Region: PRK11139
568708013464	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708013465	The C-terminal substrate domain of LysR-type GcdR, TrPI, HvR and beta-lactamase regulators, and that of other closely related homologs; contains the type 2 periplasmic binding fold; Region: PBP2_GcdR_TrpI_HvrB_AmpR_like; cd08432
568708013466	dimerization interface [polypeptide binding]; other site
568708013467	substrate binding pocket [chemical binding]; other site
568708013470	Bacterial protein of unknown function (DUF903); Region: DUF903; pfam06004
568708013472	1 probable transmembrane helix predicted for STM_MW29461 by TMHMM2.0 at aa 5-27
568708013473	Signal peptide predicted for STM_MW29461 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.586 between residues 21 and 22
568708013474	Selenocysteine lyase/Cysteine desulfurase [Posttranslational modification, protein turnover, chaperones]; Region: csdA; COG0520
568708013475	Cysteine desulfurase (SufS)-like. This family belongs to the pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to cysteine desulfurase (SufS) and selenocysteine lyase. SufS...; Region: SufS_like; cd06453
568708013476	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
568708013477	catalytic residue [active]
568708013479	CsdA-binding activator; Provisional; Region: PRK15019
568708013481	Predicted permeases [General function prediction only]; Region: RarD; COG2962
568708013482	10 probable transmembrane helices predicted for STM_MW29491 by TMHMM2.0 at aa 2-19, 29-48, 61-83, 88-110, 115-137, 141-158, 165-187, 197-219, 226-248 and 253-275
568708013484	sulfur acceptor protein CsdL; Provisional; Region: PRK15116
568708013485	Family of activating enzymes (E1) of ubiquitin-like proteins related to the E.coli hypothetical protein ygdL. The common reaction mechanism catalyzed by E1-like enzymes begins with a nucleophilic attack of the C-terminal carboxylate of the ubiquitin-like...; Region: YgdL_like; cd00755
568708013486	putative ATP binding site [chemical binding]; other site
568708013487	putative substrate interface [chemical binding]; other site
568708013489	murein transglycosylase A; Provisional; Region: mltA; PRK11162
568708013490	murein hydrolase B; Provisional; Region: PRK10760; cl17906
568708013491	MltA specific insert domain; Region: MltA; pfam03562
568708013492	3D domain; Region: 3D; pfam06725
568708013495	Signal peptide predicted for STM_MW29511 by SignalP 2.0 HMM (Signal peptide probability 0.911) with cleavage site probability 0.584 between residues 23 and 24
568708013496	AMIN domain; Region: AMIN; pfam11741
568708013497	N-acetylmuramoyl-L-alanine amidase [Cell envelope biogenesis, outer membrane]; Region: AmiC; COG0860
568708013498	N-acetylmuramoyl-L-alanine amidase or MurNAc-LAA (also known as peptidoglycan aminohydrolase, NAMLA amidase, NAMLAA, Amidase 3, and peptidoglycan amidase; EC 3.5.1.28) is an autolysin that hydrolyzes the amide bond between N-acetylmuramoyl and L-amino...; Region: MurNAc-LAA; cd02696
568708013499	active site
568708013500	metal binding site [ion binding]; metal-binding site
568708013503	Signal peptide predicted for STM_MW29521 by SignalP 2.0 HMM (Signal peptide probability 0.969) with cleavage site probability 0.946 between residues 31 and 32
568708013504	N-acetylglutamate synthase; Validated; Region: PRK05279
568708013505	AAK_NAGS-ABP: N-acetylglutamate (NAG) kinase-like domain of the NAG Synthase (NAGS) of the arginine-biosynthesis pathway (ABP) found in gamma- and beta-proteobacteria and higher plant chloroplasts. Domain architecture of these NAGS consisted of an...; Region: AAK_NAGS-ABP; cd04237
568708013506	putative feedback inhibition sensing region; other site
568708013507	putative nucleotide binding site [chemical binding]; other site
568708013508	putative substrate binding site [chemical binding]; other site
568708013509	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
568708013510	Coenzyme A binding pocket [chemical binding]; other site
568708013513	exonuclease V subunit alpha; Provisional; Region: recD; PRK10875
568708013514	AAA domain; Region: AAA_30; pfam13604
568708013515	Family description; Region: UvrD_C_2; pfam13538
568708013518	exonuclease V subunit beta; Provisional; Region: recB; PRK10876
568708013520	protease3; Provisional; Region: PRK15101
568708013521	Insulinase (Peptidase family M16); Region: Peptidase_M16; pfam00675
568708013522	Peptidase M16 inactive domain; Region: Peptidase_M16_C; pfam05193
568708013523	Peptidase M16 inactive domain; Region: Peptidase_M16_C; pfam05193
568708013526	Signal peptide predicted for STM_MW29561 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.986 between residues 23 and 24
568708013527	Exonuclease V gamma subunit [DNA replication, recombination, and repair]; Region: RecC; COG1330
568708013528	exonuclease V subunit gamma; Provisional; Region: recC; PRK11069
568708013530	hypothetical protein; Provisional; Region: PRK10332
568708013531	Prepilin peptidase dependent protein C term (DUF3728); Region: DUF3728; pfam12528
568708013532	1 probable transmembrane helix predicted for STM_MW29581 by TMHMM2.0 at aa 15-37
568708013533	hypothetical protein; Provisional; Region: PRK11521
568708013535	1 probable transmembrane helix predicted for STM_MW29591 by TMHMM2.0 at aa 10-27
568708013536	Signal peptide predicted for STM_MW29591 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.819 between residues 26 and 27
568708013537	hypothetical protein; Provisional; Region: PRK10557
568708013538	Type IV pilin N-term methylation site GFxxxE; Region: N_methyl_2; pfam13544
568708013539	1 probable transmembrane helix predicted for STM_MW29601 by TMHMM2.0 at aa 7-26
568708013540	hypothetical protein; Provisional; Region: PRK10506
568708013541	Type IV pilin N-term methylation site GFxxxE; Region: N_methyl_2; pfam13544
568708013542	1 probable transmembrane helix predicted for STM_MW29611 by TMHMM2.0 at aa 7-29
568708013543	thymidylate synthase; Reviewed; Region: thyA; PRK01827
568708013544	Thymidylate synthase and pyrimidine hydroxymethylase: Thymidylate synthase (TS) and deoxycytidylate hydroxymethylase (dCMP-HMase) are homologs that catalyze analogous alkylation of C5 of pyrimidine nucleotides. Both enzymes are involved in the...; Region: TS_Pyrimidine_HMase; cd00351
568708013545	dimerization interface [polypeptide binding]; other site
568708013546	active site
568708013548	prolipoprotein diacylglyceryl transferase; Reviewed; Region: PRK00052
568708013549	5 probable transmembrane helices predicted for STM_MW29631 by TMHMM2.0 at aa 15-37, 58-80, 95-117, 223-245 and 260-282
568708013551	fused phosphoenolpyruvate-protein phosphotransferase PtsP/GAF domain; Provisional; Region: PRK11061
568708013552	Domain present in phytochromes and cGMP-specific phosphodiesterases; Region: GAF; smart00065
568708013553	PEP-utilising enzyme, N-terminal; Region: PEP-utilisers_N; pfam05524
568708013554	PEP-utilising enzyme, mobile domain; Region: PEP-utilizers; pfam00391
568708013555	PEP-utilising enzyme, TIM barrel domain; Region: PEP-utilizers_C; pfam02896
568708013560	Diadenosine tetraphosphate (Ap4A) hydrolase is a member of the Nudix hydrolase superfamily. Members of this family are well represented in a variety of prokaryotic and eukaryotic organisms. Phylogenetic analysis reveals two distinct subgroups where plant...; Region: Ap4A_hydrolase_plant_like; cd03671
568708013561	putative active site [active]
568708013562	Ap4A binding site [chemical binding]; other site
568708013563	nudix motif; other site
568708013564	putative metal binding site [ion binding]; other site
568708013566	MutH is a 28kD endonuclease involved in methyl-directed DNA mismatch repair in gram negative bacteria. MutH is both sequence-specific and methylation-specific, introducing a nick in the unmethylated strand of a hemi-methylated d(GATC) DNA duplex.   MutH...; Region: MutH_Sau3AI; cd00583
568708013567	putative DNA-binding cleft [nucleotide binding]; other site
568708013568	putative DNA clevage site; other site
568708013569	molecular lever; other site
568708013571	Membrane protein TerC, possibly involved in tellurium resistance [Inorganic ion transport and metabolism]; Region: TerC; COG0861
568708013572	7 probable transmembrane helices predicted for STM_MW29671 by TMHMM2.0 at aa 20-42, 55-77, 90-107, 128-145, 160-182, 189-208 and 218-236
568708013574	Bacterial protein of unknown function (DUF903); Region: DUF903; pfam06004
568708013575	Signal peptide predicted for STM_MW29681 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.678 between residues 19 and 20
568708013576	1 probable transmembrane helix predicted for STM_MW29681 by TMHMM2.0 at aa 4-26
568708013578	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660
568708013579	Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248
568708013580	active site
568708013581	catalytic tetrad [active]
568708013583	lysophospholipid transporter LplT; Provisional; Region: PRK11195
568708013584	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708013585	12 probable transmembrane helices predicted for STM_MW29701 by TMHMM2.0 at aa 19-41, 51-73, 94-116, 136-158, 163-185, 195-213, 220-242, 257-279, 286-305, 309-331, 344-366 and 371-393
568708013587	Signal peptide predicted for STM_MW29701 by SignalP 2.0 HMM (Signal peptide probability 0.668) with cleavage site probability 0.639 between residues 29 and 30
568708013588	bifunctional acyl-[acyl carrier protein] synthetase/2-acylglycerophosphoethanolamine acyltransferase; Validated; Region: PRK08043
568708013589	Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: AGPAT-like; Region: LPLAT_AGPAT-like; cd07989
568708013590	putative acyl-acceptor binding pocket; other site
568708013591	C-terminal domain of the acyl-acyl carrier protein synthetase (also called 2-acylglycerophosphoethanolamine acyltransferase, Aas); Region: AAS_C; cd05909
568708013592	acyl-activating enzyme (AAE) consensus motif; other site
568708013593	putative AMP binding site [chemical binding]; other site
568708013596	DNA-binding transcriptional regulator GalR; Provisional; Region: PRK10727
568708013597	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
568708013598	DNA binding site [nucleotide binding]
568708013599	domain linker motif; other site
568708013600	Ligand binding domain of DNA transcription iso-repressor GalS, which is one of two regulatory proteins involved in galactose transport and metabolism; Region: PBP1_GalS_like; cd06270
568708013601	dimerization interface (closed form) [polypeptide binding]; other site
568708013602	ligand binding site [chemical binding]; other site
568708013605	pfam_scan;Pfam:PF00356; E()=1.3E-18;score=66.2;query4-49;description=LacI; pfam_scan;Pfam:PF00532; E()=8.3E-31;score=106.7;query 61-286;description=Peripla_BP_1
568708013608	diaminopimelate decarboxylase; Provisional; Region: PRK11165
568708013609	Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzyme Diaminopimelate Decarboxylase; Region: PLPDE_III_DapDC; cd06828
568708013610	active site
568708013611	pyridoxal 5'-phosphate (PLP) binding site [chemical binding]; other site
568708013612	substrate binding site [chemical binding]; other site
568708013613	catalytic residues [active]
568708013614	dimer interface [polypeptide binding]; other site
568708013617	DNA-binding transcriptional regulator LysR; Provisional; Region: PRK11013
568708013618	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708013619	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
568708013620	dimerization interface [polypeptide binding]; other site
568708013623	putative racemase; Provisional; Region: PRK10200
568708013624	aspartate racemase; Region: asp_race; TIGR00035
568708013626	MFS transporter, sugar porter (SP) family; Region: SP; TIGR00879
568708013627	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708013628	putative substrate translocation pore; other site
568708013629	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708013631	12 probable transmembrane helices predicted for STM_MW29781 by TMHMM2.0 at aa 24-46, 61-83, 90-112, 116-138, 150-167, 177-199, 259-281, 296-318, 325-347, 362-384, 397-419 and 424-446
568708013632	2-deoxy-D-gluconate 3-dehydrogenase; Validated; Region: PRK08993
568708013633	gluconate 5-dehydrogenase (Ga5DH)-like, classical (c) SDRs; Region: Ga5DH-like_SDR_c; cd05347
568708013634	NADP binding site [chemical binding]; other site
568708013635	homodimer interface [polypeptide binding]; other site
568708013636	active site
568708013638	5-keto-4-deoxyuronate isomerase; Provisional; Region: PRK00924
568708013640	putative acyltransferase; Provisional; Region: PRK05790
568708013641	Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751
568708013642	dimer interface [polypeptide binding]; other site
568708013643	active site
568708013646	Transcriptional regulator [Transcription]; Region: LysR; COG0583
568708013647	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708013648	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
568708013649	dimerization interface [polypeptide binding]; other site
568708013652	Predicted membrane protein [Function unknown]; Region: COG4125
568708013653	Bacterial Transmembrane Pair family; Region: BTP; pfam05232
568708013654	Bacterial Transmembrane Pair family; Region: BTP; pfam05232
568708013656	4 probable transmembrane helices predicted for STM_MW29831 by TMHMM2.0 at aa 24-46, 56-75, 95-117 and 121-143
568708013657	Amino acid permeases [Amino acid transport and metabolism]; Region: SdaC; COG0814
568708013658	threonine/serine transporter TdcC; Provisional; Region: PRK13629; cl17672
568708013660	10 probable transmembrane helices predicted for STM_MW29841 by TMHMM2.0 at aa 20-42, 86-108, 123-145, 152-174, 194-216, 236-258, 287-309, 334-356, 360-382 and 389-408
568708013661	Transcriptional regulators RcnR and FrmR, and related domains; this domain family was previously known as part of DUF156; Region: RcnR-FrmR-like_DUF156; cd10153
568708013662	putative metal binding site [ion binding]; other site
568708013663	putative homodimer interface [polypeptide binding]; other site
568708013664	putative homotetramer interface [polypeptide binding]; other site
568708013665	putative homodimer-homodimer interface [polypeptide binding]; other site
568708013666	putative allosteric switch controlling residues; other site
568708013668	transcriptional activator SprB; Provisional; Region: PRK15320
568708013669	Holliday junction DNA helicase RuvA; Provisional; Region: ruvA; PRK14600
568708013670	Protein of unknown function (DUF1401); Region: DUF1401; pfam07180
568708013672	Fimbrial protein; Region: Fimbrial; pfam00419
568708013673	Signal peptide predicted for STM_MW29881 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 29 and 30
568708013674	fimbrial chaperone protein StdC; Provisional; Region: PRK15254
568708013675	Gram-negative pili assembly chaperone, N-terminal domain; Region: Pili_assembly_N; pfam00345
568708013676	Gram-negative pili assembly chaperone, C-terminal domain; Region: Pili_assembly_C; pfam02753
568708013679	Signal peptide predicted for STM_MW29891 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.677 between residues 27 and 28
568708013680	fimbrial outer membrane usher protein StdB; Provisional; Region: PRK15255
568708013681	PapC N-terminal domain; Region: PapC_N; pfam13954
568708013682	Type VII secretion system (T7SS), usher protein; Region: Usher; pfam00577
568708013683	PapC C-terminal domain; Region: PapC_C; pfam13953
568708013685	Signal peptide predicted for STM_MW29901 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.994 between residues 21 and 22
568708013686	fimbrial protein StdA; Provisional; Region: PRK15210
568708013688	2 probable transmembrane helices predicted for STM_MW29911 by TMHMM2.0 at aa 15-34 and 47-69
568708013689	Signal peptide predicted for STM_MW29911 by SignalP 2.0 HMM (Signal peptide probability 0.981) with cleavage site probability 0.981 between residues 64 and 65
568708013690	hypothetical protein; Provisional; Region: PRK10316
568708013691	YfdX protein; Region: YfdX; pfam10938
568708013693	Signal peptide predicted for STM_MW29921 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 22 and 23
568708013694	Opacity protein and related surface antigens [Cell envelope biogenesis, outer membrane]; Region: COG3637
568708013696	Signal peptide predicted for STM_MW29931 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 24 and 25
568708013697	PIN domain of ribonucleases (toxins), VapC and FitB, of prokaryotic toxin/antitoxin operons, Pyrococcus horikoshii protein PH0500, and other similar bacterial and archaeal homologs; Region: PIN_VapC-FitB; cd09881
568708013698	oligomeric interface; other site
568708013699	putative active site [active]
568708013700	homodimer interface [polypeptide binding]; other site
568708013702	Virulence-associated protein and related proteins [Function unknown]; Region: VagC; COG4456
568708013703	Catalytic domain of phospholipase D superfamily proteins; Region: PLDc_SF; cl15239
568708013704	Signal peptide predicted for STM_MW29961 by SignalP 2.0 HMM (Signal peptide probability 0.676) with cleavage site probability 0.628 between residues 28 and 29
568708013705	Protein of unknown function (DUF1460); Region: DUF1460; pfam07313
568708013707	Lysine Motif is a small domain involved in binding peptidoglycan; Region: LysM; cd00118
568708013708	Peptidase family M23; Region: Peptidase_M23; pfam01551
568708013711	Signal peptide predicted for STM_MW29981 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.446 between residues 32 and 33
568708013712	Isopentenyldiphosphate isomerase [Lipid metabolism]; Region: Idi; COG1443
568708013713	Isopentenyl diphosphate (IPP) isomerase, a member of the Nudix hydrolase superfamily, is a key enzyme in the isoprenoid biosynthetic pathway. Isoprenoids comprise a large family of natural products including sterols, carotenoids, dolichols and prenylated...; Region: IPP_Isomerase; cd02885
568708013714	active site
568708013715	metal binding site [ion binding]; metal-binding site
568708013716	nudix motif; other site
568708013718	lysyl-tRNA synthetase; Reviewed; Region: PRK12445
568708013719	LysRS_N: N-terminal, anticodon recognition domain of lysyl-tRNA synthetases (LysRS). These enzymes are homodimeric class 2b aminoacyl-tRNA synthetases (aaRSs). This domain is a beta-barrel domain (OB fold) involved in binding the tRNA anticodon stem-loop; Region: LysRS_N; cd04322
568708013720	dimer interface [polypeptide binding]; other site
568708013721	putative anticodon binding site; other site
568708013722	Lys_tRNA synthetase (LysRS) class II core domain. Class II LysRS is a dimer which attaches a lysine to the 3' OH group of ribose of the appropriate tRNA. Its assignment to class II aaRS is based upon its structure and the presence of three...; Region: LysRS_core; cd00775
568708013723	motif 1; other site
568708013724	active site
568708013725	motif 2; other site
568708013726	motif 3; other site
568708013729	This domain is found in peptide chain release factors; Region: PCRF; smart00937
568708013730	Protein chain release factor B [Translation, ribosomal structure and biogenesis]; Region: PrfB; COG1186
568708013731	RF-1 domain; Region: RF-1; pfam00472
568708013734	ssDNA exonuclease RecJ; Provisional; Region: PRK11070
568708013735	DHH family; Region: DHH; pfam01368
568708013736	DHHA1 domain; Region: DHHA1; pfam02272
568708013739	protein disulfide isomerase II DsbC; Provisional; Region: PRK10877
568708013740	DsbA family, DsbC and DsbG subfamily; V-shaped homodimeric proteins containing a redox active CXXC motif imbedded in a TRX fold. They function as protein disulfide isomerases and chaperones in the bacterial periplasm to correct non-native disulfide bonds...; Region: DsbA_DsbC_DsbG; cd03020
568708013741	dimerization domain [polypeptide binding]; other site
568708013742	dimer interface [polypeptide binding]; other site
568708013743	catalytic residues [active]
568708013745	site-specific tyrosine recombinase XerD; Reviewed; Region: xerD; PRK00283
568708013746	XerD and XerC integrases, DNA breaking-rejoining enzymes, N- and C-terminal domains. XerD-like integrases are involved in the site-specific integration and excision of lysogenic bacteriophage genomes, transposition of conjugative transposons, termination...; Region: INT_XerDC; cd00798
568708013747	active site
568708013748	Int/Topo IB signature motif; other site
568708013751	flavodoxin FldB; Provisional; Region: PRK12359
568708013753	Protein of unknown function (DUF1434); Region: DUF1434; pfam07254
568708013755	1 probable transmembrane helix predicted for STM_MW30061 by TMHMM2.0 at aa 20-51
568708013756	hypothetical protein; Provisional; Region: PRK10878
568708013758	putative global regulator; Reviewed; Region: PRK09559
568708013759	folate-binding protein YgfZ; Region: ygfZ_signature; TIGR03317
568708013761	hemolysin; Provisional; Region: PRK15087
568708013762	channel protein, hemolysin III family; Region: hlyIII; TIGR01065
568708013763	7 probable transmembrane helices predicted for STM_MW30091 by TMHMM2.0 at aa 20-42, 46-68, 89-107, 112-134, 139-161, 165-187 and 194-216
568708013765	ASC-1 homology domain, subfamily similar to Escherichia coli Yqfb. The ASCH domain, a small beta-barrel domain found in all three kingdoms of life, resembles the RNA-binding PUA domain and may also interact with RNA. ASCH has been proposed to function as...; Region: ASCH_yqfb_like; cd06552
568708013767	6-phospho-beta-glucosidase BglA; Provisional; Region: PRK15014
568708013768	beta-galactosidase; Region: BGL; TIGR03356
568708013770	Putative MetA-pathway of phenol degradation; Region: Phenol_MetA_deg; pfam13557
568708013771	glycine dehydrogenase; Provisional; Region: PRK05367
568708013772	Glycine cleavage system P-protein, alpha- and beta-subunits. This family consists of Glycine cleavage system P-proteins EC:1.4.4.2 from bacterial, mammalian and plant sources. The P protein is part of the glycine decarboxylase multienzyme complex EC:2.1; Region: GDC-P; cd00613
568708013773	tetramer interface [polypeptide binding]; other site
568708013774	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708013775	catalytic residue [active]
568708013776	Glycine cleavage system P-protein, alpha- and beta-subunits. This family consists of Glycine cleavage system P-proteins EC:1.4.4.2 from bacterial, mammalian and plant sources. The P protein is part of the glycine decarboxylase multienzyme complex EC:2.1; Region: GDC-P; cd00613
568708013777	tetramer interface [polypeptide binding]; other site
568708013778	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708013779	catalytic residue [active]
568708013781	Glycine cleavage H-protein. Glycine cleavage H-proteins are part of the glycine cleavage system (GCS) found in bacteria, archea and the mitochondria of eukaryotes. GCS is a multienzyme complex consisting of 4 different components (P-, H-, T- and...; Region: GCS_H; cd06848
568708013782	lipoyl attachment site [posttranslational modification]; other site
568708013784	glycine cleavage system aminomethyltransferase T; Reviewed; Region: gcvT; PRK00389
568708013785	Glycine cleavage T-protein C-terminal barrel domain; Region: GCV_T_C; pfam08669
568708013788	oxidoreductase; Provisional; Region: PRK08013
568708013789	Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family; Region: Ubi-OHases; TIGR01988
568708013791	2-octaprenyl-6-methoxyphenyl hydroxylase; Validated; Region: PRK05732
568708013792	Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family; Region: Ubi-OHases; TIGR01988
568708013794	Signal peptide predicted for STM_MW30171 by SignalP 2.0 HMM (Signal peptide probability 0.954) with cleavage site probability 0.777 between residues 25 and 26
568708013795	proline aminopeptidase P II; Provisional; Region: PRK10879
568708013796	Aminopeptidase P, N-terminal domain; Region: AMP_N; pfam05195
568708013797	Prolidase. E.C. 3.4.13.9. Also known as Xaa-Pro dipeptidase, X-Pro dipeptidase, proline dipeptidase., imidodipeptidase, peptidase D, gamma-peptidase. Catalyses hydrolysis of Xaa-Pro dipeptides; also acts on aminoacyl-hydroxyproline analogs. No action on...; Region: Prolidase; cd01087
568708013798	active site
568708013801	hypothetical protein; Reviewed; Region: PRK01736
568708013803	Z-ring-associated protein; Provisional; Region: PRK10972
568708013805	5-formyltetrahydrofolate cyclo-ligase family protein; Provisional; Region: PRK10333
568708013806	5-formyltetrahydrofolate cyclo-ligase family; Region: 5-FTHF_cyc-lig; pfam01812
568708013808	D-3-phosphoglycerate dehydrogenase; Provisional; Region: PRK11790
568708013809	Phosphoglycerate dehydrogenases, NAD-binding and catalytic domains; Region: PGDH_3; cd12176
568708013810	ligand binding site [chemical binding]; other site
568708013811	NAD binding site [chemical binding]; other site
568708013812	tetramer interface [polypeptide binding]; other site
568708013813	catalytic site [active]
568708013814	C-terminal ACT (regulatory) domain of D-3-Phosphoglycerate Dehydrogenase (3PGDH) found in fungi and bacteria; Region: ACT_3PGDH; cd04901
568708013815	L-serine binding site [chemical binding]; other site
568708013816	ACT domain interface; other site
568708013820	RPI_A: Ribose 5-phosphate isomerase type A (RPI_A) subfamily; RPI catalyzes the reversible conversion of ribose-5-phosphate to ribulose 5-phosphate, the first step of the non-oxidative branch of the pentose phosphate pathway. This reaction leads to the...; Region: RPI_A; cd01398
568708013821	tetramer (dimer of dimers) interface [polypeptide binding]; other site
568708013822	active site
568708013823	dimer interface [polypeptide binding]; other site
568708013825	chromosome replication initiation inhibitor protein; Validated; Region: PRK03635
568708013826	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708013827	The C-terminal substrate binding domain of LysR-type transcriptional regulator, ArgP (IciA), for arginine exporter (ArgO); contains the type 2 periplasmic binding fold; Region: PBP2_IciA_ArgP; cd08428
568708013828	putative dimerization interface [polypeptide binding]; other site
568708013831	Uncharacterized conserved protein [Function unknown]; Region: COG2968
568708013832	oxidative stress defense protein; Provisional; Region: PRK11087
568708013834	Signal peptide predicted for STM_MW30261 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 21 and 22
568708013835	arginine exporter protein; Provisional; Region: PRK09304
568708013836	6 probable transmembrane helices predicted for STM_MW30271 by TMHMM2.0 at aa 4-26, 39-61, 66-88, 111-133, 148-170 and 182-199
568708013838	mechanosensitive channel MscS; Provisional; Region: PRK10334
568708013839	Mechanosensitive ion channel; Region: MS_channel; pfam00924
568708013842	3 probable transmembrane helices predicted for STM_MW30281 by TMHMM2.0 at aa 26-48, 68-90 and 105-127
568708013843	fructose-bisphosphate aldolase; Provisional; Region: PRK09197
568708013844	Class II Type A, Fructose-1,6-bisphosphate (FBP) aldolases. The enzyme catalyses the zinc-dependent, reversible aldol condensation of dihydroxyacetone phosphate with glyceraldehyde-3-phosphate to form fructose-1,6-bisphosphate. FBP aldolase is...; Region: FBP_aldolase_IIA; cd00946
568708013845	active site
568708013846	intersubunit interface [polypeptide binding]; other site
568708013847	zinc binding site [ion binding]; other site
568708013848	Na+ binding site [ion binding]; other site
568708013850	Phosphoglycerate kinase (PGK) is a monomeric enzyme which catalyzes the transfer of the high-energy phosphate group of 1,3-bisphosphoglycerate to ADP, forming ATP and 3-phosphoglycerate. This reaction represents the first of the two substrate-level...; Region: Phosphoglycerate_kinase; cd00318
568708013851	Phosphoglycerate kinase; Region: PGK; pfam00162
568708013852	substrate binding site [chemical binding]; other site
568708013853	hinge regions; other site
568708013854	ADP binding site [chemical binding]; other site
568708013855	catalytic site [active]
568708013857	erythrose 4-phosphate dehydrogenase; Provisional; Region: PRK13535
568708013858	Glyceraldehyde 3-phosphate dehydrogenase, NAD binding domain; Region: Gp_dh_N; smart00846
568708013859	Glyceraldehyde 3-phosphate dehydrogenase, C-terminal domain; Region: Gp_dh_C; pfam02800
568708013862	Domain of unknown function found in archaea, bacteria, and plants; Region: DUF296; cd11378
568708013863	trimer interface [polypeptide binding]; other site
568708013864	putative Zn binding site [ion binding]; other site
568708013866	5 probable transmembrane helices predicted for STM_MW30331 by TMHMM2.0 at aa 10-29, 42-64, 74-96, 103-125 and 152-174
568708013867	ABC-type cobalt transport system, permease component CbiQ and related transporters [Inorganic ion transport and metabolism]; Region: CbiQ; COG0619
568708013868	Signal peptide predicted for STM_MW30341 by SignalP 2.0 HMM (Signal peptide probability 0.990) with cleavage site probability 0.463 between residues 24 and 25
568708013870	4 probable transmembrane helices predicted for STM_MW30341 by TMHMM2.0 at aa 15-37, 50-72, 82-104 and 215-234
568708013871	ABC-type cobalt transport system, ATPase component [Inorganic ion transport and metabolism]; Region: CbiO; COG1122
568708013872	First domain of the ATP-binding cassette component of cobalt transport system; Region: ABC_cobalt_CbiO_domain1; cd03225
568708013873	Walker A/P-loop; other site
568708013874	ATP binding site [chemical binding]; other site
568708013875	Q-loop/lid; other site
568708013876	ABC transporter signature motif; other site
568708013877	Walker B; other site
568708013878	D-loop; other site
568708013879	H-loop/switch region; other site
568708013881	pfam_scan;Pfam:PF00005; E()=4.9E-31;score=107.9;query 29-197;description=ABC_tran
568708013883	transketolase; Reviewed; Region: PRK12753
568708013884	Thiamine pyrophosphate (TPP) family, Transketolase (TK) subfamily, TPP-binding module; TK catalyzes the transfer of a two-carbon unit from ketose phosphates to aldose phosphates. In heterotrophic organisms, TK provides a link between glycolysis and the...; Region: TPP_TK; cd02012
568708013885	TPP-binding site [chemical binding]; other site
568708013886	dimer interface [polypeptide binding]; other site
568708013887	Pyrimidine (PYR) binding domain of 1-deoxy-D-xylulose-5-phosphate synthase (DXS), transketolase (TK), and related proteins; Region: TPP_PYR_DXS_TK_like; cd07033
568708013888	PYR/PP interface [polypeptide binding]; other site
568708013889	dimer interface [polypeptide binding]; other site
568708013890	TPP binding site [chemical binding]; other site
568708013891	Transketolase, C-terminal domain; Region: Transketolase_C; pfam02780
568708013895	Zn-dependent protease with chaperone function [Posttranslational modification, protein turnover, chaperones]; Region: HtpX; COG0501
568708013897	Agmatinase-like family includes proclavaminic acid amidinohydrolase; Region: Agmatinase_PAH; cd11592
568708013898	agmatinase; Region: agmatinase; TIGR01230
568708013899	oligomer interface [polypeptide binding]; other site
568708013900	putative active site [active]
568708013901	Mn binding site [ion binding]; other site
568708013903	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
568708013905	1 probable transmembrane helix predicted for STM_MW30401 by TMHMM2.0 at aa 7-26
568708013906	Signal peptide predicted for STM_MW30401 by SignalP 2.0 HMM (Signal peptide probability 0.815) with cleavage site probability 0.482 between residues 23 and 24
568708013907	Beta-galactosidase, beta subunit [Carbohydrate transport and metabolism]; Region: EbgC; COG2731
568708013909	Malate/L-lactate dehydrogenases [Energy production and conversion]; Region: COG2055
568708013911	Threonine dehydrogenase and related Zn-dependent dehydrogenases [Amino acid transport and metabolism / General function prediction only]; Region: Tdh; COG1063
568708013912	Alcohol dehydrogenases of the MDR family; Region: Zn_ADH7; cd08261
568708013913	putative NAD(P) binding site [chemical binding]; other site
568708013914	catalytic Zn binding site [ion binding]; other site
568708013915	structural Zn binding site [ion binding]; other site
568708013918	Mannitol-1-phosphate/altronate dehydrogenases [Carbohydrate transport and metabolism]; Region: MtlD; COG0246
568708013919	Mannitol dehydrogenase Rossmann domain; Region: Mannitol_dh; pfam01232
568708013920	Mannitol dehydrogenase C-terminal domain; Region: Mannitol_dh_C; pfam08125
568708013923	Transcriptional regulators [Transcription]; Region: FadR; COG2186
568708013924	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
568708013925	DNA-binding site [nucleotide binding]; DNA binding site
568708013926	This entry represents the C-terminal ligand binding domain of many members of the GntR family; Region: FCD; smart00895
568708013929	DNA phosphorothioation-dependent restriction protein DptH; Region: dnd_assoc_2; TIGR03237
568708013930	Signal peptide predicted for STM_MW30461 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.301 between residues 25 and 26
568708013931	Arginine decarboxylase (spermidine biosynthesis) [Amino acid transport and metabolism]; Region: SpeA; COG1166
568708013932	Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzyme Arginine Decarboxylase; Region: PLPDE_III_ADC; cd06830
568708013933	dimer interface [polypeptide binding]; other site
568708013934	active site
568708013935	pyridoxal 5'-phosphate (PLP) binding site [chemical binding]; other site
568708013936	catalytic residues [active]
568708013937	Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzymes; Region: PLPDE_III; cl00261
568708013940	Virulence promoting factor; Region: YqgB; pfam11036
568708013942	Protein of unknown function (DUF2684); Region: DUF2684; pfam10885
568708013944	2 probable transmembrane helices predicted for STM_MW30501 by TMHMM2.0 at aa 21-43 and 63-77
568708013945	S-adenosylmethionine synthetase; Validated; Region: PRK05250
568708013946	S-adenosylmethionine synthetase, N-terminal domain; Region: S-AdoMet_synt_N; pfam00438
568708013947	S-adenosylmethionine synthetase, central domain; Region: S-AdoMet_synt_M; pfam02772
568708013948	S-adenosylmethionine synthetase, C-terminal domain; Region: S-AdoMet_synt_C; pfam02773
568708013952	MFS transporter, sugar porter (SP) family; Region: SP; TIGR00879
568708013953	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708013954	putative substrate translocation pore; other site
568708013955	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708013956	Signal peptide predicted for STM_MW30521 by SignalP 2.0 HMM (Signal peptide probability 0.986) with cleavage site probability 0.892 between residues 30 and 31
568708013957	12 probable transmembrane helices predicted for STM_MW30521 by TMHMM2.0 at aa 13-35, 55-77, 84-103, 108-130, 142-159, 169-191, 252-274, 289-311, 318-340, 350-372, 385-407 and 417-436
568708013959	hypothetical protein; Provisional; Region: PRK04860
568708013960	Zn-dependent metalloprotease, SprT family [General function prediction only]; Region: SprT; COG3091
568708013962	DNA-specific endonuclease I; Provisional; Region: PRK15137
568708013963	Endonuclease I [DNA replication, recombination, and repair]; Region: EndA; COG2356
568708013964	Signal peptide predicted for STM_MW30541 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 22 and 23
568708013966	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG1385
568708013967	RNA methyltransferase, RsmE family; Region: TIGR00046
568708013969	glutathione synthetase; Provisional; Region: PRK05246
568708013970	Prokaryotic glutathione synthetase, N-terminal domain; Region: GSH-S_N; pfam02951
568708013971	Prokaryotic glutathione synthetase, ATP-grasp domain; Region: GSH-S_ATP; pfam02955
568708013974	hypothetical protein; Validated; Region: PRK00228
568708013976	Holliday junction resolvase-like protein; Reviewed; Region: PRK00109
568708013978	IclR helix-turn-helix domain; Region: HTH_IclR; cl17605
568708013979	Transcriptional regulator [Transcription]; Region: IclR; COG1414
568708013980	Tfp pilus assembly protein, pilus retraction ATPase PilT [Cell motility and secretion / Intracellular trafficking and secretion]; Region: PilT; COG2805
568708013981	Pilus retraction ATPase PilT. PilT is a nucleotide binding protein responsible for the retraction of type IV pili, likely by pili disassembly. This retraction provides the force required for travel of bacteria in low water environments by a mechanism...; Region: PilT; cd01131
568708013982	Walker A motif; other site
568708013983	ATP binding site [chemical binding]; other site
568708013984	Walker B motif; other site
568708013986	Pyridoxal 5-phosphate (PLP)-binding TIM barrel domain of Type III PLP-Dependent Enzymes, Yggs-like proteins; Region: PLPDE_III_Yggs_like; cd06824
568708013987	pyridoxal 5'-phosphate (PLP) binding site [chemical binding]; other site
568708013988	catalytic residue [active]
568708013990	YGGT family; Region: YGGT; pfam02325
568708013991	YGGT family; Region: YGGT; pfam02325
568708013992	4 probable transmembrane helices predicted for STM_MW30621 by TMHMM2.0 at aa 5-24, 63-85, 89-111 and 153-175
568708013994	hypothetical protein; Validated; Region: PRK05090
568708013996	NTPase/HAM1.  This family consists of the HAM1 protein and pyrophosphate-releasing xanthosine/ inosine triphosphatase. HAM1 protects the cell against mutagenesis by the base analog 6-N-hydroxylaminopurine (HAP) in E. Coli and S. cerevisiae. A...; Region: HAM1; cd00515
568708013997	active site
568708013998	dimerization interface [polypeptide binding]; other site
568708014000	HemN family oxidoreductase; Provisional; Region: PRK05660
568708014001	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
568708014002	FeS/SAM binding site; other site
568708014003	HemN C-terminal domain; Region: HemN_C; pfam06969
568708014006	Protein of unknown function (DUF1202); Region: DUF1202; pfam06717
568708014008	Signal peptide predicted for STM_MW30661 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.997 between residues 21 and 22
568708014009	Bacterial L-asparaginases and related enzymes; Region: L-asparaginase_like; cd00411
568708014010	homodimer interface [polypeptide binding]; other site
568708014011	active site
568708014013	1 probable transmembrane helix predicted for STM_MW30671 by TMHMM2.0 at aa 7-29
568708014014	Signal peptide predicted for STM_MW30671 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 22 and 23
568708014015	hypothetical protein; Provisional; Region: PRK10626
568708014016	Protein of unknown function (DUF2884); Region: DUF2884; pfam11101
568708014018	Signal peptide predicted for STM_MW30681 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.735 between residues 20 and 21
568708014019	hypothetical protein; Provisional; Region: PRK11702
568708014021	tRNA (guanine-N(7)-)-methyltransferase; Reviewed; Region: trmB; PRK00121
568708014023	adenine DNA glycosylase; Provisional; Region: PRK10880
568708014024	endonuclease III; includes endonuclease III (DNA-(apurinic or apyrimidinic site) lyase), alkylbase DNA glycosidases (Alka-family) and other DNA glycosidases; Region: ENDO3c; cd00056
568708014025	minor groove reading motif; other site
568708014026	helix-hairpin-helix signature motif; other site
568708014027	substrate binding pocket [chemical binding]; other site
568708014028	active site
568708014029	iron-sulpphur binding domain in DNA-(apurinic or apyrimidinic site) lyase (subfamily of ENDO3); Region: FES; smart00525
568708014030	DNA glycosylase (MutY in bacteria and hMYH in humans) is responsible for repairing misread  A*oxoG residues to C*G by removing the inappropriately paired adenine base from the DNA backbone. It belongs to the Nudix hydrolase superfamily and is important...; Region: DNA_Glycosylase_C; cd03431
568708014031	DNA binding and oxoG recognition site [nucleotide binding]
568708014035	oxidative damage protection protein; Provisional; Region: PRK05408
568708014037	murein transglycosylase C; Provisional; Region: mltC; PRK11671
568708014038	Domain of unknown function (DUF3393); Region: DUF3393; pfam11873
568708014039	Lytic Transglycosylase (LT)  and Goose Egg White Lysozyme (GEWL) domain. Members include the soluble and insoluble membrane-bound LTs in bacteria, the LTs in bacteriophage lambda, as well as, the eukaryotic "goose-type" lysozymes (GEWL).  LTs...; Region: LT_GEWL; cd00254
568708014040	N-acetyl-D-glucosamine binding site [chemical binding]; other site
568708014041	catalytic residue [active]
568708014042	Signal peptide predicted for STM_MW30731 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.564 between residues 23 and 24
568708014044	nucleoside transporter; Region: 2A0110; TIGR00889
568708014046	12 probable transmembrane helices predicted for STM_MW30741 by TMHMM2.0 at aa 9-31, 41-63, 70-87, 92-114, 135-152, 162-184, 211-233, 253-275, 282-301, 311-333, 346-365 and 380-402
568708014047	ornithine decarboxylase; Provisional; Region: PRK13578
568708014048	Orn/Lys/Arg decarboxylase, N-terminal domain; Region: OKR_DC_1_N; pfam03709
568708014049	Ornithine decarboxylase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD corresponds to ornithine decarboxylase (ODC), arginine decarboxylase (ADC) and lysine...; Region: Orn_deC_like; cd00615
568708014050	homodimer interface [polypeptide binding]; other site
568708014051	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708014052	catalytic residue [active]
568708014053	Orn/Lys/Arg decarboxylase, C-terminal domain; Region: OKR_DC_1_C; pfam03711
568708014057	Uncharacterized membrane protein, possible Na+ channel or pump [General function prediction only]; Region: COG1811
568708014059	6 probable transmembrane helices predicted for STM_MW30761 by TMHMM2.0 at aa 4-23, 36-58, 102-124, 145-167, 177-199 and 211-233
568708014060	This conserved domain belongs to a superfamily including the bleomycin resistance protein, glyoxalase I, and type I ring-cleaving dioxygenases; Region: Glo_EDI_BRP_like_2; cd07253
568708014061	dimer interface [polypeptide binding]; other site
568708014062	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
568708014063	metal binding site [ion binding]; metal-binding site
568708014065	Acetyl-CoA hydrolase [Energy production and conversion]; Region: ACH1; COG0427
568708014066	Acetyl-CoA hydrolase/transferase N-terminal domain; Region: AcetylCoA_hydro; pfam02550
568708014067	Acetyl-CoA hydrolase/transferase C-terminal domain; Region: AcetylCoA_hyd_C; pfam13336
568708014069	FkbR2 is a Streptomyces hygroscopicus protein with a hot dog fold that belongs to a conserved family of proteins found in prokaryotes and archaea but not in eukaryotes. FkbR2  has sequence similarity to (R)-specific enoyl-CoA hydratase, the peroxisomal...; Region: FkbR2; cd03451
568708014070	putative active site [active]
568708014071	putative catalytic site [active]
568708014073	Citrate lyase beta subunit [Carbohydrate transport and metabolism]; Region: CitE; COG2301
568708014075	The C-terminal substrate binding domain of LysR-type transcrptional regulator BudR, which is responsible for activation of the expression of the butanediol operon genes; contains the type 2 periplasmic binding fold; Region: PBP2_BudR; cd08451
568708014076	putative dimerization interface [polypeptide binding]; other site
568708014077	putative substrate binding pocket [chemical binding]; other site
568708014079	Arylsulfatase A and related enzymes [Inorganic ion transport and metabolism]; Region: AslA; COG3119
568708014080	Sulfatase; Region: Sulfatase; pfam00884
568708014082	Signal peptide predicted for STM_MW30821 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.993 between residues 20 and 21
568708014083	anaerobic sulfatase-maturating enzyme; Region: sulfatase_rSAM; TIGR03942
568708014084	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
568708014085	FeS/SAM binding site; other site
568708014086	radical SAM additional 4Fe4S-binding SPASM domain; Region: rSAM_more_4Fe4S; TIGR04085
568708014087	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
568708014088	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
568708014089	DNA binding residues [nucleotide binding]
568708014090	dimerization interface [polypeptide binding]; other site
568708014092	Protein of unknown function (DUF3156); Region: DUF3156; pfam11354
568708014094	Amino acid permease; Region: AA_permease_2; pfam13520
568708014096	12 probable transmembrane helices predicted for STM_MW30861 by TMHMM2.0 at aa 13-35, 48-70, 90-121, 136-158, 165-187, 202-224, 236-258, 293-315, 345-362, 372-394, 407-429 and 439-456
568708014097	Predicted enzyme of the cupin superfamily [General function prediction only]; Region: COG3450
568708014099	putative aminophosphonate oxidoreductase; Region: Phn_aa_oxid; TIGR03329
568708014100	Glycine/D-amino acid oxidases (deaminating) [Amino acid transport and metabolism]; Region: DadA; COG0665
568708014102	Escherichia coli NAD+-dependent phenylacetaldehyde dehydrogenase PadA-like; Region: ALDH_PADH_NahF; cd07113
568708014103	Aldehyde dehydrogenase family; Region: Aldedh; pfam00171
568708014104	NAD(P) binding site [chemical binding]; other site
568708014105	catalytic residues [active]
568708014107	DNA replication/recombination/repair protein; Provisional; Region: iraD; PRK14128
568708014109	Type VI protein secretion system component Hcp (secreted cytotoxin) [Intracellular trafficking, secretion,    and vesicular transport]; Region: Hcp; COG3157
568708014111	Catalytic domain of Helicobacter pylori peptidoglycan deacetylase (HpPgdA) and similar proteins; Region: CE4_HpPgdA_like; cd10938
568708014112	active site
568708014113	catalytic site [active]
568708014114	Zn binding site [ion binding]; other site
568708014115	tetramer interface [polypeptide binding]; other site
568708014117	Predicted amidohydrolase [General function prediction only]; Region: COG0388
568708014118	Uncharacterized subgroup of the nitrilase superfamily; some members of this subgroup have an N-terminal RimI domain (class 12 nitrilases); Region: nitrilase_Rim1_like; cd07574
568708014119	putative active site [active]
568708014120	catalytic triad [active]
568708014121	putative dimer interface [polypeptide binding]; other site
568708014123	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708014124	D-galactonate transporter; Region: 2A0114; TIGR00893
568708014125	putative substrate translocation pore; other site
568708014127	9 probable transmembrane helices predicted for STM_MW30941 by TMHMM2.0 at aa 7-29, 75-97, 137-159, 169-191, 236-258, 268-290, 311-333, 362-384 and 393-415
568708014128	Signal peptide predicted for STM_MW30941 by SignalP 2.0 HMM (Signal peptide probability 0.887) with cleavage site probability 0.627 between residues 31 and 32
568708014129	mannonate dehydratase; Provisional; Region: PRK03906
568708014130	mannonate dehydratase; Region: uxuA; TIGR00695
568708014132	D-mannonate oxidoreductase; Provisional; Region: PRK15037
568708014133	Mannitol dehydrogenase Rossmann domain; Region: Mannitol_dh; pfam01232
568708014134	Mannitol dehydrogenase C-terminal domain; Region: Mannitol_dh_C; pfam08125
568708014137	Glucuronate isomerase; Region: UxaC; pfam02614
568708014138	Glucuronate isomerase [Carbohydrate transport and metabolism]; Region: UxaC; COG1904
568708014140	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
568708014141	dimer interface [polypeptide binding]; other site
568708014142	putative CheW interface [polypeptide binding]; other site
568708014143	MCP-signal associated domain; Region: MCPsignal_assoc; pfam13682
568708014145	bifunctional glutathionylspermidine amidase/glutathionylspermidine synthetase; Provisional; Region: PRK10507
568708014146	CHAP domain; Region: CHAP; pfam05257
568708014147	Glutathionylspermidine synthase [Amino acid transport and metabolism]; Region: Gsp; COG0754
568708014150	1 probable transmembrane helix predicted for STM_MW30991 by TMHMM2.0 at aa 65-84
568708014151	putative S-transferase; Provisional; Region: PRK11752
568708014152	GST_N family, Ure2p-like subfamily; composed of the Saccharomyces cerevisiae Ure2p and related GSTs. Ure2p is a regulator for nitrogen catabolism in yeast. It represses the expression of several gene products involved in the use of poor nitrogen sources...; Region: GST_N_Ure2p_like; cd03048
568708014153	C-terminal domain interface [polypeptide binding]; other site
568708014154	GSH binding site (G-site) [chemical binding]; other site
568708014155	dimer interface [polypeptide binding]; other site
568708014156	C-terminal, alpha helical domain of Escherichia coli Yghu Glutathione S-transferases and related uncharacterized proteins; Region: GST_C_YghU_like; cd10292
568708014157	dimer interface [polypeptide binding]; other site
568708014158	N-terminal domain interface [polypeptide binding]; other site
568708014159	active site
568708014162	Bacterial extracellular solute-binding protein; Region: SBP_bac_11; pfam13531
568708014163	molybdate ABC transporter periplasmic molybdate-binding protein; Provisional; Region: PRK03537
568708014164	Periplasmic binding protein TroA_e.  These proteins are predicted to function as initial receptors in the ABC metal ion uptake in eubacteria and archaea.  They belong to the TroA superfamily of helical backbone metal receptor proteins that share a...; Region: TroA_e; cd01142
568708014165	putative ligand binding residues [chemical binding]; other site
568708014166	Periplasmic binding protein; Region: Peripla_BP_2; pfam01497
568708014168	Signal peptide predicted for STM_MW31021 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.913 between residues 23 and 24
568708014169	hydrogenase 2 accessory protein HypG; Provisional; Region: PRK10413
568708014171	Zn finger protein HypA/HybF (possibly regulating hydrogenase expression) [General function prediction only]; Region: HybF; COG0375
568708014172	hydrogenase nickel incorporation protein HybF; Provisional; Region: PRK12380
568708014174	hydrogenase 2-specific chaperone; Provisional; Region: PRK10465
568708014175	coenzyme F420-reducing hydrogenase delta subunit (putative coenzyme F420 hydrogenase processing subunit); Region: frhD; TIGR00130
568708014176	Endopeptidases belonging to membrane-bound hydrogenases group. These hydrogenases transfer electrons from H2 to a cytochrome that is bound to a membrane-located complex coupling electron transfer to transmembrane proton translocation. Endopeptidase HybD...; Region: H2MP_MemB-H2up; cd06062
568708014177	putative substrate-binding site; other site
568708014178	nickel binding site [ion binding]; other site
568708014180	hydrogenase 2 large subunit; Provisional; Region: PRK10467
568708014181	Ni,Fe-hydrogenase I large subunit [Energy production and conversion]; Region: HyaB; COG0374
568708014183	putative hydrogenase 2 b cytochrome subunit; Provisional; Region: PRK10881
568708014184	Polysulphide reductase, NrfD; Region: NrfD; pfam03916
568708014185	10 probable transmembrane helices predicted for STM_MW31081 by TMHMM2.0 at aa 13-32, 52-74, 86-108, 128-150, 171-193, 208-227, 246-268, 283-302, 315-337 and 352-374
568708014187	hydrogenase 2 protein HybA; Provisional; Region: PRK10882
568708014188	4Fe-4S binding domain; Region: Fer4_6; pfam12837
568708014190	Signal peptide predicted for STM_MW31091 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.995 between residues 26 and 27
568708014191	hydrogenase 2 small subunit; Provisional; Region: PRK10468
568708014192	Tat (twin-arginine translocation) pathway signal sequence; Region: TAT_signal_seq; TIGR01409
568708014193	NADH ubiquinone oxidoreductase, 20 Kd subunit; Region: Oxidored_q6; pfam01058
568708014194	1 probable transmembrane helix predicted for STM_MW31101 by TMHMM2.0 at aa 332-354
568708014196	Signal peptide predicted for STM_MW31101 by SignalP 2.0 HMM (Signal peptide probability 0.995) with cleavage site probability 0.857 between residues 37 and 38
568708014197	Protein of unknown function (DUF2623); Region: DUF2623; pfam11115
568708014199	methyl-accepting chemotaxis protein II; Provisional; Region: PRK15048
568708014200	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
568708014201	dimerization interface [polypeptide binding]; other site
568708014202	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
568708014203	dimer interface [polypeptide binding]; other site
568708014204	putative CheW interface [polypeptide binding]; other site
568708014206	2 probable transmembrane helices predicted for STM_MW31121 by TMHMM2.0 at aa 10-32 and 190-212
568708014207	Signal peptide predicted for STM_MW31121 by SignalP 2.0 HMM (Signal peptide probability 0.973) with cleavage site probability 0.645 between residues 36 and 37
568708014208	hypothetical protein; Provisional; Region: PRK05208
568708014210	3 probable transmembrane helices predicted for STM_MW31131 by TMHMM2.0 at aa 10-32, 53-75 and 136-155
568708014211	1 probable transmembrane helix predicted for STM_MW31141 by TMHMM2.0 at aa 7-29
568708014212	oxidoreductase; Provisional; Region: PRK07985
568708014213	classical (c) SDR, subgroup 1; Region: SDR_c1; cd05355
568708014214	NAD binding site [chemical binding]; other site
568708014215	metal binding site [ion binding]; metal-binding site
568708014216	active site
568708014218	biopolymer transport protein ExbD; Provisional; Region: PRK11267
568708014219	Biopolymer transport protein [Intracellular trafficking and secretion]; Region: ExbD; COG0848
568708014221	1 probable transmembrane helix predicted for STM_MW31181 by TMHMM2.0 at aa 20-42
568708014222	biopolymer transport protein ExbB; Provisional; Region: PRK10414
568708014223	3 probable transmembrane helices predicted for STM_MW31191 by TMHMM2.0 at aa 20-42, 131-153 and 177-199
568708014225	cystathionine beta-lyase; Provisional; Region: PRK08114
568708014226	CGS_like: Cystathionine gamma-synthase is a PLP dependent enzyme and catalyzes the committed step of methionine biosynthesis. This pathway is unique to microorganisms and plants, rendering the enzyme an attractive target for the development of...; Region: CGS_like; cd00614
568708014227	homodimer interface [polypeptide binding]; other site
568708014228	substrate-cofactor binding pocket; other site
568708014229	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708014230	catalytic residue [active]
568708014232	Uncharacterized membrane-associated protein [Function unknown]; Region: DedA; COG0586
568708014233	SNARE associated Golgi protein; Region: SNARE_assoc; cl00429
568708014234	4 probable transmembrane helices predicted for STM_MW31221 by TMHMM2.0 at aa 16-38, 66-88, 158-180 and 190-212
568708014236	AraC-type transcriptional regulator N-terminus; Region: AraC_N; pfam06719
568708014237	AraC-type DNA-binding domain-containing proteins [Transcription]; Region: AraC; COG2207
568708014238	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708014239	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708014242	Uncharacterized oxidoreductases, Fe-dependent alcohol dehydrogenase family [Energy production and conversion]; Region: COG1979
568708014243	Butanol dehydrogenase catalyzes the conversion of butyraldehyde to butanol with the cofactor NAD(P)H being oxidized in the process; Region: BDH; cd08187
568708014244	dimer interface [polypeptide binding]; other site
568708014245	active site
568708014246	metal binding site [ion binding]; metal-binding site
568708014248	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660
568708014249	Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248
568708014250	active site
568708014251	catalytic tetrad [active]
568708014253	Di- and tricarboxylate transporters [Inorganic ion transport and metabolism]; Region: CitT; COG0471
568708014254	Anion permease ArsB/NhaD.  These permeases have been shown to translocate sodium, arsenate, antimonite, sulfate and organic anions across biological membranes in all three kingdoms of life.  A typical anion permease contains 8-13 transmembrane helices...; Region: ArsB_NhaD_permease; cd00625
568708014255	transmembrane helices; other site
568708014257	12 probable transmembrane helices predicted for STM_MW31261 by TMHMM2.0 at aa 13-30, 45-77, 90-112, 127-149, 192-214, 229-251, 281-300, 304-323, 336-358, 373-395, 402-424 and 461-483
568708014258	Diadenosine tetraphosphate (Ap4A) hydrolase and other HIT family hydrolases [Nucleotide transport and metabolism / Carbohydrate transport and metabolism / General function prediction only]; Region: Hit; COG0537
568708014259	nucleotide binding site/active site [active]
568708014260	catalytic residue [active]
568708014262	hypothetical protein; Provisional; Region: PRK01254
568708014263	Radical SAM N-terminal; Region: Radical_SAM_N; pfam08497
568708014264	Domain of unknown function (DUF3362); Region: DUF3362; pfam11842
568708014267	TRAP-type C4-dicarboxylate transport system, periplasmic component [Carbohydrate transport and metabolism]; Region: DctP; COG1638
568708014268	Bacterial extracellular solute-binding protein, family 7; Region: SBP_bac_7; pfam03480
568708014269	Signal peptide predicted for STM_MW31291 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 26 and 27
568708014270	1 probable transmembrane helix predicted for STM_MW31291 by TMHMM2.0 at aa 7-26
568708014272	TRAP-type C4-dicarboxylate transport system, small permease component [Carbohydrate transport and metabolism]; Region: DctM; COG3090
568708014273	Signal peptide predicted for STM_MW31301 by SignalP 2.0 HMM (Signal peptide probability 0.993) with cleavage site probability 0.401 between residues 28 and 29
568708014274	4 probable transmembrane helices predicted for STM_MW31301 by TMHMM2.0 at aa 11-33, 48-66, 89-111 and 131-151
568708014276	DctM-like transporters; Region: DctM; pfam06808
568708014277	TRAP transporter, DctM subunit; Region: dctM; TIGR00786
568708014278	11 probable transmembrane helices predicted for STM_MW31311 by TMHMM2.0 at aa 7-29, 62-84, 105-127, 147-169, 176-198, 229-258, 279-301, 321-338, 343-360, 370-392 and 404-426
568708014280	FtsI repressor; Provisional; Region: PRK10883
568708014281	Multicopper oxidase; Region: Cu-oxidase_3; pfam07732
568708014282	Multicopper oxidase; Region: Cu-oxidase_2; pfam07731
568708014285	Signal peptide predicted for STM_MW31321 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.992 between residues 27 and 28
568708014286	1-acyl-sn-glycerol-3-phosphate acyltransferase; Provisional; Region: PRK15018
568708014287	Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: AGPAT-like; Region: LPLAT_AGPAT-like; cd07989
568708014288	putative acyl-acceptor binding pocket; other site
568708014290	1 probable transmembrane helix predicted for STM_MW31331 by TMHMM2.0 at aa 2-24
568708014291	DNA topoisomerase IV, A subunit, proteobacterial; Region: parC_Gneg; TIGR01062
568708014292	DNA Topoisomerase, subtype IIA; domain A'; bacterial DNA topoisomerase IV (C subunit, ParC), bacterial DNA gyrases (A subunit, GyrA),mammalian DNA toposiomerases II. DNA topoisomerases are essential enzymes that regulate the conformational changes...; Region: TOP4c; cd00187
568708014293	CAP-like domain; other site
568708014294	active site
568708014295	primary dimer interface [polypeptide binding]; other site
568708014296	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
568708014299	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
568708014300	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708014301	DNA gyrase inhibitor [DNA replication, recombination, and repair]; Region: COG3449
568708014304	Periplasmic protein with OB-fold [Function unknown]; Region: COG3111
568708014306	Signal peptide predicted for STM_MW31361 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.996 between residues 20 and 21
568708014307	DNA-binding transcriptional regulator QseB; Provisional; Region: PRK10336
568708014308	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708014309	active site
568708014310	phosphorylation site [posttranslational modification]
568708014311	intermolecular recognition site; other site
568708014312	dimerization interface [polypeptide binding]; other site
568708014313	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
568708014314	DNA binding site [nucleotide binding]
568708014317	sensor protein QseC; Provisional; Region: PRK10337
568708014318	Y_Y_Y domain; Region: Y_Y_Y; pfam07495
568708014319	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
568708014320	dimer interface [polypeptide binding]; other site
568708014321	phosphorylation site [posttranslational modification]
568708014322	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708014323	ATP binding site [chemical binding]; other site
568708014324	Mg2+ binding site [ion binding]; other site
568708014325	G-X-G motif; other site
568708014326	Signal peptide predicted for STM_MW31381 by SignalP 2.0 HMM (Signal peptide probability 0.984) with cleavage site probability 0.861 between residues 31 and 32
568708014327	2 probable transmembrane helices predicted for STM_MW31381 by TMHMM2.0 at aa 13-32 and 159-181
568708014330	Putative NADPH-quinone reductase (modulator of drug activity B) [General function prediction only]; Region: MdaB; COG2249
568708014332	Uncharacterized conserved protein [Function unknown]; Region: COG1359
568708014334	DNA topoisomerase IV, B subunit, proteobacterial; Region: parE_Gneg; TIGR01055
568708014335	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708014336	ATP binding site [chemical binding]; other site
568708014337	Mg2+ binding site [ion binding]; other site
568708014338	G-X-G motif; other site
568708014339	TopoIIA_Trans_DNA_gyrase: Transducer domain, having a ribosomal S5 domain 2-like fold, of the type found in proteins of the type IIA family of DNA topoisomerases similar to the B subunits of E. coli DNA gyrase and E. coli Topoisomerase IV which are; Region: TopoII_Trans_DNA_gyrase; cd00822
568708014340	anchoring element; other site
568708014341	dimer interface [polypeptide binding]; other site
568708014342	ATP binding site [chemical binding]; other site
568708014343	Topoisomerase-primase domain. This is a nucleotidyl transferase/hydrolase domain found in type IA, type IIA and type IIB topoisomerases, bacterial DnaG-type primases, small primase-like proteins from bacteria and archaea, OLD family nucleases from...; Region: TOPRIM; cl00718
568708014344	active site
568708014345	metal binding site [ion binding]; metal-binding site
568708014346	DNA gyrase B subunit, carboxyl terminus; Region: DNA_gyraseB_C; pfam00986
568708014350	esterase YqiA; Provisional; Region: PRK11071
568708014352	Enterobacter aerogenes GpdQ and related proteins, metallophosphatase domain; Region: MPP_GpdQ; cd07402
568708014353	Calcineurin-like phosphoesterase; Region: Metallophos; pfam00149
568708014354	active site
568708014355	metal binding site [ion binding]; metal-binding site
568708014356	hexamer interface [polypeptide binding]; other site
568708014359	putative dehydrogenase; Provisional; Region: PRK11039
568708014361	ADP-ribose pyrophosphatase NudF; Provisional; Region: nudF; PRK10729
568708014362	ADP-ribose pyrophosphatase (ADPRase) catalyzes the hydrolysis of ADP-ribose and a variety of additional ADP-sugar conjugates to AMP and ribose-5-phosphate. Like other members of the Nudix hydrolase superfamily, it requires a divalent cation, such as Mg2+; Region: ADPRase_NUDT5; cd03424
568708014363	dimer interface [polypeptide binding]; other site
568708014364	ADP-ribose binding site [chemical binding]; other site
568708014365	active site
568708014366	nudix motif; other site
568708014367	metal binding site [ion binding]; metal-binding site
568708014369	outer membrane channel protein; Reviewed; Region: tolC; PRK09465
568708014370	Signal peptide predicted for STM_MW31461 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.991 between residues 24 and 25
568708014372	hypothetical protein; Provisional; Region: PRK11653
568708014373	Signal peptide predicted for STM_MW31471 by SignalP 2.0 HMM (Signal peptide probability 0.971) with cleavage site probability 0.413 between residues 36 and 37
568708014375	Glutathionylspermidine synthase [Amino acid transport and metabolism]; Region: Gsp; COG0754
568708014377	The Class III extradiol dioxygenase, 4,5-DOPA Dioxygenase, catalyzes the incorporation of both atoms of molecular oxygen into 4,5-dihydroxy-phenylalanine; Region: 45_DOPA_Dioxygenase; cd07363
568708014378	Catalytic LigB subunit of aromatic ring-opening dioxygenase; Region: LigB; pfam02900
568708014379	putative active site [active]
568708014380	metal binding site [ion binding]; metal-binding site
568708014382	zinc transporter ZupT; Provisional; Region: PRK04201
568708014383	ZIP Zinc transporter; Region: Zip; pfam02535
568708014384	Signal peptide predicted for STM_MW31501 by SignalP 2.0 HMM (Signal peptide probability 0.962) with cleavage site probability 0.814 between residues 25 and 26
568708014385	8 probable transmembrane helices predicted for STM_MW31501 by TMHMM2.0 at aa 5-24, 31-50, 65-87, 108-130, 140-162, 169-191, 195-217 and 234-256
568708014387	Protein of unknown function (DUF4051); Region: DUF4051; pfam13260
568708014388	1 probable transmembrane helix predicted for STM_MW31511 by TMHMM2.0 at aa 4-21
568708014389	Arylsulfotransferase (ASST); Region: Arylsulfotrans; pfam05935
568708014390	Signal peptide predicted for STM_MW31521 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.985 between residues 27 and 28
568708014391	1 probable transmembrane helix predicted for STM_MW31521 by TMHMM2.0 at aa 9-31
568708014393	DsbA family, DsbA subfamily; DsbA is a monomeric thiol disulfide oxidoreductase protein containing a redox active CXXC motif imbedded in a TRX fold. It is involved in the oxidative protein folding pathway in prokaryotes, and is the strongest thiol...; Region: DsbA_DsbA; cd03019
568708014394	DSBA-like thioredoxin domain; Region: DSBA; pfam01323
568708014395	catalytic residues [active]
568708014396	hinge region; other site
568708014397	alpha helical domain; other site
568708014398	Signal peptide predicted for STM_MW31541 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.751 between residues 27 and 28
568708014400	putative disulfide oxidoreductase; Provisional; Region: PRK04307
568708014402	4 probable transmembrane helices predicted for STM_MW31551 by TMHMM2.0 at aa 27-49, 59-78, 83-105 and 197-219
568708014403	3,4-dihydroxy-2-butanone 4-phosphate synthase; Provisional; Region: ribB; PRK03353
568708014404	3,4-dihydroxy-2-butanone 4-phosphate synthase [Coenzyme metabolism]; Region: RibB; COG0108
568708014406	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2960
568708014408	glycogen synthesis protein GlgS; Provisional; Region: PRK02922
568708014410	Protein of unknown function (DUF1449); Region: DUF1449; pfam07290
568708014412	3 probable transmembrane helices predicted for STM_MW31591 by TMHMM2.0 at aa 13-35, 63-85 and 98-117
568708014413	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2268
568708014414	Band_7_flotillin: a subgroup of the band 7 domain of flotillin (reggie) like proteins. This subgroup contains proteins similar to stomatin, prohibitin, flotillin, HlfK/C and podicin.  These two proteins are lipid raft-associated.  Individual proteins of...; Region: Band_7_flotillin; cd03399
568708014415	2 probable transmembrane helices predicted for STM_MW31601 by TMHMM2.0 at aa 11-33 and 46-68
568708014416	bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase; Provisional; Region: PRK11316
568708014417	RfaE encodes a bifunctional ADP-heptose synthase involved in the biosynthesis of the lipopolysaccharide (LPS) core precursor ADP-L-glycero-D-manno-heptose. LPS plays an important role in maintaining the structural integrity of the bacterial outer...; Region: RfaE_like; cd01172
568708014418	putative ribose interaction site [chemical binding]; other site
568708014419	putative ADP binding site [chemical binding]; other site
568708014420	rfaE bifunctional protein, domain II; Region: rfaE_dom_II; TIGR02199
568708014421	active site
568708014422	nucleotide binding site [chemical binding]; other site
568708014423	HIGH motif; other site
568708014424	KMSKS motif; other site
568708014427	bifunctional glutamine-synthetase adenylyltransferase/deadenyltransferase; Reviewed; Region: PRK11072
568708014428	Nucleotidyltransferase (NT) domain of Escherichia coli adenylyltransferase (GlnE), Escherichia coli uridylyl transferase (GlnD), and similar proteins; Region: NT_GlnE_GlnD_like; cd05401
568708014429	metal binding triad; other site
568708014430	GlnD PII-uridylyltransferase; Region: GlnD_UR_UTase; pfam08335
568708014431	Nucleotidyltransferase (NT) domain of Escherichia coli adenylyltransferase (GlnE), Escherichia coli uridylyl transferase (GlnD), and similar proteins; Region: NT_GlnE_GlnD_like; cd05401
568708014432	metal binding triad; other site
568708014433	GlnD PII-uridylyltransferase; Region: GlnD_UR_UTase; pfam08335
568708014436	Uncharacterized conserved protein [Function unknown]; Region: COG3025
568708014437	Uncharacterized subgroup of the CYTH-like superfamily having an associated CHAD domain; Region: CYTH-like_Pase_CHAD; cd07756
568708014438	putative active site [active]
568708014439	putative metal binding residues [ion binding]; other site
568708014440	signature motif; other site
568708014441	putative triphosphate binding site [ion binding]; other site
568708014442	CHAD domain; Region: CHAD; pfam05235
568708014444	SH3 domain-containing protein; Provisional; Region: PRK10884
568708014445	Bacterial SH3 domain homologues; Region: SH3b; smart00287
568708014446	Signal peptide predicted for STM_MW31641 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.989 between residues 22 and 23
568708014448	1 probable transmembrane helix predicted for STM_MW31641 by TMHMM2.0 at aa 167-189
568708014449	multifunctional tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase; Reviewed; Region: cca; PRK10885
568708014450	Nucleotidyltransferase (NT) domain of ClassII CCA-adding enzymes; Region: NT_ClassII-CCAase; cd05398
568708014451	active site
568708014452	NTP binding site [chemical binding]; other site
568708014453	metal binding triad [ion binding]; metal-binding site
568708014454	Probable RNA and SrmB- binding site of polymerase A; Region: PolyA_pol_RNAbd; pfam12627
568708014455	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
568708014456	Zn2+ binding site [ion binding]; other site
568708014457	Mg2+ binding site [ion binding]; other site
568708014460	undecaprenyl pyrophosphate phosphatase; Reviewed; Region: PRK00281
568708014461	7 probable transmembrane helices predicted for STM_MW31661 by TMHMM2.0 at aa 7-29, 49-71, 91-110, 120-137, 188-210, 225-247 and 254-273
568708014463	Dihydroneopterin aldolase (DHNA) and 7,8-dihydroneopterin triphosphate epimerase domain (DHNTPE); these enzymes have been designated folB and folX, respectively. Folate derivatives are essential cofactors in the biosynthesis of purines, pyrimidines, and...; Region: DHNA_DHNTPE; cd00534
568708014464	homooctamer interface [polypeptide binding]; other site
568708014465	active site
568708014467	putative glycerol-3-phosphate acyltransferase PlsY; Provisional; Region: PRK00220
568708014468	5 probable transmembrane helices predicted for STM_MW31681 by TMHMM2.0 at aa 4-26, 53-75, 80-102, 109-131 and 136-158
568708014470	UGMP family protein; Validated; Region: PRK09604
568708014471	Inactive homolog of metal-dependent proteases, putative molecular chaperone [Posttranslational modification, protein turnover, chaperones]; Region: COG1214; cl17884
568708014473	30S ribosomal protein S21; Reviewed; Region: rpsU; PRK00270
568708014475	DNA primase; Validated; Region: dnaG; PRK05667
568708014476	CHC2 zinc finger; Region: zf-CHC2; pfam01807
568708014477	DNA primase catalytic core, N-terminal domain; Region: Toprim_N; pfam08275
568708014478	TOPRIM_DnaG_primases: The topoisomerase-primase (TORPIM) nucleotidyl transferase/hydrolase domain found in the active site regions of proteins similar to Escherichia coli DnaG. Primases synthesize RNA primers for the initiation of DNA replication. DnaG...; Region: TOPRIM_DnaG_primases; cd03364
568708014479	active site
568708014480	metal binding site [ion binding]; metal-binding site
568708014481	interdomain interaction site; other site
568708014482	DnaB-helicase binding domain of primase; Region: DnaB_bind; pfam10410
568708014483	DNA primase DnaG DnaB-binding; Region: DnaG_DnaB_bind; pfam08278
568708014489	RNA polymerase sigma factor RpoD; Validated; Region: PRK05658
568708014490	Sigma-70 factor, region 1.1; Region: Sigma70_r1_1; pfam03979
568708014491	Sigma-70 factor, region 1.2; Region: Sigma70_r1_2; pfam00140
568708014492	Sigma-70, non-essential region; Region: Sigma70_ner; pfam04546
568708014493	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
568708014494	Sigma-70 region 3; Region: Sigma70_r3; pfam04539
568708014495	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
568708014496	DNA binding residues [nucleotide binding]
568708014503	G:T/U mismatch specific DNA glcosylase (MUG); Region: UDG_F2_MUG; cd10028
568708014504	active site
568708014505	SUMO-1 interface [polypeptide binding]; other site
568708014507	BTP5
568708014508	DNA-binding transcriptional regulator; Provisional; Region: PRK09678
568708014509	Ogr/Delta-like zinc finger; Region: Ogr_Delta; pfam04606
568708014511	tail protein; Provisional; Region: D; PHA02561
568708014513	Phage P2 GpU; Region: Phage_P2_GpU; pfam06995
568708014515	phage tail tape measure protein, TP901 family, core region; Region: tape_meas_TP901; TIGR01760
568708014516	4 probable transmembrane helices predicted for STM_MW31771 by TMHMM2.0 at aa 538-560, 567-589, 593-612 and 619-638
568708014518	Phage P2 GpE; Region: Phage_P2_GpE; pfam06528
568708014520	Mu-like prophage FluMu protein gp41; Region: FluMu_gp41; pfam10109
568708014522	major tail tube protein; Provisional; Region: FII; PHA02600
568708014524	major tail sheath protein; Provisional; Region: FI; PHA02560
568708014526	Caudovirales tail fibre assembly protein; Region: Caudo_TAP; pfam02413
568708014528	Phage tail-collar fibre protein; Region: DUF3751; pfam12571
568708014529	Phage tail fibre repeat; Region: Phage_fiber_2; pfam03406
568708014530	Phage tail fibre repeat; Region: Phage_fiber_2; pfam03406
568708014531	Phage-related tail fibre protein [General function prediction only]; Region: COG5301
568708014532	Phage tail fibre repeat; Region: Phage_fiber_2; pfam03406
568708014534	Signal peptide predicted for STM_MW31841 by SignalP 2.0 HMM (Signal peptide probability 0.894) with cleavage site probability 0.829 between residues 19 and 20
568708014535	phage tail protein, P2 protein I family; Region: tail_P2_I; TIGR01634
568708014537	baseplate assembly protein; Provisional; Region: J; PHA02568
568708014539	baseplate wedge subunit; Provisional; Region: W; PHA02516
568708014541	phage baseplate assembly protein V; Region: phage_P2_V; TIGR01644
568708014542	Phage P2 baseplate assembly protein gpV [General function prediction only]; Region: gpV; COG4540
568708014544	Phage virion morphogenesis family; Region: Phage_tail_S; pfam05069
568708014546	P2 phage tail completion protein R (GpR); Region: P2_Phage_GpR; pfam06891
568708014548	phage lysis regulatory protein, LysB family; Region: phage_LysB; TIGR03495
568708014549	The lysozyme from bacteriophage lambda hydrolyses the beta-1,4-glycosidic bond between N-acetylmuramic acid (MurNAc) and N-acetylglucosamine (GlcNAc), as do other lysozymes.  But unlike other lysozymes, bacteriophage lambda does not produce a reducing...; Region: bacteriophage_lambda_lysozyme; cd00736
568708014550	N-acetyl-D-glucosamine binding site [chemical binding]; other site
568708014551	catalytic residue [active]
568708014553	Phage head completion protein (GPL); Region: Phage_GPL; pfam05926
568708014555	terminase endonuclease subunit; Provisional; Region: M; PHA02537
568708014556	Phage small terminase subunit; Region: Phage_term_smal; pfam05944
568708014558	Phage major capsid protein, P2 family; Region: Phage_cap_P2; pfam05125
568708014560	Phage capsid scaffolding protein (GPO) serine peptidase; Region: Phage_GPO; pfam05929
568708014562	terminase ATPase subunit; Provisional; Region: P; PHA02535
568708014563	Putative ATPase subunit of terminase (gpP-like); Region: Terminase_5; pfam06056
568708014566	portal vertex protein; Provisional; Region: Q; PHA02536
568708014567	Phage portal protein; Region: Phage_portal; pfam04860
568708014569	2 probable transmembrane helices predicted for STM_MW32031 by TMHMM2.0 at aa 4-21 and 34-53
568708014570	DinI-like family; Region: DinI; pfam06183
568708014572	Bacteriophage replication gene A protein (GPA); Region: Phage_GPA; pfam05840
568708014574	Domain of Unknown Function with PDB structure (DUF3850); Region: DUF3850; pfam12961
568708014576	DNA polymerase III, epsilon subunit and related 3'-5' exonucleases [DNA replication, recombination, and repair]; Region: DnaQ; COG0847
568708014577	DEDDh 3'-5' exonuclease domain family; Region: DEDDh; cd06127
568708014578	active site
568708014579	catalytic site [active]
568708014580	substrate binding site [chemical binding]; other site
568708014582	DksA-like zinc finger domain containing protein; Region: PHA00080
568708014584	Protein of unknown function (DUF2732); Region: DUF2732; pfam10809
568708014586	Phage regulatory protein CII (CP76); Region: Phage_CP76; pfam06892
568708014588	Bacteriophage CI repressor helix-turn-helix domain; Region: Phage_CI_repr; pfam07022
568708014590	integrase; Provisional; Region: int; PHA02601
568708014591	DNA breaking-rejoining enzymes, C-terminal catalytic domain. The DNA breaking-rejoining enzyme superfamily includes type IB topoisomerases and tyrosine recombinases that share the same fold in their catalytic domain containing six conserved active site...; Region: DNA_BRE_C; cl00213
568708014592	active site
568708014593	DNA binding site [nucleotide binding]
568708014594	Int/Topo IB signature motif; other site
568708014596	Siderophore-interacting protein [Inorganic ion transport and metabolism]; Region: ViuB; COG2375
568708014597	Siderophore interacting proteins share the domain structure of the ferredoxin reductase like family. Siderophores are produced in various bacteria (and some plants) to extract iron from hosts. Binding constants are high, so iron can be pilfered from...; Region: siderophore_interacting; cd06193
568708014598	FAD binding pocket [chemical binding]; other site
568708014599	FAD binding motif [chemical binding]; other site
568708014600	phosphate binding motif [ion binding]; other site
568708014601	NAD binding pocket [chemical binding]; other site
568708014604	Predicted transcriptional regulators [Transcription]; Region: COG1695
568708014605	Transcriptional regulator PadR-like family; Region: PadR; pfam03551
568708014607	Four helix bundle sensory module for signal transduction; Region: 4HB_MCP_1; pfam12729
568708014608	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
568708014609	dimerization interface [polypeptide binding]; other site
568708014610	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
568708014611	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
568708014612	dimer interface [polypeptide binding]; other site
568708014613	putative CheW interface [polypeptide binding]; other site
568708014615	2 probable transmembrane helices predicted for STM_MW32171 by TMHMM2.0 at aa 12-34 and 191-210
568708014617	Signal peptide predicted for STM_MW32171 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.408 between residues 33 and 34
568708014618	PAS fold; Region: PAS_3; pfam08447
568708014619	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
568708014620	putative active site [active]
568708014621	heme pocket [chemical binding]; other site
568708014622	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
568708014623	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
568708014624	dimer interface [polypeptide binding]; other site
568708014625	putative CheW interface [polypeptide binding]; other site
568708014628	putrescine--2-oxoglutarate aminotransferase; Provisional; Region: PRK11522
568708014629	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
568708014630	inhibitor-cofactor binding pocket; inhibition site
568708014631	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708014632	catalytic residue [active]
568708014634	NADH:flavin oxidoreductases, Old Yellow Enzyme family [Energy production and conversion]; Region: NemA; COG1902
568708014635	2,4-dienoyl-CoA reductase (DCR) FMN-binding domain. DCR in E. coli  is an iron-sulfur flavoenzyme which contains FMN, FAD, and a 4Fe-4S cluster. It is also a monomer, unlike that of its eukaryotic counterparts which form homotetramers and lack the...; Region: DCR_FMN; cd02930
568708014636	active site
568708014637	FMN binding site [chemical binding]; other site
568708014638	2,4-decadienoyl-CoA binding site; other site
568708014639	catalytic residue [active]
568708014640	4Fe-4S cluster binding site [ion binding]; other site
568708014641	Uncharacterized NAD(FAD)-dependent dehydrogenases [General function prediction only]; Region: HcaD; COG0446
568708014642	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
568708014646	SAM-dependent 23S ribosomal RNA mG1835 methyltransferase; Provisional; Region: PRK15001
568708014647	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708014648	S-adenosylmethionine binding site [chemical binding]; other site
568708014650	Predicted metal-dependent hydrolase [General function prediction only]; Region: COG1451
568708014652	YdcF-like. YdcF-like is a large family of mainly bacterial proteins, with a few members found in fungi, plants, and archaea. Escherichia coli YdcF has been shown to bind S-adenosyl-L-methionine (AdoMet), but a biochemical function has not been...; Region: YdcF-like; cd06259
568708014653	putative active site [active]
568708014654	Signal peptide predicted for STM_MW32231 by SignalP 2.0 HMM (Signal peptide probability 0.792) with cleavage site probability 0.231 between residues 43 and 44
568708014655	1 probable transmembrane helix predicted for STM_MW32231 by TMHMM2.0 at aa 19-41
568708014657	Predicted dehydrogenases and related proteins [General function prediction only]; Region: MviM; COG0673
568708014658	Oxidoreductase family, NAD-binding Rossmann fold; Region: GFO_IDH_MocA; pfam01408
568708014660	integral membrane protein, TerC family; Region: R_switched_Alx; TIGR03718
568708014661	9 probable transmembrane helices predicted for STM_MW32251 by TMHMM2.0 at aa 10-29, 42-64, 79-101, 114-136, 142-161, 198-220, 235-257, 264-286 and 290-312
568708014663	serine/threonine transporter SstT; Provisional; Region: PRK13628
568708014664	Na+/H+-dicarboxylate symporters [Energy production and conversion]; Region: GltP; COG1301
568708014665	8 probable transmembrane helices predicted for STM_MW32261 by TMHMM2.0 at aa 13-35, 50-72, 84-106, 141-163, 191-213, 218-240, 292-314 and 329-351
568708014667	Uncharacterized membrane-associated protein [Function unknown]; Region: DedA; COG0586
568708014668	SNARE associated Golgi protein; Region: SNARE_assoc; cl00429
568708014669	6 probable transmembrane helices predicted for STM_MW32271 by TMHMM2.0 at aa 19-38, 42-64, 71-93, 126-148, 153-175 and 190-212
568708014671	EnvZ/OmpR regulon moderator; Provisional; Region: PRK10629
568708014672	Signal peptide predicted for STM_MW32281 by SignalP 2.0 HMM (Signal peptide probability 0.928) with cleavage site probability 0.396 between residues 34 and 35
568708014673	1 probable transmembrane helix predicted for STM_MW32281 by TMHMM2.0 at aa 12-31
568708014674	Protein of unknown function (DUF1090); Region: DUF1090; pfam06476
568708014675	Signal peptide predicted for STM_MW32291 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.959 between residues 20 and 21
568708014677	Predicted membrane protein [Function unknown]; Region: COG5393
568708014679	2 probable transmembrane helices predicted for STM_MW32301 by TMHMM2.0 at aa 50-72 and 82-104
568708014680	YqjK-like protein; Region: YqjK; pfam13997
568708014681	Predicted membrane protein [Function unknown]; Region: COG2259
568708014683	4 probable transmembrane helices predicted for STM_MW32321 by TMHMM2.0 at aa 40-62, 77-99, 104-121 and 136-153
568708014684	Predicted glutathione S-transferase [Posttranslational modification, protein turnover, chaperones]; Region: ECM4; COG0435
568708014685	Glutathione S-transferase, N-terminal domain; Region: GST_N_2; pfam13409
568708014686	C-terminal, alpha helical domain of Class Omega-like Glutathione S-transferases; Region: GST_C_Omega_like; cd03190
568708014687	putative dimer interface [polypeptide binding]; other site
568708014688	N-terminal domain interface [polypeptide binding]; other site
568708014689	putative substrate binding pocket (H-site) [chemical binding]; other site
568708014691	Predicted membrane protein [Function unknown]; Region: COG3152
568708014693	3 probable transmembrane helices predicted for STM_MW32341 by TMHMM2.0 at aa 24-46, 51-70 and 82-101
568708014694	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708014695	putative DNA-binding transcriptional regulator; Provisional; Region: PRK11074
568708014696	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
568708014697	dimerization interface [polypeptide binding]; other site
568708014700	Pirin-related protein [General function prediction only]; Region: COG1741
568708014701	Pirin; Region: Pirin; pfam02678
568708014703	L-cysteine desulfidase [Amino acid transport and metabolism]; Region: COG3681
568708014705	Amino acid permeases [Amino acid transport and metabolism]; Region: SdaC; COG0814
568708014706	serine transporter; Region: stp; TIGR00814
568708014707	11 probable transmembrane helices predicted for STM_MW32391 by TMHMM2.0 at aa 38-60, 65-87, 112-134, 149-171, 184-206, 221-243, 264-286, 318-340, 363-385, 389-411 and 423-442
568708014708	L-serine dehydratase TdcG; Provisional; Region: PRK15040
568708014709	Serine dehydratase beta chain; Region: SDH_beta; pfam03315
568708014710	Serine dehydratase alpha chain; Region: SDH_alpha; pfam03313
568708014713	formate acetyltransferase 1; Region: pyr_form_ly_1; TIGR01255
568708014714	Pyruvate formate lyase 1; Region: PFL1; cd01678
568708014715	coenzyme A binding site [chemical binding]; other site
568708014716	active site
568708014717	catalytic residues [active]
568708014718	glycine loop; other site
568708014721	propionate/acetate kinase; Provisional; Region: PRK12379
568708014722	Acetate kinase [Energy production and conversion]; Region: ackA; COG0282
568708014724	threonine/serine transporter TdcC; Provisional; Region: PRK13629
568708014725	Amino acid permeases [Amino acid transport and metabolism]; Region: SdaC; COG0814
568708014726	11 probable transmembrane helices predicted for STM_MW32431 by TMHMM2.0 at aa 23-40, 44-66, 97-119, 134-156, 163-185, 212-234, 255-277, 315-337, 358-380, 390-409 and 422-440
568708014728	Threonine dehydratase [Amino acid transport and metabolism]; Region: IlvA; COG1171
568708014729	Threonine dehydratase: The first step in amino acid degradation is the removal of nitrogen. Although the nitrogen atoms of most amino acids are transferred to alpha-ketoglutarate before removal, the alpha-amino group of threonine can be directly...; Region: Thr-dehyd; cd01562
568708014730	tetramer interface [polypeptide binding]; other site
568708014731	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708014732	catalytic residue [active]
568708014734	DNA-binding transcriptional activator TdcA; Provisional; Region: PRK10341
568708014735	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708014736	The C-terminal substrate binding domain of LysR-type transcriptional regulator TdcA, which is involved in the degradation of L-serine and L-threonine, contains the type 2 periplasmic binding fold; Region: PBP2_TdcA; cd08418
568708014737	putative substrate binding pocket [chemical binding]; other site
568708014738	putative dimerization interface [polypeptide binding]; other site
568708014741	glycerate kinase I; Provisional; Region: PRK10342
568708014743	tartronate semialdehyde reductase; Provisional; Region: garR; PRK11559
568708014744	6-phosphogluconate dehydrogenase-like protein; Reviewed; Region: PRK09599
568708014746	alpha-dehydro-beta-deoxy-D-glucarate aldolase; Provisional; Region: PRK10558
568708014748	galactarate dehydratase; Region: galactar-dH20; TIGR03248
568708014749	Domains similar to fish antifreeze type III protein; Region: SAF_AH_GD; cd11613
568708014750	D-galactarate dehydratase / Altronate hydrolase, C terminus; Region: GD_AH_C; pfam04295
568708014753	Sugar kinases, ribokinase family [Carbohydrate transport and metabolism]; Region: RbsK; COG0524
568708014754	2-keto-3-deoxygluconate kinase (KdgK) phosphorylates 2-keto-3-deoxygluconate (KDG) to form 2-keto-3-deoxy-6-phosphogluconate (KDGP). KDG is the common intermediate product, that allows organisms to channel D-glucuronate and/or D-galacturinate into the...; Region: KdgK; cd01166
568708014755	substrate binding site [chemical binding]; other site
568708014756	ATP binding site [chemical binding]; other site
568708014758	Transcriptional regulators of sugar metabolism [Transcription / Carbohydrate transport and metabolism]; Region: GlpR; COG1349
568708014759	helix_turn_helix, Deoxyribose operon repressor; Region: HTH_DEOR; smart00420
568708014760	DeoR C terminal sensor domain; Region: DeoRC; pfam00455
568708014763	Tagatose-1,6-bisphosphate (TBP) aldolase and related Type B Class II aldolases. TBP aldolase is a tetrameric class II aldolase that catalyzes the reversible condensation of dihydroxyacetone phosphate with glyceraldehyde 3-phsophate to produce tagatose 1; Region: TBP_aldolase_IIB; cd00947
568708014764	fructose-bisphosphate aldolase; Provisional; Region: PRK09197
568708014765	intersubunit interface [polypeptide binding]; other site
568708014766	active site
568708014767	zinc binding site [ion binding]; other site
568708014768	Na+ binding site [ion binding]; other site
568708014770	Fructose-1-phosphate kinase and related fructose-6-phosphate kinase (PfkB) [Carbohydrate transport and metabolism]; Region: FruK; COG1105
568708014771	1-phosphofructokinase (FruK), minor 6-phosphofructokinase (pfkB) and related sugar kinases. FruK plays an important role in the predominant pathway for fructose utilisation.This group also contains tagatose-6-phophate kinase, an enzyme of the tagatose...; Region: FruK_PfkB_like; cd01164
568708014772	putative substrate binding site [chemical binding]; other site
568708014773	putative ATP binding site [chemical binding]; other site
568708014775	putative PTS system  transporter subunits IIBC; Provisional; Region: PRK11404
568708014776	PTS_IIB_fructose: subunit IIB of enzyme II (EII) of the fructose-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS). In this system, EII (also referred to as FruAB) is a fructose-specific permease made up of two proteins (FruA and...; Region: PTS_IIB_fructose; cd05569
568708014777	active site
568708014778	P-loop; other site
568708014779	phosphorylation site [posttranslational modification]
568708014780	Phosphotransferase system, fructose-specific IIC component [Carbohydrate transport and metabolism]; Region: FruA; COG1299
568708014783	8 probable transmembrane helices predicted for STM_MW32551 by TMHMM2.0 at aa 133-155, 175-197, 209-231, 251-270, 291-310, 330-352, 391-413 and 428-450
568708014784	PTS_IIA, PTS system, fructose/mannitol specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This...; Region: PTS_IIA_fru; cd00211
568708014785	active site
568708014786	phosphorylation site [posttranslational modification]
568708014787	Histidine-containing phosphocarrier protein (HPr)-like proteins. HPr is a central component of the bacterial phosphoenolpyruvate sugar phosphotransferase system (PTS). The PTS catalyses the phosphorylation of sugar substrates during their translocation...; Region: PTS-HPr_like; cd00367
568708014788	dimerization domain swap beta strand [polypeptide binding]; other site
568708014789	regulatory protein interface [polypeptide binding]; other site
568708014790	active site
568708014791	regulatory phosphorylation site [posttranslational modification]; other site
568708014794	D-tagatose-1,6-bisphosphate aldolase subunit GatZ; Provisional; Region: PRK15052
568708014796	PTS_IIA, PTS system, fructose/mannitol specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This...; Region: PTS_IIA_fru; cd00211
568708014797	active site
568708014798	phosphorylation site [posttranslational modification]
568708014800	PTS_IIB_galactitol: subunit IIB of enzyme II (EII) of the galactitol-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS).  In this system, EII is a galactitol-specific permease with two cytoplasmic domains (IIA and IIB) and a...; Region: PTS_IIB_galactitol; cd05566
568708014801	active site
568708014802	P-loop; other site
568708014803	phosphorylation site [posttranslational modification]
568708014804	Signal peptide predicted for STM_MW32591 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 19 and 20
568708014806	Phosphotransferase system, galactitol-specific IIC component [Carbohydrate transport and metabolism]; Region: GatC; COG3775
568708014807	PTS system sugar-specific permease component; Region: EIIC-GAT; cl04451
568708014808	9 probable transmembrane helices predicted for STM_MW32601 by TMHMM2.0 at aa 4-26, 39-61, 91-113, 134-156, 225-247, 299-321, 331-348, 353-375 and 411-433
568708014810	galactitol-1-phosphate dehydrogenase; Provisional; Region: PRK10309
568708014811	NAD(P)-dependent sugar dehydrogenases; Region: sugar_DH; cd08236
568708014812	putative NAD(P) binding site [chemical binding]; other site
568708014813	catalytic Zn binding site [ion binding]; other site
568708014816	Transcriptional regulators of sugar metabolism [Transcription / Carbohydrate transport and metabolism]; Region: GlpR; COG1349
568708014817	helix_turn_helix, Deoxyribose operon repressor; Region: HTH_DEOR; smart00420
568708014818	DeoR C terminal sensor domain; Region: DeoRC; pfam00455
568708014821	SAM-dependent 16S ribosomal RNA C1402 ribose 2'-O-methyltransferase; Provisional; Region: PRK14994
568708014822	Ribosomal RNA small subunit methyltransferase I, also known as rRNA (cytidine-2'-O-)-methyltransferase RsmI; Region: RsmI; cd11648
568708014823	putative SAM binding site [chemical binding]; other site
568708014824	putative homodimer interface [polypeptide binding]; other site
568708014826	Type 1 periplasmic binding fold superfamily; Region: Periplasmic_Binding_Protein_Type_1; cl10011
568708014827	Putative lipoprotein [General function prediction only]; Region: LppC; COG3107
568708014828	Periplasmic binding component of lipoprotein LppC, an immunodominant antigen; Region: PBP1_YraM_LppC_lipoprotein_like; cd06339
568708014829	putative ligand binding site [chemical binding]; other site
568708014830	Signal peptide predicted for STM_MW32641 by SignalP 2.0 HMM (Signal peptide probability 0.840) with cleavage site probability 0.396 between residues 30 and 31
568708014832	TIGR00252 family protein; Region: TIGR00252
568708014834	Phosphoheptose isomerase is a member of the SIS (Sugar ISomerase) superfamily. Phosphoheptose isomerase catalyzes the isomerization of sedoheptulose 7-phosphate into D-glycero-D-mannoheptose 7-phosphate. This is the first step of the biosynthesis of...; Region: SIS_GmhA; cd05006
568708014835	dimer interface [polypeptide binding]; other site
568708014836	active site
568708014838	outer membrane lipoprotein; Provisional; Region: PRK11023
568708014839	BON domain; Region: BON; pfam04972
568708014840	BON domain; Region: BON; pfam04972
568708014841	Signal peptide predicted for STM_MW32671 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.540 between residues 22 and 23
568708014842	1 probable transmembrane helix predicted for STM_MW32671 by TMHMM2.0 at aa 7-29
568708014844	CC3(TIP30)-like, atypical (a) SDRs; Region: CC3_like_SDR_a; cd05250
568708014845	NADH(P)-binding; Region: NAD_binding_10; pfam13460
568708014846	NAD binding site [chemical binding]; other site
568708014847	active site
568708014849	intracellular protease, PfpI family; Region: PfpI; TIGR01382
568708014850	A type 1 glutamine amidotransferase (GATase1)-like domain found in PfpI from Pyrococcus furiosus; Region: GATase1_PfpI_like; cd03134
568708014851	proposed catalytic triad [active]
568708014852	conserved cys residue [active]
568708014854	hypothetical protein; Provisional; Region: PRK03467
568708014855	The GIY-YIG domain of uncharacterized protein family UPF0213 related to structure-specific endonuclease SLX1; Region: GIY-YIG_UPF0213; cd10456
568708014856	GIY-YIG motif/motif A; other site
568708014857	putative active site [active]
568708014858	putative metal binding site [ion binding]; other site
568708014860	Acetyltransferases [General function prediction only]; Region: RimI; COG0456
568708014861	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
568708014862	Coenzyme A binding pocket [chemical binding]; other site
568708014864	Putative lipid carrier protein [Lipid metabolism]; Region: COG3154
568708014866	Collagenase and related proteases [Posttranslational modification, protein turnover, chaperones]; Region: COG0826
568708014867	Peptidase family U32; Region: Peptidase_U32; pfam01136
568708014869	putative protease; Provisional; Region: PRK15447
568708014870	Collagenase and related proteases [Posttranslational modification, protein turnover, chaperones]; Region: COG0826
568708014872	hypothetical protein; Provisional; Region: PRK10508
568708014873	Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cl07892
568708014875	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3034
568708014877	1 probable transmembrane helix predicted for STM_MW32771 by TMHMM2.0 at aa 5-27
568708014878	tryptophan permease; Provisional; Region: PRK10483
568708014879	aromatic amino acid transport protein; Region: araaP; TIGR00837
568708014881	10 probable transmembrane helices predicted for STM_MW32791 by TMHMM2.0 at aa 10-32, 59-81, 96-118, 125-147, 162-184, 197-219, 256-278, 290-312, 317-339 and 360-382
568708014882	DEAD-box helicases. A diverse family of proteins involved in ATP-dependent RNA unwinding, needed in a variety of cellular processes including splicing, ribosome biogenesis and RNA degradation. The name derives from the sequence of the Walker  B motif; Region: DEADc; cd00268
568708014883	DEAD-like helicases superfamily; Region: DEXDc; smart00487
568708014884	ATP binding site [chemical binding]; other site
568708014885	Mg++ binding site [ion binding]; other site
568708014886	motif III; other site
568708014887	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
568708014888	nucleotide binding region [chemical binding]; other site
568708014889	ATP-binding site [chemical binding]; other site
568708014890	RNA recognition motif in Escherichia coli cold-shock DEAD box protein A (CsdA) and similar proteins; Region: RRM_EcCsdA_like; cd12499
568708014891	putative RNA binding site [nucleotide binding]; other site
568708014895	lipoprotein NlpI; Provisional; Region: PRK11189
568708014896	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
568708014897	binding surface
568708014898	TPR motif; other site
568708014900	Signal peptide predicted for STM_MW32811 by SignalP 2.0 HMM (Signal peptide probability 0.996) with cleavage site probability 0.958 between residues 22 and 23
568708014901	polynucleotide phosphorylase/polyadenylase; Provisional; Region: PRK11824
568708014902	Polyribonucleotide nucleotidyltransferase, repeat 1; Region: RNase_PH_PNPase_1; cd11363
568708014903	RNase E interface [polypeptide binding]; other site
568708014904	trimer interface [polypeptide binding]; other site
568708014905	Polyribonucleotide nucleotidyltransferase, RNA binding domain; Region: PNPase; pfam03726
568708014906	Polyribonucleotide nucleotidyltransferase, repeat 2; Region: RNase_PH_PNPase_2; cd11364
568708014907	RNase E interface [polypeptide binding]; other site
568708014908	trimer interface [polypeptide binding]; other site
568708014909	active site
568708014910	Polynucleotide phosphorylase (PNPase) K homology RNA-binding domain (KH). PNPase is a polyribonucleotide nucleotidyl transferase that degrades mRNA in prokaryotes and plant chloroplasts. The C-terminal region of PNPase contains domains homologous to...; Region: PNPase_KH; cd02393
568708014911	putative nucleic acid binding region [nucleotide binding]; other site
568708014912	G-X-X-G motif; other site
568708014913	S1_PNPase: Polynucleotide phosphorylase (PNPase), ), S1-like RNA-binding domain. PNPase  is a polyribonucleotide nucleotidyl transferase that degrades mRNA. It is a trimeric multidomain protein. The C-terminus contains the S1 domain which binds ssRNA; Region: S1_PNPase; cd04472
568708014914	RNA binding site [nucleotide binding]; other site
568708014915	domain interface; other site
568708014921	Ribosomal protein S15 (prokaryotic)_S13 (eukaryotic) binds the central domain of 16S rRNA and is required for assembly of the small ribosomal subunit and for intersubunit association, thus representing a key element in the assembly of the whole ribosome; Region: Ribosomal_S15p_S13e; cd00353
568708014922	16S/18S rRNA binding site [nucleotide binding]; other site
568708014923	S13e-L30e interaction site [polypeptide binding]; other site
568708014924	25S rRNA binding site [nucleotide binding]; other site
568708014926	tRNA pseudouridine synthase B; Provisional; Region: truB; PRK05033
568708014927	Pseudouridine synthase, Escherichia coli TruB like; Region: PseudoU_synth_EcTruB; cd02573
568708014928	RNA binding site [nucleotide binding]; other site
568708014929	active site
568708014930	Pseudouridine synthase II TruB, C-terminal; Region: TruB-C_2; pfam09157
568708014933	ribosome-binding factor A; Validated; Region: rbfA; PRK00521
568708014935	Translation initiation factor IF-2, N-terminal region; Region: IF2_N; pfam04760
568708014936	Bacterial translation initiation factor IF-2 associated region; Region: IF2_assoc; pfam08364
568708014937	translation initiation factor IF-2; Region: IF-2; TIGR00487
568708014938	Translation initiation factor IF-2, N-terminal region; Region: IF2_N; pfam04760
568708014939	Initiation Factor 2 (IF2)/ eukaryotic Initiation Factor 5B (eIF5B) family; Region: IF2_eIF5B; cd01887
568708014940	G1 box; other site
568708014941	putative GEF interaction site [polypeptide binding]; other site
568708014942	GTP/Mg2+ binding site [chemical binding]; other site
568708014943	Switch I region; other site
568708014944	G2 box; other site
568708014945	G3 box; other site
568708014946	Switch II region; other site
568708014947	G4 box; other site
568708014948	G5 box; other site
568708014949	This family represents the domain II of bacterial Initiation Factor 2 (IF2) and its eukaryotic mitochondrial homologue mtIF2. IF2, the largest initiation factor is an essential GTP binding protein. In E. coli three natural forms of IF2 exist in the cell; Region: IF2_mtIF2_II; cd03702
568708014950	Translation-initiation factor 2; Region: IF-2; pfam11987
568708014951	mtIF2_IVc: this family represents the C2 subdomain of domain IV of mitochondrial translation initiation factor 2 (mtIF2) which adopts a beta-barrel fold displaying a high degree of structural similarity with domain II of the translation elongation factor...; Region: mtIF2_IVc; cd03692
568708014957	transcription elongation factor NusA; Validated; Region: nusA; PRK09202
568708014958	NusA N-terminal domain; Region: NusA_N; pfam08529
568708014959	S1_NusA: N-utilizing substance A protein (NusA), S1-like RNA-binding domain. S1-like RNA-binding domains are found in a wide variety of RNA-associated proteins. NusA is a transcription elongation factor containing an N-terminal catalytic domain and three...; Region: S1_NusA; cd04455
568708014960	RNA binding site [nucleotide binding]; other site
568708014961	homodimer interface [polypeptide binding]; other site
568708014962	NusA-like KH domain; Region: KH_5; pfam13184
568708014963	NusA_K homology RNA-binding domain (KH). NusA is an essential multifunctional transcription elongation factor that is universally conserved among prokaryotes and archaea. NusA anti-termination function plays an important role in the expression of...; Region: NusA_KH; cd02134
568708014964	G-X-X-G motif; other site
568708014965	transcription termination factor NusA, C-terminal duplication; Region: nusA_Cterm_rpt; TIGR01954
568708014966	transcription termination factor NusA, C-terminal duplication; Region: nusA_Cterm_rpt; TIGR01954
568708014969	ribosome maturation protein RimP; Reviewed; Region: PRK00092
568708014970	hypothetical protein; Provisional; Region: PRK14641
568708014971	Bacillus subtilis YxlS-like, C-terminal domain; Region: YlxS_C; cd01734
568708014972	putative oligomer interface [polypeptide binding]; other site
568708014973	putative RNA binding site [nucleotide binding]; other site
568708014975	argininosuccinate synthase; Validated; Region: PRK05370
568708014976	argininosuccinate synthase; Provisional; Region: PRK13820
568708014978	Domain of unknown function (DUF1963); Region: DUF1963; cl01600
568708014980	Preprotein translocase SecG subunit; Region: SecG; pfam03840
568708014982	2 probable transmembrane helices predicted for STM_MW32911 by TMHMM2.0 at aa 5-22 and 51-73
568708014983	phosphoglucosamine mutase; Provisional; Region: glmM; PRK10887
568708014984	GlmM is a bacterial phosphoglucosamine mutase (PNGM) that belongs to the alpha-D-phosphohexomutase superfamily. It is required for the interconversion of glucosamine-6-phosphate and glucosamine-1-phosphate in the biosynthetic pathway of...; Region: GlmM; cd05802
568708014985	active site
568708014986	substrate binding site [chemical binding]; other site
568708014987	metal binding site [ion binding]; metal-binding site
568708014992	DHPS subgroup of Pterin binding enzymes. DHPS (dihydropteroate synthase), a functional homodimer, catalyzes the condensation of p-aminobenzoic acid (pABA) in the de novo biosynthesis of folate, which is an essential cofactor in both nucleic acid and...; Region: DHPS; cd00739
568708014993	dihydropteroate synthase; Region: DHPS; TIGR01496
568708014994	substrate binding pocket [chemical binding]; other site
568708014995	dimer interface [polypeptide binding]; other site
568708014996	inhibitor binding site; inhibition site
568708014998	Transposase IS200 like; Region: Y1_Tnp; pfam01797
568708015000	ATP-dependent metalloprotease; Reviewed; Region: hflB; PRK10733
568708015001	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708015002	Walker A motif; other site
568708015003	ATP binding site [chemical binding]; other site
568708015004	Walker B motif; other site
568708015005	arginine finger; other site
568708015006	Peptidase family M41; Region: Peptidase_M41; pfam01434
568708015010	2 probable transmembrane helices predicted for STM_MW32951 by TMHMM2.0 at aa 5-24 and 97-119
568708015011	Signal peptide predicted for STM_MW32951 by SignalP 2.0 HMM (Signal peptide probability 0.701) with cleavage site probability 0.380 between residues 27 and 28
568708015012	23S rRNA methylase [Translation, ribosomal structure and biogenesis]; Region: FtsJ; COG0293
568708015013	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708015014	S-adenosylmethionine binding site [chemical binding]; other site
568708015016	RNA-binding protein YhbY; Provisional; Region: PRK10343
568708015018	transcription elongation factor GreA; Reviewed; Region: greA; PRK00226
568708015019	Transcription elongation factor, N-terminal; Region: GreA_GreB_N; pfam03449
568708015020	Transcription elongation factor, GreA/GreB, C-term; Region: GreA_GreB; pfam01272
568708015023	D-alanyl-D-alanine carboxypeptidase/endopeptidase; Provisional; Region: PRK11113
568708015024	D-alanyl-D-alanine carboxypeptidase, serine-type, PBP4 family; Region: PBP4; TIGR00666
568708015025	Signal peptide predicted for STM_MW32991 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.997 between residues 20 and 21
568708015027	GTPase CgtA; Reviewed; Region: obgE; PRK12298
568708015028	GTP1/OBG; Region: GTP1_OBG; pfam01018
568708015029	Obg GTPase; Region: Obg; cd01898
568708015030	G1 box; other site
568708015031	GTP/Mg2+ binding site [chemical binding]; other site
568708015032	Switch I region; other site
568708015033	G2 box; other site
568708015034	G3 box; other site
568708015035	Switch II region; other site
568708015036	G4 box; other site
568708015037	G5 box; other site
568708015041	Permeases of the drug/metabolite transporter (DMT) superfamily [Carbohydrate transport and metabolism / Amino acid transport and metabolism / General function prediction only]; Region: RhaT; COG0697
568708015042	EamA-like transporter family; Region: EamA; pfam00892
568708015043	EamA-like transporter family; Region: EamA; pfam00892
568708015044	10 probable transmembrane helices predicted for STM_MW33011 by TMHMM2.0 at aa 20-39, 54-73, 86-108, 118-135, 144-166, 170-192, 205-227, 232-254, 261-283 and 293-315
568708015046	50S ribosomal protein L27; Validated; Region: rpmA; PRK05435
568708015048	50S ribosomal protein L21/unknown domain fusion protein; Provisional; Region: PRK12278
568708015049	50S ribosomal protein L21; Validated; Region: rplU; PRK05573
568708015051	Geranylgeranyl pyrophosphate synthase [Coenzyme metabolism]; Region: IspA; COG0142
568708015052	Trans-Isoprenyl Diphosphate Synthases, head-to-tail; Region: Trans_IPPS_HT; cd00685
568708015053	substrate binding pocket [chemical binding]; other site
568708015054	chain length determination region; other site
568708015055	substrate-Mg2+ binding site; other site
568708015056	catalytic residues [active]
568708015057	aspartate-rich region 1; other site
568708015058	active site lid residues [active]
568708015059	aspartate-rich region 2; other site
568708015061	DNA-binding transcriptional regulator Nlp; Provisional; Region: PRK10344
568708015062	UDP-N-acetylglucosamine 1-carboxyvinyltransferase; Region: murA; TIGR01072
568708015063	UDP-N-acetylglucosamine enolpyruvyl transferase catalyzes enolpyruvyl transfer as part of the first step in the biosynthesis of peptidoglycan, a component of the bacterial cell wall. The reaction is phosphoenolpyruvate + UDP-N-acetyl-D-glucosamine =...; Region: UdpNAET; cd01555
568708015064	hinge; other site
568708015065	active site
568708015067	Predicted transcriptional regulator, BolA superfamily [Transcription]; Region: COG5007
568708015069	Sulphate Transporter and Anti-Sigma factor antagonist) domain of anti-anti-sigma factors, key regulators of anti-sigma factors by phosphorylation; Region: STAS_anti-anti-sigma_factors; cd07043
568708015070	anti sigma factor interaction site; other site
568708015071	regulatory phosphorylation site [posttranslational modification]; other site
568708015073	ABC transporter periplasmic binding protein MlaC; Provisional; Region: PRK15117
568708015075	Signal peptide predicted for STM_MW33091 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.861 between residues 21 and 22
568708015076	ABC-type transport system involved in resistance to organic solvents, periplasmic component [Secondary metabolites biosynthesis, transport, and catabolism]; Region: Ttg2C; COG1463
568708015077	mce related protein; Region: MCE; pfam02470
568708015079	1 probable transmembrane helix predicted for STM_MW33101 by TMHMM2.0 at aa 9-31
568708015080	Signal peptide predicted for STM_MW33101 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.870 between residues 28 and 29
568708015081	ABC-type transport system involved in resistance to organic solvents, permease component [Secondary metabolites biosynthesis, transport, and catabolism]; Region: Ttg2B; COG0767
568708015082	conserved hypothetical integral membrane protein; Region: TIGR00056
568708015083	5 probable transmembrane helices predicted for STM_MW33111 by TMHMM2.0 at aa 48-70, 85-107, 148-170, 197-219 and 239-258
568708015085	putative ABC transporter ATP-binding protein YrbF; Provisional; Region: PRK11831
568708015086	ATP-binding cassette transport system involved in resistant to organic solvents; Region: ABC_Org_Solvent_Resistant; cd03261
568708015087	Walker A/P-loop; other site
568708015088	ATP binding site [chemical binding]; other site
568708015089	Q-loop/lid; other site
568708015090	ABC transporter signature motif; other site
568708015091	Walker B; other site
568708015092	D-loop; other site
568708015093	H-loop/switch region; other site
568708015095	putative calcium/sodium:proton antiporter; Provisional; Region: PRK10734
568708015096	Sodium/calcium exchanger protein; Region: Na_Ca_ex; pfam01699
568708015097	Sodium/calcium exchanger protein; Region: Na_Ca_ex; pfam01699
568708015099	9 probable transmembrane helices predicted for STM_MW33131 by TMHMM2.0 at aa 13-35, 55-77, 86-105, 115-137, 158-180, 190-212, 225-247, 257-276 and 283-305
568708015100	D-arabinose 5-phosphate isomerase; Provisional; Region: PRK10892
568708015101	KpsF-like protein. KpsF is an arabinose-5-phosphate isomerase which contains SIS (Sugar ISomerase) domains. SIS domains are found in many phosphosugar isomerases and phosphosugar binding proteins. KpsF catalyzes the reversible reaction of ribulose...; Region: SIS_Kpsf; cd05014
568708015102	putative active site [active]
568708015103	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains associated with KpsF/GutQ domains in the API [A5P (D-arabinose 5-phosphate) isomerase] protein.  These APIs catalyze the conversion of the pentose pathway...; Region: CBS_pair_KpsF_GutQ_assoc; cd04604
568708015106	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase; Provisional; Region: PRK09484
568708015107	HAD-superfamily hydrolase, subfamily IIIA; Region: HAD-SF-IIIA; TIGR01662
568708015109	lipopolysaccharide exporter periplasmic protein; Provisional; Region: PRK10893
568708015110	Lipopolysaccharide-assembly, LptC-related; Region: LptC; pfam06835
568708015111	Signal peptide predicted for STM_MW33161 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.708 between residues 25 and 26
568708015112	1 probable transmembrane helix predicted for STM_MW33161 by TMHMM2.0 at aa 7-25
568708015114	lipopolysaccharide transport periplasmic protein LptA; Provisional; Region: PRK10894
568708015115	lipopolysaccharide transport periplasmic protein LptA; Region: outer_YhbN_LptA; TIGR03002
568708015116	Signal peptide predicted for STM_MW33171 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.984 between residues 27 and 28
568708015118	lipopolysaccharide ABC transporter ATP-binding protein; Provisional; Region: PRK10895
568708015119	ATP-binding cassette component of YhbG transport system; Region: ABC_YhbG; cd03218
568708015120	Walker A/P-loop; other site
568708015121	ATP binding site [chemical binding]; other site
568708015122	Q-loop/lid; other site
568708015123	ABC transporter signature motif; other site
568708015124	Walker B; other site
568708015125	D-loop; other site
568708015126	H-loop/switch region; other site
568708015128	RNA polymerase factor sigma-54; Reviewed; Region: PRK05932
568708015129	Sigma-54 factor, Activator interacting domain (AID); Region: Sigma54_AID; pfam00309
568708015130	Sigma-54 factor, core binding domain; Region: Sigma54_CBD; pfam04963
568708015131	Sigma-54, DNA binding domain; Region: Sigma54_DBD; pfam04552
568708015135	RaiA ("ribosome-associated inhibitor A", also known as Protein Y (PY), YfiA, and SpotY,  is a stress-response protein that binds the ribosomal subunit interface and arrests translation by interfering with aminoacyl-tRNA binding to the ribosomal...; Region: RaiA; cd00552
568708015136	30S subunit binding site; other site
568708015138	PTS_IIA, PTS system, fructose/mannitol specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This...; Region: PTS_IIA_fru; cd00211
568708015139	active site
568708015140	phosphorylation site [posttranslational modification]
568708015142	P-loop ATPase protein family; Region: ATP_bind_2; cl15794
568708015144	Histidine-containing phosphocarrier protein (HPr)-like proteins. HPr is a central component of the bacterial phosphoenolpyruvate sugar phosphotransferase system (PTS). The PTS catalyses the phosphorylation of sugar substrates during their translocation...; Region: PTS-HPr_like; cd00367
568708015145	dimerization domain swap beta strand [polypeptide binding]; other site
568708015146	regulatory protein interface [polypeptide binding]; other site
568708015147	active site
568708015148	regulatory phosphorylation site [posttranslational modification]; other site
568708015150	hypothetical protein; Provisional; Region: PRK10345
568708015152	monofunctional biosynthetic peptidoglycan transglycosylase; Provisional; Region: mtgA; PRK00056
568708015153	Transglycosylase; Region: Transgly; cl17702
568708015155	Signal peptide predicted for STM_MW33251 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.755 between residues 46 and 47
568708015156	1 probable transmembrane helix predicted for STM_MW33251 by TMHMM2.0 at aa 19-41
568708015157	isoprenoid biosynthesis protein with amidotransferase-like domain; Provisional; Region: PRK11780
568708015158	Type 1 glutamine amidotransferase (GATase1)-like domain found in zebrafish ES1; Region: GATase1_ES1; cd03133
568708015159	conserved cys residue [active]
568708015161	aerobic respiration control sensor protein ArcB; Provisional; Region: PRK11091
568708015162	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
568708015163	putative active site [active]
568708015164	heme pocket [chemical binding]; other site
568708015165	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
568708015166	dimer interface [polypeptide binding]; other site
568708015167	phosphorylation site [posttranslational modification]
568708015168	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708015169	ATP binding site [chemical binding]; other site
568708015170	Mg2+ binding site [ion binding]; other site
568708015171	G-X-G motif; other site
568708015172	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708015173	active site
568708015174	phosphorylation site [posttranslational modification]
568708015175	intermolecular recognition site; other site
568708015176	dimerization interface [polypeptide binding]; other site
568708015177	Histidine Phosphotransfer domain, involved in signalling through a two part component systems in which an autophosphorylating histidine protein kinase serves as a phosphoryl donor to a response regulator protein; the response regulator protein is...; Region: HPT; cd00088
568708015178	putative binding surface; other site
568708015179	active site
568708015185	2 probable transmembrane helices predicted for STM_MW33271 by TMHMM2.0 at aa 20-42 and 55-77
568708015186	Signal peptide predicted for STM_MW33271 by SignalP 2.0 HMM (Signal peptide probability 0.907) with cleavage site probability 0.597 between residues 41 and 42
568708015187	radical SAM protein, TIGR01212 family; Region: TIGR01212
568708015188	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
568708015189	FeS/SAM binding site; other site
568708015191	glutamate synthase subunit alpha; Provisional; Region: gltB; PRK11750
568708015192	Glutamine amidotransferases class-II (Gn-AT), glutamate synthase (GltS)-type. GltS is a homodimer that synthesizes L-glutamate from 2-oxoglutarate and L-glutamine, an important step in ammonia assimilation in bacteria, cyanobacteria and plants. The...; Region: GltS; cd00713
568708015193	active site
568708015194	dimer interface [polypeptide binding]; other site
568708015195	Glutamate synthase central domain; Region: Glu_syn_central; pfam04898
568708015196	Glutamate synthase (GltS) FMN-binding domain.  GltS is a complex iron-sulfur flavoprotein that catalyzes the reductive synthesis of L-glutamate from 2-oxoglutarate and L-glutamine via intramolecular channelling of ammonia, a reaction in the plant, yeast...; Region: GltS_FMN; cd02808
568708015197	active site
568708015198	FMN binding site [chemical binding]; other site
568708015199	substrate binding site [chemical binding]; other site
568708015200	3Fe-4S cluster binding site [ion binding]; other site
568708015201	gltb_C. This domain is found at the C-terminus of the large subunit (gltB) of glutamate synthase (GltS). GltS encodes a complex iron-sulfur flavoprotein that catalyzes the synthesis of L-glutamate from L-glutamine and 2-oxoglutarate. It requires the...; Region: gltB_C; cd00982
568708015202	domain interface; other site
568708015207	glutamate synthase small subunit family protein, proteobacterial; Region: gltD_gamma_fam; TIGR01318
568708015208	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
568708015209	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
568708015212	Protein of unknown function (DUF1016); Region: DUF1016; pfam06250
568708015213	Predicted nuclease of restriction endonuclease-like fold [General    function prediction only]; Region: COG4804
568708015215	nucleobase-cation-symport-1 (NCS1) transporter CobB-like; solute-binding domain; Region: SLC-NCS1sbd_CobB-like; cd11484
568708015216	Permease for cytosine/purines, uracil, thiamine, allantoin; Region: Transp_cyt_pur; pfam02133
568708015217	Na binding site [ion binding]; other site
568708015218	putative substrate binding site [chemical binding]; other site
568708015220	12 probable transmembrane helices predicted for STM_MW33321 by TMHMM2.0 at aa 21-43, 53-75, 96-118, 128-150, 152-174, 189-211, 223-245, 255-277, 296-318, 323-345, 358-375 and 380-402
568708015221	cytosine deaminase; Provisional; Region: PRK09230
568708015222	Bacterial cytosine deaminase and related metal-dependent hydrolases. Cytosine deaminases (CDs) catalyze the deamination of cytosine, producing uracil and ammonia. They play an important role in pyrimidine salvage. CDs are present in prokaryotes and fungi; Region: Bact_CD; cd01293
568708015223	active site
568708015225	Beta-galactosidase, beta subunit [Carbohydrate transport and metabolism]; Region: EbgC; COG2731
568708015227	N-acetylmannosamine kinase; Provisional; Region: PRK05082
568708015228	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cd00012
568708015229	nucleotide binding site [chemical binding]; other site
568708015231	Putative N-acetylmannosamine-6-phosphate epimerase [Carbohydrate transport and metabolism]; Region: NanE; COG3010
568708015232	N-acetylmannosamine-6-phosphate epimerase (NanE) converts N-acetylmannosamine-6-phosphate to N-acetylglucosamine-6-phosphate. This reaction is part of the pathway that allows the usage of sialic acid as a carbohydrate source. Sialic acids are a family of...; Region: NanE; cd04729
568708015233	putative active site cavity [active]
568708015235	putative sialic acid transporter; Provisional; Region: PRK03893
568708015236	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708015237	putative substrate translocation pore; other site
568708015239	14 probable transmembrane helices predicted for STM_MW33371 by TMHMM2.0 at aa 20-42, 57-79, 86-108, 112-134, 147-166, 171-190, 224-243, 248-267, 280-302, 312-334, 347-369, 373-395, 404-426 and 431-453
568708015240	N-acetylneuraminate lyase; Provisional; Region: PRK04147
568708015241	N-Acetylneuraminic acid aldolase, also called N-acetylneuraminate lyase (NAL); Region: NAL; cd00954
568708015242	inhibitor site; inhibition site
568708015243	active site
568708015244	dimer interface [polypeptide binding]; other site
568708015245	catalytic residue [active]
568708015247	transcriptional regulator NanR; Provisional; Region: PRK03837
568708015248	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
568708015249	DNA-binding site [nucleotide binding]; DNA binding site
568708015250	FCD domain; Region: FCD; pfam07729
568708015253	Stringent starvation protein B [General function prediction only]; Region: SspB; COG2969
568708015255	stringent starvation protein A; Provisional; Region: sspA; PRK09481
568708015256	GST_N family, Stringent starvation protein A (SspA) subfamily; SspA is a RNA polymerase (RNAP)-associated protein required for the lytic development of phage P1 and for stationary phase-induced acid tolerance of E. coli. It is implicated in survival...; Region: GST_N_SspA; cd03059
568708015257	C-terminal domain interface [polypeptide binding]; other site
568708015258	putative GSH binding site (G-site) [chemical binding]; other site
568708015259	dimer interface [polypeptide binding]; other site
568708015260	C-terminal, alpha helical domain of Stringent starvation protein A; Region: GST_C_SspA; cd03186
568708015261	dimer interface [polypeptide binding]; other site
568708015262	N-terminal domain interface [polypeptide binding]; other site
568708015265	Family of unknown function (DUF695); Region: DUF695; pfam05117
568708015266	Protein of unknown function (DUF1260); Region: DUF1260; pfam06877
568708015269	30S ribosomal protein S9; Reviewed; Region: rpsI; PRK00132
568708015271	Ribosomal protein L13.  Protein L13, a large ribosomal subunit protein, is one of five proteins required for an early folding intermediate of 23S rRNA in the assembly of the large subunit. L13 is situated on the bottom of the large subunit, near the...; Region: Ribosomal_L13; cd00392
568708015272	23S rRNA interface [nucleotide binding]; other site
568708015273	L3 interface [polypeptide binding]; other site
568708015275	Predicted ATPase [General function prediction only]; Region: COG1485
568708015277	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3105
568708015278	hypothetical protein; Provisional; Region: PRK11677
568708015279	1 probable transmembrane helix predicted for STM_MW33461 by TMHMM2.0 at aa 4-26
568708015281	serine endoprotease; Provisional; Region: PRK10139
568708015282	Trypsin-like peptidase domain; Region: Trypsin_2; pfam13365
568708015283	PDZ domain of tryspin-like serine proteases, such as DegP/HtrA, which are oligomeric proteins involved in heat-shock response, chaperone function, and apoptosis. May be responsible for substrate recognition and/or binding, as most PDZ domains bind...; Region: PDZ_serine_protease; cd00987
568708015284	protein binding site [polypeptide binding]; other site
568708015285	PDZ domain of tryspin-like serine proteases, such as DegP/HtrA, which are oligomeric proteins involved in heat-shock response, chaperone function, and apoptosis. May be responsible for substrate recognition and/or binding, as most PDZ domains bind...; Region: PDZ_serine_protease; cd00987
568708015286	Signal peptide predicted for STM_MW33471 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 27 and 28
568708015287	1 probable transmembrane helix predicted for STM_MW33471 by TMHMM2.0 at aa 7-29
568708015290	serine endoprotease; Provisional; Region: PRK10898
568708015291	Trypsin-like peptidase domain; Region: Trypsin_2; pfam13365
568708015292	PDZ domain of tryspin-like serine proteases, such as DegP/HtrA, which are oligomeric proteins involved in heat-shock response, chaperone function, and apoptosis. May be responsible for substrate recognition and/or binding, as most PDZ domains bind...; Region: PDZ_serine_protease; cd00987
568708015293	Signal peptide predicted for STM_MW33481 by SignalP 2.0 HMM (Signal peptide probability 0.600) with cleavage site probability 0.341 between residues 21 and 22
568708015294	1 probable transmembrane helix predicted for STM_MW33481 by TMHMM2.0 at aa 5-27
568708015297	Triphosphoribosyl-dephospho-CoA synthetase [Coenzyme metabolism]; Region: CitG; COG1767
568708015299	oxaloacetate decarboxylase subunit beta; Provisional; Region: PRK15476
568708015300	9 probable transmembrane helices predicted for STM_MW33501 by TMHMM2.0 at aa 13-35, 122-144, 159-178, 180-202, 222-244, 266-288, 308-327, 339-361 and 413-432
568708015302	oxaloacetate decarboxylase; Provisional; Region: PRK14040
568708015303	Pyruvate carboxylase and Transcarboxylase 5S, carboxyltransferase domain; Region: DRE_TIM_PC_TC_5S; cd07937
568708015304	active site
568708015305	catalytic residues [active]
568708015306	metal binding site [ion binding]; metal-binding site
568708015307	homodimer binding site [polypeptide binding]; other site
568708015308	The biotinyl-domain or biotin carboxyl carrier protein (BCCP) domain is present in all biotin-dependent enzymes, such as acetyl-CoA carboxylase, pyruvate carboxylase, propionyl-CoA carboxylase, methylcrotonyl-CoA carboxylase, geranyl-CoA carboxylase; Region: biotinyl_domain; cd06850
568708015309	carboxyltransferase (CT) interaction site; other site
568708015310	biotinylation site [posttranslational modification]; other site
568708015314	L(+)-tartrate dehydratase subunit beta; Validated; Region: PRK08228
568708015316	pfam_scan;Pfam:PF05681; E()=4.0E-78;score=261.8;query 10-281;description=Fumerase
568708015318	Na+/H+ antiporter NhaD and related arsenite permeases [Inorganic ion transport and metabolism]; Region: ArsB; COG1055
568708015319	Permease SLC13 (solute carrier 13).  The sodium/dicarboxylate cotransporter NaDC-1 has been shown to translocate Krebs cycle intermediates such as succinate, citrate, and alpha-ketoglutarate across plasma membranes rabbit, human, and rat kidney. It is...; Region: SLC13_permease; cd01115
568708015320	transmembrane helices; other site
568708015321	11 probable transmembrane helices predicted for STM_MW33541 by TMHMM2.0 at aa 4-20, 25-44, 49-71, 92-121, 136-158, 171-193, 244-266, 279-301, 316-338, 359-378 and 398-420
568708015323	Transcriptional regulators [Transcription]; Region: GntR; COG1802
568708015324	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
568708015325	DNA-binding site [nucleotide binding]; DNA binding site
568708015326	FCD domain; Region: FCD; pfam07729
568708015329	Transcriptional regulators [Transcription]; Region: GntR; COG1802
568708015330	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
568708015331	DNA-binding site [nucleotide binding]; DNA binding site
568708015334	malate dehydrogenase; Provisional; Region: PRK05086
568708015335	Glyoxysomal and mitochondrial malate dehydrogenases; Region: MDH_glyoxysomal_mitochondrial; cd01337
568708015336	NAD binding site [chemical binding]; other site
568708015337	dimerization interface [polypeptide binding]; other site
568708015338	Substrate binding site [chemical binding]; other site
568708015341	arginine repressor; Provisional; Region: PRK05066
568708015342	Arginine repressor, DNA binding domain; Region: Arg_repressor; pfam01316
568708015343	Arginine repressor, C-terminal domain; Region: Arg_repressor_C; pfam02863
568708015346	Protein of unknown function (DUF1471); Region: DUF1471; pfam07338
568708015347	Signal peptide predicted for STM_MW33591 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 22 and 23
568708015349	Protein of unknown function (DUF1471); Region: DUF1471; pfam07338
568708015350	Signal peptide predicted for STM_MW33601 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.961 between residues 22 and 23
568708015351	1 probable transmembrane helix predicted for STM_MW33601 by TMHMM2.0 at aa 5-24
568708015353	Barstar is an intracellular inhibitor of barnase, an extracellular ribonuclease of Bacillus amyloliquefaciens. Barstar binds tightly to the barnase active site and sterically blocks it thus inhibiting its potentially lethal RNase activity inside the cell; Region: Barstar; cd05142
568708015354	RNAase interaction site [polypeptide binding]; other site
568708015356	p-hydroxybenzoic acid efflux subunit AaeB; Provisional; Region: PRK10631
568708015357	Fusaric acid resistance protein-like; Region: FUSC_2; pfam13515
568708015359	10 probable transmembrane helices predicted for STM_MW33621 by TMHMM2.0 at aa 13-33, 38-60, 67-89, 93-112, 119-136, 151-168, 370-392, 407-426, 433-452 and 481-503
568708015360	p-hydroxybenzoic acid efflux subunit AaeA; Provisional; Region: PRK10559
568708015361	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
568708015362	HlyD family secretion protein; Region: HlyD_3; pfam13437
568708015364	1 probable transmembrane helix predicted for STM_MW33631 by TMHMM2.0 at aa 12-31
568708015365	Signal peptide predicted for STM_MW33631 by SignalP 2.0 HMM (Signal peptide probability 0.989) with cleavage site probability 0.885 between residues 30 and 31
568708015366	efflux system membrane protein; Provisional; Region: PRK11594
568708015367	2 probable transmembrane helices predicted for STM_MW33641 by TMHMM2.0 at aa 7-29 and 44-66
568708015369	transcriptional regulator; Provisional; Region: PRK10632
568708015370	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708015371	The C-terminal substrate binding domain of LysR-type transcriptional regulator CrgA and its related homologs, contains the type 2 periplasmic binding domain; Region: PBP2_CrgA_like; cd08422
568708015372	putative effector binding pocket; other site
568708015373	dimerization interface [polypeptide binding]; other site
568708015376	protease TldD; Provisional; Region: tldD; PRK10735
568708015378	hypothetical protein; Provisional; Region: PRK10899
568708015379	AsmA-like C-terminal region; Region: AsmA_2; pfam13502
568708015380	ribonuclease G; Provisional; Region: PRK11712
568708015381	S1_RNase_E: RNase E and RNase G, S1-like RNA-binding domain. RNase E is an essential endoribonuclease in the processing and degradation of RNA. In addition to its role in mRNA degradation, RNase E has also been implicated in the processing of rRNA, and...; Region: S1_RNase_E; cd04453
568708015382	homodimer interface [polypeptide binding]; other site
568708015383	oligonucleotide binding site [chemical binding]; other site
568708015386	Maf-like protein; Region: Maf; pfam02545
568708015387	Nucleotide binding protein Maf. Maf has been implicated in inhibition of septum formation in eukaryotes, bacteria and archaea, but homologs in B.subtilis and S.cerevisiae are nonessential for cell division. Maf has been predicted to be a nucleotide- or...; Region: Maf; cd00555
568708015388	active site
568708015389	dimer interface [polypeptide binding]; other site
568708015391	rod shape-determining protein MreD; Provisional; Region: PRK11060
568708015393	5 probable transmembrane helices predicted for STM_MW33701 by TMHMM2.0 at aa 11-28, 32-51, 58-80, 100-122 and 135-152
568708015394	rod shape-determining protein MreC; Region: mreC; TIGR00219
568708015395	rod shape-determining protein MreC; Region: MreC; pfam04085
568708015397	1 probable transmembrane helix predicted for STM_MW33711 by TMHMM2.0 at aa 13-35
568708015398	rod shape-determining protein MreB; Provisional; Region: PRK13927
568708015399	MreB and similar proteins; Region: MreB_like; cd10225
568708015400	nucleotide binding site [chemical binding]; other site
568708015401	Mg binding site [ion binding]; other site
568708015402	putative protofilament interaction site [polypeptide binding]; other site
568708015403	RodZ interaction site [polypeptide binding]; other site
568708015405	regulatory protein CsrD; Provisional; Region: PRK11059
568708015406	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
568708015407	metal binding site [ion binding]; metal-binding site
568708015408	active site
568708015409	I-site; other site
568708015410	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
568708015413	2 probable transmembrane helices predicted for STM_MW33731 by TMHMM2.0 at aa 10-32 and 130-152
568708015414	Signal peptide predicted for STM_MW33731 by SignalP 2.0 HMM (Signal peptide probability 0.951) with cleavage site probability 0.693 between residues 33 and 34
568708015415	Yhdh putative quinone oxidoreductases; Region: MDR_yhdh; cd08288
568708015416	putative quinone oxidoreductase, YhdH/YhfP family; Region: oxido_YhdH; TIGR02823
568708015417	NADP binding site [chemical binding]; other site
568708015418	dimer interface [polypeptide binding]; other site
568708015421	TMAO/DMSO reductase; Reviewed; Region: PRK05363
568708015422	YedY_like molybdopterin cofactor (Moco) binding domain, a subgroup of the sulfite oxidase (SO) family of molybdopterin binding domains. Escherichia coli YedY has been propsed to form a heterodimer, consisting of a soluble catalytic subunit termed YedY; Region: YedY_like_Moco; cd02107
568708015423	Moco binding site; other site
568708015424	metal coordination site [ion binding]; other site
568708015426	putative sulfite oxidase subunit YedZ; Reviewed; Region: PRK05419
568708015427	6 probable transmembrane helices predicted for STM_MW33761 by TMHMM2.0 at aa 13-30, 45-67, 80-102, 117-139, 151-168 and 172-189
568708015429	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit; Validated; Region: PRK06302
568708015430	The biotinyl-domain or biotin carboxyl carrier protein (BCCP) domain is present in all biotin-dependent enzymes, such as acetyl-CoA carboxylase, pyruvate carboxylase, propionyl-CoA carboxylase, methylcrotonyl-CoA carboxylase, geranyl-CoA carboxylase; Region: biotinyl_domain; cd06850
568708015431	carboxyltransferase (CT) interaction site; other site
568708015432	biotinylation site [posttranslational modification]; other site
568708015434	acetyl-CoA carboxylase biotin carboxylase subunit; Validated; Region: PRK08591
568708015435	Carbamoyl-phosphate synthase L chain, N-terminal domain; Region: CPSase_L_chain; pfam00289
568708015436	Carbamoyl-phosphate synthase L chain, ATP binding domain; Region: CPSase_L_D2; pfam02786
568708015437	Biotin carboxylase C-terminal domain; Region: Biotin_carb_C; smart00878
568708015441	hypothetical protein; Provisional; Region: PRK10633
568708015443	2 probable transmembrane helices predicted for STM_MW33791 by TMHMM2.0 at aa 13-32 and 42-64
568708015444	Na(+)/pantothenate cotransporters: PanF of Escherichia coli and related proteins; solute binding domain; Region: SLC5sbd_PanF; cd10327
568708015445	Na binding site [ion binding]; other site
568708015446	13 probable transmembrane helices predicted for STM_MW33801 by TMHMM2.0 at aa 5-24, 37-59, 72-94, 123-145, 160-182, 189-211, 233-255, 268-290, 319-341, 369-386, 391-413, 420-442 and 447-466
568708015448	ribosomal protein L11 methyltransferase; Region: prmA; TIGR00406
568708015449	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cl17173
568708015451	tRNA-dihydrouridine synthase B; Provisional; Region: PRK10415
568708015452	Dihydrouridine synthase-like (DUS-like) FMN-binding domain. Members of this family catalyze the reduction of the 5,6-double bond of a uridine residue on tRNA. Dihydrouridine modification of tRNA is widely observed in prokaryotes and eukaryotes, and also...; Region: DUS_like_FMN; cd02801
568708015453	FMN binding site [chemical binding]; other site
568708015454	active site
568708015455	catalytic residues [active]
568708015456	substrate binding site [chemical binding]; other site
568708015458	Factor for inversion stimulation Fis, transcriptional activator [Transcription / DNA replication, recombination, and repair]; Region: Fis; COG2901
568708015459	global DNA-binding transcriptional dual regulator Fis; Provisional; Region: fis; PRK00430
568708015461	DNA modification methylase [DNA replication, recombination, and repair]; Region: COG0863
568708015462	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708015463	DNA methylase; Region: N6_N4_Mtase; pfam01555
568708015465	Protein of unknown function (DUF2556); Region: DUF2556; pfam10831
568708015467	1 probable transmembrane helix predicted for STM_MW33851 by TMHMM2.0 at aa 7-29
568708015468	MHYT domain (predicted integral membrane sensor domain) [Signal transduction mechanisms]; Region: COG3300
568708015469	Bacterial signalling protein N terminal repeat; Region: MHYT; pfam03707
568708015470	Bacterial signalling protein N terminal repeat; Region: MHYT; pfam03707
568708015471	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
568708015472	metal binding site [ion binding]; metal-binding site
568708015473	active site
568708015474	I-site; other site
568708015475	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
568708015476	7 probable transmembrane helices predicted for STM_MW33861 by TMHMM2.0 at aa 10-27, 40-62, 77-99, 112-134, 139-161, 174-193 and 213-235
568708015480	DNA-binding transcriptional regulator EnvR; Provisional; Region: PRK09975
568708015481	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
568708015482	MAATS-type transcriptional repressor, C-terminal region; Region: TetR_C_2; pfam08361
568708015485	multidrug efflux system transporter AcrA; Provisional; Region: PRK15030
568708015486	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
568708015487	HlyD family secretion protein; Region: HlyD_3; pfam13437
568708015488	Signal peptide predicted for STM_MW33891 by SignalP 2.0 HMM (Signal peptide probability 0.989) with cleavage site probability 0.671 between residues 22 and 23
568708015490	multidrug efflux system protein AcrB; Provisional; Region: PRK15127
568708015491	Signal peptide predicted for STM_MW33901 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.692 between residues 26 and 27
568708015493	12 probable transmembrane helices predicted for STM_MW33901 by TMHMM2.0 at aa 9-31, 337-359, 366-388, 392-414, 438-460, 470-492, 541-563, 872-891, 898-920, 925-947, 974-996 and 1006-1028
568708015494	Prokaryotic membrane lipoprotein lipid attachment site; Region: LPAM_1; pfam08139
568708015495	Signal peptide predicted for STM_MW33911 by SignalP 2.0 HMM (Signal peptide probability 0.904) with cleavage site probability 0.903 between residues 18 and 19
568708015497	1 probable transmembrane helix predicted for STM_MW33911 by TMHMM2.0 at aa 50-72
568708015498	Carbonic anhydrases/acetyltransferases, isoleucine patch superfamily [General function prediction only]; Region: PaaY; COG0663
568708015499	Gamma carbonic anhydrase-like: This family is composed of gamma carbonic anhydrase (CA), Ferripyochelin Binding Protein (FBP), E. coli paaY protein, and similar proteins. CAs are zinc-containing enzymes that catalyze the reversible hydration of carbon...; Region: LbH_gamma_CA_like; cd04645
568708015500	trimer interface [polypeptide binding]; other site
568708015501	putative metal binding site [ion binding]; other site
568708015502	Protein of unknown function (DUF1488); Region: DUF1488; pfam07369
568708015504	shikimate 5-dehydrogenase; Reviewed; Region: aroE; PRK00258
568708015505	Shikimate dehydrogenase substrate binding domain; Region: Shikimate_dh_N; pfam08501
568708015506	NAD(P) binding domain of Shikimate dehydrogenase; Region: NAD_bind_Shikimate_DH; cd01065
568708015507	shikimate binding site; other site
568708015508	NAD(P) binding site [chemical binding]; other site
568708015511	tRNA(ANN) t(6)A37 threonylcarbamoyladenosine modification protein; Provisional; Region: PRK10634
568708015513	Topoisomerase DNA binding C4 zinc finger; Region: zf-C4_Topoisom; pfam01396
568708015514	Zn-finger domain associated with topoisomerase type I [DNA replication, recombination, and repair]; Region: TopA; COG0551
568708015515	Topoisomerase DNA binding C4 zinc finger; Region: zf-C4_Topoisom; pfam01396
568708015516	Topoisomerase DNA binding C4 zinc finger; Region: zf-C4_Topoisom; pfam01396
568708015518	hypothetical protein; Validated; Region: PRK03430
568708015520	hypothetical protein; Provisional; Region: PRK10736
568708015521	DNA protecting protein DprA; Region: dprA; TIGR00732
568708015523	Polypeptide or peptide deformylase; a family of metalloenzymes that catalyzes the removal of the N-terminal formyl group in a growing polypeptide chain following translation initiation during protein synthesis in prokaryotes. These enzymes utilize Fe(II)...; Region: Pep_deformylase; cd00487
568708015524	active site
568708015525	catalytic residues [active]
568708015526	metal binding site [ion binding]; metal-binding site
568708015528	methionyl-tRNA formyltransferase; Reviewed; Region: fmt; PRK00005
568708015529	Methionyl-tRNA formyltransferase, N-terminal hydrolase domain; Region: FMT_core_Met-tRNA-FMT_N; cd08646
568708015530	putative active site [active]
568708015531	substrate binding site [chemical binding]; other site
568708015532	putative cosubstrate binding site; other site
568708015533	catalytic site [active]
568708015534	C-terminal domain of Formyltransferase and other enzymes; Region: Met_tRNA_FMT_C; cd08704
568708015535	substrate binding site [chemical binding]; other site
568708015538	N-terminal RNA binding domain of the methyltransferase Sun. The rRNA-specific 5-methylcytidine transferase Sun, also known as RrmB or Fmu shares the RNA-binding non-catalytic domain with the transcription termination factor NusB. The precise biological...; Region: Methyltransferase_Sun; cd00620
568708015539	putative RNA binding site [nucleotide binding]; other site
568708015540	16S rRNA methyltransferase B; Provisional; Region: PRK10901
568708015541	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708015542	S-adenosylmethionine binding site [chemical binding]; other site
568708015545	potassium transporter peripheral membrane component; Reviewed; Region: trkA; PRK09496
568708015546	TrkA-N domain; Region: TrkA_N; pfam02254
568708015547	TrkA-C domain; Region: TrkA_C; pfam02080
568708015548	TrkA-N domain; Region: TrkA_N; pfam02254
568708015549	TrkA-C domain; Region: TrkA_C; pfam02080
568708015552	Large-conductance mechanosensitive channel [Cell envelope biogenesis, outer membrane]; Region: MscL; COG1970
568708015553	large-conductance mechanosensitive channel; Reviewed; Region: mscL; PRK00567
568708015555	2 probable transmembrane helices predicted for STM_MW34031 by TMHMM2.0 at aa 20-42 and 77-99
568708015556	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3036
568708015558	zinc-responsive transcriptional regulator; Provisional; Region: zntR; PRK09514
568708015559	Helix-Turn-Helix DNA binding domain of Heavy Metal Resistance transcription regulators; Region: HTH_HMRTR; cd04770
568708015560	DNA binding residues [nucleotide binding]
568708015561	dimer interface [polypeptide binding]; other site
568708015562	metal binding site [ion binding]; metal-binding site
568708015565	hypothetical protein; Provisional; Region: PRK10203
568708015567	50S ribosomal protein L17; Validated; Region: rplQ; PRK05591
568708015569	DNA-directed RNA polymerase subunit alpha; Provisional; Region: PRK05182
568708015570	N-terminal domain of the Alpha subunit of Bacterial RNA polymerase; Region: RNAP_alpha_NTD; cd06928
568708015571	alphaNTD homodimer interface [polypeptide binding]; other site
568708015572	alphaNTD - beta interaction site [polypeptide binding]; other site
568708015573	alphaNTD - beta' interaction site [polypeptide binding]; other site
568708015574	Bacterial RNA polymerase, alpha chain C terminal domain; Region: RNA_pol_A_CTD; pfam03118
568708015578	30S ribosomal protein S4; Validated; Region: rpsD; PRK05327
568708015579	Ribosomal protein S4/S9 N-terminal domain; Region: Ribosomal_S4; pfam00163
568708015580	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
568708015581	RNA binding surface [nucleotide binding]; other site
568708015584	30S ribosomal protein S11; Validated; Region: PRK05309
568708015586	30S ribosomal protein S13; Validated; Region: rpsM; PRK05179
568708015587	30S ribosomal protein S13; Region: bact_S13; TIGR03631
568708015589	Ribosomal protein L36; Region: Ribosomal_L36; pfam00444
568708015591	preprotein translocase subunit SecY; Reviewed; Region: secY; PRK09204
568708015592	SecY translocase; Region: SecY; pfam00344
568708015593	10 probable transmembrane helices predicted for STM_MW34131 by TMHMM2.0 at aa 22-44, 76-98, 119-138, 153-175, 182-204, 215-237, 274-296, 316-338, 373-392 and 397-414
568708015595	50S ribosomal protein L15; Reviewed; Region: rplO; PRK05592
568708015597	Ribosomal protein L30, which is found in eukaryotes and prokaryotes but not in archaea, is one of the smallest ribosomal proteins with a molecular mass of about 7kDa. L30 binds the 23SrRNA as well as the 5S rRNA and is one of five ribosomal proteins that...; Region: Ribosomal_L30; cd01658
568708015598	23S rRNA binding site [nucleotide binding]; other site
568708015600	30S ribosomal protein S5; Validated; Region: rpsE; PRK00550
568708015601	Ribosomal protein S5, N-terminal domain; Region: Ribosomal_S5; pfam00333
568708015602	Ribosomal protein S5, C-terminal domain; Region: Ribosomal_S5_C; pfam03719
568708015605	Ribosomal L18/L5e:  L18 (L5e) is a ribosomal protein found in the central protuberance (CP) of the large subunit. L18 binds 5S rRNA and induces a conformational change that stimulates the binding of L5 to 5S rRNA. Association of 5S rRNA with 23S rRNA...; Region: Ribosomal_L18_L5e; cd00432
568708015606	23S rRNA interface [nucleotide binding]; other site
568708015607	5S rRNA interface [nucleotide binding]; other site
568708015608	L27 interface [polypeptide binding]; other site
568708015609	L5 interface [polypeptide binding]; other site
568708015611	50S ribosomal protein L6; Validated; Region: rplF; PRK05498
568708015612	Ribosomal protein L6; Region: Ribosomal_L6; pfam00347
568708015613	Ribosomal protein L6; Region: Ribosomal_L6; pfam00347
568708015615	30S ribosomal protein S8; Validated; Region: rpsH; PRK00136
568708015617	30S ribosomal protein S14; Reviewed; Region: rpsN; PRK08881
568708015619	50S ribosomal protein L5; Validated; Region: rplE; PRK00010
568708015620	Ribosomal protein L5; Region: Ribosomal_L5; pfam00281
568708015621	ribosomal L5P family C-terminus; Region: Ribosomal_L5_C; pfam00673
568708015624	50S ribosomal protein L24; Reviewed; Region: rplX; PRK00004
568708015625	KOW motif of Ribosomal Protein L26; Region: KOW_RPL26; cd06089
568708015626	RNA binding site [nucleotide binding]; other site
568708015628	50S ribosomal protein L14; Validated; Region: rplN; PRK05483
568708015630	30S ribosomal protein S17; Reviewed; Region: rpsQ; PRK05610
568708015632	Ribosomal_L16_L10e: L16 is an essential protein in the large ribosomal subunit of bacteria, mitochondria, and chloroplasts. Large subunits that lack L16 are defective in peptidyl transferase activity, peptidyl-tRNA hydrolysis activity, association with...; Region: Ribosomal_L16_L10e; cd01433
568708015633	23S rRNA interface [nucleotide binding]; other site
568708015634	5S rRNA interface [nucleotide binding]; other site
568708015635	putative antibiotic binding site [chemical binding]; other site
568708015636	L25 interface [polypeptide binding]; other site
568708015637	L27 interface [polypeptide binding]; other site
568708015639	30S ribosomal protein S3; Reviewed; Region: rpsC; PRK00310
568708015640	K homology RNA-binding (KH) domain of the prokaryotic 30S small ribosomal subunit protein S3. S3  is part of the head region of the 30S ribosomal subunit and is believed to interact with mRNA as it threads its way from the latch into the channel.  The KH...; Region: 30S_S3_KH; cd02412
568708015641	G-X-X-G motif; other site
568708015642	Ribosomal protein S3, C-terminal domain; Region: Ribosomal_S3_C; pfam00189
568708015646	Ribosomal protein L22/L17e.  L22 (L17 in eukaryotes) is a core protein of the large ribosomal subunit.  It is the only ribosomal protein that interacts with all six domains of 23S rRNA, and is one of the proteins important for directing the proper...; Region: Ribosomal_L22; cd00336
568708015647	protein-rRNA interface [nucleotide binding]; other site
568708015648	putative translocon binding site; other site
568708015650	30S ribosomal protein S19; Reviewed; Region: rpsS; PRK00357
568708015652	50S ribosomal protein L2; Validated; Region: rplB; PRK09374
568708015653	Ribosomal Proteins L2, RNA binding domain; Region: Ribosomal_L2; pfam00181
568708015654	Ribosomal Proteins L2, C-terminal domain; Region: Ribosomal_L2_C; pfam03947
568708015657	50S ribosomal protein L23; Reviewed; Region: rplW; PRK05738
568708015659	50S ribosomal protein L4; Provisional; Region: rplD; PRK05319
568708015661	50S ribosomal protein L3, bacterial; Region: L3_bact; TIGR03625
568708015663	30S ribosomal protein S10; Reviewed; Region: rpsJ; PRK00596
568708015665	Type II secretory pathway, prepilin signal peptidase PulO and related peptidases [Cell motility and secretion / Posttranslational modification, protein turnover, chaperones / Intracellular trafficking and secretion]; Region: PulO; COG1989
568708015666	Type IV leader peptidase family; Region: Peptidase_A24; pfam01478
568708015667	4 probable transmembrane helices predicted for STM_MW34341 by TMHMM2.0 at aa 4-21, 55-74, 101-123 and 130-152
568708015669	Bacterioferritin (cytochrome b1) [Inorganic ion transport and metabolism]; Region: Bfr; COG2193
568708015670	Bacterioferritin, ferritin-like diiron-binding domain; Region: Bacterioferritin; cd00907
568708015671	heme binding site [chemical binding]; other site
568708015672	ferroxidase pore; other site
568708015673	ferroxidase diiron center [ion binding]; other site
568708015675	bacterioferritin-associated ferredoxin; Provisional; Region: PRK10509
568708015677	elongation factor Tu; Reviewed; Region: PRK00049
568708015678	Elongation Factor Tu (EF-Tu) GTP-binding proteins; Region: EF_Tu; cd01884
568708015679	G1 box; other site
568708015680	GEF interaction site [polypeptide binding]; other site
568708015681	GTP/Mg2+ binding site [chemical binding]; other site
568708015682	Switch I region; other site
568708015683	G2 box; other site
568708015684	G3 box; other site
568708015685	Switch II region; other site
568708015686	G4 box; other site
568708015687	G5 box; other site
568708015688	EFTU_II: Elongation factor Tu domain II. Elongation factors Tu (EF-Tu) are three-domain GTPases with an essential function in the elongation phase of mRNA translation. The GTPase center of EF-Tu is in the N-terminal domain (domain I), also known as the...; Region: EFTU_II; cd03697
568708015689	Domain III of elongation factor (EF) Tu. Ef-Tu consists of three structural domains, designated I, II and III. Domain III adopts a beta barrel structure. Domain III is involved in binding to both charged tRNA and binding to elongation factor Ts (EF-Ts); Region: EFTU_III; cd03707
568708015690	Antibiotic Binding Site [chemical binding]; other site
568708015694	elongation factor G; Reviewed; Region: PRK00007
568708015695	Elongation factor G (EF-G) family involved in both the elongation and ribosome recycling phases of protein synthesis; Region: EF-G; cd01886
568708015696	G1 box; other site
568708015697	putative GEF interaction site [polypeptide binding]; other site
568708015698	GTP/Mg2+ binding site [chemical binding]; other site
568708015699	Switch I region; other site
568708015700	G2 box; other site
568708015701	G3 box; other site
568708015702	Switch II region; other site
568708015703	G4 box; other site
568708015704	G5 box; other site
568708015705	EFG_mtEFG_II: this subfamily represents the domain II of elongation factor G (EF-G) in bacteria and, the C-terminus of mitochondrial Elongation factor G1 (mtEFG1) and G2 (mtEFG2)_like proteins found in eukaryotes. During the process of peptide synthesis...; Region: EFG_mtEFG_II; cd04088
568708015706	EFG_mtEFG1_IV: domains similar to domain IV of the bacterial translational elongation factor (EF) EF-G. Included in this group is a domain of mitochondrial Elongation factor G1 (mtEFG1) proteins homologous to domain IV of EF-G. Eukaryotic cells harbor 2...; Region: EFG_mtEFG1_IV; cd01434
568708015707	EFG_mtEFG_C: domains similar to the C-terminal domain of the bacterial translational elongation factor (EF) EF-G.  Included in this group is the C-terminus of mitochondrial Elongation factor G1 (mtEFG1) and G2 (mtEFG2) proteins. Eukaryotic cells harbor 2...; Region: EFG_mtEFG_C; cd03713
568708015712	30S ribosomal protein S7; Validated; Region: PRK05302
568708015714	S12-like family, 30S ribosomal protein S12 subfamily; S12 is located at the interface of the large and small ribosomal subunits of prokaryotes, chloroplasts and mitochondria, where it plays an important role in both tRNA and ribosomal subunit...; Region: Ribosomal_S12; cd03368
568708015715	S17 interaction site [polypeptide binding]; other site
568708015716	S8 interaction site; other site
568708015717	16S rRNA interaction site [nucleotide binding]; other site
568708015718	streptomycin interaction site [chemical binding]; other site
568708015719	23S rRNA interaction site [nucleotide binding]; other site
568708015720	aminoacyl-tRNA interaction site (A-site) [nucleotide binding]; other site
568708015722	sulfur transfer complex subunit TusB; Provisional; Region: PRK13510
568708015724	sulfur relay protein TusC; Validated; Region: PRK00211
568708015726	sulfur transfer complex subunit TusD; Validated; Region: PRK00207
568708015728	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2964
568708015729	YheO-like PAS domain; Region: PAS_6; pfam08348
568708015730	HTH domain; Region: HTH_22; pfam13309
568708015732	FKBP-type peptidyl-prolyl cis-trans isomerase; Provisional; Region: PRK10902
568708015733	Domain amino terminal to FKBP-type peptidyl-prolyl isomerase; Region: FKBP_N; pfam01346
568708015734	FKBP-type peptidyl-prolyl cis-trans isomerase; Region: FKBP_C; pfam00254
568708015737	Signal peptide predicted for STM_MW34451 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.976 between residues 25 and 26
568708015738	phi X174 lysis protein; Provisional; Region: PRK02793
568708015740	FKBP-type peptidyl-prolyl cis-trans isomerase; Provisional; Region: PRK15095
568708015741	FKBP-type peptidyl-prolyl cis-trans isomerase; Region: FKBP_C; pfam00254
568708015743	Predicted nucleic-acid-binding protein containing a Zn-ribbon domain [General function prediction only]; Region: COG3529
568708015745	glutathione-regulated potassium-efflux system protein KefB; Provisional; Region: PRK03659
568708015746	Kef-type K+ transport systems, membrane components [Inorganic ion transport and metabolism]; Region: KefB; COG0475
568708015747	TrkA-N domain; Region: TrkA_N; pfam02254
568708015749	10 probable transmembrane helices predicted for STM_MW34491 by TMHMM2.0 at aa 6-25, 32-51, 56-75, 87-109, 113-135, 148-170, 180-202, 223-245, 265-287 and 294-316
568708015751	Signal peptide predicted for STM_MW34491 by SignalP 2.0 HMM (Signal peptide probability 0.876) with cleavage site probability 0.309 between residues 19 and 20
568708015752	glutathione-regulated potassium-efflux system ancillary protein KefG; Provisional; Region: PRK04930
568708015754	putative ABC transporter ATP-binding protein; Provisional; Region: PRK10636
568708015755	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
568708015756	Walker A/P-loop; other site
568708015757	ATP binding site [chemical binding]; other site
568708015758	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
568708015759	ABC transporter signature motif; other site
568708015760	Walker B; other site
568708015761	D-loop; other site
568708015762	ABC transporter; Region: ABC_tran_2; pfam12848
568708015763	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
568708015765	putative monooxygenase; Provisional; Region: PRK11118
568708015767	putative hydrolase; Provisional; Region: PRK10985
568708015768	SAM (Sterile alpha motif ); Region: SAM_superfamily; cl15755
568708015770	hypothetical protein; Provisional; Region: PRK04966
568708015772	Phosphoribulokinase-like (PRK-like) is a family of proteins similar to phosphoribulokinase (PRK), the enzyme involved in the Benson-Calvin cycle in chloroplasts or photosynthetic prokaryotes. PRK catalyzes the phosphorylation of D-ribulose 5-phosphate to...; Region: PRK_like; cd02029
568708015773	active site
568708015774	Signal peptide predicted for STM_MW34551 by SignalP 2.0 HMM (Signal peptide probability 0.637) with cleavage site probability 0.588 between residues 24 and 25
568708015776	hypothetical protein; Provisional; Region: PRK10738
568708015778	DNA-binding transcriptional dual regulator Crp; Provisional; Region: PRK11753
568708015779	effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038
568708015780	ligand binding site [chemical binding]; other site
568708015781	flexible hinge region; other site
568708015782	helix_turn_helix, cAMP Regulatory protein C-terminus; DNA binding domain of prokaryotic regulatory proteins belonging to the catabolite activator protein family; Region: HTH_CRP; cd00092
568708015783	putative switch regulator; other site
568708015784	non-specific DNA interactions [nucleotide binding]; other site
568708015785	DNA binding site [nucleotide binding]
568708015786	sequence specific DNA binding site [nucleotide binding]; other site
568708015787	putative cAMP binding site [chemical binding]; other site
568708015790	integral membrane protein, YccS/YhfK family; Region: YCCS_YHJK; TIGR01667
568708015791	FUSC-like inner membrane protein yccS; Region: FUSC-like; pfam12805
568708015792	Fusaric acid resistance protein-like; Region: FUSC_2; pfam13515
568708015793	8 probable transmembrane helices predicted for STM_MW34581 by TMHMM2.0 at aa 21-43, 78-100, 107-129, 134-156, 411-433, 437-453, 458-477 and 487-506
568708015794	bifunctional N-succinyldiaminopimelate-aminotransferase/acetylornithine transaminase protein; Reviewed; Region: argD; PRK05093
568708015795	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
568708015796	inhibitor-cofactor binding pocket; inhibition site
568708015797	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708015798	catalytic residue [active]
568708015800	para-aminobenzoate synthase component II; Provisional; Region: PRK08857
568708015801	Type 1 glutamine amidotransferase (GATase1) domain found in Anthranilate synthase; Region: GATase1_Anthranilate_Synthase; cd01743
568708015802	glutamine binding [chemical binding]; other site
568708015803	catalytic triad [active]
568708015805	Protein involved in cell division [Cell division and chromosome partitioning]; Region: Fic; COG2184
568708015806	cell filamentation protein Fic; Provisional; Region: PRK10347
568708015808	hypothetical protein; Provisional; Region: PRK10204
568708015810	peptidyl-prolyl cis-trans isomerase A (rotamase A); Provisional; Region: PRK10903
568708015811	cyclophilin_EcCYP_like: cyclophilin-type A-like peptidylprolyl cis- trans isomerase (PPIase) domain similar to the cytosolic E. coli cyclophilin A and Streptomyces antibioticus SanCyp18. Compared to the archetypal cyclophilin Human cyclophilin A, these...; Region: cyclophilin_EcCYP_like; cd01920
568708015812	substrate binding site [chemical binding]; other site
568708015814	Signal peptide predicted for STM_MW34631 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.985 between residues 24 and 25
568708015815	putative transporter; Provisional; Region: PRK03699
568708015816	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708015817	putative substrate translocation pore; other site
568708015818	Signal peptide predicted for STM_MW34641 by SignalP 2.0 HMM (Signal peptide probability 0.995) with cleavage site probability 0.985 between residues 32 and 33
568708015819	12 probable transmembrane helices predicted for STM_MW34641 by TMHMM2.0 at aa 12-34, 49-66, 78-95, 99-121, 134-156, 161-183, 204-226, 246-268, 273-292, 297-319, 332-354 and 359-381
568708015821	nitrite reductase subunit NirD; Provisional; Region: PRK14989
568708015822	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
568708015823	BFD-like [2Fe-2S] binding domain; Region: Fer2_BFD; pfam04324
568708015824	BFD-like [2Fe-2S] binding domain; Region: Fer2_BFD; pfam04324
568708015825	Nitrite/Sulfite reductase ferredoxin-like half domain; Region: NIR_SIR_ferr; pfam03460
568708015831	Assimilatory nitrite reductase (NirD) family, Rieske domain; Assimilatory nitrate and nitrite reductases convert nitrate through nitrite to ammonium. Members include bacterial and fungal proteins. The bacterial NirD contains a single Rieske domain while...; Region: Rieske_NirD; cd03529
568708015832	nitrite transporter NirC; Provisional; Region: PRK11562
568708015834	6 probable transmembrane helices predicted for STM_MW34671 by TMHMM2.0 at aa 26-48, 58-80, 101-123, 150-172, 184-206 and 226-248
568708015835	siroheme synthase; Provisional; Region: cysG; PRK10637
568708015836	Putative NAD(P)-binding; Region: NAD_binding_7; pfam13241
568708015837	Sirohaem synthase dimerisation region; Region: CysG_dimeriser; pfam10414
568708015838	Uroporphyrin-III C-methyltransferase (S-Adenosyl-L-methionine:uroporphyrinogen III methyltransferase, SUMT); Region: SUMT; cd11642
568708015839	active site
568708015840	SAM binding site [chemical binding]; other site
568708015841	homodimer interface [polypeptide binding]; other site
568708015844	Autotransporter beta-domain; Region: Autotransporter; pfam03797
568708015845	Signal peptide predicted for STM_MW34691 by SignalP 2.0 HMM (Signal peptide probability 0.987) with cleavage site probability 0.960 between residues 27 and 28
568708015846	Transposase IS200 like; Region: Y1_Tnp; pfam01797
568708015848	tryptophanyl-tRNA synthetase II; Reviewed; Region: PRK12282
568708015849	catalytic core domain of tryptophanyl-tRNA synthetase; Region: TrpRS_core; cd00806
568708015850	active site
568708015851	HIGH motif; other site
568708015852	dimer interface [polypeptide binding]; other site
568708015853	KMSKS motif; other site
568708015855	phosphoglycolate phosphatase; Provisional; Region: PRK13222
568708015856	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708015857	motif II; other site
568708015859	Ribulose-5-phosphate 3-epimerase (RPE). This enzyme catalyses the interconversion of D-ribulose 5-phosphate (Ru5P) into D-xylulose 5-phosphate, as part of the Calvin cycle (reductive pentose phosphate pathway) in chloroplasts and in the oxidative pentose...; Region: RPE; cd00429
568708015860	ribulose-phosphate 3-epimerase; Region: rpe; TIGR01163
568708015861	substrate binding site [chemical binding]; other site
568708015862	hexamer interface [polypeptide binding]; other site
568708015863	metal binding site [ion binding]; metal-binding site
568708015865	DNA adenine methylase; Provisional; Region: PRK10904
568708015867	cell division protein DamX; Validated; Region: PRK10905
568708015868	Uncharacterized protein conserved in bacteria [Function unknown]; Region: DamX; COG3266
568708015869	1 probable transmembrane helix predicted for STM_MW34751 by TMHMM2.0 at aa 93-115
568708015871	Dehydroquinate synthase (DHQS) catalyzes the conversion of DAHP to DHQ in shikimate pathway for aromatic compounds synthesis; Region: DHQS; cd08195
568708015872	active site
568708015873	dimer interface [polypeptide binding]; other site
568708015874	metal binding site [ion binding]; metal-binding site
568708015876	shikimate kinase; Reviewed; Region: aroK; PRK00131
568708015877	Shikimate kinase (SK) is the fifth enzyme in the shikimate pathway, a seven-step biosynthetic pathway which converts erythrose-4-phosphate to chorismic acid, found in bacteria, fungi and plants. Chorismic acid is a important intermediate in the synthesis...; Region: SK; cd00464
568708015878	ADP binding site [chemical binding]; other site
568708015879	magnesium binding site [ion binding]; other site
568708015880	putative shikimate binding site; other site
568708015882	outer membrane porin HofQ; Provisional; Region: hofQ; PRK10560
568708015883	Bacterial type II and III secretion system protein; Region: Secretin; pfam00263
568708015887	Protein of unknown function (DUF2531); Region: DUF2531; pfam10748
568708015889	Signal peptide predicted for STM_MW34781 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.903 between residues 18 and 19
568708015890	1 probable transmembrane helix predicted for STM_MW34801 by TMHMM2.0 at aa 15-37
568708015891	Tfp pilus assembly protein PilN [Cell motility and secretion / Intracellular trafficking and secretion]; Region: PilN; COG3166
568708015892	Fimbrial assembly protein (PilN); Region: PilN; pfam05137
568708015894	1 probable transmembrane helix predicted for STM_MW34811 by TMHMM2.0 at aa 21-43
568708015895	Tfp pilus assembly protein, ATPase PilM [Cell motility and secretion / Intracellular trafficking and secretion]; Region: PilM; COG4972
568708015896	penicillin-binding protein 1a; Provisional; Region: mrcA; PRK11636
568708015897	Transglycosylase; Region: Transgly; pfam00912
568708015898	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; cl17760
568708015899	Signal peptide predicted for STM_MW34831 by SignalP 2.0 HMM (Signal peptide probability 0.636) with cleavage site probability 0.493 between residues 32 and 33
568708015900	1 probable transmembrane helix predicted for STM_MW34831 by TMHMM2.0 at aa 12-34
568708015903	adenosine nucleotide hydrolase NudE; Provisional; Region: nudE; PRK11762
568708015904	ADP-ribose pyrophosphatase (ADPRase) catalyzes the hydrolysis of ADP-ribose and a variety of additional ADP-sugar conjugates to AMP and ribose-5-phosphate. Like other members of the Nudix hydrolase superfamily, it requires a divalent cation, such as Mg2+; Region: ADPRase_NUDT5; cd03424
568708015905	ADP-ribose binding site [chemical binding]; other site
568708015906	dimer interface [polypeptide binding]; other site
568708015907	active site
568708015908	nudix motif; other site
568708015909	metal binding site [ion binding]; metal-binding site
568708015911	Intracellular growth attenuator protein IgaA; Region: IgaA; pfam07095
568708015913	4 probable transmembrane helices predicted for STM_MW34851 by TMHMM2.0 at aa 157-176, 180-202, 291-313 and 607-629
568708015914	haloacid dehalogenase superfamily, subfamily IA, variant 3 with third motif having DD or ED; Region: HAD-SF-IA-v3; TIGR01509
568708015915	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708015916	motif II; other site
568708015918	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
568708015919	RNA binding surface [nucleotide binding]; other site
568708015921	Hsp33-like chaperonin; Reviewed; Region: hslO; PRK00114
568708015922	Heat shock protein 33 (Hsp33):  Cytosolic protein that acts as a molecular chaperone under oxidative conditions.  In normal (reducing) cytosolic conditions, four conserved Cys residues are coordinated by a Zn ion. Under oxidative stress (such as heat...; Region: Hsp33; cd00498
568708015923	dimerization interface [polypeptide binding]; other site
568708015924	domain crossover interface; other site
568708015925	redox-dependent activation switch; other site
568708015927	Domain of unknown function (DUF4153); Region: DUF4153; pfam13687
568708015928	11 probable transmembrane helices predicted for STM_MW34891 by TMHMM2.0 at aa 12-34, 39-61, 66-84, 99-118, 138-160, 183-200, 213-235, 250-268, 281-303, 318-340 and 353-375
568708015929	Phosphoenolpyruvate carboxykinase; Region: PEPCK_ATP; pfam01293
568708015930	Phosphoenolpyruvate carboxykinase (PEPCK), a critical gluconeogenic enzyme, catalyzes the first committed step in the diversion of tricarboxylic acid cycle intermediates toward gluconeogenesis. It catalyzes the reversible decarboxylation and...; Region: PEPCK_ATP; cd00484
568708015931	active site
568708015932	substrate-binding site [chemical binding]; other site
568708015933	metal-binding site [ion binding]
568708015934	ATP binding site [chemical binding]; other site
568708015936	osmolarity sensor protein; Provisional; Region: envZ; PRK09467
568708015937	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
568708015938	dimerization interface [polypeptide binding]; other site
568708015939	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
568708015940	dimer interface [polypeptide binding]; other site
568708015941	phosphorylation site [posttranslational modification]
568708015942	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708015943	ATP binding site [chemical binding]; other site
568708015944	G-X-G motif; other site
568708015946	1 probable transmembrane helix predicted for STM_MW34911 by TMHMM2.0 at aa 121-140
568708015948	osmolarity response regulator; Provisional; Region: ompR; PRK09468
568708015949	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708015950	active site
568708015951	phosphorylation site [posttranslational modification]
568708015952	intermolecular recognition site; other site
568708015953	dimerization interface [polypeptide binding]; other site
568708015954	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
568708015955	DNA binding site [nucleotide binding]
568708015958	transcription elongation factor GreB; Reviewed; Region: greB; PRK01885
568708015959	Transcription elongation factor, N-terminal; Region: GreA_GreB_N; pfam03449
568708015960	Transcription elongation factor, GreA/GreB, C-term; Region: GreA_GreB; pfam01272
568708015963	Transcriptional accessory protein [Transcription]; Region: Tex; COG2183
568708015964	Tex-like protein N-terminal domain; Region: Tex_N; pfam09371
568708015965	Likely ribonuclease with RNase H fold; Region: YqgFc; smart00732
568708015966	S1_Tex: The C-terminal S1 domain of a transcription accessory factor called Tex, which has been characterized in Bordetella pertussis and Pseudomonas aeruginosa. The tex gene is essential in Bortella pertusis and is named for its role in toxin expression; Region: S1_Tex; cd05685
568708015967	RNA binding site [nucleotide binding]; other site
568708015970	ferrous iron transport protein A; Reviewed; Region: feoA; PRK09555
568708015972	ferrous iron transport protein B; Reviewed; Region: feoB; PRK09554
568708015973	Ferrous iron transport protein B (FeoB) family; Region: FeoB; cd01879
568708015974	G1 box; other site
568708015975	GTP/Mg2+ binding site [chemical binding]; other site
568708015976	Switch I region; other site
568708015977	G2 box; other site
568708015978	G3 box; other site
568708015979	Switch II region; other site
568708015980	G4 box; other site
568708015981	G5 box; other site
568708015982	Nucleoside recognition; Region: Gate; pfam07670
568708015983	Ferrous iron transport protein B C terminus; Region: FeoB_C; pfam07664
568708015984	Nucleoside recognition; Region: Gate; pfam07670
568708015987	10 probable transmembrane helices predicted for STM_MW34961 by TMHMM2.0 at aa 277-299, 309-331, 344-366, 386-408, 429-447, 451-473, 510-532, 663-685, 692-714 and 720-742
568708015990	ferrous iron transport protein FeoC; Provisional; Region: PRK15431
568708015992	hypothetical protein; Provisional; Region: PRK09956
568708015993	Putative transposase, YhgA-like; Region: Transposase_31; pfam04754
568708015995	carboxylesterase BioH; Provisional; Region: PRK10349
568708015996	homoserine O-acetyltransferase; Provisional; Region: metX; cl17114
568708015998	DNA utilization protein GntX; Provisional; Region: PRK11595
568708015999	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
568708016000	active site
568708016002	Fe/S biogenesis protein NfuA; Provisional; Region: PRK11190
568708016003	Fe-S cluster assembly scaffold protein [Posttranslational modification, protein turnover, chaperones]; Region: sufA; COG0316
568708016004	Thioredoxin-like proteins and domains [Posttranslational modification, protein turnover, chaperones]; Region: COG0694
568708016007	high-affinity gluconate transporter; Provisional; Region: PRK14984
568708016008	gluconate transporter; Region: gntP; TIGR00791
568708016009	Signal peptide predicted for STM_MW35021 by SignalP 2.0 HMM (Signal peptide probability 0.918) with cleavage site probability 0.567 between residues 23 and 24
568708016011	10 probable transmembrane helices predicted for STM_MW35021 by TMHMM2.0 at aa 7-27, 37-59, 80-98, 103-125, 159-181, 242-264, 277-296, 333-355, 362-384 and 399-421
568708016012	4-alpha-glucanotransferase; Provisional; Region: malQ; PRK11052
568708016013	4-alpha-glucanotransferase [Carbohydrate transport and metabolism]; Region: MalQ; COG1640
568708016015	Signal peptide predicted for STM_MW35031 by SignalP 2.0 HMM (Signal peptide probability 0.964) with cleavage site probability 0.898 between residues 22 and 23
568708016016	maltodextrin phosphorylase; Provisional; Region: PRK14985
568708016017	This is a family of oligosaccharide phosphorylases. It includes yeast and mammalian glycogen phosphorylases, plant starch/glucan phosphorylase, as well as the maltodextrin phosphorylases of bacteria. The members of this family catalyze the breakdown of...; Region: GT1_Glycogen_Phosphorylase; cd04300
568708016018	homodimer interface [polypeptide binding]; other site
568708016019	active site pocket [active]
568708016021	transcriptional regulator MalT; Provisional; Region: PRK04841
568708016022	AAA ATPase domain; Region: AAA_16; pfam13191
568708016023	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
568708016024	DNA binding residues [nucleotide binding]
568708016025	dimerization interface [polypeptide binding]; other site
568708016027	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3041
568708016029	DNA-damage-inducible protein J [DNA replication, recombination, and repair]; Region: RelB; COG3077
568708016031	RNA 3'-terminal-phosphate cyclase; Provisional; Region: PRK04204
568708016032	RNA 3' phosphate cyclase domain (class II). These proteins function as RNA cyclase to catalyze the ATP-dependent conversion of 3'-phosphate to a 2'.3'-cyclic phosphodiester at the end of RNA molecule. A conserved catalytic histidine...; Region: RNA_Cyclase_Class_II; cd00874
568708016033	putative active site [active]
568708016034	adenylation catalytic residue [active]
568708016037	Uncharacterized protein family UPF0027; Region: UPF0027; pfam01139
568708016038	hypothetical protein; Reviewed; Region: PRK09588
568708016040	TROVE domain; Region: TROVE; pfam05731
568708016042	Sigma54-dependent transcription regulator containing an AAA-type ATPase domain and a DNA-binding domain [Transcription / Signal transduction mechanisms]; Region: RtcR; COG4650
568708016043	Regulator of RNA terminal phosphate cyclase; Region: RtcR; pfam06956
568708016044	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708016045	Walker A motif; other site
568708016046	ATP binding site [chemical binding]; other site
568708016047	Walker B motif; other site
568708016048	arginine finger; other site
568708016051	DNA-binding transcriptional repressor GlpR; Provisional; Region: PRK10906
568708016052	DeoR-like helix-turn-helix domain; Region: HTH_DeoR; pfam08220
568708016053	DeoR C terminal sensor domain; Region: DeoRC; pfam00455
568708016056	intramembrane serine protease GlpG; Provisional; Region: PRK10907
568708016057	Protein of unknown function (DUF3582); Region: DUF3582; pfam12122
568708016058	Membrane associated serine protease [Amino acid transport and metabolism]; Region: COG0705
568708016059	6 probable transmembrane helices predicted for STM_MW35131 by TMHMM2.0 at aa 98-120, 140-162, 169-188, 192-214, 223-245 and 250-272
568708016061	GlpE sulfurtransferase (ST) and homologs are members of the Rhodanese Homology Domain superfamily. Unlike other rhodanese sulfurtransferases, GlpE is a single domain protein but indications are that it functions as a dimer. The active site contains a...; Region: GlpE_ST; cd01444
568708016062	active site residue [active]
568708016064	glycerol-3-phosphate dehydrogenase; Reviewed; Region: glpD; PRK12266
568708016066	hypothetical protein; Provisional; Region: PRK09781
568708016067	ABC-type phosphate transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: PstS; COG0226
568708016068	5 probable transmembrane helices predicted for STM_MW35171 by TMHMM2.0 at aa 27-58, 73-95, 108-127, 160-182 and 195-217
568708016069	Glycerol dehydrogenase and related enzymes [Energy production and conversion]; Region: GldA; COG0371
568708016070	Glycerol dehydrogenases (GlyDH) catalyzes oxidation of glycerol to dihydroxyacetone in glycerol dissmilation; Region: GlyDH; cd08170
568708016071	dimer interface [polypeptide binding]; other site
568708016072	active site
568708016073	metal binding site [ion binding]; metal-binding site
568708016075	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708016076	D-galactonate transporter; Region: 2A0114; TIGR00893
568708016077	putative substrate translocation pore; other site
568708016078	12 probable transmembrane helices predicted for STM_MW35191 by TMHMM2.0 at aa 13-30, 50-72, 85-104, 109-131, 144-166, 176-193, 239-261, 271-293, 305-324, 328-350, 363-385 and 395-417
568708016080	Dihydroxyacid dehydratase/phosphogluconate dehydratase [Amino acid transport and metabolism / Carbohydrate transport and metabolism]; Region: IlvD; COG0129
568708016082	Dihydrodipicolinate synthase/N-acetylneuraminate lyase [Amino acid transport and metabolism / Cell envelope biogenesis, outer membrane]; Region: DapA; COG0329
568708016083	Dihydrodipicolinate synthase family; Region: DHDPS-like; cd00408
568708016084	inhibitor site; inhibition site
568708016085	active site
568708016086	dimer interface [polypeptide binding]; other site
568708016087	catalytic residue [active]
568708016089	helix_turn_helix isocitrate lyase regulation; Region: HTH_ICLR; smart00346
568708016090	Transcriptional regulator [Transcription]; Region: IclR; COG1414
568708016091	Bacterial transcriptional regulator; Region: IclR; pfam01614
568708016094	glycogen phosphorylase; Provisional; Region: PRK14986
568708016095	This is a family of oligosaccharide phosphorylases. It includes yeast and mammalian glycogen phosphorylases, plant starch/glucan phosphorylase, as well as the maltodextrin phosphorylases of bacteria. The members of this family catalyze the breakdown of...; Region: GT1_Glycogen_Phosphorylase; cd04300
568708016096	homodimer interface [polypeptide binding]; other site
568708016097	active site pocket [active]
568708016099	glycogen synthase; Provisional; Region: glgA; PRK00654
568708016100	This family is most closely related to the GT1 family of glycosyltransferases. Glycogen synthase catalyzes the formation and elongation of the alpha-1,4-glucose backbone using ADP-glucose, the second and key step of glycogen biosynthesis. This family...; Region: GT1_Glycogen_synthase_DULL1_like; cd03791
568708016101	ADP-binding pocket [chemical binding]; other site
568708016102	homodimer interface [polypeptide binding]; other site
568708016105	glucose-1-phosphate adenylyltransferase; Provisional; Region: glgC; PRK00725
568708016106	ADP-glucose pyrophosphorylase is involved in the biosynthesis of glycogen or starch; Region: ADP_Glucose_PP; cd02508
568708016107	ligand binding site; other site
568708016108	oligomer interface; other site
568708016109	Glucose-1-phosphate adenylyltransferase, C-terminal Left-handed parallel beta helix (LbH) domain: Glucose-1-phosphate adenylyltransferase is also known as ADP-glucose synthase or ADP-glucose pyrophosphorylase. It catalyzes the first committed and...; Region: LbH_G1P_AT_C; cd04651
568708016110	dimer interface [polypeptide binding]; other site
568708016111	N-terminal domain interface [polypeptide binding]; other site
568708016112	sulfate 1 binding site; other site
568708016114	glycogen debranching enzyme; Provisional; Region: PRK03705
568708016115	N-terminal Early set domain associated with the catalytic domain of Glycogen debranching enzyme and bacterial isoamylase (also called glycogen 6-glucanohydrolase); Region: E_set_GDE_Isoamylase_N; cd02856
568708016116	Alpha amylase catalytic domain found in glycogen debranching enzymes; Region: AmyAc_Glg_debranch; cd11326
568708016117	active site
568708016118	catalytic site [active]
568708016121	glycogen branching enzyme; Provisional; Region: PRK05402
568708016122	N-terminal Early set domain associated with the catalytic domain of prokaryotic glycogen branching enzyme; Region: E_set_GBE_prok_N; cd02855
568708016123	Alpha amylase catalytic domain found in the Glycogen branching enzyme (also called 1,4-alpha-glucan branching enzyme); Region: AmyAc_Glg_BE; cd11322
568708016124	active site
568708016125	catalytic site [active]
568708016126	Alpha amylase, C-terminal all-beta domain; Region: Alpha-amylase_C; pfam02806
568708016130	aspartate-semialdehyde dehydrogenase; Reviewed; Region: PRK06598
568708016131	Semialdehyde dehydrogenase, NAD binding domain; Region: Semialdhyde_dh; smart00859
568708016134	low affinity gluconate transporter; Provisional; Region: PRK10472
568708016135	gluconate transporter; Region: gntP; TIGR00791
568708016136	13 probable transmembrane helices predicted for STM_MW35301 by TMHMM2.0 at aa 4-21, 28-47, 57-79, 104-126, 146-168, 175-197, 228-250, 262-284, 299-321, 328-350, 354-373, 386-408 and 423-445
568708016138	Signal peptide predicted for STM_MW35301 by SignalP 2.0 HMM (Signal peptide probability 0.669) with cleavage site probability 0.493 between residues 23 and 24
568708016139	Gluconate kinase (GntK) catalyzes the phosphoryl transfer from ATP to gluconate. The resulting product gluconate-6-phoshate is an important precursor of gluconate metabolism. GntK acts as a dimmer composed of two identical subunits; Region: GntK; cd02021
568708016140	ATP-binding site [chemical binding]; other site
568708016141	Gluconate-6-phosphate binding site [chemical binding]; other site
568708016143	gluconate operon transcriptional regulator; Provisional; Region: PRK14987
568708016144	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
568708016145	DNA binding site [nucleotide binding]
568708016146	domain linker motif; other site
568708016147	Ligand-binding domain of DNA transcription repressor GntR specific for gluconate, a member of the LacI-GalR family of bacterial transcription regulators; Region: PBP1_GntR; cd01575
568708016148	putative ligand binding site [chemical binding]; other site
568708016149	putative dimerization interface [polypeptide binding]; other site
568708016152	Pirin-related protein [General function prediction only]; Region: COG1741
568708016153	Pirin; Region: Pirin; pfam02678
568708016155	putative oxidoreductase; Provisional; Region: PRK10206
568708016156	Oxidoreductase family, NAD-binding Rossmann fold; Region: GFO_IDH_MocA; pfam01408
568708016157	Oxidoreductase family, C-terminal alpha/beta domain; Region: GFO_IDH_MocA_C; pfam02894
568708016160	putative acetyltransferase YhhY; Provisional; Region: PRK10140
568708016161	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
568708016162	Coenzyme A binding pocket [chemical binding]; other site
568708016164	Transcriptional regulators of sugar metabolism [Transcription / Carbohydrate transport and metabolism]; Region: GlpR; COG1349
568708016165	helix_turn_helix, Deoxyribose operon repressor; Region: HTH_DEOR; smart00420
568708016166	Sugar kinases, ribokinase family [Carbohydrate transport and metabolism]; Region: RbsK; COG0524
568708016167	Ribokinase catalyses the phosphorylation of ribose to ribose-5-phosphate using ATP. This reaction is the first step in the ribose metabolism. It traps ribose within the cell after uptake and also prepares the sugar for use in the synthesis of nucleotides...; Region: ribokinase; cd01174
568708016168	substrate binding site [chemical binding]; other site
568708016169	dimer interface [polypeptide binding]; other site
568708016170	ATP binding site [chemical binding]; other site
568708016173	A4 beta-galactosidase middle domain: a type 1 glutamine amidotransferase (GATase1)-like domain; Region: A4_beta-galactosidase_middle_domain; cd03143
568708016175	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3238
568708016176	Protein of unknown function, DUF606; Region: DUF606; pfam04657
568708016177	Signal peptide predicted for STM_MW35381 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.734 between residues 27 and 28
568708016178	10 probable transmembrane helices predicted for STM_MW35381 by TMHMM2.0 at aa 7-26, 41-60, 80-97, 107-125, 138-157, 161-183, 196-218, 233-252, 257-276 and 286-308
568708016180	Phosphotriesterase (PTE) catalyzes the hydrolysis of organophosphate nerve agents, including the chemical warfare agents VX, soman, and sarin as well as the insecticide paraoxon. PTE exists as a homodimer with one active site per monomer. The active site...; Region: PTE; cd00530
568708016181	active site
568708016182	substrate binding pocket [chemical binding]; other site
568708016183	homodimer interaction site [polypeptide binding]; other site
568708016185	gamma-glutamyltranspeptidase; Reviewed; Region: ggt; PRK09615
568708016186	gamma-glutamyltranspeptidase; Region: g_glut_trans; TIGR00066
568708016188	Signal peptide predicted for STM_MW35401 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 24 and 25
568708016189	hypothetical protein; Provisional; Region: PRK10350
568708016190	Signal peptide predicted for STM_MW35411 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.988 between residues 17 and 18
568708016192	cytoplasmic glycerophosphodiester phosphodiesterase; Provisional; Region: ugpQ; PRK09454
568708016193	Glycerophosphodiester phosphodiesterase domain in Escherichia coli cytosolic glycerophosphodiester phosphodiesterase UgpQ and similar proteins; Region: GDPD_EcUgpQ_like; cd08562
568708016194	putative active site [active]
568708016195	catalytic site [active]
568708016196	putative metal binding site [ion binding]; other site
568708016198	glycerol-3-phosphate transporter ATP-binding subunit; Provisional; Region: ugpC; PRK11650
568708016199	The N-terminal ATPase domain of the maltose transporter, MalK; Region: ABC_MalK_N; cd03301
568708016200	Walker A/P-loop; other site
568708016201	ATP binding site [chemical binding]; other site
568708016202	Q-loop/lid; other site
568708016203	ABC transporter signature motif; other site
568708016204	Walker B; other site
568708016205	D-loop; other site
568708016206	H-loop/switch region; other site
568708016207	TOBE domain; Region: TOBE_2; pfam08402
568708016210	ABC-type sugar transport system, permease component [Carbohydrate transport and metabolism]; Region: UgpE; COG0395
568708016211	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708016212	dimer interface [polypeptide binding]; other site
568708016213	conserved gate region; other site
568708016214	ABC-ATPase subunit interface; other site
568708016215	7 probable transmembrane helices predicted for STM_MW35441 by TMHMM2.0 at aa 7-29, 82-104, 111-130, 145-167, 188-210, 215-237 and 250-272
568708016217	Signal peptide predicted for STM_MW35441 by SignalP 2.0 HMM (Signal peptide probability 0.642) with cleavage site probability 0.418 between residues 34 and 35
568708016218	ABC-type polysaccharide transport system, permease component [Carbohydrate transport and metabolism]; Region: LplB; COG4209
568708016219	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708016220	dimer interface [polypeptide binding]; other site
568708016221	conserved gate region; other site
568708016222	putative PBP binding loops; other site
568708016223	ABC-ATPase subunit interface; other site
568708016224	6 probable transmembrane helices predicted for STM_MW35451 by TMHMM2.0 at aa 12-34, 71-93, 106-128, 157-179, 206-228 and 266-288
568708016226	glycerol-3-phosphate transporter periplasmic binding protein; Provisional; Region: PRK10974
568708016227	ABC-type sugar transport system, periplasmic component [Carbohydrate transport and metabolism]; Region: UgpB; COG1653
568708016229	1 probable transmembrane helix predicted for STM_MW35461 by TMHMM2.0 at aa 7-29
568708016230	Signal peptide predicted for STM_MW35461 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 23 and 24
568708016231	Prophage maintenance system killer protein [General function prediction only]; Region: Doc; COG3654
568708016233	Antitoxin Phd_YefM, type II toxin-antitoxin system; Region: PhdYeFM_antitox; pfam02604
568708016235	leucine/isoleucine/valine transporter ATP-binding subunit; Provisional; Region: livF; PRK11614
568708016236	ATP-binding cassette domain of branched-chain amino acid transporter; Region: ABC_TM1139_LivF_branched; cd03224
568708016237	Walker A/P-loop; other site
568708016238	ATP binding site [chemical binding]; other site
568708016239	Q-loop/lid; other site
568708016240	ABC transporter signature motif; other site
568708016241	Walker B; other site
568708016242	D-loop; other site
568708016243	H-loop/switch region; other site
568708016245	leucine/isoleucine/valine transporter ATP-binding subunit; Provisional; Region: livG; PRK11300
568708016246	ATP-binding cassette component of branched chain amino acids transport system; Region: ABC_Mj1267_LivG_branched; cd03219
568708016247	Walker A/P-loop; other site
568708016248	ATP binding site [chemical binding]; other site
568708016249	Q-loop/lid; other site
568708016250	ABC transporter signature motif; other site
568708016251	Walker B; other site
568708016252	D-loop; other site
568708016253	H-loop/switch region; other site
568708016255	leucine/isoleucine/valine transporter permease subunit; Provisional; Region: livM; PRK11301
568708016256	Domain of unknown function (DUF3382); Region: DUF3382; pfam11862
568708016257	Transmembrane subunit (TM) of Escherichia coli LivM and related proteins. LivM is one of two TMs of the E. coli LIV-1/LS transporter, a Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporter involved in the uptake of...; Region: TM_PBP1_LivM_like; cd06581
568708016258	TM-ABC transporter signature motif; other site
568708016259	10 probable transmembrane helices predicted for STM_MW35511 by TMHMM2.0 at aa 4-26, 47-66, 91-108, 120-142, 162-184, 193-210, 261-283, 315-337, 352-374 and 381-400
568708016261	Signal peptide predicted for STM_MW35511 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.989 between residues 20 and 21
568708016262	Branched-chain amino acid transport system / permease component; Region: BPD_transp_2; pfam02653
568708016263	Transmembrane subunit (TM) of Escherichia coli LivH and related proteins. LivH is one of two TMs of the E. coli LIV-1/LS transporter, a Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporter involved in the uptake of...; Region: TM_PBP1_LivH_like; cd06582
568708016264	TM-ABC transporter signature motif; other site
568708016265	8 probable transmembrane helices predicted for STM_MW35521 by TMHMM2.0 at aa 15-37, 44-66, 70-92, 105-124, 153-175, 207-229, 244-266 and 282-301
568708016267	ABC-type branched-chain amino acid transport systems, periplasmic component [Amino acid transport and metabolism]; Region: LivK; COG0683
568708016268	Type I periplasmic ligand-binding domain of ABC (Atpase Binding Cassette)-type active transport systems that are involved in the transport of all three branched chain aliphatic amino acids (leucine, isoleucine and valine); Region: PBP1_ABC_LIVBP_like; cd06342
568708016269	dimerization interface [polypeptide binding]; other site
568708016270	ligand binding site [chemical binding]; other site
568708016272	Signal peptide predicted for STM_MW35531 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 23 and 24
568708016273	Acetyltransferase (GNAT) domain; Region: DUF3749; pfam12568
568708016275	ABC-type branched-chain amino acid transport systems, periplasmic component [Amino acid transport and metabolism]; Region: LivK; COG0683
568708016276	Type I periplasmic ligand-binding domain of ABC (Atpase Binding Cassette)-type active transport systems that are involved in the transport of all three branched chain aliphatic amino acids (leucine, isoleucine and valine); Region: PBP1_ABC_LIVBP_like; cd06342
568708016277	dimerization interface [polypeptide binding]; other site
568708016278	ligand binding site [chemical binding]; other site
568708016280	Signal peptide predicted for STM_MW35561 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 21 and 22
568708016281	RNA polymerase factor sigma-32; Reviewed; Region: PRK06596
568708016282	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
568708016283	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
568708016284	DNA binding residues [nucleotide binding]
568708016287	putative protein insertion permease FtsX; Region: ftsX; TIGR00439
568708016288	cell division ABC transporter subunit FtsX; Provisional; Region: ftsX; PRK11026
568708016289	4 probable transmembrane helices predicted for STM_MW35581 by TMHMM2.0 at aa 71-93, 223-245, 266-288 and 323-342
568708016291	cell division protein FtsE; Provisional; Region: PRK10908
568708016292	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
568708016293	Walker A/P-loop; other site
568708016294	ATP binding site [chemical binding]; other site
568708016295	Q-loop/lid; other site
568708016296	ABC transporter signature motif; other site
568708016297	Walker B; other site
568708016298	D-loop; other site
568708016299	H-loop/switch region; other site
568708016301	signal recognition particle-docking protein FtsY; Provisional; Region: PRK10416
568708016302	SRP54-type protein, helical bundle domain; Region: SRP54_N; pfam02881
568708016303	The signal recognition particle (SRP) mediates the transport to or across the plasma membrane in bacteria and the endoplasmic reticulum in eukaryotes. SRP recognizes N-terminal sighnal sequences of newly synthesized polypeptides at the ribosome. The...; Region: SRP; cd03115
568708016304	P loop; other site
568708016305	GTP binding site [chemical binding]; other site
568708016308	N6-adenine-specific methylase [DNA replication, recombination, and repair]; Region: COG0742
568708016309	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708016310	S-adenosylmethionine binding site [chemical binding]; other site
568708016312	hypothetical protein; Provisional; Region: PRK10910
568708016314	2 probable transmembrane helices predicted for STM_MW35621 by TMHMM2.0 at aa 4-23 and 30-52
568708016315	Protein of unknown function (DUF2500); Region: DUF2500; pfam10694
568708016317	1 probable transmembrane helix predicted for STM_MW35631 by TMHMM2.0 at aa 5-24
568708016318	Signal peptide predicted for STM_MW35631 by SignalP 2.0 HMM (Signal peptide probability 0.916) with cleavage site probability 0.574 between residues 18 and 19
568708016319	Predicted membrane protein [Function unknown]; Region: COG3714
568708016321	6 probable transmembrane helices predicted for STM_MW35641 by TMHMM2.0 at aa 28-45, 50-72, 77-96, 101-123, 130-152 and 156-178
568708016322	zinc/cadmium/mercury/lead-transporting ATPase; Provisional; Region: zntA; PRK11033
568708016323	Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371
568708016324	metal-binding site [ion binding]
568708016325	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
568708016326	Soluble P-type ATPase [General function prediction only]; Region: COG4087
568708016328	5 probable transmembrane helices predicted for STM_MW35651 by TMHMM2.0 at aa 147-169, 189-211, 350-372, 387-409 and 690-712
568708016331	methyl-accepting chemotaxis protein I; Provisional; Region: PRK15041
568708016332	ligand binding domain of Tar- and Tsr-related chemoreceptors; Region: Tar_Tsr_LBD; cd00181
568708016333	dimer interface [polypeptide binding]; other site
568708016334	ligand binding site [chemical binding]; other site
568708016335	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
568708016336	dimerization interface [polypeptide binding]; other site
568708016337	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
568708016338	dimer interface [polypeptide binding]; other site
568708016339	putative CheW interface [polypeptide binding]; other site
568708016340	Signal peptide predicted for STM_MW35661 by SignalP 2.0 HMM (Signal peptide probability 0.963) with cleavage site probability 0.427 between residues 31 and 32
568708016341	2 probable transmembrane helices predicted for STM_MW35661 by TMHMM2.0 at aa 10-32 and 195-217
568708016345	SirA (also known as UvrY,  and YhhP) belongs to a family of two-component response regulators that controls secondary metabolism and virulence. The other member of this two-component system is a sensor kinase called BarA which phosphorylates SirA.  A...; Region: SirA; cd03423
568708016346	CPxP  motif; other site
568708016348	hypothetical protein; Provisional; Region: PRK11212
568708016349	6 probable transmembrane helices predicted for STM_MW35681 by TMHMM2.0 at aa 13-35, 45-64, 71-93, 108-130, 142-164 and 179-201
568708016351	hypothetical protein; Provisional; Region: PRK11615
568708016353	major facilitator superfamily transporter; Provisional; Region: PRK05122
568708016354	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708016355	putative substrate translocation pore; other site
568708016356	12 probable transmembrane helices predicted for STM_MW35701 by TMHMM2.0 at aa 33-55, 65-87, 99-121, 136-158, 163-185, 189-211, 232-254, 264-283, 290-312, 322-344, 351-373 and 378-400
568708016358	Predicted permease, member of the PurR regulon [General function prediction only]; Region: yhhT; cl00465
568708016359	Domain of unknown function DUF20; Region: UPF0118; pfam01594
568708016360	8 probable transmembrane helices predicted for STM_MW35711 by TMHMM2.0 at aa 12-29, 33-55, 62-84, 141-163, 198-220, 224-246, 253-275 and 295-317
568708016362	holo-(acyl carrier protein) synthase 2; Provisional; Region: PRK10351
568708016363	4'-phosphopantetheinyl transferase superfamily; Region: ACPS; pfam01648
568708016365	nickel responsive regulator; Provisional; Region: PRK02967
568708016366	NikR C terminal nickel binding domain; Region: NikR_C; pfam08753
568708016369	ABC-type multidrug transport system, permease component [Defense mechanisms]; Region: COG0842
568708016370	ABC-2 type transporter; Region: ABC2_membrane; pfam01061
568708016371	6 probable transmembrane helices predicted for STM_MW35741 by TMHMM2.0 at aa 25-47, 174-196, 230-252, 256-278, 285-302 and 344-366
568708016373	Signal peptide predicted for STM_MW35741 by SignalP 2.0 HMM (Signal peptide probability 0.882) with cleavage site probability 0.803 between residues 40 and 41
568708016374	ATPase components of various ABC-type transport systems, contain duplicated ATPase [General function prediction only]; Region: COG1123
568708016375	ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230
568708016376	Walker A/P-loop; other site
568708016377	ATP binding site [chemical binding]; other site
568708016378	Q-loop/lid; other site
568708016379	ABC transporter signature motif; other site
568708016380	Walker B; other site
568708016381	D-loop; other site
568708016382	H-loop/switch region; other site
568708016383	ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230
568708016384	Walker A/P-loop; other site
568708016385	ATP binding site [chemical binding]; other site
568708016386	Q-loop/lid; other site
568708016387	ABC transporter signature motif; other site
568708016388	Walker B; other site
568708016389	D-loop; other site
568708016390	H-loop/switch region; other site
568708016391	ABC-type multidrug transport system, permease component [Defense mechanisms]; Region: COG0842
568708016392	ABC-2 family transporter protein; Region: ABC2_membrane_2; pfam12679
568708016393	5 probable transmembrane helices predicted for STM_MW35751 by TMHMM2.0 at aa 702-724, 752-774, 779-801, 808-830 and 869-891
568708016396	HlyD family secretion protein; Region: HlyD; pfam00529
568708016397	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
568708016398	HlyD family secretion protein; Region: HlyD_3; pfam13437
568708016400	1 probable transmembrane helix predicted for STM_MW35761 by TMHMM2.0 at aa 7-26
568708016401	Signal peptide predicted for STM_MW35761 by SignalP 2.0 HMM (Signal peptide probability 0.921) with cleavage site probability 0.747 between residues 23 and 24
568708016402	Predicted flavoproteins [General function prediction only]; Region: COG2081
568708016403	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
568708016405	Signal peptide predicted for STM_MW35771 by SignalP 2.0 HMM (Signal peptide probability 0.991) with cleavage site probability 0.912 between residues 22 and 23
568708016406	Phosphate/sulphate permeases [Inorganic ion transport and metabolism]; Region: PitA; COG0306
568708016407	Phosphate/sulphate permeases [Inorganic ion transport and metabolism]; Region: PitA; COG0306
568708016408	Signal peptide predicted for STM_MW35781 by SignalP 2.0 HMM (Signal peptide probability 0.699) with cleavage site probability 0.429 between residues 32 and 33
568708016410	8 probable transmembrane helices predicted for STM_MW35781 by TMHMM2.0 at aa 13-35, 53-75, 82-104, 114-136, 166-183, 193-215, 339-361 and 431-453
568708016411	universal stress protein UspB; Provisional; Region: PRK04960
568708016413	2 probable transmembrane helices predicted for STM_MW35791 by TMHMM2.0 at aa 5-24 and 90-109
568708016414	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
568708016415	Ligand Binding Site [chemical binding]; other site
568708016417	dipeptide/tripeptide permease B; Provisional; Region: PRK10207
568708016418	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708016419	putative substrate translocation pore; other site
568708016420	POT family; Region: PTR2; pfam00854
568708016421	14 probable transmembrane helices predicted for STM_MW35811 by TMHMM2.0 at aa 20-42, 52-74, 83-102, 107-124, 145-167, 171-193, 214-233, 237-255, 268-290, 314-336, 349-371, 386-408, 415-437 and 457-479
568708016423	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708016424	S-adenosylmethionine binding site [chemical binding]; other site
568708016426	oligopeptidase A; Provisional; Region: PRK10911
568708016427	Peptidase family M3 dipeptidyl carboxypeptidase (DCP); Region: M3A_DCP; cd06456
568708016428	active site
568708016429	Zn binding site [ion binding]; other site
568708016431	PAP2, bacterial acid phosphatase or class A non-specific acid phosphatases. These enzymes catalyze phosphomonoester hydrolysis, with optimal activity in low pH conditions. They are secreted into the periplasmic space, and their physiological role remains...; Region: PAP2_acid_phosphatase; cd03397
568708016432	Membrane-associated phospholipid phosphatase [Lipid metabolism]; Region: PgpB; COG0671
568708016433	active site
568708016435	Protein involved in catabolism of external DNA [General function prediction only]; Region: ComJ; COG2961
568708016437	glutathione reductase; Validated; Region: PRK06116
568708016438	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
568708016439	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
568708016440	Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852
568708016444	Type II (periplasmic) bacterial L-asparaginase; Region: L-asparaginase_II; cd08964
568708016445	active site
568708016446	homodimer interface [polypeptide binding]; other site
568708016447	homotetramer interface [polypeptide binding]; other site
568708016449	1 probable transmembrane helix predicted for STM_MW35871 by TMHMM2.0 at aa 7-29
568708016450	Signal peptide predicted for STM_MW35871 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.988 between residues 20 and 21
568708016451	Anaerobic C4-dicarboxylate transporter [General function prediction only]; Region: DcuB; COG2704
568708016452	anaerobic C4-dicarboxylate transporter; Reviewed; Region: PRK09412
568708016453	11 probable transmembrane helices predicted for STM_MW35881 by TMHMM2.0 at aa 20-42, 52-74, 87-109, 163-185, 227-249, 264-281, 294-316, 331-350, 357-374, 379-398 and 419-438
568708016455	Fructoselysine kinase-like.  Fructoselysine is a fructoseamine formed by glycation, a non-enzymatic reaction of glucose with a primary amine followed by an Amadori rearrangement, resulting in a protein that is modified at the amino terminus and at the...; Region: Fructoselysine_kinase_like; cd01940
568708016456	Sugar kinases, ribokinase family [Carbohydrate transport and metabolism]; Region: RbsK; COG0524
568708016457	substrate binding site [chemical binding]; other site
568708016458	ATP binding site [chemical binding]; other site
568708016460	Predicted phosphosugar isomerases [Cell envelope biogenesis, outer membrane]; Region: AgaS; COG2222
568708016461	A subgroup of the SIS domain. SIS (Sugar ISomerase) domains are found in many phosphosugar isomerases and phosphosugar binding proteins. SIS domains are also found in proteins that regulate the expression of genes involved in synthesis of phosphosugars; Region: SIS_1; cd05710
568708016462	putative active site [active]
568708016463	SIS (Sugar ISomerase) domain repeat 2 found in Glucosamine 6-phosphate synthase (GlmS) and Glucosamine-6-phosphate deaminase (GlmD). The SIS domain is found in many phosphosugar isomerases and phosphosugar binding proteins. GlmS contains a N-terminal...; Region: SIS_GlmS_GlmD_2; cd05009
568708016464	dimer interface [polypeptide binding]; other site
568708016465	active site
568708016467	Transcriptional regulators [Transcription]; Region: PhnF; COG2188
568708016468	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
568708016469	DNA-binding site [nucleotide binding]; DNA binding site
568708016470	UTRA domain; Region: UTRA; pfam07702
568708016473	trehalase; Provisional; Region: treF; PRK13270
568708016474	Trehalase; Region: Trehalase; pfam01204
568708016476	1 probable transmembrane helix predicted for STM_MW35931 by TMHMM2.0 at aa 337-359
568708016477	Phage-related lysozyme (muraminidase) [General function prediction only]; Region: COG3772
568708016478	catalytic residue [active]
568708016479	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
568708016480	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
568708016481	DNA binding residues [nucleotide binding]
568708016482	dimerization interface [polypeptide binding]; other site
568708016484	Transcriptional regulator [Transcription]; Region: LysR; COG0583
568708016485	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708016486	The C-terminal substrate binding domain of an uncharacterized LysR-type transcriptional regulator CrgA-like, contains the type 2 periplasmic binding fold; Region: PBP2_CrgA_like_3; cd08472
568708016487	putative effector binding pocket; other site
568708016488	putative dimerization interface [polypeptide binding]; other site
568708016491	inner membrane protein YhjD; Region: TIGR00766
568708016493	6 probable transmembrane helices predicted for STM_MW35971 by TMHMM2.0 at aa 80-102, 135-157, 191-213, 233-255, 267-289 and 304-326
568708016494	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708016495	metabolite-proton symporter; Region: 2A0106; TIGR00883
568708016496	putative substrate translocation pore; other site
568708016498	11 probable transmembrane helices predicted for STM_MW35981 by TMHMM2.0 at aa 32-54, 69-88, 109-131, 166-188, 195-217, 247-269, 290-312, 322-341, 348-370, 380-402 and 409-431
568708016500	Uncharacterized protein involved in outer membrane biogenesis [Cell envelope biogenesis, outer membrane]; Region: AsmA; COG2982
568708016501	AsmA-like C-terminal region; Region: AsmA_2; pfam13502
568708016503	1 probable transmembrane helix predicted for STM_MW35991 by TMHMM2.0 at aa 7-29
568708016504	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
568708016506	Sugar kinases, ribokinase family [Carbohydrate transport and metabolism]; Region: RbsK; COG0524
568708016507	2-keto-3-deoxygluconate kinase (KdgK) phosphorylates 2-keto-3-deoxygluconate (KDG) to form 2-keto-3-deoxy-6-phosphogluconate (KDGP). KDG is the common intermediate product, that allows organisms to channel D-glucuronate and/or D-galacturinate into the...; Region: KdgK; cd01166
568708016508	substrate binding site [chemical binding]; other site
568708016509	ATP binding site [chemical binding]; other site
568708016511	Predicted Zn-dependent peptidases [General function prediction only]; Region: PqqL; COG0612
568708016512	Peptidase M16 inactive domain; Region: Peptidase_M16_C; pfam05193
568708016515	Signal peptide predicted for STM_MW36021 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.997 between residues 24 and 25
568708016516	C4-dicarboxylate transporter DctA; Reviewed; Region: PRK01663
568708016517	Na+/H+-dicarboxylate symporters [Energy production and conversion]; Region: GltP; COG1301
568708016519	9 probable transmembrane helices predicted for STM_MW36031 by TMHMM2.0 at aa 5-27, 47-64, 77-99, 141-163, 184-206, 216-238, 289-311, 326-348 and 353-375
568708016520	putative diguanylate cyclase; Provisional; Region: PRK13561
568708016521	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
568708016522	metal binding site [ion binding]; metal-binding site
568708016523	active site
568708016524	I-site; other site
568708016525	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
568708016528	1 probable transmembrane helix predicted for STM_MW36041 by TMHMM2.0 at aa 127-149
568708016529	cellulose synthase subunit BcsC; Provisional; Region: PRK11447
568708016530	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cl02429
568708016531	TPR motif; other site
568708016532	binding surface
568708016533	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
568708016534	TPR motif; other site
568708016535	binding surface
568708016536	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
568708016537	binding surface
568708016538	TPR motif; other site
568708016539	Cellulose synthase operon protein C C-terminus (BCSC_C); Region: BCSC_C; pfam05420
568708016541	Signal peptide predicted for STM_MW36051 by SignalP 2.0 HMM (Signal peptide probability 0.990) with cleavage site probability 0.523 between residues 46 and 47
568708016542	endo-1,4-D-glucanase; Provisional; Region: PRK11097
568708016544	1 probable transmembrane helix predicted for STM_MW36061 by TMHMM2.0 at aa 7-29
568708016545	Signal peptide predicted for STM_MW36061 by SignalP 2.0 HMM (Signal peptide probability 0.991) with cleavage site probability 0.850 between residues 22 and 23
568708016546	cellulose synthase regulator protein; Provisional; Region: PRK11114
568708016548	1 probable transmembrane helix predicted for STM_MW36071 by TMHMM2.0 at aa 603-625
568708016549	cellulose synthase catalytic subunit; Provisional; Region: bcsA; PRK11498
568708016550	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394
568708016551	CESA_CelA_like are involved in the elongation of the glucan chain of cellulose; Region: CESA_CelA_like; cd06421
568708016552	DXD motif; other site
568708016553	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394
568708016554	PilZ domain; Region: PilZ; pfam07238
568708016555	10 probable transmembrane helices predicted for STM_MW36081 by TMHMM2.0 at aa 28-50, 150-169, 173-190, 197-216, 229-251, 522-541, 545-567, 588-610, 633-655 and 668-690
568708016558	cell division protein; Provisional; Region: PRK10037
568708016560	Protein of unknown function (DUF2629); Region: DUF2629; pfam10945
568708016562	cellulose biosynthesis protein BcsE; Provisional; Region: PRK15045
568708016563	Protein of unknown function (DUF2819); Region: DUF2819; pfam10995
568708016565	Protein of unknown function (DUF2636); Region: DUF2636; pfam11120
568708016567	1 probable transmembrane helix predicted for STM_MW36121 by TMHMM2.0 at aa 7-29
568708016568	pfam_scan;Pfam:PF11658; E()=2.2E-226;score=751.8;query 24-553;description=DUF3260
568708016570	pfam_scan;Pfam:PF01053; E()=6.9E-19;score=67.3;query7- 77;description=Cys_Met_Meta_PP
568708016572	Amino acid permeases [Amino acid transport and metabolism]; Region: SdaC; COG0814
568708016573	threonine/serine transporter TdcC; Provisional; Region: PRK13629; cl17672
568708016574	11 probable transmembrane helices predicted for STM_MW36161 by TMHMM2.0 at aa 29-51, 56-73, 105-127, 147-169, 176-194, 214-236, 256-278, 303-325, 351-373, 377-399 and 412-431
568708016576	dipeptide transporter ATP-binding subunit; Provisional; Region: dppF; PRK11308
568708016577	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
568708016578	Walker A/P-loop; other site
568708016579	ATP binding site [chemical binding]; other site
568708016580	Q-loop/lid; other site
568708016581	ABC transporter signature motif; other site
568708016582	Walker B; other site
568708016583	D-loop; other site
568708016584	H-loop/switch region; other site
568708016585	oligopeptide/dipeptide ABC transporter, ATP-binding protein, C-terminal domain; Region: oligo_HPY; TIGR01727
568708016588	dipeptide transporter ATP-binding subunit; Provisional; Region: dppD; PRK11022
568708016589	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
568708016590	Walker A/P-loop; other site
568708016591	ATP binding site [chemical binding]; other site
568708016592	Q-loop/lid; other site
568708016593	ABC transporter signature motif; other site
568708016594	Walker B; other site
568708016595	D-loop; other site
568708016596	H-loop/switch region; other site
568708016597	oligopeptide/dipeptide ABC transporter, ATP-binding protein, C-terminal domain; Region: oligo_HPY; TIGR01727
568708016600	dipeptide transporter; Provisional; Region: PRK10913
568708016601	N-terminal TM domain of oligopeptide transport permease C; Region: OppC_N; pfam12911
568708016602	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708016603	dimer interface [polypeptide binding]; other site
568708016604	conserved gate region; other site
568708016605	putative PBP binding loops; other site
568708016606	ABC-ATPase subunit interface; other site
568708016607	5 probable transmembrane helices predicted for STM_MW36191 by TMHMM2.0 at aa 31-53, 103-125, 140-162, 210-232 and 265-287
568708016609	ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppB; COG0601
568708016610	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708016611	dimer interface [polypeptide binding]; other site
568708016612	conserved gate region; other site
568708016613	putative PBP binding loops; other site
568708016614	ABC-ATPase subunit interface; other site
568708016615	6 probable transmembrane helices predicted for STM_MW36201 by TMHMM2.0 at aa 9-31, 99-121, 134-156, 202-221, 258-280 and 309-331
568708016617	ABC-type dipeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: DdpA; COG0747
568708016618	The substrate-binding component of an ABC-type dipeptide import system contains the type 2 periplasmic binding fold; Region: PBP2_DppA_like; cd08493
568708016619	peptide binding site [polypeptide binding]; other site
568708016621	Xanthine/uracil permeases [Nucleotide transport and metabolism]; Region: UraA; COG2233
568708016622	13 probable transmembrane helices predicted for STM_MW36221 by TMHMM2.0 at aa 20-42, 47-69, 76-98, 103-125, 132-154, 169-191, 196-218, 233-255, 287-309, 319-341, 348-370, 380-402 and 409-431
568708016624	Arylsulfotransferase (ASST); Region: Arylsulfotran_2; pfam14269
568708016626	Transcriptional regulators [Transcription]; Region: PurR; COG1609
568708016627	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
568708016628	DNA binding site [nucleotide binding]
568708016629	domain linker motif; other site
568708016630	Ligand-binding domain of uncharacterized DNA-binding regulatory proteins that are members of the LacI-GalR family of bacterial transcription repressors; Region: PBP1_LacI_like_8; cd06287
568708016631	putative dimerization interface [polypeptide binding]; other site
568708016632	putative ligand binding site [chemical binding]; other site
568708016634	1 probable transmembrane helix predicted for STM_MW36241 by TMHMM2.0 at aa 67-89
568708016636	phosphoethanolamine transferase; Provisional; Region: PRK11560
568708016637	Domain of unknown function (DUF1705); Region: DUF1705; pfam08019
568708016638	Sulfatase; Region: Sulfatase; pfam00884
568708016641	5 probable transmembrane helices predicted for STM_MW36251 by TMHMM2.0 at aa 12-31, 46-68, 81-103, 118-140 and 161-178
568708016642	Signal peptide predicted for STM_MW36251 by SignalP 2.0 HMM (Signal peptide probability 0.813) with cleavage site probability 0.796 between residues 37 and 38
568708016643	long polar fimbrial protein LpfE; Provisional; Region: PRK15205
568708016645	Signal peptide predicted for STM_MW36261 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 20 and 21
568708016646	Signal peptide; signalp; query 1-25;cleavage_site_probability=0.992; 1.000
568708016647	long polar fimbrial outer membrane usher protein LpfC; Provisional; Region: PRK15207
568708016648	PapC N-terminal domain; Region: PapC_N; pfam13954
568708016649	Type VII secretion system (T7SS), usher protein; Region: Usher; pfam00577
568708016650	PapC C-terminal domain; Region: PapC_C; pfam13953
568708016652	Signal peptide predicted for STM_MW36281 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 32 and 33
568708016653	long polar fimbrial chaperone LpfB; Provisional; Region: PRK15208
568708016654	Gram-negative pili assembly chaperone, N-terminal domain; Region: Pili_assembly_N; pfam00345
568708016655	Gram-negative pili assembly chaperone, C-terminal domain; Region: Pili_assembly_C; pfam02753
568708016658	1 probable transmembrane helix predicted for STM_MW36291 by TMHMM2.0 at aa 7-29
568708016659	Signal peptide predicted for STM_MW36291 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 23 and 24
568708016660	long polar fimbrial protein LpfA; Provisional; Region: PRK15209
568708016662	Signal peptide predicted for STM_MW36301 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 24 and 25
568708016663	Autotransporter protein or domain, integral membrane beta-barrel involved in protein secretion [Cell motility and secretion]; Region: COG5571
568708016665	1 probable transmembrane helix predicted for STM_MW36311 by TMHMM2.0 at aa 12-31
568708016666	Signal peptide predicted for STM_MW36311 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.667 between residues 30 and 31
568708016667	3-methyl-adenine DNA glycosylase I; Provisional; Region: PRK10353
568708016669	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
568708016670	Coenzyme A binding pocket [chemical binding]; other site
568708016672	The MopB_DMSOR-BSOR-TMAOR CD contains dimethylsulfoxide reductase (DMSOR), biotin sulfoxide reductase (BSOR),  trimethylamine N-oxide reductase (TMAOR) and other related proteins. DMSOR always catalyzes the reduction of DMSO to dimethylsulfide, but its...; Region: MopB_DMSOR-BSOR-TMAOR; cd02769
568708016673	molybdopterin guanine dinucleotide-containing S/N-oxide reductases; Region: bisC_fam; TIGR00509
568708016674	molybdopterin cofactor binding site [chemical binding]; other site
568708016675	substrate binding site [chemical binding]; other site
568708016676	The MopB_DMSOR-BSOR-TMAOR CD contains dimethylsulfoxide reductase (DMSOR), biotin sulfoxide reductase (BSOR),  trimethylamine N-oxide reductase (TMAOR) and other related proteins. DMSOR always catalyzes the reduction of DMSO to dimethylsulfide, but its...; Region: MopB_CT_DMSOR-BSOR-TMAOR; cd02793
568708016677	molybdopterin cofactor binding site; other site
568708016680	putative outer membrane lipoprotein; Provisional; Region: PRK10510
568708016681	Peptidoglycan binding domains similar to the C-terminal domain of outer-membrane protein OmpA; Region: OmpA_C-like; cd07185
568708016682	ligand binding site [chemical binding]; other site
568708016683	2 probable transmembrane helices predicted for STM_MW36351 by TMHMM2.0 at aa 25-44 and 51-73
568708016685	bifunctional glyoxylate/hydroxypyruvate reductase B; Provisional; Region: PRK15409
568708016686	D-glycerate dehydrogenase/hydroxypyruvate reductase (GDH); Region: GDH; cd05301
568708016687	dimerization interface [polypeptide binding]; other site
568708016688	ligand binding site [chemical binding]; other site
568708016689	NADP binding site [chemical binding]; other site
568708016690	catalytic site [active]
568708016693	Protein of unknown function (DUF3053); Region: DUF3053; pfam11254
568708016695	1 probable transmembrane helix predicted for STM_MW36371 by TMHMM2.0 at aa 10-27
568708016696	Predicted transcriptional regulator [Transcription]; Region: COG2944
568708016697	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
568708016698	salt bridge; other site
568708016699	non-specific DNA binding site [nucleotide binding]; other site
568708016700	sequence-specific DNA binding site [nucleotide binding]; other site
568708016702	Cold-Shock Protein (CSP) contains an S1-like cold-shock domain (CSD) that is found in eukaryotes, prokaryotes, and archaea.  CSP's include the major cold-shock proteins CspA and CspB in bacteria and the eukaryotic gene regulatory factor Y-box...; Region: CSP_CDS; cd04458
568708016703	DNA-binding site [nucleotide binding]; DNA binding site
568708016704	RNA-binding motif; other site
568708016706	Acetyltransferase (GNAT) domain; Region: Acetyltransf_7; pfam13508
568708016707	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4453
568708016709	Acetyltransferase (GNAT) domain; Region: Acetyltransf_10; pfam13673
568708016710	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
568708016711	Coenzyme A binding pocket [chemical binding]; other site
568708016713	glycyl-tRNA synthetase subunit beta; Validated; Region: glyS; PRK01233
568708016714	DALR anticodon binding domain; Region: DALR_1; pfam05746
568708016717	Class II Glycyl-tRNA synthetase (GlyRS) alpha subunit core catalytic domain. GlyRS functions as a homodimer in eukaryotes, archaea and some bacteria and as a heterotetramer in the remainder of prokaryotes and in arabidopsis. It is responsible for the...; Region: GlyRS_alpha_core; cd00733
568708016718	dimer interface [polypeptide binding]; other site
568708016719	motif 1; other site
568708016720	active site
568708016721	motif 2; other site
568708016722	motif 3; other site
568708016724	YsaB-like lipoprotein; Region: YsaB; pfam13983
568708016725	Signal peptide predicted for STM_MW36461 by SignalP 2.0 HMM (Signal peptide probability 0.990) with cleavage site probability 0.657 between residues 27 and 28
568708016726	Predicted O-acyltransferase [General function prediction only]; Region: COG3274
568708016727	Acyltransferase family; Region: Acyl_transf_3; pfam01757
568708016729	10 probable transmembrane helices predicted for STM_MW36471 by TMHMM2.0 at aa 13-30, 45-67, 79-101, 114-136, 143-160, 175-194, 201-223, 233-255, 268-288 and 303-321
568708016730	xylulokinase; Provisional; Region: PRK15027
568708016731	Escherichia coli xylulokinase-like D-xylulose kinases; a subgroup of the FGGY family of carbohydrate kinases; Region: FGGY_D-XK_EcXK-like; cd07808
568708016732	N- and C-terminal domain interface [polypeptide binding]; other site
568708016733	active site
568708016734	MgATP binding site [chemical binding]; other site
568708016735	catalytic site [active]
568708016736	metal binding site [ion binding]; metal-binding site
568708016737	xylulose binding site [chemical binding]; other site
568708016738	homodimer interface [polypeptide binding]; other site
568708016741	xylose isomerase; Provisional; Region: PRK05474
568708016742	xylose isomerase; Region: xylose_isom_A; TIGR02630
568708016744	Ligand-binding domain of DNA transcription repressor specific for xylose (XylR); Region: PBP1_XylR; cd01543
568708016745	putative dimerization interface [polypeptide binding]; other site
568708016746	Transcriptional regulators [Transcription]; Region: PurR; COG1609
568708016747	putative ligand binding site [chemical binding]; other site
568708016748	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708016749	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
568708016750	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708016752	hypothetical protein; Provisional; Region: PRK10356
568708016753	Uncharacterized FlgJ-related protein [General function prediction only]; Region: Bax; COG2992
568708016755	Signal peptide predicted for STM_MW36511 by SignalP 2.0 HMM (Signal peptide probability 0.995) with cleavage site probability 0.961 between residues 27 and 28
568708016756	alpha-amylase; Reviewed; Region: malS; PRK09505
568708016757	Alpha amylase catalytic domain family; Region: AmyAc_family; cl07893
568708016758	active site
568708016759	catalytic site [active]
568708016760	Signal peptide predicted for STM_MW36521 by SignalP 2.0 HMM (Signal peptide probability 0.987) with cleavage site probability 0.643 between residues 17 and 18
568708016762	valine--pyruvate transaminase; Provisional; Region: avtA; PRK09440
568708016763	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
568708016764	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708016765	homodimer interface [polypeptide binding]; other site
568708016766	catalytic residue [active]
568708016768	4Fe-4S dicluster domain; Region: Fer4_11; pfam13247
568708016770	Transcriptional regulator [Transcription]; Region: IclR; COG1414
568708016771	helix_turn_helix isocitrate lyase regulation; Region: HTH_ICLR; smart00346
568708016772	Bacterial transcriptional regulator; Region: IclR; pfam01614
568708016775	2,3-diketo-L-gulonate reductase; Provisional; Region: PRK13260
568708016777	Beta-galactosidase, beta subunit [Carbohydrate transport and metabolism]; Region: EbgC; COG2731
568708016779	2,3-diketo-L-gulonate TRAP transporter small permease protein YiaM; Provisional; Region: PRK09877
568708016780	4 probable transmembrane helices predicted for STM_MW36591 by TMHMM2.0 at aa 7-29, 44-66, 79-98 and 113-135
568708016782	L-dehydroascorbate transporter large permease subunit; Provisional; Region: PRK15060
568708016783	DctM-like transporters; Region: DctM; pfam06808
568708016784	Signal peptide predicted for STM_MW36601 by SignalP 2.0 HMM (Signal peptide probability 0.748) with cleavage site probability 0.369 between residues 33 and 34
568708016785	11 probable transmembrane helices predicted for STM_MW36601 by TMHMM2.0 at aa 4-26, 47-69, 93-124, 137-159, 169-191, 212-230, 234-256, 277-299, 314-347, 354-376 and 396-418
568708016787	TRAP-type C4-dicarboxylate transport system, periplasmic component [Carbohydrate transport and metabolism]; Region: DctP; COG1638
568708016788	tripartite ATP-independent periplasmic transporter solute receptor, DctP family; Region: dctP; TIGR00787
568708016789	Signal peptide predicted for STM_MW36611 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.986 between residues 24 and 25
568708016791	Sugar (pentulose and hexulose) kinases [Carbohydrate transport and metabolism]; Region: XylB; COG1070
568708016792	L-xylulose kinases; a subfamily of the FGGY family of carbohydrate kinases; Region: FGGY_L-XK; cd07802
568708016793	putative N- and C-terminal domain interface [polypeptide binding]; other site
568708016794	putative active site [active]
568708016795	MgATP binding site [chemical binding]; other site
568708016796	catalytic site [active]
568708016797	metal binding site [ion binding]; metal-binding site
568708016798	putative xylulose binding site [chemical binding]; other site
568708016801	3-Keto-L-gulonate 6-phosphate decarboxylase (KGPDC) and D-arabino-3-hexulose-6-phosphate synthase (HPS). KGPDC catalyzes the formation of L-xylulose 5-phosphate and carbon dioxide from 3-keto-L-gulonate 6-phosphate as part of the anaerobic pathway for...; Region: KGPDC_HPS; cd04726
568708016802	active site
568708016803	dimer interface [polypeptide binding]; other site
568708016804	magnesium binding site [ion binding]; other site
568708016806	putative L-xylulose 5-phosphate 3-epimerase; Reviewed; Region: PRK13210
568708016807	AP endonuclease family 2; These endonucleases play a role in DNA repair. Cleave phosphodiester bonds at apurinic or apyrimidinic sites; the alignment also contains hexulose-6-phosphate isomerases, enzymes that catalyze the epimerization of...; Region: AP2Ec; cd00019
568708016808	AP (apurinic/apyrimidinic) site pocket; other site
568708016809	DNA interaction; other site
568708016810	Metal-binding active site; metal-binding site
568708016812	L-ribulose-5-phosphate 4-epimerase; Reviewed; Region: araD; PRK08193
568708016813	Class II Aldolase and Adducin head (N-terminal) domain. Aldolases are ubiquitous enzymes catalyzing central steps of carbohydrate metabolism. Based on enzymatic mechanisms, this superfamily has been divided into two distinct classes (Class I and II); Region: Aldolase_II; cd00398
568708016814	intersubunit interface [polypeptide binding]; other site
568708016815	active site
568708016816	Zn2+ binding site [ion binding]; other site
568708016818	AraC-like ligand binding domain; Region: AraC_binding; pfam02311
568708016819	AraC-type DNA-binding domain-containing proteins [Transcription]; Region: AraC; COG2207
568708016820	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708016823	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3533
568708016824	Putative glycosyl hydrolase of unknown function (DUF1680); Region: DUF1680; pfam07944
568708016826	Ralstonia eutrophus NAD+-dependent acetaldehyde dehydrogenase II-like; Region: ALDH_ACDHII-AcoD; cd07116
568708016827	Aldehyde dehydrogenase family; Region: Aldedh; pfam00171
568708016828	NAD(P) binding site [chemical binding]; other site
568708016829	catalytic residues [active]
568708016831	Transcriptional regulator/sugar kinase [Transcription / Carbohydrate transport and metabolism]; Region: NagC; COG1940
568708016832	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cd00012
568708016833	nucleotide binding site [chemical binding]; other site
568708016835	selenocysteinyl-tRNA-specific translation factor; Provisional; Region: PRK10512
568708016836	SelB, the dedicated elongation factor for delivery of selenocysteinyl-tRNA to the ribosome; Region: SelB; cd04171
568708016837	G1 box; other site
568708016838	putative GEF interaction site [polypeptide binding]; other site
568708016839	GTP/Mg2+ binding site [chemical binding]; other site
568708016840	Switch I region; other site
568708016841	G2 box; other site
568708016842	G3 box; other site
568708016843	Switch II region; other site
568708016844	G4 box; other site
568708016845	G5 box; other site
568708016846	selB_II: this subfamily represents the domain of elongation factor SelB, homologous to domain II of EF-Tu. SelB may function by replacing EF-Tu. In prokaryotes, the incorporation of selenocysteine as the 21st amino acid, encoded by TGA, requires several...; Region: selB_II; cd03696
568708016847	This family represents the domain of elongation factor SelB, homologous to domain III of EF-Tu. SelB may function by replacing EF-Tu. In prokaryotes, the incorporation of selenocysteine as the 21st amino acid, encoded by TGA, requires several elements:...; Region: selB_III; cd04094
568708016848	Elongation factor SelB, winged helix; Region: SelB-wing_2; pfam09106
568708016849	Elongation factor SelB, winged helix; Region: SelB-wing_3; pfam09107
568708016854	selenocysteine synthase; Provisional; Region: PRK04311
568708016855	Selenocysteine synthase N terminal; Region: Se-cys_synth_N; pfam12390
568708016856	Selenocysteine synthase [seryl-tRNASer selenium transferase] [Amino acid transport and metabolism]; Region: SelA; COG1921
568708016857	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
568708016858	catalytic residue [active]
568708016860	putative glutathione S-transferase; Provisional; Region: PRK10357
568708016861	GST_N family, unknown subfamily 3; composed of uncharacterized bacterial proteins with similarity to GSTs. GSTs are cytosolic dimeric proteins involved in cellular detoxification by catalyzing the conjugation of glutathione (GSH) with a wide range of...; Region: GST_N_3; cd03049
568708016862	putative C-terminal domain interface [polypeptide binding]; other site
568708016863	putative GSH binding site (G-site) [chemical binding]; other site
568708016864	putative dimer interface [polypeptide binding]; other site
568708016865	C-terminal, alpha helical domain of an unknown subfamily 6 of Glutathione S-transferases; Region: GST_C_6; cd03205
568708016866	dimer interface [polypeptide binding]; other site
568708016867	N-terminal domain interface [polypeptide binding]; other site
568708016868	putative substrate binding pocket (H-site) [chemical binding]; other site
568708016871	PTS system mannitol-specific transporter subunit IICBA; Provisional; Region: PRK15083
568708016872	PTS system, mannitol-specific IIC component; Region: mtlA; TIGR00851
568708016873	PTS_IIB_mannitol: subunit IIB of enzyme II (EII) of the mannitol-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS). In this system, EII is a mannitol-specific permease with two cytoplasmic domains (IIA and IIB) and a transmembrane...; Region: PTS_IIB_mannitol; cd05567
568708016874	active site
568708016875	P-loop; other site
568708016876	phosphorylation site [posttranslational modification]
568708016877	PTS_IIA, PTS system, fructose/mannitol specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This...; Region: PTS_IIA_fru; cd00211
568708016878	active site
568708016879	phosphorylation site [posttranslational modification]
568708016881	8 probable transmembrane helices predicted for STM_MW36731 by TMHMM2.0 at aa 20-42, 52-74, 87-109, 129-151, 212-234, 244-263, 270-292 and 312-334
568708016884	mannitol-1-phosphate 5-dehydrogenase; Provisional; Region: PRK02318
568708016885	Mannitol dehydrogenase Rossmann domain; Region: Mannitol_dh; pfam01232
568708016886	Mannitol dehydrogenase C-terminal domain; Region: Mannitol_dh_C; pfam08125
568708016889	Transcriptional regulator [Transcription]; Region: MtlR; COG3722
568708016890	mannitol repressor protein; Provisional; Region: mtlR; PRK11001
568708016892	hypothetical protein; Provisional; Region: PRK11020
568708016894	Protein of unknown function (DUF3251); Region: DUF3251; cl08186
568708016895	Signal peptide predicted for STM_MW36781 by SignalP 2.0 HMM (Signal peptide probability 0.821) with cleavage site probability 0.749 between residues 21 and 22
568708016897	Extended Signal Peptide of Type V secretion system; Region: ESPR; pfam13018
568708016898	YadA-like, left-handed beta-roll; Region: LbR_YadA-like; cd12820
568708016899	trimer interface [polypeptide binding]; other site
568708016900	Autotransporter adhesin [Intracellular trafficking and secretion / Extracellular structures]; Region: Hia; COG5295
568708016901	Haemagglutinin; Region: HIM; pfam05662
568708016902	Haemagglutinin; Region: HIM; pfam05662
568708016903	YadA-like C-terminal region; Region: YadA; pfam03895
568708016904	Signal peptide predicted for STM_MW36791 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.470 between residues 50 and 51
568708016908	L-lactate permease; Provisional; Region: PRK10420
568708016909	glycolate transporter; Provisional; Region: PRK09695
568708016910	12 probable transmembrane helices predicted for STM_MW36801 by TMHMM2.0 at aa 10-32, 39-58, 68-90, 119-141, 156-178, 199-218, 244-266, 299-321, 368-387, 407-424, 434-456 and 528-550
568708016912	DNA-binding transcriptional repressor LldR; Provisional; Region: PRK10421
568708016913	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
568708016914	DNA-binding site [nucleotide binding]; DNA binding site
568708016915	FCD domain; Region: FCD; pfam07729
568708016918	L-lactate dehydrogenase; Provisional; Region: lldD; PRK11197
568708016919	Family of homologous FMN-dependent alpha-hydroxyacid oxidizing enzymes. This family occurs in both prokaryotes and eukaryotes. Members of this family include flavocytochrome b2 (FCB2), glycolate oxidase (GOX), lactate monooxygenase (LMO), mandelate...; Region: alpha_hydroxyacid_oxid_FMN; cd02809
568708016920	active site
568708016921	substrate binding site [chemical binding]; other site
568708016922	FMN binding site [chemical binding]; other site
568708016923	putative catalytic residues [active]
568708016925	putative rRNA methylase; Provisional; Region: PRK10358
568708016927	Transcriptional regulators [Transcription]; Region: PurR; COG1609
568708016928	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
568708016929	DNA binding site [nucleotide binding]
568708016930	domain linker motif; other site
568708016931	Ligand-binding domain of DNA transcription repressor GntR specific for gluconate, a member of the LacI-GalR family of bacterial transcription regulators; Region: PBP1_GntR; cd01575
568708016932	putative dimerization interface [polypeptide binding]; other site
568708016933	putative ligand binding site [chemical binding]; other site
568708016936	L-alanine-DL-glutamate epimerase and related enzymes of enolase superfamily [Cell envelope biogenesis, outer membrane / General function prediction only]; Region: COG4948
568708016937	Mandelate racemase (MR)-like subfamily of the enolase superfamily. Enzymes of this subgroup share three conserved carboxylate ligands for the essential divalent metal ion (usually Mg2+), two aspartates and a glutamate, and conserved catalytic residues; Region: MR_like; cd03316
568708016938	active site pocket [active]
568708016941	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708016942	D-galactonate transporter; Region: 2A0114; TIGR00893
568708016943	putative substrate translocation pore; other site
568708016944	Signal peptide predicted for STM_MW36861 by SignalP 2.0 HMM (Signal peptide probability 0.800) with cleavage site probability 0.782 between residues 27 and 28
568708016945	12 probable transmembrane helices predicted for STM_MW36861 by TMHMM2.0 at aa 13-35, 50-72, 79-101, 105-127, 140-162, 172-189, 240-262, 277-299, 311-333, 338-360, 372-394 and 404-426
568708016947	serine acetyltransferase; Provisional; Region: cysE; PRK11132
568708016948	Serine acetyltransferase, N-terminal; Region: SATase_N; pfam06426
568708016949	Serine acetyltransferase (SAT): SAT catalyzes the CoA-dependent acetylation of the side chain hydroxyl group of L-serine to form O-acetylserine, as the first step of a two-step biosynthetic pathway in bacteria and plants leading to the formation of...; Region: LbH_SAT; cd03354
568708016950	trimer interface [polypeptide binding]; other site
568708016951	active site
568708016952	substrate binding site [chemical binding]; other site
568708016953	CoA binding site [chemical binding]; other site
568708016955	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase; Validated; Region: gpsA; PRK00094
568708016956	NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus; Region: NAD_Gly3P_dh_N; pfam01210
568708016957	NAD-dependent glycerol-3-phosphate dehydrogenase C-terminus; Region: NAD_Gly3P_dh_C; pfam07479
568708016960	Signal peptide predicted for STM_MW36881 by SignalP 2.0 HMM (Signal peptide probability 0.796) with cleavage site probability 0.748 between residues 21 and 22
568708016961	Preprotein translocase subunit SecB. SecB is a cytoplasmic component of the multisubunit membrane-bound enzyme termed Sec protein translocase, which is the main constituent of the General Secretory (type II) Pathway involved in translocation of nascent...; Region: Translocase_SecB; cd00557
568708016962	SecA binding site; other site
568708016963	Preprotein binding site; other site
568708016965	Glutaredoxin (GRX) family, GRX bacterial class 1 and 3 (b_1_3)-like subfamily; composed of bacterial GRXs, approximately 10 kDa in size, and proteins containing a GRX or GRX-like domain. GRX is a glutathione (GSH) dependent reductase, catalyzing the...; Region: GRX_GRXb_1_3_like; cd03418
568708016966	GSH binding site [chemical binding]; other site
568708016967	catalytic residues [active]
568708016969	Rhodanese Homology Domain (RHOD); an alpha beta fold domain found duplicated in the rhodanese protein. The cysteine containing enzymatically active version of the domain is also found in the Cdc25 class of protein phosphatases and a variety of proteins...; Region: RHOD; cd00158
568708016970	active site residue [active]
568708016972	1 probable transmembrane helix predicted for STM_MW36911 by TMHMM2.0 at aa 7-29
568708016973	phosphoglyceromutase; Provisional; Region: PRK05434
568708016974	2,3-bisphosphoglycerate-independent phosphoglycerate mutase; Region: pgm_bpd_ind; TIGR01307
568708016977	AmiB activator; Provisional; Region: PRK11637
568708016978	putative uroporphyrinogen III C-methyltransferase; Provisional; Region: PRK10920
568708016979	Peptidase family M23; Region: Peptidase_M23; pfam01551
568708016980	Signal peptide predicted for STM_MW36931 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 42 and 43
568708016982	Putative catalytic domain of family 2 polysaccharide deacetylases (DACs) from bacteria; Region: CE4_DAC2; cd10936
568708016983	NodB motif; other site
568708016984	putative active site [active]
568708016985	putative catalytic site [active]
568708016986	Zn binding site [ion binding]; other site
568708016987	Signal peptide predicted for STM_MW36941 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 23 and 24
568708016988	1 probable transmembrane helix predicted for STM_MW36941 by TMHMM2.0 at aa 7-29
568708016990	putative glycosyl transferase; Provisional; Region: PRK10073
568708016991	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cd00761
568708016992	active site
568708016995	L-threonine 3-dehydrogenase; Validated; Region: tdh; PRK05396
568708016996	Medium chain reductase/dehydrogenase (MDR)/zinc-dependent alcohol dehydrogenase-like family; Region: MDR; cl16912
568708016997	NAD(P) binding site [chemical binding]; other site
568708017000	pyridoxal phosphate-dependent acyltransferase, putative; Region: gly_Cac_T_rel; TIGR01825
568708017001	KBL_like; this family belongs to the pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD corresponds to serine palmitoyltransferase (SPT), 5-aminolevulinate synthase (ALAS); Region: KBL_like; cd06454
568708017002	substrate-cofactor binding pocket; other site
568708017003	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708017004	catalytic residue [active]
568708017006	ADP-L-glycero-D-mannoheptose 6-epimerase (GME), extended (e) SDRs; Region: ADP_GME_SDR_e; cd05248
568708017007	ADP-L-glycero-D-mannoheptose-6-epimerase; Provisional; Region: rfaD; PRK11150
568708017008	NADP binding site [chemical binding]; other site
568708017009	homopentamer interface [polypeptide binding]; other site
568708017010	substrate binding site [chemical binding]; other site
568708017011	active site
568708017013	ADP-heptose:LPS heptosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaF; COG0859
568708017014	Lipopolysaccharide heptosyltransferase is involved in the biosynthesis of lipooligosaccharide (LOS). Lipopolysaccharide (LPS) is a major component of the outer membrane of gram-negative bacteria. LPS heptosyltransferase transfers heptose molecules from...; Region: GT1_LPS_heptosyltransferase; cd03789
568708017015	putative active site [active]
568708017017	Lipopolysaccharide heptosyltransferase is involved in the biosynthesis of lipooligosaccharide (LOS). Lipopolysaccharide (LPS) is a major component of the outer membrane of gram-negative bacteria. LPS heptosyltransferase transfers heptose molecules from...; Region: GT1_LPS_heptosyltransferase; cd03789
568708017018	Glycosyltransferase family 9 (heptosyltransferase); Region: Glyco_transf_9; pfam01075
568708017019	putative active site [active]
568708017021	Lipid A core - O-antigen ligase and related enzymes [Cell envelope biogenesis, outer membrane]; Region: RfaL; COG3307
568708017022	O-antigen ligase RfaL; Provisional; Region: PRK15487
568708017023	10 probable transmembrane helices predicted for STM_MW37021 by TMHMM2.0 at aa 21-53, 68-85, 126-145, 160-182, 189-206, 210-225, 230-247, 325-347, 360-379 and 383-401
568708017025	lipopolysaccharide 1,2-N-acetylglucosaminetransferase; Provisional; Region: PRK15484
568708017026	This family is most closely related to the GT1 family of glycosyltransferases and named after YqgM in Bacillus licheniformis about which little is known. Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to...; Region: GT1_YqgM_like; cd03801
568708017028	Signal peptide predicted for STM_MW37031 by SignalP 2.0 HMM (Signal peptide probability 0.986) with cleavage site probability 0.880 between residues 22 and 23
568708017029	lipopolysaccharide core biosynthesis protein; Provisional; Region: PRK09822
568708017030	Lipopolysaccharide core biosynthesis protein (WaaY); Region: WaaY; pfam06176
568708017032	lipopolysaccharide 1,3-galactosyltransferase; Provisional; Region: PRK15171
568708017033	A4GalT_like proteins catalyze the addition of galactose or glucose residues to the lipooligosaccharide (LOS) or lipopolysaccharide (LPS) of the bacterial cell surface; Region: GT8_A4GalT_like; cd04194
568708017034	Ligand binding site; other site
568708017035	metal-binding site
568708017036	Glycosyl transferase family 8 C-terminal; Region: Glyco_transf_8C; pfam08437
568708017039	lipopolysaccharide 1,3-galactosyltransferase; Provisional; Region: PRK15171
568708017040	A4GalT_like proteins catalyze the addition of galactose or glucose residues to the lipooligosaccharide (LOS) or lipopolysaccharide (LPS) of the bacterial cell surface; Region: GT8_A4GalT_like; cd04194
568708017041	Ligand binding site; other site
568708017042	metal-binding site
568708017043	Glycosyl transferase family 8 C-terminal; Region: Glyco_transf_8C; pfam08437
568708017046	UDP-D-galactose:(glucosyl)lipopolysaccharide-1, 6-D-galactosyltransferase; Provisional; Region: PRK09922
568708017047	This family is most closely related to the GT1 family of glycosyltransferases. WabH in Klebsiella pneumoniae has been shown to transfer a GlcNAc residue from UDP-GlcNAc onto the acceptor GalUA residue in the cellular outer core; Region: GT1_WabH_like; cd03811
568708017048	putative ADP-binding pocket [chemical binding]; other site
568708017050	Lipopolysaccharide biosynthesis proteins, LPS:glycosyltransferases [Cell envelope biogenesis, outer membrane]; Region: RfaJ; COG1442
568708017051	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394
568708017052	lipopolysaccharide core heptose(I) kinase RfaP; Provisional; Region: PRK15123
568708017054	Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438
568708017055	This family is most closely related to the GT1 family of glycosyltransferases and named after YqgM in Bacillus licheniformis about which little is known. Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to...; Region: GT1_YqgM_like; cd03801
568708017057	lipopolysaccharide core biosynthesis protein; Provisional; Region: PRK10422
568708017058	Lipopolysaccharide heptosyltransferase is involved in the biosynthesis of lipooligosaccharide (LOS). Lipopolysaccharide (LPS) is a major component of the outer membrane of gram-negative bacteria. LPS heptosyltransferase transfers heptose molecules from...; Region: GT1_LPS_heptosyltransferase; cd03789
568708017059	putative active site [active]
568708017061	3-deoxy-D-manno-octulosonic-acid transferase [Cell envelope biogenesis, outer membrane]; Region: KdtA; COG1519
568708017062	3-Deoxy-D-manno-octulosonic-acid transferase (kdotransferase); Region: Glycos_transf_N; pfam04413
568708017063	Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. The acceptor molecule can be a lipid, a protein, a heterocyclic compound, or another carbohydrate...; Region: Glycosyltransferase_GTB_type; cl10013
568708017066	phosphopantetheine adenylyltransferase; Provisional; Region: coaD; PRK00168
568708017067	Phosphopantetheine adenylyltransferase; Region: PPAT; cd02163
568708017068	active site
568708017069	(T/H)XGH motif; other site
568708017071	formamidopyrimidine/5-formyluracil/ 5-hydroxymethyluracil DNA glycosylase; Validated; Region: PRK01103
568708017072	N-terminal domain of Escherichia coli Fpg1/MutM and related bacterial DNA glycosylases; Region: EcFpg-like_N; cd08966
568708017073	DNA binding site [nucleotide binding]
568708017074	catalytic residue [active]
568708017075	H2TH interface [polypeptide binding]; other site
568708017076	putative catalytic residues [active]
568708017077	turnover-facilitating residue; other site
568708017078	intercalation triad [nucleotide binding]; other site
568708017079	8OG recognition residue [nucleotide binding]; other site
568708017080	putative reading head residues; other site
568708017081	Formamidopyrimidine-DNA glycosylase H2TH domain; Region: H2TH; pfam06831
568708017082	Zinc finger found in FPG and IleRS; Region: zf-FPG_IleRS; pfam06827
568708017086	50S ribosomal protein L33; Validated; Region: rpmG; PRK00595
568708017088	50S ribosomal protein L28; Reviewed; Region: rpmB; PRK00359
568708017090	hypothetical protein; Reviewed; Region: PRK00024
568708017091	Mov34/MPN/PAD-1 family; Region: MPN_DUF2466; cd08071
568708017092	MPN+ (JAMM) motif; other site
568708017093	Zinc-binding site [ion binding]; other site
568708017095	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate synthase; Validated; Region: PRK05579
568708017096	Flavoprotein; Region: Flavoprotein; pfam02441
568708017097	DNA / pantothenate metabolism flavoprotein; Region: DFP; pfam04127
568708017100	Trimeric dUTP diphosphatases; Region: trimeric_dUTPase; cd07557
568708017101	trimer interface [polypeptide binding]; other site
568708017102	active site
568708017104	division inhibitor protein; Provisional; Region: slmA; PRK09480
568708017105	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
568708017107	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
568708017108	active site
568708017110	ribonuclease PH; Reviewed; Region: rph; PRK00173
568708017111	Ribonuclease PH; Region: RNase_PH_bact; cd11362
568708017112	hexamer interface [polypeptide binding]; other site
568708017113	active site
568708017116	hypothetical protein; Provisional; Region: PRK11820
568708017117	YicC-like family, N-terminal region; Region: YicC_N; pfam03755
568708017118	Domain of unknown function (DUF1732); Region: DUF1732; pfam08340
568708017121	Transcriptional regulator [Transcription]; Region: LysR; COG0583
568708017122	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708017123	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
568708017124	dimerization interface [polypeptide binding]; other site
568708017127	Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849
568708017128	Signal peptide predicted for STM_MW37261 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 21 and 22
568708017130	Predicted membrane protein [Function unknown]; Region: COG2860
568708017131	UPF0126 domain; Region: UPF0126; pfam03458
568708017132	UPF0126 domain; Region: UPF0126; pfam03458
568708017134	7 probable transmembrane helices predicted for STM_MW37271 by TMHMM2.0 at aa 5-22, 29-51, 64-81, 88-109, 114-136, 148-167 and 172-189
568708017135	NAD-dependent DNA ligase LigB; Reviewed; Region: ligB; PRK08097
568708017136	NAD+ dependent DNA ligase adenylation domain. DNA ligases catalyze the crucial step of joining the breaks in duplex DNA during DNA replication, repair and recombination, utilizing either ATP or NAD(+) as a cofactor, but using the same basic reaction...; Region: LIGANc; cl03295
568708017137	nucleotide binding pocket [chemical binding]; other site
568708017138	K-X-D-G motif; other site
568708017139	catalytic site [active]
568708017140	NAD-dependent DNA ligase OB-fold domain; Region: DNA_ligase_OB; pfam03120
568708017143	Signal peptide predicted for STM_MW37281 by SignalP 2.0 HMM (Signal peptide probability 0.761) with cleavage site probability 0.676 between residues 30 and 31
568708017144	Guanylate kinase [Nucleotide transport and metabolism]; Region: Gmk; COG0194
568708017145	Guanosine monophosphate kinase (GMPK, EC 2.7.4.8), also known as guanylate kinase (GKase), catalyzes the reversible phosphoryl transfer from adenosine triphosphate (ATP) to guanosine monophosphate (GMP) to yield adenosine diphosphate (ADP) and guanosine...; Region: GMPK; cd00071
568708017146	catalytic site [active]
568708017147	G-X2-G-X-G-K; other site
568708017149	DNA-directed RNA polymerase, omega subunit; Region: rpoZ; TIGR00690
568708017151	bifunctional (p)ppGpp synthetase II/ guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase; Provisional; Region: PRK11092
568708017152	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
568708017153	Zn2+ binding site [ion binding]; other site
568708017154	Mg2+ binding site [ion binding]; other site
568708017155	Nucleotidyltransferase (NT) domain of RelA- and SpoT-like ppGpp synthetases and hydrolases; Region: NT_Rel-Spo_like; cd05399
568708017156	synthetase active site [active]
568708017157	NTP binding site [chemical binding]; other site
568708017158	metal binding site [ion binding]; metal-binding site
568708017159	TGS_RelA_SpoT: The RelA (SpoT) protein, also referred to as ppGpp hydrolase/synthetase, is a ribosome-associated protein that is activated during amino acid starvation and thought to mediate the stringent response. RelA contains a TGS domain, named after...; Region: TGS_RelA_SpoT; cd01668
568708017160	ACT  domain found C-terminal of the RelA/SpoT domains; Region: ACT_RelA-SpoT; cd04876
568708017164	tRNA guanosine-2'-O-methyltransferase; Provisional; Region: PRK11081
568708017165	SpoU rRNA Methylase family; Region: SpoU_methylase; pfam00588
568708017166	SpoU, rRNA methylase, C-terminal; Region: SpoU_methylas_C; pfam12105
568708017168	ATP-dependent DNA helicase RecG; Provisional; Region: PRK10917
568708017169	RecG_wedge_OBF: A subfamily of OB folds corresponding to the OB fold found in the N-terminal (wedge) domain of Escherichia coli RecG. RecG is a branched-DNA-specific helicase, which catalyzes the interconversion of a DNA replication fork to a...; Region: RecG_wedge_OBF; cd04488
568708017170	generic binding surface II; other site
568708017171	ssDNA binding site; other site
568708017172	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
568708017173	ATP binding site [chemical binding]; other site
568708017174	putative Mg++ binding site [ion binding]; other site
568708017175	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
568708017176	nucleotide binding region [chemical binding]; other site
568708017177	ATP-binding site [chemical binding]; other site
568708017182	sodium--glutamate symport carrier (gltS); Region: gltS; TIGR00210
568708017184	9 probable transmembrane helices predicted for STM_MW37351 by TMHMM2.0 at aa 70-87, 94-116, 157-179, 213-235, 245-267, 274-292, 302-324, 336-358 and 368-390
568708017185	Xanthine/uracil permeases [Nucleotide transport and metabolism]; Region: UraA; COG2233
568708017187	11 probable transmembrane helices predicted for STM_MW37361 by TMHMM2.0 at aa 43-65, 90-112, 127-149, 156-178, 193-212, 219-241, 261-283, 346-368, 378-400, 407-429 and 439-458
568708017188	AsmA family; Region: AsmA; pfam05170
568708017189	Signal peptide predicted for STM_MW37371 by SignalP 2.0 HMM (Signal peptide probability 0.708) with cleavage site probability 0.479 between residues 31 and 32
568708017191	1 probable transmembrane helix predicted for STM_MW37371 by TMHMM2.0 at aa 7-26
568708017192	putative alpha-glucosidase; Provisional; Region: PRK10658
568708017193	Galactose mutarotase-like; Region: Gal_mutarotas_2; pfam13802
568708017194	YicI alpha-xylosidase is a glycosyl hydrolase family 31 (GH31) enzyme that catalyzes the release of an alpha-xylosyl residue from the non-reducing end of alpha-xyloside substrates such as alpha-xylosyl fluoride and isoprimeverose. YicI forms a...; Region: GH31_xylosidase_YicI; cd06593
568708017195	active site
568708017196	homotrimer interface [polypeptide binding]; other site
568708017197	catalytic site [active]
568708017198	homohexamer (dimer of homotrimers) interface [polypeptide binding]; other site
568708017200	putative transporter; Provisional; Region: PRK11462
568708017201	Na+/melibiose symporter and related transporters [Carbohydrate transport and metabolism]; Region: MelB; COG2211
568708017202	11 probable transmembrane helices predicted for STM_MW37391 by TMHMM2.0 at aa 32-54, 81-100, 115-137, 150-170, 180-202, 232-254, 264-286, 293-315, 319-341, 362-384 and 399-421
568708017204	Virulence protein [General function prediction only]; Region: COG3943
568708017205	Virulence protein RhuM family; Region: Virulence_RhuM; pfam13310
568708017206	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
568708017207	Transposase; Region: HTH_Tnp_1; pfam01527
568708017209	autotransport protein MisL; Provisional; Region: PRK15313
568708017210	Pertactin-like passenger domains (virulence factors), C-terminal, subgroup 2, of autotransporter proteins of the type V secretion system of Gram-negative bacteria. This subgroup includes the passenger domains of the nonprotease autotransporters, Ag43; Region: PL2_Passenger_AT; cd01344
568708017211	Autotransporter beta-domain; Region: Autotransporter; pfam03797
568708017212	Signal peptide predicted for STM_MW37461 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.997 between residues 27 and 28
568708017213	1 probable transmembrane helix predicted for STM_MW37461 by TMHMM2.0 at aa 7-29
568708017216	DNA-binding winged-HTH domains [Transcription]; Region: CadC; COG3710
568708017217	DNA binding site [nucleotide binding]
568708017219	1 probable transmembrane helix predicted for STM_MW37481 by TMHMM2.0 at aa 170-192
568708017220	Isochorismatase family; Region: Isochorismatase; pfam00857
568708017221	YcaC related amidohydrolases; E.coli YcaC is an homooctameric hydrolase with unknown specificity. Despite its weak sequence similarity, it is structurally related to other amidohydrolases and shares conserved active site residues with them; Region: YcaC_related; cd01012
568708017222	catalytic triad [active]
568708017223	dimer interface [polypeptide binding]; other site
568708017224	conserved cis-peptide bond; other site
568708017226	2 probable transmembrane helices predicted for STM_MW37511 by TMHMM2.0 at aa 7-26 and 135-157
568708017227	Signal peptide predicted for STM_MW37511 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.977 between residues 26 and 27
568708017228	magnesium-transporting ATPase; Provisional; Region: PRK15122
568708017229	Cation transporter/ATPase, N-terminus; Region: Cation_ATPase_N; smart00831
568708017230	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
568708017231	Putative hydrolase of sodium-potassium ATPase alpha subunit; Region: Hydrolase_like2; pfam13246
568708017232	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708017233	motif II; other site
568708017234	Cation transporting ATPase, C-terminus; Region: Cation_ATPase_C; pfam00689
568708017235	8 probable transmembrane helices predicted for STM_MW37521 by TMHMM2.0 at aa 87-105, 115-134, 293-315, 325-347, 719-741, 779-801, 844-866 and 876-893
568708017240	magnesium transport protein MgtC; Provisional; Region: PRK15385
568708017241	MgtC family; Region: MgtC; pfam02308
568708017243	4 probable transmembrane helices predicted for STM_MW37531 by TMHMM2.0 at aa 5-27, 34-56, 66-83 and 90-112
568708017244	EamA-like transporter family; Region: EamA; pfam00892
568708017245	Carboxylate/Amino Acid/Amine Transporter; Region: 2A78; TIGR00950
568708017246	EamA-like transporter family; Region: EamA; pfam00892
568708017247	Signal peptide predicted for STM_MW37541 by SignalP 2.0 HMM (Signal peptide probability 0.968) with cleavage site probability 0.960 between residues 25 and 26
568708017248	10 probable transmembrane helices predicted for STM_MW37541 by TMHMM2.0 at aa 7-29, 39-59, 72-94, 98-120, 127-144, 154-176, 183-205, 215-237, 250-272 and 276-293
568708017250	hypothetical protein; Provisional; Region: PRK09956
568708017251	Putative transposase, YhgA-like; Region: Transposase_31; pfam04754
568708017253	conserved hypothetical protein EF_0839/AHA_3917; Region: EF_0839; TIGR03581
568708017255	pfam_scan;Pfam:PF03841; E()=1.3E-20;score=73.1;query14-280;description=SelA
568708017257	Phosphotransferase system, mannose/fructose/N-acetylgalactosamine-specific component IID [Carbohydrate transport and metabolism]; Region: ManZ; COG3716
568708017258	5 probable transmembrane helices predicted for STM_MW37581 by TMHMM2.0 at aa 129-148, 152-174, 198-217, 237-259 and 266-285
568708017260	Phosphotransferase system, mannose/fructose/N-acetylgalactosamine-specific component IIC [Carbohydrate transport and metabolism]; Region: ManY; COG3715
568708017262	5 probable transmembrane helices predicted for STM_MW37591 by TMHMM2.0 at aa 21-43, 93-110, 141-163, 178-200 and 207-239
568708017263	PTS_IIB, PTS system, Mannose/sorbose specific IIB subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIB_man; cd00001
568708017264	active site
568708017265	phosphorylation site [posttranslational modification]
568708017267	PTS_IIA, PTS system, mannose/sorbose specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIA_man; cd00006
568708017268	active pocket/dimerization site; other site
568708017269	active site
568708017270	phosphorylation site [posttranslational modification]
568708017272	Transcriptional regulators containing an AAA-type ATPase domain and a DNA-binding domain [Transcription / Signal transduction mechanisms]; Region: PspF; COG1221
568708017273	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708017274	Walker A motif; other site
568708017275	ATP binding site [chemical binding]; other site
568708017276	Walker B motif; other site
568708017277	arginine finger; other site
568708017278	Transcriptional antiterminator [Transcription]; Region: COG3933
568708017279	PTS_IIA, PTS system, mannose/sorbose specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIA_man; cl00025
568708017280	active site
568708017281	active pocket/dimerization site; other site
568708017282	phosphorylation site [posttranslational modification]
568708017283	PRD domain; Region: PRD; pfam00874
568708017286	Signal peptide predicted for STM_MW37631 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 21 and 22
568708017287	Beta-glucosidase/6-phospho-beta-glucosidase/beta- galactosidase [Carbohydrate transport and metabolism]; Region: BglB; COG2723
568708017288	beta-galactosidase; Region: BGL; TIGR03356
568708017290	ribonucleoside transporter; Reviewed; Region: nepI; PRK10213
568708017291	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708017292	putative substrate translocation pore; other site
568708017293	12 probable transmembrane helices predicted for STM_MW37651 by TMHMM2.0 at aa 20-42, 57-79, 86-105, 110-132, 145-167, 177-196, 217-239, 254-276, 283-302, 307-329, 341-363 and 367-389
568708017295	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4737
568708017297	Predicted transcriptional regulator [Transcription]; Region: COG2944
568708017298	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
568708017299	non-specific DNA binding site [nucleotide binding]; other site
568708017300	salt bridge; other site
568708017301	sequence-specific DNA binding site [nucleotide binding]; other site
568708017303	Histidine-containing phosphocarrier protein (HPr)-like proteins. HPr is a central component of the bacterial phosphoenolpyruvate sugar phosphotransferase system (PTS). The PTS catalyses the phosphorylation of sugar substrates during their translocation...; Region: PTS-HPr_like; cd00367
568708017304	dimerization domain swap beta strand [polypeptide binding]; other site
568708017305	regulatory protein interface [polypeptide binding]; other site
568708017306	active site
568708017307	regulatory phosphorylation site [posttranslational modification]; other site
568708017309	Tagatose-1,6-bisphosphate (TBP) aldolase and related Type B Class II aldolases. TBP aldolase is a tetrameric class II aldolase that catalyzes the reversible condensation of dihydroxyacetone phosphate with glyceraldehyde 3-phsophate to produce tagatose 1; Region: TBP_aldolase_IIB; cd00947
568708017310	intersubunit interface [polypeptide binding]; other site
568708017311	active site
568708017312	zinc binding site [ion binding]; other site
568708017313	Na+ binding site [ion binding]; other site
568708017315	Sugar (pentulose and hexulose) kinases [Carbohydrate transport and metabolism]; Region: XylB; COG1070
568708017316	uncharacterized subgroup; belongs to the FGGY family of carbohydrate kinases; Region: FGGY_1; cd07774
568708017317	putative N- and C-terminal domain interface [polypeptide binding]; other site
568708017318	putative active site [active]
568708017319	putative MgATP binding site [chemical binding]; other site
568708017320	catalytic site [active]
568708017321	metal binding site [ion binding]; metal-binding site
568708017322	putative carbohydrate binding site [chemical binding]; other site
568708017325	Phosphotransferase system, galactitol-specific IIC component [Carbohydrate transport and metabolism]; Region: GatC; COG3775
568708017326	PTS system sugar-specific permease component; Region: EIIC-GAT; cl04451
568708017327	11 probable transmembrane helices predicted for STM_MW37711 by TMHMM2.0 at aa 13-35, 42-64, 98-120, 141-163, 178-200, 225-247, 251-270, 305-327, 337-356, 363-385 and 421-443
568708017329	PTS_IIB_galactitol: subunit IIB of enzyme II (EII) of the galactitol-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS).  In this system, EII is a galactitol-specific permease with two cytoplasmic domains (IIA and IIB) and a...; Region: PTS_IIB_galactitol; cd05566
568708017330	active site
568708017331	P-loop; other site
568708017332	phosphorylation site [posttranslational modification]
568708017334	Signal peptide predicted for STM_MW37721 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.954 between residues 20 and 21
568708017335	PTS_IIA, PTS system, fructose/mannitol specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This...; Region: PTS_IIA_fru; cd00211
568708017336	active site
568708017337	phosphorylation site [posttranslational modification]
568708017339	Transcriptional regulators [Transcription]; Region: PhnF; COG2188
568708017340	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
568708017341	DNA-binding site [nucleotide binding]; DNA binding site
568708017342	UTRA domain; Region: UTRA; pfam07702
568708017345	Protein of unknown function (DUF1198); Region: DUF1198; pfam06711
568708017347	1 probable transmembrane helix predicted for STM_MW37751 by TMHMM2.0 at aa 4-21
568708017348	sugar phosphate antiporter; Reviewed; Region: uhpT; PRK09556
568708017349	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708017350	putative substrate translocation pore; other site
568708017351	12 probable transmembrane helices predicted for STM_MW37761 by TMHMM2.0 at aa 28-45, 67-89, 96-118, 123-145, 158-180, 190-212, 254-276, 296-318, 325-347, 357-379, 392-411 and 426-445
568708017353	regulatory protein UhpC; Provisional; Region: PRK11663
568708017354	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708017355	putative substrate translocation pore; other site
568708017356	12 probable transmembrane helices predicted for STM_MW37771 by TMHMM2.0 at aa 26-45, 67-89, 96-118, 122-144, 156-178, 183-205, 245-267, 287-309, 322-344, 348-370, 377-399 and 409-431
568708017358	sensory histidine kinase UhpB; Provisional; Region: PRK11644
568708017359	MASE1; Region: MASE1; pfam05231
568708017360	Histidine kinase; Region: HisKA_3; pfam07730
568708017361	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708017362	ATP binding site [chemical binding]; other site
568708017363	Mg2+ binding site [ion binding]; other site
568708017364	G-X-G motif; other site
568708017366	7 probable transmembrane helices predicted for STM_MW37781 by TMHMM2.0 at aa 7-29, 78-100, 112-130, 140-162, 186-205, 220-242 and 255-274
568708017369	Signal peptide predicted for STM_MW37781 by SignalP 2.0 HMM (Signal peptide probability 0.855) with cleavage site probability 0.579 between residues 32 and 33
568708017370	DNA-binding transcriptional activator UhpA; Provisional; Region: PRK10360
568708017371	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708017372	active site
568708017373	phosphorylation site [posttranslational modification]
568708017374	intermolecular recognition site; other site
568708017375	dimerization interface [polypeptide binding]; other site
568708017376	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
568708017377	DNA binding residues [nucleotide binding]
568708017378	dimerization interface [polypeptide binding]; other site
568708017381	deoxyribose mutarotase_like; Region: deoxyribose_mutarotase; cd09269
568708017382	active site
568708017383	catalytic residues [active]
568708017384	Fucose permease [Carbohydrate transport and metabolism]; Region: FucP; COG0738
568708017385	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708017386	putative substrate translocation pore; other site
568708017387	12 probable transmembrane helices predicted for STM_MW37811 by TMHMM2.0 at aa 20-42, 57-79, 86-105, 109-128, 149-171, 205-227, 256-275, 290-312, 319-336, 340-362, 375-397 and 401-423
568708017389	Sugar kinases, ribokinase family [Carbohydrate transport and metabolism]; Region: RbsK; COG0524
568708017390	Ribokinase catalyses the phosphorylation of ribose to ribose-5-phosphate using ATP. This reaction is the first step in the ribose metabolism. It traps ribose within the cell after uptake and also prepares the sugar for use in the synthesis of nucleotides...; Region: ribokinase; cd01174
568708017391	substrate binding site [chemical binding]; other site
568708017392	dimer interface [polypeptide binding]; other site
568708017393	ATP binding site [chemical binding]; other site
568708017395	DNA-binding transcriptional repressor DeoR; Provisional; Region: PRK10681
568708017396	DeoR-like helix-turn-helix domain; Region: HTH_DeoR; cl17531
568708017397	DeoR C terminal sensor domain; Region: DeoRC; pfam00455
568708017400	Acetolactate synthase, small (regulatory) subunit [Amino acid transport and metabolism]; Region: IlvH; COG0440
568708017401	N-terminal ACT domain of the Escherichia coli IlvH-like regulatory subunit of acetohydroxyacid synthase (AHAS); Region: ACT_AHAS; cd04878
568708017402	putative valine binding site [chemical binding]; other site
568708017403	dimer interface [polypeptide binding]; other site
568708017405	acetolactate synthase catalytic subunit; Validated; Region: PRK08155
568708017406	Pyrimidine (PYR) binding domain of POX and related proteins; Region: TPP_PYR_POX_like; cd07035
568708017407	PYR/PP interface [polypeptide binding]; other site
568708017408	dimer interface [polypeptide binding]; other site
568708017409	TPP binding site [chemical binding]; other site
568708017410	Thiamine pyrophosphate enzyme, central domain; Region: TPP_enzyme_M; pfam00205
568708017411	Thiamine pyrophosphate (TPP) family, Acetohydroxyacid synthase (AHAS) subfamily, TPP-binding module; composed of proteins similar to the large catalytic subunit of AHAS. AHAS catalyzes the condensation of two molecules of pyruvate to give the...; Region: TPP_AHAS; cd02015
568708017412	TPP-binding site [chemical binding]; other site
568708017413	dimer interface [polypeptide binding]; other site
568708017418	Signal peptide predicted for STM_MW37852 by SignalP 2.0 HMM (Signal peptide probability 0.836) with cleavage site probability 0.795 between residues 18 and 19
568708017419	1 probable transmembrane helix predicted for STM_MW37871 by TMHMM2.0 at aa 6-28
568708017420	phosphonate utilization associated putative membrane protein; Region: phn_DUF6; TIGR03340
568708017421	Small Multidrug Resistance protein; Region: Multi_Drug_Res; cl00910
568708017422	Signal peptide predicted for STM_MW37881 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.987 between residues 26 and 27
568708017423	10 probable transmembrane helices predicted for STM_MW37881 by TMHMM2.0 at aa 10-32, 39-61, 66-85, 98-117, 121-143, 150-167, 177-199, 216-235, 239-261 and 266-285
568708017425	multidrug resistance protein D; Provisional; Region: emrD; PRK11652
568708017426	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708017427	putative substrate translocation pore; other site
568708017429	11 probable transmembrane helices predicted for STM_MW37891 by TMHMM2.0 at aa 15-34, 41-60, 65-87, 100-122, 132-149, 170-192, 207-229, 242-264, 268-290, 297-319 and 329-351
568708017430	Cellulase (glycosyl hydrolase family 5); Region: Cellulase; pfam00150
568708017432	DNA-binding transcriptional regulator DsdC; Provisional; Region: PRK10086
568708017433	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708017434	The C-terminal substrate domain of LysR-type GcdR, TrPI, HvR and beta-lactamase regulators, and that of other closely related homologs; contains the type 2 periplasmic binding fold; Region: PBP2_GcdR_TrpI_HvrB_AmpR_like; cd08432
568708017435	dimerization interface [polypeptide binding]; other site
568708017436	substrate binding pocket [chemical binding]; other site
568708017439	permease DsdX; Provisional; Region: PRK09921
568708017440	gluconate transporter; Region: gntP; TIGR00791
568708017441	12 probable transmembrane helices predicted for STM_MW37921 by TMHMM2.0 at aa 4-23, 30-49, 54-76, 104-126, 146-168, 175-197, 226-248, 261-283, 303-322, 343-365, 385-407 and 420-442
568708017443	D-Serine dehydratase is a pyridoxal phosphate (PLP)-dependent enzyme which catalyzes the conversion of L- or D-serine  to pyruvate and ammonia.  D-serine dehydratase serves as a detoxifying enzyme in most E. coli strains where D-serine is a competitive...; Region: D-Ser-dehyd; cd06447
568708017444	Pyridoxal-phosphate dependent enzyme; Region: PALP; pfam00291
568708017445	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
568708017446	catalytic residue [active]
568708017448	Arylsulfatase regulator (Fe-S oxidoreductase) [General function prediction only]; Region: AslB; COG0641
568708017449	Domain of unknown function (DUF4008); Region: DUF4008; cl14869
568708017450	Domain of unknown function (DUF202); Region: DUF202; pfam02656
568708017451	3 probable transmembrane helices predicted for STM_MW37951 by TMHMM2.0 at aa 21-43, 48-70 and 91-113
568708017452	Predicted membrane protein [Function unknown]; Region: COG2149
568708017453	3 probable transmembrane helices predicted for STM_MW37961 by TMHMM2.0 at aa 21-40, 50-72 and 92-114
568708017455	putative transporter; Validated; Region: PRK03818
568708017456	Predicted Permease Membrane Region; Region: Asp-Al_Ex; pfam06826
568708017457	TrkA-C domain; Region: TrkA_C; pfam02080
568708017458	TrkA-C domain; Region: TrkA_C; pfam02080
568708017459	AspT/YidE/YbjL antiporter duplication domain; Region: YidE_YbjL_dupl; TIGR01625
568708017460	11 probable transmembrane helices predicted for STM_MW37971 by TMHMM2.0 at aa 4-21, 28-46, 61-83, 95-117, 160-182, 374-396, 400-419, 431-448, 463-485, 492-514 and 529-551
568708017463	Molecular chaperone (small heat shock protein) [Posttranslational modification, protein turnover, chaperones]; Region: IbpA; COG0071
568708017464	Alpha-crystallin domain (ACD) found in Escherichia coli inclusion body-associated proteins IbpA and IbpB, and similar proteins.  IbpA and IbpB are 16 kDa small heat shock proteins (sHsps). sHsps are molecular chaperones that suppress protein aggregation...; Region: ACD_IbpA-B_like; cd06470
568708017465	putative dimer interface [polypeptide binding]; other site
568708017467	Molecular chaperone (small heat shock protein) [Posttranslational modification, protein turnover, chaperones]; Region: IbpA; COG0071
568708017468	Alpha-crystallin domain (ACD) found in Escherichia coli inclusion body-associated proteins IbpA and IbpB, and similar proteins.  IbpA and IbpB are 16 kDa small heat shock proteins (sHsps). sHsps are molecular chaperones that suppress protein aggregation...; Region: ACD_IbpA-B_like; cd06470
568708017469	putative dimer interface [polypeptide binding]; other site
568708017471	hypothetical protein; Provisional; Region: PRK11616
568708017472	Signal peptide predicted for STM_MW38001 by SignalP 2.0 HMM (Signal peptide probability 0.993) with cleavage site probability 0.839 between residues 27 and 28
568708017474	Protein of unknown function (DUF3748); Region: DUF3748; pfam12566
568708017475	Uncharacterized protein involved in biosynthesis of c-type cytochromes [Posttranslational modification, protein turnover, chaperones]; Region: CcmH; COG3088
568708017476	Cytochrome c biogenesis factor [Posttranslational modification, protein turnover, chaperones]; Region: COG4235
568708017478	3 probable transmembrane helices predicted for STM_MW38021 by TMHMM2.0 at aa 2-24, 103-125 and 150-172
568708017479	Signal peptide predicted for STM_MW38021 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.985 between residues 22 and 23
568708017480	cytochrome c biogenesis protein CcmA; Provisional; Region: PRK13538
568708017481	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
568708017482	Walker A/P-loop; other site
568708017483	ATP binding site [chemical binding]; other site
568708017484	Q-loop/lid; other site
568708017485	ABC transporter signature motif; other site
568708017486	Walker B; other site
568708017487	D-loop; other site
568708017488	H-loop/switch region; other site
568708017490	Haem-binding domain; Region: Haem_bd; pfam14376
568708017491	Cytochrome c peroxidase [Inorganic ion transport and metabolism]; Region: MauG; COG1858
568708017493	1 probable transmembrane helix predicted for STM_MW38041 by TMHMM2.0 at aa 7-29
568708017494	chaperone protein TorD; Validated; Region: torD; PRK04976
568708017496	trimethylamine N-oxide reductase I catalytic subunit; Provisional; Region: PRK15102
568708017497	The MopB_DMSOR-BSOR-TMAOR CD contains dimethylsulfoxide reductase (DMSOR), biotin sulfoxide reductase (BSOR),  trimethylamine N-oxide reductase (TMAOR) and other related proteins. DMSOR always catalyzes the reduction of DMSO to dimethylsulfide, but its...; Region: MopB_DMSOR-BSOR-TMAOR; cd02769
568708017498	molybdopterin cofactor binding site [chemical binding]; other site
568708017499	substrate binding site [chemical binding]; other site
568708017500	The MopB_DMSOR-BSOR-TMAOR CD contains dimethylsulfoxide reductase (DMSOR), biotin sulfoxide reductase (BSOR),  trimethylamine N-oxide reductase (TMAOR) and other related proteins. DMSOR always catalyzes the reduction of DMSO to dimethylsulfide, but its...; Region: MopB_CT_DMSOR-BSOR-TMAOR; cd02793
568708017501	molybdopterin cofactor binding site; other site
568708017504	Signal peptide predicted for STM_MW38061 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 39 and 40
568708017505	trimethylamine N-oxide reductase cytochrome c-type subunit; Provisional; Region: PRK15032
568708017506	cytochrome c-type protein NapC; Provisional; Region: PRK10617; cl17554
568708017508	1 probable transmembrane helix predicted for STM_MW38071 by TMHMM2.0 at aa 12-34
568708017509	DNA-binding transcriptional regulator TorR; Provisional; Region: PRK10766
568708017510	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708017511	active site
568708017512	phosphorylation site [posttranslational modification]
568708017513	intermolecular recognition site; other site
568708017514	dimerization interface [polypeptide binding]; other site
568708017515	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
568708017516	DNA binding site [nucleotide binding]
568708017519	TMAO reductase system periplasmic protein TorT; Provisional; Region: PRK10936
568708017520	Type 1 periplasmic binding fold superfamily; Region: Periplasmic_Binding_Protein_Type_1; cl10011
568708017522	Signal peptide predicted for STM_MW38091 by SignalP 2.0 HMM (Signal peptide probability 0.850) with cleavage site probability 0.727 between residues 22 and 23
568708017523	hybrid sensory histidine kinase TorS; Provisional; Region: PRK11466
568708017524	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
568708017525	dimer interface [polypeptide binding]; other site
568708017526	phosphorylation site [posttranslational modification]
568708017527	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708017528	ATP binding site [chemical binding]; other site
568708017529	Mg2+ binding site [ion binding]; other site
568708017530	G-X-G motif; other site
568708017531	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708017532	active site
568708017533	phosphorylation site [posttranslational modification]
568708017534	intermolecular recognition site; other site
568708017535	dimerization interface [polypeptide binding]; other site
568708017536	Histidine Phosphotransfer domain, involved in signalling through a two part component systems in which an autophosphorylating histidine protein kinase serves as a phosphoryl donor to a response regulator protein; the response regulator protein is...; Region: HPT; cd00088
568708017537	putative binding surface; other site
568708017538	active site
568708017539	Signal peptide predicted for STM_MW38101 by SignalP 2.0 HMM (Signal peptide probability 0.996) with cleavage site probability 0.595 between residues 36 and 37
568708017540	2 probable transmembrane helices predicted for STM_MW38101 by TMHMM2.0 at aa 10-32 and 332-354
568708017545	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708017546	D-galactonate transporter; Region: 2A0114; TIGR00893
568708017547	putative substrate translocation pore; other site
568708017548	12 probable transmembrane helices predicted for STM_MW38111 by TMHMM2.0 at aa 31-53, 68-90, 97-117, 122-144, 156-178, 182-203, 257-278, 293-315, 322-344, 354-376, 389-411 and 416-438
568708017550	galactonate dehydratase; Provisional; Region: PRK14017
568708017551	D-galactonate dehydratase catalyses the dehydration of galactonate to 2-keto-3-deoxygalactnate (KDGal), as part of the D-galactonate nonphosphorolytic catabolic Entner-Doudoroff pathway. D-galactonate dehydratase belongs to the enolase superfamily of...; Region: D-galactonate_dehydratase; cd03325
568708017552	putative active site pocket [active]
568708017553	putative metal binding site [ion binding]; other site
568708017556	2-dehydro-3-deoxy-6-phosphogalactonate aldolase; Reviewed; Region: PRK09140
568708017557	KDPG and KHG aldolase; Region: KDPG_aldolase; cd00452
568708017558	active site
568708017559	intersubunit interface [polypeptide binding]; other site
568708017560	catalytic residue [active]
568708017562	2-keto-3-deoxy-galactonokinase [Carbohydrate transport and metabolism]; Region: DgoK; COG3734
568708017563	2-keto-3-deoxy-galactonokinase; Region: DGOK; pfam05035
568708017565	Transcriptional regulators [Transcription]; Region: FadR; COG2186
568708017566	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
568708017567	DNA-binding site [nucleotide binding]; DNA binding site
568708017568	FCD domain; Region: FCD; pfam07729
568708017571	sugar phosphate phosphatase; Provisional; Region: PRK10513
568708017572	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708017573	active site
568708017574	motif I; other site
568708017575	motif II; other site
568708017576	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708017578	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708017579	D-galactonate transporter; Region: 2A0114; TIGR00893
568708017580	putative substrate translocation pore; other site
568708017581	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708017582	12 probable transmembrane helices predicted for STM_MW38171 by TMHMM2.0 at aa 13-35, 55-77, 89-111, 115-132, 145-167, 172-194, 239-261, 276-298, 305-324, 334-353, 366-388 and 393-415
568708017584	L-alanine-DL-glutamate epimerase and related enzymes of enolase superfamily [Cell envelope biogenesis, outer membrane / General function prediction only]; Region: COG4948
568708017585	Mandelate racemase (MR)-like subfamily of the enolase superfamily. Enzymes of this subgroup share three conserved carboxylate ligands for the essential divalent metal ion (usually Mg2+), two aspartates and a glutamate, and conserved catalytic residues; Region: MR_like; cd03316
568708017586	active site pocket [active]
568708017589	Transcriptional regulator [Transcription]; Region: LysR; COG0583
568708017590	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708017591	TThe C-terminal substrate binding domain of an uncharacterized LysR-type transcriptional regulator, contains the type 2 periplasmic binding fold; Region: PBP2_LTTR_like_4; cd08440
568708017592	putative dimerization interface [polypeptide binding]; other site
568708017595	DNA gyrase subunit B; Provisional; Region: gyrB; PRK14939
568708017596	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708017597	Mg2+ binding site [ion binding]; other site
568708017598	G-X-G motif; other site
568708017599	TopoIIA_Trans_DNA_gyrase: Transducer domain, having a ribosomal S5 domain 2-like fold, of the type found in proteins of the type IIA family of DNA topoisomerases similar to the B subunits of E. coli DNA gyrase and E. coli Topoisomerase IV which are; Region: TopoII_Trans_DNA_gyrase; cd00822
568708017600	anchoring element; other site
568708017601	dimer interface [polypeptide binding]; other site
568708017602	ATP binding site [chemical binding]; other site
568708017603	TOPRIM_TopoIIA_GyrB: topoisomerase-primase (TOPRIM) nucleotidyl transferase/hydrolase domain of the type found in proteins of the type IIA family of DNA topoisomerases similar to the Escherichia coli GyrB subunit. TopoIIA enzymes cut both strands of the...; Region: TOPRIM_TopoIIA_GyrB; cd03366
568708017604	active site
568708017605	putative metal-binding site [ion binding]; other site
568708017606	DNA gyrase B subunit, carboxyl terminus; Region: DNA_gyraseB_C; pfam00986
568708017611	recF protein; Region: recf; TIGR00611
568708017612	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
568708017613	Walker A/P-loop; other site
568708017614	ATP binding site [chemical binding]; other site
568708017615	Q-loop/lid; other site
568708017616	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
568708017617	ABC transporter signature motif; other site
568708017618	Walker B; other site
568708017619	D-loop; other site
568708017620	H-loop/switch region; other site
568708017622	DNA polymerase III subunit beta; Validated; Region: PRK05643
568708017623	Beta clamp domain.  The beta subunit (processivity factor) of DNA polymerase III holoenzyme, refered to as the beta clamp, forms a ring shaped dimer that encircles dsDNA (sliding clamp) in bacteria.  The beta-clamp is structurally similar to the trimeric...; Region: beta_clamp; cd00140
568708017624	putative DNA binding surface [nucleotide binding]; other site
568708017625	dimer interface [polypeptide binding]; other site
568708017626	beta-clamp/clamp loader binding surface; other site
568708017627	beta-clamp/translesion DNA polymerase binding surface; other site
568708017631	DnaA N-terminal domain; Region: DnaA_N; pfam11638
568708017632	chromosomal replication initiator protein DnaA; Region: DnaA; TIGR00362
568708017633	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708017634	Walker A motif; other site
568708017635	ATP binding site [chemical binding]; other site
568708017636	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cl17189
568708017637	Walker B motif; other site
568708017638	arginine finger; other site
568708017639	C-terminal domain of bacterial DnaA proteins. The DNA-binding C-terminal domain of DnaA contains a helix-turn-helix motif that specifically interacts with the DnaA box, a 9-mer motif that occurs repetitively in the replication origin oriC. Multiple...; Region: Bac_DnaA_C; cd06571
568708017640	DnaA box-binding interface [nucleotide binding]; other site
568708017643	50S ribosomal protein L34; Reviewed; Region: rpmH; PRK00399
568708017645	ribonuclease P; Reviewed; Region: rnpA; PRK01732
568708017647	hypothetical protein; Validated; Region: PRK00041
568708017649	membrane protein insertase; Provisional; Region: PRK01318
568708017650	Carbohydrate Binding Module 6 (CBM6) and CBM35_like superfamily; Region: CBM6-CBM35-CBM36_like; cl14880
568708017651	membrane protein insertase, YidC/Oxa1 family, C-terminal domain; Region: yidC_oxa1_cterm; TIGR03592
568708017652	Signal peptide predicted for STM_MW38271 by SignalP 2.0 HMM (Signal peptide probability 0.983) with cleavage site probability 0.707 between residues 24 and 25
568708017653	4 probable transmembrane helices predicted for STM_MW38271 by TMHMM2.0 at aa 7-24, 346-368, 419-441 and 497-519
568708017655	tRNA modification GTPase TrmE; Reviewed; Region: trmE; PRK05291
568708017656	GTP-binding protein TrmE N-terminus; Region: TrmE_N; pfam10396
568708017657	trmE is a tRNA modification GTPase; Region: trmE; cd04164
568708017658	G1 box; other site
568708017659	GTP/Mg2+ binding site [chemical binding]; other site
568708017660	Switch I region; other site
568708017661	G2 box; other site
568708017662	Switch II region; other site
568708017663	G3 box; other site
568708017664	G4 box; other site
568708017665	G5 box; other site
568708017666	Catalytic cysteine-containing C-terminus of GTPase, MnmE; Region: GTPase_Cys_C; pfam12631
568708017670	pfam_scan;Pfam:PF00589; E()=1.0E-19;score=70.7;query219- 368;description=Phage_integrase
568708017672	putative transferase, LIC12162 family; Region: o_ant_LIC12162; TIGR04331
568708017673	Retron-type reverse transcriptase [DNA replication, recombination, and repair]; Region: COG3344
568708017674	RT_Bac_retron_II: Reverse transcriptases (RTs) in bacterial retrotransposons or retrons. The polymerase reaction of this enzyme leads to the production of a unique RNA-DNA complex called msDNA (multicopy single-stranded (ss)DNA) in which a small ssDNA...; Region: RT_Bac_retron_II; cd03487
568708017675	putative active site [active]
568708017676	putative NTP binding site [chemical binding]; other site
568708017677	putative nucleic acid binding site [nucleotide binding]; other site
568708017679	multidrug efflux system protein MdtL; Provisional; Region: PRK10473
568708017680	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708017681	putative substrate translocation pore; other site
568708017682	Signal peptide predicted for STM_MW38321 by SignalP 2.0 HMM (Signal peptide probability 0.661) with cleavage site probability 0.498 between residues 30 and 31
568708017683	12 probable transmembrane helices predicted for STM_MW38321 by TMHMM2.0 at aa 5-24, 39-58, 70-89, 99-116, 129-151, 156-178, 210-232, 242-264, 271-290, 294-316, 328-350 and 355-377
568708017685	DNA-binding transcriptional regulator YidZ; Provisional; Region: PRK10216
568708017686	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708017687	The C-terminal substrate binding domain of LysR-type transcriptional regulators that involved in the catabolism of nitroaromatic/naphthalene compounds and that of related regulators; contains the type 2 periplasmic binding fold; Region: PBP2_Nitroaromatics_like; cd08417
568708017688	substrate binding pocket [chemical binding]; other site
568708017689	dimerization interface [polypeptide binding]; other site
568708017692	Phosphopantetheinyl transferase [Coenzyme metabolism]; Region: Sfp; COG2091
568708017693	Predicted flavoprotein [General function prediction only]; Region: COG0431
568708017694	NADPH-dependent FMN reductase; Region: FMN_red; pfam03358
568708017696	Xanthine/uracil/vitamin C permease [Nucleotide transport and    metabolism]; Region: COG2252
568708017697	13 probable transmembrane helices predicted for STM_MW38361 by TMHMM2.0 at aa 72-94, 104-126, 128-150, 155-177, 184-203, 218-240, 247-264, 295-317, 337-359, 369-391, 398-416, 431-453 and 466-484
568708017699	6-phosphogluconate phosphatase; Provisional; Region: PRK10563
568708017700	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708017701	active site
568708017702	motif I; other site
568708017703	motif II; other site
568708017705	transcriptional regulator PhoU; Provisional; Region: PRK11115
568708017706	PhoU domain; Region: PhoU; pfam01895
568708017707	PhoU domain; Region: PhoU; pfam01895
568708017709	phosphate transporter ATP-binding protein; Provisional; Region: pstB; PRK10744
568708017710	ATP-binding cassette domain of the phosphate transport system; Region: ABC_PstB_phosphate_transporter; cd03260
568708017711	Walker A/P-loop; other site
568708017712	ATP binding site [chemical binding]; other site
568708017713	Q-loop/lid; other site
568708017714	ABC transporter signature motif; other site
568708017715	Walker B; other site
568708017716	D-loop; other site
568708017717	H-loop/switch region; other site
568708017719	phosphate transporter permease subunit PtsA; Provisional; Region: pstA; PRK11268
568708017720	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708017721	dimer interface [polypeptide binding]; other site
568708017722	conserved gate region; other site
568708017723	putative PBP binding loops; other site
568708017724	ABC-ATPase subunit interface; other site
568708017725	6 probable transmembrane helices predicted for STM_MW38401 by TMHMM2.0 at aa 29-51, 88-110, 123-145, 150-169, 201-223 and 268-290
568708017727	phosphate transporter permease subunit PstC; Provisional; Region: pstC; PRK11275
568708017728	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708017729	dimer interface [polypeptide binding]; other site
568708017730	conserved gate region; other site
568708017731	putative PBP binding loops; other site
568708017732	ABC-ATPase subunit interface; other site
568708017733	6 probable transmembrane helices predicted for STM_MW38411 by TMHMM2.0 at aa 21-43, 78-100, 112-134, 166-188, 227-249 and 282-304
568708017735	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
568708017736	substrate binding pocket [chemical binding]; other site
568708017737	membrane-bound complex binding site; other site
568708017738	hinge residues; other site
568708017739	1 probable transmembrane helix predicted for STM_MW38421 by TMHMM2.0 at aa 7-29
568708017740	Signal peptide predicted for STM_MW38421 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.935 between residues 25 and 26
568708017741	PTS_IIB_fructose: subunit IIB of enzyme II (EII) of the fructose-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS). In this system, EII (also referred to as FruAB) is a fructose-specific permease made up of two proteins (FruA and...; Region: PTS_IIB_fructose; cd05569
568708017742	active site
568708017743	P-loop; other site
568708017744	phosphorylation site [posttranslational modification]
568708017745	PTS system, fructose subfamily, IIC component; Region: PTS_IIC_fructo; TIGR01427
568708017746	Phosphotransferase system, EIIC; Region: PTS_EIIC; pfam02378
568708017748	9 probable transmembrane helices predicted for STM_MW38431 by TMHMM2.0 at aa 134-156, 166-188, 201-223, 245-267, 279-301, 324-346, 359-381, 396-418 and 430-448
568708017750	Signal peptide predicted for STM_MW38431 by SignalP 2.0 HMM (Signal peptide probability 0.947) with cleavage site probability 0.486 between residues 24 and 25
568708017751	shikimate 5-dehydrogenase; Reviewed; Region: PRK12550
568708017752	Shikimate dehydrogenase substrate binding domain; Region: Shikimate_dh_N; pfam08501
568708017753	NAD(P) binding domain of Shikimate dehydrogenase; Region: NAD_bind_Shikimate_DH; cd01065
568708017754	shikimate binding site; other site
568708017755	NAD(P) binding site [chemical binding]; other site
568708017758	ABC-type uncharacterized transport system, periplasmic component [General function prediction only]; Region: COG4533
568708017759	Sugar transport-related sRNA regulator N-term; Region: SgrR_N; pfam12793
568708017760	The C-terminal solute-binding domain of DNA-binding transcriptional regulator SgrR is related to the ABC-type oligopeptide-binding proteins and contains the type 2 periplasmic-binding fold; Region: PBP2_SgrR_like; cd08507
568708017762	glucosamine--fructose-6-phosphate aminotransferase; Reviewed; Region: PRK00331
568708017763	Glutamine amidotransferases class-II (Gn-AT)_GFAT-type. This domain is found at the N-terminus of glucosamine-6P synthase (GlmS, or GFAT in humans).  The glutaminase domain catalyzes amide nitrogen transfer from glutamine to the appropriate substrate. In...; Region: GFAT; cd00714
568708017764	glutaminase active site [active]
568708017765	SIS (Sugar ISomerase) domain repeat 1 found in Glucosamine 6-phosphate synthase (GlmS) and Glucosamine-6-phosphate deaminase (GlmD). The SIS domain is found in many phosphosugar isomerases and phosphosugar binding proteins. GlmS contains a N-terminal...; Region: SIS_GlmS_GlmD_1; cd05008
568708017766	dimer interface [polypeptide binding]; other site
568708017767	active site
568708017768	SIS (Sugar ISomerase) domain repeat 2 found in Glucosamine 6-phosphate synthase (GlmS) and Glucosamine-6-phosphate deaminase (GlmD). The SIS domain is found in many phosphosugar isomerases and phosphosugar binding proteins. GlmS contains a N-terminal...; Region: SIS_GlmS_GlmD_2; cd05009
568708017769	dimer interface [polypeptide binding]; other site
568708017770	active site
568708017773	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase; Provisional; Region: glmU; PRK09451
568708017774	N-terminal domain of bacterial GlmU; Region: GT2_GlmU_N_bac; cd02540
568708017775	Substrate binding site; other site
568708017776	Mg++ binding site; other site
568708017777	N-acetyl-glucosamine-1-phosphate uridyltransferase (GlmU), C-terminal left-handed beta-helix (LbH) acetyltransferase domain: GlmU is also known as UDP-N-acetylglucosamine pyrophosphorylase. It is a bifunctional bacterial enzyme that catalyzes two...; Region: LbH_GlmU_C; cd03353
568708017778	active site
568708017779	substrate binding site [chemical binding]; other site
568708017780	CoA binding site [chemical binding]; other site
568708017782	Integral membrane protein, interacts with FtsH [General function prediction only]; Region: COG0670
568708017783	Inhibitor of apoptosis-promoting Bax1; Region: Bax1-I; pfam01027
568708017784	6 probable transmembrane helices predicted for STM_MW38481 by TMHMM2.0 at aa 25-47, 62-81, 94-116, 120-142, 158-192 and 207-229
568708017786	F0F1 ATP synthase subunit epsilon; Validated; Region: atpC; PRK00571
568708017787	mitochondrial ATP synthase delta subunit; Region: F1-ATPase_delta; cd12152
568708017788	gamma subunit interface [polypeptide binding]; other site
568708017789	epsilon subunit interface [polypeptide binding]; other site
568708017790	LBP interface [polypeptide binding]; other site
568708017793	F0F1 ATP synthase subunit beta; Validated; Region: PRK09280
568708017794	ATP synthase alpha/beta family, beta-barrel domain; Region: ATP-synt_ab_N; pfam02874
568708017795	F1 ATP synthase beta subunit, nucleotide-binding domain. The F-ATPase is found in bacterial plasma membranes, mitochondrial inner membranes and in chloroplast thylakoid membranes. It has also been found in the archaea Methanosarcina barkeri. It uses a...; Region: F1-ATPase_beta; cd01133
568708017796	alpha subunit interaction interface [polypeptide binding]; other site
568708017797	Walker A motif; other site
568708017798	ATP binding site [chemical binding]; other site
568708017799	Walker B motif; other site
568708017800	inhibitor binding site; inhibition site
568708017801	ATP synthase alpha/beta chain, C terminal domain; Region: ATP-synt_ab_C; pfam00306
568708017805	mitochondrial ATP synthase gamma subunit; Region: F1-ATPase_gamma; cd12151
568708017806	core domain interface [polypeptide binding]; other site
568708017807	delta subunit interface [polypeptide binding]; other site
568708017808	epsilon subunit interface [polypeptide binding]; other site
568708017810	F0F1 ATP synthase subunit alpha; Validated; Region: PRK09281
568708017811	ATP synthase alpha/beta family, beta-barrel domain; Region: ATP-synt_ab_N; pfam02874
568708017812	F1 ATP synthase alpha, central domain. The F-ATPase is found in bacterial plasma membranes, mitochondrial inner membranes and in chloroplast thylakoid membranes. It has also been found in the archaea Methanosarcina barkeri. It uses a proton gradient to...; Region: F1_ATPase_alpha; cd01132
568708017813	beta subunit interaction interface [polypeptide binding]; other site
568708017814	Walker A motif; other site
568708017815	ATP binding site [chemical binding]; other site
568708017816	Walker B motif; other site
568708017817	ATP synthase alpha/beta chain, C terminal domain; Region: ATP-synt_ab_C; pfam00306
568708017821	F0F1 ATP synthase subunit delta; Validated; Region: PRK05758
568708017822	ATP synthase delta (OSCP) subunit; Region: OSCP; pfam00213
568708017824	F0F1 ATP synthase subunit B; Validated; Region: PRK05759
568708017825	F0F1-type ATP synthase, subunit b [Energy production and conversion]; Region: AtpF; COG0711
568708017827	1 probable transmembrane helix predicted for STM_MW38541 by TMHMM2.0 at aa 5-27
568708017828	F0F1-type ATP synthase, subunit a [Energy production and conversion]; Region: AtpB; COG0356
568708017829	F0F1 ATP synthase subunit A; Validated; Region: PRK05815
568708017830	5 probable transmembrane helices predicted for STM_MW38551 by TMHMM2.0 at aa 36-58, 100-122, 142-164, 211-233 and 243-265
568708017832	F0F1 ATP synthase subunit I; Validated; Region: PRK08049
568708017833	4 probable transmembrane helices predicted for STM_MW38561 by TMHMM2.0 at aa 15-31, 36-58, 73-95 and 100-122
568708017835	Predicted S-adenosylmethionine-dependent methyltransferase involved in bacterial cell division [Cell envelope biogenesis, outer membrane]; Region: GidB; COG0357
568708017836	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708017837	S-adenosylmethionine binding site [chemical binding]; other site
568708017839	tRNA uridine 5-carboxymethylaminomethyl modification enzyme GidA; Validated; Region: PRK05192
568708017840	NAD(FAD)-utilizing enzyme possibly involved in translation [Translation, ribosomal structure and biogenesis]; Region: Gid; COG1206
568708017841	GidA associated domain 3; Region: GIDA_assoc_3; pfam13932
568708017843	FMN-binding protein MioC; Provisional; Region: PRK09004
568708017845	DNA-binding transcriptional regulator AsnC; Provisional; Region: PRK11179
568708017846	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
568708017847	putative DNA binding site [nucleotide binding]; other site
568708017848	putative Zn2+ binding site [ion binding]; other site
568708017849	AsnC family; Region: AsnC_trans_reg; pfam01037
568708017852	Asparagine synthetase (aspartate-ammonia ligase) (AsnA) catalyses the conversion of L-aspartate to L-asparagine in the presence of ATP and ammonia.  AsnA is a homodimeric enzyme which is structurally similiar to the catalytic core domain of class II...; Region: AsnA; cd00645
568708017853	dimer interface [polypeptide binding]; other site
568708017854	active site
568708017856	hypothetical protein; Provisional; Region: yieM; PRK10997
568708017857	VWA YIEM type: Von Willebrand factor type A (vWA) domain was originally found in the blood coagulation protein von Willebrand factor (vWF). Typically, the vWA domain is made up of approximately 200 amino acid residues folded into a classic a/b...; Region: VWA_YIEM_type; cd01462
568708017858	metal ion-dependent adhesion site (MIDAS); other site
568708017860	regulatory ATPase RavA; Provisional; Region: PRK13531
568708017861	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708017862	Walker A motif; other site
568708017863	ATP binding site [chemical binding]; other site
568708017864	Walker B motif; other site
568708017865	arginine finger; other site
568708017866	Protein of unknown function (DUF3763); Region: DUF3763; pfam12592
568708017868	potassium transport protein Kup; Provisional; Region: trkD; PRK10745
568708017869	potassium uptake protein; Region: kup; TIGR00794
568708017870	Signal peptide predicted for STM_MW38641 by SignalP 2.0 HMM (Signal peptide probability 0.744) with cleavage site probability 0.744 between residues 22 and 23
568708017871	12 probable transmembrane helices predicted for STM_MW38641 by TMHMM2.0 at aa 7-29, 49-71, 102-124, 134-156, 168-190, 210-232, 245-267, 287-309, 335-357, 363-385, 392-414 and 419-441
568708017873	D-ribose pyranase; Provisional; Region: PRK11797
568708017875	D-ribose transporter ATP binding protein; Provisional; Region: PRK10762
568708017876	First domain of the ATP-binding cassette component of monosaccharide transport system; Region: ABC_Carb_Monos_I; cd03216
568708017877	Walker A/P-loop; other site
568708017878	ATP binding site [chemical binding]; other site
568708017879	Q-loop/lid; other site
568708017880	ABC transporter signature motif; other site
568708017881	Walker B; other site
568708017882	D-loop; other site
568708017883	H-loop/switch region; other site
568708017884	Second domain of the ATP-binding cassette component of monosaccharide transport system; Region: ABC_Carb_Monos_II; cd03215
568708017886	Branched-chain amino acid transport system / permease component; Region: BPD_transp_2; pfam02653
568708017887	Transmembrane subunit (TM) of Escherichia coli AraH and related proteins. E. coli AraH is the TM of a Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporter involved in the uptake of the monosaccharide arabinose. This group...; Region: TM_PBP1_transp_AraH_like; cd06579
568708017888	TM-ABC transporter signature motif; other site
568708017889	8 probable transmembrane helices predicted for STM_MW38671 by TMHMM2.0 at aa 21-43, 53-72, 74-93, 97-119, 126-145, 165-187, 221-243 and 275-297
568708017891	D-ribose transporter subunit RbsB; Provisional; Region: PRK10653
568708017892	Periplasmic sugar-binding domain of the thermophilic Thermoanaerobacter tengcongensis ribose binding protein (ttRBP) and its mesophilic homologs; Region: PBP1_ribose_binding; cd06323
568708017893	ligand binding site [chemical binding]; other site
568708017894	dimerization interface [polypeptide binding]; other site
568708017895	Signal peptide predicted for STM_MW38681 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.949 between residues 25 and 26
568708017897	Sugar kinases, ribokinase family [Carbohydrate transport and metabolism]; Region: RbsK; COG0524
568708017898	Ribokinase catalyses the phosphorylation of ribose to ribose-5-phosphate using ATP. This reaction is the first step in the ribose metabolism. It traps ribose within the cell after uptake and also prepares the sugar for use in the synthesis of nucleotides...; Region: ribokinase; cd01174
568708017899	substrate binding site [chemical binding]; other site
568708017900	dimer interface [polypeptide binding]; other site
568708017901	ATP binding site [chemical binding]; other site
568708017903	transcriptional repressor RbsR; Provisional; Region: PRK10423
568708017904	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
568708017905	DNA binding site [nucleotide binding]
568708017906	domain linker motif; other site
568708017907	Ligand-binding domain of purine repressor, PurR, which functions as the master regulatory protein of de novo purine nucleotide biosynthesis in Escherichia coli; Region: PBP1_PurR; cd06275
568708017908	dimerization interface [polypeptide binding]; other site
568708017909	ligand binding site [chemical binding]; other site
568708017912	putative transporter; Provisional; Region: PRK10504
568708017913	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708017914	putative substrate translocation pore; other site
568708017915	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708017917	14 probable transmembrane helices predicted for STM_MW38711 by TMHMM2.0 at aa 11-33, 48-70, 77-99, 103-125, 137-159, 164-181, 201-218, 222-244, 264-286, 291-313, 325-347, 351-373, 394-416 and 431-450
568708017918	Signal peptide predicted for STM_MW38711 by SignalP 2.0 HMM (Signal peptide probability 0.992) with cleavage site probability 0.952 between residues 27 and 28
568708017919	Transcriptional regulators [Transcription]; Region: FadR; COG2186
568708017920	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
568708017921	DNA-binding site [nucleotide binding]; DNA binding site
568708017922	This entry represents the C-terminal ligand binding domain of many members of the GntR family; Region: FCD; smart00895
568708017925	transcriptional regulator HdfR; Provisional; Region: PRK03601
568708017926	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708017927	LysR substrate binding domain; Region: LysR_substrate; pfam03466
568708017928	dimerization interface [polypeptide binding]; other site
568708017931	hypothetical protein; Provisional; Region: PRK11027
568708017933	putative ATP-dependent protease; Provisional; Region: PRK09862
568708017934	Subunit ChlI of Mg-chelatase; Region: ChlI; pfam13541
568708017935	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708017936	Walker A motif; other site
568708017937	ATP binding site [chemical binding]; other site
568708017938	Walker B motif; other site
568708017939	arginine finger; other site
568708017940	Magnesium chelatase, subunit ChlI; Region: Mg_chelatase_2; pfam13335
568708017942	acetolactate synthase 2 catalytic subunit; Reviewed; Region: PRK08978
568708017943	Pyrimidine (PYR) binding domain of POX and related proteins; Region: TPP_PYR_POX_like; cd07035
568708017944	PYR/PP interface [polypeptide binding]; other site
568708017945	dimer interface [polypeptide binding]; other site
568708017946	TPP binding site [chemical binding]; other site
568708017947	Thiamine pyrophosphate enzyme, central domain; Region: TPP_enzyme_M; pfam00205
568708017948	Thiamine pyrophosphate (TPP) family, Acetohydroxyacid synthase (AHAS) subfamily, TPP-binding module; composed of proteins similar to the large catalytic subunit of AHAS. AHAS catalyzes the condensation of two molecules of pyruvate to give the...; Region: TPP_AHAS; cd02015
568708017949	TPP-binding site [chemical binding]; other site
568708017950	dimer interface [polypeptide binding]; other site
568708017954	acetolactate synthase 2 regulatory subunit; Provisional; Region: ilvM; PRK11152
568708017955	Branched-chain amino acid aminotransferase/4-amino-4-deoxychorismate lyase [Amino acid transport and metabolism / Coenzyme metabolism]; Region: IlvE; COG0115
568708017956	BCAT_beta_family: Branched-chain aminotransferase catalyses the transamination of the branched-chain amino acids  leusine, isoleucine and valine to their respective alpha-keto acids, alpha-ketoisocaproate, alpha-keto-beta-methylvalerate and...; Region: BCAT_beta_family; cd01557
568708017957	homodimer interface [polypeptide binding]; other site
568708017958	substrate-cofactor binding pocket; other site
568708017959	catalytic residue [active]
568708017961	dihydroxy-acid dehydratase; Provisional; Region: PRK12448
568708017963	threonine dehydratase; Reviewed; Region: PRK09224
568708017964	Threonine dehydratase: The first step in amino acid degradation is the removal of nitrogen. Although the nitrogen atoms of most amino acids are transferred to alpha-ketoglutarate before removal, the alpha-amino group of threonine can be directly...; Region: Thr-dehyd; cd01562
568708017965	tetramer interface [polypeptide binding]; other site
568708017966	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708017967	catalytic residue [active]
568708017968	First of two tandem C-terminal ACT domains of threonine dehydratase I (ThrD-I; L-threonine hydrolyase); Region: ACT_ThrD-I_1; cd04906
568708017969	putative Ile/Val binding site [chemical binding]; other site
568708017970	Second of two tandem C-terminal ACT domains of threonine dehydratase I (ThrD-I; L-threonine hydrolyase); Region: ACT_ThrD-I_2; cd04907
568708017971	putative Ile/Val binding site [chemical binding]; other site
568708017974	Phage-related protein [Function unknown]; Region: COG4679
568708017976	Uncharacterized conserved small protein [Function unknown]; Region: COG5606
568708017977	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708017978	DNA-binding transcriptional regulator IlvY; Provisional; Region: PRK11716
568708017979	The C-terminal substrate binding of LysR-type transcriptional regulator IlvY, which activates the expression of ilvC gene that encoding acetohydroxy acid isomeroreductase for the biosynthesis of branched amino acids; contains the type 2 periplasmic bindin; Region: PBP2_IlvY; cd08430
568708017980	putative dimerization interface [polypeptide binding]; other site
568708017983	ketol-acid reductoisomerase; Validated; Region: PRK05225
568708017984	Acetohydroxy acid isomeroreductase, catalytic domain; Region: IlvN; pfam07991
568708017985	Acetohydroxy acid isomeroreductase, catalytic domain; Region: IlvC; pfam01450
568708017986	Acetohydroxy acid isomeroreductase, catalytic domain; Region: IlvC; pfam01450
568708017989	peptidyl-prolyl cis-trans isomerase C; Provisional; Region: PRK15441
568708017990	Parvulin-like peptidyl-prolyl isomerase [Posttranslational modification, protein turnover, chaperones]; Region: SurA; COG0760
568708017994	ATP-dependent DNA helicase Rep; Provisional; Region: PRK10919
568708017995	Part of AAA domain; Region: AAA_19; pfam13245
568708017996	Family description; Region: UvrD_C_2; pfam13538
568708017998	guanosine pentaphosphate phosphohydrolase; Provisional; Region: PRK11031
568708017999	Ppx/GppA phosphatase family; Region: Ppx-GppA; pfam02541
568708018001	ATP-dependent RNA helicase RhlB; Provisional; Region: PRK04837
568708018002	DEAD-box helicases. A diverse family of proteins involved in ATP-dependent RNA unwinding, needed in a variety of cellular processes including splicing, ribosome biogenesis and RNA degradation. The name derives from the sequence of the Walker  B motif; Region: DEADc; cd00268
568708018003	ATP binding site [chemical binding]; other site
568708018004	Mg++ binding site [ion binding]; other site
568708018005	motif III; other site
568708018006	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
568708018007	nucleotide binding region [chemical binding]; other site
568708018008	ATP-binding site [chemical binding]; other site
568708018011	TRX family; composed of two groups: Group I, which includes proteins that exclusively encode a TRX domain; and Group II, which are composed of fusion proteins of TRX and additional domains. Group I TRX is a small ancient protein that alter the redox...; Region: TRX_family; cd02947
568708018012	Thioredoxin-like; Region: Thioredoxin_8; pfam13905
568708018013	catalytic residues [active]
568708018015	transcription termination factor Rho; Provisional; Region: rho; PRK09376
568708018016	Rho termination factor, N-terminal domain; Region: Rho_N; smart00959
568708018017	Rho_CSD: Rho protein cold-shock domain (CSD). Rho protein is a transcription termination factor in most bacteria. In bacteria, there are two distinct mechanisms for mRNA transcription termination. In intrinsic termination, RNA polymerase and nascent mRNA...; Region: Rho_CSD; cd04459
568708018018	RNA binding site [nucleotide binding]; other site
568708018019	Transcription termination factor rho is a bacterial ATP-dependent RNA/DNA helicase. It is a homohexamer. Each monomer consists of an N-terminal domain of the OB fold, which is responsible for binding to cysteine rich nucleotides. This alignment is of the...; Region: rho_factor; cd01128
568708018020	multimer interface [polypeptide binding]; other site
568708018021	Walker A motif; other site
568708018022	ATP binding site [chemical binding]; other site
568708018023	Walker B motif; other site
568708018027	undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase; Provisional; Region: PRK15119
568708018028	This subfamily contains Escherichia coli WecA, Bacillus subtilis TagO and related proteins. WecA is an UDP-N-acetylglucosamine (GlcNAc):undecaprenyl-phosphate (Und-P) GlcNAc-1-phosphate transferase that catalyzes the formation of a phosphodiester bond...; Region: GT_WecA_like; cd06853
568708018029	Mg++ binding site [ion binding]; other site
568708018030	putative catalytic motif [active]
568708018031	substrate binding site [chemical binding]; other site
568708018032	11 probable transmembrane helices predicted for STM_MW38931 by TMHMM2.0 at aa 5-24, 45-65, 69-88, 105-127, 131-153, 160-179, 184-206, 213-232, 242-261, 294-311 and 321-338
568708018034	lipopolysaccharide biosynthesis protein WzzE; Provisional; Region: PRK11638
568708018035	Chain length determinant protein; Region: Wzz; pfam02706
568708018037	2 probable transmembrane helices predicted for STM_MW38941 by TMHMM2.0 at aa 29-51 and 323-342
568708018038	UDP-N-acetylglucosamine 2-epimerase [Cell envelope biogenesis, outer membrane]; Region: WecB; COG0381
568708018039	Bacterial members of the UDP-N-Acetylglucosamine (GlcNAc) 2-Epimerase  family are known to catalyze the reversible interconversion of UDP-GlcNAc and UDP-N-acetylmannosamine (UDP-ManNAc). The enzyme serves to produce an activated form of ManNAc residues; Region: GT1_UDP-GlcNAc_2-Epimerase; cd03786
568708018040	active site
568708018041	homodimer interface [polypeptide binding]; other site
568708018043	UDP-N-acetyl-D-mannosamine dehydrogenase; Provisional; Region: wecC; PRK11064
568708018044	UDP-glucose/GDP-mannose dehydrogenase family, central domain; Region: UDPG_MGDP_dh; pfam00984
568708018045	UDP binding domain; Region: UDPG_MGDP_dh_C; smart00984
568708018046	Signal peptide predicted for STM_MW38961 by SignalP 2.0 HMM (Signal peptide probability 0.938) with cleavage site probability 0.852 between residues 23 and 24
568708018050	dTDP-glucose 4,6-dehydratase; Provisional; Region: PRK10217
568708018051	dTDP-D-glucose 4,6-dehydratase, extended (e) SDRs; Region: dTDP_GD_SDR_e; cd05246
568708018052	NAD binding site [chemical binding]; other site
568708018053	substrate binding site [chemical binding]; other site
568708018054	homodimer interface [polypeptide binding]; other site
568708018055	active site
568708018057	dTDP-glucose pyrophosphorylase [Cell envelope biogenesis, outer membrane]; Region: RfbA; COG1209
568708018058	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394
568708018060	TDP-fucosamine acetyltransferase; Provisional; Region: PRK10975
568708018062	Predicted pyridoxal phosphate-dependent enzyme apparently involved in regulation of cell wall biogenesis [Cell envelope biogenesis, outer membrane]; Region: WecE; COG0399
568708018063	3-amino-5-hydroxybenzoic acid synthase family (AHBA_syn). AHBA_syn family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The members of this CD are involved in various biosynthetic pathways for secondary...; Region: AHBA_syn; cd00616
568708018064	inhibitor-cofactor binding pocket; inhibition site
568708018065	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708018066	catalytic residue [active]
568708018068	Membrane protein involved in the export of O-antigen and teichoic acid [General function prediction only]; Region: RfbX; COG2244
568708018069	Uncharacterized subfamily of the multidrug and toxic compound extrusion (MATE) proteins; Region: MATE_like_10; cd13125
568708018071	12 probable transmembrane helices predicted for STM_MW39011 by TMHMM2.0 at aa 13-35, 45-67, 80-102, 117-139, 146-165, 175-195, 216-238, 253-275, 296-318, 333-355, 362-384 and 390-412
568708018072	4-alpha-L-fucosyltransferase glycosyl transferase group 56; Region: Glyco_transf_56; pfam07429
568708018074	putative common antigen polymerase; Provisional; Region: PRK02975
568708018076	11 probable transmembrane helices predicted for STM_MW39031 by TMHMM2.0 at aa 4-26, 33-55, 70-89, 116-138, 153-175, 182-201, 205-224, 226-245, 338-360, 381-398 and 408-430
568708018077	Teichoic acid biosynthesis proteins [Cell envelope biogenesis, outer membrane]; Region: WecG; COG1922
568708018078	The glycosyltransferase WecG/TagA superfamily contains Escherichia coli WecG, Bacillus subtilis TagA and related proteins. E. coli WecG is believed to be a UDP-N-acetyl-D-mannosaminuronic acid transferase, and is involved in enterobacterial common...; Region: Glyco_transf_WecG_TagA; cd06533
568708018080	putative transport protein YifK; Provisional; Region: PRK10746
568708018082	12 probable transmembrane helices predicted for STM_MW39051 by TMHMM2.0 at aa 19-36, 40-59, 93-115, 125-147, 154-176, 191-213, 240-262, 277-299, 331-353, 358-380, 401-423 and 428-450
568708018083	putative protoheme IX biogenesis protein; Provisional; Region: PRK10747
568708018084	HemY protein N-terminus; Region: HemY_N; pfam07219
568708018087	1 probable transmembrane helix predicted for STM_MW39061 by TMHMM2.0 at aa 21-43
568708018088	putative uroporphyrinogen III C-methyltransferase; Provisional; Region: PRK10920
568708018089	Uncharacterized enzyme of heme biosynthesis [Coenzyme metabolism]; Region: HemX; COG2959
568708018091	1 probable transmembrane helix predicted for STM_MW39071 by TMHMM2.0 at aa 35-57
568708018092	uroporphyrinogen-III synthase; Reviewed; Region: hemD; PRK05928
568708018093	Uroporphyrinogen-III synthase (HemD) catalyzes the asymmetrical cyclization of tetrapyrrole (linear) to uroporphyrinogen-III, the fourth step in the biosynthesis of heme. This ubiquitous enzyme is present in eukaryotes, bacteria and archaea. Mutations in...; Region: HemD; cd06578
568708018094	active site
568708018096	porphobilinogen deaminase; Reviewed; Region: hemC; PRK00072
568708018097	Hydroxymethylbilane synthase (HMBS), also known as porphobilinogen deaminase (PBGD), is an intermediate enzyme in the biosynthetic pathway of tetrapyrrolic ring systems, such as heme, chlorophylls, and vitamin B12. HMBS catalyzes the conversion of...; Region: HMBS; cd00494
568708018098	domain interfaces; other site
568708018099	active site
568708018102	Adenylate cyclase [Nucleotide transport and metabolism]; Region: CyaA; COG3072
568708018103	Adenylate cyclase NT domain; Region: Adenyl_cycl_N; pfam12633
568708018104	Adenylate cyclase, class-I; Region: Adenylate_cycl; pfam01295
568708018106	3 probable transmembrane helices predicted for STM_MW39111 by TMHMM2.0 at aa 4-23, 25-47 and 81-103
568708018107	2 probable transmembrane helices predicted for STM_MW39121 by TMHMM2.0 at aa 28-45 and 49-71
568708018108	Frataxin is a nuclear-encoded mitochondrial protein implicated in Friedreich's ataxia (FRDA), an human autosomal recessive neurodegenerative disease; Frataxin is found in eukaryotes and in purple bacteria; lack of frataxin causes iron to accumulate...; Region: Frataxin; cd00503
568708018109	putative iron binding site [ion binding]; other site
568708018111	Protein of unknown function (DUF3021); Region: DUF3021; pfam11457
568708018112	4 probable transmembrane helices predicted for STM_MW39151 by TMHMM2.0 at aa 20-42, 47-64, 71-93 and 103-125
568708018114	Signal peptide; signalp; query 1-22;cleavage_site_probability=0.937; 0.973
568708018115	Predicted small periplasmic lipoprotein [Cell motility and secretion]; Region: COG5567
568708018116	Signal peptide predicted for STM_MW39171 by SignalP 2.0 HMM (Signal peptide probability 0.906) with cleavage site probability 0.578 between residues 23 and 24
568708018117	1 probable transmembrane helix predicted for STM_MW39171 by TMHMM2.0 at aa 7-29
568708018118	diaminopimelate epimerase; Provisional; Region: dapF; PRK00450
568708018119	Diaminopimelate epimerase; Region: DAP_epimerase; pfam01678
568708018120	Diaminopimelate epimerase; Region: DAP_epimerase; pfam01678
568708018122	hypothetical protein; Provisional; Region: PRK10963
568708018124	Site-specific recombinase XerC [DNA replication, recombination, and repair]; Region: XerC; COG4973
568708018125	XerD and XerC integrases, DNA breaking-rejoining enzymes, N- and C-terminal domains. XerD-like integrases are involved in the site-specific integration and excision of lysogenic bacteriophage genomes, transposition of conjugative transposons, termination...; Region: INT_XerDC; cd00798
568708018126	active site
568708018127	Int/Topo IB signature motif; other site
568708018130	flavin mononucleotide phosphatase; Provisional; Region: PRK10748
568708018131	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708018132	motif II; other site
568708018134	DNA-dependent helicase II; Provisional; Region: uvrD; PRK11773
568708018135	Part of AAA domain; Region: AAA_19; pfam13245
568708018136	Family description; Region: UvrD_C_2; pfam13538
568708018138	Mg2+ and Co2+ transporters [Inorganic ion transport and metabolism]; Region: CorA; COG0598
568708018139	Escherichia coli Mg2+ transporter CorA_like subgroup; Region: EcCorA-like_1; cd12835
568708018140	Cl binding site [ion binding]; other site
568708018141	oligomer interface [polypeptide binding]; other site
568708018143	2 probable transmembrane helices predicted for STM_MW39231 by TMHMM2.0 at aa 255-273 and 288-310
568708018144	Protein of unknown function (DUF2628); Region: DUF2628; pfam10947
568708018146	2 probable transmembrane helices predicted for STM_MW39241 by TMHMM2.0 at aa 50-72 and 76-107
568708018147	hypothetical protein; Provisional; Region: PRK11371
568708018148	4 probable transmembrane helices predicted for STM_MW39251 by TMHMM2.0 at aa 42-59, 63-85, 98-120 and 124-143
568708018149	putative chloramphenical resistance permease RarD; Provisional; Region: PRK15430
568708018150	EamA-like transporter family; Region: EamA; cl17759
568708018151	10 probable transmembrane helices predicted for STM_MW39261 by TMHMM2.0 at aa 12-34, 38-60, 73-95, 100-122, 129-146, 150-167, 180-197, 212-234, 239-261 and 271-290
568708018153	PaaI_thioesterase is a tetrameric acyl-CoA thioesterase with a hot dog fold and one of several proteins responsible for phenylacetic acid (PA) degradation in bacteria.  Although orthologs of PaaI exist in archaea and eukaryotes, their function has not...; Region: PaaI_thioesterase; cd03443
568708018154	CoenzymeA binding site [chemical binding]; other site
568708018155	subunit interaction site [polypeptide binding]; other site
568708018156	PHB binding site; other site
568708018158	The outer membrane phospholipase A (OMPLA) is an integral membrane enzyme that catalyses the hydrolysis of acylester bonds in phospholipids using calcium as a cofactor. The enzyme has a fold of transmembrane beta-barrels and is widespread among...; Region: OMPLA; cd00541
568708018159	dimerization interface [polypeptide binding]; other site
568708018160	substrate binding site [chemical binding]; other site
568708018161	active site
568708018162	calcium binding site [ion binding]; other site
568708018164	ATP-dependent DNA helicase RecQ; Provisional; Region: PRK11057
568708018165	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
568708018166	ATP binding site [chemical binding]; other site
568708018167	putative Mg++ binding site [ion binding]; other site
568708018168	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
568708018169	nucleotide binding region [chemical binding]; other site
568708018170	ATP-binding site [chemical binding]; other site
568708018171	This DNA-binding domain is found in the RecQ helicase among others and has a helix-turn-helix structure; Region: RQC; smart00956
568708018172	Helicase and RNase D C-terminal; Region: HRDC; smart00341
568708018177	threonine efflux system; Provisional; Region: PRK10229
568708018178	6 probable transmembrane helices predicted for STM_MW39301 by TMHMM2.0 at aa 4-26, 42-64, 68-87, 119-141, 151-173 and 186-205
568708018180	homoserine/homoserine lactone efflux protein; Provisional; Region: rhtB; PRK10520
568708018181	6 probable transmembrane helices predicted for STM_MW39311 by TMHMM2.0 at aa 5-27, 39-61, 71-88, 115-137, 147-169 and 188-205
568708018183	Signal peptide predicted for STM_MW39311 by SignalP 2.0 HMM (Signal peptide probability 0.874) with cleavage site probability 0.541 between residues 24 and 25
568708018184	lysophospholipase L2; Provisional; Region: PRK10749
568708018185	Putative lysophospholipase; Region: Hydrolase_4; pfam12146
568708018187	putative hydrolase; Provisional; Region: PRK10976
568708018188	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708018189	active site
568708018190	motif I; other site
568708018191	motif II; other site
568708018192	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708018194	Carboxylate/Amino Acid/Amine Transporter; Region: 2A78; TIGR00950
568708018195	EamA-like transporter family; Region: EamA; pfam00892
568708018196	Signal peptide predicted for STM_MW39341 by SignalP 2.0 HMM (Signal peptide probability 0.655) with cleavage site probability 0.614 between residues 19 and 20
568708018197	10 probable transmembrane helices predicted for STM_MW39341 by TMHMM2.0 at aa 2-24, 28-47, 54-76, 80-102, 109-128, 138-157, 170-192, 202-224, 231-253 and 258-275
568708018199	DNA-binding transcriptional regulator MetR; Provisional; Region: PRK15421
568708018200	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708018201	The C-terminal substrate binding domain of LysR-type transcriptional regulator metR, which regulates the expression of methionine biosynthetic genes, contains type 2 periplasmic binding fold; Region: PBP2_MetR; cd08441
568708018202	putative dimerization interface [polypeptide binding]; other site
568708018205	Signal peptide predicted for STM_MW39351 by SignalP 2.0 HMM (Signal peptide probability 0.934) with cleavage site probability 0.662 between residues 34 and 35
568708018206	5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase; Provisional; Region: PRK05222
568708018207	CIMS - Cobalamine-independent methonine synthase, or MetE, N-terminal domain_like. Many members have been characterized as 5-methyltetrahydropteroyltriglutamate-homocysteine methyltransferases, EC:2.1.1.14, mostly from bacteria and plants. This enzyme...; Region: CIMS_N_terminal_like; cd03312
568708018208	THF binding site; other site
568708018209	CIMS - Cobalamine-independent methonine synthase, or MetE, C-terminal domain_like. Many members have been characterized as 5-methyltetrahydropteroyltriglutamate-homocysteine methyltransferases, EC:2.1.1.14, mostly from bacteria and plants. This enzyme...; Region: CIMS_C_terminal_like; cd03311
568708018210	substrate binding site [chemical binding]; other site
568708018211	THF binding site; other site
568708018212	zinc-binding site [ion binding]; other site
568708018215	anaerobic sulfatase-maturating enzyme; Region: sulfatase_rSAM; TIGR03942
568708018216	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
568708018217	FeS/SAM binding site; other site
568708018218	radical SAM additional 4Fe4S-binding SPASM domain; Region: rSAM_more_4Fe4S; TIGR04085
568708018221	Dienelactone hydrolase and related enzymes [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG0412
568708018223	uridine phosphorylase; Provisional; Region: PRK11178
568708018224	uridine phosphorylase; Region: Uridine-psphlse; TIGR01718
568708018226	DNA recombination protein RmuC; Provisional; Region: PRK10361
568708018227	RmuC family; Region: RmuC; pfam02646
568708018228	Signal peptide predicted for STM_MW39401 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.973 between residues 28 and 29
568708018229	1 probable transmembrane helix predicted for STM_MW39401 by TMHMM2.0 at aa 5-24
568708018231	ubiE/COQ5 methyltransferase family; Region: Ubie_methyltran; pfam01209
568708018232	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708018233	S-adenosylmethionine binding site [chemical binding]; other site
568708018234	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4627
568708018236	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3165
568708018237	SCP-2 sterol transfer family; Region: SCP2; pfam02036
568708018239	putative ubiquinone biosynthesis protein UbiB; Reviewed; Region: ubiB; PRK04750
568708018240	2-polyprenylphenol 6-hydroxylase; Region: UbiB; TIGR01982
568708018242	1 probable transmembrane helix predicted for STM_MW39431 by TMHMM2.0 at aa 523-542
568708018243	twin arginine translocase protein A; Provisional; Region: tatA; PRK03554
568708018244	1 probable transmembrane helix predicted for STM_MW39441 by TMHMM2.0 at aa 4-21
568708018246	sec-independent translocase; Provisional; Region: PRK01770
568708018247	sec-independent translocase; Provisional; Region: tatB; PRK00404
568708018248	1 probable transmembrane helix predicted for STM_MW39451 by TMHMM2.0 at aa 4-21
568708018249	twin-arginine protein translocation system subunit TatC; Provisional; Region: PRK10921
568708018251	6 probable transmembrane helices predicted for STM_MW39461 by TMHMM2.0 at aa 20-42, 74-96, 116-138, 158-180, 193-210 and 215-237
568708018252	TatD like proteins;  E.coli TatD is a cytoplasmic protein, shown to have magnesium dependent DNase activity; Region: TatD_DNAse; cd01310
568708018253	active site
568708018255	transcriptional activator RfaH; Provisional; Region: rfaH; PRK09014
568708018256	N-Utilization Substance G (NusG) N-terminal domain in the NusG Specialized Paralog (SP), RfaH; Region: NGN_SP_RfaH; cd09892
568708018257	KOW: an acronym for the authors' surnames (Kyrpides, Ouzounis and Woese); Region: KOW; cl00354
568708018259	3-octaprenyl-4-hydroxybenzoate decarboxylase; Provisional; Region: PRK10922
568708018261	FMN reductase; Validated; Region: fre; PRK08051
568708018262	NAD(P)H dependent flavin oxidoreductases use flavin as a substrate in mediating electron transfer from iron complexes or iron proteins. Structurally similar to ferredoxin reductases, but with only 15% sequence identity, flavin reductases reduce FAD, FMN; Region: flavin_oxioreductase; cd06189
568708018263	FAD binding pocket [chemical binding]; other site
568708018264	FAD binding motif [chemical binding]; other site
568708018265	phosphate binding motif [ion binding]; other site
568708018266	beta-alpha-beta structure motif; other site
568708018267	NAD binding pocket [chemical binding]; other site
568708018270	Arylsulfotransferase (ASST); Region: Arylsulfotrans; pfam05935
568708018271	Signal peptide predicted for STM_MW39511 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.644 between residues 26 and 27
568708018273	3-ketoacyl-CoA thiolase; Reviewed; Region: fadA; PRK08947
568708018274	Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751
568708018275	dimer interface [polypeptide binding]; other site
568708018276	active site
568708018279	multifunctional fatty acid oxidation complex subunit alpha; Reviewed; Region: fadB; PRK11730
568708018280	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
568708018281	substrate binding site [chemical binding]; other site
568708018282	oxyanion hole (OAH) forming residues; other site
568708018283	trimer interface [polypeptide binding]; other site
568708018284	3-hydroxyacyl-CoA dehydrogenase, NAD binding domain; Region: 3HCDH_N; pfam02737
568708018285	3-hydroxyacyl-CoA dehydrogenase, C-terminal domain; Region: 3HCDH; pfam00725
568708018286	3-hydroxyacyl-CoA dehydrogenase, C-terminal domain; Region: 3HCDH; pfam00725
568708018290	proline dipeptidase; Provisional; Region: PRK13607
568708018291	Prolidase. E.C. 3.4.13.9. Also known as Xaa-Pro dipeptidase, X-Pro dipeptidase, proline dipeptidase., imidodipeptidase, peptidase D, gamma-peptidase. Catalyses hydrolysis of Xaa-Pro dipeptides; also acts on aminoacyl-hydroxyproline analogs. No action on...; Region: Prolidase; cd01087
568708018292	active site
568708018294	hypothetical protein; Provisional; Region: PRK11568
568708018295	Uncharacterized protein family UPF0029; Region: UPF0029; pfam01205
568708018296	Domain of unknown function (DUF1949); Region: DUF1949; pfam09186
568708018299	potassium transporter; Provisional; Region: PRK10750
568708018300	potassium uptake protein, TrkH family; Region: 2a38; TIGR00933
568708018301	Signal peptide predicted for STM_MW39561 by SignalP 2.0 HMM (Signal peptide probability 0.648) with cleavage site probability 0.408 between residues 27 and 28
568708018302	10 probable transmembrane helices predicted for STM_MW39561 by TMHMM2.0 at aa 9-31, 35-57, 69-91, 133-155, 185-207, 238-260, 273-295, 332-354, 396-418 and 456-478
568708018304	protoporphyrinogen oxidase; Provisional; Region: hemG; PRK11104
568708018306	Molybdenum is an essential trace element in the form of molybdenum cofactor (Moco) which is associated with the metabolism of nitrogen, carbon and sulfur by redox active enzymes. In E. coli, the synthesis of Moco involves genes from several loci: moa; Region: MobB; cd03116
568708018307	Walker A motif; other site
568708018309	molybdopterin-guanine dinucleotide biosynthesis protein MobA; Reviewed; Region: mobA; PRK00317
568708018310	MobA catalyzes the formation of molybdopterin guanine dinucleotide; Region: MobA; cd02503
568708018311	GTP binding site; other site
568708018312	Protein of unknown function (DUF1040); Region: DUF1040; pfam06288
568708018314	Putative homoserine kinase type II (protein kinase fold) [General function prediction only]; Region: COG2334
568708018315	serine/threonine protein kinase; Provisional; Region: PRK11768
568708018317	DsbA family, DsbA subfamily; DsbA is a monomeric thiol disulfide oxidoreductase protein containing a redox active CXXC motif imbedded in a TRX fold. It is involved in the oxidative protein folding pathway in prokaryotes, and is the strongest thiol...; Region: DsbA_DsbA; cd03019
568708018318	DSBA-like thioredoxin domain; Region: DSBA; pfam01323
568708018319	catalytic residues [active]
568708018320	hinge region; other site
568708018321	alpha helical domain; other site
568708018322	Signal peptide predicted for STM_MW39621 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.894 between residues 19 and 20
568708018324	1-acyl-sn-glycerol-3-phosphate acyltransferase [Lipid metabolism]; Region: PlsC; COG0204
568708018325	Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: LCLAT1-like; Region: LPLAT_LCLAT1-like; cd07990
568708018326	putative acyl-acceptor binding pocket; other site
568708018328	3 probable transmembrane helices predicted for STM_MW39631 by TMHMM2.0 at aa 12-34, 49-66 and 122-140
568708018329	Signal peptide predicted for STM_MW39631 by SignalP 2.0 HMM (Signal peptide probability 0.652) with cleavage site probability 0.424 between residues 25 and 26
568708018330	DNA polymerase I; Provisional; Region: PRK05755
568708018331	PIN domain of the 5'-3' exonuclease of Taq DNA polymerase I and homologs; Region: PIN_53EXO; cd09859
568708018332	active site
568708018333	metal binding site 1 [ion binding]; metal-binding site
568708018334	putative 5' ssDNA interaction site; other site
568708018335	metal binding site 3; metal-binding site
568708018336	metal binding site 2 [ion binding]; metal-binding site
568708018337	H3TH domain of the 5'-3' exonuclease of Taq DNA polymerase I and homologs; Region: H3TH_53EXO; cd09898
568708018338	putative DNA binding site [nucleotide binding]; other site
568708018339	putative metal binding site [ion binding]; other site
568708018340	DEDDy 3'-5' exonuclease domain of Escherichia coli DNA polymerase I and similar bacterial family-A DNA polymerases; Region: DNA_polA_I_Ecoli_like_exo; cd06139
568708018341	active site
568708018342	catalytic site [active]
568708018343	substrate binding site [chemical binding]; other site
568708018344	Polymerase I functions primarily to fill DNA gaps that arise during DNA repair, recombination and replication; Region: DNA_pol_A_pol_I_C; cd08637
568708018345	active site
568708018346	DNA binding site [nucleotide binding]
568708018347	catalytic site [active]
568708018352	YihA (EngB) GTPase family; Region: YihA_EngB; cd01876
568708018353	G1 box; other site
568708018354	GTP/Mg2+ binding site [chemical binding]; other site
568708018355	Switch I region; other site
568708018356	G2 box; other site
568708018357	G3 box; other site
568708018358	Switch II region; other site
568708018359	G4 box; other site
568708018360	G5 box; other site
568708018363	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3078
568708018365	coproporphyrinogen III oxidase; Provisional; Region: PRK09249
568708018366	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
568708018367	FeS/SAM binding site; other site
568708018368	HemN C-terminal domain; Region: HemN_C; pfam06969
568708018371	nitrogen regulation protein NR(I); Provisional; Region: glnG; PRK10923
568708018372	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708018373	active site
568708018374	phosphorylation site [posttranslational modification]
568708018375	intermolecular recognition site; other site
568708018376	dimerization interface [polypeptide binding]; other site
568708018377	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708018378	Walker A motif; other site
568708018379	ATP binding site [chemical binding]; other site
568708018380	Walker B motif; other site
568708018381	arginine finger; other site
568708018382	Bacterial regulatory protein, Fis family; Region: HTH_8; pfam02954
568708018386	nitrogen regulation protein NR(II); Provisional; Region: glnL; PRK11073
568708018387	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
568708018388	putative active site [active]
568708018389	heme pocket [chemical binding]; other site
568708018390	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
568708018391	dimer interface [polypeptide binding]; other site
568708018392	phosphorylation site [posttranslational modification]
568708018393	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708018394	ATP binding site [chemical binding]; other site
568708018395	Mg2+ binding site [ion binding]; other site
568708018396	G-X-G motif; other site
568708018400	glutamine synthetase; Provisional; Region: glnA; PRK09469
568708018401	Glutamine synthetase, beta-Grasp domain; Region: Gln-synt_N; pfam03951
568708018402	Glutamine synthetase, catalytic domain; Region: Gln-synt_C; pfam00120
568708018405	GTP-binding protein; Provisional; Region: PRK10218
568708018406	Tyrosine phosphorylated protein A (TypA)/BipA family belongs to ribosome-binding GTPases; Region: TypA_BipA; cd01891
568708018407	G1 box; other site
568708018408	putative GEF interaction site [polypeptide binding]; other site
568708018409	GTP/Mg2+ binding site [chemical binding]; other site
568708018410	Switch I region; other site
568708018411	G2 box; other site
568708018412	G3 box; other site
568708018413	Switch II region; other site
568708018414	G4 box; other site
568708018415	G5 box; other site
568708018416	BipA_TypA_II: domain II of BipA (also called TypA) having homology to domain II of the elongation factors (EFs) EF-G and EF-Tu.  BipA is a highly conserved protein with global regulatory properties in Escherichia coli. BipA is phosphorylated on a...; Region: BipA_TypA_II; cd03691
568708018417	BipA_TypA_C: a C-terminal portion of BipA or TypA having homology to the C terminal domains of the elongation factors EF-G and EF-2. A member of the ribosome binding GTPase superfamily, BipA is widely distributed in bacteria and plants.  BipA is a highly...; Region: BipA_TypA_C; cd03710
568708018421	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708018422	haloacid dehalogenase-like hydrolase; Region: Hydrolase_3; pfam08282
568708018423	active site
568708018424	motif I; other site
568708018425	motif II; other site
568708018426	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708018428	coproporphyrinogen III oxidase; Validated; Region: PRK08208
568708018429	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
568708018430	FeS/SAM binding site; other site
568708018431	HemN C-terminal domain; Region: HemN_C; pfam06969
568708018434	Sulfatase; Region: Sulfatase; cl17466
568708018436	YheC/D like ATP-grasp; Region: ATPgrasp_YheCD; pfam14398
568708018437	Leucine-rich repeats (LRRs), ribonuclease inhibitor (RI)-like subfamily. LRRs are 20-29 residue sequence motifs present in many proteins that participate in protein-protein interactions and have different functions and cellular locations. LRRs correspond...; Region: LRR_RI; cl15309
568708018438	Leucine-rich repeats; other site
568708018439	Substrate binding site [chemical binding]; other site
568708018440	outer membrane porin L; Provisional; Region: ompL; PRK09980
568708018442	Signal peptide predicted for STM_MW39801 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.908 between residues 20 and 21
568708018443	sugar (Glycoside-Pentoside-Hexuronide) transporter; Region: gph; TIGR00792
568708018444	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708018445	putative substrate translocation pore; other site
568708018446	12 probable transmembrane helices predicted for STM_MW39811 by TMHMM2.0 at aa 20-42, 52-74, 86-108, 119-141, 154-176, 186-208, 237-259, 274-296, 303-325, 329-351, 380-402 and 415-437
568708018447	melibiose:sodium symporter; Provisional; Region: PRK10429; cl15392
568708018448	sugar (Glycoside-Pentoside-Hexuronide) transporter; Region: gph; TIGR00792
568708018449	11 probable transmembrane helices predicted for STM_MW39821 by TMHMM2.0 at aa 46-68, 89-111, 121-143, 156-178, 188-210, 244-266, 276-295, 308-328, 333-355, 387-409 and 419-441
568708018450	alpha-glucosidase; Provisional; Region: PRK10426
568708018451	Galactose mutarotase-like; Region: Gal_mutarotas_2; pfam13802
568708018452	YihQ is a bacterial alpha-glucosidase with a conserved glycosyl hydrolase family 31 (GH31) domain that catalyzes the release of an alpha-glucosyl residue from the non-reducing end of alpha-glucoside substrates such as alpha-glucosyl fluoride. Orthologs...; Region: GH31_glucosidase_YihQ; cd06594
568708018453	putative active site [active]
568708018454	putative catalytic site [active]
568708018456	Aldose 1-epimerase, similar to Escherichia coli YihR; Region: Aldose_epim_Ec_YihR; cd09022
568708018457	active site
568708018458	catalytic residues [active]
568708018460	AGE domain; N-acyl-D-glucosamine 2-epimerase domain; Responsible for intermediate epimerization during biosynthesis of N-acetylneuraminic acid. Catalytic mechanism is believed to be via nucleotide elimination and readdition and is ATP modulated. AGE is...; Region: AGE; cd00249
568708018461	dimerization interface [polypeptide binding]; other site
568708018462	putative active cleft [active]
568708018464	Tagatose-1,6-bisphosphate aldolase [Carbohydrate transport and metabolism]; Region: LacD; COG3684
568708018466	NADH-dependent gamma-hydroxybutyrate dehydrogenase; Provisional; Region: PRK15461
568708018467	6-phosphogluconate dehydrogenase-like protein; Reviewed; Region: PRK09599
568708018469	Sugar kinases, ribokinase family [Carbohydrate transport and metabolism]; Region: RbsK; COG0524
568708018470	Ribokinase-like subgroup B.  Found in bacteria and plants, this subgroup is part of the ribokinase/pfkB superfamily.  Its oligomerization state is unknown at this time; Region: ribokinase_group_B; cd01945
568708018471	substrate binding site [chemical binding]; other site
568708018472	ATP binding site [chemical binding]; other site
568708018474	Transcriptional regulators of sugar metabolism [Transcription / Carbohydrate transport and metabolism]; Region: GlpR; COG1349
568708018475	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
568708018476	putative DNA binding site [nucleotide binding]; other site
568708018477	putative Zn2+ binding site [ion binding]; other site
568708018478	DeoR C terminal sensor domain; Region: DeoRC; pfam00455
568708018481	haloacid dehalogenase superfamily, subfamily IA, variant 3 with third motif having DD or ED; Region: HAD-SF-IA-v3; TIGR01509
568708018482	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708018483	motif II; other site
568708018485	hypothetical protein; Reviewed; Region: PRK01637
568708018487	6 probable transmembrane helices predicted for STM_MW39911 by TMHMM2.0 at aa 39-61, 101-120, 140-162, 177-199, 212-234 and 244-266
568708018488	D-Tyrosyl-tRNAtyr deacylases; a class of tRNA-dependent hydrolases which are capable of hydrolyzing the ester bond of D-Tyrosyl-tRNA reducing the level of cellular D-Tyrosine while recycling the peptidyl-tRNA; found in bacteria and in eukaryotes but not...; Region: Dtyr_deacylase; cd00563
568708018489	putative active site [active]
568708018490	dimerization interface [polypeptide binding]; other site
568708018491	putative tRNAtyr binding site [nucleotide binding]; other site
568708018493	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
568708018494	Coenzyme A binding pocket [chemical binding]; other site
568708018495	Putative thioesterase (yiiD_Cterm); Region: YiiD_Cterm; pfam09500
568708018498	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
568708018499	non-specific DNA binding site [nucleotide binding]; other site
568708018500	salt bridge; other site
568708018501	sequence-specific DNA binding site [nucleotide binding]; other site
568708018503	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4680
568708018505	Protein of unknown function (DUF2424); Region: DUF2424; pfam10340
568708018506	alpha/beta hydrolase fold; Region: Abhydrolase_3; pfam07859
568708018508	Predicted transcriptional regulator [Transcription]; Region: COG2944
568708018509	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
568708018510	non-specific DNA binding site [nucleotide binding]; other site
568708018511	salt bridge; other site
568708018512	sequence-specific DNA binding site [nucleotide binding]; other site
568708018514	formate dehydrogenase accessory protein FdhE; Provisional; Region: PRK03564
568708018515	formate dehydrogenase accessory protein FdhE; Region: FdhE; TIGR01562
568708018517	formate dehydrogenase-O subunit gamma; Provisional; Region: PRK10639
568708018518	formate dehydrogenase, gamma subunit; Region: formate-DH-gamm; TIGR01583
568708018520	4 probable transmembrane helices predicted for STM_MW39991 by TMHMM2.0 at aa 21-40, 55-77, 114-136 and 151-173
568708018521	formate dehydrogenase, beta subunit, Fe-S containing; Region: FDH-beta; TIGR01582
568708018522	Formate dehydrogenase N, transmembrane; Region: Form-deh_trans; pfam09163
568708018525	formate dehydrogenase, alpha subunit, proteobacterial-type; Region: formate-DH-alph; TIGR01553
568708018526	Formate dehydrogenase N, alpha subunit (Formate-Dh-Na) is a major component of nitrate respiration in bacteria such as in the E. coli formate dehydrogenase N (Fdh-N). Fdh-N is a membrane protein that is a complex of three different subunits and is the...; Region: MopB_Formate-Dh-Na-like; cd02752
568708018527	[4Fe-4S] binding site [ion binding]; other site
568708018528	Molybdopterin-Binding (MopB) domain of the MopB superfamily of proteins, a  large, diverse, heterogeneous superfamily of enzymes that, in general, bind molybdopterin as a cofactor. The MopB domain is found in a wide variety of molybdenum- and...; Region: Molybdopterin-Binding; cl09928
568708018529	Formate dehydrogenase N, alpha subunit (Formate-Dh-Na) is a major component of nitrate respiration in bacteria such as in the E. coli formate dehydrogenase N (Fdh-N). Fdh-N is a membrane protein that is a complex of three different subunits and is the...; Region: MopB_Formate-Dh-Na-like; cd02752
568708018530	Formate dehydrogenase N, alpha subunit (Formate-Dh-Na) is a major component of nitrate respiration in bacteria such as in the E. coli formate dehydrogenase N (Fdh-N). Fdh-N is a membrane protein that is a complex of three different subunits and is the...; Region: MopB_CT_Formate-Dh-Na-like; cd02792
568708018531	molybdopterin cofactor binding site; other site
568708018535	Signal peptide predicted for STM_MW40011 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.993 between residues 33 and 34
568708018536	1 probable transmembrane helix predicted for STM_MW40011 by TMHMM2.0 at aa 11-33
568708018537	formate dehydrogenase accessory protein; Reviewed; Region: PRK00724
568708018539	Protein of unknown function (DUF3829); Region: DUF3829; pfam12889
568708018540	Signal peptide predicted for STM_MW40031 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.997 between residues 21 and 22
568708018541	Protein of unknown function (DUF3829); Region: DUF3829; pfam12889
568708018542	Branched-chain amino acid transport protein (AzlD); Region: AzlD; pfam05437
568708018543	4 probable transmembrane helices predicted for STM_MW40051 by TMHMM2.0 at aa 4-26, 38-60, 65-82 and 87-106
568708018545	Predicted branched-chain amino acid permease (azaleucine resistance) [Amino acid transport and metabolism]; Region: AzlC; COG1296
568708018546	5 probable transmembrane helices predicted for STM_MW40061 by TMHMM2.0 at aa 21-43, 58-80, 127-149, 159-178 and 191-213
568708018548	Signal peptide predicted for STM_MW40061 by SignalP 2.0 HMM (Signal peptide probability 0.996) with cleavage site probability 0.979 between residues 36 and 37
568708018549	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
568708018550	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
568708018551	non-specific DNA binding site [nucleotide binding]; other site
568708018552	salt bridge; other site
568708018553	sequence-specific DNA binding site [nucleotide binding]; other site
568708018554	Cupin domain; Region: Cupin_2; cl17218
568708018557	L-rhamnose 1-epimerase; Region: YiiL_rotase; TIGR02625
568708018559	lactaldehyde reductase; Region: lactal_redase; TIGR02638
568708018560	Lactadehyde:propanediol oxidoreductase (LPO) catalyzes the interconversion between L-lactaldehyde and L-1,2-propanediol in Escherichia coli and other enterobacteria; Region: LPO; cd08176
568708018561	dimer interface [polypeptide binding]; other site
568708018562	active site
568708018563	metal binding site [ion binding]; metal-binding site
568708018565	Class II Aldolase and Adducin head (N-terminal) domain. Aldolases are ubiquitous enzymes catalyzing central steps of carbohydrate metabolism. Based on enzymatic mechanisms, this superfamily has been divided into two distinct classes (Class I and II); Region: Aldolase_II; cd00398
568708018566	intersubunit interface [polypeptide binding]; other site
568708018567	active site
568708018568	Zn2+ binding site [ion binding]; other site
568708018570	L-rhamnose isomerase; Provisional; Region: PRK01076
568708018571	Predicted sugar isomerase [Cell envelope biogenesis, outer membrane]; Region: COG4952; cl17900
568708018573	L-rhamnulose kinases; a subfamily of the FGGY family of carbohydrate kinases; Region: FGGY_RhuK; cd07771
568708018574	N- and C-terminal domain interface [polypeptide binding]; other site
568708018575	active site
568708018576	putative catalytic site [active]
568708018577	metal binding site [ion binding]; metal-binding site
568708018578	ATP binding site [chemical binding]; other site
568708018579	rhamnulokinase; Provisional; Region: rhaB; PRK10640
568708018580	carbohydrate binding site [chemical binding]; other site
568708018583	transcriptional activator RhaS; Provisional; Region: PRK13503
568708018584	AraC-like ligand binding domain; Region: AraC_binding; pfam02311
568708018585	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708018586	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708018589	transcriptional activator RhaR; Provisional; Region: PRK13502
568708018590	AraC-like ligand binding domain; Region: AraC_binding; pfam02311
568708018591	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708018594	L-rhamnose-proton symport protein (RhaT); Region: RhaT; pfam06379
568708018595	RhaT L-rhamnose-proton symporter family protein; Region: RhaT; TIGR00776
568708018597	10 probable transmembrane helices predicted for STM_MW40151 by TMHMM2.0 at aa 4-26, 38-55, 70-92, 99-121, 136-155, 175-192, 212-234, 254-276, 291-309 and 321-343
568708018598	Oligogalacturonate-specific porin protein (KdgM); Region: KdgM; pfam06178
568708018599	Signal peptide predicted for STM_MW40161 by SignalP 2.0 HMM (Signal peptide probability 0.993) with cleavage site probability 0.975 between residues 22 and 23
568708018601	DctM-like transporters; Region: DctM; pfam06808
568708018602	TRAP-type C4-dicarboxylate transport system, large permease component [Carbohydrate transport and metabolism]; Region: DctQ; COG1593
568708018603	12 probable transmembrane helices predicted for STM_MW40171 by TMHMM2.0 at aa 10-41, 61-83, 103-125, 146-168, 178-200, 221-243, 248-267, 280-302, 312-334, 341-360, 370-392 and 404-426
568708018605	Signal peptide predicted for STM_MW40171 by SignalP 2.0 HMM (Signal peptide probability 0.981) with cleavage site probability 0.885 between residues 22 and 23
568708018606	TRAP-type C4-dicarboxylate transport system, small permease component [Carbohydrate transport and metabolism]; Region: DctM; COG3090
568708018607	4 probable transmembrane helices predicted for STM_MW40181 by TMHMM2.0 at aa 10-32, 48-66, 86-108 and 129-151
568708018609	Signal peptide predicted for STM_MW40181 by SignalP 2.0 HMM (Signal peptide probability 0.976) with cleavage site probability 0.932 between residues 27 and 28
568708018610	TRAP-type C4-dicarboxylate transport system, periplasmic component [Carbohydrate transport and metabolism]; Region: DctP; COG1638
568708018611	Bacterial extracellular solute-binding protein, family 7; Region: SBP_bac_7; pfam03480
568708018613	Signal peptide predicted for STM_MW40191 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.995 between residues 24 and 25
568708018614	superoxide dismutase; Provisional; Region: PRK10925
568708018615	Iron/manganese superoxide dismutases, alpha-hairpin domain; Region: Sod_Fe_N; pfam00081
568708018616	Iron/manganese superoxide dismutases, C-terminal domain; Region: Sod_Fe_C; pfam02777
568708018619	6-N-hydroxylaminopurine resistance protein; Provisional; Region: PRK11536
568708018620	MOSC domain; Region: MOSC; pfam03473
568708018621	3-alpha domain; Region: 3-alpha; pfam03475
568708018624	SnoaL-like domain; Region: SnoaL_2; pfam12680
568708018625	two-component sensor protein; Provisional; Region: cpxA; PRK09470
568708018626	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
568708018627	dimerization interface [polypeptide binding]; other site
568708018628	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
568708018629	dimer interface [polypeptide binding]; other site
568708018630	phosphorylation site [posttranslational modification]
568708018631	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708018632	ATP binding site [chemical binding]; other site
568708018633	Mg2+ binding site [ion binding]; other site
568708018634	G-X-G motif; other site
568708018637	2 probable transmembrane helices predicted for STM_MW40231 by TMHMM2.0 at aa 5-27 and 165-187
568708018639	DNA-binding transcriptional regulator CpxR; Provisional; Region: PRK10955
568708018640	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708018641	active site
568708018642	intermolecular recognition site; other site
568708018643	dimerization interface [polypeptide binding]; other site
568708018644	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
568708018645	DNA binding site [nucleotide binding]
568708018648	CpxP component of the bacterial Cpx-two-component system and related proteins; Region: CpxP_like; cd09916
568708018649	dimer interface [polypeptide binding]; other site
568708018650	Signal peptide predicted for STM_MW40251 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 21 and 22
568708018651	ferrous iron efflux protein F; Reviewed; Region: fieF; PRK09509
568708018652	Predicted Co/Zn/Cd cation transporters [Inorganic ion transport and metabolism]; Region: MMT1; COG0053
568708018653	Signal peptide predicted for STM_MW40261 by SignalP 2.0 HMM (Signal peptide probability 0.913) with cleavage site probability 0.343 between residues 30 and 31
568708018654	6 probable transmembrane helices predicted for STM_MW40261 by TMHMM2.0 at aa 12-34, 38-60, 80-102, 117-139, 158-175 and 180-199
568708018656	Phosphofructokinase, a key regulatory enzyme in glycolysis, catalyzes the phosphorylation of fructose-6-phosphate to fructose-1,6-biphosphate. The members belong to a subfamily of the PFKA family (cd00363) and include bacterial ATP-dependent...; Region: Bacterial_PFK; cd00763
568708018657	6-phosphofructokinase; Region: PFKA_ATP; TIGR02482
568708018658	active site
568708018659	ADP/pyrophosphate binding site [chemical binding]; other site
568708018660	dimerization interface [polypeptide binding]; other site
568708018661	allosteric effector site; other site
568708018662	fructose-1,6-bisphosphate binding site; other site
568708018664	Bacterial extracellular solute-binding protein; Region: SBP_bac_11; pfam13531
568708018665	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
568708018666	substrate binding pocket [chemical binding]; other site
568708018667	membrane-bound complex binding site; other site
568708018668	Signal peptide predicted for STM_MW40281 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 19 and 20
568708018670	CDP-diacylglycerol pyrophosphatase, bacterial type; Region: cdh; TIGR00672
568708018671	Signal peptide predicted for STM_MW40291 by SignalP 2.0 HMM (Signal peptide probability 0.923) with cleavage site probability 0.355 between residues 18 and 19
568708018673	1 probable transmembrane helix predicted for STM_MW40291 by TMHMM2.0 at aa 5-23
568708018674	Na+/melibiose symporter and related transporters [Carbohydrate transport and metabolism]; Region: MelB; COG2211
568708018675	melibiose:sodium symporter; Provisional; Region: PRK10429; cl15392
568708018676	12 probable transmembrane helices predicted for STM_MW40301 by TMHMM2.0 at aa 12-34, 44-66, 79-96, 106-128, 149-171, 176-198, 228-247, 262-284, 291-310, 320-342, 362-384 and 399-421
568708018678	Sugar kinases, ribokinase family [Carbohydrate transport and metabolism]; Region: RbsK; COG0524
568708018679	Fructokinases (FRKs) mainly from bacteria and plants are enzymes with high specificity for fructose, as are all FRKs, but they catalyzes the conversion of fructose to fructose-6-phosphate, which is an entry point into glycolysis via conversion into...; Region: bac_FRK; cd01167
568708018680	putative substrate binding site [chemical binding]; other site
568708018681	putative ATP binding site [chemical binding]; other site
568708018683	ADP-ribosylglycohydrolase [Posttranslational modification, protein turnover, chaperones]; Region: DraG; COG1397
568708018684	Signal peptide predicted for STM_MW40321 by SignalP 2.0 HMM (Signal peptide probability 0.959) with cleavage site probability 0.788 between residues 22 and 23
568708018686	Transcriptional regulators [Transcription]; Region: PhnF; COG2188
568708018687	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
568708018688	DNA-binding site [nucleotide binding]; DNA binding site
568708018689	Alanine racemase, C-terminal domain; Region: Ala_racemase_C; cl08293
568708018690	UTRA domain; Region: UTRA; pfam07702
568708018695	Uncharacterized conserved protein, contains double-stranded beta-helix domain [Function unknown]; Region: COG1917
568708018697	autoinducer-2 (AI-2) kinase; Provisional; Region: PRK10939
568708018698	Autoinducer-2 kinases; a subfamily of the FGGY family of carbohydrate kinases; Region: FGGY_AI-2K; cd07775
568708018699	putative N- and C-terminal domain interface [polypeptide binding]; other site
568708018700	putative active site [active]
568708018701	putative MgATP binding site [chemical binding]; other site
568708018702	catalytic site [active]
568708018703	metal binding site [ion binding]; metal-binding site
568708018704	putative carbohydrate binding site [chemical binding]; other site
568708018705	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cl17037
568708018708	transcriptional regulator LsrR; Provisional; Region: PRK15418
568708018709	helix_turn_helix, cAMP Regulatory protein C-terminus; DNA binding domain of prokaryotic regulatory proteins belonging to the catabolite activator protein family; Region: HTH_CRP; cl17320
568708018710	Putative sugar-binding domain; Region: Sugar-bind; pfam04198
568708018712	autoinducer 2 ABC transporter ATP-binding protein LsrA; Provisional; Region: PRK15439
568708018713	First domain of the ATP-binding cassette component of monosaccharide transport system; Region: ABC_Carb_Monos_I; cd03216
568708018714	Walker A/P-loop; other site
568708018715	ATP binding site [chemical binding]; other site
568708018716	Q-loop/lid; other site
568708018717	ABC transporter signature motif; other site
568708018718	Walker B; other site
568708018719	D-loop; other site
568708018720	H-loop/switch region; other site
568708018721	Second domain of the ATP-binding cassette component of monosaccharide transport system; Region: ABC_Carb_Monos_II; cd03215
568708018723	Branched-chain amino acid transport system / permease component; Region: BPD_transp_2; pfam02653
568708018724	Transmembrane subunit (TM) of Escherichia coli AraH and related proteins. E. coli AraH is the TM of a Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporter involved in the uptake of the monosaccharide arabinose. This group...; Region: TM_PBP1_transp_AraH_like; cd06579
568708018725	TM-ABC transporter signature motif; other site
568708018726	Signal peptide predicted for STM_MW40401 by SignalP 2.0 HMM (Signal peptide probability 0.959) with cleavage site probability 0.607 between residues 29 and 30
568708018727	9 probable transmembrane helices predicted for STM_MW40401 by TMHMM2.0 at aa 13-32, 36-58, 65-87, 91-113, 118-135, 155-177, 210-232, 250-272 and 279-301
568708018729	Branched-chain amino acid transport system / permease component; Region: BPD_transp_2; pfam02653
568708018730	Transmembrane subunit (TM) of Escherichia coli AraH and related proteins. E. coli AraH is the TM of a Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporter involved in the uptake of the monosaccharide arabinose. This group...; Region: TM_PBP1_transp_AraH_like; cd06579
568708018731	TM-ABC transporter signature motif; other site
568708018732	9 probable transmembrane helices predicted for STM_MW40411 by TMHMM2.0 at aa 7-29, 39-61, 66-88, 92-114, 119-141, 161-183, 214-236, 251-282 and 295-314
568708018734	autoinducer 2-binding protein lsrB; Provisional; Region: PRK15408
568708018735	Periplasmic binding domain of autoinducer-2 (AI-2) receptor LsrB from Salmonella typhimurium and its close homologs; Region: PBP1_LsrB_Quorum_Sensing; cd06302
568708018736	ligand binding site [chemical binding]; other site
568708018737	Signal peptide predicted for STM_MW40421 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.994 between residues 26 and 27
568708018738	DhnA-type fructose-1,6-bisphosphate aldolase and related enzymes [Carbohydrate transport and metabolism]; Region: FbaB; COG1830
568708018739	Class I fructose-1,6-bisphosphate (FBP) aldolases of the archaeal type (DhnA homologs); Region: DhnA; cd00958
568708018740	putative active site; other site
568708018741	catalytic residue [active]
568708018743	autoinducer-2 (AI-2) modifying protein LsrG; Provisional; Region: PRK10486
568708018745	Pentose-5-phosphate-3-epimerase [Carbohydrate transport and metabolism]; Region: Rpe; COG0036
568708018746	Ribulose-5-phosphate 3-epimerase (RPE). This enzyme catalyses the interconversion of D-ribulose 5-phosphate (Ru5P) into D-xylulose 5-phosphate, as part of the Calvin cycle (reductive pentose phosphate pathway) in chloroplasts and in the oxidative pentose...; Region: RPE; cd00429
568708018747	substrate binding site [chemical binding]; other site
568708018748	hexamer interface [polypeptide binding]; other site
568708018749	metal binding site [ion binding]; metal-binding site
568708018750	1 probable transmembrane helix predicted for STM_MW40451 by TMHMM2.0 at aa 12-34
568708018752	Triosephosphate isomerase (TIM) is a glycolytic enzyme that catalyzes the interconversion of dihydroxyacetone phosphate and D-glyceraldehyde-3-phosphate. The reaction is very efficient and requires neither cofactors nor metal ions. TIM, usually...; Region: TIM; cd00311
568708018753	triosephosphate isomerase; Provisional; Region: PRK14567
568708018754	substrate binding site [chemical binding]; other site
568708018755	dimer interface [polypeptide binding]; other site
568708018756	catalytic triad [active]
568708018758	Protein of unknown function (DUF1454); Region: DUF1454; pfam07305
568708018760	Signal peptide predicted for STM_MW40471 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.989 between residues 23 and 24
568708018761	Predicted membrane protein [Function unknown]; Region: COG3152
568708018763	4 probable transmembrane helices predicted for STM_MW40481 by TMHMM2.0 at aa 20-37, 41-63, 75-97 and 101-123
568708018764	ferredoxin-NADP reductase; Provisional; Region: PRK10926
568708018765	Ferredoxin-NADP+ (oxido)reductase is an FAD-containing enzyme that catalyzes the reversible electron transfer between NADP(H) and electron carrier proteins such as ferredoxin and flavodoxin. Isoforms of these flavoproteins (i.e. having a non-covalently...; Region: FNR1; cd06195
568708018766	FAD binding pocket [chemical binding]; other site
568708018767	FAD binding motif [chemical binding]; other site
568708018768	phosphate binding motif [ion binding]; other site
568708018769	beta-alpha-beta structure motif; other site
568708018770	NAD binding pocket [chemical binding]; other site
568708018773	Bacterial fructose-1,6-bisphosphatase, glpX-encoded; Region: FBPase_glpX; pfam03320
568708018774	Bacterial fructose-1,6-bisphosphatase, glpX-encoded. A dimeric enzyme dependent on Mg(2+). glpX-encoded FPBase (FBPase class II) differs from other members of the inositol-phosphatase superfamily by permutation of secondary structure elements. The core...; Region: FBPase_glpX; cd01516
568708018775	putative active site [active]
568708018777	glycerol kinase; Provisional; Region: glpK; PRK00047
568708018778	Escherichia coli glycerol kinase-like proteins; belongs to the FGGY family of carbohydrate kinases; Region: FGGY_EcGK_like; cd07786
568708018779	N- and C-terminal domain interface [polypeptide binding]; other site
568708018780	active site
568708018781	MgATP binding site [chemical binding]; other site
568708018782	catalytic site [active]
568708018783	metal binding site [ion binding]; metal-binding site
568708018784	glycerol binding site [chemical binding]; other site
568708018785	homotetramer interface [polypeptide binding]; other site
568708018786	homodimer interface [polypeptide binding]; other site
568708018787	FBP binding site [chemical binding]; other site
568708018788	protein IIAGlc interface [polypeptide binding]; other site
568708018791	Major intrinsic protein (MIP) superfamily. Members of the MIP superfamily function as membrane channels that selectively transport water, small neutral molecules, and ions out of and between cells. The channel proteins share a common fold: the N-terminal...; Region: MIP; cd00333
568708018792	amphipathic channel; other site
568708018793	Asn-Pro-Ala signature motifs; other site
568708018795	6 probable transmembrane helices predicted for STM_MW40521 by TMHMM2.0 at aa 12-34, 44-66, 86-108, 145-167, 180-202 and 232-251
568708018796	septal ring assembly protein ZapB; Provisional; Region: PRK15422
568708018798	ribonuclease activity regulator protein RraA; Provisional; Region: PRK09372
568708018800	1,4-dihydroxy-2-naphthoate octaprenyltransferase; Region: menA; TIGR00751
568708018801	UbiA prenyltransferase family; Region: UbiA; pfam01040
568708018802	9 probable transmembrane helices predicted for STM_MW40551 by TMHMM2.0 at aa 21-40, 45-64, 99-121, 125-144, 151-173, 178-200, 230-249, 253-270 and 291-308
568708018804	Signal peptide predicted for STM_MW40551 by SignalP 2.0 HMM (Signal peptide probability 0.900) with cleavage site probability 0.900 between residues 36 and 37
568708018805	ATP-dependent protease ATP-binding subunit HslU; Provisional; Region: hslU; PRK05201
568708018806	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708018807	Walker A motif; other site
568708018808	ATP binding site [chemical binding]; other site
568708018809	AAA domain (Cdc48 subfamily); Region: AAA_2; pfam07724
568708018810	Walker B motif; other site
568708018811	arginine finger; other site
568708018812	C-terminal, D2-small domain, of ClpB protein; Region: ClpB_D2-small; smart01086
568708018815	Protease HslV and the ATPase/chaperone HslU are part of an ATP-dependent proteolytic system that is the prokaryotic homolog of the proteasome. HslV is a dimer of hexamers (a dodecamer) that forms a central proteolytic chamber with active sites on the...; Region: protease_HslV; cd01913
568708018816	active site
568708018817	HslU subunit interaction site [polypeptide binding]; other site
568708018819	essential cell division protein FtsN; Provisional; Region: PRK10927
568708018820	cell division protein FtsN; Provisional; Region: PRK12757
568708018822	1 probable transmembrane helix predicted for STM_MW40581 by TMHMM2.0 at aa 35-57
568708018823	Signal peptide predicted for STM_MW40581 by SignalP 2.0 HMM (Signal peptide probability 0.697) with cleavage site probability 0.325 between residues 45 and 46
568708018824	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
568708018825	DNA binding site [nucleotide binding]
568708018826	DNA-binding transcriptional regulator CytR; Provisional; Region: PRK11041
568708018827	domain linker motif; other site
568708018828	Ligand-binding domain of an uncharacterized transcription regulator from Actinobacillus succinogenes and its close homologs from other bacteria; Region: PBP1_LacI_like_6; cd06284
568708018829	dimerization interface [polypeptide binding]; other site
568708018830	ligand binding site [chemical binding]; other site
568708018833	primosome assembly protein PriA; Validated; Region: PRK05580
568708018834	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
568708018835	ATP binding site [chemical binding]; other site
568708018836	putative Mg++ binding site [ion binding]; other site
568708018837	helicase superfamily c-terminal domain; Region: HELICc; smart00490
568708018838	ATP-binding site [chemical binding]; other site
568708018841	50S ribosomal protein L31; Reviewed; Region: rpmE; PRK00019
568708018843	conserved hypothetical protein; Region: chp_urease_rgn; TIGR02117
568708018845	Arylsulfotransferase (ASST); Region: Arylsulfotrans; pfam05935
568708018847	1 probable transmembrane helix predicted for STM_MW40631 by TMHMM2.0 at aa 7-26
568708018848	Signal peptide predicted for STM_MW40631 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.991 between residues 22 and 23
568708018849	Met Repressor, MetJ.  MetJ is a bacterial regulatory protein that uses S-adenosylmethionine (SAM) as a corepressor to regulate the production of Methionine. MetJ binds arrays of two to five adjacent copies of an eight base-pair 'metbox'...; Region: Met_repressor_MetJ; cd00490
568708018850	dimerization interface [polypeptide binding]; other site
568708018851	DNA binding site [nucleotide binding]
568708018852	corepressor binding sites; other site
568708018854	cystathionine gamma-synthase; Provisional; Region: PRK08045
568708018855	CGS_like: Cystathionine gamma-synthase is a PLP dependent enzyme and catalyzes the committed step of methionine biosynthesis. This pathway is unique to microorganisms and plants, rendering the enzyme an attractive target for the development of...; Region: CGS_like; cd00614
568708018856	homodimer interface [polypeptide binding]; other site
568708018857	substrate-cofactor binding pocket; other site
568708018858	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708018859	catalytic residue [active]
568708018861	bifunctional aspartate kinase II/homoserine dehydrogenase II; Provisional; Region: metL; PRK09466
568708018862	AAK_AK-HSDH: Amino Acid Kinase Superfamily (AAK), AK-HSDH; this CD includes the N-terminal catalytic domain of aspartokinase (AK) of the bifunctional enzyme AK - homoserine dehydrogenase (HSDH). These aspartokinases are found in bacteria (E. coli...; Region: AAK_AK-HSDH; cd04257
568708018863	putative catalytic residues [active]
568708018864	putative nucleotide binding site [chemical binding]; other site
568708018865	putative aspartate binding site [chemical binding]; other site
568708018866	ACT domains C-terminal to the catalytic domain of aspartokinase (AK; 4-L-aspartate-4-phosphotransferase); Region: ACT_AK-like_2; cd04892
568708018867	Homoserine dehydrogenase, NAD binding domain; Region: NAD_binding_3; pfam03447
568708018868	Homoserine dehydrogenase; Region: Homoserine_dh; pfam00742
568708018872	mechanosensitive channel MscS; Provisional; Region: PRK10334
568708018873	Conserved TM helix; Region: TM_helix; pfam05552
568708018874	Mechanosensitive ion channel; Region: MS_channel; pfam00924
568708018877	3 probable transmembrane helices predicted for STM_MW40671 by TMHMM2.0 at aa 25-44, 64-86 and 96-118
568708018878	Sugar (and other) transporter; Region: Sugar_tr; pfam00083
568708018879	9 probable transmembrane helices predicted for STM_MW40681 by TMHMM2.0 at aa 21-40, 60-82, 89-111, 121-143, 148-170, 175-194, 215-237, 252-274 and 295-314
568708018880	5'-nucleotidase/2',3'-cyclic phosphodiesterase and related esterases [Nucleotide transport and metabolism]; Region: UshA; COG0737
568708018881	Escherichia coli UshA-like family, N-terminal metallophosphatase domain; Region: MPP_UshA_N_like; cd00845
568708018882	active site
568708018883	metal binding site [ion binding]; metal-binding site
568708018884	5'-nucleotidase, C-terminal domain; Region: 5_nucleotid_C; pfam02872
568708018887	Methylenetetrahydrofolate reductase (MTHFR). 5,10-Methylenetetrahydrofolate is reduced to 5-methyltetrahydrofolate by methylenetetrahydrofolate reductase, a cytoplasmic, NAD(P)-dependent enzyme. 5-methyltetrahydrofolate is utilized by methionine synthase...; Region: MTHFR; cd00537
568708018888	FAD binding site [chemical binding]; other site
568708018890	catalase/hydroperoxidase HPI(I); Provisional; Region: PRK15061
568708018891	Heme-dependent peroxidases similar to plant peroxidases; Region: plant_peroxidase_like; cl00196
568708018892	heme binding site [chemical binding]; other site
568708018893	C-terminal non-catalytic domain of catalase-peroxidases; Region: catalase_peroxidase_2; cd08200
568708018895	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3738
568708018897	Glycerol dehydrogenase and related enzymes [Energy production and conversion]; Region: GldA; COG0371
568708018898	Glycerol dehydrogenases (GlyDH) catalyzes oxidation of glycerol to dihydroxyacetone in glycerol dissmilation; Region: GlyDH; cd08170
568708018899	dimer interface [polypeptide binding]; other site
568708018900	active site
568708018901	metal binding site [ion binding]; metal-binding site
568708018903	Transaldolase-like fructose-6-phosphate aldolases (FSA) found in bacteria and archaea; Region: Transaldolase_FSA; cd00956
568708018904	active site
568708018905	intersubunit interactions; other site
568708018906	catalytic residue [active]
568708018908	Histidine-containing phosphocarrier protein (HPr)-like proteins. HPr is a central component of the bacterial phosphoenolpyruvate sugar phosphotransferase system (PTS). The PTS catalyses the phosphorylation of sugar substrates during their translocation...; Region: PTS-HPr_like; cd00367
568708018909	dimerization domain swap beta strand [polypeptide binding]; other site
568708018910	regulatory protein interface [polypeptide binding]; other site
568708018911	active site
568708018912	regulatory phosphorylation site [posttranslational modification]; other site
568708018913	PEP-utilising enzyme, N-terminal; Region: PEP-utilisers_N; pfam05524
568708018914	Phosphoenolpyruvate-protein kinase (PTS system EI component in bacteria) [Carbohydrate transport and metabolism]; Region: PtsA; COG1080
568708018915	PEP-utilising enzyme, mobile domain; Region: PEP-utilizers; pfam00391
568708018916	PEP-utilising enzyme, TIM barrel domain; Region: PEP-utilizers_C; pfam02896
568708018917	PTS_IIA, PTS system, fructose/mannitol specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This...; Region: PTS_IIA_fru; cd00211
568708018918	active site
568708018919	phosphorylation site [posttranslational modification]
568708018925	putative PTS system fructose-like transporter subunit EIIC; Provisional; Region: PRK10478
568708018926	Phosphotransferase system, EIIC; Region: PTS_EIIC; pfam02378
568708018927	8 probable transmembrane helices predicted for STM_MW40771 by TMHMM2.0 at aa 21-40, 60-82, 95-117, 132-154, 175-194, 214-236, 283-305 and 315-334
568708018928	PTS_IIB_fructose: subunit IIB of enzyme II (EII) of the fructose-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS). In this system, EII (also referred to as FruAB) is a fructose-specific permease made up of two proteins (FruA and...; Region: PTS_IIB_fructose; cd05569
568708018929	active site
568708018930	P-loop; other site
568708018931	phosphorylation site [posttranslational modification]
568708018932	Signal peptide predicted for STM_MW40781 by SignalP 2.0 HMM (Signal peptide probability 0.962) with cleavage site probability 0.795 between residues 20 and 21
568708018934	putative formate acetyltransferase 2; Provisional; Region: pflD; PRK09983
568708018935	Pyruvate formate lyase 2 and related enzymes; Region: PFL2_DhaB_BssA; cd01677
568708018936	dimer interface [polypeptide binding]; other site
568708018937	active site
568708018938	glycine loop; other site
568708018941	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
568708018942	FeS/SAM binding site; other site
568708018943	pyruvate formate lyase II activase; Provisional; Region: PRK10076
568708018945	PTS_IIB_fructose: subunit IIB of enzyme II (EII) of the fructose-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS). In this system, EII (also referred to as FruAB) is a fructose-specific permease made up of two proteins (FruA and...; Region: PTS_IIB_fructose; cd05569
568708018946	active site
568708018947	P-loop; other site
568708018948	phosphorylation site [posttranslational modification]
568708018949	Signal peptide predicted for STM_MW40811 by SignalP 2.0 HMM (Signal peptide probability 0.801) with cleavage site probability 0.752 between residues 24 and 25
568708018951	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
568708018952	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708018954	hypothetical protein; Provisional; Region: PRK10649
568708018955	Sulfatase; Region: Sulfatase; pfam00884
568708018957	5 probable transmembrane helices predicted for STM_MW40831 by TMHMM2.0 at aa 13-35, 50-67, 69-91, 118-140 and 153-170
568708018958	Signal peptide predicted for STM_MW40831 by SignalP 2.0 HMM (Signal peptide probability 0.695) with cleavage site probability 0.641 between residues 33 and 34
568708018959	phosphoenolpyruvate carboxylase; Reviewed; Region: PRK00009
568708018960	Phosphoenolpyruvate carboxylase [Energy production and conversion]; Region: Ppc; COG2352
568708018962	acetylornithine deacetylase; Provisional; Region: PRK05111
568708018963	M20 Peptidase acetylornithine deacetylase; Region: M20_ArgE; cd03894
568708018964	metal binding site [ion binding]; metal-binding site
568708018965	putative dimer interface [polypeptide binding]; other site
568708018968	N-acetyl-gamma-glutamyl-phosphate reductase; Validated; Region: argC; PRK00436
568708018969	Semialdehyde dehydrogenase, NAD binding domain; Region: Semialdhyde_dh; smart00859
568708018972	AAK_NAGK-NC: N-Acetyl-L-glutamate kinase - noncyclic (NAGK-NC) catalyzes the phosphorylation of the gamma-COOH group of N-acetyl-L-glutamate (NAG) by ATP in the second step of microbial arginine biosynthesis using the acetylated, noncyclic route of...; Region: AAK_NAGK-NC; cd04249
568708018973	nucleotide binding site [chemical binding]; other site
568708018974	N-acetyl-L-glutamate binding site [chemical binding]; other site
568708018976	argininosuccinate lyase; Provisional; Region: PRK04833
568708018977	Argininosuccinate lyase (argininosuccinase, ASAL); Region: Argininosuccinate_lyase; cd01359
568708018978	active sites [active]
568708018979	tetramer interface [polypeptide binding]; other site
568708018981	DNA-binding transcriptional regulator OxyR; Provisional; Region: PRK11151
568708018982	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708018983	The C-terminal substrate-binding domain of the LysR-type transcriptional regulator OxyR, a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_OxyR; cd08411
568708018984	dimerization interface [polypeptide binding]; other site
568708018987	soluble pyridine nucleotide transhydrogenase; Provisional; Region: PRK05249
568708018988	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
568708018989	Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852
568708018993	DNA-binding transcriptional repressor FabR; Provisional; Region: PRK11202
568708018994	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
568708018996	hypothetical protein; Provisional; Region: PRK11056
568708018997	Signal peptide predicted for STM_MW40921 by SignalP 2.0 HMM (Signal peptide probability 0.988) with cleavage site probability 0.938 between residues 26 and 27
568708018999	3 probable transmembrane helices predicted for STM_MW40921 by TMHMM2.0 at aa 25-47, 60-82 and 86-108
568708019000	tRNA (uracil-5-)-methyltransferase; Validated; Region: PRK05031
568708019001	Protein of unknown function (DUF3164); Region: DUF3164; pfam11363
568708019002	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708019003	S-adenosylmethionine binding site [chemical binding]; other site
568708019005	vitamin B12/cobalamin outer membrane transporter; Provisional; Region: btuB; PRK10641
568708019006	TonB dependent/Ligand-Gated channels are created by a monomeric 22 strand (22,24) anti-parallel beta-barrel. Ligands apparently bind to the large extracellular loops. The N-terminal 150-200 residues form a plug from the periplasmic end of barrel; Region: ligand_gated_channel; cd01347
568708019007	N-terminal plug; other site
568708019008	ligand-binding site [chemical binding]; other site
568708019009	Signal peptide predicted for STM_MW40941 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 20 and 21
568708019012	glutamate racemase; Provisional; Region: PRK00865
568708019014	UDP-N-acetylenolpyruvoylglucosamine reductase; Provisional; Region: murB; PRK00046
568708019015	FAD binding domain; Region: FAD_binding_4; pfam01565
568708019016	UDP-N-acetylenolpyruvoylglucosamine reductase, C-terminal domain; Region: MurB_C; pfam02873
568708019019	Biotin operon repressor [Transcription]; Region: BirA; COG1654
568708019020	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor; Provisional; Region: PRK11886
568708019021	Biotin/lipoate A/B protein ligase family; Region: BPL_LplA_LipB; pfam03099
568708019022	Biotin protein ligase C terminal domain; Region: BPL_C; pfam02237
568708019026	pantothenate kinase; Provisional; Region: PRK05439
568708019027	Pantothenate kinase (PanK) catalyzes the phosphorylation of pantothenic acid to form 4'-phosphopantothenic, which is the first of five steps in coenzyme A (CoA) biosynthetic pathway. The reaction carried out by this enzyme is a key regulatory point...; Region: PanK; cd02025
568708019028	ATP-binding site [chemical binding]; other site
568708019029	CoA-binding site [chemical binding]; other site
568708019030	Mg2+-binding site [ion binding]; other site
568708019032	elongation factor Tu; Reviewed; Region: PRK00049
568708019033	Elongation Factor Tu (EF-Tu) GTP-binding proteins; Region: EF_Tu; cd01884
568708019034	G1 box; other site
568708019035	GEF interaction site [polypeptide binding]; other site
568708019036	GTP/Mg2+ binding site [chemical binding]; other site
568708019037	Switch I region; other site
568708019038	G2 box; other site
568708019039	G3 box; other site
568708019040	Switch II region; other site
568708019041	G4 box; other site
568708019042	G5 box; other site
568708019043	EFTU_II: Elongation factor Tu domain II. Elongation factors Tu (EF-Tu) are three-domain GTPases with an essential function in the elongation phase of mRNA translation. The GTPase center of EF-Tu is in the N-terminal domain (domain I), also known as the...; Region: EFTU_II; cd03697
568708019044	Domain III of elongation factor (EF) Tu. Ef-Tu consists of three structural domains, designated I, II and III. Domain III adopts a beta barrel structure. Domain III is involved in binding to both charged tRNA and binding to elongation factor Ts (EF-Ts); Region: EFTU_III; cd03707
568708019045	Antibiotic Binding Site [chemical binding]; other site
568708019049	preprotein translocase subunit SecE; Reviewed; Region: secE; PRK05740
568708019050	3 probable transmembrane helices predicted for STM_MW41001 by TMHMM2.0 at aa 34-51, 55-77 and 109-131
568708019052	transcription antitermination protein NusG; Validated; Region: nusG; PRK05609
568708019053	Bacterial N-Utilization Substance G (NusG) N-terminal (NGN) domain, subgroup 1; Region: NGN_Bact_1; cd09891
568708019054	putative homodimer interface [polypeptide binding]; other site
568708019055	NusG contains an NGN domain at its N-terminus and KOW motif at its C-terminus; Region: KOW_NusG; cd06091
568708019056	heterodimer interface [polypeptide binding]; other site
568708019057	homodimer interface [polypeptide binding]; other site
568708019060	50S ribosomal protein L11; Validated; Region: rplK; PRK00140
568708019061	Ribosomal protein L11. Ribosomal protein L11, together with proteins L10 and L7/L12, and 23S rRNA, form the L7/L12 stalk on the surface of the large subunit of the ribosome. The homologous eukaryotic cytoplasmic protein is also called 60S ribosomal...; Region: Ribosomal_L11; cd00349
568708019062	23S rRNA interface [nucleotide binding]; other site
568708019063	L7/L12 interface [polypeptide binding]; other site
568708019064	putative thiostrepton binding site; other site
568708019065	L25 interface [polypeptide binding]; other site
568708019068	Ribosomal protein L1.  The L1 protein, located near the E-site of the ribosome, forms part of the L1 stalk along with 23S rRNA.  In bacteria and archaea, L1 functions both as a ribosomal protein that binds rRNA, and as a translation repressor that binds...; Region: Ribosomal_L1; cd00403
568708019069	mRNA/rRNA interface [nucleotide binding]; other site
568708019071	Ribosomal protein L10 family, L10 subfamily; composed of bacterial 50S ribosomal protein and eukaryotic mitochondrial 39S ribosomal protein, L10. L10 occupies the L7/L12 stalk of the ribosome. The N-terminal domain (NTD) of L10 interacts with L11 protein...; Region: Ribosomal_L10; cd05797
568708019072	23S rRNA interface [nucleotide binding]; other site
568708019073	Interface with L7/L12 ribosomal proteins [polypeptide binding]; other site
568708019075	Ribosomal protein L7/L12. Ribosomal protein L7/L12 refers to the large ribosomal subunit proteins L7 and L12, which are identical except that L7 is acetylated at the N terminus. It is a component of the L7/L12 stalk, which is located at the surface of...; Region: Ribosomal_L7_L12; cd00387
568708019076	core dimer interface [polypeptide binding]; other site
568708019077	peripheral dimer interface [polypeptide binding]; other site
568708019078	L10 interface [polypeptide binding]; other site
568708019079	L11 interface [polypeptide binding]; other site
568708019080	putative EF-Tu interaction site [polypeptide binding]; other site
568708019081	putative EF-G interaction site [polypeptide binding]; other site
568708019083	DNA-directed RNA polymerase subunit beta; Reviewed; Region: rpoB; PRK00405
568708019084	RNA polymerase beta subunit. RNA polymerases catalyse the DNA dependent polymerization of RNA. Prokaryotes contain a single RNA polymerase compared to three in eukaryotes (not including mitochondrial. and chloroplast polymerases). Each RNA polymerase...; Region: RNA_pol_B_RPB2; cl17585
568708019085	RNA polymerase Rpb2, domain 2; Region: RNA_pol_Rpb2_2; pfam04561
568708019086	RNA polymerase beta subunit. RNA polymerases catalyse the DNA dependent polymerization of RNA. Prokaryotes contain a single RNA polymerase compared to three in eukaryotes (not including mitochondrial. and chloroplast polymerases). Each RNA polymerase...; Region: RNA_pol_B_RPB2; cd00653
568708019087	RNA polymerase Rpb2, domain 6; Region: RNA_pol_Rpb2_6; pfam00562
568708019088	RNA polymerase beta subunit. RNA polymerases catalyse the DNA dependent polymerization of RNA. Prokaryotes contain a single RNA polymerase compared to three in eukaryotes (not including mitochondrial. and chloroplast polymerases). Each RNA polymerase...; Region: RNA_pol_B_RPB2; cd00653
568708019089	RPB3 interaction site [polypeptide binding]; other site
568708019090	RPB1 interaction site [polypeptide binding]; other site
568708019091	RPB11 interaction site [polypeptide binding]; other site
568708019092	RPB10 interaction site [polypeptide binding]; other site
568708019099	RNA polymerase Rpb1, domain 1; Region: RNA_pol_Rpb1_1; pfam04997
568708019100	DNA-directed RNA polymerase, beta' subunit/160 kD subunit [Transcription]; Region: RpoC; COG0086
568708019101	RNA polymerase I subunit A N-terminus; Region: RPOLA_N; smart00663
568708019102	RNA polymerase Rpb1, domain 3; Region: RNA_pol_Rpb1_3; pfam04983
568708019103	RNA polymerase Rpb1, domain 4; Region: RNA_pol_Rpb1_4; pfam05000
568708019104	RNA polymerase Rpb1, domain 5; Region: RNA_pol_Rpb1_5; pfam04998
568708019105	Largest subunit of RNA polymerase (RNAP), C-terminal domain; Region: RNAP_largest_subunit_C; cl11429
568708019106	Rpb1 - Rpb6 interaction site [polypeptide binding]; other site
568708019107	Largest subunit of RNA polymerase (RNAP), C-terminal domain; Region: RNAP_largest_subunit_C; cl11429
568708019108	Largest subunit (beta') of Bacterial DNA-dependent RNA polymerase (RNAP), C-terminal domain; Region: RNAP_beta'_C; cd02655
568708019109	DNA binding site [nucleotide binding]
568708019110	Rpb1 (beta') - Rpb2 (beta) interaction site [polypeptide binding]; other site
568708019116	3 probable transmembrane helices predicted for STM_MW41081 by TMHMM2.0 at aa 20-42, 52-74 and 86-105
568708019117	type III secretion system protein; Provisional; Region: PRK15384
568708019118	non-LEE encoded effector protein NleB; Provisional; Region: PRK15382
568708019119	thiamine biosynthesis protein ThiH; Reviewed; Region: thiH; PRK09240
568708019120	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
568708019121	FeS/SAM binding site; other site
568708019122	Biotin and Thiamin Synthesis associated domain; Region: BATS; pfam06968
568708019124	Thiazole synthase (ThiG) is the tetrameric enzyme that is involved in the formation of the thiazole moiety of thiamin pyrophosphate, an essential ubiquitous cofactor that plays an important role in carbohydrate and amino acid metabolism. ThiG catalyzes...; Region: ThiG; cd04728
568708019125	ThiS interaction site; other site
568708019126	putative active site [active]
568708019127	tetramer interface [polypeptide binding]; other site
568708019129	ThiaminS ubiquitin-like sulfur carrier protein; Region: ThiS; cd00565
568708019130	thiS-thiF/thiG interaction site; other site
568708019132	ThiF_MoeB_HesA. Family of E1-like enzymes involved in molybdopterin and thiamine biosynthesis family. The common reaction mechanism catalyzed by MoeB and ThiF, like other E1 enzymes, begins with a nucleophilic attack of the C-terminal carboxylate of MoaD...; Region: ThiF_MoeB_HesA_family; cd00757
568708019133	thiazole biosynthesis adenylyltransferase ThiF, E. coli subfamily; Region: adenyl_thiF; TIGR02356
568708019134	ATP binding site [chemical binding]; other site
568708019135	substrate interface [chemical binding]; other site
568708019138	1 probable transmembrane helix predicted for STM_MW41151 by TMHMM2.0 at aa 26-48
568708019139	Thiamine monophosphate synthase (TMP synthase)/TenI. TMP synthase catalyzes an important step in the thiamine biosynthesis pathway, the substitution of the pyrophosphate of 2-methyl-4-amino-5- hydroxymethylpyrimidine pyrophosphate by 4-methyl-5-; Region: TMP_TenI; cd00564
568708019140	thiamine phosphate binding site [chemical binding]; other site
568708019141	active site
568708019142	pyrophosphate binding site [ion binding]; other site
568708019144	thiamine biosynthesis protein ThiC; Provisional; Region: PRK09284
568708019145	ThiC-associated domain; Region: ThiC-associated; pfam13667
568708019146	Thiamine biosynthesis protein ThiC [Coenzyme metabolism]; Region: ThiC; COG0422
568708019148	Regulator of sigma D [Transcription]; Region: Rsd; COG3160
568708019150	NADH pyrophosphatase; Reviewed; Region: nudC; PRK00241
568708019151	NADH pyrophosphatase-like rudimentary NUDIX domain; Region: NUDIX-like; pfam09296
568708019152	NADH pyrophosphatase zinc ribbon domain; Region: zf-NADH-PPase; pfam09297
568708019153	NADH pyrophosphatase, a member of the Nudix hydrolase superfamily, catalyzes the cleavage of NADH into reduced nicotinamide mononucleotide (NMNH) and AMP. Like other members of the Nudix family, it requires a divalent cation, such as Mg2+ or Mn2+, for...; Region: NADH_pyrophosphatase; cd03429
568708019154	putative NADH binding site [chemical binding]; other site
568708019155	putative active site [active]
568708019156	nudix motif; other site
568708019157	putative metal binding site [ion binding]; other site
568708019161	methylcobalamin:coenzyme M methyltransferase; Validated; Region: PRK06252
568708019162	Uroporphyrinogen decarboxylase (URO-D) is a dimeric cytosolic enzyme that decarboxylates the four acetate side chains of uroporphyrinogen III (uro-III) to create coproporphyrinogen III, without requiring any prosthetic groups or cofactors. This reaction...; Region: URO-D; cd00717
568708019163	substrate binding site [chemical binding]; other site
568708019164	active site
568708019166	Endonuclease_V, a DNA repair enzyme that initiates repair of nitrosative deaminated purine bases; Region: Endonuclease_V; cd06559
568708019167	Active_site [active]
568708019169	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3068
568708019171	Integration host factor (IHF) and HU are small heterodimeric members of the DNABII protein family that bind and bend DNA, functioning as architectural factors in many cellular processes including transcription, site-specific recombination, and...; Region: HU_IHF; cd00591
568708019172	IHF dimer interface [polypeptide binding]; other site
568708019173	IHF - DNA interface [nucleotide binding]; other site
568708019175	Protein of unknown function (DUF1481); Region: DUF1481; pfam07356
568708019177	CpxP component of the bacterial Cpx-two-component system and related proteins; Region: CpxP_like; cd09916
568708019178	dimer interface [polypeptide binding]; other site
568708019179	1 probable transmembrane helix predicted for STM_MW41251 by TMHMM2.0 at aa 7-29
568708019180	Signal peptide predicted for STM_MW41251 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.971 between residues 26 and 27
568708019181	sensor protein ZraS; Provisional; Region: PRK10364
568708019182	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
568708019183	dimer interface [polypeptide binding]; other site
568708019184	phosphorylation site [posttranslational modification]
568708019185	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708019186	ATP binding site [chemical binding]; other site
568708019187	Mg2+ binding site [ion binding]; other site
568708019188	G-X-G motif; other site
568708019189	2 probable transmembrane helices predicted for STM_MW41261 by TMHMM2.0 at aa 13-35 and 204-223
568708019192	transcriptional regulatory protein ZraR; Provisional; Region: PRK10365
568708019193	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708019194	active site
568708019195	phosphorylation site [posttranslational modification]
568708019196	intermolecular recognition site; other site
568708019197	dimerization interface [polypeptide binding]; other site
568708019198	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708019199	Walker A motif; other site
568708019200	ATP binding site [chemical binding]; other site
568708019201	Walker B motif; other site
568708019202	arginine finger; other site
568708019203	Bacterial regulatory protein, Fis family; Region: HTH_8; pfam02954
568708019207	phosphoribosylamine--glycine ligase; Provisional; Region: PRK00885
568708019208	Phosphoribosylglycinamide synthetase, N domain; Region: GARS_N; pfam02844
568708019209	Phosphoribosylglycinamide synthetase, ATP-grasp (A) domain; Region: GARS_A; pfam01071
568708019210	Phosphoribosylglycinamide synthetase, C domain; Region: GARS_C; pfam02843
568708019214	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase; Provisional; Region: purH; PRK00881
568708019215	Inosine monophosphate cyclohydrolase domain. This is the N-terminal domain in the purine biosynthesis pathway protein ATIC (purH). The bifunctional ATIC protein contains a C-terminal  ATIC formylase domain that formylates...; Region: IMPCH; cd01421
568708019216	purine monophosphate binding site [chemical binding]; other site
568708019217	dimer interface [polypeptide binding]; other site
568708019218	putative catalytic residues [active]
568708019219	AICARFT/IMPCHase bienzyme; Region: AICARFT_IMPCHas; smart00798
568708019222	Acetyltransferase (GNAT) domain; Region: Acetyltransf_10; pfam13673
568708019223	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
568708019224	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
568708019225	Coenzyme A binding pocket [chemical binding]; other site
568708019227	homoserine O-succinyltransferase; Provisional; Region: PRK05368
568708019228	Type 1 glutamine amidotransferase (GATase1)-like domain found in homoserine trans-succinylase (HTS); Region: GATase1_HTS; cd03131
568708019229	proposed active site lysine [active]
568708019230	conserved cys residue [active]
568708019232	Malate synthase A (MSA), present in some bacteria, plants and fungi. Prokaryotic MSAs tend to be monomeric, whereas eukaryotic enzymes are homomultimers. In general, malate synthase catalyzes the Claisen condensation of glyoxylate and acetyl-CoA to...; Region: malate_synt_A; cd00727
568708019233	malate synthase A; Region: malate_syn_A; TIGR01344
568708019234	active site
568708019236	isocitrate lyase; Provisional; Region: PRK15063
568708019237	Members of the ICL/PEPM enzyme family catalyze either P-C or C-C bond formation/cleavage. Known members are phosphoenolpyruvate mutase (PEPM), phosphonopyruvate hydrolase (PPH), carboxyPEP mutase (CPEP mutase), oxaloacetate hydrolase (OAH), isocitrate...; Region: ICL_PEPM; cd00377
568708019238	tetramer interface [polypeptide binding]; other site
568708019239	active site
568708019240	Mg2+/Mn2+ binding site [ion binding]; other site
568708019242	Isocitrate dehydrogenase kinase/phosphatase [Signal transduction mechanisms]; Region: COG4579
568708019243	bifunctional isocitrate dehydrogenase kinase/phosphatase protein; Validated; Region: aceK; PRK02946
568708019245	ASC-1 homology domain, subfamily similar to Enterococcus faecalis Ef3133. The ASCH domain, a small beta-barrel domain found in all three kingdoms of life, resembles the RNA-binding PUA domain and may also interact with RNA. ASCH has been proposed to...; Region: ASCH_Ef3133_like; cd06553
568708019247	transcriptional repressor IclR; Provisional; Region: PRK11569
568708019248	helix_turn_helix isocitrate lyase regulation; Region: HTH_ICLR; smart00346
568708019249	Bacterial transcriptional regulator; Region: IclR; pfam01614
568708019252	B12-dependent methionine synthase; Provisional; Region: metH; PRK09490
568708019253	Methionine synthase I (cobalamin-dependent), methyltransferase domain [Amino acid transport and metabolism]; Region: MetH; COG0646
568708019254	MeTr subgroup of pterin binding enzymes. This family includes cobalamin-dependent methyltransferases such as methyltetrahydrofolate, corrinoid iron-sulfur protein methyltransferase (MeTr) and methionine synthase (MetH).  Cobalamin-dependent...; Region: MeTr; cd00740
568708019255	substrate binding pocket [chemical binding]; other site
568708019256	B12 binding domain of methionine synthase. This domain binds methylcobalamin, which it uses as an intermediate methyl carrier from methyltetrahydrofolate (CH3H4folate) to homocysteine (Hcy); Region: methionine_synthase_B12_BD; cd02069
568708019257	B12 binding site [chemical binding]; other site
568708019258	cobalt ligand [ion binding]; other site
568708019259	Vitamin B12 dependent methionine synthase, activation domain; Region: Met_synt_B12; pfam02965
568708019265	Na+/phosphate symporter [Inorganic ion transport and metabolism]; Region: NptA; COG1283
568708019266	Na+/Pi-cotransporter; Region: Na_Pi_cotrans; pfam02690
568708019267	Signal peptide predicted for STM_MW41381 by SignalP 2.0 HMM (Signal peptide probability 0.977) with cleavage site probability 0.919 between residues 38 and 39
568708019269	7 probable transmembrane helices predicted for STM_MW41381 by TMHMM2.0 at aa 42-64, 74-96, 108-130, 150-172, 177-199, 214-236 and 249-271
568708019270	Type 1 glutamine amidotransferase (GATase1)-like domain found in peptidase E; Region: GAT1_Peptidase_E; cd03146
568708019271	active site pocket [active]
568708019272	oxyanion hole [active]
568708019273	catalytic triad [active]
568708019274	active site nucleophile [active]
568708019276	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3122
568708019278	23S rRNA pseudouridine synthase F; Provisional; Region: PRK10475
568708019279	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
568708019280	RNA binding surface [nucleotide binding]; other site
568708019281	Pseudouridine synthase, Escherichia coli RluF like; Region: PseudoU_synth_RluF; cd02554
568708019282	probable active site [active]
568708019285	hypothetical protein; Provisional; Region: PRK10515
568708019287	Predicted Na+-dependent transporter [General function prediction only]; Region: COG0385
568708019288	Sodium Bile acid symporter family; Region: SBF; pfam01758
568708019289	9 probable transmembrane helices predicted for STM_MW41441 by TMHMM2.0 at aa 7-24, 29-51, 64-86, 92-114, 119-141, 156-178, 191-213, 217-239 and 260-282
568708019291	ATPase domain
568708019292	Serine acetyltransferase [Amino acid transport and metabolism]; Region: CysE; COG1045
568708019293	1 probable transmembrane helix predicted for STM_MW41461 by TMHMM2.0 at aa 15-37
568708019294	Orthopoxvirus protein of unknown function (DUF830); Region: DUF830; cl13998
568708019295	Domain of unknown function (DUF4376); Region: DUF4376; pfam14301
568708019296	BTP6
568708019297	Phage-related tail fibre protein [General function prediction only]; Region: COG5301
568708019298	Phage tail-collar fibre protein; Region: DUF3751; pfam12571
568708019299	Phage tail fibre repeat; Region: Phage_fiber_2; pfam03406
568708019301	Bacteriophage P2-related tail formation protein [General function prediction only]; Region: gpI; COG4385
568708019303	Phage-related baseplate assembly protein [General function prediction only]; Region: COG3948
568708019305	Phage baseplate assembly protein W [General function prediction only]; Region: COG3628
568708019307	9 probable transmembrane helices predicted for STM_MW41531 by TMHMM2.0 at aa 7-29, 73-92, 99-118, 128-150, 206-228, 256-275, 288-310, 315-334 and 341-363
568708019308	undecaprenyl phosphate 4-deoxy-4-formamido-L-arabinose transferase; Provisional; Region: PRK10714
568708019309	Bacterial DPM1_like enzymes are related to eukaryotic DPM1; Region: DPM1_like_bac; cd04187
568708019310	Ligand binding site; other site
568708019311	Putative Catalytic site; other site
568708019312	DXD motif; other site
568708019314	2 probable transmembrane helices predicted for STM_MW41541 by TMHMM2.0 at aa 227-249 and 264-286
568708019315	Predicted membrane protein [Function unknown]; Region: COG2246
568708019316	4 probable transmembrane helices predicted for STM_MW41551 by TMHMM2.0 at aa 9-31, 35-54, 67-84 and 94-116
568708019318	Signal peptide predicted for STM_MW41551 by SignalP 2.0 HMM (Signal peptide probability 0.762) with cleavage site probability 0.712 between residues 37 and 38
568708019319	phage baseplate assembly protein V; Region: phage_P2_V; TIGR01644
568708019320	Phage P2 baseplate assembly protein gpV [General function prediction only]; Region: gpV; COG4540
568708019322	Phage protein D [General function prediction only]; Region: COG3500
568708019324	Phage P2 GpU; Region: Phage_P2_GpU; pfam06995
568708019326	Phage-related minor tail protein; Region: PhageMin_Tail; pfam10145
568708019328	Mu-like prophage FluMu protein gp41; Region: FluMu_gp41; pfam10109
568708019329	Phage tail tube protein FII [General function prediction only]; Region: COG3498
568708019331	Phage tail sheath protein FI [General function prediction only]; Region: COG3497
568708019333	Gp37 protein; Region: Gp37; pfam09646
568708019335	Signal peptide predicted for STM_MW41651 by SignalP 2.0 HMM (Signal peptide probability 0.655) with cleavage site probability 0.343 between residues 30 and 31
568708019336	1 probable transmembrane helix predicted for STM_MW41651 by TMHMM2.0 at aa 10-29
568708019337	Soluble lytic murein transglycosylase and related regulatory proteins (some contain LysM/invasin domains) [Cell envelope biogenesis, outer membrane]; Region: MltE; COG0741
568708019338	Lytic Transglycosylase (LT)  and Goose Egg White Lysozyme (GEWL) domain. Members include the soluble and insoluble membrane-bound LTs in bacteria, the LTs in bacteriophage lambda, as well as, the eukaryotic "goose-type" lysozymes (GEWL).  LTs...; Region: LT_GEWL; cd00254
568708019339	N-acetyl-D-glucosamine binding site [chemical binding]; other site
568708019340	catalytic residue [active]
568708019342	Signal peptide predicted for STM_MW41661 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.993 between residues 19 and 20
568708019343	Protein of unknown function (DUF4063); Region: DUF4063; pfam13272
568708019344	3 probable transmembrane helices predicted for STM_MW41671 by TMHMM2.0 at aa 5-24, 29-51 and 71-93
568708019345	Signal peptide predicted for STM_MW41671 by SignalP 2.0 HMM (Signal peptide probability 0.992) with cleavage site probability 0.941 between residues 29 and 30
568708019346	Mor transcription activator family; Region: Mor; pfam08765
568708019348	aspartate kinase III; Validated; Region: PRK09084
568708019349	Amino Acid Kinases (AAK) superfamily, catalytic domain; present in such enzymes like N-acetylglutamate kinase (NAGK), carbamate kinase (CK), aspartokinase (AK), glutamate-5-kinase (G5K) and UMP kinase (UMPK). The AAK superfamily includes kinases that...; Region: AAK; cl00452
568708019350	nucleotide binding site [chemical binding]; other site
568708019351	substrate binding site [chemical binding]; other site
568708019352	ACT domains are commonly involved in specifically binding an amino acid or other small ligand leading to regulation of the enzyme; Region: ACT; cl09141
568708019353	ACT domains located C-terminal to the catalytic domain of the lysine-sensitive aspartokinase isoenzyme AKIII; Region: ACT_AKiii-LysC-EC_2; cd04917
568708019354	dimer interface [polypeptide binding]; other site
568708019357	glucose-6-phosphate isomerase; Reviewed; Region: pgi; PRK00179
568708019358	Phosphoglucose isomerase (PGI) contains two SIS (Sugar ISomerase) domains. This classification is based on the alignment of the first SIS domain. PGI is a multifunctional enzyme which as an intracellular dimer catalyzes the reversible isomerization of...; Region: SIS_PGI_1; cd05015
568708019359	active site
568708019360	dimer interface [polypeptide binding]; other site
568708019361	Phosphoglucose isomerase (PGI) contains two SIS (Sugar ISomerase) domains. This classification is based on the alignment of the second SIS domain. PGI is a multifunctional enzyme which as an intracellular dimer catalyzes the reversible isomerization of...; Region: SIS_PGI_2; cd05016
568708019362	dimer interface [polypeptide binding]; other site
568708019363	active site
568708019365	Exopolysaccharide production protein YjbE; Region: YjbE; pfam11106
568708019366	Signal peptide predicted for STM_MW41711 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.986 between residues 22 and 23
568708019368	1 probable transmembrane helix predicted for STM_MW41711 by TMHMM2.0 at aa 5-27
568708019369	Protein of unknown function (DUF2886); Region: DUF2886; pfam11102
568708019370	Signal peptide predicted for STM_MW41721 by SignalP 2.0 HMM (Signal peptide probability 0.990) with cleavage site probability 0.351 between residues 30 and 31
568708019372	Capsule biosynthesis GfcC; Region: Caps_synth_GfcC; pfam06251
568708019373	Signal peptide predicted for STM_MW41731 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.977 between residues 20 and 21
568708019374	1 probable transmembrane helix predicted for STM_MW41731 by TMHMM2.0 at aa 5-27
568708019376	Bacterial putative lipoprotein (DUF940); Region: DUF940; pfam06082
568708019377	Signal peptide predicted for STM_MW41741 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 20 and 21
568708019379	Predicted membrane protein [Function unknown]; Region: COG3223
568708019380	4 probable transmembrane helices predicted for STM_MW41751 by TMHMM2.0 at aa 13-35, 55-77, 84-103 and 113-130
568708019382	ABC-type sugar transport system, permease component [Carbohydrate transport and metabolism]; Region: UgpE; COG0395
568708019383	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708019384	dimer interface [polypeptide binding]; other site
568708019385	conserved gate region; other site
568708019386	putative PBP binding loops; other site
568708019387	ABC-ATPase subunit interface; other site
568708019388	6 probable transmembrane helices predicted for STM_MW41761 by TMHMM2.0 at aa 13-35, 89-111, 124-143, 153-175, 205-227 and 258-280
568708019390	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
568708019391	dimer interface [polypeptide binding]; other site
568708019392	conserved gate region; other site
568708019393	putative PBP binding loops; other site
568708019394	ABC-ATPase subunit interface; other site
568708019395	8 probable transmembrane helices predicted for STM_MW41771 by TMHMM2.0 at aa 17-36, 40-57, 70-92, 284-306, 319-341, 370-392, 413-435 and 484-506
568708019397	maltose ABC transporter periplasmic protein; Reviewed; Region: malE; PRK09474
568708019398	Domain of unknown function (DUF4179); Region: DUF4179; pfam13786
568708019399	Bacterial extracellular solute-binding protein; Region: SBP_bac_1; pfam01547
568708019401	Signal peptide predicted for STM_MW41781 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 29 and 30
568708019402	1 probable transmembrane helix predicted for STM_MW41781 by TMHMM2.0 at aa 7-29
568708019403	maltose/maltodextrin transporter ATP-binding protein; Provisional; Region: PRK11000
568708019404	The N-terminal ATPase domain of the maltose transporter, MalK; Region: ABC_MalK_N; cd03301
568708019405	Walker A/P-loop; other site
568708019406	ATP binding site [chemical binding]; other site
568708019407	Q-loop/lid; other site
568708019408	ABC transporter signature motif; other site
568708019409	Walker B; other site
568708019410	D-loop; other site
568708019411	H-loop/switch region; other site
568708019412	TOBE domain; Region: TOBE_2; pfam08402
568708019415	The Maltoporin-like channels (LamB porin) form a trimeric structure which facilitate the diffusion of maltodextrins and other sugars across the outer membrane of Gram-negative bacteria. The membrane channel is formed by an 18-strand antiparallel...; Region: Maltoporin-like; cd01346
568708019416	trimer interface; other site
568708019417	sugar binding site [chemical binding]; other site
568708019418	Signal peptide predicted for STM_MW41811 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.972 between residues 25 and 26
568708019420	maltose regulon periplasmic protein; Provisional; Region: PRK10564
568708019421	Signal peptide predicted for STM_MW41821 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.994 between residues 26 and 27
568708019422	1 probable transmembrane helix predicted for STM_MW41821 by TMHMM2.0 at aa 7-26
568708019424	chorismate pyruvate lyase; Provisional; Region: ubiC; PRK11655
568708019426	4-hydroxybenzoate octaprenyltransferase; Reviewed; Region: ubiA; PRK12848
568708019427	UbiA prenyltransferase family; Region: UbiA; pfam01040
568708019428	7 probable transmembrane helices predicted for STM_MW41841 by TMHMM2.0 at aa 23-40, 45-67, 99-132, 160-182, 203-225, 229-251 and 272-289
568708019430	glycerol-3-phosphate O-acyltransferase; Region: plsB; TIGR03703
568708019431	Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: GPAT-like; Region: LPLAT_DHAPAT-like; cd07993
568708019432	putative acyl-acceptor binding pocket; other site
568708019434	Diacylglycerol kinase [Cell envelope biogenesis, outer membrane]; Region: DgkA; COG0818
568708019436	2 probable transmembrane helices predicted for STM_MW41861 by TMHMM2.0 at aa 57-79 and 99-121
568708019437	LexA repressor; Validated; Region: PRK00215
568708019438	LexA DNA binding domain; Region: LexA_DNA_bind; pfam01726
568708019439	Peptidase S24 LexA-like proteins are involved in the SOS response leading to the repair of single-stranded DNA within the bacterial cell. This family includes: the lambda repressor CI/C2 family and related bacterial prophage repressor proteins; LexA (EC...; Region: S24_LexA-like; cd06529
568708019440	Catalytic site [active]
568708019443	DNA-damage-inducible SOS response protein; Provisional; Region: PRK10367
568708019444	DinF and similar proteins, a subfamily of the multidrug and toxic compound extrusion (MATE)-like proteins; Region: MATE_DinF_like; cd13136
568708019445	12 probable transmembrane helices predicted for STM_MW41881 by TMHMM2.0 at aa 11-33, 43-65, 89-111, 131-153, 160-182, 187-209, 241-263, 267-289, 321-343, 353-375, 388-405 and 409-428
568708019447	hypothetical protein; Provisional; Region: PRK10428
568708019449	Ferric uptake regulator(Fur) and related metalloregulatory proteins; typically iron-dependent, DNA-binding repressors and activators; Region: Fur_like; cd07153
568708019450	metal binding site 2 [ion binding]; metal-binding site
568708019451	putative DNA binding helix; other site
568708019452	metal binding site 1 [ion binding]; metal-binding site
568708019453	dimer interface [polypeptide binding]; other site
568708019454	structural Zn2+ binding site [ion binding]; other site
568708019456	F plasmid transfer operon, TraF, protein; Region: TraF_2; pfam13729
568708019457	Signal peptide predicted for STM_MW41921 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.991 between residues 24 and 25
568708019458	tRNA-dihydrouridine synthase A; Provisional; Region: PRK11815
568708019459	Dihydrouridine synthase-like (DUS-like) FMN-binding domain. Members of this family catalyze the reduction of the 5,6-double bond of a uridine residue on tRNA. Dihydrouridine modification of tRNA is widely observed in prokaryotes and eukaryotes, and also...; Region: DUS_like_FMN; cd02801
568708019460	FMN binding site [chemical binding]; other site
568708019461	active site
568708019462	catalytic residues [active]
568708019463	substrate binding site [chemical binding]; other site
568708019465	phage shock protein G; Reviewed; Region: pspG; PRK09459
568708019466	Signal peptide predicted for STM_MW41941 by SignalP 2.0 HMM (Signal peptide probability 0.967) with cleavage site probability 0.416 between residues 31 and 32
568708019468	2 probable transmembrane helices predicted for STM_MW41941 by TMHMM2.0 at aa 7-29 and 39-61
568708019469	quinone oxidoreductase, NADPH-dependent; Provisional; Region: PRK10754
568708019470	Quinone oxidoreductase (QOR); Region: QOR2; cd05286
568708019471	NADP binding site [chemical binding]; other site
568708019472	dimer interface [polypeptide binding]; other site
568708019475	replicative DNA helicase; Provisional; Region: PRK08006
568708019476	DnaB-like helicase N terminal domain; Region: DnaB; pfam00772
568708019477	DnaB helicase C terminal domain. The hexameric helicase DnaB unwinds the DNA duplex at the  chromosome replication fork. Although the mechanism by which DnaB both couples ATP hydrolysis to translocation along DNA and denatures the duplex is unknown, a...; Region: DnaB_C; cd00984
568708019478	Walker A motif; other site
568708019479	ATP binding site [chemical binding]; other site
568708019480	Walker B motif; other site
568708019481	DNA binding loops [nucleotide binding]
568708019484	alanine racemase; Reviewed; Region: alr; PRK00053
568708019485	Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzymes, Proteobacterial Alanine Racemases; Region: PLPDE_III_AR_proteobact; cd06827
568708019486	active site
568708019487	pyridoxal 5'-phosphate (PLP) binding site [chemical binding]; other site
568708019488	substrate binding site [chemical binding]; other site
568708019489	catalytic residues [active]
568708019490	dimer interface [polypeptide binding]; other site
568708019493	aromatic amino acid aminotransferase; Provisional; Region: PRK09257
568708019494	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
568708019495	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708019496	homodimer interface [polypeptide binding]; other site
568708019497	catalytic residue [active]
568708019499	haloacid dehalogenase-like hydrolase; Region: Hydrolase; pfam00702
568708019500	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708019501	active site
568708019502	motif I; other site
568708019503	motif II; other site
568708019504	Signal peptide predicted for STM_MW41991 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.961 between residues 23 and 24
568708019506	Uncharacterized conserved protein [Function unknown]; Region: COG0432
568708019508	Uncharacterized protein conserved in bacteria [Function unknown]; Region: MmcQ; COG2315
568708019510	1 probable transmembrane helix predicted for STM_MW42031 by TMHMM2.0 at aa 7-29
568708019511	Signal peptide predicted for STM_MW42031 by SignalP 2.0 HMM (Signal peptide probability 0.969) with cleavage site probability 0.519 between residues 21 and 22
568708019512	excinuclease ABC subunit A; Reviewed; Region: uvrA; PRK00349
568708019513	ATP-binding cassette domain I of the excision repair protein UvrA; Region: ABC_UvrA_I; cd03270
568708019514	ATP-binding cassette domain I of the excision repair protein UvrA; Region: ABC_UvrA_I; cd03270
568708019515	ATP-binding cassette domain II of the excision repair protein UvrA; Region: ABC_UvrA_II; cd03271
568708019517	Single-stranded DNA-binding protein [DNA replication, recombination, and repair]; Region: Ssb; COG0629
568708019518	SSB_OBF: A subfamily of OB folds similar to the OB fold of ssDNA-binding protein (SSB). SSBs bind with high affinity to ssDNA. They bind to and protect ssDNA intermediates during DNA metabolic pathways. All bacterial and eukaryotic SSBs studied to date...; Region: SSB_OBF; cd04496
568708019519	dimer interface [polypeptide binding]; other site
568708019520	ssDNA binding site [nucleotide binding]; other site
568708019521	tetramer (dimer of dimers) interface [polypeptide binding]; other site
568708019522	putative single-stranded DNA-binding protein; Region: PHA01740
568708019524	hypothetical protein; Validated; Region: PRK09039
568708019525	1 probable transmembrane helix predicted for STM_MW42081 by TMHMM2.0 at aa 15-37
568708019526	Zinc finger-containing protein; Region: zf-C4H2; pfam10146
568708019527	Signal peptide predicted for STM_MW42091 by SignalP 2.0 HMM (Signal peptide probability 0.992) with cleavage site probability 0.992 between residues 25 and 26
568708019528	4 probable transmembrane helices predicted for STM_MW42091 by TMHMM2.0 at aa 7-26, 41-63, 131-153 and 186-208
568708019529	type I secretion outer membrane protein, TolC family; Region: type_I_sec_TolC; TIGR01844
568708019530	Signal peptide predicted for STM_MW42101 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 19 and 20
568708019532	type I secretion membrane fusion protein, HlyD family; Region: type_I_hlyD; TIGR01843
568708019533	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
568708019534	HlyD family secretion protein; Region: HlyD_3; pfam13437
568708019535	1 probable transmembrane helix predicted for STM_MW42111 by TMHMM2.0 at aa 12-34
568708019536	Putative flagellar system-associated repeat; Region: SWM_repeat; pfam13753
568708019537	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708019538	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708019539	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708019540	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708019541	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708019542	Sulfite oxidase (SO) family, molybdopterin binding domain. This molybdopterin cofactor (Moco) binding domain is found in a variety of oxidoreductases, main members of this family are nitrate reductase (NR) and sulfite oxidase (SO). SO catalyzes the...; Region: SO_family_Moco; cl00199
568708019543	Putative flagellar system-associated repeat; Region: SWM_repeat; pfam13753
568708019544	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708019545	Sulfite oxidase (SO) family, molybdopterin binding domain. This molybdopterin cofactor (Moco) binding domain is found in a variety of oxidoreductases, main members of this family are nitrate reductase (NR) and sulfite oxidase (SO). SO catalyzes the...; Region: SO_family_Moco; cl00199
568708019546	Putative flagellar system-associated repeat; Region: SWM_repeat; pfam13753
568708019547	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708019548	Sulfite oxidase (SO) family, molybdopterin binding domain. This molybdopterin cofactor (Moco) binding domain is found in a variety of oxidoreductases, main members of this family are nitrate reductase (NR) and sulfite oxidase (SO). SO catalyzes the...; Region: SO_family_Moco; cl00199
568708019549	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708019550	Sulfite oxidase (SO) family, molybdopterin binding domain. This molybdopterin cofactor (Moco) binding domain is found in a variety of oxidoreductases, main members of this family are nitrate reductase (NR) and sulfite oxidase (SO). SO catalyzes the...; Region: SO_family_Moco; cl00199
568708019551	Putative flagellar system-associated repeat; Region: SWM_repeat; pfam13753
568708019552	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708019553	Sulfite oxidase (SO) family, molybdopterin binding domain. This molybdopterin cofactor (Moco) binding domain is found in a variety of oxidoreductases, main members of this family are nitrate reductase (NR) and sulfite oxidase (SO). SO catalyzes the...; Region: SO_family_Moco; cl00199
568708019554	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708019555	Sulfite oxidase (SO) family, molybdopterin binding domain. This molybdopterin cofactor (Moco) binding domain is found in a variety of oxidoreductases, main members of this family are nitrate reductase (NR) and sulfite oxidase (SO). SO catalyzes the...; Region: SO_family_Moco; cl00199
568708019556	Putative flagellar system-associated repeat; Region: SWM_repeat; pfam13753
568708019557	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708019558	Sulfite oxidase (SO) family, molybdopterin binding domain. This molybdopterin cofactor (Moco) binding domain is found in a variety of oxidoreductases, main members of this family are nitrate reductase (NR) and sulfite oxidase (SO). SO catalyzes the...; Region: SO_family_Moco; cl00199
568708019559	Putative flagellar system-associated repeat; Region: SWM_repeat; pfam13753
568708019560	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708019561	Sulfite oxidase (SO) family, molybdopterin binding domain. This molybdopterin cofactor (Moco) binding domain is found in a variety of oxidoreductases, main members of this family are nitrate reductase (NR) and sulfite oxidase (SO). SO catalyzes the...; Region: SO_family_Moco; cl00199
568708019562	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708019563	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708019564	Sulfite oxidase (SO) family, molybdopterin binding domain. This molybdopterin cofactor (Moco) binding domain is found in a variety of oxidoreductases, main members of this family are nitrate reductase (NR) and sulfite oxidase (SO). SO catalyzes the...; Region: SO_family_Moco; cl00199
568708019565	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708019566	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708019567	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708019568	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708019569	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708019570	Putative flagellar system-associated repeat; Region: SWM_repeat; pfam13753
568708019571	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708019572	Putative flagellar system-associated repeat; Region: SWM_repeat; pfam13753
568708019573	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708019574	Bacterial Ig-like domain (group 3); Region: Big_3_2; pfam12245
568708019575	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708019576	Bacterial Ig-like domain (group 3); Region: Big_3_4; pfam13754
568708019577	ABC-type bacteriocin/lantibiotic exporters, contain an N-terminal double-glycine peptidase domain [Defense mechanisms]; Region: SunT; COG2274
568708019578	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
568708019579	Walker A/P-loop; other site
568708019580	ATP binding site [chemical binding]; other site
568708019581	Q-loop/lid; other site
568708019582	ABC transporter signature motif; other site
568708019583	Walker B; other site
568708019584	D-loop; other site
568708019585	H-loop/switch region; other site
568708019586	5 probable transmembrane helices predicted for STM_MW42131 by TMHMM2.0 at aa 157-179, 189-208, 262-284, 288-310 and 376-398
568708019588	2 probable transmembrane helices predicted for STM_MW42141 by TMHMM2.0 at aa 10-29 and 36-58
568708019589	Predicted signal transduction protein containing sensor and EAL domains [Signal transduction mechanisms]; Region: COG4943
568708019590	CSS motif domain associated with EAL; Region: CSS-motif; pfam12792
568708019591	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
568708019592	Signal peptide predicted for STM_MW42151 by SignalP 2.0 HMM (Signal peptide probability 0.874) with cleavage site probability 0.414 between residues 34 and 35
568708019593	2 probable transmembrane helices predicted for STM_MW42151 by TMHMM2.0 at aa 10-32 and 239-261
568708019595	DNA-binding transcriptional regulator SoxS; Provisional; Region: PRK10219
568708019596	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708019598	redox-sensitivie transcriptional activator SoxR; Provisional; Region: PRK15002
568708019599	Helix-Turn-Helix DNA binding domain of the SoxR transcription regulator; Region: HTH_SoxR; cd01110
568708019600	DNA binding residues [nucleotide binding]
568708019601	dimer interface [polypeptide binding]; other site
568708019602	[2Fe-2S] cluster binding site [ion binding]; other site
568708019605	Glutathione S-transferase [Posttranslational modification, protein turnover, chaperones]; Region: Gst; COG0625
568708019606	GST_N family, Saccharomyces cerevisiae GTT1-like subfamily; composed of predominantly uncharacterized proteins with similarity to the S. cerevisiae GST protein, GTT1, and the Schizosaccharomyces pombe GST-III. GSTs are cytosolic dimeric proteins involved...; Region: GST_N_GTT1_like; cd03046
568708019607	putative C-terminal domain interface [polypeptide binding]; other site
568708019608	putative GSH binding site (G-site) [chemical binding]; other site
568708019609	putative dimer interface [polypeptide binding]; other site
568708019610	C-terminal, alpha helical domain of GTT1-like Glutathione S-transferases; Region: GST_C_GTT1_like; cd03189
568708019611	putative N-terminal domain interface [polypeptide binding]; other site
568708019612	putative dimer interface [polypeptide binding]; other site
568708019613	putative substrate binding pocket (H-site) [chemical binding]; other site
568708019616	Xanthine/uracil/vitamin C permease [Nucleotide transport and    metabolism]; Region: COG2252
568708019618	12 probable transmembrane helices predicted for STM_MW42191 by TMHMM2.0 at aa 29-51, 56-78, 85-107, 112-134, 146-165, 175-197, 202-224, 244-266, 329-351, 356-378, 391-413 and 428-447
568708019619	Na+/H+ antiporter, bacterial form; Region: a_cpa1; TIGR00831
568708019620	Kef-type K+ transport systems, membrane components [Inorganic ion transport and metabolism]; Region: KefB; cl10482
568708019621	9 probable transmembrane helices predicted for STM_MW42201 by TMHMM2.0 at aa 4-26, 86-108, 113-135, 181-203, 233-255, 276-298, 313-335, 361-383 and 398-420
568708019623	Transcriptional regulator [Transcription]; Region: LysR; COG0583
568708019624	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708019625	The C-terminal substrate binding domain of LysR-like transcriptional regulator CidR, contains the type 2 periplasmic binding fold; Region: PBP2_CidR; cd08438
568708019626	putative dimerization interface [polypeptide binding]; other site
568708019629	Putative effector of murein hydrolase LrgA [General function prediction only]; Region: COG1380
568708019630	4 probable transmembrane helices predicted for STM_MW42221 by TMHMM2.0 at aa 20-42, 47-66, 73-95 and 100-122
568708019632	Putative effector of murein hydrolase [Cell envelope biogenesis, outer membrane]; Region: LrgB; COG1346
568708019633	6 probable transmembrane helices predicted for STM_MW42231 by TMHMM2.0 at aa 4-21, 33-54, 64-86, 93-115, 149-171 and 203-225
568708019635	Predicted symporter [General function prediction only]; Region: DhlC; COG4147
568708019636	Uncharacterized bacterial solute carrier 5 subfamily; putative solute-binding domain; Region: SLC5sbd_u4; cd11480
568708019637	Na binding site [ion binding]; other site
568708019638	13 probable transmembrane helices predicted for STM_MW42241 by TMHMM2.0 at aa 33-55, 76-98, 103-125, 146-168, 183-205, 212-234, 261-283, 303-325, 362-384, 404-423, 428-450, 462-484 and 494-516
568708019640	Signal peptide predicted for STM_MW42241 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 18 and 19
568708019641	Predicted membrane protein [Function unknown]; Region: COG3162
568708019643	2 probable transmembrane helices predicted for STM_MW42251 by TMHMM2.0 at aa 25-47 and 62-84
568708019644	acetyl-CoA synthetase; Provisional; Region: PRK00174
568708019645	Acetyl-CoA synthetase (also known as acetate-CoA ligase and acetyl-activating enzyme); Region: ACS; cd05966
568708019646	active site
568708019647	CoA binding site [chemical binding]; other site
568708019648	acyl-activating enzyme (AAE) consensus motif; other site
568708019649	AMP binding site [chemical binding]; other site
568708019650	acetate binding site [chemical binding]; other site
568708019652	cytochrome c nitrite reductase subunit c552; Provisional; Region: nrfA; PRK11125
568708019653	Signal peptide predicted for STM_MW42281 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 26 and 27
568708019655	cytochrome c nitrite reductase pentaheme subunit; Provisional; Region: PRK11659
568708019657	cytochrome c nitrite reductase, Fe-S protein; Region: cyt_nit_nrfC; TIGR03149
568708019658	Signal peptide predicted for STM_MW42301 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.998 between residues 27 and 28
568708019660	Formate-dependent nitrite reductase, membrane component [Inorganic ion transport and metabolism]; Region: NrfD; COG3301
568708019661	cytochrome c nitrite reductase, NrfD subunit; Region: cyt_nit_nrfD; TIGR03148
568708019663	8 probable transmembrane helices predicted for STM_MW42311 by TMHMM2.0 at aa 15-37, 57-76, 91-113, 144-166, 181-203, 224-241, 256-278 and 290-312
568708019664	heme lyase subunit NrfE; Provisional; Region: PRK10369
568708019665	formate-dependent nitrite reductase complex subunit NrfF; Provisional; Region: PRK10144
568708019666	15 probable transmembrane helices predicted for STM_MW42321 by TMHMM2.0 at aa 13-35, 56-78, 93-115, 127-149, 183-205, 212-234, 254-271, 283-305, 315-337, 357-379, 394-416, 429-448, 552-571, 608-627 and 708-727
568708019669	formate-dependent nitrite reductase complex subunit NrfG; Provisional; Region: PRK10370
568708019670	1 probable transmembrane helix predicted for STM_MW42331 by TMHMM2.0 at aa 20-37
568708019671	glutamate/aspartate:proton symporter; Provisional; Region: gltP; PRK11283
568708019672	Na+/H+-dicarboxylate symporters [Energy production and conversion]; Region: GltP; COG1301
568708019673	8 probable transmembrane helices predicted for STM_MW42341 by TMHMM2.0 at aa 7-29, 49-71, 84-106, 163-185, 206-228, 233-255, 354-376 and 391-409
568708019675	FOG: TPR repeat, SEL1 subfamily [General function prediction only]; Region: COG0790
568708019676	Sel1-like repeats; Region: SEL1; smart00671
568708019678	formate dehydrogenase, alpha subunit, archaeal-type; Region: Fdh-alpha; TIGR01591
568708019679	Formate dehydrogenase H (Formate-Dh-H) catalyzes the reversible oxidation of formate to CO2 with the release of a proton and two electrons. It is a component of the anaerobic formate hydrogen lyase complex. The E. coli formate dehydrogenase H (Fdh-H) is...; Region: MopB_Formate-Dh-H; cd02753
568708019680	[4Fe-4S] binding site [ion binding]; other site
568708019681	molybdopterin cofactor binding site; other site
568708019682	Formate dehydrogenase H (Formate-Dh-H) catalyzes the reversible oxidation of formate to CO2 with the release of a proton and two electrons. It is a component of the anaerobic formate hydrogen lyase complex. The E. coli formate dehydrogenase H (Fdh-H) is...; Region: MopB_CT_Formate-Dh_H; cd02790
568708019683	molybdopterin cofactor binding site; other site
568708019687	pfam_scan;Pfam:PF05118; E()=1.6E-62;score=209.3;query 68-222;description=Asp_Arg_Hydrox; tmhmm; query 1-302
568708019689	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
568708019690	Coenzyme A binding pocket [chemical binding]; other site
568708019692	Escherichia coli PhnB and similar proteins; the E. coli phnB gene is found next to an operon involved in the cleavage of carbon-phosphorus bonds in unactivated alkylphosphonates; Region: PhnB_like; cd06588
568708019693	dimer interface [polypeptide binding]; other site
568708019694	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
568708019696	hypothetical protein; Provisional; Region: PRK10220
568708019697	PhnA Zinc-Ribbon; Region: PhnA_Zn_Ribbon; pfam08274
568708019698	PhnA protein; Region: PhnA; pfam03831
568708019701	proline/glycine betaine transporter; Provisional; Region: PRK10642
568708019702	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708019703	putative substrate translocation pore; other site
568708019704	Osmosensory transporter coiled coil; Region: Osmo_CC; pfam08946
568708019706	12 probable transmembrane helices predicted for STM_MW42411 by TMHMM2.0 at aa 30-52, 67-89, 98-120, 124-146, 167-189, 199-221, 260-282, 297-319, 326-346, 351-373, 386-408 and 418-437
568708019708	sensor protein BasS/PmrB; Provisional; Region: PRK10755
568708019709	HAMP domain; Region: HAMP; pfam00672
568708019710	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
568708019711	dimer interface [polypeptide binding]; other site
568708019712	phosphorylation site [posttranslational modification]
568708019713	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708019714	ATP binding site [chemical binding]; other site
568708019715	Mg2+ binding site [ion binding]; other site
568708019716	G-X-G motif; other site
568708019719	2 probable transmembrane helices predicted for STM_MW42421 by TMHMM2.0 at aa 13-35 and 66-88
568708019720	DNA-binding transcriptional regulator BasR; Provisional; Region: PRK10643
568708019721	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708019722	active site
568708019723	phosphorylation site [posttranslational modification]
568708019724	intermolecular recognition site; other site
568708019725	dimerization interface [polypeptide binding]; other site
568708019726	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
568708019727	DNA binding site [nucleotide binding]
568708019730	putative metal dependent hydrolase; Provisional; Region: PRK11598
568708019731	Domain of unknown function (DUF1705); Region: DUF1705; pfam08019
568708019732	Sulfatase; Region: Sulfatase; pfam00884
568708019735	5 probable transmembrane helices predicted for STM_MW42441 by TMHMM2.0 at aa 11-33, 48-70, 77-99, 119-141 and 154-176
568708019736	arginine:agmatin antiporter; Provisional; Region: PRK10644
568708019738	11 probable transmembrane helices predicted for STM_MW42451 by TMHMM2.0 at aa 10-32, 39-61, 94-116, 123-142, 152-173, 228-250, 274-296, 324-341, 356-378, 385-407 and 411-428
568708019739	DNA-binding transcriptional regulator GadX; Provisional; Region: PRK09978
568708019740	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708019742	arginine decarboxylase; Provisional; Region: PRK15029
568708019743	Orn/Lys/Arg decarboxylase, N-terminal domain; Region: OKR_DC_1_N; pfam03709
568708019744	Ornithine decarboxylase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD corresponds to ornithine decarboxylase (ODC), arginine decarboxylase (ADC) and lysine...; Region: Orn_deC_like; cd00615
568708019745	homodimer interface [polypeptide binding]; other site
568708019746	pyridoxal 5'-phosphate binding site [chemical binding]; other site
568708019747	catalytic residue [active]
568708019748	Orn/Lys/Arg decarboxylase, C-terminal domain; Region: OKR_DC_1_C; pfam03711
568708019752	DNA-binding transcriptional regulator MelR; Provisional; Region: PRK10371
568708019753	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708019754	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708019756	alpha-galactosidase; Provisional; Region: PRK15076
568708019757	Glycoside Hydrolases Family 4; Alpha-glucosidases and alpha-galactosidases; Region: GH4_alpha_glucosidase_galactosidase; cd05297
568708019758	NAD binding site [chemical binding]; other site
568708019759	sugar binding site [chemical binding]; other site
568708019760	divalent metal binding site [ion binding]; other site
568708019761	putative tetramer (dimer of dimers) interface [polypeptide binding]; other site
568708019762	dimer interface [polypeptide binding]; other site
568708019764	melibiose:sodium symporter; Provisional; Region: PRK10429
568708019765	sugar (Glycoside-Pentoside-Hexuronide) transporter; Region: gph; TIGR00792
568708019766	12 probable transmembrane helices predicted for STM_MW42501 by TMHMM2.0 at aa 9-31, 36-58, 78-100, 110-132, 145-167, 177-199, 236-258, 268-290, 297-319, 324-346, 378-400 and 410-432
568708019767	fumarate hydratase; Provisional; Region: PRK15389
568708019768	Tartrate dehydratase alpha subunit/Fumarate hydratase class I, N-terminal domain [Energy production and conversion]; Region: TtdA; COG1951
568708019769	Fumarase C-terminus; Region: Fumerase_C; pfam05683
568708019772	Anaerobic C4-dicarboxylate transporter [General function prediction only]; Region: DcuB; COG2704
568708019773	anaerobic C4-dicarboxylate transporter; Reviewed; Region: PRK12489
568708019774	11 probable transmembrane helices predicted for STM_MW42521 by TMHMM2.0 at aa 21-43, 53-75, 88-110, 142-164, 171-193, 236-253, 266-288, 303-325, 346-368, 378-400 and 421-443
568708019776	DNA-binding transcriptional activator DcuR; Provisional; Region: PRK10430
568708019777	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708019778	active site
568708019779	phosphorylation site [posttranslational modification]
568708019780	intermolecular recognition site; other site
568708019781	dimerization interface [polypeptide binding]; other site
568708019783	sensory histidine kinase DcuS; Provisional; Region: PRK11086
568708019784	PAS domain; Region: PAS; smart00091
568708019785	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708019786	ATP binding site [chemical binding]; other site
568708019787	Mg2+ binding site [ion binding]; other site
568708019788	G-X-G motif; other site
568708019790	2 probable transmembrane helices predicted for STM_MW42551 by TMHMM2.0 at aa 20-42 and 183-202
568708019792	Signal peptide predicted for STM_MW42551 by SignalP 2.0 HMM (Signal peptide probability 0.942) with cleavage site probability 0.539 between residues 36 and 37
568708019793	anaerobic dimethyl sulfoxide reductase, A subunit, DmsA/YnfE family; Region: dmsA_ynfE; TIGR02166
568708019794	This CD (MopB_DmsA-EC) includes the DmsA enzyme of the dmsABC operon encoding the anaerobic dimethylsulfoxide reductase (DMSOR) of Escherichia coli and other related DMSOR-like enzymes. Unlike other DMSOR-like enzymes, this group has a  predicted...; Region: MopB_DmsA-EC; cd02770
568708019795	putative [Fe4-S4] binding site [ion binding]; other site
568708019796	putative molybdopterin cofactor binding site [chemical binding]; other site
568708019797	The MopB_CT_DmsA-EC CD includes the DmsA enzyme of the dmsABC operon encoding the anaerobic dimethylsulfoxide reductase (DMSOR) of Escherichia coli and other related DMSOR-like enzymes. Unlike other DMSOR-like enzymes, this group has a  predicted...; Region: MopB_CT_DmsA-EC; cd02794
568708019798	putative molybdopterin cofactor binding site; other site
568708019799	Signal peptide predicted for STM_MW42561 by SignalP 2.0 HMM (Signal peptide probability 0.995) with cleavage site probability 0.988 between residues 43 and 44
568708019803	DMSO reductase, iron-sulfur subunit; Region: DMSO_dmsB; TIGR02951
568708019805	DMSO reductase anchor subunit [General function prediction only]; Region: DmsC; COG3302
568708019807	8 probable transmembrane helices predicted for STM_MW42581 by TMHMM2.0 at aa 10-32, 39-61, 81-100, 107-129, 139-161, 166-188, 203-221 and 228-250
568708019808	Uncharacterized component of anaerobic dehydrogenases [General function prediction only]; Region: TorD; COG3381
568708019810	Domain of unknown function (DUF1996); Region: DUF1996; pfam09362
568708019812	Signal peptide predicted for STM_MW42601 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 23 and 24
568708019813	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3204
568708019814	SdiA-regulated; Region: SdiA-regulated; cd09971
568708019815	putative active site [active]
568708019816	1 probable transmembrane helix predicted for STM_MW42611 by TMHMM2.0 at aa 13-35
568708019818	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
568708019819	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
568708019820	DNA binding residues [nucleotide binding]
568708019821	dimerization interface [polypeptide binding]; other site
568708019823	AraC family transcriptional regulator; Provisional; Region: PRK15186
568708019824	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708019826	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4453
568708019828	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
568708019829	Coenzyme A binding pocket [chemical binding]; other site
568708019831	Membrane-associated phospholipid phosphatase [Lipid metabolism]; Region: PgpB; COG0671
568708019832	PAP2, bacterial acid phosphatase or class A non-specific acid phosphatases. These enzymes catalyze phosphomonoester hydrolysis, with optimal activity in low pH conditions. They are secreted into the periplasmic space, and their physiological role remains...; Region: PAP2_acid_phosphatase; cd03397
568708019833	active site
568708019835	Signal peptide predicted for STM_MW42691 by SignalP 2.0 HMM (Signal peptide probability 0.856) with cleavage site probability 0.814 between residues 20 and 21
568708019836	Helix-Turn-Helix DNA binding domain of putative transcription regulators from the MerR superfamily; Region: HTH_MerR-like_sg3; cd01282
568708019837	MerR HTH family regulatory protein; Region: MerR_1; pfam13411
568708019838	DNA binding residues [nucleotide binding]
568708019839	putative dimer interface [polypeptide binding]; other site
568708019842	putative transcriptional regulator; Provisional; Region: PRK11640
568708019843	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
568708019845	thiol:disulfide interchange protein precursor; Provisional; Region: dipZ; PRK00293
568708019846	Disulphide bond corrector protein DsbC; Region: DsbC; pfam11412
568708019847	Cytochrome C biogenesis protein transmembrane region; Region: DsbD; cl15788
568708019848	DsbD gamma family; DsbD gamma is the C-terminal periplasmic domain of the bacterial protein DsbD. It contains a CXXC motif in a TRX fold and shuttles the reducing potential from the membrane domain (DsbD beta) to the N-terminal periplasmic domain (DsbD...; Region: DsbDgamma; cd02953
568708019849	DsbD alpha interface [polypeptide binding]; other site
568708019850	catalytic residues [active]
568708019852	8 probable transmembrane helices predicted for STM_MW42721 by TMHMM2.0 at aa 5-22, 170-192, 212-234, 246-268, 297-319, 326-348, 358-380 and 387-409
568708019855	Signal peptide predicted for STM_MW42721 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 19 and 20
568708019856	divalent-cation tolerance protein CutA; Provisional; Region: PRK10645
568708019858	Anaerobic C4-dicarboxylate transporter [General function prediction only]; Region: DcuB; COG2704
568708019859	anaerobic C4-dicarboxylate transporter; Reviewed; Region: PRK09412
568708019861	10 probable transmembrane helices predicted for STM_MW42741 by TMHMM2.0 at aa 7-29, 49-71, 91-113, 123-145, 187-204, 219-238, 245-267, 287-306, 319-341 and 371-393
568708019862	Signal peptide predicted for STM_MW42741 by SignalP 2.0 HMM (Signal peptide probability 0.795) with cleavage site probability 0.617 between residues 27 and 28
568708019863	aspartate ammonia-lyase; Provisional; Region: aspA; PRK12273
568708019864	Aspartase; Region: Aspartase; cd01357
568708019865	active sites [active]
568708019866	tetramer interface [polypeptide binding]; other site
568708019869	Protein affecting phage T7 exclusion by the F plasmid [General function prediction only]; Region: FxsA; COG3030
568708019870	3 probable transmembrane helices predicted for STM_MW42761 by TMHMM2.0 at aa 15-34, 39-61 and 92-114
568708019872	putative transporter; Provisional; Region: PRK11021
568708019873	10 probable transmembrane helices predicted for STM_MW42771 by TMHMM2.0 at aa 7-29, 44-66, 87-109, 146-168, 181-203, 223-245, 258-280, 314-336, 343-362 and 372-406
568708019875	Signal peptide predicted for STM_MW42771 by SignalP 2.0 HMM (Signal peptide probability 0.710) with cleavage site probability 0.417 between residues 33 and 34
568708019876	Chaperonin 10 Kd subunit (cpn10 or GroES); Cpn10 cooperates with chaperonin 60 (cpn60 or GroEL), an ATPase, to assist the folding and assembly of proteins and is found in eubacterial cytosol, as well as in the matrix of mitochondria and chloroplasts. It...; Region: cpn10; cd00320
568708019877	oligomerisation interface [polypeptide binding]; other site
568708019878	mobile loop; other site
568708019879	roof hairpin; other site
568708019881	chaperonin GroEL; Reviewed; Region: groEL; PRK12849
568708019882	GroEL_like type I chaperonin. Chaperonins are involved in productive folding of proteins. They share a common general morphology, a double toroid of 2 stacked rings, each composed of 7-9 subunits. The symmetry of type I is seven-fold and they are found...; Region: GroEL; cd03344
568708019883	ring oligomerisation interface [polypeptide binding]; other site
568708019884	ATP/Mg binding site [chemical binding]; other site
568708019885	stacking interactions; other site
568708019886	hinge regions; other site
568708019888	Domain of unknown function (DUF4156); Region: DUF4156; pfam13698
568708019889	Signal peptide predicted for STM_MW42801 by SignalP 2.0 HMM (Signal peptide probability 0.996) with cleavage site probability 0.593 between residues 28 and 29
568708019890	Lysine 2,3-aminomutase [Amino acid transport and metabolism]; Region: KamA; COG1509
568708019891	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
568708019892	FeS/SAM binding site; other site
568708019894	elongation factor P; Validated; Region: PRK00529
568708019895	Elongation factor P (EF-P) KOW-like domain; Region: EFP_N; pfam08207
568708019896	S1_EF-P_repeat_1: Translation elongation factor P (EF-P), S1-like RNA-binding domain, repeat 1. EF-P stimulates the peptidyltransferase activity in the prokaryotic 70S ribosome. EF-P enhances the synthesis of certain dipeptides with...; Region: S1_EF-P_repeat_1; cd04470
568708019897	RNA binding site [nucleotide binding]; other site
568708019898	S1_EF-P_repeat_2: Translation elongation factor P (EF-P), S1-like RNA-binding domain, repeat 1. EF-P stimulates the peptidyltransferase activity in the prokaryotic 70S ribosome. EF-P enhances the synthesis of certain dipeptides with...; Region: S1_EF-P_repeat_2; cd05794
568708019899	RNA binding site [nucleotide binding]; other site
568708019903	entericidin B membrane lipoprotein; Provisional; Region: PRK10081
568708019904	Signal peptide predicted for STM_MW42841 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.992 between residues 21 and 22
568708019906	1 probable transmembrane helix predicted for STM_MW42841 by TMHMM2.0 at aa 7-29
568708019907	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
568708019908	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
568708019909	DNA binding residues [nucleotide binding]
568708019910	dimerization interface [polypeptide binding]; other site
568708019912	multidrug efflux system protein; Provisional; Region: PRK11431
568708019914	4 probable transmembrane helices predicted for STM_MW42861 by TMHMM2.0 at aa 2-19, 29-48, 55-77 and 87-104
568708019915	outer membrane lipoprotein Blc; Provisional; Region: PRK10477
568708019916	Lipocalin-like domain; Region: Lipocalin_2; pfam08212
568708019918	Signal peptide predicted for STM_MW42871 by SignalP 2.0 HMM (Signal peptide probability 0.989) with cleavage site probability 0.691 between residues 18 and 19
568708019919	Quinol:fumarate reductase (QFR) Type D subfamily, 13kD hydrophobic subunit D; QFR couples the reduction of fumarate to succinate to the oxidation of quinol to quinone, the opposite reaction to that catalyzed by the related protein, succinate:quinine...; Region: QFR_TypeD_subunitD; cd00547
568708019920	Iron-sulfur protein interface; other site
568708019921	proximal quinone binding site [chemical binding]; other site
568708019922	C-subunit interface; other site
568708019923	distal quinone binding site; other site
568708019924	3 probable transmembrane helices predicted for STM_MW42881 by TMHMM2.0 at aa 13-42, 57-79 and 99-118
568708019926	Quinol:fumarate reductase (QFR) Type D subfamily, 15kD hydrophobic subunit C;  QFR couples the reduction of fumarate to succinate to the oxidation of quinol to quinone, the opposite reaction to that catalyzed by the related protein, succinate:quinine...; Region: QFR_TypeD_subunitC; cd00546
568708019927	D-subunit interface [polypeptide binding]; other site
568708019928	Iron-sulfur protein interface; other site
568708019929	proximal quinone binding site [chemical binding]; other site
568708019931	3 probable transmembrane helices predicted for STM_MW42891 by TMHMM2.0 at aa 28-50, 60-82 and 108-130
568708019932	fumarate reductase iron-sulfur subunit; Provisional; Region: PRK12385
568708019933	2Fe-2S iron-sulfur cluster binding domain; Region: Fer2_3; pfam13085
568708019934	fumarate reductase flavoprotein subunit; Validated; Region: PRK09231
568708019935	L-aspartate oxidase; Provisional; Region: PRK06175
568708019936	Fumarate reductase flavoprotein C-term; Region: Succ_DH_flav_C; pfam02910
568708019939	Signal peptide predicted for STM_MW42911 by SignalP 2.0 HMM (Signal peptide probability 0.907) with cleavage site probability 0.351 between residues 27 and 28
568708019940	poxB regulator PoxA; Provisional; Region: PRK09350
568708019941	Class II tRNA amino-acyl synthetase-like catalytic core domain. Class II amino acyl-tRNA synthetases (aaRS) share a common fold and generally attach an amino acid to the 3' OH of ribose of the appropriate tRNA.   PheRS is an exception in that it...; Region: class_II_aaRS-like_core; cl00268
568708019942	motif 1; other site
568708019943	dimer interface [polypeptide binding]; other site
568708019944	active site
568708019945	motif 2; other site
568708019946	motif 3; other site
568708019948	inner membrane transporter YjeM; Provisional; Region: PRK15238
568708019949	Signal peptide predicted for STM_MW42931 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.891 between residues 25 and 26
568708019950	12 probable transmembrane helices predicted for STM_MW42931 by TMHMM2.0 at aa 12-34, 38-57, 95-117, 132-154, 161-183, 208-230, 243-265, 310-332, 364-383, 393-415, 435-457 and 467-484
568708019952	Protein of unknown function (DUF2645); Region: DUF2645; pfam10840
568708019953	Signal peptide predicted for STM_MW42941 by SignalP 2.0 HMM (Signal peptide probability 0.911) with cleavage site probability 0.512 between residues 21 and 22
568708019955	3 probable transmembrane helices predicted for STM_MW42941 by TMHMM2.0 at aa 7-26, 55-72 and 79-98
568708019956	putative mechanosensitive channel protein; Provisional; Region: PRK10929
568708019957	Mechanosensitive ion channel inner membrane domain 1; Region: MscS_TM; pfam12794
568708019958	Mechanosensitive ion channel; Region: MS_channel; pfam00924
568708019959	11 probable transmembrane helices predicted for STM_MW42951 by TMHMM2.0 at aa 475-492, 521-543, 553-575, 596-617, 627-648, 669-691, 696-718, 784-806, 826-848, 879-898 and 908-930
568708019961	Signal peptide predicted for STM_MW42951 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 19 and 20
568708019962	phosphatidylserine decarboxylase; Reviewed; Region: psd; PRK00044
568708019964	GTPase RsgA; Reviewed; Region: PRK12288
568708019965	S1_like: Ribosomal protein S1-like RNA-binding domain. Found in a wide variety of RNA-associated proteins. Originally identified in S1 ribosomal protein. This superfamily also contains the Cold Shock Domain (CSD), which is a homolog of the S1 domain; Region: S1_like; cl09927
568708019966	RNA binding site [nucleotide binding]; other site
568708019967	Ribosomal interacting GTPase YjeQ/EngC, a circularly permuted subfamily of the Ras GTPases; Region: YjeQ_EngC; cd01854
568708019968	GTPase/Zn-binding domain interface [polypeptide binding]; other site
568708019969	GTP/Mg2+ binding site [chemical binding]; other site
568708019970	G4 box; other site
568708019971	G5 box; other site
568708019972	G1 box; other site
568708019973	Switch I region; other site
568708019974	G2 box; other site
568708019975	G3 box; other site
568708019976	Switch II region; other site
568708019978	DEDDh 3'-5' exonuclease domain of oligoribonuclease and similar proteins; Region: Orn; cd06135
568708019979	catalytic site [active]
568708019980	putative active site [active]
568708019981	putative substrate binding site [chemical binding]; other site
568708019982	dimer interface [polypeptide binding]; other site
568708019984	note framshift follwoign codon 1 within a 8xpoly T tract; pfam_scan;Pfam:PF00497; E()=5.6E-72;score=242.1;query 24-244;description=SBP_bac_3
568708019986	epoxyqueuosine reductase; Region: TIGR00276
568708019987	Domain of unknown function (DUF1730); Region: DUF1730; pfam08331
568708019989	putative carbohydrate kinase; Provisional; Region: PRK10565
568708019990	Uncharacterized conserved protein [Function unknown]; Region: COG0062
568708019991	B.subtilis YXKO protein of unknown function and related proteins. Based on the conservation of the ATP binding site, the substrate binding site and the Mg2+binding site and structural homology this group is a member of the ribokinase-like superfamily; Region: YXKO-related; cd01171
568708019992	putative substrate binding site [chemical binding]; other site
568708019993	putative ATP binding site [chemical binding]; other site
568708019996	ADP-binding protein; Provisional; Region: PRK10646
568708019998	N-acetylmuramoyl-l-alanine amidase II; Provisional; Region: PRK10431
568708019999	N-acetylmuramoyl-L-alanine amidase or MurNAc-LAA (also known as peptidoglycan aminohydrolase, NAMLA amidase, NAMLAA, Amidase 3, and peptidoglycan amidase; EC 3.5.1.28) is an autolysin that hydrolyzes the amide bond between N-acetylmuramoyl and L-amino...; Region: MurNAc-LAA; cd02696
568708020000	active site
568708020001	metal binding site [ion binding]; metal-binding site
568708020002	Signal peptide predicted for STM_MW43031 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.949 between residues 22 and 23
568708020004	DNA mismatch repair protein; Reviewed; Region: mutL; PRK00095
568708020005	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708020006	ATP binding site [chemical binding]; other site
568708020007	Mg2+ binding site [ion binding]; other site
568708020008	G-X-G motif; other site
568708020009	MutL_Trans_MutL: transducer domain, having a ribosomal S5 domain 2-like fold, found in proteins similar to Escherichia coli MutL.  EcMutL belongs to the DNA mismatch repair (MutL/MLH1/PMS2) family.  This transducer domain is homologous to the second...; Region: MutL_Trans_MutL; cd03482
568708020010	ATP binding site [chemical binding]; other site
568708020011	MutL C terminal dimerisation domain; Region: MutL_C; pfam08676
568708020015	tRNA delta(2)-isopentenylpyrophosphate transferase; Reviewed; Region: miaA; PRK00091
568708020016	tRNA delta(2)-isopentenylpyrophosphate transferase [Translation, ribosomal structure and biogenesis]; Region: MiaA; COG0324
568708020018	bacterial Hfq-like; Region: Hfq; cd01716
568708020019	hexamer interface [polypeptide binding]; other site
568708020020	Sm1 motif; other site
568708020021	RNA binding site [nucleotide binding]; other site
568708020022	Sm2 motif; other site
568708020024	GTPase HflX; Provisional; Region: PRK11058
568708020025	GTP-binding GTPase N-terminal; Region: GTP-bdg_N; pfam13167
568708020026	HflX GTPase family; Region: HflX; cd01878
568708020027	G1 box; other site
568708020028	GTP/Mg2+ binding site [chemical binding]; other site
568708020029	Switch I region; other site
568708020030	G2 box; other site
568708020031	G3 box; other site
568708020032	Switch II region; other site
568708020033	G4 box; other site
568708020034	G5 box; other site
568708020037	FtsH protease regulator HflK; Provisional; Region: PRK10930
568708020038	Bacterial membrane protein N terminal; Region: HflK_N; pfam12221
568708020039	Band_7_HflK: The band 7 domain of flotillin (reggie) like proteins. This group includes proteins similar to prokaryotic HlfK (High frequency of lysogenization K). Although many members of the band 7 family are lipid raft associated, prokaryote plasma...; Region: Band_7_HflK; cd03404
568708020040	1 probable transmembrane helix predicted for STM_MW43081 by TMHMM2.0 at aa 78-100
568708020042	FtsH protease regulator HflC; Provisional; Region: PRK11029
568708020043	Band_7_HflC: The band 7 domain of flotillin (reggie) like proteins. This group includes proteins similar to prokaryotic HlfC (High frequency of lysogenization C). Although many members of the band 7 family are lipid raft associated, prokaryote plasma...; Region: Band_7_HflC; cd03405
568708020044	Signal peptide predicted for STM_MW43091 by SignalP 2.0 HMM (Signal peptide probability 0.723) with cleavage site probability 0.456 between residues 24 and 25
568708020045	1 probable transmembrane helix predicted for STM_MW43091 by TMHMM2.0 at aa 5-23
568708020047	Adenylosuccinate synthetase; Region: Adenylsucc_synt; smart00788
568708020048	Adenylosuccinate synthetase (AdSS) catalyzes the first step in the de novo biosynthesis of AMP. IMP and L-aspartate are conjugated in a two-step reaction accompanied by the hydrolysis of GTP to GDP in the presence of Mg2+. In the first step, the...; Region: AdSS; cd03108
568708020049	GDP-binding site [chemical binding]; other site
568708020050	ACT binding site; other site
568708020051	IMP binding site; other site
568708020053	Predicted transcriptional regulator [Transcription]; Region: COG1959
568708020054	transcriptional repressor NsrR; Provisional; Region: PRK11014
568708020056	exoribonuclease R; Provisional; Region: PRK11642
568708020057	Ribonuclease B OB domain; Region: OB_RNB; pfam08206
568708020058	S1_like: Ribosomal protein S1-like RNA-binding domain. Found in a wide variety of RNA-associated proteins. Originally identified in S1 ribosomal protein. This superfamily also contains the Cold Shock Domain (CSD), which is a homolog of the S1 domain; Region: S1_like; cl09927
568708020059	RNB domain; Region: RNB; pfam00773
568708020060	S1_RNase_R: RNase R C-terminal S1 domain. RNase R is a processive 3' to 5' exoribonuclease, which is a homolog of RNase II. RNase R degrades RNA with secondary structure having a 3' overhang of at least 7 nucleotides. RNase R and PNPase...; Region: S1_RNase_R; cd04471
568708020061	RNA binding site [nucleotide binding]; other site
568708020066	23S rRNA (guanosine-2'-O-)-methyltransferase; Provisional; Region: PRK11181
568708020067	RNA 2'-O ribose methyltransferase substrate binding; Region: SpoU_sub_bind; smart00967
568708020068	SpoU rRNA Methylase family; Region: SpoU_methylase; pfam00588
568708020071	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3789
568708020073	Phage shock protein A (IM30), suppresses sigma54-dependent transcription [Transcription / Signal transduction mechanisms]; Region: PspA; COG1842
568708020075	Ion channel; Region: Ion_trans_2; pfam07885
568708020076	Kef-type K+ transport systems, predicted NAD-binding component [Inorganic ion transport and metabolism]; Region: Kch; COG1226
568708020077	3 probable transmembrane helices predicted for STM_MW43161 by TMHMM2.0 at aa 15-37, 44-66 and 81-100
568708020079	Protein of unknown function (DUF2491); Region: DUF2491; pfam10679
568708020081	Predicted membrane protein [Function unknown]; Region: COG3766
568708020082	Domain of Unknown Function (DUF350); Region: DUF350; pfam03994
568708020083	Domain of Unknown Function (DUF350); Region: DUF350; pfam03994
568708020084	4 probable transmembrane helices predicted for STM_MW43181 by TMHMM2.0 at aa 6-28, 48-70, 75-97 and 109-131
568708020086	Predicted integral membrane protein [Function unknown]; Region: COG5463
568708020088	Glutathionylspermidine synthase [Amino acid transport and metabolism]; Region: Gsp; COG0754
568708020090	isovaleryl CoA dehydrogenase; Provisional; Region: PRK11561
568708020091	Proteins involved in DNA damage response, similar to the AidB gene product; Region: AidB; cd01154
568708020092	FAD binding site [chemical binding]; other site
568708020093	substrate binding site [chemical binding]; other site
568708020094	catalytic residues [active]
568708020097	Protein of unknown function (DUF1471); Region: DUF1471; pfam07338
568708020099	putative biofilm stress and motility protein A; Provisional; Region: PRK14864
568708020101	1 probable transmembrane helix predicted for STM_MW43231 by TMHMM2.0 at aa 13-32
568708020102	Signal peptide predicted for STM_MW43231 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.602 between residues 30 and 31
568708020103	esterase; Provisional; Region: PRK10566
568708020104	Putative lysophospholipase; Region: Hydrolase_4; pfam12146
568708020105	Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326
568708020107	transcriptional repressor UlaR; Provisional; Region: PRK13509
568708020108	DeoR-like helix-turn-helix domain; Region: HTH_DeoR; pfam08220
568708020109	DeoR C terminal sensor domain; Region: DeoRC; pfam00455
568708020112	putative L-ascorbate 6-phosphate lactonase; Provisional; Region: PRK11709
568708020113	Predicted Zn-dependent hydrolases of the beta-lactamase fold [General function prediction only]; Region: COG2220
568708020114	Uncharacterized protein conserved in bacteria [Function unknown]; Region: SgaT; COG3037
568708020115	PTS system ascorbate-specific transporter subunits IICB; Provisional; Region: PRK09548
568708020116	10 probable transmembrane helices predicted for STM_MW43271 by TMHMM2.0 at aa 22-44, 51-73, 111-133, 154-183, 244-263, 275-297, 317-339, 351-373, 388-410 and 435-457
568708020118	PTS_IIB_ascorbate: subunit IIB of enzyme II (EII) of the L-ascorbate-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS). In this system, EII is an L-ascorbate-specific permease with two cytoplasmic subunits (IIA and IIB) and a...; Region: PTS_IIB_ascorbate; cd05563
568708020119	active site
568708020120	P-loop; other site
568708020121	phosphorylation site [posttranslational modification]
568708020123	PTS_IIA, PTS system, fructose/mannitol specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This...; Region: PTS_IIA_fru; cd00211
568708020124	active site
568708020125	phosphorylation site [posttranslational modification]
568708020127	3-Keto-L-gulonate 6-phosphate decarboxylase (KGPDC) and D-arabino-3-hexulose-6-phosphate synthase (HPS). KGPDC catalyzes the formation of L-xylulose 5-phosphate and carbon dioxide from 3-keto-L-gulonate 6-phosphate as part of the anaerobic pathway for...; Region: KGPDC_HPS; cd04726
568708020128	active site
568708020129	dimer interface [polypeptide binding]; other site
568708020130	magnesium binding site [ion binding]; other site
568708020132	L-xylulose 5-phosphate 3-epimerase; Reviewed; Region: PRK13209
568708020133	AP endonuclease family 2; These endonucleases play a role in DNA repair. Cleave phosphodiester bonds at apurinic or apyrimidinic sites; the alignment also contains hexulose-6-phosphate isomerases, enzymes that catalyze the epimerization of...; Region: AP2Ec; cd00019
568708020134	AP (apurinic/apyrimidinic) site pocket; other site
568708020135	DNA interaction; other site
568708020136	Metal-binding active site; metal-binding site
568708020138	L-ribulose-5-phosphate 4-epimerase; Reviewed; Region: araD; PRK08193
568708020139	Class II Aldolase and Adducin head (N-terminal) domain. Aldolases are ubiquitous enzymes catalyzing central steps of carbohydrate metabolism. Based on enzymatic mechanisms, this superfamily has been divided into two distinct classes (Class I and II); Region: Aldolase_II; cd00398
568708020140	intersubunit interface [polypeptide binding]; other site
568708020141	active site
568708020142	Zn2+ binding site [ion binding]; other site
568708020144	Protein of unknown function (DUF1471); Region: DUF1471; pfam07338
568708020146	Signal peptide predicted for STM_MW43331 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.720 between residues 20 and 21
568708020147	30S ribosomal protein S6; Reviewed; Region: rpsF; PRK00453
568708020149	SSB_OBF: A subfamily of OB folds similar to the OB fold of ssDNA-binding protein (SSB). SSBs bind with high affinity to ssDNA. They bind to and protect ssDNA intermediates during DNA metabolic pathways. All bacterial and eukaryotic SSBs studied to date...; Region: SSB_OBF; cd04496
568708020150	dimer interface [polypeptide binding]; other site
568708020151	ssDNA binding site [nucleotide binding]; other site
568708020152	tetramer (dimer of dimers) interface [polypeptide binding]; other site
568708020154	30S ribosomal protein S18; Reviewed; Region: rpsR; PRK00391
568708020156	50S ribosomal protein L9; Reviewed; Region: rplI; PRK00137
568708020157	Ribosomal protein L9, N-terminal domain; Region: Ribosomal_L9_N; pfam01281
568708020158	Ribosomal protein L9, C-terminal domain; Region: Ribosomal_L9_C; pfam03948
568708020161	Permeases of the drug/metabolite transporter (DMT) superfamily [Carbohydrate transport and metabolism / Amino acid transport and metabolism / General function prediction only]; Region: RhaT; COG0697
568708020162	EamA-like transporter family; Region: EamA; pfam00892
568708020163	10 probable transmembrane helices predicted for STM_MW43391 by TMHMM2.0 at aa 13-34, 54-72, 85-107, 117-134, 141-163, 173-192, 204-226, 231-253, 258-280 and 284-303
568708020165	Cell envelope opacity-associated protein A [Cell envelope biogenesis, outer membrane]; Region: OapA; COG3061
568708020166	Opacity-associated protein A LysM-like domain; Region: OapA; pfam04225
568708020169	peptidyl-prolyl cis-trans isomerase; Provisional; Region: PRK11570
568708020170	Domain amino terminal to FKBP-type peptidyl-prolyl isomerase; Region: FKBP_N; pfam01346
568708020171	FKBP-type peptidyl-prolyl cis-trans isomerase; Region: FKBP_C; pfam00254
568708020174	D-alanine/D-serine/glycine permease; Provisional; Region: PRK11049
568708020175	12 probable transmembrane helices predicted for STM_MW43421 by TMHMM2.0 at aa 27-44, 49-71, 104-126, 136-158, 165-187, 210-232, 252-274, 289-311, 347-369, 374-396, 417-435 and 439-461
568708020177	iron-sulfur cluster repair di-iron protein; Provisional; Region: PRK10992
568708020178	Domain of Unknown function (DUF542); Region: ScdA_N; pfam04405
568708020179	Hemerythrin-like domain; Region: Hr-like; cd12108
568708020180	Fe binding site [ion binding]; other site
568708020183	Permeases of the drug/metabolite transporter (DMT) superfamily [Carbohydrate transport and metabolism / Amino acid transport and metabolism / General function prediction only]; Region: RhaT; COG0697
568708020184	EamA-like transporter family; Region: EamA; pfam00892
568708020186	10 probable transmembrane helices predicted for STM_MW43441 by TMHMM2.0 at aa 5-25, 35-52, 64-86, 91-113, 120-142, 152-174, 195-217, 232-254, 259-281 and 286-308
568708020187	Predicted nucleoside-diphosphate-sugar epimerases [Cell envelope biogenesis, outer membrane / Carbohydrate transport and metabolism]; Region: COG0702
568708020188	triphenylmethane reductase (TMR)-like proteins, NMRa-like, atypical (a) SDRs; Region: TMR_SDR_a; cd05269
568708020189	NADP binding site [chemical binding]; other site
568708020191	Predicted transcriptional regulators [Transcription]; Region: COG1733
568708020192	HxlR-like helix-turn-helix; Region: HxlR; pfam01638
568708020194	bifunctional 2',3'-cyclic nucleotide 2'-phosphodiesterase/3'-nucleotidase periplasmic precursor protein; Reviewed; Region: cpdB; PRK09420
568708020195	Escherichia coli CpdB and related proteins, N-terminal metallophosphatase domain; Region: MPP_CpdB_N; cd07410
568708020196	active site
568708020197	metal binding site [ion binding]; metal-binding site
568708020198	5'-nucleotidase, C-terminal domain; Region: 5_nucleotid_C; pfam02872
568708020201	Signal peptide predicted for STM_MW43471 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.996 between residues 19 and 20
568708020202	CysQ, a 3'-Phosphoadenosine-5'-phosphosulfate (PAPS) 3'-phosphatase, is a bacterial member of the inositol monophosphatase family. It has been proposed that CysQ helps control intracellular levels of PAPS, which is an intermediate in...; Region: CysQ; cd01638
568708020203	Archaeal fructose-1,6-bisphosphatase and related enzymes of inositol monophosphatase family [Carbohydrate transport and metabolism]; Region: SuhB; COG0483
568708020204	active site
568708020206	Predicted transcriptional regulator [General function prediction only]; Region: COG3054
568708020208	Signal peptide predicted for STM_MW43491 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.887 between residues 20 and 21
568708020209	Protein of unknown function (DUF1107); Region: DUF1107; pfam06526
568708020211	Hemolysins and related proteins containing CBS domains [General function prediction only]; Region: TlyC; COG1253
568708020212	Domain of unknown function DUF21; Region: DUF21; pfam01595
568708020213	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains associated with the CorC_HlyC domain. CorC_HlyC is a transporter associated domain. This small domain is found in Na+/H+ antiporters, in proteins involved in...; Region: CBS_pair_CorC_HlyC_assoc; cd04590
568708020214	Transporter associated domain; Region: CorC_HlyC; smart01091
568708020217	4 probable transmembrane helices predicted for STM_MW43511 by TMHMM2.0 at aa 5-27, 58-80, 100-117 and 144-162
568708020219	Signal peptide predicted for STM_MW43511 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.988 between residues 26 and 27
568708020220	methionine sulfoxide reductase A; Provisional; Region: PRK00058
568708020222	Outer membrane protein [Cell envelope biogenesis, outer membrane]; Region: COG0729
568708020223	Surface antigen variable number repeat; Region: Surf_Ag_VNR; pfam07244
568708020224	Surface antigen; Region: Bac_surface_Ag; pfam01103
568708020225	Signal peptide predicted for STM_MW43531 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.967 between residues 21 and 22
568708020228	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2911
568708020229	Family of unknown function (DUF490); Region: DUF490; pfam04357
568708020230	Signal peptide predicted for STM_MW43541 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.711 between residues 25 and 26
568708020231	1 probable transmembrane helix predicted for STM_MW43541 by TMHMM2.0 at aa 7-29
568708020233	GGCT-like domains, also called AIG2-like family. Gamma-glutamyl cyclotransferase (GGCT) catalyzes the formation of pyroglutamic acid (5-oxoproline) from dipeptides containing gamma-glutamyl, and is a dimeric protein. In Homo sapiens, the protein is...; Region: GGCT_like; cd06661
568708020234	putative active site pocket [active]
568708020235	dimerization interface [polypeptide binding]; other site
568708020236	putative catalytic residue [active]
568708020238	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708020239	D-galactonate transporter; Region: 2A0114; TIGR00893
568708020240	putative substrate translocation pore; other site
568708020241	12 probable transmembrane helices predicted for STM_MW43561 by TMHMM2.0 at aa 7-26, 41-63, 76-93, 97-116, 137-154, 164-186, 215-237, 252-273, 280-302, 307-329, 342-364 and 374-393
568708020243	putative metallo-dependent hydrolase; Provisional; Region: PRK12394
568708020244	Metallo-dependent hydrolases, subgroup B is part of the superfamily of metallo-dependent hydrolases, a large group of proteins that show conservation in their 3-dimensional fold (TIM barrel) and in details of their active site. The vast majority of the...; Region: Met_dep_hydrolase_B; cd01307
568708020245	active site
568708020247	Inorganic pyrophosphatase. These enzymes hydrolyze inorganic pyrophosphate (PPi) to two molecules of orthophosphates (Pi). The reaction requires bivalent cations. The enzymes in general exist as homooligomers; Region: pyrophosphatase; cd00412
568708020248	dimer interface [polypeptide binding]; other site
568708020249	substrate binding site [chemical binding]; other site
568708020250	metal binding sites [ion binding]; metal-binding site
568708020252	Fructose-1,6-bisphosphatase, an enzyme that catalyzes the hydrolysis of fructose-1,6-biphosphate  into fructose-6-phosphate and is critical in gluconeogenesis pathway. The alignment model also includes chloroplastic FBPases and sedoheptulose-1; Region: FBPase; cd00354
568708020253	AMP binding site [chemical binding]; other site
568708020254	metal binding site [ion binding]; metal-binding site
568708020255	active site
568708020257	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase; Region: mpl; TIGR01081
568708020258	Mur ligase family, catalytic domain; Region: Mur_ligase; pfam01225
568708020259	Mur ligase middle domain; Region: Mur_ligase_M; pfam08245
568708020260	Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875
568708020261	Signal peptide predicted for STM_MW43601 by SignalP 2.0 HMM (Signal peptide probability 0.966) with cleavage site probability 0.924 between residues 24 and 25
568708020265	Transcriptional regulators [Transcription]; Region: RpiR; COG1737
568708020266	Helix-turn-helix domain, rpiR family; Region: HTH_6; pfam01418
568708020267	RpiR-like protein. RpiR contains a SIS (Sugar ISomerase) domain, which is found in many phosphosugar isomerases and phosphosugar binding proteins. In E. coli, rpiR negatively regulates the expression of rpiB gene. Both rpiB and rpiA are ribose phosphate...; Region: SIS_RpiR; cd05013
568708020268	putative active site [active]
568708020271	D-xylose transporter XylE; Provisional; Region: xylE; PRK10077
568708020272	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708020273	putative substrate translocation pore; other site
568708020274	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708020276	12 probable transmembrane helices predicted for STM_MW43621 by TMHMM2.0 at aa 12-34, 54-73, 85-107, 111-133, 146-165, 175-197, 257-279, 294-316, 323-345, 355-377, 389-408 and 423-445
568708020277	D-xylose transporter XylE; Provisional; Region: xylE; PRK10077
568708020278	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708020279	putative substrate translocation pore; other site
568708020280	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708020281	Signal peptide predicted for STM_MW43631 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.955 between residues 31 and 32
568708020282	12 probable transmembrane helices predicted for STM_MW43631 by TMHMM2.0 at aa 12-34, 49-68, 81-100, 105-127, 140-162, 177-196, 260-282, 297-319, 326-345, 355-377, 390-412 and 422-444
568708020284	Uncharacterized enzyme involved in inositol metabolism [Carbohydrate transport and metabolism]; Region: IolB; COG3718
568708020286	Methylmalonate semialdehyde dehydrogenase and ALDH family members 6A1 and 6B2; Region: ALDH_F6_MMSDH; cd07085
568708020287	methylmalonic acid semialdehyde dehydrogenase; Region: MMSDH; TIGR01722
568708020288	tetrameric interface [polypeptide binding]; other site
568708020289	NAD binding site [chemical binding]; other site
568708020290	catalytic residues [active]
568708020292	AraC-like ligand binding domain; Region: AraC_binding; pfam02311
568708020293	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
568708020294	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708020297	Sugar phosphate isomerases/epimerases [Carbohydrate transport and metabolism]; Region: IolE; COG1082
568708020299	Predicted dehydrogenases and related proteins [General function prediction only]; Region: MviM; COG0673
568708020300	Oxidoreductase family, NAD-binding Rossmann fold; Region: GFO_IDH_MocA; pfam01408
568708020301	Oxidoreductase family, C-terminal alpha/beta domain; Region: GFO_IDH_MocA_C; pfam02894
568708020304	O-Glycosyl hydrolase [Cell envelope biogenesis, outer membrane]; Region: COG5520
568708020305	O-Glycosyl hydrolase family 30; Region: Glyco_hydro_30; pfam02055
568708020307	Sugar phosphate isomerases/epimerases [Carbohydrate transport and metabolism]; Region: IolE; COG1082
568708020309	major facilitator superfamily transporter; Provisional; Region: PRK05122
568708020310	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708020311	putative substrate translocation pore; other site
568708020312	12 probable transmembrane helices predicted for STM_MW43721 by TMHMM2.0 at aa 12-34, 49-68, 89-111, 116-138, 145-167, 177-199, 212-234, 249-266, 273-295, 299-321, 334-356 and 366-385
568708020314	Sugar kinases, ribokinase family [Carbohydrate transport and metabolism]; Region: RbsK; COG0524
568708020315	2-keto-3-deoxygluconate kinase (KdgK) phosphorylates 2-keto-3-deoxygluconate (KDG) to form 2-keto-3-deoxy-6-phosphogluconate (KDGP). KDG is the common intermediate product, that allows organisms to channel D-glucuronate and/or D-galacturinate into the...; Region: KdgK; cd01166
568708020316	substrate binding site [chemical binding]; other site
568708020317	ATP binding site [chemical binding]; other site
568708020318	Uncharacterized protein conserved in bacteria (DUF2090); Region: DUF2090; pfam09863
568708020319	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3892
568708020322	Acetolactate synthase [Amino acid transport and metabolism]; Region: COG3962
568708020323	Pyrimidine (PYR) binding domain of POX and related proteins; Region: TPP_PYR_POX_like; cd07035
568708020324	PYR/PP interface [polypeptide binding]; other site
568708020325	dimer interface [polypeptide binding]; other site
568708020326	TPP binding site [chemical binding]; other site
568708020327	Thiamine pyrophosphate enzyme, central domain; Region: TPP_enzyme_M; pfam00205
568708020328	Thiamine pyrophosphate (TPP) family, IolD subfamily, TPP-binding module; composed of proteins similar to Rhizobium leguminosarum bv. viciae IolD. IolD plays an important role in myo-inositol catabolism; Region: TPP_IolD; cd02003
568708020329	TPP-binding site; other site
568708020333	Predicted dehydrogenases and related proteins [General function prediction only]; Region: MviM; COG0673
568708020334	Oxidoreductase family, NAD-binding Rossmann fold; Region: GFO_IDH_MocA; pfam01408
568708020335	Oxidoreductase family, C-terminal alpha/beta domain; Region: GFO_IDH_MocA_C; pfam02894
568708020338	polyol permease family; Region: 2A0118; TIGR00897
568708020339	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708020340	putative substrate translocation pore; other site
568708020341	12 probable transmembrane helices predicted for STM_MW43761 by TMHMM2.0 at aa 20-42, 57-79, 86-105, 110-132, 145-167, 177-196, 231-253, 263-282, 295-317, 322-344, 357-379 and 383-402
568708020343	Predicted sugar epimerase [Carbohydrate transport and metabolism]; Region: COG4130
568708020344	AP endonuclease family 2; These endonucleases play a role in DNA repair. Cleave phosphodiester bonds at apurinic or apyrimidinic sites; the alignment also contains hexulose-6-phosphate isomerases, enzymes that catalyze the epimerization of...; Region: AP2Ec; cl12060
568708020345	DNA interaction; other site
568708020346	Metal-binding active site; metal-binding site
568708020348	Xylose isomerase-like TIM barrel; Region: AP_endonuc_2; pfam01261
568708020350	hypothetical protein; Provisional; Region: PRK05255
568708020352	peptidase PmbA; Provisional; Region: PRK11040
568708020354	cytochrome b562; Provisional; Region: PRK15058
568708020355	Signal peptide predicted for STM_MW43811 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 22 and 23
568708020356	1 probable transmembrane helix predicted for STM_MW43811 by TMHMM2.0 at aa 5-23
568708020358	match to SC4294 1..39 blast score 73.2 percent identity 82 SC4294 hypothetical protein 4598157:4598312 forward MW:5627; match to SC4294 38..51 blast score 31.2 percent identity 100 SC4294 hypothetical protein 4598157:4598312 forward MW:5627; tmhmm; query 1-47
568708020359	PRD domain protein EF_0829/AHA_3910; Region: EF_0829; TIGR03582
568708020361	conserved hypothetical protein EF_0830/AHA_3911; Region: EF_0830; TIGR03577
568708020362	conserved hypothetical protein EF_0831/AHA_3912; Region: EF_0831; TIGR03578
568708020363	conserved hypothetical protein EF_0832/AHA_3913; Region: EF_0832; TIGR03580
568708020364	Signal peptide predicted for STM_MW43861 by SignalP 2.0 HMM (Signal peptide probability 0.850) with cleavage site probability 0.565 between residues 24 and 25
568708020365	6 probable transmembrane helices predicted for STM_MW43861 by TMHMM2.0 at aa 2-24, 55-77, 111-133, 143-165, 177-199 and 214-232
568708020366	conserved hypothetical protein EF_0833/AHA_3914; Region: EF_0833; TIGR03579
568708020367	6 probable transmembrane helices predicted for STM_MW43871 by TMHMM2.0 at aa 15-37, 57-74, 84-106, 111-133, 165-187 and 194-213
568708020368	probable amidohydrolase EF_0837/AHA_3915; Region: EF_0837; TIGR03583
568708020369	Metallo-dependent hydrolases, subgroup B is part of the superfamily of metallo-dependent hydrolases, a large group of proteins that show conservation in their 3-dimensional fold (TIM barrel) and in details of their active site. The vast majority of the...; Region: Met_dep_hydrolase_B; cd01307
568708020370	active site
568708020372	uncharacterized pyridoxal phosphate-dependent enzyme; Region: selA_rel; TIGR01437
568708020373	Threonine aldolase [Amino acid transport and metabolism]; Region: GLY1; COG2008
568708020375	conserved hypothetical protein EF_0839/AHA_3917; Region: EF_0839; TIGR03581
568708020377	Transcriptional antiterminator [Transcription]; Region: BglG; COG3711
568708020378	HTH domain; Region: HTH_11; pfam08279
568708020379	Mga helix-turn-helix domain; Region: Mga; pfam05043
568708020380	PRD domain; Region: PRD; pfam00874
568708020381	PRD domain; Region: PRD; pfam00874
568708020382	PTS_IIB_bgl_like: the PTS (phosphotransferase system) IIB domain of a family of sensory systems composed of a membrane-bound sugar-sensor (similar to BglF) and a transcription antiterminator (similar to BglG) which regulate expression of genes involved...; Region: PTS_IIB_bgl_like; cd05568
568708020383	active site
568708020384	P-loop; other site
568708020385	phosphorylation site [posttranslational modification]
568708020386	PTS_IIA, PTS system, fructose/mannitol specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This...; Region: PTS_IIA_fru; cd00211
568708020387	active site
568708020388	phosphorylation site [posttranslational modification]
568708020393	bifunctional antitoxin/transcriptional repressor RelB; Provisional; Region: PRK11235
568708020395	Cytotoxic translational repressor of toxin-antitoxin stability system [Translation, ribosomal structure and biogenesis / Cell division and chromosome partitioning]; Region: RelE; COG2026
568708020397	anaerobic ribonucleoside-triphosphate reductase activating protein; Region: NrdG; TIGR02491
568708020398	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
568708020399	FeS/SAM binding site; other site
568708020400	anaerobic ribonucleoside triphosphate reductase; Provisional; Region: PRK09263
568708020401	ATP cone domain; Region: ATP-cone; pfam03477
568708020402	Class III ribonucleotide reductase; Region: RNR_III; cd01675
568708020403	effector binding site; other site
568708020404	active site
568708020405	Zn binding site [ion binding]; other site
568708020406	glycine loop; other site
568708020409	trehalose-6-phosphate hydrolase; Provisional; Region: PRK10933
568708020410	Alpha amylase catalytic domain found in Sucrose isomerases, oligo-1,6-glucosidase (also called isomaltase; sucrase-isomaltase; alpha-limit dextrinase), dextran glucosidase (also called glucan 1,6-alpha-glucosidase), and related proteins; Region: AmyAc_SI_OligoGlu_DGase; cd11333
568708020411	Ca binding site [ion binding]; other site
568708020412	active site
568708020413	catalytic site [active]
568708020414	Domain of unknown function (DUF3459); Region: DUF3459; pfam11941
568708020416	pfam_scan;Pfam:PF00367; E()=5.9E-11;score=41.1;query11-41;description=PTS_EIIB; pfam_scan;Pfam:PF02378; E()=2.4E-34;score=118.5;query 112-404;description=PTS_EIIC; tmhmm; query 1-473
568708020419	trehalose repressor; Provisional; Region: treR; PRK09492
568708020420	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
568708020421	DNA binding site [nucleotide binding]
568708020422	domain linker motif; other site
568708020423	Ligand-binding domain of DNA transcription repressor specific for trehalose (TreR) which is a member of the LacI-GalR family of bacterial transcription regulators; Region: PBP1_TreR_like; cd01542
568708020424	dimerization interface [polypeptide binding]; other site
568708020425	ligand binding site [chemical binding]; other site
568708020428	magnesium-transporting ATPase MgtA; Provisional; Region: PRK10517
568708020429	Cation transporter/ATPase, N-terminus; Region: Cation_ATPase_N; pfam00690
568708020430	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
568708020431	Putative hydrolase of sodium-potassium ATPase alpha subunit; Region: Hydrolase_like2; pfam13246
568708020432	haloacid dehalogenase-like hydrolase; Region: HAD; pfam12710
568708020433	Soluble P-type ATPase [General function prediction only]; Region: COG4087
568708020434	Cation transporting ATPase, C-terminus; Region: Cation_ATPase_C; pfam00689
568708020436	8 probable transmembrane helices predicted for STM_MW44011 by TMHMM2.0 at aa 122-141, 295-314, 324-346, 714-736, 773-795, 808-827, 842-864 and 869-891
568708020440	Transposase; Region: HTH_Tnp_1; cl17663
568708020442	2 probable transmembrane helices predicted for STM_MW44021 by TMHMM2.0 at aa 59-78 and 82-101
568708020443	YjgF, YER057c, and UK114 belong to a large family of proteins present in bacteria, archaea, and eukaryotes with no definitive function. The conserved domain is similar in structure to chorismate mutase but there is no sequence similarity and no...; Region: YjgF_YER057c_UK114_family; cd00448
568708020444	homotrimer interaction site [polypeptide binding]; other site
568708020445	putative active site [active]
568708020447	aspartate carbamoyltransferase regulatory subunit; Reviewed; Region: PRK00893
568708020448	Aspartate carbamoyltransferase regulatory chain, allosteric domain; Region: PyrI; pfam01948
568708020449	Aspartate carbamoyltransferase regulatory chain, metal binding domain; Region: PyrI_C; pfam02748
568708020452	Aspartate carbamoyltransferase, catalytic chain [Nucleotide transport and metabolism]; Region: PyrB; COG0540
568708020453	Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding domain; Region: OTCace_N; pfam02729
568708020454	Aspartate/ornithine carbamoyltransferase, Asp/Orn binding domain; Region: OTCace; pfam00185
568708020457	pyrBI operon leader peptide; Provisional; Region: PRK10224
568708020459	Arginine repressor [Transcription]; Region: ArgR; COG1438
568708020460	Arginine repressor, DNA binding domain; Region: Arg_repressor; pfam01316
568708020461	Arginine repressor, C-terminal domain; Region: Arg_repressor_C; pfam02863
568708020464	Predicted membrane protein [Function unknown]; Region: COG1288
568708020465	C4-dicarboxylate anaerobic carrier; Region: DcuC; pfam03606
568708020466	11 probable transmembrane helices predicted for STM_MW44091 by TMHMM2.0 at aa 7-29, 76-98, 121-140, 162-184, 205-222, 263-285, 290-307, 322-339, 371-393, 413-435 and 442-464
568708020468	Signal peptide predicted for STM_MW44091 by SignalP 2.0 HMM (Signal peptide probability 0.708) with cleavage site probability 0.265 between residues 24 and 25
568708020469	ornithine carbamoyltransferase; Validated; Region: PRK02102
568708020470	Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding domain; Region: OTCace_N; pfam02729
568708020471	Aspartate/ornithine carbamoyltransferase, Asp/Orn binding domain; Region: OTCace; pfam00185
568708020474	carbamate kinase-like carbamoyl phosphate synthetase; Reviewed; Region: PRK12454
568708020475	AAK_CK: Carbamate kinase (CK) catalyzes both the ATP-phosphorylation of carbamate and carbamoyl phosphate (CP) utilization with the production of ATP from ADP and CP. Both CK (this CD) and nonhomologous CP synthetase synthesize carbamoyl phosphate, an...; Region: AAK_CK; cd04235
568708020476	putative substrate binding site [chemical binding]; other site
568708020477	nucleotide binding site [chemical binding]; other site
568708020478	nucleotide binding site [chemical binding]; other site
568708020479	homodimer interface [polypeptide binding]; other site
568708020481	arginine deiminase; Provisional; Region: PRK01388
568708020483	Beta-galactosidase, beta subunit [Carbohydrate transport and metabolism]; Region: EbgC; COG2731
568708020485	ornithine carbamoyltransferase subunit I; Provisional; Region: PRK03515
568708020486	Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding domain; Region: OTCace_N; pfam02729
568708020487	Aspartate/ornithine carbamoyltransferase, Asp/Orn binding domain; Region: OTCace; pfam00185
568708020490	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3076
568708020491	RNase E inhibitor protein; Provisional; Region: PRK11191
568708020493	MiaE tRNA-modifying nonheme diiron monooxygenase, ferritin-like diiron-binding domain; Region: MiaE; cd07910
568708020494	active site
568708020495	dinuclear metal binding site [ion binding]; other site
568708020496	dimerization interface [polypeptide binding]; other site
568708020498	Protein of unknown function (DUF3617); Region: DUF3617; pfam12276
568708020499	Signal peptide predicted for STM_MW44181 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.993 between residues 22 and 23
568708020500	Acetyltransferase (GNAT) domain; Region: Acetyltransf_10; pfam13673
568708020501	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
568708020502	Coenzyme A binding pocket [chemical binding]; other site
568708020504	Predicted membrane protein [Function unknown]; Region: COG4269
568708020506	8 probable transmembrane helices predicted for STM_MW44201 by TMHMM2.0 at aa 24-46, 67-89, 99-121, 142-164, 169-191, 229-251, 281-303 and 324-346
568708020507	valyl-tRNA synthetase; Reviewed; Region: valS; PRK05729
568708020508	catalytic core domain of valyl-tRNA synthetases; Region: ValRS_core; cd00817
568708020509	HIGH motif; other site
568708020510	Leucyl-tRNA synthetase, Domain 2; Region: tRNA-synt_1_2; pfam13603
568708020511	catalytic core domain of valyl-tRNA synthetases; Region: ValRS_core; cd00817
568708020512	active site
568708020513	KMSKS motif; other site
568708020514	Anticodon-binding domain of valyl tRNA synthetases; Region: Anticodon_Ia_Val; cd07962
568708020515	tRNA binding surface [nucleotide binding]; other site
568708020516	anticodon binding site; other site
568708020517	Valyl tRNA synthetase tRNA binding arm; Region: Val_tRNA-synt_C; pfam10458
568708020521	DNA polymerase III subunit chi; Validated; Region: PRK05728
568708020523	multifunctional aminopeptidase A; Provisional; Region: PRK00913
568708020524	Cytosol aminopeptidase family, N-terminal and catalytic domains.  Family M17 contains zinc- and manganese-dependent exopeptidases ( EC  3.4.11.1), including leucine aminopeptidase. They catalyze removal of amino acids from the N-terminus of a protein and...; Region: Peptidase_M17; cd00433
568708020525	interface (dimer of trimers) [polypeptide binding]; other site
568708020526	Substrate-binding/catalytic site; other site
568708020527	Zn-binding sites [ion binding]; other site
568708020530	lipopolysaccharide ABC transporter permease LptF; Provisional; Region: PRK15120
568708020531	Predicted permease YjgP/YjgQ family; Region: YjgP_YjgQ; pfam03739
568708020533	6 probable transmembrane helices predicted for STM_MW44251 by TMHMM2.0 at aa 17-39, 54-76, 97-119, 267-289, 296-313 and 328-348
568708020534	lipopolysaccharide ABC transporter permease; Provisional; Region: PRK15071
568708020535	Predicted permease YjgP/YjgQ family; Region: YjgP_YjgQ; pfam03739
568708020537	6 probable transmembrane helices predicted for STM_MW44261 by TMHMM2.0 at aa 10-32, 64-83, 103-125, 279-301, 305-322 and 329-351
568708020538	gluconate operon transcriptional regulator; Provisional; Region: PRK14987
568708020539	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
568708020540	DNA binding site [nucleotide binding]
568708020541	domain linker motif; other site
568708020542	Ligand-binding domain of DNA transcription repressor GntR specific for gluconate, a member of the LacI-GalR family of bacterial transcription regulators; Region: PBP1_GntR; cd01575
568708020543	putative dimerization interface [polypeptide binding]; other site
568708020544	putative ligand binding site [chemical binding]; other site
568708020547	gluconate transporter; Region: gntP; TIGR00791
568708020548	fructuronate transporter; Provisional; Region: PRK10034; cl15264
568708020550	11 probable transmembrane helices predicted for STM_MW44281 by TMHMM2.0 at aa 20-42, 66-88, 92-114, 138-160, 186-208, 221-243, 258-279, 291-313, 317-339, 346-368 and 383-405
568708020551	gluconate 5-dehydrogenase; Provisional; Region: PRK08085
568708020552	gluconate 5-dehydrogenase (Ga5DH)-like, classical (c) SDRs; Region: Ga5DH-like_SDR_c; cd05347
568708020553	NADP binding site [chemical binding]; other site
568708020554	homodimer interface [polypeptide binding]; other site
568708020555	active site
568708020557	L-idonate 5-dehydrogenase; Provisional; Region: PRK09880
568708020558	L-idonate 5-dehydrogenase; Region: idonate-5-DH; cd08232
568708020559	putative NAD(P) binding site [chemical binding]; other site
568708020560	catalytic Zn binding site [ion binding]; other site
568708020563	Gluconate kinase (GntK) catalyzes the phosphoryl transfer from ATP to gluconate. The resulting product gluconate-6-phoshate is an important precursor of gluconate metabolism. GntK acts as a dimmer composed of two identical subunits; Region: GntK; cd02021
568708020564	ATP-binding site [chemical binding]; other site
568708020565	Gluconate-6-phosphate binding site [chemical binding]; other site
568708020567	Zn-dependent alcohol dehydrogenases [General function prediction only]; Region: AdhP; COG1064
568708020568	Cinnamyl alcohol dehydrogenases (CAD); Region: CAD1; cd05283
568708020569	putative NAD(P) binding site [chemical binding]; other site
568708020570	putative substrate binding site [chemical binding]; other site
568708020571	catalytic Zn binding site [ion binding]; other site
568708020572	structural Zn binding site [ion binding]; other site
568708020573	dimer interface [polypeptide binding]; other site
568708020577	Part of AAA domain; Region: AAA_19; pfam13245
568708020578	Superfamily I DNA and RNA helicases and helicase subunits [DNA replication, recombination, and repair]; Region: COG1112
568708020579	AAA domain; Region: AAA_12; pfam13087
568708020580	Catalytic domain of phospholipase D superfamily proteins; Region: PLDc_SF; cl15239
568708020581	putative active site [active]
568708020582	catalytic site [active]
568708020583	Uncharacterized conserved protein [Function unknown]; Region: COG4127
568708020584	Restriction endonuclease; Region: Mrr_cat; pfam04471
568708020586	conserved hypothetical protein; Region: Lon_rel_chp; TIGR02653
568708020587	Putative ATP-dependent Lon protease; Region: Lon_2; pfam13337
568708020589	TIGR02687 family protein; Region: TIGR02687
568708020590	PglZ domain; Region: PglZ; pfam08665
568708020592	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
568708020593	AAA domain; Region: AAA_21; pfam13304
568708020594	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
568708020595	Walker A/P-loop; other site
568708020596	Walker A/P-loop; other site
568708020597	ATP binding site [chemical binding]; other site
568708020598	ATP binding site [chemical binding]; other site
568708020599	Q-loop/lid; other site
568708020601	Type II restriction enzyme, methylase subunits [Defense mechanisms]; Region: COG1002
568708020602	Methyltransferase domain; Region: Methyltransf_26; pfam13659
568708020604	TIGR02680 family protein; Region: TIGR02680
568708020606	Domain of unknown function (DUF1788); Region: DUF1788; pfam08747
568708020608	Putative inner membrane protein (DUF1819); Region: DUF1819; pfam08849
568708020611	hypothetical protein; Provisional; Region: PRK12378
568708020613	Methyltransferase domain; Region: Methyltransf_23; pfam13489
568708020614	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708020615	S-adenosylmethionine binding site [chemical binding]; other site
568708020616	Methyltransferase domain; Region: Methyltransf_31; pfam13847
568708020617	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708020618	S-adenosylmethionine binding site [chemical binding]; other site
568708020620	hypothetical protein; Provisional; Region: PRK13687
568708020622	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4332
568708020624	Uncharacterized conserved protein [Function unknown]; Region: COG3439
568708020625	Signal peptide predicted for STM_MW44511 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.978 between residues 24 and 25
568708020627	Dienelactone hydrolase family; Region: DLH; pfam01738
568708020629	DNA-binding transcriptional repressor UxuR; Provisional; Region: PRK10225
568708020630	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
568708020631	DNA-binding site [nucleotide binding]; DNA binding site
568708020632	This entry represents the C-terminal ligand binding domain of many members of the GntR family; Region: FCD; smart00895
568708020635	tryptophanyl-tRNA synthetase II; Reviewed; Region: PRK12282
568708020636	catalytic core domain of tryptophanyl-tRNA synthetase; Region: TrpRS_core; cd00806
568708020637	active site
568708020638	HIGH motif; other site
568708020639	dimer interface [polypeptide binding]; other site
568708020640	KMSKS motif; other site
568708020642	Type VI protein secretion system component Hcp (secreted cytotoxin) [Intracellular trafficking, secretion,    and vesicular transport]; Region: Hcp; COG3157
568708020644	Aspartate racemase [Cell envelope biogenesis, outer membrane]; Region: RacX; COG1794
568708020645	aspartate racemase; Region: asp_race; TIGR00035
568708020646	Signal peptide predicted for STM_MW44561 by SignalP 2.0 HMM (Signal peptide probability 0.753) with cleavage site probability 0.564 between residues 17 and 18
568708020648	cell density-dependent motility repressor; Provisional; Region: PRK10082
568708020649	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
568708020650	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
568708020651	dimerization interface [polypeptide binding]; other site
568708020654	isoaspartyl dipeptidase; Provisional; Region: PRK10657
568708020655	Superfamily of metallo-dependent hydrolases (also called amidohydrolase superfamily) is a large group of proteins that show conservation in their 3-dimensional fold (TIM barrel) and in details of their active site. The vast majority of the members have a...; Region: metallo-dependent_hydrolases; cl00281
568708020656	active site
568708020658	hypothetical protein; Provisional; Region: PRK10519
568708020659	3 probable transmembrane helices predicted for STM_MW44591 by TMHMM2.0 at aa 20-42, 68-90 and 130-152
568708020661	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3314
568708020662	Nucleoside recognition; Region: Gate; pfam07670
568708020663	5 probable transmembrane helices predicted for STM_MW44601 by TMHMM2.0 at aa 37-59, 92-114, 146-165, 180-202 and 246-268
568708020665	tmhmm; query 1-125
568708020666	Protein of unknown function (DUF1228); Region: DUF1228; pfam06779
568708020667	12 probable transmembrane helices predicted for STM_MW44621 by TMHMM2.0 at aa 13-35, 55-77, 84-103, 108-130, 137-159, 169-191, 212-234, 244-266, 271-293, 298-320, 333-355 and 360-382
568708020669	Predicted membrane protein [Function unknown]; Region: COG2733
568708020670	3 probable transmembrane helices predicted for STM_MW44631 by TMHMM2.0 at aa 13-32, 42-62 and 398-420
568708020672	Signal peptide predicted for STM_MW44631 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.294 between residues 42 and 43
568708020673	multidrug efflux system protein MdtM; Provisional; Region: PRK15403
568708020674	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
568708020675	putative substrate translocation pore; other site
568708020676	12 probable transmembrane helices predicted for STM_MW44641 by TMHMM2.0 at aa 13-35, 50-72, 84-103, 107-129, 141-163, 167-189, 219-241, 256-278, 290-312, 316-338, 350-372 and 376-398
568708020678	Putative transposase, YhgA-like; Region: Transposase_31; pfam04754
568708020680	NAD-dependent aldehyde dehydrogenases [Energy production and conversion]; Region: PutA; COG1012
568708020681	Mycobacterium tuberculosis succinate-semialdehyde dehydrogenase 1-like; Region: ALDH_SSADH1_GabD1; cd07100
568708020682	NAD(P) binding site [chemical binding]; other site
568708020683	catalytic residues [active]
568708020685	5 probable transmembrane helices predicted for STM_MW44681 by TMHMM2.0 at aa 17-39, 54-76, 103-125, 140-162 and 169-191
568708020686	endoribonuclease SymE; Provisional; Region: PRK13605
568708020688	EcoKI restriction-modification system protein HsdS; Provisional; Region: PRK09737
568708020689	Type I restriction modification DNA specificity domain; Region: Methylase_S; pfam01420
568708020690	Type I restriction modification DNA specificity domain; Region: Methylase_S; pfam01420
568708020692	HsdM N-terminal domain; Region: HsdM_N; pfam12161
568708020693	N-6 DNA Methylase; Region: N6_Mtase; pfam02384
568708020694	Methyltransferase domain; Region: Methyltransf_26; pfam13659
568708020696	type I restriction enzyme EcoKI subunit R; Provisional; Region: hsdR; PRK11448
568708020697	Domain of unknown function (DUF4145); Region: DUF4145; pfam13643
568708020698	Type I restriction enzyme R protein N terminus (HSDR_N); Region: HSDR_N; pfam04313
568708020699	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
568708020700	ATP binding site [chemical binding]; other site
568708020701	putative Mg++ binding site [ion binding]; other site
568708020705	Restriction endonuclease [Defense mechanisms]; Region: Mrr; COG1715
568708020706	Mrr N-terminal domain; Region: Mrr_N; pfam14338
568708020707	Calponin homology domain; actin-binding domain which may be present as a single copy or in tandem repeats (which increases binding affinity). The CH domain is found in cytoskeletal and signal transduction proteins, including actin-binding proteins like...; Region: CH; cl00030
568708020708	Restriction endonuclease; Region: Mrr_cat; pfam04471
568708020710	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2929
568708020712	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3514
568708020713	putative GTP-binding protein YjiA; Provisional; Region: PRK11537
568708020714	The function of this protein family is unkown. The amino acid sequence of YjiA protein in E. coli contains several conserved motifs that characterizes it as a P-loop GTPase. YijA gene is among the genes significantly induced in response to DNA-damage...; Region: CobW_like; cd03112
568708020715	P-loop, Walker A motif; other site
568708020716	Base recognition motif; other site
568708020717	Cobalamin synthesis protein cobW C-terminal domain; Region: CobW_C; pfam07683
568708020720	Uncharacterized small protein [Function unknown]; Region: COG2879
568708020722	carbon starvation protein A; Provisional; Region: PRK15015
568708020723	Carbon starvation protein CstA; Region: CstA; pfam02554
568708020724	C-terminal domain on CstA (DUF4161); Region: DUF4161; pfam13722
568708020725	16 probable transmembrane helices predicted for STM_MW44781 by TMHMM2.0 at aa 12-29, 34-56, 89-111, 121-140, 161-183, 193-215, 220-242, 257-279, 286-305, 325-347, 364-386, 486-505, 532-551, 566-588, 595-617 and 662-684
568708020727	Signal peptide predicted for STM_MW44781 by SignalP 2.0 HMM (Signal peptide probability 0.638) with cleavage site probability 0.612 between residues 27 and 28
568708020728	methyl-accepting chemotaxis protein I; Provisional; Region: PRK15041
568708020729	ligand binding domain of Tar- and Tsr-related chemoreceptors; Region: Tar_Tsr_LBD; cd00181
568708020730	dimer interface [polypeptide binding]; other site
568708020731	ligand binding site [chemical binding]; other site
568708020732	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
568708020733	dimerization interface [polypeptide binding]; other site
568708020734	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
568708020735	dimer interface [polypeptide binding]; other site
568708020736	putative CheW interface [polypeptide binding]; other site
568708020737	Signal peptide predicted for STM_MW44791 by SignalP 2.0 HMM (Signal peptide probability 0.995) with cleavage site probability 0.327 between residues 25 and 26
568708020738	2 probable transmembrane helices predicted for STM_MW44791 by TMHMM2.0 at aa 7-29 and 192-214
568708020742	Transcriptional regulators containing an AAA-type ATPase domain and a DNA-binding domain [Transcription / Signal transduction mechanisms]; Region: PspF; COG1221
568708020743	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708020744	Walker A motif; other site
568708020745	ATP binding site [chemical binding]; other site
568708020746	Walker B motif; other site
568708020747	arginine finger; other site
568708020748	Transcriptional antiterminator [Transcription]; Region: COG3933
568708020749	PTS_IIA, PTS system, mannose/sorbose specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIA_man; cd00006
568708020750	active pocket/dimerization site; other site
568708020751	active site
568708020752	phosphorylation site [posttranslational modification]
568708020753	PRD domain; Region: PRD; pfam00874
568708020757	PTS_IIA, PTS system, mannose/sorbose specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIA_man; cd00006
568708020758	active pocket/dimerization site; other site
568708020759	active site
568708020760	phosphorylation site [posttranslational modification]
568708020762	PTS_IIB, PTS system, Mannose/sorbose specific IIB subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIB_man; cd00001
568708020763	active site
568708020764	phosphorylation site [posttranslational modification]
568708020766	Phosphotransferase system, mannose/fructose/N-acetylgalactosamine-specific component IIC [Carbohydrate transport and metabolism]; Region: ManY; COG3715
568708020767	Signal peptide predicted for STM_MW44831 by SignalP 2.0 HMM (Signal peptide probability 0.641) with cleavage site probability 0.472 between residues 19 and 20
568708020769	7 probable transmembrane helices predicted for STM_MW44831 by TMHMM2.0 at aa 7-29, 44-63, 70-92, 96-118, 138-160, 180-199 and 206-235
568708020770	Phosphotransferase system, mannose/fructose/N-acetylgalactosamine-specific component IID [Carbohydrate transport and metabolism]; Region: ManZ; COG3716
568708020772	6 probable transmembrane helices predicted for STM_MW44841 by TMHMM2.0 at aa 69-91, 111-133, 146-168, 197-219, 231-253 and 258-277
568708020773	Predicted phosphosugar isomerases [Cell envelope biogenesis, outer membrane]; Region: AgaS; COG2222
568708020774	SIS (Sugar ISomerase) domain repeat 1 found in Glucosamine 6-phosphate synthase (GlmS) and Glucosamine-6-phosphate deaminase (GlmD). The SIS domain is found in many phosphosugar isomerases and phosphosugar binding proteins. GlmS contains a N-terminal...; Region: SIS_GlmS_GlmD_1; cd05008
568708020775	dimer interface [polypeptide binding]; other site
568708020776	active site
568708020777	SIS (Sugar ISomerase) domain repeat 2 found in Glucosamine 6-phosphate synthase (GlmS) and Glucosamine-6-phosphate deaminase (GlmD). The SIS domain is found in many phosphosugar isomerases and phosphosugar binding proteins. GlmS contains a N-terminal...; Region: SIS_GlmS_GlmD_2; cd05009
568708020778	dimer interface [polypeptide binding]; other site
568708020779	active site
568708020781	Predicted phosphosugar isomerases [Cell envelope biogenesis, outer membrane]; Region: AgaS; COG2222
568708020782	A subgroup of the SIS domain. SIS (Sugar ISomerase) domains are found in many phosphosugar isomerases and phosphosugar binding proteins. SIS domains are also found in proteins that regulate the expression of genes involved in synthesis of phosphosugars; Region: SIS_1; cd05710
568708020783	putative active site [active]
568708020784	SIS domain. SIS (Sugar ISomerase) domains are found in many phosphosugar isomerases and phosphosugar binding proteins. SIS domains are also found in proteins that regulate the expression of genes involved in synthesis of phosphosugars; Region: SIS; cl00389
568708020786	phosphoglycerol transferase I; Provisional; Region: PRK03776
568708020787	Phosphoglycerol transferase and related proteins, alkaline phosphatase superfamily [Cell envelope biogenesis, outer membrane]; Region: MdoB; COG1368
568708020789	2 probable transmembrane helices predicted for STM_MW44871 by TMHMM2.0 at aa 43-65 and 77-99
568708020790	hypothetical protein; Provisional; Region: PRK11667
568708020792	1 probable transmembrane helix predicted for STM_MW44881 by TMHMM2.0 at aa 7-29
568708020793	Signal peptide predicted for STM_MW44881 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.427 between residues 24 and 25
568708020794	DNA replication protein DnaC; Validated; Region: PRK07952
568708020795	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
568708020796	Walker A motif; other site
568708020797	ATP binding site [chemical binding]; other site
568708020798	Walker B motif; other site
568708020800	primosomal protein DnaI; Provisional; Region: PRK02854
568708020801	hypothetical protein; Provisional; Region: PRK09917
568708020802	4 probable transmembrane helices predicted for STM_MW44911 by TMHMM2.0 at aa 7-29, 53-75, 87-109 and 129-151
568708020804	Uncharacterized conserved protein [Function unknown]; Region: COG2966
568708020805	Protein of unknown function (DUF1212); Region: DUF1212; pfam06738
568708020806	4 probable transmembrane helices predicted for STM_MW44921 by TMHMM2.0 at aa 184-201, 214-236, 241-263 and 276-298
568708020808	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
568708020809	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
568708020810	DNA binding residues [nucleotide binding]
568708020811	dimerization interface [polypeptide binding]; other site
568708020813	DNA-binding transcriptional activator BglJ; Provisional; Region: PRK11475
568708020814	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
568708020815	DNA binding residues [nucleotide binding]
568708020817	This CD, composed mainly of bacterial single-domain proteins, includes the Thermus thermophilus (Tt) YbaK-like protein, a homolog of the trans-acting Escherichia coli YbaK Cys-tRNA(Pro) deacylase and the Agrobacterium tumefaciens  ProX Ala-tRNA(Pro)...; Region: ProX_deacylase; cd04333
568708020818	putative deacylase active site [active]
568708020820	ferric iron reductase involved in ferric hydroximate transport; Provisional; Region: PRK10647
568708020821	Ferric iron reductase FhuF-like transporter; Region: FhuF; pfam06276
568708020822	FhuF 2Fe-2S C-terminal domain; Region: FhuF_C; pfam11575
568708020825	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
568708020826	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
568708020827	metal binding site [ion binding]; metal-binding site
568708020828	active site
568708020829	I-site; other site
568708020831	5 probable transmembrane helices predicted for STM_MW44971 by TMHMM2.0 at aa 21-40, 45-62, 69-86, 101-123 and 144-163
568708020832	Signal peptide predicted for STM_MW44971 by SignalP 2.0 HMM (Signal peptide probability 0.713) with cleavage site probability 0.283 between residues 34 and 35
568708020833	Protein of unknown function (DUF1435); Region: DUF1435; pfam07256
568708020835	3 probable transmembrane helices predicted for STM_MW44981 by TMHMM2.0 at aa 5-27, 31-48 and 55-72
568708020836	16S ribosomal RNA m2G1207 methyltransferase; Provisional; Region: rsmC; PRK09489
568708020837	Methyltransferase small domain N-terminal; Region: MTS_N; pfam08468
568708020838	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
568708020839	S-adenosylmethionine binding site [chemical binding]; other site
568708020842	DNA polymerase III subunit psi; Validated; Region: PRK06856
568708020844	ribosomal-protein-alanine N-acetyltransferase; Provisional; Region: rimI; PRK09491
568708020845	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
568708020846	Coenzyme A binding pocket [chemical binding]; other site
568708020848	dUMP phosphatase; Provisional; Region: PRK09449
568708020849	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708020850	motif II; other site
568708020852	peptide chain release factor 3; Provisional; Region: prfC; PRK00741
568708020853	Release Factor 3 (RF3) protein involved in the terminal step of translocation in bacteria; Region: RF3; cd04169
568708020854	G1 box; other site
568708020855	putative GEF interaction site [polypeptide binding]; other site
568708020856	GTP/Mg2+ binding site [chemical binding]; other site
568708020857	Switch I region; other site
568708020858	G2 box; other site
568708020859	G3 box; other site
568708020860	Switch II region; other site
568708020861	G4 box; other site
568708020862	G5 box; other site
568708020863	RF3_II: this subfamily represents the domain II of bacterial Release Factor 3 (RF3). Termination of protein synthesis by the ribosome requires two release factor (RF) classes. The class II RF3 is a GTPase that removes class I RFs (RF1 or RF2) from the...; Region: RF3_II; cd03689
568708020866	periplasmic protein; Provisional; Region: PRK10568
568708020867	BON domain; Region: BON; pfam04972
568708020868	Signal peptide predicted for STM_MW45041 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 28 and 29
568708020870	Predicted esterase of the alpha-beta hydrolase superfamily [General function prediction only]; Region: COG4667
568708020871	Hypothetical patatin similar to yjju protein of Escherichia coli; Region: Pat_hypo_Ecoli_yjju_like; cd07208
568708020872	active site
568708020873	nucleophile elbow; other site
568708020875	pfam_scan;Pfam:PF01026; E()=4.9E-75;score=251.6;query 6-255;description=TatD_DNase
568708020877	glycine radical enzyme activase, YjjW family; Region: activase_YjjW; TIGR04041
568708020878	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
568708020879	FeS/SAM binding site; other site
568708020882	hypothetical protein; Provisional; Region: PRK10977
568708020883	Ribonucleotide reductase and Pyruvate formate lyase; Region: RNR_PFL; cl09939
568708020885	2-deoxyribose-5-phosphate aldolase (DERA) of the DeoC family; Region: DeoC; cd00959
568708020886	intersubunit interface [polypeptide binding]; other site
568708020887	active site
568708020888	catalytic residue [active]
568708020890	thymidine phosphorylase; Reviewed; Region: deoA; PRK05820
568708020891	Glycosyl transferase family, helical bundle domain; Region: Glycos_trans_3N; pfam02885
568708020892	Glycosyl transferase family, a/b domain; Region: Glycos_transf_3; pfam00591
568708020893	Pyrimidine nucleoside phosphorylase C-terminal domain; Region: PYNP_C; pfam07831
568708020897	phosphopentomutase; Provisional; Region: PRK05362
568708020898	Metalloenzyme superfamily; Region: Metalloenzyme; pfam01676
568708020901	purine nucleoside phosphorylase; Reviewed; Region: deoD; PRK05819
568708020902	Uridine phosphorylase [Nucleotide transport and metabolism]; Region: Udp; COG2820
568708020904	hypothetical protein; Provisional; Region: PRK15301
568708020905	Signal peptide predicted for STM_MW45131 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 26 and 27
568708020906	putative fimbrial outer membrane usher protein; Provisional; Region: PRK15304
568708020907	PapC N-terminal domain; Region: PapC_N; pfam13954
568708020908	Type VII secretion system (T7SS), usher protein; Region: Usher; pfam00577
568708020909	PapC C-terminal domain; Region: PapC_C; pfam13953
568708020911	Signal peptide predicted for STM_MW45141 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 27 and 28
568708020912	putative fimbrial chaperone protein; Provisional; Region: PRK09918
568708020913	Gram-negative pili assembly chaperone, N-terminal domain; Region: Pili_assembly_N; pfam00345
568708020914	Gram-negative pili assembly chaperone, C-terminal domain; Region: Pili_assembly_C; pfam02753
568708020917	Signal peptide predicted for STM_MW45161 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.820 between residues 27 and 28
568708020918	hypothetical protein; Provisional; Region: PRK15302
568708020920	Signal peptide predicted for STM_MW45171 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.969 between residues 21 and 22
568708020921	hypothetical protein; Provisional; Region: PRK15303
568708020923	Signal peptide predicted for STM_MW45181 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 20 and 21
568708020924	lipoate-protein ligase A; Provisional; Region: lplA; PRK03822
568708020925	Lipoate-protein ligase A [Coenzyme metabolism]; Region: LplA; COG0095
568708020926	Bacterial lipoate protein ligase C-terminus; Region: Lip_prot_lig_C; pfam10437
568708020929	hypothetical protein; Provisional; Region: PRK11246
568708020931	2 probable transmembrane helices predicted for STM_MW45201 by TMHMM2.0 at aa 13-32 and 162-184
568708020932	Signal peptide predicted for STM_MW45201 by SignalP 2.0 HMM (Signal peptide probability 0.996) with cleavage site probability 0.852 between residues 30 and 31
568708020933	phosphoserine phosphatase; Provisional; Region: serB; PRK11133
568708020934	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
568708020935	motif II; other site
568708020937	DNA repair protein RadA; Region: sms; TIGR00416
568708020938	Sms (bacterial radA) DNA repair protein. This protein is not related to archael radA any more than is to other RecA-like NTPases. Sms has a role in recombination and recombinational repair and is responsible for the stabilization or processing of...; Region: Sms; cd01121
568708020939	Walker A motif/ATP binding site; other site
568708020940	ATP binding site [chemical binding]; other site
568708020941	Walker B motif; other site
568708020942	Subunit ChlI of Mg-chelatase; Region: ChlI; pfam13541
568708020945	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
568708020946	non-specific DNA binding site [nucleotide binding]; other site
568708020947	salt bridge; other site
568708020948	bifunctional DNA-binding transcriptional repressor/ NMN adenylyltransferase; Provisional; Region: PRK08099
568708020949	sequence-specific DNA binding site [nucleotide binding]; other site
568708020950	Nicotinamide/nicotinate mononucleotide adenylyltransferase of bifunctional NadR-like proteins; Region: NMNAT_NadR; cd02167
568708020951	active site
568708020952	(T/H)XGH motif; other site
568708020953	Predicted ATPase/kinase involved in NAD metabolism [Coenzyme metabolism]; Region: NadR; COG3172
568708020955	putative ABC transporter ATP-binding protein; Reviewed; Region: PRK11819
568708020956	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
568708020957	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
568708020958	ABC transporter; Region: ABC_tran_2; pfam12848
568708020959	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
568708020961	lytic murein transglycosylase; Provisional; Region: PRK11619
568708020962	Lytic Transglycosylase (LT)  and Goose Egg White Lysozyme (GEWL) domain. Members include the soluble and insoluble membrane-bound LTs in bacteria, the LTs in bacteriophage lambda, as well as, the eukaryotic "goose-type" lysozymes (GEWL).  LTs...; Region: LT_GEWL; cd00254
568708020963	N-acetyl-D-glucosamine binding site [chemical binding]; other site
568708020964	catalytic residue [active]
568708020965	Signal peptide predicted for STM_MW45251 by SignalP 2.0 HMM (Signal peptide probability 0.726) with cleavage site probability 0.725 between residues 39 and 40
568708020967	Trp operon repressor; Provisional; Region: PRK01381
568708020969	inosine/xanthosine triphosphatase; Reviewed; Region: PRK05074
568708020971	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
568708020972	catalytic core [active]
568708020974	1 probable transmembrane helix predicted for STM_MW45281 by TMHMM2.0 at aa 146-168
568708020975	right oriC-binding transcriptional activator; Provisional; Region: PRK15121
568708020976	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
568708020977	GyrI-like small molecule binding domain; Region: GyrI-like; pfam06445
568708020980	hypothetical protein; Provisional; Region: PRK10756
568708020981	CreA protein; Region: CreA; pfam05981
568708020982	Signal peptide predicted for STM_MW45301 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 21 and 22
568708020984	DNA-binding response regulator CreB; Provisional; Region: PRK11083
568708020985	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708020986	active site
568708020987	phosphorylation site [posttranslational modification]
568708020988	intermolecular recognition site; other site
568708020989	dimerization interface [polypeptide binding]; other site
568708020990	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
568708020991	DNA binding site [nucleotide binding]
568708020994	sensory histidine kinase CreC; Provisional; Region: PRK11100
568708020995	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cl01054
568708020996	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
568708020997	dimer interface [polypeptide binding]; other site
568708020998	phosphorylation site [posttranslational modification]
568708020999	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
568708021000	ATP binding site [chemical binding]; other site
568708021001	Mg2+ binding site [ion binding]; other site
568708021002	G-X-G motif; other site
568708021003	Signal peptide predicted for STM_MW45321 by SignalP 2.0 HMM (Signal peptide probability 0.859) with cleavage site probability 0.597 between residues 27 and 28
568708021004	2 probable transmembrane helices predicted for STM_MW45321 by TMHMM2.0 at aa 5-27 and 184-206
568708021007	Inner membrane protein involved in colicin E2 resistance [Defense mechanisms]; Region: CreD; COG4452
568708021009	6 probable transmembrane helices predicted for STM_MW45331 by TMHMM2.0 at aa 10-32, 298-317, 321-343, 350-372, 377-396 and 403-420
568708021010	putative major fimbrial protein SthE; Provisional; Region: PRK15292
568708021011	P pilus assembly protein, pilin FimA [Cell motility and secretion / Intracellular trafficking and secretion]; Region: FimA; COG3539
568708021013	Signal peptide predicted for STM_MW45341 by SignalP 2.0 HMM (Signal peptide probability 0.952) with cleavage site probability 0.902 between residues 20 and 21
568708021014	putative fimbrial protein SthD; Provisional; Region: PRK15293
568708021016	1 probable transmembrane helix predicted for STM_MW45351 by TMHMM2.0 at aa 7-29
568708021017	Signal peptide predicted for STM_MW45351 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.614 between residues 27 and 28
568708021018	putative fimbrial outer membrane usher protein SthC; Provisional; Region: PRK15294
568708021019	PapC N-terminal domain; Region: PapC_N; pfam13954
568708021020	Type VII secretion system (T7SS), usher protein; Region: Usher; pfam00577
568708021021	PapC C-terminal domain; Region: PapC_C; pfam13953
568708021023	Signal peptide predicted for STM_MW45361 by SignalP 2.0 HMM (Signal peptide probability 0.848) with cleavage site probability 0.847 between residues 28 and 29
568708021024	fimbrial assembly chaperone SthB; Provisional; Region: PRK15295
568708021025	Gram-negative pili assembly chaperone, N-terminal domain; Region: Pili_assembly_N; pfam00345
568708021026	Gram-negative pili assembly chaperone, C-terminal domain; Region: Pili_assembly_C; pfam02753
568708021029	Signal peptide predicted for STM_MW45371 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 20 and 21
568708021030	putative fimbrial protein SthA; Provisional; Region: PRK15296
568708021032	Signal peptide predicted for STM_MW45381 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 22 and 23
568708021033	putative DNA-binding transcriptional regulator; Provisional; Region: PRK11832
568708021034	Helix-turn-helix domain; Region: HTH_36; pfam13730
568708021035	tmhmm; query 1-166
568708021036	two-component response regulator; Provisional; Region: PRK11173
568708021037	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
568708021038	active site
568708021039	phosphorylation site [posttranslational modification]
568708021040	intermolecular recognition site; other site
568708021041	dimerization interface [polypeptide binding]; other site
568708021042	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
568708021043	DNA binding site [nucleotide binding]
568708021046	rRNA methylase [Translation, ribosomal structure and biogenesis]; Region: LasT; COG0565
568708021047	putative RNA methyltransferase; Provisional; Region: PRK10433