-- dump date   	20140620_081937
-- class       	Genbank::CDS
-- table       	cds_note
-- id	note
YP_002122401.1	binds to the dnaA-box as an ATP-bound complex at the origin of replication during the initiation of chromosomal replication; can also affect transcription of multiple genes including itself.
YP_002122402.1	binds the polymerase to DNA and acts as a sliding clamp
YP_002122403.1	similar to ref|ZP_00784446.1| conserved hypothetical protein [Streptococcus agalactiae COH1]
YP_002122404.1	similar to ref|YP_001199566.1| Predicted transcriptional regulator [Streptococcus suis 98HAH33]; Unknown, COG1396 Predicted transcriptional regulators.
YP_002122405.1	translation-associated GTPase; the crystal structure of the Haemophilus influenzae YchF protein showed similarity to the yeast structure (PDB: 1NI3); fluorescence spectroscopy revealed nucleic acid binding; the yeast protein YBR025c interacts with the translation elongation factor eEF1
YP_002122406.1	Enables the recycling of peptidyl-tRNAs produced at termination of translation
YP_002122407.1	similar to ref|NP_801268.1|  transcription-repair coupling factor [Streptococcus pyogenes SSI-1]; Necessary for strand-specific repair. A lesion in the template strand blocks the RNA polymerase complex (RNAP). The RNAP-DNA-RNA complex is specifically recognized by TRCF which releases RNAP and the truncated transcript; the TCRF may replace RNAP at the lesion site and then recruit the uvrA/B/C repair system.
YP_002122408.1	similar to ref|NP_814052.1| polysaccharide biosynthesis family protein [Enterococcus faecalis V583]; Unknown, COG2244 Membrane protein involved in the export of O-antigen and teichoic acid.
YP_002122409.1	similar to ref|ZP_00780251.1| S4 RNA-binding domain protein [Streptococcus agalactiae 18RS21]; Unknown, COG1188 Ribosome-associated heat shock protein implicated in the recycling of the 50S subunit (S4 paralog).
YP_002122410.1	similar to ref|YP_599604.1| Cell division protein DIVIC [Streptococcus pyogenes MGAS2096]
YP_002122411.1	similar to ref|ZP_00366568.1| COG2367: Beta-lactamase class A [Streptococcus pyogenes M49 591]
YP_002122412.1	similar to ref|YP_059329.1| tRNA(Ile)-lysidine synthetase [Streptococcus pyogenes MGAS10394]; Ligates lysine onto the cytidine present at position 34 of the AUA codon-specific tRNA(Ile) that contains the anticodon CAU, in an ATP-dependent manner. Cytidine is converted to lysidine, thus changing the amino acid specificity of the tRNA from methionine to isoleucine.
YP_002122413.1	similar to ref|NP_606347.1| hypoxanthine-guanine phosphoribosyltransferase [Streptococcus pyogenes MGAS8232]; This Enzyme Acts Exclusively On Hypoxanthine; It Does Not Act On Guanine (By Similarity).
YP_002122414.1	similar to ref|YP_279483.1| cell division protein [Streptococcus pyogenes MGAS6180]; Seems to act as an ATP-dependent zinc metallopeptidase.
YP_002122415.1	similar to ref|YP_059333.1| Amino acid permease [Streptococcus pyogenes MGAS10394]; Involved in the transport of the cationic amino acids (arginine, lysine and ornithine).
YP_002122416.1	similar to ref|NP_346626.1| rod shape-determining protein MreC [Streptococcus pneumoniae TIGR4]; Involved In Formation Of The Rod Shape Of The Cell. May Also Contribute To Regulation Of Formation Of Penicillin-Binding Proteins.
YP_002122417.1	similar to ref|NP_720504.1|  cell shape-determining protein MreD [Streptococcus mutans UA159]; MreD (murein formation D) protein is involved in the rod shape determination in Escherichia coli, and more generally in cell shape determination of bacteria whether or not they are rod-shaped.
YP_002122418.1	similar to ref|YP_597626.1| Secreted protein [Streptococcus pyogenes MGAS10270]; pfam05257, CHAP domain. This domain corresponds to an amidase function. Many of these proteins are involved in cell wall metabolism of bacteria. This domain is found at the N-terminus of the bifunctional Escherichia coli GSP synthetase/GSP amidase, where is functions as a glutathionylspermidine amidase.
YP_002122419.1	catalyzes the formation of 5-phospho-alpha-D-ribose 1-phosphate from D-ribose 5-phosphate and ATP
YP_002122420.1	involved in DNA repair and RecFOR pathway recombination; RecFOR proteins displace ssDNA-binding protein and facilitate the production of RecA-coated ssDNA
YP_002122421.1	involved in acylation of glycerol-3-phosphate to form 1-acyl-glycerol-3 phosphate for use in phospholipid biosynthesis; functions with PlsY
YP_002122422.1	carries the fatty acid chain in fatty acid biosynthesis
YP_002122423.1	catalyzes the formation of (S)-2-(5-amino-1-(5-phospho-D-ribosyl)imidazole-4- carboxamido)succinate from 5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxylate and L-aspartate in purine biosynthesis; SAICAR synthase
YP_002122424.1	similar to ref|YP_819618.1| Phosphoribosylformylglycinamidine (FGAM) synthase [Streptococcus thermophilus LMD-9]; Unknown, proposed to phosphorylate an amide oxygen of the purine nucleotide using ATP, activating the carbon of the resulting iminophosphate for nucleophilic attack.
YP_002122425.1	Catalyzes first step of the de novo purine nucleotide biosynthetic pathway
YP_002122426.1	catalyzes the formation of 1-(5-phosphoribosyl)-5-aminoimidazole from 2-(formamido)-N1-(5-phosphoribosyl)acetamidine and ATP in purine biosynthesis
YP_002122427.1	glycinamide ribonucleotide transformylase; GAR Tfase; catalyzes the synthesis of 5'-phosphoribosylformylglycinamide from 5'-phosphoribosylglycinamide and 10-formyltetrahydrofolate; PurN requires formyl folate for the reaction unlike PurT which uses formate
YP_002122428.1	involved in de novo purine biosynthesis
YP_002122429.1	similar to ref|YP_281392.1| autolysin [Streptococcus pyogenes MGAS5005]; Unknown, surface antigen; autolysin; choline binding protein.
YP_002122430.1	catalyzes the formation of N(1)-(5-phospho-D-ribosyl)glycinamide from 5-phospho-D-ribosylamine and glycine in purine biosynthesis
YP_002122431.1	similar to ref|YP_001127629.1| phosphoribosylaminoimidazole carboxylase catalytic subunit [Streptococcus pyogenes str. Manfredo]; This subunit can alone transform AIR to CAIR, but in association with purK, which possesses an ATPase activity, an enzyme complex is produced which is capable of converting AIR to CAIR efficiently under physiological condition.
YP_002122432.1	With PurE catalyzes the conversion of aminoimidazole ribonucleotide to carboxyaminoimidazole ribonucleotide in the de novo purine nucleotide biosynthetic pathway
YP_002122433.1	similar to ref|NP_734515.1| hypothetical protein gbs0045 [Streptococcus agalactiae NEM316]
YP_002122434.1	similar to ref|YP_059401.1| Transcriptional regulator [Streptococcus pyogenes MGAS10394]
YP_002122435.1	promotes strand exchange during homologous recombination; RuvAB complex promotes branch migration; RuvABC complex scans the DNA during branch migration and resolves Holliday junctions at consensus sequences; forms hexameric rings around opposite DNA arms; requires ATP for branch migration and orientation of RuvAB complex determines direction of migration
YP_002122437.1	similar to ref|NP_268454.1|  protein-tyrosine phosphatase [Streptococcus pyogenes M1 GAS]; Acts on tyrosine phosphorylated proteins, low-MW aryl phosphates and natural and synthetic acyl phosphates. Isoform 3 does not possess phosphatase activity.
YP_002122438.1	similar to ref|NP_606371.1| hypothetical protein spyM18_0041 [Streptococcus pyogenes MGAS8232]; Unknown, MORN repeat motif family protein.
YP_002122439.1	similar to ref|YP_281403.1| alcohol dehydrogenase/acetaldehyde dehydrogenase (acetylating) [Streptococcus pyogenes MGAS5005]; This enzyme has two NAD(+)-dependent activities:ADH and ACDH. May be a critical enzyme in the fermentative pathway.
YP_002122441.1	similar to ref|YP_598559.1| Zn-dependent alcohol dehydrogenase [Streptococcus pyogenes MGAS10270]
YP_002122442.1	similar to zinc-dependent eukaryotic ADH enzymes and distinct from fermentative ADHs
YP_002122443.1	similar to ref|YP_001034708.1| ABC-type multidrug/protein/lipid transport system (pediocin PA-1 exporter), ATPase and permease components,  [Streptococcus sanguinis SK36]
YP_002122444.1	similar to ref|NP_815050.1| HesA/MoeB/ThiF family protein [Enterococcus faecalis V583]
YP_002122445.1	similar to ref|YP_196698.1| Hypothetical zinc protease [Ehrlichia ruminantium str. Gardel]
YP_002122446.1	similar to ref|YP_140611.1| positive transcriptional regulator MutR family [Streptococcus thermophilus CNRZ1066]
YP_002122448.1	catalyzes the formation of L-threonine from O-phospho-L-homoserine
YP_002122449.1	similar to ref|YP_059409.1| Na+ driven multidrug efflux pump [Streptococcus pyogenes MGAS10394]; Multidrug efflux pump.
YP_002122450.1	similar to ref|YP_059409.1| Na+ driven multidrug efflux pump [Streptococcus pyogenes MGAS10394]; Multidrug efflux pump.
YP_002122451.1	NusE; involved in assembly of the 30S subunit; in the ribosome, this protein is involved in the binding of tRNA; in Escherichia coli this protein was also found to be involved in transcription antitermination; NusB/S10 heterodimers bind boxA sequences in the leader RNA of rrn operons which is required for antitermination; binding of NusB/S10 to boxA nucleates assembly of the antitermination complex
YP_002122452.1	binds directly near the 3' end of the 23S rRNA, where it nucleates assembly of the 50S subunit; essential for peptidyltransferase activity; mutations in this gene confer resistance to tiamulin
YP_002122453.1	L4 is important during the early stages of 50S assembly; it initially binds near the 5' end of the 23S rRNA
YP_002122454.1	similar to ref|NP_268462.1| 50S ribosomal protein L23 [Streptococcus pyogenes M1 GAS]; Binds to a specific region on the 23S rRNA.
YP_002122455.1	one of the primary rRNA-binding proteins; required for association of the 30S and 50S subunits to form the 70S ribosome, for tRNA binding and peptide bond formation
YP_002122456.1	similar to gb|ABP89047.1| SSU ribosomal protein S19P [Streptococcus suis 05ZYH33]; Protein S19 forms a complex with S13 that binds strongly to the 16S ribosomal RNA.
YP_002122457.1	binds specifically to 23S rRNA during the early stages of 50S assembly; makes contact with all 6 domains of the 23S rRNA in the assembled 50S subunit and ribosome; mutations in this gene result in erythromycin resistance; located near peptidyl-transferase center
YP_002122458.1	forms a complex with S10 and S14; binds the lower part of the 30S subunit head and the mRNA in the complete ribosome to position it for translation
YP_002122459.1	located in the peptidyl transferase center and may be involved in peptidyl transferase activity; similar to archaeal L10e
YP_002122460.1	one of the stabilizing components for the large ribosomal subunit
YP_002122461.1	primary binding protein; helps mediate assembly; involved in translation fidelity
YP_002122462.1	binds to the 23S rRNA between the centers for peptidyl transferase and GTPase
YP_002122463.1	assembly initiator protein; binds to 5' end of 23S rRNA and nucleates assembly of the 50S; surrounds polypeptide exit tunnel
YP_002122464.1	part of 50S and 5S/L5/L18/L25 subcomplex; contacts 5S rRNA and P site tRNA; forms a bridge to the 30S subunit in the ribosome by binding to S13
YP_002122465.1	located in the peptidyl transferase center and involved in assembly of 30S ribosome subunit; similar to what is observed with proteins L31 and L33, some proteins in this family contain CXXC motifs that are involved in zinc binding; if two copies are present in a genome, then the duplicated copy appears to have lost the zinc-binding motif and is instead regulated by zinc; the proteins in this group appear to contain the zinc-binding motif
YP_002122466.1	binds directly to 16S rRNA central domain where it helps coordinate assembly of the platform of the 30S subunit
YP_002122467.1	ribosomal protein L6 appears to have arisen as a result of an ancient gene duplication as based on structural comparison of the Bacillus stearothermophilus protein; RNA-binding appears to be in the C-terminal domain; mutations in the L6 gene confer resistance to aminoglycoside antibiotics such as gentamicin and these occur in truncations of the C-terminal domain; it has been localized to a region between the base of the L7/L12 stalk and the central protuberance
YP_002122468.1	binds 5S rRNA along with protein L5 and L25
YP_002122469.1	located at the back of the 30S subunit body where it stabilizes the conformation of the head with respect to the body; contacts S4 and S8; with S4 and S12 plays a role in translational accuracy; mutations in this gene result in spectinomycin resistance
YP_002122470.1	L30 binds domain II of the 23S rRNA and the 5S rRNA; similar to eukaryotic protein L7
YP_002122471.1	late assembly protein
YP_002122472.1	forms heterotrimeric complex in the membrane; in bacteria the complex consists of SecY which forms the channel pore and SecE and SecG; the SecG subunit is not essential; in bacteria translocation is driven via the SecA ATPase
YP_002122473.1	similar to ref|ZP_01834380.1| adenylate kinase [Streptococcus pneumoniae SP23-BS72]; This small ubiquitous enzyme is essential for maintenance and cell growth.
YP_002122474.1	stimulates the activities of the other two initiation factors, IF-2 and IF-3
YP_002122475.1	smallest protein in the large subunit; similar to what is found with protein L31 and L33 several bacterial genomes contain paralogs which may be regulated by zinc; the protein from Thermus thermophilus has a zinc-binding motif and contains a bound zinc ion; the proteins in this group have the motif
YP_002122476.1	located at the top of the head of the 30S subunit, it contacts several helices of the 16S rRNA; makes contact with the large subunit via RNA-protein interactions and via protein-protein interactions with L5; contacts P-site tRNA
YP_002122477.1	located on the platform of the 30S subunit, it bridges several disparate RNA helices of the 16S rRNA; forms part of the Shine-Dalgarno cleft in the 70S ribosome; interacts with S7 and S18 and IF-3
YP_002122478.1	catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Dimerization of the alpha subunit is the first step in the sequential assembly of subunits to form the holoenzyme
YP_002122479.1	is a component of the macrolide binding site in the peptidyl transferase center
YP_002122480.1	similar to ref|YP_850136.1| hypothetical protein lwe1939 [Listeria welshimeri serovar 6b str. SLCC5334]
YP_002122481.1	similar to ref|XP_597510.3| Gene info PREDICTED: similar to olfactory receptor MOR123-1 [Bos taurus]
YP_002122482.1	similar to gb|EDK97023.1| Gene info phosphoinositide-3-kinase, class 3, isoform CRA_c [Mus musculus]
YP_002122484.1	similar to ref|YP_001449395.1| hypothetical protein SGO_0073 [Streptococcus gordonii str. Challis substr. CH1]
YP_002122485.1	similar to ref|YP_001197470.1| hypothetical protein SSU05_0100 [Streptococcus suis 05ZYH33]; Site-specific DNA recombination.
YP_002122486.1	similar to ref|YP_001197471.1| hypothetical protein SSU05_0101 [Streptococcus suis 05ZYH33]
YP_002122487.1	similar to ref|YP_001197472.1| hypothetical protein SSU05_0102 [Streptococcus suis 05ZYH33]; Unknown, COG2946 phage replication protein RstA.
YP_002122488.1	similar to ref|YP_001197473.1| hypothetical protein SSU05_0103 [Streptococcus suis 05ZYH33]
YP_002122489.1	similar to ref|YP_893172.1| FtsK/SpoIIIE family protein [Bacillus thuringiensis str. Al Hakam]; Unknown, COG1674 DNA segregation ATPase FtsK/SpoIIIE and related proteins.
YP_002122490.1	similar to ref|NP_073692.1| tail protein [Bacillus phage GA-1]
YP_002122491.1	similar to ref|ZP_01829310.1| IS1167, transposase [Streptococcus pneumoniae SP18-BS74]
YP_002122492.1	similar to ref|ZP_01829310.1| IS1167, transposase [Streptococcus pneumoniae SP18-BS74]
YP_002122493.1	similar to ref|YP_078429.1| Major facilitator superfamily [Bacillus licheniformis ATCC 14580]; Unknown, COG0477 Permeases of the major facilitator superfamily.
YP_002122494.1	similar to gb|ABA41499.1| collagen-like protein I [Streptococcus equi subsp. equi]; Possible adhesin, has a collagen-structural-motif domain composed of 83 Gly-Xaa-Yaa repeats that in part form 22 GDQ-GQK-GER repeats.
YP_002122495.1	similar to gb|ABA41497.1| collagen-like protein G [Streptococcus equi subsp. equi]; Possible adhesin, has a collagen-structural-motif domain composed of 67 Gly-Xaa-Yaa repeats.
YP_002122496.1	similar to ref|ZP_01372633.1| NUDIX hydrolase [Desulfitobacterium hafniense DCB-2]; Catalyzes The 1,3-Allylic Rearrangement Of The Homoallylic Substrate Isopentenyl (Ipp) To Its Highly Electrophilic Allylic Isomer, Dimethylallyl Diphosphate (Dmapp).
YP_002122497.1	An essential enzyme in the nonmevalonate pathway of isopentenyl diphosphate and dimethylallyl diphosphate biosynthesis
YP_002122498.1	similar to ref|YP_059444.1| High-affinity zinc uptake system ATP-binding protein [Streptococcus pyogenes MGAS10394]; Unknown, COG1846 Transcriptional regulators.
YP_002122499.1	similar to ref|YP_059444.1| High-affinity zinc uptake system ATP-binding protein [Streptococcus pyogenes MGAS10394]; Part of the ATP-driven transport system for zinc.
YP_002122500.1	similar to ref|YP_279546.1| high-affinity zinc uptake system membrane protein [Streptococcus pyogenes MGAS6180]; Part of an ATP-driven transport system for zinc.
YP_002122501.1	catalyzes the formation of tyrosyl-tRNA(Tyr) from tyrosine and tRNA(Tyr)
YP_002122502.1	similar to ref|NP_663878.1|  penicillin-binding protein 1b [Streptococcus pyogenes MGAS315]; CSynthesis and cross-linking of nascent peptidoglycan glycan strands.
YP_002122503.1	DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates; beta subunit is part of the catalytic core which binds with a sigma factor to produce the holoenzyme
YP_002122504.1	DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Subunit beta' binds to sigma factor allowing it to bind to the -10 region of the promoter
YP_002122505.1	similar to ref|ZP_01803959.1| hypothetical protein CdifQ_04001361 [Clostridium difficile QCD-32g58]; Unknown, Gene is flanked 5' and 3' by a 51 nt direct repeat (aggagctagtcttagctccttttatcatgctaaaatcattagattaattgg) and small ORFs with similarity to IS1193D.
YP_002122506.1	similar to ref|NP_736373.1| hypothetical protein gbs1940 [Streptococcus agalactiae NEM316]; Alanine racemase catalyses the pyridoxal-dependent conversion of L-alanine into D-alanine, a key component of bacterial peptidoglycan.
YP_002122507.1	similar to ref|NP_268497.1|  DNA binding protein [Streptococcus pyogenes M1 GAS]; Unknown, COG4699: Uncharacterized protein conserved in bacteria.
YP_002122508.1	similar to ref|YP_001450417.1| bacteriocin-associated integral membrane protein subfamily [Streptococcus gordonii str. Challis substr. CH1]; Unknown, bacteriocin associated membrane protein; immunity protein.
YP_002122509.1	similar to ref|ZP_01835894.1| ABC transporter, ATP-binding protein [Streptococcus pneumoniae SP23-BS72]; Probably part of a binding-protein-dependent transport system for an amino acid. Probably responsible for energy coupling to the transport system; competence damage-inducible protein A.
YP_002122510.1	similar to ref|YP_595819.1| ComG operon protein 1 [Streptococcus pyogenes MGAS9429]; Required for uptake of DNA by competent cells.
YP_002122511.1	similar to ref|YP_281451.1| comG operon protein 2 [Streptococcus pyogenes MGAS5005]; Required for transformation and DNA binding.
YP_002122512.1	similar to ref|YP_601589.1| ComG operon protein 3 [Streptococcus pyogenes MGAS10750]; Involved in competence.
YP_002122513.1	similar to ref|NP_663885.1|  competence protein [Streptococcus pyogenes MGAS315]; Involved in competence.
YP_002122514.1	similar to ref|YP_281455.1| comG operon protein 6 [Streptococcus pyogenes MGAS5005]; Involved in competence.
YP_002122515.1	similar to ref|YP_059458.1| ComG operon protein 6 [Streptococcus pyogenes MGAS10394]; Involved in competence.
YP_002122516.1	similar to ref|NP_268574.1|  transposase, IS861 [Streptococcus pyogenes M1 GAS]
YP_002122517.1	similar to ref|YP_602677.1| Transposase [Streptococcus pyogenes MGAS10750]
YP_002122518.1	similar to ref|YP_595826.1| adenine-specific methyltransferase [Streptococcus pyogenes MGAS9429]; Unknown, COG0827 Adenine-specific DNA methylase.
YP_002122519.1	AckA utilizes acetate and can acetylate CheY which increases signal strength during flagellar rotation; utilizes magnesium and ATP; also involved in conversion of acetate to aceyl-CoA
YP_002122520.1	similar to ref|ZP_01817412.1| hypothetical protein CGSSp3BS71_02812 [Streptococcus pneumoniae SP3-BS71]
YP_002122521.1	similar to ref|ZP_00784694.1| transcriptional antiterminator, BglG family [Streptococcus agalactiae COH1]; Transcriptional antiterminator.
YP_002122522.1	similar to ref|NP_687232.1| PTS system, IIB component,  [Streptococcus agalactiae 2603V/R]; Probably involved in ascorbate uptake.
YP_002122523.1	membrane component; functions with enzymes IIB (sgaB; ulaB) and IIA (sgaA; ulaC) enzyme I and HPr for anaerobic utilization and uptake of L-ascorbate; sgaTBA are regulated by yifQ as well as Crp and Fnr
YP_002122525.1	similar to ref|YP_597524.1| oligoendopeptidase O [Streptococcus pyogenes MGAS9429]; Unknown, COG3590 Predicted metalloendopeptidase.
YP_002122526.1	EF-Ts; functions during elongation stage of protein translation; forms a dimer; associates with EF-Tu-GDP complex and promotes exchange of GDP to GTP resulting in regeneration of the active form of EF-Tu
YP_002122527.1	one of the last subunits in the assembly of the 30S subunit; absence of S2 does not inhibit assembly but results in an inactive subunit
YP_002122528.1	similar to ref|NP_270011.1|  alkyl hydroperoxidase [Streptococcus pyogenes M1 GAS]; Directly reduces organic hydroperoxides in its reduced dithiol form.
YP_002122529.1	similar to ref|NP_270010.1|  cold shock protein [Streptococcus pyogenes M1 GAS]; Stimulates the transcription of cold-shock-inducible promoters.
YP_002122530.1	similar to ref|YP_599441.1| CtsR family transcriptional regulator [Streptococcus pyogenes MGAS10270]; Negative regulator of class III stress genes (clpC, clpP).
YP_002122531.1	similar to ref|YP_603351.1| Negative regulator of genetic competence clpC/mecB [Streptococcus pyogenes MGAS10750]; Part of a stress-induced multi-chaperone system, it is involved in the recovery of the cell from heat-induced damage, in cooperation with dnaK, dnaJ and grpE. Acts before dnaK, in the processing of protein aggregates. Protein binding stimulates the ATPase activity; ATP hydrolysis unfolds the denatured protein aggregates, which probably helps expose new hydrophobic binding sites on the surface of clpB-bound aggregates, contributing to the solubilization and refolding of denatured protein aggregates by dnaK.
YP_002122532.1	similar to ref|NP_688051.1| hypothetical protein SAG1041 [Streptococcus agalactiae 2603V/R]
YP_002122533.1	similar to ref|ZP_00874485.1| Lipase, class 3 [Streptococcus suis 89/1591]; Unknown, has lipase class 3 domain.
YP_002122534.1	similar to ref|ZP_00874484.1| hypothetical protein SsuiDRAFT_1541 [Streptococcus suis 89/1591]
YP_002122535.1	similar to ref|ZP_00874545.1| hypothetical protein SsuiDRAFT_1602 [Streptococcus suis 89/1591]
YP_002122536.1	10 kDa chaperonin; Cpn10; GroES; forms homoheptameric ring; binds to one or both ends of the GroEL double barrel in the presence of adenine nucleotides capping it; folding of unfolded substrates initiates in a GroEL-substrate bound and capped by GroES; release of the folded substrate is dependent on ATP binding and hydrolysis in the trans ring
YP_002122537.1	60 kDa chaperone family; promotes refolding of misfolded polypeptides especially under stressful conditions; forms two stacked rings of heptamers to form a barrel-shaped 14mer; ends can be capped by GroES; misfolded proteins enter the barrel where they are refolded when GroES binds; many bacteria have multiple copies of the groEL gene which are active under different environmental conditions; the B.japonicum protein in this cluster is expressed constitutively; in Rhodobacter, Corynebacterium and Rhizobium this protein is essential for growth
YP_002122538.1	similar to ref|YP_001450297.1| Phosphohydrolase (MutT/nudix family protein) [Streptococcus gordonii str. Challis substr. CH1]
YP_002122539.1	similar to ref|ZP_01824093.1| hypothetical protein CGSSp9BS68_00132 [Streptococcus pneumoniae SP9-BS68]
YP_002122540.1	similar to ref|ZP_01824094.1| hypothetical protein CGSSp9BS68_00137 [Streptococcus pneumoniae SP9-BS68]
YP_002122541.1	similar to ref|ZP_01824096.1| ATPase [Streptococcus pneumoniae SP9-BS68]; Part ABC transporter complex.
YP_002122542.1	similar to ref|ZP_01819232.1| hypothetical protein CGSSp6BS73_09666 [Streptococcus pneumoniae SP6-BS73]
YP_002122543.1	similar to ref|ZP_01819367.1| succinyl-diaminopimelate desuccinylase [Streptococcus pneumoniae SP6-BS73]
YP_002122544.1	similar to ref|NP_608080.1| hypothetical protein spyM18_2125 [Streptococcus pyogenes MGAS8232]
YP_002122545.1	similar to ref|NP_722253.1|  pseudouridylate synthase [Streptococcus mutans UA159]; Responsible For Synthesis Of Pseudouridine From Uracil At Positions 955, 2504 And 2580 In 23s Ribosomal RNA.
YP_002122546.1	similar to ref|NP_665564.1| hypothetical protein SpyM3_1760 [Streptococcus pyogenes MGAS315]
YP_002122547.1	similar to ref|NP_688485.1| hypothetical protein SAG1491 [Streptococcus agalactiae 2603V/R]
YP_002122548.1	similar to ref|ZP_00365970.1| COG0251:  translation initiation inhibitor, yjgF family [Streptococcus pyogenes M49 591]
YP_002122549.1	similar to ref|YP_061071.1| Multimodular transpeptidase-transglycosylase PBP 2A [Streptococcus pyogenes MGAS10394]; Cell wall formation. May be involved in outgrowth of the germinated spore or it could function in the synthesis of the germ cell wall.
YP_002122550.1	forms a complex with SecY and SecG; SecYEG forms a protein-conducting channel to which secA binds and translocates targeted polypeptides across the cytoplasmic membrane, a process driven by ATP and a proton-motive force
YP_002122551.1	Modulates Rho-dependent transcription termination
YP_002122553.1	similar to gb|ABA41496.1| collagen-like protein F [Streptococcus equi subsp. equi]; Possible adhesin, has a collagen-structural-motif domain composed of 55 Gly-Xaa-Yaa repeats.
YP_002122554.1	similar to emb|CAB65412.1|  Mga-like regulatory protein [Streptococcus dysgalactiae subsp. dysgalactiae]; positive regulator of the adjacent M-like protein.
YP_002122555.1	similar to gb|AAB71984.1| M-protein [Streptococcus equi]; Binds IgG molecules of the Ig1, Ig2 and Ig4 subclasses, and also binds fibrinogen.
YP_002122557.1	leucine--tRNA ligase; LeuRS; class-I aminoacyl-tRNA synthetase; charges leucine by linking carboxyl group to alpha-phosphate of ATP and then transfers aminoacyl-adenylate to its tRNA; due to the large number of codons that tRNA(Leu) recognizes, the leucyl-tRNA synthetase does not recognize the anticodon loop of the tRNA, but instead recognition is dependent on a conserved discriminator base A37 and a long arm; an editing domain hydrolyzes misformed products; in Methanothermobacter thermautotrophicus this enzyme associates with prolyl-tRNA synthetase
YP_002122558.1	similar to ref|NP_268734.1| hypothetical protein SPy_0435 [Streptococcus pyogenes M1 GAS]
YP_002122559.1	membrane component; functions with enzymes IIB (sgaB; ulaB) and IIA (sgaA; ulaC) enzyme I and HPr for anaerobic utilization and uptake of L-ascorbate; sgaTBA are regulated by yifQ as well as Crp and Fnr
YP_002122560.1	similar to ref|NP_268554.1| hypothetical protein SPy_0175 [Streptococcus pyogenes M1 GAS]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in ascorbate transport.
YP_002122561.1	similar to ref|YP_601650.1| PTS system, 3-keto-L-gulonate specific IIA component [Streptococcus pyogenes MGAS10750]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in ascorbate transport.
YP_002122562.1	catalyzes the formation of L-xylulose-5-phosphate from 3-keto-L-gulonate-6-phosphate in anaerobic L-ascorbate utilization
YP_002122563.1	L-xylulose 5-phosphate 3-epimerase activity not yet demonstrated; may be involved in the utilization of 2,3-diketo-L-gulonate
YP_002122564.1	catalyzes the formation of D-xylulose 5-phosphate from L-ribulose 5-phosphate in the L-arabinose and L-ascorbate degradation pathways
YP_002122565.1	similar to ref|YP_059519.1| Transcription antiterminator, BglG family [Streptococcus pyogenes MGAS10394]; regulator of adjacent sga operon.
YP_002122566.1	similar to ref|YP_601656.1|  L-ascorbate 6-phosphate lactonase [Streptococcus pyogenes MGAS10750]; Proposed to catalyze the first step in L-ascorbate-6-phosphate degradation.
YP_002122568.1	similar to ref|NP_268562.1|  glycine betaine/proline ABC transporter (ATP-binding protein) [Streptococcus pyogenes M1 GAS]; Involved in a multicomponent binding-protein-dependent transport system for glycine betaine. Probably responsible for energy coupling to the transport system.
YP_002122569.1	similar to ref|YP_601658.1| Glycine betaine-binding protein / Glycine betaine transport system permease [Streptococcus pyogenes MGAS10750]; Involved in a multicomponent binding-protein-dependent transport system for glycine betaine; probably responsible for the translocation of the substrate across the membrane.
YP_002122571.1	similar to ref|ZP_01371554.1| transposase, IS4 [Desulfitobacterium hafniense DCB-2]
YP_002122573.1	has 3'-5' exonuclease, 5'-3' exonuclease and 5'-3'polymerase activities, primarily functions to fill gaps during DNA replication and repair
YP_002122574.1	similar to ref|YP_597771.1| CoA binding protein [Streptococcus pyogenes MGAS10270]; Unknown, COG1832 Predicted CoA-binding protein.
YP_002122575.1	similar to ref|YP_279628.1| ferric uptake regulation protein [Streptococcus pyogenes MGAS6180]; Regulation of ferric uptake.
YP_002122576.1	immunoglobulin G binding protein G precursor; similar to gb|AAQ08491.1| Szp protein [Streptococcus equi subsp. zooepidemicus]; Unknown, possibly involved in immune evasion
YP_002122577.1	similar to dbj|BAF34922.1| dextran-binding lectin A [Streptococcus sobrinus]; Catalysis of the hydrolysis of terminal, non-reducing alpha-D-galactose residues in alpha-D-galactosides, including galactose oligosaccharides, galactomannans and galactohydrolase.
YP_002122578.1	similar to ref|ZP_00365478.1| COG5523: Predicted integral membrane protein [Streptococcus pyogenes M49 591]
YP_002122580.1	Exchanges the guanine residue with 7-aminomethyl-7-deazaguanine in tRNAs with GU(N) anticodons (tRNA-Asp, -Asn, -His and -Tyr)
YP_002122581.1	similar to gb|AAQ91576.1| collagen-like protein 3 [Streptococcus equi]; Specific Function:Possible adhesin, has a collagen-structural-motif domain composed of 79 Gly-Xaa-Yaa repeats.
YP_002122582.1	similar to ref|YP_281540.1| zinc finger protein [Streptococcus pyogenes MGAS5005]
YP_002122583.1	similar to ref|YP_059530.1| BioY [Streptococcus pyogenes MGAS10394]
YP_002122584.1	similar to ref|YP_059531.1| Metal-dependent hydrolase [Streptococcus pyogenes MGAS10394]
YP_002122585.1	similar to ref|YP_001127758.1|  deaminase [Streptococcus pyogenes str. Manfredo]
YP_002122586.1	similar to ref|YP_601669.1| S-layer protein / Peptidoglycan endo-beta-N-acetylglucosaminidase [Streptococcus pyogenes MGAS10750]
YP_002122587.1	similar to ref|ZP_00874436.1| Integrase, catalytic region [Streptococcus suis 89/1591]
YP_002122588.1	similar to emb|CAD33903.1| hypothethical protein [Streptococcus dysgalactiae subsp. equisimilis]
YP_002122590.1	similar to gb|AAQ03572.1|AF414053_1 hyaluronan synthase [Streptococcus equi subsp. zooepidemicus]; Glycosaminoglycan synthesis. The hyaluronic acid capsule is involved in the pathogenicity of group A Streptococci; it may be the major virulence determinant.
YP_002122591.1	similar to gb|AAN65249.1|AF347022_2 UDP-glucose dehydrogenase [Streptococcus equi subsp. zooepidemicus]; Catalyzes the formation of UDP-glucuronic acid which is required for capsular hyaluronic acid synthesis.
YP_002122592.1	similar to gb|AAN65250.1|AF347022_3 UDP-glucose pyrophosphorylase [Streptococcus equi subsp. zooepidemicus]; May play a role in stationary phase survival.
YP_002122593.1	similar to gb|AAQ05206.1|AF468690_1 UDP-N-acetyl-glucosamine pyrophosphorylase [Streptococcus equi subsp. zooepidemicus]; Bifunctional Enzyme Responsible For The Acetylation Of Glc-N-1-P To Give Glcnac-1-P And The Synthesis Of UDP-Glcnac.
YP_002122594.1	functions in sugar metabolism in glycolysis and the Embden-Meyerhof pathways (EMP) and in gluconeogenesis; catalyzes reversible isomerization of glucose-6-phosphate to fructose-6-phosphate; member of PGI family
YP_002122595.1	Converts D-sorbitol-dphosphate to D-fructose-6-phosphate
YP_002122596.1	similar to ref|NP_720766.1| regulator of sorbitol operon [Streptococcus mutans UA159]; Positive regulator of sorbitol operon.
YP_002122597.1	similar to ref|NP_720767.1| sorbitol operon activator [Streptococcus mutans UA159]; Positive regulator for sorbitol operon expression.
YP_002122598.1	similar to ref|NP_720768.1| PTS system, sorbitol (glucitol) phosphotransferase enzyme IIC2 [Streptococcus mutans UA159]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in glucitol/sorbitol transport.
YP_002122599.1	similar to ref|NP_720769.1| PTS system, sorbitol phosphotransferase enzyme IIBC [Streptococcus mutans UA159]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in glucitol/sorbitol transport.
YP_002122600.1	similar to ref|NP_720770.1|  PTS system, sorbitol-specific enzyme IIA [Streptococcus mutans UA159]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in glucitol/sorbitol transport.
YP_002122601.1	similar to ref|ZP_02184619.1| cassette chromosome recombinase B1 [Carnobacterium sp. AT7]
YP_002122602.1	similar to ref|ZP_00513513.1| abortive infection protein,  [Crocosphaera watsonii WH8501]
YP_002122603.1	similar to ref|ZP_01628459.1| hypothetical protein N9414_15200 [Nodularia spumigena CCY9414]
YP_002122604.1	similar to gb|AAQ91579.1| collagen-like protein 3 [Streptococcus equi]; Possible adhesin, has a collagen-structural-motif domain composed of 61 Gly-Xaa-Yaa repeats.
YP_002122605.1	similar to ref|YP_821136.1| 5-formyltetrahydrofolate cyclo-ligase [Streptococcus thermophilus LMD-9]; Catalysis of the reaction: ATP + 5-formyltetrahydrofolate = ADP + phosphate + 5,10-methenyltetrahydrofolate.
YP_002122606.1	similar to ref|YP_059541.1| integral membrane protein (Rhomboid family) [Streptococcus pyogenes MGAS10394]
YP_002122607.1	similar to gb|AAQ05209.1|AF468691_2 UDP-glucose pyrophosphorylase [Streptococcus equi subsp. zooepidemicus]; Catalysis of the reaction: UTP + alpha-D-glucose 1-phosphate = diphosphate + UDP-glucose.
YP_002122608.1	catalyzes the NAD(P)H-dependent reduction of glycerol 3-phosphate to glycerone phosphate
YP_002122610.1	similar to ref|YP_599803.1| Transcriptional regulator, MarR family [Streptococcus pyogenes MGAS2096]
YP_002122611.1	similar to ref|YP_001127771.1| ABC transporter ATP-binding membrane protein [Streptococcus pyogenes str. Manfredo]
YP_002122612.1	similar to ref|NP_268592.1|  ABC transporter (ATP-binding protein) [Streptococcus pyogenes M1 GAS]
YP_002122613.1	similar to ref|NP_663969.1| hypothetical protein SpyM3_0165 [Streptococcus pyogenes MGAS315]; Possibly invovlved in DNA integration/recombination/invertion.
YP_002122614.1	catalyzes the formation of dUMP from dUTP
YP_002122615.1	Sms; stabilizes the strand-invasion intermediate during the DNA repair; involved in recombination of donor DNA and plays an important role in DNA damage repair after exposure to mutagenic agents
YP_002122616.1	similar to ref|YP_821127.1| Carbonic anhydrase [Streptococcus thermophilus LMD-9]; Carbonate hydro-lyase (carbon-dioxide-forming).
YP_002122617.1	similar to ref|YP_279665.1| hypothetical protein M28_Spy0196 [Streptococcus pyogenes MGAS6180]
YP_002122618.1	Charges one glutamine molecule and pairs it to its corresponding RNA trinucleotide during protein translation
YP_002122619.1	similar to ref|YP_597813.1| Sensory transduction protein kinase FasB [Streptococcus pyogenes MGAS10270]
YP_002122620.1	similar to ref|YP_597814.1| Sensory transduction protein kinase FasC [Streptococcus pyogenes MGAS10270]
YP_002122621.1	similar to gb|AAL78045.1| response regulator FasA [Streptococcus dysgalactiae subsp. equisimilis]
YP_002122623.1	similar to ref|NP_816714.1| ABC transporter, ATP-binding protein [Enterococcus faecalis V583]; Involved in transport.
YP_002122624.1	similar to ref|NP_816713.1| hypothetical protein EF3103 [Enterococcus faecalis V583]
YP_002122625.1	similar to ref|NP_816711.1| hypothetical protein EF3101 [Enterococcus faecalis V583]
YP_002122626.1	similar to ref|NP_816709.1| transporter accessory protein,  [Enterococcus faecalis V583]
YP_002122627.1	protein component of RNaseP which catalyzes the removal of the 5'-leader sequence from pre-tRNA to produce the mature 5'terminus; this enzyme also cleaves other RNA substrates
YP_002122628.1	similar to ref|YP_001127782.1| membrane protein OxaA 1 precursor [Streptococcus pyogenes str. Manfredo]; Required for the insertion of integral membrane proteins into the membrane. May also be involved in protein secretion processes.
YP_002122629.1	similar to ref|YP_595942.1| jag protein [Streptococcus pyogenes MGAS9429]; RNA binding
YP_002122630.1	similar to gb|EAY64209.1| conserved hypothetical protein [Burkholderia cenocepacia PC184]
YP_002122631.1	similar to ref|ZP_00230000.1| hypothetical protein LMOh7858_0095 [Listeria monocytogenes str. 4b H7858]
YP_002122632.1	Converts N-acetylmannosamine-6-phosphate to N-acetylglucosamine-6-phosphate
YP_002122633.1	similar to ref|YP_001198767.1| Phosphotransferase system IIC component, glucose/maltose/N-acetylglucosamine-specific [Streptococcus suis 05ZYH33]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in glucose transport.
YP_002122634.1	similar to ref|YP_603278.1| PTS system, glucose-specific IIABC component [Streptococcus pyogenes MGAS10750]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in glucose transport.
YP_002122635.1	in Escherichia coli transcription of this gene is enhanced by polyamines
YP_002122636.1	Converts N-acetylmannosamine-6-phosphate to N-acetylglucosamine-6-phosphate
YP_002122637.1	similar to ref|YP_279676.1| N-acetylneuraminate-binding protein [Streptococcus pyogenes MGAS6180]
YP_002122638.1	similar to ref|YP_597823.1| N-acetylneuraminate transport system permease [Streptococcus pyogenes MGAS10270]; Probably part of the binding-protein-dependent transport system yurMNO. Probably responsible for the translocation of the substrate across the membrane.
YP_002122639.1	similar to ref|NP_663987.1|  sugar transport protein (permease) [Streptococcus pyogenes MGAS315]; Part of the binding-protein-dependent transport system for L-arabinose. Probably responsible for the translocation of the substrate across the membrane.
YP_002122640.1	similar to ref|NP_606523.1| hypothetical protein spyM18_0238 [Streptococcus pyogenes MGAS8232]
YP_002122641.1	similar to ref|YP_595949.1| hypothetical membrane spanning protein [Streptococcus pyogenes MGAS9429]
YP_002122642.1	similar to ref|NP_268611.1|  acylneuraminate lyase [Streptococcus pyogenes M1 GAS]; Catalyzes the cleavage of N-acetylneuraminic acid (sialic acid) to form pyruvate and N-acetylmannosamine via a Schiff base intermediate.
YP_002122643.1	Catalysis of ATP + N-acyl-D-mannosamine = ADP + N-acyl-D-mannosamine 6-phosphate.
YP_002122644.1	cephalosporin-C deacetylase; similar to ref|YP_328767.1| acetyl xylan esterase,  [Streptococcus agalactiae A909]
YP_002122645.1	similar to ref|YP_328768.1| phosphosugar-binding transcriptional regulator, RpiR family [Streptococcus agalactiae A909]; Binding to a specific DNA sequence in order to modulate transcription.
YP_002122646.1	similar to ref|YP_001127793.1| TatD related DNase [Streptococcus pyogenes str. Manfredo]
YP_002122647.1	similar to ref|YP_279684.1| ribonuclease M5 [Streptococcus pyogenes MGAS6180]; Interacting selectively with any nucleic acid.
YP_002122648.1	similar to ref|YP_001201713.1| Thiol-disulfide isomerase and thioredoxin [Streptococcus suis 98HAH33]
YP_002122649.1	catalyzes the transfer of a total of four methyl groups from S-adenosyl-l-methionine (S-AdoMet) to two adjacent adenosine bases A1518 and A1519 in 16S rRNA; mutations in ksgA causes resistance to the translation initiation inhibitor kasugamycin
YP_002122650.1	EngC; RsgA; CpgA; circularly permuted GTPase; ribosome small subunit-dependent GTPase A; has the pattern G4-G1-G3 as opposed to other GTPases; interacts strongly with 30S ribosome which stimulates GTPase activity
YP_002122651.1	catalyzes the interconversion of D-ribulose 5-phosphate to xylulose 5-phosphate
YP_002122652.1	similar to ref|YP_601714.1| Thiamin pyrophosphokinase [Streptococcus pyogenes MGAS10750]; Catalyzes the phosphorylation of thiamine to thiamine pyrophosphate.
YP_002122653.1	similar to ref|YP_601715.1| RmuC family protein [Streptococcus pyogenes MGAS10750]; Involved in DNA recombination.
YP_002122654.1	similar to ref|NP_268621.1|  CMP-binding factor [Streptococcus pyogenes M1 GAS]; 3'-5' exoribonuclease
YP_002122655.1	similar to ref|NP_268622.1| purine operon repressor [Streptococcus pyogenes M1 GAS]; Controls the transcription of the pur operon for purine biosynthetic genes.
YP_002122656.1	similar to ref|NP_268623.1|  surface exclusion protein [Streptococcus pyogenes M1 GAS]
YP_002122657.1	interacts with and stabilizes bases of the 16S rRNA that are involved in tRNA selection in the A site and with the mRNA backbone; located at the interface of the 30S and 50S subunits, it traverses the body of the 30S subunit contacting proteins on the other side; mutations in the S12 gene confer streptomycin resistance
YP_002122658.1	binds directly to 16S rRNA where it nucleates assembly of the head domain of the 30S subunit
YP_002122659.1	EF-G; promotes GTP-dependent translocation of the ribosome during translation; many organisms have multiple copies of this gene
YP_002122661.1	similar to dbj|BAD37145.1| glyceraldehyde-3-phosphate dehydrogenase [Streptococcus gordonii]; Also binds human plasminogen, Nephritis associated plasmin receptor,  moonlighting dual function non-classical secreted protein.
YP_002122662.1	similar to emb|CAA73175.1| acid phosphatase [Streptococcus dysgalactiae subsp. equisimilis]
YP_002122663.1	Converts 3-phospho-D-glycerate to 3-phospho-D-glyceroyl phosphate during the glycolysis pathway
YP_002122666.1	similar to ref|YP_597334.1| hypothetical protein MGAS9429_Spy1603 [Streptococcus pyogenes MGAS9429]
YP_002122667.1	similar to ref|YP_597332.1| glutamine synthetase [Streptococcus pyogenes MGAS9429]; Plays an essential role in the metabolism of nitrogen by catalyzing the condensation of glutamate and ammonia to form glutamine, Class I enzymes (GSI) are specific to prokaryotes, and are oligomers of 12 identical subunits. The activity of GSI-type enzyme is controlled by the adenylation of a tyrosine residue. The adenylated enzyme is inactive.
YP_002122668.1	similar to ref|NP_687990.1| ABC transporter, substrate-binding protein [Streptococcus agalactiae 2603V/R]; This protein is a component of the oligopeptide permease, a binding protein-dependent transport system, It binds peptides up to five amino acids long with high affinity. Also required for sporulation and competence.
YP_002122669.1	similar to ref|NP_687185.1| oligopeptide ABC transporter, permease [Streptococcus agalactiae 2603V/R]; Part of the binding-protein-dependent transport system for oligopeptides; probably responsible for the translocation of the substrate across the membrane. Also required for sporulation and competence.
YP_002122670.1	similar to ref|NP_687186.1| oligopeptide ABC transporter, permease [Streptococcus agalactiae 2603V/R]; Part of the binding-protein-dependent transport system for oligopeptides; probably responsible for the translocation of the substrate across the membrane. Also required for sporulation and competence.
YP_002122671.1	similar to ref|NP_687187.1| oligopeptide ABC transporter, ATP-binding protein [Streptococcus agalactiae 2603V/R]; Part of the binding protein-dependent transport system for oligopeptides. Probably responsible for energy coupling to the transport system. Required for sporulation and competence.
YP_002122672.1	similar to ref|NP_687188.1| oligopeptide ABC transporter, ATP-binding protein [Streptococcus agalactiae 2603V/R]; Part of the binding-protein-dependent transport system for oligopeptides. Probably responsible for energy coupling to the transport system.
YP_002122673.1	similar to ref|ZP_00366343.1| COG0595: Predicted hydrolase of the metallo-beta-lactamase superfamily [Streptococcus pyogenes M49 591]
YP_002122674.1	similar to ref|YP_603146.1|  transcriptional regulator [Streptococcus pyogenes MGAS10750]
YP_002122675.1	similar to ref|YP_603145.1| Non-proteolytic protein, peptidase family M22 [Streptococcus pyogenes MGAS10750]
YP_002122676.1	similar to ref|YP_597328.1| ribosomal-protein-S18-alanine acetyltransferase [Streptococcus pyogenes MGAS9429]; This Enzyme Acetylates The N-Terminal Alanine Of Ribosomal Protein S18.
YP_002122677.1	in most organisms, only the N-terminal domain is present in a single polypeptide; in some archaea this domain is fused to a kinase domain; this gene is essential for growth in Escherichia coli and Bacillus subtilis; the secreted glycoprotease from Pasteurella haemolytica showed specificity for O-sialoglycosylated proteins; the Pyrococcus structure shows DNA-binding properties, iron-binding, ATP-binding, and AP endonuclease activity
YP_002122678.1	similar to ref|ZP_00875785.1| Protein of unknown function DUF218 [Streptococcus suis 89/1591]
YP_002122679.1	similar to ref|ZP_00366338.1| COG0199: Ribosomal protein S14 [Streptococcus pyogenes M49 591]; Known to be required for the assembly of 30S particles and may also be responsible for determining the conformation of the 16S rRNA at the A site.
YP_002122680.1	similar to ref|YP_281042.1| NAD(FAD)-utilizing dehydrogenase [Streptococcus pyogenes MGAS6180]
YP_002122681.1	similar to ref|YP_001127858.1|  DNA-binding protein [Streptococcus pyogenes str. Manfredo]
YP_002122682.1	3'-5' exonuclease of DNA polymerase III
YP_002122683.1	similar to ref|YP_599257.1| MerR family transcriptional regulator [Streptococcus pyogenes MGAS10270]; Transcriptional regulator.
YP_002122684.1	similar to ref|YP_602677.1| Transposase [Streptococcus pyogenes MGAS10750]
YP_002122685.1	similar to ref|YP_596865.1| transposase [Streptococcus pyogenes MGAS9429]
YP_002122686.1	similar to ref|YP_281033.1| hypothetical protein M28_Spy1568 [Streptococcus pyogenes MGAS6180]
YP_002122687.1	similar to ref|NP_816189.1| site-specific recombinase, phage integrase family [Enterococcus faecalis V583]; Site-specific tyrosine recombinase, which acts by catalyzing the cutting and rejoining of the recombining DNA molecules. The xerC-xerD complex is essential to convert dimers of the bacterial chromosome into monomers to permit their segregation at cell division. It also contributes to the segregational stability of plasmids.
YP_002122688.1	similar to ref|NP_813967.1| hypothetical protein EF0165 [Enterococcus faecalis V583]
YP_002122689.1	similar to ref|NP_965557.1| hypothetical protein LJ1751 [Lactobacillus johnsonii NCC 533]; Unknown, has some similarity with plasmid/phage replication initiation proteins may function with Sez_0298 which has similarity with plasmid/phage integrase/recombinase.
YP_002122690.1	similar to ref|ZP_01817519.1| hypothetical protein CGSSp3BS71_03347 [Streptococcus pneumoniae SP3-BS71]
YP_002122691.1	similar to ref|XP_788744.2| PREDICTED: similar to kelch-like ECH-associated protein 1 [Strongylocentrotus purpuratus]
YP_002122692.1	similar to ref|ZP_01968479.1| hypothetical protein RUMTOR_02056 [Ruminococcus torques ATCC 27756]
YP_002122693.1	similar to ref|XP_001431093.1| hypothetical protein GSPATT00033548001 [Paramecium tetraurelia strain d4-2]
YP_002122694.1	similar to ref|YP_536282.1| hypothetical protein LSL_1395 [Lactobacillus salivarius UCC118]
YP_002122695.1	similar to ref|XP_001592791.1| hypothetical protein SS1G_05712 [Sclerotinia sclerotiorum 1980]
YP_002122696.1	similar to ref|ZP_00875721.1| Helix-turn-helix motif:Protein of unknown function DUF955 [Streptococcus suis 89/1591]
YP_002122697.1	similar to ref|YP_001308760.1| hypothetical protein Cbei_1630 [Clostridium beijerinckii NCIMB 8052]
YP_002122699.1	similar to ref|YP_330353.1| hypothetical protein SAK_1753 [Streptococcus agalactiae A909]
YP_002122700.1	similar to ref|NP_734897.1| similar to two-component response regulator [Streptococcus agalactiae NEM316]; Member of the two-component regulatory system, has some similarity with SaeR and PhoP.
YP_002122701.1	similar to ref|NP_687428.1| sensor histidine kinase [Streptococcus agalactiae 2603V/R]; Member of the two-component regulatory system, has similarity with SaeS and PhoR.
YP_002122702.1	similar to dbj|BAD00710.1| fibronectin-binding protein [Streptococcus equi subsp. zooepidemicus]; Unknown,  cell surface fibronectin-binding protein.
YP_002122703.1	similar to ref|NP_268584.1|  regulatory protein - RofA related [Streptococcus pyogenes M1 GAS]; RofA-like, regulator of adjacent predicted cell surface fibronectin-binding protein.
YP_002122704.1	similar to ref|YP_001643140.1| Abortive infection protein [Bacillus weihenstephanensis KBAB4]
YP_002122705.1	similar to ref|NP_269854.1|  repressor - phage associated [Streptococcus pyogenes M1 GAS]
YP_002122706.1	similar to ref|YP_060907.1| Transcriptional regulator, Cro/CI family [Streptococcus pyogenes MGAS10394]
YP_002122707.1	similar to ref|YP_329140.1| pyridoxamine 5'-phosphate oxidase family [Streptococcus agalactiae A909]
YP_002122708.1	catalyzes the removal of N-terminal dipeptides when proline is the penultimate residue
YP_002122709.1	similar to ref|NP_269852.1|  transcriptional regulatory protein [Streptococcus pyogenes M1 GAS]
YP_002122710.1	similar to ref|YP_281028.1| quinolone resistance norA protein [Streptococcus pyogenes MGAS6180]; quinolone antibiotic resistance protein.
YP_002122711.1	similar to ref|NP_688723.1| universal stress protein family [Streptococcus agalactiae 2603V/R]
YP_002122712.1	similar to ref|YP_601194.1| Aquaporin / Glycerol uptake facilitator protein [Streptococcus pyogenes MGAS2096]; Mixed channel protein that transports both water and glycerol.
YP_002122713.1	similar to ref|NP_269848.1|  C3-degrading proteinase [Streptococcus pyogenes M1 GAS]
YP_002122714.1	similar to gb|AAT87717.1| Penicillin-binding protein [Streptococcus pyogenes MGAS10394]; Unknown, similar to beta lactamase.
YP_002122715.1	similar to ref|NP_358009.1| Pyruvate formate-lyase [Streptococcus pneumoniae R6]; Glucose metabolism (nonoxidative conversion).
YP_002122716.1	involved in translesion DNA polymerization with beta clamp of polymerase III; belongs to Y family of polymerases; does not contain proofreading function
YP_002122717.1	similar to ref|NP_665398.1| hypothetical protein SpyM3_1594 [Streptococcus pyogenes MGAS315]
YP_002122718.1	similar to ref|YP_603119.1| Exodeoxyribonuclease V alpha chain [Streptococcus pyogenes MGAS10750]; Exhibits several catalytic activities, including ATP-dependent exonuclease, ATP-stimulated endonuclease, ATP-dependent unwinding and DNA-dependent ATPase activities. strand cleavage occurs 5' to 3' during the unwinding of duplex DNA at Chi sequences, which locally stimulate recombination.
YP_002122719.1	similar to ref|YP_603118.1| Signal peptidase I [Streptococcus pyogenes MGAS10750]
YP_002122720.1	An endonuclease that specifically degrades the RNA strand of RNA-DNA hybrids
YP_002122721.1	similar to ref|YP_597299.1| hypothetical cytosolic protein [Streptococcus pyogenes MGAS9429]
YP_002122722.1	similar to ref|YP_597298.1| CvpA family membrane protein [Streptococcus pyogenes MGAS9429]
YP_002122723.1	similar to ref|YP_140176.1| DNA mismatch repair protein [Streptococcus thermophilus LMG 18311]
YP_002122725.1	Involved in disulfide oxidoreductase activity and electron transport
YP_002122726.1	similar to ref|NP_722180.1|  thioredoxin [Streptococcus mutans UA159]; Component of the thioredoxin-thioredoxin reductase system. Participates in various redox reactions through the reversible oxidation of its active center dithiol to a disulfide and catalyzes dithiol-disulfide exchange reactions.
YP_002122727.1	similar to gb|AAQ08496.1| Szp protein [Streptococcus equi subsp. zooepidemicus]; This protein is one of the different antigenic serotypes of protein M. Protein M is closely associated with virulence of the bacterium and can render the organism resistant to phagocytosis.
YP_002122728.1	similar to ref|YP_140171.1| A/G-specific adenine glycosylase [Streptococcus thermophilus LMG 18311]; Adenine glycosylase active on G-A and C-A mispairs.
YP_002122729.1	similar to ref|NP_721760.1| hypothetical protein SMU.1400c [Streptococcus mutans UA159]
YP_002122731.1	binds cooperatively with S18 to the S15-16S complex, allowing platform assembly to continue with S11 and S21
YP_002122732.1	binds to single stranded DNA and may facilitate the binding and interaction of other proteins to DNA
YP_002122733.1	binds as a heterodimer with protein S6 to the central domain of the 16S rRNA; helps stabilize the platform of the 30S subunit
YP_002122734.1	similar to ref|YP_602677.1| Transposase [Streptococcus pyogenes MGAS10750]
YP_002122735.1	similar to ref|YP_596865.1| transposase [Streptococcus pyogenes MGAS9429]
YP_002122736.1	similar to ref|YP_281004.1| hypothetical membrane spanning protein [Streptococcus pyogenes MGAS6180]
YP_002122737.1	similar to ref|YP_001127890.1| CorA-like Mg2+ transporter protein [Streptococcus pyogenes str. Manfredo]; May play a role in the transport of magnesium.
YP_002122738.1	The UvrABC repair system catalyzes the recognition and processing of DNA lesions. UvrA is an ATPase and a DNA-binding protein. A damage recognition complex composed of 2 uvrA and 2 uvrB subunits scans DNA for abnormalities. When the presence of a lesion has been verified by uvrB, the uvrA molecules dissociate
YP_002122739.1	similar to ref|YP_060856.1| Xaa-Pro dipeptidase [Streptococcus pyogenes MGAS10394]; The hydrolysis of a peptide bond or bonds within a protein.
YP_002122740.1	similar to ref|YP_060855.1| ComE operon protein 2 [Streptococcus pyogenes MGAS10394]; Catalysis of the reaction: dCMP + H2O = dUMP + NH3, Dispensable for transformability.
YP_002122741.1	Involved in peptide bond synthesis; alters the affinity of the ribosome for aminoacyl-tRNA
YP_002122742.1	similar to ref|YP_001127895.1| hypothetical protein SpyM50304 [Streptococcus pyogenes str. Manfredo]
YP_002122743.1	Regulates rRNA biosynthesis by transcriptional antitermination
YP_002122744.1	similar to ref|YP_001451052.1| hypothetical protein SGO_1783 [Streptococcus gordonii str. Challis substr. CH1]
YP_002122745.1	similar to ref|YP_001035341.1| hypothetical protein SSA_1393 [Streptococcus sanguinis SK36]
YP_002122746.1	similar to ref|YP_001035340.1| hypothetical protein SSA_1392 [Streptococcus sanguinis SK36]
YP_002122747.1	similar to ref|YP_697958.1| bacteriocin [Clostridium perfringens SM101]
YP_002122748.1	similar to ref|YP_001035338.1| hypothetical protein SSA_1390 [Streptococcus sanguinis SK36]
YP_002122749.1	similar to ref|XP_503073.1| hypothetical protein [Yarrowia lipolytica]
YP_002122750.1	similar to ref|YP_282907.1| sucrose operon repressor [Streptococcus pyogenes MGAS5005]; Negative regulator of scrB expression.
YP_002122751.1	similar to ref|YP_280995.1| sucrose-6-phosphate hydrolase [Streptococcus pyogenes MGAS6180]; Catalysis of the hydrolysis of terminal non-reducing beta-D-fructofuranoside residues in beta-D-fructofuranosides.
YP_002122752.1	similar to ref|YP_001127899.1| Gene info PTS system, sucrose-specific IIABC component [Streptococcus pyogenes str. Manfredo]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in sucrose transport.
YP_002122753.1	similar to ref|NP_665373.1|  sucrose-specific PTS permease, enzyme II [Streptococcus pyogenes MGAS315]; Endohydrolysis of the di-N-acetylchitobiosyl unit in high-mannose glycopeptides and glycoproteins. Complex biantennary glycans are the preferred substrates. Tri- and tetraantennary glycans are not hydrolyzed, and high mannose glycans are very poor substrates.
YP_002122754.1	similar to ref|NP_607886.1| secreted endoglycosidase [Streptococcus pyogenes MGAS8232]; Catalysis of the reaction: ATP + D-fructose = ADP + D-fructose 6-phosphate.
YP_002122755.1	similar to ref|NP_269816.1|  mannose-6-phosphate isomerase [Streptococcus pyogenes M1 GAS]; Involved in the conversion of glucose to GDP-L-fucose.
YP_002122756.1	functions in protein export; can interact with acidic membrane phospholipids and the SecYEG protein complex; binds to preproteins; binds to ATP and undergoes a conformational change to promote membrane insertion of SecA/bound preprotein; ATP hydrolysis appears to drive release of the preprotein from SecA and deinsertion of SecA from the membrane; additional proteins SecD/F/YajC aid SecA recycling; exists in an equilibrium between monomers and dimers; may possibly form higher order oligomers; proteins in this cluster correspond SecA1; SecA2 is not essential and seems to play a role in secretion of a subset of proteins
YP_002122757.1	Catalyzes the formation of holo-ACP, which mediates the essential transfer of acyl fatty acid intermediates during the biosynthesis of fatty acids and lipids
YP_002122758.1	converts L-alanine to D-alanine which is used in cell wall biosynthesis; binds one pyridoxal phosphate per monomer; forms a homodimer
YP_002122759.1	similar to ref|YP_599208.1| Immunogenic secreted protein [Streptococcus pyogenes MGAS10270]; pfam05257, CHAP domain. This domain corresponds to an amidase function, MurNAc-L-Ala amidase. Many of these proteins are involved in cell wall metabolism of bacteria. This domain is found at the N-terminus of the bifunctional Escherichia coli GSP synthetase/GSP amidase, where is functions as a glutathionylspermidine amidase.
YP_002122760.1	similar to ref|YP_597265.1|  Fe3+-siderophore transport protein [Streptococcus pyogenes MGAS9429]; Involoved in iron acquisition.
YP_002122761.1	similar to gb|ABI79311.1| heme-binding protein [Streptococcus equi subsp. equi]
YP_002122762.1	similar to gb|ABI79312.1| heme-binding lipoprotein [Streptococcus equi subsp. equi]; Binds citrate-dependent iron(III); part of the binding- protein-dependent transport system for uptake of citrate-dependent iron(III).
YP_002122763.1	similar to ref|NP_665363.1|  ferrichrome ABC transporter (permease) [Streptococcus pyogenes MGAS315]; This is one of the proteins involved in the high- affinity transport of ferrichrome.
YP_002122764.1	similar to ref|YP_060837.1| Ferrichrome transport ATP-binding protein [Streptococcus pyogenes MGAS10394]; Part of the binding-protein-dependent transport system for Fe(3+)-ferrichrome. Probably responsible for energy coupling to the transport system.
YP_002122765.1	similar to ref|NP_607874.1|  ABC transporter (ATP-binding protein) [Streptococcus pyogenes MGAS8232]; Component of a transport system.
YP_002122766.1	similar to ref|YP_597258.1| ABC transporter ATP-binding protein [Streptococcus pyogenes MGAS9429]; Component of a transport system.
YP_002122767.1	similar to ref|NP_607872.1| hypothetical protein spyM18_1861 [Streptococcus pyogenes MGAS8232]; Permease component of an ABC transporter.
YP_002122768.1	similar to ref|NP_607871.1| hypothetical protein spyM18_1860 [Streptococcus pyogenes MGAS8232]; Possibly involved in cobalt transport.
YP_002122769.1	similar to ref|YP_001127916.1| ABC transporter ATP-binding protein [Streptococcus pyogenes str. Manfredo]; Part of the ABC transporter complex possibly involved in cobalt import. Responsible for energy coupling to the transport system.
YP_002122770.1	similar to ref|NP_722150.1|  ATP-dependent DNA helicase, RecG [Streptococcus mutans UA159]; Critical role in recombination and DNA repair. Help process Holliday junction intermediates to mature products by catalyzing branch migration. Has a DNA unwinding activity characteristic of a DNA helicase with a 3' to 5' polarity. RecG unwind branched duplex DNA (Y-DNA).
YP_002122771.1	similar to ref|NP_269796.1|  L-asparaginase [Streptococcus pyogenes M1 GAS]; Catalysis of the reaction: L-asparagine + H2O = L-aspartate + NH3.
YP_002122772.1	similar to ref|ZP_00365596.1| COG0561: Predicted hydrolases of the HAD superfamily [Streptococcus pyogenes M49 591]
YP_002122773.1	similar to ref|YP_280968.1| universal stress protein family [Streptococcus pyogenes MGAS6180]
YP_002122774.1	CodY; DNA-binding protein that represses the expression of many genes that are induced as cells make the transition from rapid exponential growth to stationary phase (By similarity). It is a GTP-binding protein that senses the intracellular GTP concentration as an indicator of nutritional limitations. At low GTP concentration it no longer binds GTP and stop to act as a transcriptional repressor
YP_002122775.1	similar to ref|YP_001034560.1| Isochorismitase family protein,  [Streptococcus sanguinis SK36]; Catalysis of the reaction: nicotinamide + H2O = nicotinate + NH3.
YP_002122776.1	allows the formation of correctly charged Asn-tRNA(Asn) or Gln-tRNA(Gln) through the transamidation of misacylated Asp-tRNA(Asn) or Glu-tRNA(Gln) in organisms which lack either or both of asparaginyl-tRNA or glutaminyl-tRNA synthetases; reaction takes place in the presence of glutamine and ATP through an activated phospho-Asp-tRNA(Asn) or phospho-Glu-tRNA; some Mycoplasma proteins contain an N-terminal fusion to an unknown domain
YP_002122777.1	allows the formation of correctly charged Asn-tRNA(Asn) or Gln-tRNA(Gln) through the transamidation of misacylated Asp-tRNA(Asn) or Glu-tRNA(Gln) in organisms which lack either or both of asparaginyl-tRNA or glutaminyl-tRNA synthetases; reaction takes place in the presence of glutamine and ATP through an activated phospho-Asp-tRNA(Asn) or phospho-Glu-tRNA
YP_002122778.1	allows the formation of correctly charged Asn-tRNA(Asn) or Gln-tRNA(Gln) through the transamidation of misacylated Asp-tRNA(Asn) or Glu-tRNA(Gln) in organisms which lack either or both of asparaginyl-tRNA or glutaminyl-tRNA synthetases; reaction takes place in the presence of glutamine and ATP through an activated phospho-Asp-tRNA(Asn) or phospho-Glu-tRNA
YP_002122779.1	similar to ref|YP_820933.1| permease of the drug/metabolite transporter (DMT) superfamily [Streptococcus thermophilus LMD-9]
YP_002122780.1	similar to ref|YP_060816.1| Hypothetical membrane spanning protein [Streptococcus pyogenes MGAS10394]
YP_002122781.1	similar to gb|AAD29424.1|AF136451_1 fibronectin-binding protein SFS [Streptococcus equi]; secreted adhesin, however lacks canonical secretion signal sequence. Has some similarity with the eukaryotic ECM protein, repetin.
YP_002122782.1	ACT domain-containing protein
YP_002122783.1	similar to ref|YP_001449706.1| glycerol-3-phosphate dehydrogenase (NAD(P)+) [Streptococcus gordonii str. Challis substr. CH1]; De novo phospholipid biosynthesis; glycerol-3 phosphate formation.
YP_002122784.1	similar to ref|NP_607855.1|  phosphoglycerate mutase [Streptococcus pyogenes MGAS8232]
YP_002122785.1	similar to ref|NP_607854.1|  D,D-carboxypeptidase [Streptococcus pyogenes MGAS8232]; Vancomycin-inducible, penicillin-resistant, DD- carboxypeptidase that hydrolyzes depsipeptide- and D-alanyl-D- alanine-containing peptidoglycan precursors. Insensitive to beta- lactams.
YP_002122786.1	similar to ref|NP_607853.1|  N-acetyl-muramidase [Streptococcus pyogenes MGAS8232]
YP_002122787.1	Negative regulator of class I heat shock genes (grpE-dnaK-dnaJ and groELS operons). Prevents heat-shock induction of these operons
YP_002122788.1	with DnaK and DnaJ acts in response to hyperosmotic and heat shock by preventing the aggregation of stress-denatured proteins; may act as a thermosensor
YP_002122789.1	heat shock protein 70; assists in folding of nascent polypeptide chains; refolding of misfolded proteins; utilizes ATPase activity to help fold; co-chaperones are DnaJ and GrpE; multiple copies in some bacteria
YP_002122790.1	chaperone Hsp40; co-chaperone with DnaK; Participates actively in the response to hyperosmotic and heat shock by preventing the aggregation of stress-denatured proteins and by disaggregating proteins, also in an autonomous, dnaK-independent fashion
YP_002122791.1	Catalyzes the reversible hydration of unsaturated fatty acyl-CoA to beta-hydroxyacyl-CoA
YP_002122792.1	similar to ref|YP_280949.1| transcriptional regulator, MarR family [Streptococcus pyogenes MGAS6180]; Transcriptional repressor.
YP_002122793.1	FabH; beta-ketoacyl-acyl carrier protein synthase III; catalyzes the condensation of acetyl-CoA with malonyl-ACP to initiate cycles of fatty acid elongation; differs from 3-oxoacyl-(acyl carrier protein) synthase I and II in that it utilizes CoA thioesters as primers rather than acyl-ACPs
YP_002122794.1	carries the fatty acid chain in fatty acid biosynthesis
YP_002122795.1	similar to ref|NP_269774.1|  trans-2-enoyl-ACP reductase II [Streptococcus pyogenes M1 GAS]; Catalysis of the reaction: acyl-[acyl-carrier protein] + NAD+ = trans-2,3-dehydroacyl-[acyl-carrier protein] + NADH + H+.
YP_002122796.1	similar to ref|NP_269773.1| acyl-carrier-protein S-malonyltransferase [Streptococcus pyogenes M1 GAS]; Fatty acid biosynthesis.
YP_002122797.1	catalyzes the first of the two reduction steps in the elongation cycle of fatty acid synthesis
YP_002122798.1	FabF; beta-ketoacyl-ACP synthase II, KASII; catalyzes a condensation reaction in fatty acid biosynthesis: addition of an acyl acceptor of two carbons from malonyl-ACP; required for the elongation of short-chain unsaturated acyl-ACP
YP_002122799.1	composes the biotin carboxyl carrier protein subunit of the acetyl-CoA carboxylase complex, the enzyme that catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, which in turn controls the rate of fatty acid metabolism
YP_002122800.1	in Pseudomonas aeruginosa this enzyme is a trimer of dimers; essential for membrane formation; performs third step of type II fatty acid biosynthesis; catalyzes dehydration of (3R)-hydroxyacyl-ACP to trans-2-acyl-ACP
YP_002122801.1	catalyzes the carboxylation of acetyl-CoA to malonyl-CoA; forms a tetramer of AccA2D2 subunits
YP_002122802.1	catalyzes the carboxylation of acetyl-CoA to malonyl-CoA; forms a tetramer composed of two alpha (AccA) and two beta (AccD) subunits; one of the two catalytic subunits that can form the acetyl CoA carboxylase enzyme together with a carrier protein; these proteins present a shorter N-terminus
YP_002122803.1	catalyzes a two-step reaction, first charging a serine molecule by linking its carboxyl group to the alpha-phosphate of ATP, followed by transfer of the aminoacyl-adenylate to its tRNA
YP_002122804.1	similar to ref|NP_734813.1| hypothetical protein gbs0344 [Streptococcus agalactiae NEM316]
YP_002122805.1	similar to ref|YP_280936.1| hypothetical cytosolic protein [Streptococcus pyogenes MGAS6180]
YP_002122806.1	similar to ref|NP_607833.1|  mannose-specific phosphotransferase system component IID [Streptococcus pyogenes MGAS8232]; This is a component of the phosphoenolpyruvate-dependent sugar phosphotransferase system (Pts), a major carbohydrate active -transport system.
YP_002122807.1	similar to ref|YP_280934.1| PTS system, mannose-specific IIC component [Streptococcus pyogenes MGAS6180]
YP_002122808.1	similar to ref|YP_001127956.1|  mannose-specific phosphotransferase system (PTS), IIAB component [Streptococcus pyogenes str. Manfredo]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in mannose transport.
YP_002122809.1	similar to ref|XP_954798.1| glutamate-cysteine ligase,  [Theileria annulata strain Ankara]
YP_002122810.1	similar to ref|NP_607830.1| hypothetical protein spyM18_1809 [Streptococcus pyogenes MGAS8232]
YP_002122811.1	similar to ref|YP_060789.1| Guanine-hypoxanthine permease [Streptococcus pyogenes MGAS10394]
YP_002122812.1	similar to ref|NP_720857.1| hypothetical protein SMU.409 [Streptococcus mutans UA159]; Similar to ATPase YjeE, predicted to have essential role in cell wall biosynthesis.
YP_002122813.1	similar to ref|NP_607771.1| hypothetical protein spyM18_1742 [Streptococcus pyogenes MGAS8232]
YP_002122814.1	similar to ref|YP_060786.1| Transcriptional regulator, LytR family [Streptococcus pyogenes MGAS10394]; Attenuator role for operon expression.
YP_002122815.1	similar to ref|NP_607769.1| hypothetical protein spyM18_1739 [Streptococcus pyogenes MGAS8232]
YP_002122816.1	similar to ref|NP_269754.1|  cell-cycle regulation histidine triad (HIT) protein [Streptococcus pyogenes M1 GAS]
YP_002122817.1	similar to ref|YP_040351.1| hypothetical protein SAR0929 [Staphylococcus aureus subsp. aureus MRSA252]
YP_002122819.1	similar to ref|YP_280925.1| ABC-type transporter ATP-binding protein ecsA [Streptococcus pyogenes MGAS6180]; Has a role in exoprotein production, sporulation and competence.
YP_002122820.1	similar to ref|YP_060782.1| EcsB [Streptococcus pyogenes MGAS10394]; Strain 3610 ecsB deletion mutant forms colonies in which certain architectural features are absent or less prominent than those observed in wild-type colonies. The Ecs activity could be important for the development of communities.
YP_002122821.1	similar to ref|YP_060781.1| Phosphotransferase enzyme family [Streptococcus pyogenes MGAS10394]
YP_002122822.1	tRNA (guanine-N(7)-)-methyltransferase; catalyzes the formation of N(7)-methylguanine at position 46 (m7G46) in tRNA by transferring the methyl residue from S-adenosyl-L-methionine
YP_002122823.1	similar to ref|YP_282830.1| Gene info phi5005.3 integrase [Streptococcus pyogenes phage 5005.3]
YP_002122824.1	in Streptococcus pneumoniae this gene was found to be essential; structure determination of the Streptococcus protein shows that it is similar to a number of other proteins
YP_002122825.1	modifies transcription through interactions with RNA polymerase affecting elongation, readthrough, termination, and antitermination
YP_002122826.1	similar to ref|YP_060777.1| Hypothetical cytosolic protein [Streptococcus pyogenes MGAS10394]; COG2740: Predicted nucleic-acid-binding protein implicated in transcription termination.
YP_002122827.1	similar to ref|NP_607760.1| hypothetical protein spyM18_1730 [Streptococcus pyogenes MGAS8232]
YP_002122828.1	Protects formylmethionyl-tRNA from spontaneous hydrolysis and promotes its binding to the 30S ribosomal subunits during initiation of protein synthesis. Also involved in the hydrolysis of GTP during the formation of the 70S ribosomal complex
YP_002122830.1	associates with free 30S ribosomal subunits; essential for efficient processing of 16S rRNA; in Escherichia coli rbfA is induced by cold shock
YP_002122831.1	similar to ref|ZP_00365884.1| COG0657: Esterase/lipase [Streptococcus pyogenes M49 591]; Unknown, similar to beta lactamases, possibly involved in PG maturation.
YP_002122832.1	similar to ref|YP_280914.1| copAB ATPase metal-fist type repressor [Streptococcus pyogenes MGAS6180]
YP_002122833.1	similar to ref|YP_597138.1| copper-exporting ATPase [Streptococcus pyogenes MGAS9429]; May play a role in the osmotic adaptation.
YP_002122835.1	similar to ref|YP_001052596.1| hypothetical protein Sbal_4262 [Shewanella baltica OS155]; Unknown, possible galanin.
YP_002122836.1	similar to ref|YP_001395827.1| hypothetical protein CKL_2444 [Clostridium kluyveri DSM 555]; The members of this family are related to the LemA protein . LemA contains an N-terminal predicted transmembrane helix. It has been predicted that the small N terminus is extracellular. The exact molecular function of this protein is uncertain.
YP_002122837.1	similar to ref|YP_597136.1| lactose phosphotransferase system repressor [Streptococcus pyogenes MGAS9429]; Repressor of the lactose catabolism operon. Galactose-6- phosphate is the inducer.
YP_002122838.1	catalyzes the interconversion of galactose 6-phosphate to tagatose
YP_002122839.1	catalyzes the interconversion of galactose 6-phosphate to tagatose 6-phosphate
YP_002122840.1	similar to ref|YP_417532.1| tagatose-6-phosphate kinase [Staphylococcus aureus RF122]; Catalysis of the reaction: ATP + D-fructose 1-phosphate = ADP + D-fructose 1,6-bisphosphate
YP_002122841.1	catalyzes the reversible reaction of dihydroxyacetone phosphate with glyceraldehyde 3-phosphate to produce tagatose 1,6-bisphosphate; in Streptococcus pyogenes there are two paralogs of tagatose-bisphosphate aldolase, encoded by lacD1 and lacD2; expression of lacD1 is highly regulated by environmental conditions while lacD2 specializes in an efficient utilization of carbohydrate sources
YP_002122843.1	similar to ref|YP_001198405.1| Transcriptional antiterminator [Streptococcus suis 05ZYH33]; Mediates positive regulation of the lac operon by functioning as an antiterminator factor of transcription.
YP_002122844.1	similar to ref|YP_001198404.1| Phosphotransferase system cellobiose-specific component IIA [Streptococcus suis 05ZYH33]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in lactose transport.
YP_002122845.1	similar to ref|YP_599311.1| PTS system, lactose-specific IIBC component [Streptococcus pyogenes MGAS10270]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in lactose transport.
YP_002122846.1	catalyzes the formation of 6-phospho-galactose from a 6-phospho-beta-galactoside
YP_002122847.1	similar to ref|NP_973373.1| lipoprotein, [Treponema denticola ATCC 35405]
YP_002122848.1	similar to ref|YP_060761.1| Hypothetical membrane spanning protein [Streptococcus pyogenes MGAS10394]
YP_002122849.1	similar to ref|NP_607744.1| hypothetical protein spyM18_1711 [Streptococcus pyogenes MGAS8232]
YP_002122850.1	similar to ref|YP_060759.1| Transcriptional regulator, TetR family [Streptococcus pyogenes MGAS10394]
YP_002122851.1	similar to ref|YP_060758.1| DegV family protein [Streptococcus pyogenes MGAS10394]; The structure of this protein revealed a bound fatty-acid molecule in a pocket between the two protein domains. The structure indicates that this family has the molecular function of fatty-acid binding and may play a role in the cellular functions of fatty acid transport or metabolism.
YP_002122853.1	similar to ref|NP_664990.1|  ribose transport operon repressor [Streptococcus pyogenes MGAS315]; Transcriptional repressor for the ribose rbsDACBK operon.
YP_002122854.1	similar to ref|ZP_00783282.1| ribokinase [Streptococcus agalactiae H36B]; Ribose metabolism; first step.
YP_002122855.1	cytoplasmic mutarotase that catalyzes the conversion between beta-pyran and beta-furan forms of D-ribose; RbsD is required for efficient ribose utilization in E. coli; rbsD-mutant E. coli strains are unable to use ribose as a sole carbon source
YP_002122856.1	similar to ref|YP_328841.1| ribose ABC transporter, ATP-binding protein [Streptococcus agalactiae A909]; Part of the binding-protein-dependent transport system for ribose. Probably responsible for energy coupling to the transport system.
YP_002122857.1	similar to ref|ZP_00783299.1| ribose ABC transporter, permease [Streptococcus agalactiae H36B]; Part of the binding-protein-dependent transport system for ribose. Probably responsible for the translocation of the substrate across the membrane.
YP_002122858.1	similar to ref|YP_328839.1| ribose ABC transporter, ribose-binding protein [Streptococcus agalactiae A909]; Involved in the high-affinity D-ribose membrane transport system.
YP_002122860.1	similar to ref|YP_597122.1| hypothetical protein MGAS9429_Spy1390 [Streptococcus pyogenes MGAS9429]; Has carboxy terminal proline rich repeat motif.
YP_002122861.1	similar to ref|YP_597120.1| sodium-dependent phosphate transporter [Streptococcus pyogenes MGAS9429]
YP_002122862.1	similar to ref|YP_001127991.1| N-acetylglucosamine-6-phosphate deacetylase [Streptococcus pyogenes str. Manfredo]; Catalysis of the reaction: N-acetyl-D-glucosamine 6-phosphate + H2O = D-glucosamine 6-phosphate + acetate.
YP_002122863.1	similar to ref|YP_597118.1| aldo/keto reductase family [Streptococcus pyogenes MGAS9429]; Catalysis of an oxidation-reduction (redox) reaction, a reversible chemical reaction in which the oxidation state of an atom or atoms within a molecule is altered. One substrate acts as a hydrogen or electron donor and becomes oxidized, while the other acts as hydrogen or electron acceptor and becomes reduced.
YP_002122864.1	similar to gb|ABO37817.1| unknown [Lactococcus garvieae]
YP_002122865.1	similar to ref|YP_001485591.1| hypothetical membrane protein [Bacillus pumilus SAFR-032]
YP_002122866.1	similar to ref|YP_035932.1| conserved hypothetical protein, possible permease [Bacillus thuringiensis serovar konkukian str. 97-27]
YP_002122867.1	similar to ref|YP_001642502.1| ABC transporter related [Bacillus weihenstephanensis KBAB4]; Part of the ABC transporter complex possibly involved in bacitracin export. Responsible for energy coupling to the transport system.
YP_002122869.1	similar to ref|YP_280894.1| hypothetical membrane spanning protein [Streptococcus pyogenes MGAS6180]
YP_002122871.1	glycine--tRNA ligase alpha chain; GlyRS; class II aminoacyl tRNA synthetase; tetramer of alpha(2)beta(2); catalyzes a two-step reaction; first charging a glycine molecule by linking its carboxyl group to the alpha-phosphate of ATP; second by transfer of the aminoacyl-adenylate to its tRNA
YP_002122872.1	glycine--tRNA ligase beta chain; glyS; class II aminoacyl tRNA synthetase; tetramer of alpha(2)beta(2); catalyzes a two-step reaction; first charging a glycine molecule by linking the carboxyl group to the alpha-phosphate of ATP; second by transfer of the aminoacyl-adenylate to its tRNA
YP_002122874.1	similar to ref|NP_269721.1| hypothetical protein SPy_1687 [Streptococcus pyogenes M1 GAS]
YP_002122875.1	similar to gb|AAC19115.1| streptolysin S associated protein SagA [Streptococcus pyogenes]; Hemolysin/cytolysin.
YP_002122876.1	similar to gb|AAK53984.1| SagB [Streptococcus dysgalactiae subsp. equisimilis]; Involved in streptolysin S synthesis/transport/immunity.
YP_002122877.1	similar to gb|AAN16973.1|AF465842_3 SagC [Streptococcus iniae]; Involved in streptolysin S synthesis/transport/immunity.
YP_002122878.1	similar to ref|YP_598228.1| Streptolysin S biosynthesis protein SagD [Streptococcus pyogenes MGAS10270]; Involved in streptolysin S synthesis/transport/immunity.
YP_002122879.1	similar to gb|AAN16975.1|AF465842_5 SagE [Streptococcus iniae]; Involved in streptolysin S synthesis/transport/immunity.
YP_002122880.1	similar to gb|AAN16976.1|AF465842_6 SagF [Streptococcus iniae]; Involved in streptolysin S synthesis/transport/immunity.
YP_002122881.1	similar to gb|AAN16977.1|AF465842_7 SagG [Streptococcus iniae]; Involved in streptolysin S synthesis/transport/immunity.
YP_002122882.1	similar to gb|AAN16978.1|AF465842_8 SagH [Streptococcus iniae]; Involved in streptolysin S synthesis/transport/immunity.
YP_002122883.1	similar to gb|AAN16979.1|AF465842_9 SagI [Streptococcus iniae]; Involved in streptolysin S synthesis/transport/immunity.
YP_002122884.1	similar to ref|NP_001105492.1| proline-rich protein [Zea mays]
YP_002122885.1	similar to gb|ABA41496.1| collagen-like protein F [Streptococcus equi subsp. equi]; Possible fibronectin-binding adhesin, has a collagen-structural-motif domain composed of 51 Gly-Xaa-Yaa repeats.
YP_002122888.1	similar to gb|AAN18300.1|  lipoprotein [Streptococcus equi]
YP_002122890.1	similar to gb|AAN18302.1| Se22.9 [Streptococcus equi]; Involved in copper homeostasis.
YP_002122891.1	similar to gb|AAN18301.1|  acetyltransferase [Streptococcus equi]
YP_002122892.1	similar to ref|YP_596508.1| transposase [Streptococcus pyogenes MGAS9429]
YP_002122893.1	similar to ref|NP_721985.1| methylated-DNA--protein-cysteine S-methyltransferase [Streptococcus mutans UA159]; Involved in the cellular defense against the biological effects of O6-methylguanine (O6-MeG) in DNA. Repairs alkylated guanine in DNA by stoichiometrically transferring the alkyl group at the O-6 position to a cysteine residue in the enzyme. This is a suicide reaction:the enzyme is irreversibly inactivated.
YP_002122894.1	similar to ref|YP_059682.1| Arsenate reductase family protein [Streptococcus pyogenes MGAS10394]
YP_002122895.1	similar to ref|YP_596074.1| exodeoxyribonuclease III [Streptococcus pyogenes MGAS9429]; In addition to 3' to 5' exonuclease and 3'-phosphatase activities, exoA was shown to make single-strand breaks at apurinic sites in DNA.
YP_002122896.1	similar to ref|YP_596076.1| interleukin-8 protease [Streptococcus pyogenes MGAS9429]; This virulence factor of S.pyogenes specifically cleaves IL-8.
YP_002122897.1	similar to ref|ZP_00874690.1| conserved hypothetical protein [Streptococcus suis 89/1591]
YP_002122898.1	similar to emb|CAJ66811.1|  cell-wall anchored surface adhesin [Streptococcus agalactiae]; Unknown, possible cell surface adhesin/albumin-binding protein.
YP_002122899.1	similar to ref|ZP_02010661.1| Heparinase II/III family protein [Opitutaceae bacterium TAV2]
YP_002122900.1	similar to ref|YP_596079.1| hypothetical membrane spanning protein [Streptococcus pyogenes MGAS9429]
YP_002122901.1	methionine--tRNA ligase; MetRS; adds methionine to tRNA(Met) with cleavage of ATP to AMP and diphosphate; some MetRS enzymes form dimers depending on a C-terminal domain that is also found in other proteins such as Trbp111 in Aquifex aeolicus and the cold-shock protein CsaA from Bacillus subtilis while others do not; four subfamilies exist based on sequence motifs and zinc content
YP_002122902.1	similar to ref|YP_001451328.1| transcription activator plcR [Streptococcus gordonii str. Challis substr. CH1]
YP_002122903.1	possible competence stimulating peptide with double glycine leader peptide and ABC transporter secretion
YP_002122904.1	possible competence stimulating peptide with double glycine leader peptide and ABC transporter secretion.
YP_002122905.1	possible competence stimulating peptide with double glycine leader peptide and ABC transporter secretion.
YP_002122906.1	similar to ref|ZP_01824165.1| competence factor transporting ATP-binding/permease ComA [Streptococcus pneumoniae SP11-BS70]; Required for induction of competence. Seems to transport the competence-stimulating peptide (CSP).
YP_002122907.1	similar to ref|YP_815485.1| competence factor transport protein ComB [Streptococcus pneumoniae D39]; Required for induction of competence.
YP_002122908.1	similar to ref|ZP_00874789.1| conserved hypothetical protein [Streptococcus suis 89/1591]
YP_002122909.1	similar to ref|YP_601843.1| ribonucleotide-diphosphate reductase subunit beta [Streptococcus pyogenes MGAS10750]; Provides the precursors necessary for DNA synthesis. Catalyzes the biosynthesis of deoxyribonucleotides from the corresponding ribonucleotides.
YP_002122910.1	similar to ref|YP_601844.1| ribonucleotide reductase stimulatory protein [Streptococcus pyogenes MGAS10750]; Unknown; probably involved in ribonucleotide reductase function.
YP_002122911.1	Catalyzes the rate-limiting step in dNTP synthesis
YP_002122912.1	similar to ref|NP_486386.1| hypothetical protein alr2346 [Nostoc sp. PCC 7120]
YP_002122913.1	similar to ref|ZP_00781600.1| branched-chain amino acid transport system II carrier protein [Streptococcus agalactiae 18RS21]; Component of the transport system for branched-chain amino acids (leucine, isoleucine and valine) Which is coupled to a proton motive force.
YP_002122914.1	similar to ref|ZP_00875692.1| Transposase, IS204/IS1001/IS1096/IS1165 [Streptococcus suis 89/1591]
YP_002122915.1	similar to ref|ZP_02093562.1| hypothetical protein PEPMIC_00313 [Peptostreptococcus micros ATCC 33270]; Virulence factor that is important for the establishment of infection in the host. pfam06013 Proteins of 100 residues with WXG. ESAT-6 is a small protein appears to be of fundamental importance in virulence and protective immunity in Mycobacterium tuberculosis. Homologues have been detected in other Gram-positive bacterial species. It may represent a novel secretion system potentially driven by the pfam01580 domains in the YukA-like proteins.
YP_002122916.1	similar to ref|ZP_02093561.1| hypothetical protein PEPMIC_00312 [Peptostreptococcus micros ATCC 33270]; Unknown, likely involved in export of the adjacent ESAT-6 family protein.
YP_002122917.1	similar to ref|ZP_02093560.1| hypothetical protein PEPMIC_00311 [Peptostreptococcus micros ATCC 33270]
YP_002122918.1	similar to ref|ZP_02093559.1| hypothetical protein PEPMIC_00310 [Peptostreptococcus micros ATCC 33270]
YP_002122919.1	similar to ref|ZP_02093558.1| hypothetical protein PEPMIC_00309 [Peptostreptococcus micros ATCC 33270]; Required for secretion of esxA.
YP_002122920.1	similar to ref|ZP_02093557.1| hypothetical protein PEPMIC_00308 [Peptostreptococcus micros ATCC 33270]; Possibly involved in export of the adjacent ESAT-6 family protein.
YP_002122921.1	similar to ref|ZP_02093556.1| hypothetical protein PEPMIC_00307 [Peptostreptococcus micros ATCC 33270]
YP_002122922.1	similar to ref|ZP_02093555.1| hypothetical protein PEPMIC_00306 [Peptostreptococcus micros ATCC 33270]
YP_002122923.1	similar to ref|ZP_02093554.1| hypothetical protein PEPMIC_00305 [Peptostreptococcus micros ATCC 33270]
YP_002122924.1	similar to ref|ZP_02093553.1| hypothetical protein PEPMIC_00304 [Peptostreptococcus micros ATCC 33270]
YP_002122925.1	similar to ref|YP_001450781.1| Gene info hypothetical protein SGO_1502 [Streptococcus gordonii str. Challis substr. CH1]
YP_002122926.1	similar to ref|ZP_00230000.1| hypothetical protein LMOh7858_0095 [Listeria monocytogenes str. 4b H7858]
YP_002122927.1	similar to ref|ZP_02093564.1| hypothetical protein PEPMIC_00315 [Peptostreptococcus micros ATCC 33270]
YP_002122928.1	similar to ref|YP_983629.1| Gene info UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase [Polaromonas naphthalenivorans CJ2]
YP_002122929.1	similar to ref|NP_928651.1| hypothetical protein plu1347 [Photorhabdus luminescens subsp. laumondii TTO1]
YP_002122930.1	similar to ref|XP_001092846.1| PREDICTED: immunoglobulin lambda variable 7-43 [Macaca mulatta]
YP_002122931.1	similar to ref|ZP_01090397.1| hypothetical protein DSM3645_11836 [Blastopirellula marina DSM 3645]
YP_002122932.1	similar to ref|YP_001093031.1| Transketolase, central region [Shewanella loihica PV-4]
YP_002122933.1	similar to ref|NP_722087.1| hypothetical protein SMU.1764c [Streptococcus mutans UA159]; CRISPR mediated immunity, TIGRFAM TIGR01596.
YP_002122934.1	similar to ref|NP_722086.1| hypothetical protein SMU.1763c [Streptococcus mutans UA159]; CRISPR mediated immunity, TIGRFAM TIGR01876.
YP_002122935.1	similar to ref|YP_598979.1| hypothetical protein MGAS10270_Spy1370 [Streptococcus pyogenes MGAS10270]; CRISPR mediated immunity, TIGRFAM TIGR01863.
YP_002122936.1	similar to ref|YP_280757.1| hypothetical cytosolic protein [Streptococcus pyogenes MGAS6180]; CRISPR mediated immunity, TIGRFAM TIGR02589.
YP_002122937.1	similar to ref|NP_269629.1| hypothetical protein SPy_1563 [Streptococcus pyogenes M1 GAS]; CRISPR mediated immunity, TIGRFAM TIGR00372.
YP_002122938.1	similar to ref|YP_597011.1| hypothetical protein MGAS9429_Spy1280 [Streptococcus pyogenes MGAS9429]; CRISPR mediated immunity, TIGRFAM TIGR00287.
YP_002122939.1	similar to ref|NP_722078.1| hypothetical protein SMU.1753c [Streptococcus mutans UA159]; CRISPR mediated immunity, TIGRFAM TIGR01573.
YP_002122940.1	similar to ref|YP_001128141.1|  cytochrome c-type biogenesis protein [Streptococcus pyogenes str. Manfredo]; Could be involved in cytochrome c synthesis.
YP_002122941.1	similar to gb|AAN18289.1|  lipoprotein [Streptococcus equi]; Involved in disulfide bond formation; related to ResA
YP_002122942.1	similar to ref|NP_269624.1| bifunctional methionine sulfoxide reductase A/B protein [Streptococcus pyogenes M1 GAS]; Has an important function as a repair enzyme for proteins that have been inactivated by oxidation. Catalyzes the reversible oxidation-reduction of methionine sulfoxide in proteins to methionine.
YP_002122943.1	similar to gb|AAN18291.1|  two-component response regulator [Streptococcus equi]
YP_002122944.1	similar to ref|YP_282643.1| two-component sensor kinase [Streptococcus pyogenes MGAS5005]
YP_002122945.1	similar to ref|YP_602880.1| hypothetical cytosolic protein [Streptococcus pyogenes MGAS10750]
YP_002122946.1	similar to ref|YP_598902.1| hypothetical protein MGAS10270_Spy1293 [Streptococcus pyogenes MGAS10270]
YP_002122947.1	similar to ref|YP_619784.1| hypothetical protein Ldb2202 [Lactobacillus delbrueckii subsp. bulgaricus ATCC 11842]
YP_002122948.1	similar to ref|YP_598901.1| Arginine repressor, argR [Streptococcus pyogenes MGAS10270]; Regulates arginine biosynthesis genes.
YP_002122949.1	similar to dbj|BAE46419.1|  CRP/FNR transcriptional regulator [Streptococcus equi subsp. zooepidemicus]
YP_002122950.1	catalyzes the degradation of arginine to citruline and ammonia
YP_002122951.1	similar to dbj|BAE46421.1|  GNAT family acetyltransferase [Streptococcus equi subsp. zooepidemicus]
YP_002122952.1	catalyzes the formation of ornithine and carbamylphosphate from citrulline in the arginine catabolic pathway
YP_002122953.1	similar to dbj|BAE46423.1| arginine/ornithine antiporter [Streptococcus equi subsp. zooepidemicus]
YP_002122954.1	similar to ref|ZP_00365692.1| COG0624: Acetylornithine deacetylase/Succinyl-diaminopimelate desuccinylase and related deacylases [Streptococcus pyogenes M49 591]; catalyzing the hydrolysis of N2-acetyl-l-ornithine to l-ornithine and acetate.
YP_002122955.1	catalyzes the reversible synthesis of carbamate and ATP from carbamoyl phosphate and ADP
YP_002122956.1	catalyzes the formation of asparagine from aspartate and ammonia
YP_002122957.1	similar to ref|ZP_00365420.1| COG0742: N6-adenine-specific methylase [Streptococcus pyogenes M49 591]; Methyltransferase
YP_002122958.1	Catalyzes the conversion of ATP and pantetheine 4'-phosphate to diphosphate and 3'-dephospho-coA
YP_002122959.1	similar to ref|YP_060605.1| ATP-dependent protease La [Streptococcus pyogenes MGAS10394]
YP_002122960.1	similar to ref|YP_060601.1| Transcriptional regulator [Streptococcus pyogenes MGAS10394]
YP_002122961.1	23S rRNA m2A2503 methyltransferase; methylates the C2 position of the A2530 nucleotide in 23S rRNA; may be involved in antibiotic resistance
YP_002122962.1	similar to ref|YP_001451006.1| ABC transporter ATP-binding protein SP2003 [Streptococcus gordonii str. Challis substr. CH1]
YP_002122963.1	similar to ref|NP_687344.1| ABC transporter, permease,  [Streptococcus agalactiae 2603V/R]
YP_002122964.1	similar to ref|YP_139771.1| sensor histidine kinase (homolog to HK11 Spn) [Streptococcus thermophilus LMG 18311]
YP_002122965.1	similar to ref|ZP_00784861.1| response regulator [Streptococcus agalactiae COH1]
YP_002122966.1	similar to ref|YP_598885.1| Type 4 prepilin peptidase pilD [Streptococcus pyogenes MGAS10270]
YP_002122967.1	similar to ref|NP_269604.1|  peroxide resistance protein [Streptococcus pyogenes M1 GAS]; Is involved in iron storage. May also be involved in the metabolic response to stress conditions.
YP_002122968.1	similar to ref|NP_664985.1| hypothetical protein SpyM3_1181 [Streptococcus pyogenes MGAS315]
YP_002122969.1	similar to ref|NP_607614.1| glucose kinase [Streptococcus pyogenes MGAS8232]; Catalysis of the reaction: ATP + D-glucose = ADP + D-glucose 6-phosphate.
YP_002122970.1	similar to ref|YP_060595.1| Rhodanese-related sulfurtransferase [Streptococcus pyogenes MGAS10394]
YP_002122971.1	similar to ref|NP_269600.1|  GTP-binding protein TypA/BipA (tyrosine phosphorylated protein A) [Streptococcus pyogenes M1 GAS]; Unknown; probably interacts with the ribosomes in a GTP dependent manner.
YP_002122972.1	similar to ref|NP_607611.1| hypothetical protein spyM18_1543 [Streptococcus pyogenes MGAS8232]
YP_002122973.1	UDP-N-acetylmuramoylalanine--D-glutamate ligase; involved in peptidoglycan biosynthesis; cytoplasmic; catalyzes the addition of glutamate to the nucleotide precursor UDP-N-acetylmuramoyl-L-alanine during cell wall formation
YP_002122974.1	UDP-N-acetylglucosamine--N-acetylmuramyl- (pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase; involved in cell wall formation; inner membrane-associated; last step of peptidoglycan synthesis
YP_002122975.1	similar to ref|NP_269596.1| cell division protein [Streptococcus pyogenes M1 GAS]; Required for the initiation of cell division. Exact function not known.
YP_002122976.1	similar to ref|YP_060589.1| Cell division protein ftsA [Streptococcus pyogenes MGAS10394]; This protein may be involved in anomalous filament growth. May be a component of the septum. It may interact with ftsZ (By similarity).
YP_002122977.1	similar to ref|YP_280652.1| pyridoxal-5'-phosphate family protein [Streptococcus pyogenes MGAS6180]
YP_002122978.1	similar to ref|ZP_00366475.1| COG1799: Uncharacterized protein conserved in bacteria [Streptococcus pyogenes M49 591]
YP_002122979.1	similar to ref|ZP_00366474.1| COG0762: Predicted integral membrane protein [Streptococcus pyogenes M49 591]
YP_002122980.1	similar to ref|YP_060584.1| RNA binding protein [Streptococcus pyogenes MGAS10394]; Unknown, The S4 domain is a small domain consisting of 60-65 amino acid residues that was detected in the bacterial ribosomal protein S4, eukaryotic ribosomal S9, two families of pseudouridine synthases, a novel family of predicted RNA methylases, a yeast protein containing a pseudouridine synthetase and a deaminase domain, bacterial tyrosyl-tRNA synthetases, and a number of uncharacterized, small proteins that may be involved in translation regulation. The S4 domain probably mediates binding to RNA.
YP_002122981.1	similar to ref|YP_280648.1| cell division initiation protein DivIVA [Streptococcus pyogenes MGAS6180]
YP_002122982.1	IleRS; catalyzes the formation of isoleucyl-tRNA(Ile) from isoleucine and tRNA(Ile); since isoleucine and other amino acids such as valine are similar, there are additional editing function in this enzyme; one is involved in hydrolysis of activated valine-AMP and the other is involved in deacylation of mischarged Val-tRNA(Ile); there are two active sites, one for aminoacylation and one for editing; class-I aminoacyl-tRNA synthetase family; some organisms carry two different copies of this enzyme
YP_002122983.1	similar to ref|NP_607599.1| hypothetical protein spyM18_1529 [Streptococcus pyogenes MGAS8232]
YP_002122984.1	similar to ref|YP_280645.1| mutator protein (7,8-dihydro-8-oxoguanine-triphosphatase) [Streptococcus pyogenes MGAS6180]; Specific for pyrimidine substrates. Acts on 5-methyl- dCTP, CTP and dCTP in decreasing order.
YP_002122985.1	similar to ref|YP_596966.1| ATP-dependent endopeptidase clp ATP-binding subunit [Streptococcus pyogenes MGAS9429]; Could be necessary for degrading proteins generated by certain types of stress.
YP_002122986.1	similar to ref|NP_269584.1| hypothetical protein SPy_1508 [Streptococcus pyogenes M1 GAS]
YP_002122987.1	similar to ref|NP_730978.1| sec23 CG1250-PA, isoform A [Drosophila melanogaster]
YP_002122988.1	similar to gb|ABA41499.1| collagen-like protein I [Streptococcus equi subsp. equi]; Possible adhesin, has a collagen-structural-motif domain composed of 95 Gly-Xaa-Yaa repeats.
YP_002122989.1	similar to ref|YP_280642.1| arginine transport system permease [Streptococcus pyogenes MGAS6180]; Probably part of a binding-protein-dependent transport system for an amino acid. Probably responsible for the translocation of the substrate across the membrane.
YP_002122990.1	similar to ref|NP_607595.1|  amino acid ABC transporter (permease) [Streptococcus pyogenes MGAS8232]; Part Of The Binding-Protein-Dependent Transport System For Glutamine; Probably Responsible For The Translocation Of The Substrate Across The Membrane.
YP_002122991.1	similar to ref|NP_721003.1|  amino acid ABC transporter, ATP-binding protein [Streptococcus mutans UA159]; Probably part of a binding-protein-dependent transport system for an amino acid. Probably responsible for energy coupling to the transport system.
YP_002122993.1	similar to ref|ZP_00790189.1| phosphoglucomutase/phosphomannomutase family protein [Streptococcus agalactiae 515]; May be involved in the production of an extracellular matrix that lends structure to the pellicle of biofilms. Through its possible activity of phosphoexomutase, it may promote the synthesis of nucleotide sugars, which are incorporated into exopolysaccharides of the extracelllular matrix of B.subtilis communities.
YP_002122994.1	catalyzes the formation of 5,10-methenyltetrahydrofolate from 5,10-methylenetetrahydrofolate and subsequent formation of 10-formyltetrahydrofolate from 5,10-methenyltetrahydrofolate
YP_002122995.1	similar to ref|YP_139133.1| hypothetical protein stu0612 [Streptococcus thermophilus LMG 18311]
YP_002122997.1	bidirectionally degrades single-stranded DNA into large acid-insoluble oligonucleotides
YP_002122998.1	catalyzes the bidirectional exonucleolytic cleavage of DNA
YP_002122999.1	similar to ref|NP_607588.1| geranyltranstransferase [Streptococcus pyogenes MGAS8232]
YP_002123000.1	similar to ref|NP_664957.1|  hemolysin [Streptococcus pyogenes MGAS315]
YP_002123001.1	similar to ref|YP_598854.1| Arginine repressor, argR [Streptococcus pyogenes MGAS10270]; Regulates arginine biosynthesis genes.
YP_002123002.1	similar to ref|YP_600842.1| DNA repair protein recN [Streptococcus pyogenes MGAS2096]; May be involved in recombinational repair of damaged DNA.
YP_002123003.1	similar to ref|YP_602827.1| hypothetical protein MGAS10750_Spy1333 [Streptococcus pyogenes MGAS10750]
YP_002123004.1	similar to ref|YP_598851.1| Fatty acid-binding protein, DegV family [Streptococcus pyogenes MGAS10270]
YP_002123005.1	similar to ref|YP_282588.1| lipase/acylhydrolase with GDSL-like motif [Streptococcus pyogenes MGAS5005]
YP_002123006.1	similar to ref|YP_280628.1| hypothetical membrane associated protein [Streptococcus pyogenes MGAS6180]
YP_002123007.1	similar to ref|NP_664950.1|  histone-like DNA-binding protein [Streptococcus pyogenes MGAS315]; Histone-like DNA-binding protein which is capable of wrapping DNA to stabilize it, and thus to prevent its denaturation under extreme environmental conditions. Seems also to act as a fortuitous virulence factor in delayed sequelae by binding to heparan sulfate-proteoglycans in the extracellular matrix of target organs and acting as a nidus for in situ immune complex formation.
YP_002123008.1	similar to ref|YP_597959.1| C3 family ADP-ribosyltransferase [Streptococcus pyogenes MGAS10270]
YP_002123009.1	similar to ref|YP_001450179.1| transporter,  SP1116 [Streptococcus gordonii str. Challis substr. CH1]
YP_002123010.1	similar to ref|NP_734700.1| hypothetical protein gbs0231 [Streptococcus agalactiae NEM316]
YP_002123011.1	similar to ref|ZP_01820549.1| transcriptional regulator MutR,  [Streptococcus pneumoniae SP6-BS73]
YP_002123012.1	similar to ref|NP_664896.1| hypothetical protein SpyM3_1092 [Streptococcus pyogenes MGAS315]
YP_002123013.1	catalyzes the conversion of dihydroorotate to orotate in the pyrimidine biosynthesis pathway; subclass 1A is a dimer formed by two identical PyrD subunits each containing an FMN group
YP_002123015.1	2,3-bisphosphoglycerate-dependent; catalyzes the interconversion of 2-phosphoglycerate to 3-phosphoglycerate
YP_002123016.1	similar to ref|YP_280622.1| transcriptional regulator, biotin repressor family [Streptococcus pyogenes MGAS6180]
YP_002123018.1	similar to ref|NP_269515.1| hypothetical protein SPy_1425 [Streptococcus pyogenes M1 GAS]
YP_002123019.1	similar to ref|YP_596939.1| formate transporter [Streptococcus pyogenes MGAS9429]; Involved in the bidirectional transport of formate.
YP_002123020.1	similar to ref|YP_820120.1| Cell division protein FtsI/penicillin-binding protein 2 [Streptococcus thermophilus LMD-9]; Cell Wall Formation; Pbp-2 Is Responsible For The Determination Of The Rod Shape Of The Cell. Its Synthesize Cross- Linked Peptidoglycan From The Lipid Intermediates.
YP_002123021.1	involved in a recombinational process of DNA repair, independent of the recBC complex
YP_002123022.1	D-alanine--D-alanine ligase; DdlA; DdlB; cytoplasmic; catalyzes the formation of D-alanyl-D-alanine from two D-alanines in peptidoglycan synthesis; there are two forms of this enzyme in Escherichia coli
YP_002123023.1	similar to ref|YP_598837.1| UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase [Streptococcus pyogenes MGAS10270]; Involved in cell wall formation. Catalyzes the final step in the synthesis of UDP-N-acetylmuramoyl-pentapeptide, the precursor of murein.
YP_002123024.1	similar to ref|NP_802044.1| hypothetical protein SPs0782 [Streptococcus pyogenes SSI-1]
YP_002123025.1	stimulates the release of release factors 1 and 2 from the ribosome after hydrolysis of the ester bond in peptidyl-tRNA has occurred; GDP/GTP-binding protein
YP_002123026.1	similar to ref|NP_269508.1|  ATP-dependent RNA helicase [Streptococcus pyogenes M1 GAS]; Has A Helix-Destabilizing Activity. Plays A Key Role In Optimal Cell Growth At Low Temperature And Is Required For Normal Cell Division. Suppressor Of A Mutant Defective In Rpsb Gene For Ribosomal Protein S2.
YP_002123027.1	similar to ref|YP_060497.1| Kup system potassium uptake protein [Streptococcus pyogenes MGAS10394]; Transport of potassium into the cell.
YP_002123028.1	similar to ref|YP_598831.1| hypothetical protein with endo/excinuclease domain [Streptococcus pyogenes MGAS10270]
YP_002123029.1	similar to ref|YP_280610.1| methyltransferase [Streptococcus pyogenes MGAS6180]
YP_002123030.1	similar to ref|YP_598829.1| 1-acyl-sn-glycerol-3-phosphate acyltransferase [Streptococcus pyogenes MGAS10270]; Catalysis of the reaction: acyl-CoA + 1-acyl-sn-glycerol 3-phosphate = CoA + 1,2-diacyl-sn-glycerol 3-phosphate.
YP_002123031.1	similar to ref|YP_280608.1| ComE operon protein 1 [Streptococcus pyogenes MGAS6180]; Needed for both DNA binding and transport. It is absolutely required for the uptake of transforming DNA but not for binding. Its role in binding may be indirect.
YP_002123032.1	similar to ref|YP_001128281.1|  competence protein [Streptococcus pyogenes str. Manfredo]; The comE operon is required for the binding and uptake of transforming DNA. ComEC is required for internalization but is dispensable for DNA binding.
YP_002123033.1	required for the assembly and function of the DNAX complex which is required for the assembly of the beta subunit onto primed DNA
YP_002123034.1	similar to ref|NP_802054.1|  superoxide dismutase (Fe/Mn) [Streptococcus pyogenes SSI-1]; Destroys radicals which are normally produced within the cells and which are toxic to biological systems.
YP_002123035.1	similar to ref|YP_282504.1| hypothetical cytosolic protein [Streptococcus pyogenes MGAS5005]
YP_002123036.1	similar to ref|YP_060432.1| Glucosamine-6-phosphate isomerase [Streptococcus pyogenes MGAS10394]; Catalyzes the reversible isomerization-deamination of glucosamine 6-phosphate (GlcN6P) to form fructose 6-phosphate (Fru6P) and ammonium ion.
YP_002123037.1	similar to ref|YP_598817.1| Ribosomal small subunit pseudouridine synthase A [Streptococcus pyogenes MGAS10270]; Responsible for synthesis of pseudouridine from uracil- 516 in 16S ribosomal RNA.
YP_002123038.1	similar to ref|YP_282500.1|  competence protein/transcription factor [Streptococcus pyogenes MGAS5005]
YP_002123039.1	similar to ref|YP_060429.1| Oligoendopeptidase F [Streptococcus pyogenes MGAS10394]; Has oligopeptidase activity and degrades a variety of small bioactive peptides, including bradykinin, neurotensin, and peptide fragments of substance P and adrenocorticotropin. Also hydrolyzes the synthetic collagen-like substrate N-(3-[2- furyl]acryloyl)-Leu-Gly-Pro-Ala (FALGPA).
YP_002123040.1	similar to ref|YP_001032265.1| acetyltransferase, GNAT family [Lactococcus lactis subsp. cremoris MG1363]
YP_002123041.1	similar to ref|ZP_00786299.1| hydrolase, haloacid dehalogenase-like family [Streptococcus agalactiae COH1]
YP_002123042.1	similar to ref|ZP_00784655.1| hydrolase, haloacid dehalogenase-like family [Streptococcus agalactiae COH1]; Displays high phosphatase activity toward erythrose 4- phosphate, fructose 6-phosphate, 2-deoxyglucose 6-phosphate, and mannose 6-phosphate. May have a role in the intracellular metabolism of many phosphorylated carbohydrates.
YP_002123043.1	similar to ref|YP_282497.1| O-methyltransferase [Streptococcus pyogenes MGAS5005]; 4-O-methyltransferase for the lactone ring of midecamycin and other macrolide antibiotics.
YP_002123044.1	cis/trans isomerase of peptidylprolyl; PPIase; membrane-bound lipoprotein
YP_002123045.1	Catalyzes a two-step reaction, first charging an alanyl molecule by linking its carboxyl group to the alpha-phosphate of ATP, followed by transfer of the aminoacyl-adenylate to its tRNA
YP_002123046.1	similar to gb|AAS09918.1| phage-encoded extracellular streptodornase D [Streptococcus pyogenes]; deoxyribonuclease
YP_002123048.1	similar to ref|YP_596896.1| peptidoglycan N-acetylglucosamine deacetylase [Streptococcus pyogenes MGAS9429]
YP_002123049.1	similar to ref|YP_280578.1| ATP-dependent RNA helicase [Streptococcus pyogenes MGAS6180]; Has A Helix-Destabilizing Activity. Plays A Key Role In Optimal Cell Growth At Low Temperature And Is Required For Normal Cell Division. Suppressor Of A Mutant Defective In Rpsb Gene For Ribosomal Protein S2.
YP_002123050.1	functions in pyrimidine salvage; pyrimidine ribonucleoside kinase; phosphorylates nucleosides or dinucleosides to make UMP or CMP using ATP or GTP as the donor
YP_002123051.1	similar to ref|ZP_01818391.1| hypothetical protein CGSSp3BS71_02178 [Streptococcus pneumoniae SP3-BS71]
YP_002123052.1	similar to ref|NP_607474.1| hypothetical protein spyM18_1378 [Streptococcus pyogenes MGAS8232]
YP_002123053.1	similar to ref|ZP_00365499.1| COG1956: GAF domain-containing protein [Streptococcus pyogenes M49 591]
YP_002123054.1	catalyzes the DNA-template-directed extension of the 3'-end of a DNA strand; the tau chain serves as a scaffold to help in the dimerizaton of the alpha,epsilon and theta core complex; the gamma chain seems to interact with the delta and delta' subunits to transfer the beta subunit on the DNA
YP_002123055.1	similar to ref|YP_060403.1| hypothetical protein M6_Spy1085 [Streptococcus pyogenes MGAS10394]
YP_002123056.1	catalyzes the formation of biotinyl-5'-AMP, also acts as a transcriptional repressor of the biotin operon
YP_002123057.1	similar to ref|YP_001198943.1|  internalin A precursor [Streptococcus suis 05ZYH33]; Mediates the entry of Listeria monocytogenes into cells.
YP_002123058.1	catalyzes the formation of S-adenosylmethionine from methionine and ATP; methionine adenosyltransferase
YP_002123060.1	adds enolpyruvyl to UDP-N-acetylglucosamine as a component of cell wall formation; gram-positive bacteria have 2 copies of MurA which are active
YP_002123062.1	similar to ref|ZP_00783009.1| sugar transporter, [Streptococcus agalactiae H36B]
YP_002123063.1	similar to ref|ZP_00132613.2| COG0524: Sugar kinases, ribokinase family [Haemophilus somnus 2336]; Catalysis of the reaction: ATP + 2-dehydro-3-deoxy-D-gluconate = ADP + beta-L-arabinose 1-phosphate.
YP_002123064.1	similar to emb|CAI72019.1| beta-glucuronidase [Streptococcus equi subsp. zooepidemicus]
YP_002123065.1	similar to ref|YP_598782.1| Transcriptional regulator, GntR family [Streptococcus pyogenes MGAS10270]; May be a regulatory protein for the LCT genes.
YP_002123066.1	similar to ref|YP_598781.1| 4-Hydroxy-2-oxoglutarate aldolase / 2-dehydro-3-deoxyphosphogluconate aldolase [Streptococcus pyogenes MGAS10270]; Key enzyme in the Enter-Duodoroff pathway. Participates in the regulation of the intracellular level of glyoxylate.
YP_002123067.1	catalyzes the interconversion of D-glucuronate to D-fructuronate or D-galacturonate to D-tagaturonate; functions in glucuronic and galacturonic metabolism
YP_002123068.1	catalyzes the formation of 2-dehydro-3-deoxy-D-gluconate from mannonate
YP_002123069.1	Converts D-mannonate to D-mannuronate
YP_002123070.1	similar to ref|YP_598777.1| Phosphoglycolate phosphatase [Streptococcus pyogenes MGAS10270]
YP_002123072.1	similar to dbj|BAD00711.2| cell surface protein precursor [Streptococcus equi subsp. zooepidemicus]; Binds to the constant Fc region of IgG with high affinity.
YP_002123073.1	similar to ref|NP_735312.1| hypothetical protein gbs0862 [Streptococcus agalactiae NEM316]
YP_002123074.1	similar to ref|YP_602697.1| Cytosolic protein containing multiple CBS domains [Streptococcus pyogenes MGAS10750]
YP_002123075.1	similar to ref|YP_280563.1| methionine aminopeptidase [Streptococcus pyogenes MGAS6180]; Removes the amino-terminal methionine from nascent proteins.
YP_002123076.1	catalyzes the formation of 5-O-(1-carboxyvinyl)-3-phosphoshikimate from phosphoenolpyruvate and 3-phosphoshikimate in tryptophan biosynthesis
YP_002123077.1	catalyzes the formation of shikimate 3-phosphate from shikimate in aromatic amino acid biosynthesis
YP_002123078.1	similar to ref|YP_282462.1| transcriptional regulator, LytR family [Streptococcus pyogenes MGAS5005]; Cell envelope-related transcriptional attenuator.
YP_002123079.1	similar to ref|YP_001128325.1|  RNA methyltransferase [Streptococcus pyogenes str. Manfredo]; Could be a 23s rRNA (Uracil-5-)-Methyltransferase.
YP_002123081.1	similar to ref|YP_598099.1| Phosphoglycerate mutase family protein [Streptococcus pyogenes MGAS10270]
YP_002123082.1	similar to ref|YP_598100.1| hypothetical protein MGAS10270_Spy0491 [Streptococcus pyogenes MGAS10270]
YP_002123083.1	similar to ref|ZP_00365794.1| COG2606: Uncharacterized conserved protein [Streptococcus pyogenes M49 591]
YP_002123084.1	similar to ref|YP_598102.1| Thiamine transporter [Streptococcus pyogenes MGAS10270]
YP_002123085.1	similar to ref|YP_602013.1| N-acetylmuramoyl-L-alanine amidase [Streptococcus pyogenes MGAS10750]
YP_002123086.1	similar to ref|YP_602014.1| Integral membrane protein [Streptococcus pyogenes MGAS10750]
YP_002123088.1	similar to ref|YP_598106.1| Glutathione peroxidase [Streptococcus pyogenes MGAS10270]; Catalysis of the reaction: 2 glutathione + H2O2 = oxidized glutathione + 2 H2O.
YP_002123089.1	similar to ref|YP_279952.1| oligoendopeptidase F [Streptococcus pyogenes MGAS6180]
YP_002123090.1	catalyzes the formation of oxaloacetate from phosphoenolpyruvate
YP_002123091.1	similar to ref|NP_606853.1|  cell division protein [Streptococcus pyogenes MGAS8232]; This is a septum-peptidoglycan biosynthetic protein, involved in cell wall formation. Plays a role in the stabilization of the ftsZ ring during cell division.
YP_002123092.1	similar to ref|YP_820727.1| Transcriptional regulator, xre family [Streptococcus thermophilus LMD-9]
YP_002123093.1	similar to ref|YP_139930.1| hypothetical protein stu1512 [Streptococcus thermophilus LMG 18311]
YP_002123094.1	similar to ref|YP_001034395.1| Bacteriocin ABC-type exporter, ATP binding/permease,  [Streptococcus sanguinis SK36]
YP_002123095.1	similar to ref|YP_001034395.1| Bacteriocin ABC-type exporter, ATP binding/permease,  [Streptococcus sanguinis SK36]
YP_002123097.1	recognizes the termination signals UGA and UAA during protein translation a specificity which is dependent on amino acid residues residing in loops of the L-shaped tRNA-like molecule of RF2; in some organisms control of PrfB protein levels is maintained through a +1 ribosomal frameshifting mechanism; this protein is similar to release factor 1
YP_002123098.1	similar to ref|NP_268888.1|  cell-division ATP-binding protein [Streptococcus pyogenes M1 GAS]
YP_002123099.1	similar to ref|YP_059871.1| Cell division protein FtsX [Streptococcus pyogenes MGAS10394]
YP_002123100.1	similar to ref|YP_001197921.1| Zn-dependent hydrolase, including glyoxylases [Streptococcus suis 05ZYH33]
YP_002123101.1	unwinds DNA
YP_002123102.1	similar to ref|YP_001450579.1| hypothetical protein SGO_1298 [Streptococcus gordonii str. Challis substr. CH1]
YP_002123103.1	catalyzes the formation of oxalozcetate and L-glutamate from L-aspartate and 2-oxoglutarate
YP_002123104.1	catalyzes a two-step reaction, first charging an asparagine molecule by linking its carboxyl group to the alpha-phosphate of ATP, followed by transfer of the aminoacyl-adenylate to its tRNA
YP_002123105.1	similar to gb|AAQ91577.1| collagen-like protein 3 [Streptococcus equi]; Possible adhesin, has a collagen-structural-motif domain composed of 62 Gly-Xaa-Yaa repeats.
YP_002123106.1	similar to ref|NP_268894.1| hypothetical protein SPy_0652 [Streptococcus pyogenes M1 GAS]
YP_002123107.1	similar to ref|YP_279987.1| transporter [Streptococcus pyogenes MGAS6180]
YP_002123108.1	similar to gb|AAK33617.1| conserved hypothetical protein [Streptococcus pyogenes M1 GAS]
YP_002123109.1	similar to emb|CAA11401.1| InsA protein [Escherichia coli]
YP_002123110.1	similar to ref|NP_414562.1| IS1 transposase InsAB' [Escherichia coli K12]
YP_002123111.1	similar to ref|YP_279989.1| dipeptidase [Streptococcus pyogenes MGAS6180]
YP_002123112.1	similar to ref|YP_059881.1| High-affinity zinc uptake system protein znuA precursor [Streptococcus pyogenes MGAS10394]; Part of the ATP-driven transport system adcABC for zinc.
YP_002123113.1	similar to ref|YP_602121.1| Transcriptional regulator, GntR family [Streptococcus pyogenes MGAS10750]
YP_002123114.1	similar to ref|YP_001128798.1| tagatose-6-phosphate aldose/ketose isomerase [Streptococcus pyogenes str. Manfredo]; May be a tagatose-6-phosphate ketose/aldose isomerase.
YP_002123115.1	catalyzes the reversible reaction of dihydroxyacetone phosphate with glyceraldehyde 3-phosphate to produce tagatose 1,6-bisphosphate; in Streptococcus pyogenes there are two paralogs of tagatose-bisphosphate aldolase, encoded by lacD1 and lacD2; expression of lacD1 is highly regulated by environmental conditions while lacD2 specializes in an efficient utilization of carbohydrate sources
YP_002123116.1	similar to ref|YP_001197814.1| Transcriptional regulator [Streptococcus suis 05ZYH33]
YP_002123117.1	similar to ref|ZP_00875460.1| Beta-galactosidase [Streptococcus suis 89/1591]; Preferentially hydrolyzes beta(1->3) galactosyl linkages over beta(1->4) linkages.
YP_002123118.1	similar to ref|YP_001197816.1| Phosphotransferase system, mannose/fructose/N-acetylgalactosamine-specific component IIB [Streptococcus suis 05ZYH33]; LevD and levE act as negative regulators of the levanase operon. They may be involved in a PTS-mediated phosphorylation of a regulator.
YP_002123119.1	similar to ref|NP_344611.1| PTS system, IIC component [Streptococcus pneumoniae TIGR4]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in fructose transport.
YP_002123120.1	similar to ref|ZP_00875457.1| PTS system mannose/fructose/sorbose family IID component [Streptococcus suis 89/1591]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in mannose transport.
YP_002123121.1	similar to ref|ZP_00875456.1| PTS system fructose subfamily IIA component [Streptococcus suis 89/1591]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active-transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in mannose transport.
YP_002123122.1	RpmE2; there appears to be two types of ribosomal proteins L31 in bacterial genomes; some contain a CxxC motif while others do not; Bacillus subtilis has both types; the proteins in this cluster do not have the CXXC motif; RpmE is found in exponentially growing Bacilli while YtiA was found after exponential growth; expression of ytiA is controlled by a zinc-specific transcriptional repressor; RpmE contains one zinc ion and a CxxC motif is responsible for this binding; forms an RNP particle along with proteins L5, L18, and L25 and 5S rRNA; found crosslinked to L2 and L25 and EF-G; may be near the peptidyltransferase site of the 50S ribosome
YP_002123123.1	similar to ref|YP_281910.1| phosphoesterase, DHH family protein [Streptococcus pyogenes MGAS5005]
YP_002123124.1	similar to ref|YP_001344360.1| GCN5-related N-acetyltransferase [Actinobacillus succinogenes 130Z]
YP_002123125.1	similar to ref|YP_139256.1| adenosine deaminase [Streptococcus thermophilus LMG 18311]; Catalysis of the reaction: adenosine + H2O = inosine + NH3.
YP_002123126.1	An electron-transfer protein; flavodoxin binds one FMN molecule, which serves as a redox-active prosthetic group
YP_002123127.1	similar to emb|CAM30580.1| chorismate mutase type II protein [Streptococcus pyogenes str. Manfredo]; Catalysis of the reaction: chorismate = prephenate.
YP_002123128.1	similar to ref|NP_721660.1|  permease, chloride channel [Streptococcus mutans UA159]
YP_002123129.1	similar to ref|YP_281913.1| chloride channel protein [Streptococcus pyogenes MGAS5005]
YP_002123130.1	this protein is located at the 30S-50S ribosomal subunit interface and may play a role in the structure and function of the aminoacyl-tRNA binding site
YP_002123131.1	similar to ref|YP_596326.1| streptodornase [Streptococcus pyogenes MGAS9429]; deozyribonuclease
YP_002123132.1	similar to ref|YP_598462.1| phage protein [Streptococcus phage 10270.2]
YP_002123133.1	similar to ref|NP_664861.1|  transcriptional regulator protein [Streptococcus pyogenes MGAS315]
YP_002123134.1	similar to ref|ZP_00785582.1| membrane protein, [Streptococcus agalactiae COH1]
YP_002123135.1	similar to ref|YP_598804.1| Chloride channel protein [Streptococcus pyogenes MGAS10270]
YP_002123136.1	B2 or R2 protein; type 1b enzyme; catalyzes the rate-limiting step in dNTP synthesis; converts nucleotides to deoxynucleotides; forms a homodimer and then a multimeric complex with NrdE
YP_002123137.1	similar to ref|NP_802075.1|  glutaredoxin [Streptococcus pyogenes SSI-1]; Electron transport system for the ribonucleotide reductase system nrdEF.
YP_002123138.1	similar to ref|YP_329567.1| phosphocarrier protein HPr [Streptococcus agalactiae A909]; P-Ser-HPr interacts with the catabolite control protein A (ccpA), forming a complex that binds to DNA at the catabolite reponse elements cre, operator sites preceding a large number of catabolite-regulated genes. Thus, P-Ser-HPr is a corepressor in carbon catabolite repression (CCR), a mechanism that allows bacteria to coordinate and optimise the utilization of available carbon sources. P-Ser-HPr also plays a role in inducer exclusion, in which it probably interacts with several non-PTS permeases and inhibits their transport activity.
YP_002123139.1	similar to ref|NP_269478.1| phosphoenolpyruvate:sugar phosphotransferase system enzyme I [Streptococcus pyogenes M1 GAS]; This is a component of the phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system. Enzyme I transfers the phosphoryl group from phosphoenolpyruvate (PEP) to the phosphoryl carrier protein (HPr). Enzyme I is common to all PTS.
YP_002123140.1	similar to ref|YP_001128305.1|  NADP-dependent glyceraldehyde-3-phosphate dehydrogenase [Streptococcus pyogenes str. Manfredo]; 4-aminobutyrate (GABA) degradation.
YP_002123141.1	similar to ref|ZP_00790437.1| cell division protein, FtsW/RodA/SpoVE family [Streptococcus agalactiae 515]
YP_002123142.1	similar to ref|YP_280000.1| DNA gyrase related protein [Streptococcus pyogenes MGAS6180]
YP_002123143.1	negatively supercoils closed circular double-stranded DNA
YP_002123144.1	acts to negatively regulates ftsZ ring formation by modulating the frequency and position of the ftsZ ring formation
YP_002123147.1	similar to ref|YP_598223.1| hypothetical cytosolic protein [Streptococcus pyogenes MGAS10270]
YP_002123148.1	enolase; catalyzes the formation of phosphoenolpyruvate from 2-phospho-D-glycerate in glycolysis
YP_002123149.1	similar to ref|YP_001198867.1| hypothetical protein SSU05_1501 [Streptococcus suis 05ZYH33]
YP_002123150.1	similar to ref|YP_001198866.1| Cytotoxic translational repressor of toxin-antitoxin stability system [Streptococcus suis 05ZYH33]
YP_002123151.1	similar to ref|NP_688076.1| IS861, transposase OrfA [Streptococcus agalactiae 2603V/R]
YP_002123152.1	similar to ref|NP_721000.1|  transposase, ISSmu1 [Streptococcus mutans UA159]
YP_002123153.1	similar to gb|AAA37416.1| complement factor H-related protein
YP_002123154.1	similar to ref|YP_596357.1| endonuclease/exonuclease/phosphatase family protein [Streptococcus pyogenes MGAS9429]
YP_002123156.1	similar to ref|ZP_00365711.1| COG4708: Predicted membrane protein [Streptococcus pyogenes M49 591]
YP_002123157.1	this protein catalyzes the formation of phosphodiester linkages between 5'-phosphoryl and 3'-hydroxyl groups in double-stranded DNA using NAD as a coenzyme and as the energy source for the reaction; essential for DNA replication and repair of damaged DNA; similar to ligase LigB
YP_002123158.1	similar to YegS from E. coli
YP_002123159.1	similar to ref|NP_721883.1| glycogen branching enzyme [Streptococcus mutans UA159]; Hydrolyzes the alpha-1,6-glucosidic linkages in glycogen which has first been partially depolymerized by phosphorylase. Shows only very little activity with native glycogen.
YP_002123160.1	catalyzes the transfer of a segment of a 1,4-alpha-D-glucan chain to a primary hydroxy group in a similar glucan chain
YP_002123161.1	catalyzes the formation of ADP-glucose and diphosphate from ATP and alpha-D-glucose 1-phosphate
YP_002123162.1	similar to ref|NP_721881.1|  glycogen biosynthesis protein GlgD [Streptococcus mutans UA159]; Required for the synthesis of glycogen, glucose-1-phosphate adenylyltransferase.
YP_002123163.1	catalyzes the formation of alpha-1,4-glucan chains from ADP-glucose
YP_002123164.1	similar to ref|NP_721879.1| glycogen phosphorylase [Streptococcus mutans UA159]; Phosphorylase is an important allosteric enzyme in carbohydrate metabolism. Enzymes from different sources differ in their regulatory mechanisms and in their natural substrates. However, all known phosphorylases share catalytic and structural properties.
YP_002123165.1	produces ATP from ADP in the presence of a proton gradient across the membrane; subunit C is part of the membrane proton channel F0
YP_002123166.1	Produces ATP from ADP in the presence of a proton gradient across the membrane. Subunit A is part of the membrane proton channel F0
YP_002123167.1	Produces ATP from ADP in the presence of a proton gradient across the membrane. Subunit B is part of the membrane proton channel.
YP_002123168.1	Produces ATP from ADP in the presence of a proton gradient across the membrane; the delta subunit is part of the catalytic core of the ATP synthase complex
YP_002123169.1	produces ATP from ADP in the presence of a proton gradient across the membrane; the alpha chain is a catalytic subunit
YP_002123170.1	Produces ATP from ADP in the presence of a proton gradient across the membrane. The gamma chain is a regulatory subunit
YP_002123171.1	Produces ATP from ADP in the presence of a proton gradient across the membrane. The beta chain is a regulatory subunit
YP_002123172.1	part of catalytic core of ATP synthase; alpha(3)beta(3)gamma(1)delta(1)epsilon(1); involved in producing ATP from ADP in the presence of the proton motive force across the membrane
YP_002123173.1	similar to ref|YP_059918.1| Hypothetical membrane associated protein [Streptococcus pyogenes MGAS10394]
YP_002123174.1	adds enolpyruvyl to UDP-N-acetylglucosamine as a component of cell wall formation; gram-positive bacteria have 2 copies of MurA which are active
YP_002123175.1	similar to gb|AAK33707.1| conserved competence associated hypothetical protein [Streptococcus pyogenes M1 GAS]
YP_002123176.1	similar to ref|YP_139616.1| competence associated membrane nuclease [Streptococcus thermophilus LMG 18311]; By degrading DNA that enters the cell, plays a role in the competence of cells to be transformed.
YP_002123178.1	catalyzes a two-step reaction, first charging a phenylalanine molecule by linking its carboxyl group to the alpha-phosphate of ATP, followed by transfer of the aminoacyl-adenylate to its tRNA; forms a heterotetramer of alpha(2)beta(2); binds two magnesium ions per tetramer; type 1 subfamily
YP_002123179.1	catalyzes a two-step reaction, first charging a phenylalanine molecule by linking its carboxyl group to the alpha-phosphate of ATP, followed by transfer of the aminoacyl-adenylate to its tRNA; forms a tetramer of alpha(2)beta(2); binds two magnesium ions per tetramer; type 2 subfamily
YP_002123180.1	similar to ref|YP_001128757.1|  permease [Streptococcus pyogenes str. Manfredo]
YP_002123181.1	similar to dbj|BAF45146.1| ABC transporter ATP-binding protein [Streptococcus equi subsp. zooepidemicus]
YP_002123182.1	similar to gb|AAD37432.1|AF150748_1 M-like protein precursor [Streptococcus equi subsp. zooepidemicus]; Major surface antigen likely antiphagocytic providing resitancew to host immune response.
YP_002123183.1	similar to dbj|BAF45148.1| TetR family transcriptional regulator [Streptococcus equi subsp. zooepidemicus]
YP_002123184.1	similar to gb|AAO43099.1| collagen-binding protein Cne precursor [Streptococcus equi subsp. equi]; Mediates attachment of cells to collagen- containing substrata, fimbrial protein.
YP_002123185.1	similar to gb|AAM77659.1|AF521601_1 surface protein se51.9 [Streptococcus equi]; Fimbrial subunit-like protein,  adhesin.
YP_002123186.1	similar to ref|YP_001035569.1| Sortase-like protein,  [Streptococcus sanguinis SK36]; Fimbrial associated sortase required for polymerization of fimbrial subunits.
YP_002123187.1	similar to pdb|2AU1|A Chain A, Crystal Structure Of Group A Streptococcus Mac-1 Orthorhombic Form; Virulence protein involved in evasion of the host immune response.
YP_002123188.1	similar to emb|CAA36712.1| proline-rich protein [Triticum aestivum]
YP_002123189.1	similar to ref|ZP_01817173.1| hypothetical protein CGSSp3BS71_06969 [Streptococcus pneumoniae SP3-BS71]
YP_002123190.1	similar to ref|NP_344990.1| hypothetical protein SP_0471 [Streptococcus pneumoniae TIGR4]
YP_002123192.1	similar to ref|YP_001034451.1| Type II secretory pathway, pullulanase PulA glycosidase,  [Streptococcus sanguinis SK36]; Hydrolyzes The Alpha-1,6-Glucosidic Linkages In Glycogen Which Has First Been Partially Depolymerized By Phosphorylase. Shows Only Very Little Activity With Native Glycogen.
YP_002123193.1	similar to ref|ZP_01573929.1| RNA polymerase, sigma-24 subunit, ECF subfamily [Clostridium cellulolyticum H10]; Sigma factors are initiation factors that promote the attachment of RNA polymerase to specific initiation sites and are then released. This sigma factor is involved in heat shock and oxidative stress response; it is believed to control protein processing in the extracytoplasmic compartment.
YP_002123195.1	similar to ref|NP_688548.1| hypothetical protein SAG1555 [Streptococcus agalactiae 2603V/R]
YP_002123196.1	similar to ref|ZP_00783577.1| conserved hypothetical protein [Streptococcus agalactiae H36B]
YP_002123197.1	similar to ref|ZP_00783579.1| Unknown [Streptococcus agalactiae H36B]
YP_002123198.1	similar to gb|ABA44760.1| conserved hypothetical protein [Streptococcus agalactiae A909]
YP_002123199.1	similar to ref|YP_330175.1| glycosyl transferase, group 2 family protein [Streptococcus agalactiae A909]
YP_002123200.1	similar to ref|YP_280042.1| ATP-dependent nuclease subunit B [Streptococcus pyogenes MGAS6180]; The enzyme complex may have a wide variety of catalytic activities including ATP-dependent exonuclease, ATP-stimulated endonuclease, ATP-dependent helicase and DNA-dependent ATPase activities.
YP_002123201.1	similar to ref|NP_664318.1|  ATP-dependent exonuclease subunit A [Streptococcus pyogenes MGAS315]; The enzyme complex may have a wide variety of catalytic activities including ATP-dependent exonuclease, ATP-stimulated endonuclease, ATP-dependent helicase and DNA-dependent ATPase activities. The subunit A may have a role in DNA unwinding (helicase), and in the nuclease activity.
YP_002123202.1	associated with arginine deiminase pathway genes; probably functions in arginine catabolism
YP_002123203.1	similar to ref|YP_330074.1| polar amino acid uptake (PAAT) family ABC transporter, amino acid-binding protein [Streptococcus agalactiae A909]; Probably part of a binding-protein-dependent transport system for an amino acid.
YP_002123204.1	a small basic protein that is one of the last in the subunit assembly; omission does not prevent assembly but the subunit is inactive; binds central domain of 16S rRNA
YP_002123205.1	similar to ref|NP_268999.1|  large conductance mechanosensitive channel [Streptococcus pyogenes M1 GAS]; Channel that opens in response to stretch forces in the membrane lipid bilayer. May participate in the regulation of osmotic pressure changes within the cell.
YP_002123206.1	synthesizes RNA primers at the replication forks
YP_002123207.1	sigma factors are initiation factors that promote the attachment of RNA polymerase to specific initiation sites and are then released; primary sigma factor of bacterium
YP_002123208.1	similar to ref|NP_269002.1| hypothetical protein SPy_0783 [Streptococcus pyogenes M1 GAS]
YP_002123209.1	similar to ref|YP_602183.1| dTDP-4-dehydrorhamnose reductase [Streptococcus pyogenes MGAS10750]; Catalysis of the reaction: dTDP-6-deoxy-L-mannose + NADP+ = dTDP-4-dehydro-6-deoxy-L-mannose + NADPH + H+.
YP_002123210.1	similar to ref|YP_059938.1| alpha-D-GlcNAc alpha-1,2-L-rhamnosyltransferase [Streptococcus pyogenes MGAS10394]
YP_002123211.1	similar to ref|YP_598268.1| alpha-L-Rha alpha-1,3-L-rhamnosyltransferase [Streptococcus pyogenes MGAS10270]
YP_002123212.1	similar to ref|YP_281968.1| polysaccharide export ABC transporter permease [Streptococcus pyogenes MGAS5005]; Possibly involved in GCS group carbohydrate antigen synthesis.
YP_002123213.1	similar to ref|ZP_00366290.1| COG1134: ABC-type polysaccharide/polyol phosphate transport system, ATPase component [Streptococcus pyogenes M49 591]; Possibly involved in cell wall localization and side chain formation of rhamnose-glucose polysaccharide.
YP_002123214.1	similar to ref|YP_001128742.1|  glycosyltransferase [Streptococcus pyogenes str. Manfredo]; Possibly involved in cell wall localization and side chain formation of rhamnose-glucose polysaccharide.
YP_002123215.1	similar to ref|YP_001128741.1| rhamnan synthesis protein F family protein [Streptococcus pyogenes str. Manfredo]; Possibly involved in synthesis of the GCS carbohydrate group antigen.
YP_002123216.1	similar to ref|YP_141826.1| glycosyl transferase [Streptococcus thermophilus CNRZ1066]; Possibly involved in synthesis of the GCS carbohydrate group antigen.
YP_002123217.1	similar to ref|YP_141825.1| hypothetical protein str1475 [Streptococcus thermophilus CNRZ1066]; Possibly involved in synthesis of the GCS carbohydrate group antigen.
YP_002123218.1	similar to ref|YP_001128737.1|  exopolysaccharide biosynthesis protein [Streptococcus pyogenes str. Manfredo]; Possibly involved in synthesis of the GCS carbohydrate group antigen.
YP_002123219.1	similar to ref|YP_280061.1| hypothetical membrane spanning protein [Streptococcus pyogenes MGAS6180]
YP_002123220.1	similar to ref|ZP_00785358.1| glycosyl transferase, group 1 family protein [Streptococcus agalactiae COH1]; Possibly involved in synthesis of the GCS carbohydrate group antigen.
YP_002123221.1	similar to ref|NP_721241.1| hypothetical protein SMU.831 [Streptococcus mutans UA159]
YP_002123222.1	similar to ref|ZP_01825231.1| UDP-glucose 4-epimerase [Streptococcus pneumoniae SP11-BS70]; Catalysis of the reaction: UDP-glucose = UDP-galactose.
YP_002123224.1	similar to ref|NP_269015.1| peptidase T [Streptococcus pyogenes M1 GAS]; Releases the N-terminal amino acid from tripeptides. Has a preference for tripeptides containing a N-terminal methionine or leucine.
YP_002123225.1	similar to ref|YP_059950.1| Gene info Pore forming protein ebsA [Streptococcus pyogenes MGAS10394]
YP_002123226.1	similar to ref|NP_269017.1| ferredoxin [Streptococcus pyogenes M1 GAS]
YP_002123227.1	similar to ref|YP_280065.1| hypothetical membrane associated protein [Streptococcus pyogenes MGAS6180]
YP_002123228.1	Catalyzes the formation of (d)CDP from ATP and (d)CMP
YP_002123229.1	IF-3 has several functions that are required and promote translation initiation including; preventing association of 70S by binding to 30S; monitoring codon-anticodon interactions by promoting disassociation of fMet-tRNA(fMet) from initiation complexes formed on leaderless mRNAs or incorrectly bound noninitiatior tRNAs and complexes with noncanonical start sites; stimulates codon-anticodon interactions at P-site; involved in moving mRNA to the P-site; and in recycling subunits
YP_002123230.1	similar to ref|YP_001035443.1| 50S ribosomal protein L35 [Streptococcus sanguinis SK36]
YP_002123231.1	binds directly to 23S ribosomal RNA prior to in vitro assembly of the 50S ribosomal subunit
YP_002123233.1	similar to ref|YP_848744.1| secreted MUCin-binding domain protein [Listeria welshimeri serovar 6b str. SLCC5334]; Unknown, possibly involved in mucin-binding.
YP_002123234.1	similar to ref|YP_602203.1| Sulfatase family protein [Streptococcus pyogenes MGAS10750]
YP_002123235.1	similar to ref|YP_281986.1| methyltransferase [Streptococcus pyogenes MGAS5005]
YP_002123236.1	catalyzes the dehydration of 3-dehydroquinate to form 3-dehydroshikimate in aromatic amino acid biosynthesis
YP_002123237.1	catalyzes the formation of chorismate from 5-O-(1-carboxyvinyl)-3-phosphoshikimate in aromatic amino acid biosynthesis
YP_002123238.1	similar to ref|YP_059961.1| Hypothetical cytosolic protein [Streptococcus pyogenes MGAS10394]
YP_002123239.1	catalyzes the reduction of 2 glutathione to glutathione disulfide; maintains high levels of reduced glutathione in the cytosol; involved in redox regulation and oxidative defense
YP_002123240.1	similar to ref|NP_607031.1| hypothetical protein spyM18_0877 [Streptococcus pyogenes MGAS8232]
YP_002123241.1	similar to ref|YP_598295.1| Cysteine desulfurase / Selenocysteine lyase [Streptococcus pyogenes MGAS10270]; Fe-S cluster biosynthesis.
YP_002123242.1	Required for the synthesis of the thiazole moiety
YP_002123244.1	similar to gb|ABH04315.1| IgG endopeptidase [Streptococcus equi subsp. zooepidemicus]; IgG cleavage resistance to the host immune response.
YP_002123246.1	similar to ref|YP_596508.1| transposase [Streptococcus pyogenes MGAS9429]
YP_002123247.1	similar to ref|YP_060299.1|  membrane-associated alkaline phosphatase [Streptococcus pyogenes MGAS10394]
YP_002123248.1	similar to ref|ZP_00365831.1| COG0477: Permeases of the major facilitator superfamily [Streptococcus pyogenes M49 591]
YP_002123249.1	similar to ref|ZP_00365454.1| COG1131: ABC-type multidrug transport system, ATPase component [Streptococcus pyogenes M49 591]
YP_002123250.1	similar to ref|YP_600647.1| Transcriptional regulator, GntR family [Streptococcus pyogenes MGAS2096]
YP_002123251.1	Catalyzes DNA-template-directed extension of the 3'-end of a DNA strand by one nucleotide at a time. Proposed to be responsible for the synthesis of the lagging strand. In the low GC gram positive bacteria this enzyme is less processive and more error prone than its counterpart in other bacteria.
YP_002123252.1	catalyzes the formation of D-fructose 1,6-bisphosphate from D-fructose 6-phosphate in glycolysis
YP_002123253.1	catalyzes the formation of phosphoenolpyruvate from pyruvate
YP_002123254.1	similar to ref|YP_280427.1| signal peptidase I [Streptococcus pyogenes MGAS6180]
YP_002123255.1	Catalyzes the first step in hexosamine metabolism, converting fructose-6P into glucosamine-6P using glutamine as a nitrogen source
YP_002123256.1	similar to ref|NP_607338.1| hypothetical protein spyM18_1226 [Streptococcus pyogenes MGAS8232]; Unknown, The PhnA protein family includes the uncharacterised Escherichia coli protein PhnA and its homologues. The E. coli phnA gene is part of a large operon associated with alkylphosphonate uptake and carbon-phosphorus bond cleavage. The protein is not related to the characterised phosphonoacetate hydrolase designated PhnA.
YP_002123257.1	similar to ref|YP_602628.1| Histidine transport system permease HisM [Streptococcus pyogenes MGAS10750]; Probably part of a binding-protein-dependent transport system for an amino acid. Probably responsible for the translocation of the substrate across the membrane.
YP_002123258.1	similar to ref|YP_602627.1| Histidine transport ATP-binding protein hisP [Streptococcus pyogenes MGAS10750]; Part of the binding-protein-dependent transport system for histidine. Probably responsible for energy coupling to the transport system.
YP_002123259.1	similar to gb|AAC35851.1| amino acid-binding protein Abp [Streptococcus uberis]; Probably part of a binding-protein-dependent transport system for an amino acid.
YP_002123260.1	similar to ref|YP_598703.1| Cobalt-zinc-cadmium resistance protein czcD [Streptococcus pyogenes MGAS10270]
YP_002123261.1	similar to ref|YP_060286.1| Na(+)-linked D-alanine glycine permease [Streptococcus pyogenes MGAS10394]
YP_002123262.1	similar to ref|YP_060284.1| DNA helicase II [Streptococcus pyogenes MGAS10394]; Essential helicase
YP_002123263.1	similar to ref|NP_269398.1| hypothetical protein SPy_1265 [Streptococcus pyogenes M1 GAS]
YP_002123264.1	similar to ref|NP_607329.1| hypothetical protein spyM18_1215 [Streptococcus pyogenes MGAS8232]
YP_002123265.1	similar to ref|YP_001128385.1| hypothetical protein SpyM50826 [Streptococcus pyogenes str. Manfredo]
YP_002123266.1	similar to ref|YP_280413.1| general stress protein, Gls24 family [Streptococcus pyogenes MGAS6180]
YP_002123267.1	similar to ref|YP_596806.1| hypothetical protein MGAS9429_Spy1075 [Streptococcus pyogenes MGAS9429]
YP_002123268.1	similar to ref|YP_280411.1| general stress protein, Gls24 family [Streptococcus pyogenes MGAS6180]
YP_002123269.1	similar to ref|YP_598693.1| NAD-dependent K+ or Na+ uptake system component / Transcriptional regulator, GntR family [Streptococcus pyogenes MGAS10270]
YP_002123270.1	similar to ref|YP_598691.1| Transcriptional regulator, TetR family [Streptococcus pyogenes MGAS10270]
YP_002123271.1	similar to ref|NP_269390.1|  ABC transporter (ATP-binding protein) [Streptococcus pyogenes M1 GAS]
YP_002123272.1	similar to ref|YP_596800.1| ABC transporter permease [Streptococcus pyogenes MGAS9429]
YP_002123273.1	similar to ref|YP_060272.1| Type I restriction-modification system specificity subunit [Streptococcus pyogenes MGAS10394]
YP_002123274.1	similar to ref|YP_602608.1| Integral membrane protein [Streptococcus pyogenes MGAS10750]
YP_002123275.1	similar to ref|YP_001128395.1| hypothetical protein SpyM50836 [Streptococcus pyogenes str. Manfredo]
YP_002123276.1	catalyzes isomerization of specific uridines in RNA to pseudouridine; responsible for residues in T loops of many tRNAs
YP_002123277.1	catalyzes the formation of FMN from riboflavin and the formation of FAD from FMN; in Bacillus the ribC gene has both flavokinase and FAD synthetase activities
YP_002123278.1	the anti-alpha factor Spx interacts with RNA polymerase alpha subunit C-terminal domain in a region that interacts with the sigma 70 subunit and may interfere with activation of promoters; in Bacillus subtilis this protein is a substrate for ClpXP protease; blocks transcription of the competence regulatory gene encoded by the srf operon; regulates a number of genes involved in thiol homeostasis including trxA and trxB; monomeric member of ArsC family of proteins; does not bind DNA; contains a disulfide bond between C10 and C13 which may sense disulfide stress
YP_002123279.1	similar to ref|YP_060266.1| hypothetical protein M6_Spy0948 [Streptococcus pyogenes MGAS10394]
YP_002123280.1	similar to ref|YP_060265.1| Myo-inositol-1(or 4)-monophosphatase [Streptococcus pyogenes MGAS10394]; Catalysis of the reaction: myo-inositol 1-phosphate + H2O = myo-inositol + phosphate.
YP_002123281.1	similar to ref|YP_596791.1|  23S rRNA m(5)C methyltransferase [Streptococcus pyogenes MGAS9429]
YP_002123282.1	similar to ref|NP_664685.1|  phosphate ABC transporter, periplasmic phosphate-binding protein [Streptococcus pyogenes MGAS315]; Probably part of the binding-protein-dependent transport system.
YP_002123283.1	similar to ref|YP_598678.1| Phosphate transport system permease pstC [Streptococcus pyogenes MGAS10270]
YP_002123284.1	similar to ref|NP_607308.1|  phosphate ABC transporter (permease) [Streptococcus pyogenes MGAS8232]
YP_002123285.1	ATP-binding protein; PstABCS is an ATP dependent phosphate uptake system which is responsible for inorganic phosphate uptake during phosphate starvation
YP_002123286.1	ATP-binding protein; PstABCS is an ATP dependent phosphate uptake system which is responsible for inorganic phosphate uptake during phosphate starvation
YP_002123287.1	similar to ref|NP_607305.1|  phosphate uptake regulatory protein [Streptococcus pyogenes MGAS8232]; Not known; probably involved in phosphate transport and/or metabolism.
YP_002123288.1	similar to ref|YP_598672.1| Lysyl aminopeptidase / alanine aminopeptidase [Streptococcus pyogenes MGAS10270]; Aminopeptidase with broad substrate specificity to several peptides. It has more affinity for oligopeptides than for dipeptides. It plays an essential role in the metabolism, it may be involved in nitrogen supply or protein turnover.
YP_002123290.1	similar to ref|YP_060255.1| CiaR [Streptococcus pyogenes MGAS10394]; Member of the two-component regulatory system ciaH/ciaR. Involved in early steps of competence regulation and in penicillin susceptibility.
YP_002123291.1	similar to ref|YP_060254.1| CiaH [Streptococcus pyogenes MGAS10394]; Member of the two-component regulatory system ciaH/ciaR. Involved in early steps of competence regulation and in penicillin susceptibility. Probably phosphorylates ciaR.
YP_002123292.1	similar to ref|YP_849450.1| hypothetical protein [Listeria welshimeri serovar 6b str. SLCC5334]
YP_002123294.1	similar to ref|NP_734694.1| Gene info hypothetical protein gbs0224 [Streptococcus agalactiae NEM316]
YP_002123295.1	similar to ref|YP_849451.1| hypothetical protein lwe1254 [Listeria welshimeri serovar 6b str. SLCC5334]
YP_002123296.1	similar to ref|NP_736409.1| hypothetical protein gbs1976 [Streptococcus agalactiae NEM316]
YP_002123297.1	similar to ref|ZP_00874490.1| hypothetical protein SsuiDRAFT_1547 [Streptococcus suis 89/1591]
YP_002123298.1	similar to ref|NP_736400.1| hypothetical protein gbs1967 [Streptococcus agalactiae NEM316]
YP_002123299.1	similar to ref|ZP_00874484.1| hypothetical protein SsuiDRAFT_1541 [Streptococcus suis 89/1591]
YP_002123300.1	similar to ref|ZP_00785752.1| Unknown [Streptococcus agalactiae COH1]
YP_002123301.1	binds directly to the 16S rRNA and is involved in post-translational inhibition of arginine and ornithine decarboxylase
YP_002123302.1	catalyzes the formation of (R)-4'-phosphopantothenate in coenzyme A biosynthesis
YP_002123303.1	similar to ref|YP_598667.1| 16S rRNA m(2)G 1207 methyltransferase [Streptococcus pyogenes MGAS10270]; Specifically methylates the guanosine in position 1207 of 16s rRNA in the 30s particle.
YP_002123304.1	Catalyzes the reversible phosphorolysis of pyrimidines in the nucleotide synthesis salvage pathway
YP_002123305.1	catalyzes the formation of D-glyceraldehyde 3-phosphate and acetaldehyde from 2-deoxy-D-ribose-5-phosphate
YP_002123306.1	Reclaims exogenous and endogenous cytidine and 2'-deoxycytidine molecules for UMP synthesis
YP_002123307.1	similar to ref|YP_280382.1| nucleoside-binding protein [Streptococcus pyogenes MGAS6180]
YP_002123308.1	similar to ref|ZP_00365738.1| COG3845: ABC-type uncharacterized transport systems, ATPase components [Streptococcus pyogenes M49 591]; Part of the binding-protein-dependent transport system for nucleosides. Probably responsible for energy coupling to the transport system.
YP_002123309.1	similar to ref|YP_280380.1| nucleoside transport system permease [Streptococcus pyogenes MGAS6180]
YP_002123310.1	similar to ref|YP_060246.1| Nucleoside transport system permease [Streptococcus pyogenes MGAS10394]
YP_002123312.1	similar to ref|YP_001128419.1|  phosphomannomutase [Streptococcus pyogenes str. Manfredo]
YP_002123313.1	similar to ref|YP_280377.1| transporter [Streptococcus pyogenes MGAS6180]
YP_002123314.1	decarboxylates 4-phosphopantothenoylcysteine to form 4'-phosphopantotheine.
YP_002123315.1	similar to ref|YP_596769.1| phosphopantothenate--cysteine ligase [Streptococcus pyogenes MGAS9429]; Catalyzes two steps in the biosynthesis of coenzyme A. In the first step cysteine is conjugated to 4'-phosphopantothenate to form 4-phosphopantothenoylcysteine, in the latter compound is decarboxylated to form 4'-phosphopantotheine.
YP_002123316.1	catalyzes the formation of 10-formyltetrahydrofolate from formate and tetrahydrofolate
YP_002123317.1	similar to ref|ZP_00781360.1| streptococcal C5a peptidase [Streptococcus agalactiae 18RS21]; This virulence factor of S.pyogenes specifically cleaves the human serum chemotaxin C5a at 68-Lys-|-Asp-69 bond near its C- terminus, destroying its ability to serve as a chemoattractant, in GAS it sets in the MGA regulon.
YP_002123318.1	similar to ref|NP_607281.1|  cardiolipin synthetase [Streptococcus pyogenes MGAS8232]; Catalyzes The Reversible Phosphatidyl Group Transfer From One Phosphatidylglycerol Molecule To Another To Form Cardiolipin (Cl) (Diphosphatidylglycerol) And Glycerol. Affects Resistance To The Gyrase Inhibitor Novobiocin.
YP_002123319.1	catalyzes the formation of 4-aspartyl phosphate from aspartate 4-semialdehyde
YP_002123320.1	similar to ref|NP_664655.1|  anaerobic ribonucleotide reductase [Streptococcus pyogenes MGAS315]
YP_002123321.1	similar to ref|YP_001128433.1| GntR family regulatory protein [Streptococcus pyogenes str. Manfredo]
YP_002123322.1	catalyzes the formation of pyridoxal 5'-phosphate from pyridoxal
YP_002123323.1	similar to emb|CAM30204.1|  membrane protein [Streptococcus pyogenes str. Manfredo]
YP_002123325.1	similar to ref|YP_280361.1| ABC transporter ATP-binding protein [Streptococcus pyogenes MGAS6180]
YP_002123326.1	similar to ref|YP_138591.1| IS1239 transposase [Streptococcus thermophilus LMG 18311]
YP_002123327.1	similar to ref|YP_596727.1| hypothetical protein MGAS9429_Spy0996 [Streptococcus pyogenes MGAS9429]
YP_002123328.1	similar to ref|YP_596508.1| transposase [Streptococcus pyogenes MGAS9429]
YP_002123329.1	similar to ref|YP_596728.1| diacylglycerol kinase family protein [Streptococcus pyogenes MGAS9429]
YP_002123330.1	similar to ref|NP_269309.1|  hemolysin III [Streptococcus pyogenes M1 GAS]; Unknown, possible extracellur hemolysin but lacks a SrtA secretion signal peptide.
YP_002123331.1	similar to ref|NP_607242.1| hypothetical protein spyM18_1120 [Streptococcus pyogenes MGAS8232]
YP_002123332.1	similar to ref|YP_329155.1| hypothetical protein SAK_0522 [Streptococcus agalactiae A909]
YP_002123333.1	similar to ref|NP_721671.1| hypothetical protein SMU.1300c [Streptococcus mutans UA159]
YP_002123334.1	similar to ref|NP_607650.1|  acetate kinase [Streptococcus pyogenes MGAS8232]; Catalysis of the reaction: ATP + acetate = ADP + acetyl phosphate.
YP_002123335.1	similar to ref|NP_606739.1|  response regulator [Streptococcus pyogenes MGAS8232]; Required for high-level post-exponential phase expression of a series of secreted proteins, has similarity with BlpR/FasA/SilA regulators.
YP_002123336.1	similar to ref|YP_281761.1| bacteriocin [Streptococcus pyogenes MGAS5005]
YP_002123337.1	similar to ref|NP_688943.1| ABC transporter, ATP-binding protein [Streptococcus agalactiae 2603V/R]
YP_002123338.1	similar to ref|ZP_00789085.1|  membrane protein [Streptococcus agalactiae 515]; Unknown, predicted to be Sec-indepently secreted by SecretomeP 2.0
YP_002123339.1	similar to ref|YP_330508.1| hypothetical protein SAK_1913 [Streptococcus agalactiae A909]
YP_002123340.1	similar to ref|YP_140101.1| pore-forming peptide, bacteriocin [Streptococcus thermophilus LMG 18311]
YP_002123341.1	similar to ref|YP_140093.1| immunity/modification protein [Streptococcus thermophilus LMG 18311]
YP_002123342.1	similar to ref|ZP_01835892.1| hypothetical protein CGSSp23BS72_00905 [Streptococcus pneumoniae SP23-BS72]
YP_002123343.1	similar to ref|ZP_01835893.1| hypothetical protein CGSSp23BS72_00910 [Streptococcus pneumoniae SP23-BS72]
YP_002123344.1	similar to ref|ZP_01821399.1| competence damage-inducible protein A [Streptococcus pneumoniae SP6-BS73]
YP_002123345.1	essential GTPase; functions in ribosome assembly; binds a unique part of the 23S rRNA; interacts with ribosomal protein L25(Ctc)
YP_002123346.1	RNH2; RNase HII; binds manganese; endonuclease which specifically degrades the RNA of RNA-DNA hybrids
YP_002123347.1	similar to ref|YP_598607.1| DNA processing protein [Streptococcus pyogenes MGAS10270]
YP_002123348.1	catalyzes the ATP-dependent breakage of single-stranded DNA followed by passage and rejoining, maintains net negative superhelicity
YP_002123349.1	similar to ref|YP_602534.1| hypothetical protein MGAS10750_Spy1040 [Streptococcus pyogenes MGAS10750]
YP_002123350.1	similar to ref|ZP_00366032.1| COG4988: ABC-type transport system involved in cytochrome bd biosynthesis, ATPase and permease components [Streptococcus pyogenes M49 591]
YP_002123351.1	similar to ref|ZP_01371554.1| transposase, IS4 [Desulfitobacterium hafniense DCB-2]
YP_002123352.1	similar to ref|YP_598633.1| (Citrate (pro-3S)-lyase) ligase [Streptococcus pyogenes MGAS10270]; Acetylation of prosthetic group (2-(5''-phosphoribosyl)- 3'-dephosphocoenzyme-A) of the gamma subunit of citrate lyase.
YP_002123353.1	similar to ref|YP_602540.1| Na+ transporting oxaloacetate decarboxylase beta chain [Streptococcus pyogenes MGAS10750]
YP_002123354.1	similar to ref|NP_603429.1| Hypothetical membrane-spanning protein [Fusobacterium nucleatum subsp. nucleatum ATCC 25586]
YP_002123355.1	similar to ref|NP_664630.1|  CitG protein,2-(5''-triphosphoribosyl)-3'-dephosphocoenzyme-A synthase [Streptococcus pyogenes MGAS315]; Catalyzes the formation of 2-(5''-triphosphoribosyl)-3'- dephosphocoenzyme-A, the precursor of the prosthetic group of the holo-acyl carrier protein (gamma chain) of citrate lyase, from ATP and dephospho-CoA.
YP_002123356.1	similar to ref|YP_602542.1| Transcriptional regulator, GntR family [Streptococcus pyogenes MGAS10750]
YP_002123357.1	similar to ref|YP_060207.1| Mg2+/citrate complex secondary transporter [Streptococcus pyogenes MGAS10394]; Transports the free citrate anion. Probably cotransports citrate and at least three or four protons. The citrate uptake is inhibited by the presence of magnesium ions.
YP_002123359.1	similar to ref|NP_607255.1| hypothetical protein spyM18_1133 [Streptococcus pyogenes MGAS8232]
YP_002123360.1	composes the biotin carboxyl carrier protein subunit of the acetyl-CoA carboxylase complex, the enzyme that catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, which in turn controls the rate of fatty acid metabolism
YP_002123361.1	similar to ref|YP_280344.1| oxaloacetate decarboxylase beta chain [Streptococcus pyogenes MGAS6180]; Lyase and sodium transporter.
YP_002123362.1	similar to ref|YP_060211.1| hypothetical protein M6_Spy0893 [Streptococcus pyogenes MGAS10394]
YP_002123363.1	acyl carrier protein; with CitE and CitF catalyzes the formation of oxaloacetate from citrate
YP_002123364.1	similar to ref|YP_598629.1| Citrate lyase beta chain / Citryl-CoA lyase subunit [Streptococcus pyogenes MGAS10270]
YP_002123365.1	similar to ref|YP_001128449.1|  citrate lyase alpha subunit [Streptococcus pyogenes str. Manfredo]
YP_002123366.1	2'-(5''-phosphoribosyl)-3'-dephospho-CoA transferase; holo-citrate lyase synthase; CitG forms the prosthetic group precursor 2'-(5''-triphosphoribosyl)-3'-dephospho-CoA which is then transferred to apo-ACP by CitX to produce holo-ACP and pyrophosphate
YP_002123367.1	similar to ref|NP_607265.1| hypothetical protein spyM18_1144 [Streptococcus pyogenes MGAS8232]
YP_002123369.1	similar to dbj|BAB83943.1| mutans bacitracin-resistance related protein A [Streptococcus mutans]; Part of the ABC transporter complex which could be involved in peptide resistance. Responsible for energy coupling to the transport system ().
YP_002123370.1	similar to ref|NP_687986.1| ABC transporter, permease,  [Streptococcus agalactiae 2603V/R]; Part of the ABC transporter complex bceAB (TC 3.A.1.123.5) involved in bacitracin export.
YP_002123371.1	similar to ref|NP_687987.1| DNA-binding response regulator [Streptococcus agalactiae 2603V/R]; Member of the two-component regulatory system bceS/bceR involved in the regulation of bacitracin resistance. When activated by bceS, binds to the upstream region of the bceAB promoter and up-regulates the expression of these two genes.
YP_002123372.1	similar to ref|NP_721404.1|  histidine kinase [Streptococcus mutans UA159]; Signal transduction histidine kinase
YP_002123373.1	site-specific tyrosine recombinase which cuts and rejoins DNA molecules; binds cooperatively to specific DNA consensus sites; essential to convert chromosome dimers to monomers during cell division and functions during plasmid segregation; cell division protein FtsK may regulate the XerS
YP_002123374.1	similar to ref|NP_687863.1| GtrA family protein [Streptococcus agalactiae 2603V/R]; Unknown. GtrA is predicted to be an integral membrane protein with 4 transmembrane spans. It is involved is in O antigen modification by Shigella flexneri bacteriophage X (SfX), but does not determine the specificity of glucosylation. Its function remains unknown, but it may play a role in translocation of UDP phosphate linked glucose (UndP-Glc) across the cytoplasmic membrane.
YP_002123375.1	similar to ref|YP_598637.1| phage transcriptional repressor [Streptococcus pyogenes MGAS10270]
YP_002123376.1	similar to ref|ZP_02075633.1| hypothetical protein CLOL250_02409 [Clostridium sp. L2-50]
YP_002123377.1	contains glutamine-hydrolyzing domain and glutamine amidotransferase; GMP-binding domain; functions to produce GMP from XMP in the IMP pathway
YP_002123379.1	similar to ref|ZP_00366165.1| COG2188: Transcriptional regulators [Streptococcus pyogenes M49 591]
YP_002123380.1	similar to ref|NP_269340.1| hypothetical protein SPy_1201 [Streptococcus pyogenes M1 GAS]; Not known. Could take part in the signal recognition particle (SRP) pathway. This is inferred due to the conservation of its genetic proximity to ftsY/ffh. May be a regulatory protein.
YP_002123381.1	similar to ref|YP_282278.1| signal recognition particle, subunit FFH/SRP54 [Streptococcus pyogenes MGAS5005]; Necessary for efficient export of extra-cytoplasmic proteins. Binds to the signal sequence when it emerges from the ribosomes.
YP_002123382.1	similar to ref|YP_060227.1| UDP-N-acetylmuramoylpentapeptide-lysine N(6)-alanyltransferase [Streptococcus pyogenes MGAS10394]
YP_002123383.1	similar to ref|ZP_00780941.1| extracellular protein [Streptococcus agalactiae 18RS21]
YP_002123384.1	similar to ref|ZP_01823706.1| histidine triad protein [Streptococcus pneumoniae SP9-BS68]
YP_002123385.1	similar to emb|CAC85395.1| laminin binding protein [Streptococcus dysgalactiae subsp. equisimilis]
YP_002123386.1	similar to ref|NP_687974.1| glyoxylase family protein [Streptococcus agalactiae 2603V/R]; Catalysis of the reaction: (R)-S-lactoylglutathione = glutathione + methylglyoxal.
YP_002123387.1	similar to ref|YP_598598.1| Sortase [Streptococcus pyogenes MGAS10270]; Transpeptidation reaction linking surface proteins to peptidoglycan.
YP_002123388.1	negatively supercoils closed circular double-stranded DNA
YP_002123389.1	Converts (S)-lactate and NAD(+) to pyruvate and NADH
YP_002123390.1	similar to gb|AAL78063.1| NADH oxidase [Streptococcus equi subsp. zooepidemicus]; Catalyzes the four-electron reduction of molecular oxygen to water.
YP_002123391.1	similar to ref|YP_598592.1| antigen-like protein [Streptococcus pyogenes MGAS10270]; COG0741: Soluble lytic murein transglycosylase and related regulatory proteins (some contain LysM/invasin domains).
YP_002123392.1	similar to ref|YP_598591.1| hypothetical protein MGAS10270_Spy0982 [Streptococcus pyogenes MGAS10270]
YP_002123393.1	catalyzes the reaction of glycine with 5,10-methylenetetrahydrofolate to form L-serine and tetrahydrofolate
YP_002123394.1	similar to ref|ZP_00366378.1| COG0454: Histone acetyltransferase HPA2 and related acetyltransferases [Streptococcus pyogenes M49 591]
YP_002123395.1	similar to ref|ZP_00366379.1| COG0009:  translation factor (SUA5) [Streptococcus pyogenes M49 591]
YP_002123396.1	similar to ref|YP_001128483.1|  methyltransferase [Streptococcus pyogenes str. Manfredo]; Methylates The Translation Termination Release Factor Rf1 On Gln-235 And Rf2 On Gln-252.
YP_002123397.1	recognizes the termination signals UAG and UAA during protein translation a specificity which is dependent on amino acid residues residing in loops of the L-shaped tRNA-like molecule of RF1; this protein is similar to release factor 2
YP_002123398.1	similar to ref|NP_269291.1| thymidine kinase [Streptococcus pyogenes M1 GAS]; Phosphorylates Both Thymidine And Deoxyuridine.
YP_002123400.1	4-OT; member of subfamily 5; forms a dimer; the function in the Escherichia coli cell is unknown
YP_002123401.1	similar to ref|YP_598583.1| Iron-sulfur cluster assembly/repair protein ApbE [Streptococcus pyogenes MGAS10270]; Involved in the conversion of aminoimidazole ribotide (AIR), a purine intermediate, to the 4-amino-5-hydroxymethyl-2- methyl pyrimidine (HMP) moiety of thiamine.
YP_002123402.1	Catalyzes the transfer of the phosphoribosyl moiety from 5-phospho--D-ribosyl-1-pyrophosphate (PRib-PP) to the 6-oxo-guanine and -xanthine
YP_002123403.1	similar to ref|ZP_00365512.1| COG0516: IMP dehydrogenase/GMP reductase [Streptococcus pyogenes M49 591]; Catalyzes the irreversible NADPH-dependent deamination of GMP to IMP. It functions in the conversion of nucleobase, nucleoside and nucleotide derivatives of G to A nucleotides, and in maintaining the intracellular balance of A and G nucleotides.
YP_002123404.1	similar to ref|YP_598579.1| Glycine betaine transport system permease / Glycine betaine-binding protein [Streptococcus pyogenes MGAS10270]; Involved in a high affinity multicomponent binding- protein-dependent transport system for glycine betaine, carnitine and choline; probably responsible for the translocation of the substrate across the membrane.
YP_002123405.1	similar to ref|NP_664595.1|  ABC transporter (ATP-binding protein) [Streptococcus pyogenes MGAS315]; Involved in a high affinity multicomponent binding- protein-dependent transport system for glycine betaine, carnitine and choline; probably responsible for energy coupling to the transport system.
YP_002123406.1	similar to ref|YP_602497.1| Na+ driven multidrug efflux pump [Streptococcus pyogenes MGAS10750]
YP_002123407.1	similar to ref|YP_280295.1| short chain dehydrogenase [Streptococcus pyogenes MGAS6180]; Catalyzes the NADP-dependent oxidation of L-allo- threonine and L-serine.
YP_002123408.1	similar to ref|NP_664590.1|  ribosomal large subunit pseudouridine synthase [Streptococcus pyogenes MGAS315]; Responsible For Synthesis Of Pseudouridine From Uracil At Positions 1911, 1915 And 1917 In 23s Ribosomal RNA; similar to Bacillus subtilis YjbO type
YP_002123409.1	catalyzes the phosphorylation of NAD to NADP
YP_002123410.1	similar to ref|NP_269279.1|  GTP pyrophosphokinase [Streptococcus pyogenes M1 GAS]; In eubacteria ppGpp (guanosine 3'-diphosphate 5-'diphosphate) is a mediator of the stringent response that coordinates a variety of cellular activities in response to changes in nutritional abundance. This enzyme catalyzes the formation of pppGpp which is then hydrolyzed to form ppGpp.
YP_002123411.1	similar to ref|YP_282209.1|  adenylate cyclase family [Streptococcus pyogenes MGAS5005]
YP_002123412.1	catalyzes the formation of 5-phospho-alpha-D-ribose 1-phosphate from D-ribose 5-phosphate and ATP
YP_002123413.1	similar to ref|YP_001128501.1|  cysteine desulfurase [Streptococcus pyogenes str. Manfredo]; Catalyzes the removal of elemental sulfur from cysteine to produce alanine.
YP_002123414.1	similar to ref|NP_269275.1| hypothetical protein SPy_1121 [Streptococcus pyogenes M1 GAS]
YP_002123415.1	modulates transcription in response to the NADH/NAD(+) redox state
YP_002123416.1	similar to ref|NP_607204.1| hypothetical protein spyM18_1080 [Streptococcus pyogenes MGAS8232]
YP_002123417.1	Involved in DNA double-strand break repair and recombination. Promotes the annealing of complementary single-stranded DNA and by simulation of RAD51 recombinase
YP_002123418.1	similar to ref|YP_282202.1| hypothetical membrane spanning protein [Streptococcus pyogenes MGAS5005]
YP_002123419.1	similar to ref|YP_060154.1| Lipase/Acylhydrolase family protein [Streptococcus pyogenes MGAS10394]
YP_002123420.1	similar to ref|YP_596686.1| chloride channel protein [Streptococcus pyogenes MGAS9429]; Probably acts as an electrical shunt for an outwardly-directed proton pump that is linked to amino acid decarboxylation, as part of the extreme acid resistance (XAR) response.
YP_002123421.1	similar to ref|YP_001128516.1| spermidine/putrescine extracellular binding protein [Streptococcus pyogenes str. Manfredo]; Required for the activity of the bacterial periplasmic transport system of putrescine and spermidine. Polyamine binding protein.
YP_002123422.1	similar to ref|NP_607191.1|  spermidine/putrescine ABC transporter (permease) [Streptococcus pyogenes MGAS8232]; Required for the activity of the bacterial periplasmic transport system of putrescine and spermidine.
YP_002123423.1	similar to ref|YP_280272.1| spermidine/putrescine transport system permease [Streptococcus pyogenes MGAS6180]; Required for the activity of the bacterial periplasmic transport system of putrescine and spermidine.
YP_002123424.1	similar to ref|YP_060142.1| PotA [Streptococcus pyogenes MGAS10394]; Part of the ABC transporter complex potABCD involved in spermidine/putrescine import. Responsible for energy coupling to the transport system.
YP_002123425.1	catalyzes the reduction of UDP-N-acetylglucosamine enolpyruvate to form UDP-N-acetylmuramate in peptidoglycan biosynthesis
YP_002123426.1	similar to ref|YP_598549.1| 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase [Streptococcus pyogenes MGAS10270]; Dihydrofolate biosynthesis; first step, Catalysis of the reaction: ATP + 2-amino-4-hydroxy-6-hydroxymethyl-7,8-dihydropteridine = AMP + 2-amino-7, 8-dihydro-4-hydroxy-6-(diphosphooxymethyl)pteridine.
YP_002123427.1	similar to emb|CAD31136.1| dihydroneopterin aldolase [Streptococcus pyogenes]; Catalyzes the conversion of 7,8-dihydroneopterin to 6- hydroxymethyl-7,8-dihydropterin.
YP_002123428.1	similar to emb|CAA04242.1| dihydropteroate synthase [Streptococcus pyogenes]; DHPS catalyzes the formation of the immediate precursor of folic acid. It is implicated in resistance to sulfonamide.
YP_002123429.1	similar to emb|CAC39312.1| GTP Cyclohydrolase [Streptococcus pyogenes]; Tetrahydrofolate biosynthesis; first step.
YP_002123430.1	similar to ref|YP_598545.1| Folylpolyglutamate synthase / Dihydrofolate synthase [Streptococcus pyogenes MGAS10270]; Conversion of folates to polyglutamate derivatives.
YP_002123431.1	similar to ref|YP_819981.1| homoserine kinase [Streptococcus thermophilus LMD-9]; Threonine biosynthesis from asparate; fourth step.
YP_002123432.1	catalyzes the formation of L-aspartate 4-semialdehyde from L-homoserine
YP_002123433.1	similar to ref|NP_664560.1| hypothetical protein SpyM3_0756 [Streptococcus pyogenes MGAS315]; Required for the synthesis of linear beta-1,6-linked glucosaminoglycans.
YP_002123434.1	similar to ref|YP_061057.1| Streptodornase [Streptococcus pyogenes MGAS10394]; Contributes to resistance to the host immune response in part by degrading neutrophil extracellular traps (NETs).
YP_002123435.1	catalyzes the formation of nucleoside triphosphate from ATP and nucleoside diphosphate
YP_002123437.1	similar to ref|YP_598361.1| ATP-dependent endopeptidase clp ATP-binding subunit clpL [Streptococcus pyogenes MGAS10270]; Could be the ATP-dependent specificity component of an ATP-dependent protease.
YP_002123438.1	similar to ref|NP_687455.1| cell wall surface anchor family protein [Streptococcus agalactiae 2603V/R]; Unknown, possible adhesin, cognate in GBS has been shown to be immunoprotective in mice.
YP_002123439.1	binds guanine nucleotides; in Escherichia coli depletion results in defective cell division and filamentation; in Bacillus subtilis this gene is essential
YP_002123440.1	binds and unfolds substrates as part of the ClpXP protease
YP_002123441.1	similar to ref|NP_607088.1| hypothetical protein spyM18_0945 [Streptococcus pyogenes MGAS8232]
YP_002123442.1	similar to ref|YP_602275.1| Dihydrofolate reductase [Streptococcus pyogenes MGAS10750]; Essential step for de novo glycine and purine synthesis, DNA precursor synthesis, and for the conversion of dUMP to dTMP.
YP_002123443.1	ThyA; catalyzes formation of dTMP and 7,8-dihydrofolate from 5,10-methylenetetrahydrofolate and dUMP; involved in deoxyribonucleotide biosynthesis; there are 2 copies in some Bacilli, one of which appears to be phage-derived
YP_002123444.1	similar to ref|NP_269080.1| 3-hydroxy-3-methylglutaryl-coenzyme A synthase (HMG-CoA synthase) [Streptococcus pyogenes M1 GAS]; Catalysis of the reaction: acetyl-CoA + H2O + acetoacetyl-CoA = (S)-3-hydroxy-3-methylglutaryl-CoA + CoA.
YP_002123445.1	similar to ref|NP_607084.1| HMG-CoA reductase [Streptococcus pyogenes MGAS8232]; Converts HMG-CoA to mevalonate.
YP_002123446.1	catalyzes the isomerization of isopentenyl pyrophosphate to dimethylallyl diphosphate
YP_002123447.1	similar to ref|YP_598351.1| Phosphomevalonate kinase [Streptococcus pyogenes MGAS10270]; Catalysis of the reaction: ATP + (R)-5-phosphomevalonate = ADP + (R)-5-diphosphomevalonate.
YP_002123448.1	similar to ref|YP_001128674.1| mevalonate diphosphate decarboxylase [Streptococcus pyogenes str. Manfredo]; Catalysis of the reaction: ATP + (R)-5-diphosphomevalonate = ADP + phosphate + isopentenyl diphosphate + CO2.
YP_002123449.1	similar to ref|NP_664399.1| mevalonate kinase [Streptococcus pyogenes MGAS315]; Catalysis of the reaction: ATP + (R)-mevalonate = ADP + (R)-5-phosphomevalonate.
YP_002123450.1	similar to ref|YP_001198771.1|  ABC transporter [Streptococcus suis 05ZYH33]
YP_002123451.1	similar to ref|YP_001200977.1| ABC-type multidrug transport system, ATPase and permease component [Streptococcus suis 98HAH33]
YP_002123452.1	similar to ref|YP_001200977.1| ABC-type multidrug transport system, ATPase and permease component [Streptococcus suis 98HAH33]
YP_002123453.1	similar to ref|YP_060013.1| 5'-nucleotidase [Streptococcus pyogenes MGAS10394]
YP_002123454.1	cleaves off formyl group from N-terminal methionine residues of newly synthesized proteins; binds iron(2+)
YP_002123455.1	converts 2-oxoglutarate to glutamate; in Escherichia coli this enzyme plays a role in glutamate synthesis when the cell is under energy restriction; uses NADPH; forms a homohexamer
YP_002123456.1	similar to ref|YP_001450473.1| permease ATP-binding protein [Streptococcus gordonii str. Challis substr. CH1]
YP_002123457.1	similar to ref|YP_001200357.1|  ABC transporter, ATP-binding protein [Streptococcus suis 98HAH33]
YP_002123458.1	similar to ref|YP_598341.1| ABC transporter ATP-binding protein uup [Streptococcus pyogenes MGAS10270]
YP_002123459.1	catalyzes the addition and repair of the 3'-terminal CCA sequence in tRNA; these proteins belong to the CCA-adding enzyme subfamily 2 which does not have phosphohydrolase activity
YP_002123460.1	similar to ref|ZP_00366624.1| COG1307: Uncharacterized protein conserved in bacteria [Streptococcus pyogenes M49 591]
YP_002123461.1	similar to ref|YP_060007.1| Transposase [Streptococcus pyogenes MGAS10394]
YP_002123462.1	similar to ref|ZP_00366628.1| COG1705: Muramidase (flagellum-specific) [Streptococcus pyogenes M49 591]; Hydrolyzes the cell wall of E.faecalis and M.lysodeikticus. May play an important role in cell wall growth and cell separation.
YP_002123463.1	similar to ref|ZP_02146542.1| Di- and tricarboxylate transporter [Phaeobacter gallaeciensis BS107]; Responsible For The Uptake Of Citrate In Exchange To The Efflux Of Succinate. Has A Relatively Broad Specificity For C(4)- Dicarboxylates And Tricarboxylates.
YP_002123464.1	similar to ref|ZP_02093443.1| hypothetical protein PEPMIC_00194 [Peptostreptococcus micros ATCC 33270]
YP_002123465.1	similar to ref|ZP_02094098.1| hypothetical protein PEPMIC_00856 [Peptostreptococcus micros ATCC 33270]
YP_002123466.1	similar to ref|ZP_02091657.1| hypothetical protein FAEPRAM212_01939 [Faecalibacterium prausnitzii M21/2]
YP_002123467.1	similar to ref|YP_596450.1| N-acetylmuramidase [Streptococcus pyogenes MGAS9429]; Cognates hydrolyze the cell wall of L.lactis and M.lysodeikticus. Required for cell separation during growth.
YP_002123468.1	similar to gb|EDQ65758.1| predicted protein [Physcomitrella patens subsp. patens]
YP_002123469.1	similar to ref|NP_269062.1|  fructose-specific enzyme II, PTS system BC component [Streptococcus pyogenes M1 GAS]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in fructose transport.
YP_002123470.1	similar to ref|YP_596448.1| 1-phosphofructokinase [Streptococcus pyogenes MGAS9429]; Catalysis of the reaction: ATP + D-tagatose 6-phosphate = ADP + D-tagatose 1,6-bisphosphate.
YP_002123471.1	similar to ref|NP_269060.1|  transcriptional repressor [Streptococcus pyogenes M1 GAS]; Repressor of the glycerol-3-phosphate regulon.
YP_002123472.1	ketopantoate reductase; catalyzes the NADPH reduction of ketopantoate to pantoate; functions in pantothenate (vitamin B5) biosynthesis
YP_002123473.1	similar to ref|NP_269058.1|  regulatory protein [Streptococcus pyogenes M1 GAS]
YP_002123474.1	similar to ref|ZP_00365412.1| COG0492: Thioredoxin reductase [Streptococcus pyogenes M49 591]; Catalysis of the reaction: thioredoxin + NADP+ = thioredoxin disulfide + NADPH + H+.
YP_002123475.1	methylates guanosine-37 in various tRNAs; uses S-adenosyl-L-methionine to transfer methyl group to tRNA
YP_002123476.1	Essential for efficient processing of 16S rRNA
YP_002123477.1	similar to ref|YP_596865.1| transposase [Streptococcus pyogenes MGAS9429]
YP_002123478.1	similar to ref|YP_602677.1| Transposase [Streptococcus pyogenes MGAS10750]
YP_002123479.1	similar to ref|ZP_00785378.1| subtilase [Streptococcus agalactiae COH1]; Unknown, has an 115aa domain with similarity to internalin A of Listeria monocytogenes.
YP_002123480.1	similar to ref|ZP_00874436.1| Integrase, catalytic region [Streptococcus suis 89/1591]
YP_002123481.1	similar to ref|ZP_02093841.1| hypothetical protein PEPMIC_00596 [Peptostreptococcus micros ATCC 33270]
YP_002123482.1	similar to ref|ZP_00366185.1| COG1837: Predicted RNA-binding protein (contains KH domain) [Streptococcus pyogenes M49 591]
YP_002123483.1	similar to ref|NP_269049.1| 30S ribosomal protein S16 [Streptococcus pyogenes M1 GAS]; In addition to being a ribosomal protein, S16 also has a cation-dependent endonuclease activity.
YP_002123484.1	similar to ref|NP_735374.1| hypothetical protein gbs0925 [Streptococcus agalactiae NEM316]
YP_002123485.1	similar to ref|YP_282009.1| ABC transporter permease [Streptococcus pyogenes MGAS5005]
YP_002123486.1	similar to ref|YP_280095.1| ABC transporter ATP-binding protein [Streptococcus pyogenes MGAS6180]
YP_002123487.1	similar to emb|CAM30488.1|  exported protein [Streptococcus pyogenes str. Manfredo]
YP_002123488.1	four CarB-CarA dimers form the carbamoyl phosphate synthetase holoenzyme that catalyzes the production of carbamoyl phosphate; CarB is responsible for the amidotransferase activity
YP_002123489.1	catalyzes production of carbamoyl phosphate from bicarbonate and glutamine in pyrimidine and arginine biosynthesis pathways; forms an octamer composed of four CarAB dimers
YP_002123490.1	catalyzes the transfer of the carbamoyl moiety from carbamoyl phosphate to L- aspartate in pyrimidine biosynthesis
YP_002123491.1	similar to ref|YP_001128709.1| uracil permease [Streptococcus pyogenes str. Manfredo]; Transport of uracil in the cell.
YP_002123492.1	regulates pyrimidine biosynthesis by binding to the mRNA of the pyr genes, also has been shown to have uracil phosphoribosyltransferase activity
YP_002123493.1	similar to ref|NP_815585.1| hypothetical protein EF1903 [Enterococcus faecalis V583]
YP_002123494.1	similar to ref|YP_059974.1| Ribosomal large subunit pseudouridine synthase D [Streptococcus pyogenes MGAS10394]; Responsible For Synthesis Of Pseudouridine From Uracil At Positions 1911, 1915 And 1917 In 23s Ribosomal RNA.
YP_002123495.1	lipoprotein signal peptidase; integral membrane protein that removes signal peptides from prolipoproteins during lipoprotein biosynthesis
YP_002123497.1	similar to ref|YP_280085.1| transcriptional regulator, LysR family [Streptococcus pyogenes MGAS6180]
YP_002123498.1	involved in the peptidyltransferase reaction during translation
YP_002123499.1	similar to ref|YP_001450118.1| ribosomal protein [Streptococcus gordonii str. Challis substr. CH1]
YP_002123500.1	similar to ref|NP_269034.1| 50S ribosomal protein L21 [Streptococcus pyogenes M1 GAS]; This protein binds to 23S ribosomal RNA in the presence of protein L20.
YP_002123501.1	similar to ref|YP_280081.1| capsule biosynthesis protein [Streptococcus pyogenes MGAS6180]
YP_002123502.1	similar to ref|NP_607417.1| hypothetical protein spyM18_1310 [Streptococcus pyogenes MGAS8232]
YP_002123503.1	similar to ref|YP_001449814.1|  permease [Streptococcus gordonii str. Challis substr. CH1] gb|AAG32545.1| Dsg [Streptococcus gordonii]
YP_002123505.1	similar to ref|ZP_01821646.1| transcriptional activator, Rgg/GadR/MutR family protein, C-terminal domain [Streptococcus pneumoniae SP6-BS73]
YP_002123506.1	in Escherichia coli this protein is involved in binding to the leader sequence of mRNAs and is itself bound to the 30S subunit; autoregulates expression via a C-terminal domain; in most gram negative organisms this protein is composed of 6 repeats of the S1 domain while in gram positive there are 4 repeats; the S1 nucleic acid-binding domain is found associated with other proteins
YP_002123507.1	similar to ref|YP_602302.1| hypothetical cytosolic protein [Streptococcus pyogenes MGAS10750]
YP_002123508.1	catalyzes the transamination of the branched-chain amino acids to their respective alpha-keto acids
YP_002123509.1	decatenates newly replicated chromosomal DNA and relaxes positive and negative DNA supercoiling
YP_002123510.1	similar to ref|YP_001128646.1| hypothetical protein SpyM51096 [Streptococcus pyogenes str. Manfredo]
YP_002123511.1	decatenates newly replicated chromosomal DNA and relaxes positive and negative DNA supercoiling
YP_002123512.1	involved in acylation of glycerol-3-phosphate to form 1-acyl-glycerol-3 phosphate for use in phospholipid biosynthesis; functions with PlsX
YP_002123513.1	catalyzes the formation of N-carbamoyl-L-aspartate from (S)-dihydroorotate in pyrimidine biosynthesis
YP_002123514.1	Excises uracil residues from the DNA which can arise as a result of misincorporation of dUMP residues by DNA polymerase or due to deamination of cytosine
YP_002123515.1	similar to gb|EDK88467.1| possible acetyltransferase [Fusobacterium nucleatum subsp.
YP_002123516.1	similar to ref|NP_664424.1|  ABC transporter (permease) [Streptococcus pyogenes MGAS315]; Part of a binding-protein-dependent transport system. Probably responsible for the translocation of the substrate across the membrane.
YP_002123517.1	similar to ref|NP_269099.1|  ABC transporter (binding protein) [Streptococcus pyogenes M1 GAS]; Probably part of a binding-protein-dependent transport system.
YP_002123518.1	catalyzes the hydrolysis of a monocarboxylic acid amid to form a monocarboxylate and ammonia
YP_002123519.1	similar to ref|ZP_00789806.1| acetyltransferase, GNAT family [Streptococcus agalactiae 515]
YP_002123520.1	similar to ref|NP_721600.1| orotate phosphoribosyltransferase [Streptococcus mutans UA159]; Catalysis of the reaction: orotidine 5'-phosphate + diphosphate = orotate + 5-phospho-alpha-D-ribose 1-diphosphate.
YP_002123521.1	type 1 subfamily; involved in last step of pyrimidine biosynthesis; converts orotidine 5'-phosphate to UMP and carbon dioxide; OMP decarboxylase; OMPDCase; OMPdecase
YP_002123522.1	similar to ref|YP_001128656.1| hypothetical protein SpyM51106 [Streptococcus pyogenes str. Manfredo]
YP_002123523.1	similar to ref|YP_596489.1| transcriptional regulators, LysR family [Streptococcus pyogenes MGAS9429]
YP_002123524.1	similar to ref|YP_060035.1| Histidine protein kinase [Streptococcus pyogenes MGAS10394]
YP_002123525.1	catalyzes the formation of a purine and ribose phosphate from a purine nucleoside; in E. coli this enzyme functions in xanthosine degradation
YP_002123526.1	catalyzes the transfer of phosphate between the C1 and C5 carbons of pentose
YP_002123527.1	Catalyzes D-ribose 5-phosphate --> D-ribulose 5-phosphate in the nonoxidative branch of the pentose phosphate pathway
YP_002123529.1	similar to ref|YP_001035335.1| hypothetical protein SSA_1387 [Streptococcus sanguinis SK36]
YP_002123534.1	similar to ref|YP_850136.1| hypothetical protein lwe1939 [Listeria welshimeri serovar 6b str. SLCC5334]
YP_002123537.1	in Escherichia coli this protein is involved in the biosynthesis of the hypermodified nucleoside 5-methylaminomethyl-2-thiouridine, which is found in the wobble position of some tRNAs and affects ribosomal frameshifting; shows potassium-dependent dimerization and GTP hydrolysis; also involved in regulation of glutamate-dependent acid resistance and activation of gadE
YP_002123538.1	similar to ref|NP_269235.1|  NADH dehydrogenase [Streptococcus pyogenes M1 GAS]; Catalysis of the reaction: 5,6,7,8-tetrahydropteridine + NAD(P)+ = a 6,7-dihydropteridine + NAD(P)H + H.
YP_002123539.1	The UvrABC repair system catalyzes the recognition and processing of DNA lesions. UvrC both incises the 5' and 3' sides of the lesion. The N-terminal half is responsible for the 3' incision and the C-terminal half is responsible for the 5' incision
YP_002123540.1	similar to ref|ZP_00784614.1| iron ABC transporter, iron-binding protein [Streptococcus agalactiae COH1]; Required For The Activity Of The Bacterial Periplasmic Transport System Of Putrescine And Spermidine. Polyamine Binding Protein.
YP_002123541.1	similar to ref|NP_688934.1| DNA-binding response regulator [Streptococcus agalactiae 2603V/R]; Member Of The Two-Component Regulatory System Atos/Atoc Involved In The Transcriptional Regulation Of The Ato Genes For Acetoacetate Metabolism. Also An Inhibitor Of Polyamine Biosynthesis.
YP_002123542.1	similar to ref|ZP_00780193.1| PTS system, IID component [Streptococcus agalactiae 18RS21]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in mannose transport.
YP_002123543.1	similar to ref|YP_060120.1| PTS system, mannose/fructose family IIC component [Streptococcus pyogenes MGAS10394]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in mannose transport.
YP_002123544.1	similar to ref|ZP_00784628.1| PTS system, IIB component [Streptococcus agalactiae COH1]
YP_002123545.1	similar to ref|YP_602425.1| PTS system, mannose/fructose family IIA component [Streptococcus pyogenes MGAS10750]
YP_002123546.1	similar to ref|YP_001128544.1| hypothetical protein SpyM50987 [Streptococcus pyogenes str. Manfredo]
YP_002123547.1	this stereospecific enzymes reduces the R isomer of methionine sulfoxide while MsrA reduces the S form; provides protection against oxidative stress
YP_002123549.1	binds to the ribosome on the universally-conserved alpha-sarcin loop
YP_002123551.1	similar to ref|YP_803634.1| Gene info Predicted prebacteriocin [Pediococcus pentosaceus ATCC 25745]; Bacteriocin
YP_002123552.1	similar to gb|ABD60751.1| class IIa sec-dependent bacteriocin [Enterococcus faecium]; Bacteriocin
YP_002123553.1	similar to ref|ZP_01821306.1| Bacteriocin processing peptidase / Bacteriocin export ABC transporter [Streptococcus pneumoniae SP6-BS73]; Involved in the export process of a bacteriocin lactococcin.
YP_002123554.1	similar to ref|ZP_01823865.1| hypothetical protein CGSSp9BS68_01433 [Streptococcus pneumoniae SP9-BS68]; ABC-type bacteriocin/lantibiotic exporters, contain an N-terminal double-glycine peptidase domain [Defense mechanisms].
YP_002123555.1	similar to ref|ZP_01817231.1| peptide pheromone BlpC [Streptococcus pneumoniae SP3-BS71]
YP_002123556.1	similar to ref|YP_001200659.1| transposase of IS200 family [Streptococcus suis 98HAH33]
YP_002123557.1	similar to ref|YP_001198456.1| transposase of IS200 family [Streptococcus suis 05ZYH33]
YP_002123559.1	present in two forms; L12 is normal, while L7 is aminoacylated at the N-terminal serine; the only multicopy ribosomal protein; 4:1 ratio of L7/L12 per ribosome; two L12 dimers bind L10; critically important for translation efficiency and fidelity; stimulates GTPase activity of translation factors
YP_002123560.1	binds the two ribosomal protein L7/L12 dimers and anchors them to the large ribosomal subunit
YP_002123561.1	similar to ref|YP_280215.1| hypothetical membrane spanning protein [Streptococcus pyogenes MGAS6180]
YP_002123562.1	similar to ref|YP_602413.1| Haloacid dehalogenase-like hydrolase [Streptococcus pyogenes MGAS10750]; Predicted to act in N-acetylglucosamine utilization subsystem.
YP_002123563.1	similar to ref|YP_282129.1| acyl-acyl carrier protein thioesterase [Streptococcus pyogenes MGAS5005]
YP_002123564.1	catalyzes the oxygen-independent formation of protoporphyrinogen-IX from coproporphyrinogen-III
YP_002123565.1	similar to ref|ZP_00875329.1| GCN5-related N-acetyltransferase [Streptococcus suis 89/1591]
YP_002123566.1	catalyzes the conversion of glucosamine-6-phosphate to glucosamine-1-phosphate
YP_002123567.1	similar to ref|NP_664474.1| hypothetical protein SpyM3_0670 [Streptococcus pyogenes MGAS315]
YP_002123568.1	similar to ref|YP_001128553.1| hypothetical protein SpyM50998 [Streptococcus pyogenes str. Manfredo]
YP_002123569.1	similar to ref|YP_598485.1| CobB/CobQ-like glutamine amidotransferase domain [Streptococcus pyogenes MGAS10270]
YP_002123570.1	similar to ref|NP_269204.1|  lipoate-protein ligase [Streptococcus pyogenes M1 GAS]; Catalyzes both the ATP-dependent activation of lipoate to lipoyl-AMP and the transfer of the activated lipoyl on the lipoate-dependent enzymes. Creates an amide linkage that joins the free carboxyl group of lipoic acid to the epsilon-amino group of a specific lysine residue in lipoyl domain of apoproteins.
YP_002123572.1	similar to ref|YP_598482.1| Dihydrolipoamide dehydrogenase [Streptococcus pyogenes MGAS10270]; The pyruvate dehydrogenase complex catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2). It contains multiple copies of three enzymatic components:pyruvate dehydrogenase (E1), dihydrolipoamide acetyltransferase (E2) and lipoamide dehydrogenase (E3).
YP_002123573.1	similar to ref|NP_607148.1| branched-chain alpha-keto acid dehydrogenase subunit E2 [Streptococcus pyogenes MGAS8232]; The 2-oxoglutarate dehydrogenase complex catalyzes the overall conversion of 2-oxoglutarate to succinyl-CoA and Co(2). It contains multiple copies of three enzymatic components: 2- oxoglutarate dehydrogenase (E1), dihydrolipoamide succinyltransferase (E2) and lipoamide dehydrogenase (E3).
YP_002123574.1	similar to ref|NP_269200.1|  acetoin dehydrogenase (TPP-dependent) beta chain [Streptococcus pyogenes M1 GAS]; The pyruvate dehydrogenase complex catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2). It contains multiple copies of three enzymatic components:pyruvate dehydrogenase (E1), dihydrolipoamide acetyltransferase (E2) and lipoamide dehydrogenase (E3).
YP_002123575.1	similar to ref|NP_802454.1|  acetoin dehydrogenase (TPP-dependent) alpha chain [Streptococcus pyogenes SSI-1]; The pyruvate dehydrogenase complex catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2). It contains multiple copies of three enzymatic components:pyruvate dehydrogenase (E1), dihydrolipoamide acetyltransferase (E2) and lipoamide dehydrogenase (E3).
YP_002123576.1	similar to ref|YP_001128561.1| ABC transporter ATP-binding protein [Streptococcus pyogenes str. Manfredo]; Facilitated transport
YP_002123577.1	similar to ref|ZP_00365872.1| hypothetical protein SpyoM01000868 [Streptococcus pyogenes M49 591]
YP_002123578.1	similar to ref|NP_607143.1|  tributyrin esterase [Streptococcus pyogenes MGAS8232]
YP_002123579.1	similar to ref|YP_060090.1| Zn-dependent hydrolase [Streptococcus pyogenes MGAS10394]
YP_002123580.1	similar to ref|NP_607141.1|  ABC transporter (ATP-binding protein) [Streptococcus pyogenes MGAS8232]; Part of the ABC transporter complex. Responsible for energy coupling to the transport system.
YP_002123581.1	similar to ref|YP_602391.1| ABC transporter permease [Streptococcus pyogenes MGAS10750]; Part Of The Binding-Protein-Dependent Transport System For Ribose. Probably Responsible For The Translocation Of The Substrate Across The Membrane.
YP_002123582.1	similar to ref|ZP_00788072.1| ABC transporter, permease [Streptococcus agalactiae CJB111]
YP_002123583.1	similar to ref|YP_329889.1| ABC transporter, substrate-binding protein,  [Streptococcus agalactiae A909]
YP_002123585.1	similar to ref|YP_280188.1| fibrinogen-binding protein [Streptococcus pyogenes MGAS6180]; adhesin, lacks a canonical Sec pathway amino terminal secretion-signal peptide.
YP_002123586.1	similar to ref|YP_282102.1| tetratricopeptide repeat family protein [Streptococcus pyogenes MGAS5005]
YP_002123587.1	similar to ref|YP_602385.1| hypothetical membrane spanning protein [Streptococcus pyogenes MGAS10750]
YP_002123588.1	similar to ref|NP_664453.1|  dGTP pyrophosphohydrolase [Streptococcus pyogenes MGAS315]; Involved in the DNA repair system to avoid A.T to G.C transversions. Degrades 8-oxo-dGTP to the monophosphate, but is also active on all of the nucleoside triphosphates.
YP_002123589.1	similar to pdb|1KEP|A Chain A, the crystal structure of dTDP-D-glucose 4,6-dehydratase (RmlB) from Streptococcus suis with dTDP-xylose bound; Catalysis of the reaction: dTDP-glucose = dTDP-4-dehydro-6-deoxy-D-glucose + H2O.
YP_002123590.1	similar to ref|NP_688208.1| dTDP-4-dehydrorhamnose 3,5-epimerase [Streptococcus agalactiae 2603V/R]; Catalysis of the reaction: dTDP-4-dehydro-6-deoxy-D-glucose = dTDP-4-dehydro-6-deoxy-L-mannose.
YP_002123591.1	similar to ref|YP_280182.1| glucose-1-phosphate thymidylyltransferase [Streptococcus pyogenes MGAS6180]; Catalyzes the formation of dTDP-glucose, from dTTP and glucose 1-phosphate, as well as its pyrophosphorolysis.
YP_002123592.1	similar to ref|YP_596523.1| glycine/D-amino acid oxidases family [Streptococcus pyogenes MGAS9429]
YP_002123593.1	similar to ref|YP_001128625.1| NIF3 (NGG1p interacting factor 3) family protein [Streptococcus pyogenes str. Manfredo]
YP_002123594.1	similar to ref|NP_269124.1| hypothetical protein SPy_0930 [Streptococcus pyogenes M1 GAS]
YP_002123595.1	similar to ref|YP_598398.1| Endonuclease III [Streptococcus pyogenes MGAS10270]; Has both an apurinic and/or apyrimidinic endonuclease activity and a DNA N-glycosylase activity. Incises damaged DNA at cytosines, thymines and guanines. Acts on a damaged strand, 5' from the damaged site. Required for the repair of both oxidative DNA damage and spontaneous mutagenic lesions.
YP_002123596.1	similar to ref|YP_598397.1| DNA replication protein dnaD [Streptococcus pyogenes MGAS10270]; component of primosome involved in the initiation of DNA replication.
YP_002123597.1	catalyzes a salvage reaction resulting in the formation of AMP which is metabolically less costly than a de novo synthesis
YP_002123598.1	similar to ref|YP_001035269.1| hypothetical protein SSA_1320 [Streptococcus sanguinis SK36]
YP_002123599.1	similar to ref|YP_598395.1| Single-stranded-DNA-specific exonuclease recJ [Streptococcus pyogenes MGAS10270]; Single-stranded-DNA-specific exonuclease. Required for many types of recombinational events, although the stringency of the requirement for recJ appears to vary with the type of recombinational event monitored and the other recombination gene products which are available.
YP_002123600.1	similar to ref|NP_664442.1|  oxidoreductase, short chain dehydrogenase/reductase family [Streptococcus pyogenes MGAS315]
YP_002123601.1	member of metallo-beta-lactamase family; the purified enzyme from Escherichia coli forms dimeric zinc phosphodiesterase; in Bacillus subtilis this protein is a 3'-tRNA processing endoribonuclease and is essential while in Escherichia coli it is not; associates with two zinc ions
YP_002123602.1	similar to ref|YP_280172.1| cystathionine beta-lyase [Streptococcus pyogenes MGAS6180]
YP_002123603.1	similar to ref|NP_607120.1|  GTP-binding protein [Streptococcus pyogenes MGAS8232]
YP_002123604.1	IPP transferase; isopentenyltransferase; involved in tRNA modification; in Escherichia coli this enzyme catalyzes the addition of a delta2-isopentenyl group from dimethylallyl diphosphate to the N6-nitrogen of adenosine adjacent to the anticodon of tRNA species that read codons starting with uracil; further tRNA modifications may occur; mutations in miaA result in defects in translation efficiency and fidelity
YP_002123605.1	similar to ref|YP_602309.1| hypothetical protein MGAS10750_Spy0815 [Streptococcus pyogenes MGAS10750]
YP_002123606.1	similar to ref|YP_895632.1| possible uridine kinase [Bacillus thuringiensis str. Al Hakam]
YP_002123607.1	similar to ref|YP_280504.1| glycogen phosphorylase [Streptococcus pyogenes MGAS6180]; Phosphorylase is an important allosteric enzyme in carbohydrate metabolism. Enzymes from different sources differ in their regulatory mechanisms and in their natural substrates. However, all known phosphorylases share catalytic and structural properties.
YP_002123608.1	amylomaltase; acts to release glucose from maltodextrins
YP_002123609.1	similar to ref|YP_596834.1| transcriptional regulator, LacI family [Streptococcus pyogenes MGAS9429]; Transcriptional repressor of the malA gene for maltase.
YP_002123610.1	similar to ref|YP_596835.1| maltose/maltodextrin-binding protein [Streptococcus pyogenes MGAS9429]; Binding protein for maltose and maltodextrin; involved in its cellular uptake.
YP_002123611.1	similar to ref|NP_269422.1|  maltose/maltodextrin ABC transport system (permease) [Streptococcus pyogenes M1 GAS]; Part of the binding-protein-dependent transport system for maltodextrin; probably responsible for the translocation of the substrate across the membrane.
YP_002123612.1	similar to ref|NP_269423.1|  maltose/maltodextrin ABC transport system (permease) [Streptococcus pyogenes M1 GAS]; Part of the binding-protein-dependent transport system for maltodextrin; probably responsible for the translocation of the substrate across the membrane.
YP_002123613.1	similar to ref|YP_598727.1| Maltodextrose utilization protein malA [Streptococcus pyogenes MGAS10270]; Has a role in maltotetraose utilization.
YP_002123614.1	similar to ref|NP_269427.1| maltodextrin transport system permease [Streptococcus pyogenes M1 GAS]; Part of the binding-protein-dependent transport system for maltodextrin; probably responsible for the translocation of the substrate across the membrane.
YP_002123615.1	similar to ref|YP_280514.1| alpha-amylase [Streptococcus pyogenes MGAS6180]; Degrades starch to alpha-, beta-, and gamma- cyclodextrins, as well as linear sugars.
YP_002123616.1	similar to ref|YP_598731.1| Neopullulanase / Cyclomaltodextrinase / Maltogenic alpha-amylase [Streptococcus pyogenes MGAS10270]; Hydrolyzes cyclodextrins. Can also act on linear maltodextrins, with the exception of maltose.
YP_002123617.1	similar to ref|YP_280516.1| maltose/maltodextrin-binding protein [Streptococcus pyogenes MGAS6180]; Binding protein for maltose and maltodextrin; involved in its cellular uptake.
YP_002123618.1	similar to ref|NP_269431.1|  esterase [Streptococcus pyogenes M1 GAS]; This protein removes the N-acetyl group from bialaphos as one of the final steps of the bialaphos biosynthetic pathway.
YP_002123619.1	similar to ref|NP_664795.1| hypothetical protein DltD [Streptococcus pyogenes MGAS315]; Could be responsible for the transfer of D-alanine residues from D-Ala-undecaprenol phosphate to the poly(glycerophosphate) chains.
YP_002123620.1	D-alanyl carrier protein subunit; involved in the incorporation of D-alanine into membrane-associated D-alanyl-lipoteichoic acid; D-alanyl carrier protein is the acceptor of activated D-alanine which it donates to a membrane acceptor(D-alanyl transferase) for incorporation into membrane lipoteichoic acid
YP_002123621.1	similar to ref|YP_060360.1| DltB [Streptococcus pyogenes MGAS10394]; Could be involved in the transport of activated D- alanine through the membrane.
YP_002123622.1	transfers D-alanine to the D-alanyl carrier protein during the incorporation of D-alanine into lipoteichoic acid
YP_002123623.1	similar to ref|NP_607430.1| hypothetical protein spyM18_1325 [Streptococcus pyogenes MGAS8232]
YP_002123624.1	The UvrABC repair system catalyzes the recognition and processing of DNA lesions. The beta-hairpin of the Uvr-B subunit is inserted between the strands, where it probes for the presence of a lesion
YP_002123625.1	similar to ref|YP_001128349.1|  glutamine ABC transporter,glutamine-binding protein/permease [Streptococcus pyogenes str. Manfredo]; Part of the binding-protein-dependent transport system for glutamine; probably responsible for the translocation of the substrate across the membrane.
YP_002123626.1	similar to ref|YP_280526.1| glutamine transport ATP-binding protein [Streptococcus pyogenes MGAS6180]; Probably part of a binding-protein-dependent transport system for an amino acid. Probably responsible for energy coupling to the transport system.
YP_002123628.1	similar to ref|NP_607434.1| hypothetical protein spyM18_1329 [Streptococcus pyogenes MGAS8232]
YP_002123629.1	similar to ref|YP_282442.1| PTS system, cellobiose-specific IIC component [Streptococcus pyogenes MGAS5005]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in cellobiose transport.
YP_002123630.1	similar to ref|YP_060367.1| hypothetical protein M6_Spy1049 [Streptococcus pyogenes MGAS10394]
YP_002123631.1	similar to ref|NP_269440.1|  PTS enzyme III [Streptococcus pyogenes M1 GAS]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in lichenan transport.
YP_002123632.1	similar to ref|YP_001128343.1| lactose/cellobiose-specific phosphotransferase system (PTS), IIB component [Streptococcus pyogenes str. Manfredo]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active-transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in cellobiose transport.
YP_002123633.1	similar to gb|AAX72177.1| transcription antiterminator, BglG family [Streptococcus pyogenes MGAS6180]; Positive regulator of the licABCH operon.
YP_002123634.1	similar to ref|YP_060371.1| outer surface protein [Streptococcus pyogenes MGAS10394]
YP_002123635.1	similar to ref|YP_001128339.1| nicotinamide mononucleotide transporter [Streptococcus pyogenes str. Manfredo]
YP_002123636.1	similar to ref|NP_269446.1| hypothetical protein SPy_1332 [Streptococcus pyogenes M1 GAS]
YP_002123637.1	essential GTPase; exhibits high exchange rate for GTP/GDP; associates with 50S ribosomal subunit; involved in regulation of chromosomal replication
YP_002123638.1	similar to ref|ZP_00790289.1| aminopeptidase PepS [Streptococcus agalactiae 515]; Exhibits a high specificity towards peptides possessing arginine or aromatic amino acids at the N-terminus. Could be involved both in bacterial growth by supplying amino acids.
YP_002123639.1	similar to ref|YP_001201503.1| 16S rRNA uridine-516 pseudouridylate synthase and related Pseudouridylate synthase [Streptococcus suis 98HAH33]; Responsible for synthesis of pseudouridine from uracil- 516 in 16S ribosomal RNA.
YP_002123640.1	similar to ref|NP_269451.1| hypothetical protein SPy_1339 [Streptococcus pyogenes M1 GAS]
YP_002123641.1	similar to ref|YP_001128328.1| major facilitator superfamily protein [Streptococcus pyogenes str. Manfredo]
YP_002123642.1	similar to ref|NP_664825.1|  ATP-dependent Zn protease [Streptococcus pyogenes MGAS315]
YP_002123643.1	similar to ref|YP_596870.1| thioesterase superfamily protein [Streptococcus pyogenes MGAS9429]; Phenylacetic acid aerobic catabolism.
YP_002123645.1	similar to ref|YP_319963.1| hypothetical protein Ava_B0060 [Anabaena variabilis ATCC 29413]
YP_002123646.1	similar to ref|NP_664256.1| hypothetical protein SpyM3_0452 [Streptococcus pyogenes MGAS315]; Displays high phosphatase activity toward erythrose 4- phosphate, fructose 6-phosphate, 2-deoxyglucose 6-phosphate, and mannose 6-phosphate. May have a role in the intracellular metabolism of many phosphorylated carbohydrates.
YP_002123647.1	similar to emb|CAG09263.1| unnamed protein product [Tetraodon nigroviridis]
YP_002123648.1	similar to gb|ABV69920.1| hyaluronidase [Streptococcus equi subsp. zooepidemicus]
YP_002123649.1	catalyzes the formation of pyruvate and glyoxylate from 4-hydroxy-2-oxoglutarate; or pyruvate and D-glyceraldehyde 3-phosphate from 2-dehydro-3-deoxy-D-glyconate 6-phosphate
YP_002123650.1	similar to ref|YP_602039.1| 2-dehydro-3-deoxygluconokinase [Streptococcus pyogenes MGAS10750]; Catalysis of the reaction: ATP + 2-dehydro-3-deoxy-D-gluconate = ADP + beta-L-arabinose 1-phosphate.
YP_002123651.1	similar to gb|ABF33585.1| Galactose-6-phosphate isomerase LacB subunit [Streptococcus pyogenes MGAS10270]
YP_002123652.1	Involved in the nonphosphorylative, ketogenic oxidation of glucose and oxidizes gluconate to 5-ketogluconate
YP_002123653.1	similar to ref|YP_059862.1| PTS system, N-acetylgalactosamine-specific IIA component [Streptococcus pyogenes MGAS10394]; Catalysis of the PEP-dependent, phosphoryl transfer-driven transport of substances across a membrane. The transport happens by catalysis of the reaction: protein N-phosphohistidine + sugar(out) = protein histidine + sugar phosphate(in). This differs from primary and secondary active transport in that the solute is modified during transport.
YP_002123654.1	similar to ref|YP_596245.1| unsaturated glucuronyl hydrolase [Streptococcus pyogenes MGAS9429]; Catalyzes the hydrolysis of oligosaccharides with unsaturated glucuronyl residues at the nonreducing terminal, to a sugar or an amino sugar, and an unsaturated D-glucuronic acid (GlcA), which is nonenzymatically converted immediately to alpha- keto acid.
YP_002123655.1	similar to ref|YP_279969.1| PTS system, N-acetylgalactosamine-specific IIB component [Streptococcus pyogenes MGAS6180]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in N-acetylgalactosamine transport.
YP_002123656.1	similar to ref|NP_268877.1|  PTS dependent N-acetyl-galactosamine-IIC component [Streptococcus pyogenes M1 GAS]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in N-acetylgalactosamine transport.
YP_002123657.1	similar to ref|YP_059858.1| PTS system, N-acetylgalactosamine-specific IID component [Streptococcus pyogenes MGAS10394]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in N-acetylgalactosamine transport.
YP_002123658.1	similar to ref|YP_602030.1| Transcriptional regulator, LacI family [Streptococcus pyogenes MGAS10750]; Sugar-binding transcriptional regulator.
YP_002123659.1	similar to ref|YP_001451052.1| hypothetical protein SGO_1783 [Streptococcus gordonii str. Challis substr. CH1]
YP_002123660.1	similar to ref|YP_001035341.1| hypothetical protein SSA_1393 [Streptococcus sanguinis SK36]
YP_002123661.1	similar to ref|YP_001035340.1| hypothetical protein SSA_1392 [Streptococcus sanguinis SK36]
YP_002123662.1	similar to ref|YP_001035338.1| hypothetical protein SSA_1390 [Streptococcus sanguinis SK36]
YP_002123663.1	similar to ref|NP_664244.1|  calcium transporter [Streptococcus pyogenes MGAS315]; Could possibly be a calcium ATPase
YP_002123664.1	similar to ref|YP_602028.1| hypothetical cytosolic protein [Streptococcus pyogenes MGAS10750]
YP_002123665.1	similar to ref|YP_596237.1| dGTP triphosphohydrolase [Streptococcus pyogenes MGAS9429]; Catalysis of the reaction: dGTP + H2O = deoxyguanosine + triphosphate.
YP_002123667.1	similar to ref|ZP_00366263.1| COG0561: Predicted hydrolases of the HAD superfamily [Streptococcus pyogenes M49 591]
YP_002123668.1	similar to ref|YP_598114.1| UDP-N-acetylmuramoylpentapeptide-lysine N(6)-alanyltransferase / UDP-N-acetylmuramoylpentapeptide-lysine N(6)-seryltransferase [Streptococcus pyogenes MGAS10270]
YP_002123669.1	similar to ref|YP_820103.1| Peptidoglycan interpeptide bridge formation enzyme [Streptococcus thermophilus LMD-9]
YP_002123670.1	Reversibly isomerizes the ketone sugar dihydroxyacetone phosphate to the aldehyde sugar glyceraldehyde-3-phosphate
YP_002123671.1	EF-Tu; promotes GTP-dependent binding of aminoacyl-tRNA to the A-site of ribosomes during protein biosynthesis; when the tRNA anticodon matches the mRNA codon, GTP hydrolysis results; the inactive EF-Tu-GDP leaves the ribosome and release of GDP is promoted by elongation factor Ts; many prokaryotes have two copies of the gene encoding EF-Tu
YP_002123672.1	similar to gb|AAN18292.1| immunoreactive protein Se117 [Streptococcus equi]; Unknown, may be a viral enhancing factor (an enhancin); 1st 700aa are virtually identical to immunoreactive protein Se117 of S. equi, and the last 300aa are similar to a chitin-binding protein of B. thuringiensis.
YP_002123673.1	similar to ref|ZP_00786125.1| conserved hypothetical protein [Streptococcus agalactiae COH1]
YP_002123674.1	similar to gb|AAN18293.1| Se18.7 [Streptococcus equi]; DNA-directed RNA polymerase specialized sigma subunit
YP_002123675.1	similar to ref|YP_001039946.1| hypothetical protein phi3396_59 [Streptococcus phage phi3396]; Possibly involved in regulation has an HTH DNA-binding domain and shares similarity with phage cI transcriptional regulator.
YP_002123676.1	similar to ref|YP_602418.1| hypothetical protein MGAS10750_Spy0924 [Streptococcus pyogenes MGAS10750]; ly involved in mediating bacterial immunity to mobile genetic elements such as phages and ICEs.
YP_002123677.1	similar to ref|NP_269217.1| hypothetical protein SPy_1048 [Streptococcus pyogenes M1 GAS]; ly involved in mediating bacterial immunity to mobile genetic elements such as phages and ICEs.
YP_002123678.1	similar to ref|NP_721763.1| hypothetical protein SMU.1404c [Streptococcus mutans UA159]; ly involved in mediating bacterial immunity to mobile genetic elements such as phages and ICEs.
YP_002123679.1	similar to ref|YP_282132.1| hypothetical cytosolic protein [Streptococcus pyogenes MGAS5005]; ly involved in mediating bacterial immunity to mobile genetic elements such as phages and ICEs.
YP_002123680.1	similar to ref|YP_012695.1| hypothetical protein LMOf2365_0084 [Listeria monocytogenes str. 4b F2365]; Possible undefined CRISPR-associated protein.
YP_002123681.1	similar to ref|YP_012695.1| hypothetical protein LMOf2365_0084 [Listeria monocytogenes str. 4b F2365]; Lmo0066 homolog within ESAT-6 gene cluster, similarity to ADP-ribosylating toxins.
YP_002123682.1	similar to ref|YP_001035282.1| hypothetical protein SSA_1333 [Streptococcus sanguinis SK36]
YP_002123683.1	similar to ref|ZP_02093553.1| hypothetical protein PEPMIC_00304 [Peptostreptococcus micros ATCC 33270]
YP_002123684.1	similar to ref|YP_820678.1| hypothetical protein STER_1302 [Streptococcus thermophilus LMD-9]
YP_002123685.1	similar to ref|XP_001303410.1| Gene info Clan CA, family C19, ubiquitin hydrolase-like cysteine peptidase [Trichomonas vaginalis G3]
YP_002123686.1	similar to ref|ZP_02093553.1| hypothetical protein PEPMIC_00304 [Peptostreptococcus micros ATCC 33270]; Lmo0066 homolog within ESAT-6 gene cluster, similarity to ADP-ribosylating toxins.
YP_002123687.1	similar to ref|YP_906161.1| conserved alanine and proline rich protein [Mycobacterium ulcerans Agy99]
YP_002123688.1	similar to gb|EDS33976.1| calpain [Culex pipiens quinquefasciatus]; Unknown, possible calpain-like cysteine proteiase.
YP_002123689.1	similar to ref|ZP_02093553.1| hypothetical protein PEPMIC_00304 [Peptostreptococcus micros ATCC 33270]
YP_002123690.1	similar to ref|ZP_02093553.1| hypothetical protein PEPMIC_00304 [Peptostreptococcus micros ATCC 33270]
YP_002123691.1	similar to ref|NP_268574.1|  transposase, IS861 [Streptococcus pyogenes M1 GAS]
YP_002123692.1	similar to ref|YP_602677.1| Transposase [Streptococcus pyogenes MGAS10750]
YP_002123693.1	similar to ref|NP_664225.1| hypothetical protein SpyM3_0421 [Streptococcus pyogenes MGAS315]
YP_002123694.1	similar to ref|NP_688697.1| drug resistance transporter, EmrB/QacA family [Streptococcus agalactiae 2603V/R]; Translocase that confers resistance to substances of high hydrophobicity.
YP_002123695.1	class II; LysRS2; catalyzes a two-step reaction, first charging a lysine molecule by linking its carboxyl group to the alpha-phosphate of ATP, followed by transfer of the aminoacyl-adenylate to its tRNA; in Methanosarcina barkeri, LysRS2 charges both tRNA molecules for lysine that exist in this organism and in addition can charge the tRNAPyl with lysine in the presence of LysRS1
YP_002123698.1	similar to ref|YP_602006.1| hypothetical cytosolic protein [Streptococcus pyogenes MGAS10750]; Unknown, bacterial seryl-tRNA synthetase related.
YP_002123701.1	similar to ref|ZP_00365935.1| COG0826: Collagenase and related proteases [Streptococcus pyogenes M49 591]; The hydrolysis of a peptide bond or bonds within a protein.
YP_002123702.1	similar to ref|ZP_00365936.1| COG0826: Collagenase and related proteases [Streptococcus pyogenes M49 591]
YP_002123703.1	similar to ref|ZP_00365937.1| COG0477: Permeases of the major facilitator superfamily [Streptococcus pyogenes M49 591]
YP_002123704.1	similar to gb|ABF37458.1| hypothetical exported protein [Streptococcus pyogenes MGAS10750]
YP_002123705.1	similar to ref|ZP_00365939.1| COG4768: Uncharacterized protein containing a divergent version of the methyl-accepting chemotaxis-like domain [Streptococcus pyogenes M49 591]
YP_002123706.1	transfers the N-acyl diglyceride moiety to the prospective N-terminal cysteine in prolipoprotein
YP_002123707.1	catalyzes the phosphorylation of the phosphocarrier protein HPr of the bacterial phosphotransferase system
YP_002123708.1	stress-responsive transcriptional regulator; similar to ref|YP_059824.1| stress-responsive transcriptional regulator [Streptococcus pyogenes MGAS10394]
YP_002123709.1	similar to gb|ABF31661.1| metallopeptidase, SprT family [Streptococcus pyogenes MGAS9429]
YP_002123710.1	similar to ref|YP_601996.1| transcription accessory protein [Streptococcus pyogenes MGAS10750]
YP_002123711.1	similar to ref|ZP_01371554.1| transposase, IS4 [Desulfitobacterium hafniense DCB-2]
YP_002123712.1	similar to ref|YP_601318.1| hypothetical protein MGAS2096_Spy1722 [Streptococcus pyogenes MGAS2096]
YP_002123713.1	ATP-binding protein; PstABCS is an ATP dependent phosphate uptake system which is responsible for inorganic phosphate uptake during phosphate starvation
YP_002123714.1	similar to ref|ZP_01825632.1| phosphate ABC transporter, permease [Streptococcus pneumoniae SP11-BS70]; Part of the binding-protein-dependent transport system. Probably responsible for the translocation of the substrate across the membrane.
YP_002123715.1	similar to ref|NP_346505.1| phosphate ABC transporter, permease [Streptococcus pneumoniae TIGR4]; Part of the binding-protein-dependent transport system. Probably responsible for the translocation of the substrate across the membrane.
YP_002123716.1	similar to ref|NP_359486.1| ABC transporter substrate-binding protein - phosphate transport [Streptococcus pneumoniae R6]; Part of a binding-protein-dependent transport system.
YP_002123717.1	similar to ref|ZP_01817667.1| sensor histidine kinase PnpS [Streptococcus pneumoniae SP3-BS71]; Member of the two-component regulatory system phoP/phoR involved in the alkaline phosphatases genes regulation. PhoR may function as a membrane-associated protein kinase that phosphorylates phoP in response to environmental signals.
YP_002123718.1	similar to ref|ZP_01817666.1| response regulator [Streptococcus pneumoniae SP3-BS71]; Member of the two-component regulatory system phoP/phoR involved in the regulation of alkaline phosphatase genes phoA and phoB and of phosphodiesterase.
YP_002123719.1	similar to ref|NP_268841.1| hypothetical protein SPy_0577 [Streptococcus pyogenes M1 GAS]
YP_002123720.1	similar to ref|YP_279928.1| hypothetical membrane spanning protein [Streptococcus pyogenes MGAS6180]
YP_002123721.1	similar to ref|YP_279927.1| hypothetical membrane spanning protein [Streptococcus pyogenes MGAS6180]
YP_002123722.1	similar to ref|YP_059819.1| Hypothetical membrane spanning protein [Streptococcus pyogenes MGAS10394]
YP_002123723.1	similar to ref|YP_281839.1| 6-phospho-beta-glucosidase [Streptococcus pyogenes MGAS5005]; Can Hydrolyze Salicin And Arbutin.
YP_002123724.1	similar to ref|YP_001128925.1| beta-glucoside-specific phosphotransferase system (PTS), IIABC component [Streptococcus pyogenes str. Manfredo]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in arbutin, cellobiose, and salicin transport.
YP_002123725.1	similar to ref|ZP_00365852.1| COG1263: Phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific [Streptococcus pyogenes M49 591]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in beta-glucoside transport.
YP_002123726.1	similar to ref|YP_281837.1| transcription antiterminator, BglG family [Streptococcus pyogenes MGAS5005]; Mediates positive regulation by functioning as an antiterminator factor of transcription.
YP_002123727.1	similar to ref|YP_601988.1| Cell division protein ftsY [Streptococcus pyogenes MGAS10750]; Required for normal cell growth and morphogenesis; translocation of at least 1 protein is impaired in its absence.
YP_002123728.1	similar to ref|YP_059813.1| Hydrolase (HAD superfamily) [Streptococcus pyogenes MGAS10394]
YP_002123729.1	similar to ref|YP_001128930.1|  haloacid dehalogenase-like hydrolase [Streptococcus pyogenes str. Manfredo]
YP_002123731.1	similar to ref|YP_001036160.1| hypothetical protein SSA_2248 [Streptococcus sanguinis SK36]
YP_002123732.1	similar to ref|YP_599261.1| ABC transporter ATP-binding protein [Streptococcus pyogenes MGAS10270]
YP_002123733.1	similar to ref|YP_001036162.1| ABC-type antimicrobial peptide transporter, permease component, [Streptococcus sanguinis SK36]
YP_002123734.1	similar to gb|ABF34719.1| hypothetical exported protein [Streptococcus pyogenes MGAS10270]
YP_002123736.1	similar to ref|ZP_00874485.1| Lipase, class 3 [Streptococcus suis 89/1591]
YP_002123737.1	similar to ref|ZP_00780318.1| conserved hypothetical protein [Streptococcus agalactiae 18RS21]
YP_002123738.1	similar to ref|ZP_00780318.1| conserved hypothetical protein [Streptococcus agalactiae 18RS21]
YP_002123739.1	similar to ref|ZP_00366640.1| COG1196: Chromosome segregation ATPases [Streptococcus pyogenes M49 591]; Plays an important role in chromosome structure and partitioning. Essential for chromosome partition.
YP_002123740.1	cytoplasmic enzyme involved in processing rRNA and some mRNAs; substrates typically have dsRNA regions; forms a homodimer; have N-terminal nuclease and C-terminal RNA-binding domains; requires magnesium as preferred ion for activity
YP_002123741.1	similar to ref|YP_597797.1| Transcriptional regulator [Streptococcus pyogenes MGAS10270]
YP_002123742.1	similar to ref|YP_001127764.1|  regulatory protein-RofA related [Streptococcus pyogenes str. Manfredo]
YP_002123743.1	similar to ref|YP_059789.1| Zn-dependent hydrolase (beta-lactamase superfamily) [Streptococcus pyogenes MGAS10394]
YP_002123744.1	similar to ref|YP_600051.1| Two-component sensor histidine kinase VicK [Streptococcus pyogenes MGAS2096]
YP_002123745.1	similar to emb|CAB65451.1| VicR protein [Streptococcus pyogenes]
YP_002123746.1	similar to ref|YP_596165.1| hypothetical cytosolic protein [Streptococcus pyogenes MGAS9429]
YP_002123747.1	similar to ref|YP_600048.1| Long-chain-fatty-acid--CoA ligase [Streptococcus pyogenes MGAS2096]; Catalysis of the reaction: ATP + a long-chain carboxylic acid + CoA = AMP + diphosphate + an acyl-CoA; long-chain fatty acids have chain lengths of C12-18.
YP_002123748.1	similar to ref|ZP_00366633.1| COG0183: Acetyl-CoA acetyltransferase [Streptococcus pyogenes M49 591]; Thiolytic cleavage of beta-ketoadipyl-CoA to succinate and acetyl-CoA (by similarity).
YP_002123749.1	similar to ref|NP_606782.1| hypothetical protein spyM18_0589 [Streptococcus pyogenes MGAS8232]
YP_002123751.1	similar to ref|YP_279887.1| ABC transporter permease [Streptococcus pyogenes MGAS6180]
YP_002123752.1	similar to ref|YP_601937.1| Daunorubicin resistance transmembrane protein [Streptococcus pyogenes MGAS10750]
YP_002123753.1	similar to ref|ZP_00783216.1| ABC transporter, ATP-binding protein [Streptococcus agalactiae H36B]
YP_002123754.1	catalyzes a two-step reaction, first charging a threonine molecule by linking its carboxyl group to the alpha-phosphate of ATP, followed by transfer of the aminoacyl-adenylate to its tRNA; catalyzes the formation of threonyl-tRNA(Thr) from threonine and tRNA(Thr)
YP_002123755.1	similar to ref|YP_279883.1| 1,2-diacylglycerol 3-glucosyltransferase [Streptococcus pyogenes MGAS6180]
YP_002123756.1	similar to ref|YP_279882.1| glycosyltransferase [Streptococcus pyogenes MGAS6180]
YP_002123758.1	converts 1,4-alpha-D-glucans to maltodextrin
YP_002123759.1	similar to gb|ABL07487.1| catabolite control protein A [Streptococcus equi subsp. zooepidemicus]; Transcriptional regulator involved in both the repression of carbohydrate utilization genes and in the positive regulation of genes involved in excretion of excess carbon.
YP_002123761.1	similar to ref|NP_268790.1|  NAD(P)H-flavin oxidoreductase [Streptococcus pyogenes M1 GAS]
YP_002123762.1	similar to ref|YP_598030.1| Bactoprenol glucosyl transferase [Streptococcus pyogenes MGAS10270]; Catalyzes the transfer of the glucose residue from UDP-glucose to a lipid carrier (by similarity).
YP_002123764.1	binds to ssrA RNA (tmRNA) and is required for its successful binding to ribosomes; also appears to function in the trans-translation step by promoting accommodation of tmRNA into the ribosomal A site; SmpB protects the tmRNA from RNase R degradation in Caulobacter crescentus; both the tmRNA and SmpB are regulated in cell cycle-dependent manner; functions in release of stalled ribosomes from damaged mRNAs and targeting proteins for degradation
YP_002123765.1	similar to ref|YP_601921.1| Exoribonuclease II [Streptococcus pyogenes MGAS10750]; 3'-5'exoribonuclease that participates in an essential cell function. Acts nonspecifically on poly(A), poly(U) and ribosomal RNAs.
YP_002123766.1	similar to ref|NP_606756.1| preprotein translocase subunit SecG [Streptococcus pyogenes MGAS8232]
YP_002123768.1	similar to emb|CAA68254.1| fibronectin-binding protein [Streptococcus equi]; Possible fibronectin-binding adhesin, has a collagen-structural-motif domain composed of 41 Gly-Xaa-Yaa repeats.
YP_002123769.1	similar to ref|YP_059753.1| dephospho-CoA kinase [Streptococcus pyogenes MGAS10394]; Catalyzes the phosphorylation of the 3'-hydroxyl group of dephosphocoenzyme A to form coenzyme A.
YP_002123770.1	Involved in base excision repair of DNA damaged by oxidation or by mutagenic agents. Acts as DNA glycosylase that recognizes and removes damaged bases
YP_002123771.1	similar to ref|ZP_00875460.1| Beta-galactosidase [Streptococcus suis 89/1591]; Preferentially hydrolyzes beta(1->3) galactosyl linkages over beta(1->4) linkages.
YP_002123772.1	similar to ref|ZP_01968534.1| hypothetical protein RUMTOR_02111 [Ruminococcus torques ATCC 27756]; Catalysis of the hydrolysis of alpha-(2->3)-, alpha-(2->6)-, alpha-(2->8)-glycosidic linkages of terminal sialic residues in oligosaccharides, glycoproteins, glycolipids, colominic acid and synthetic substrates.
YP_002123773.1	similar to ref|ZP_01817544.1| Phosphotransferase system (PTS) cellobiose-specific, IIC component, [Streptococcus pneumoniae SP3-BS71]; Catalysis of the PEP-dependent, phosphoryl transfer-driven transport of substances across a membrane. The transport happens by catalysis of the reaction: protein N-phosphohistidine + sugar(out) = protein histidine + sugar phosphate(in). This differs from primary and secondary active transport in that the solute is modified during transport.
YP_002123774.1	similar to ref|ZP_01825420.1| phosphotransferase system cellobiose-specific component IIC [Streptococcus pneumoniae SP11-BS70]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in cellobiose transport.
YP_002123775.1	similar to ref|ZP_00603570.1| Phosphotransferase system PTS, lactose/cellobiose-specific IIA subunit [Enterococcus faecium DO]; This is a component of the phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system. The IIcd domains contain the sugar binding site and the transmembrane channel; the IIa domain contains the primary phosphorylation site (the donor is phospho-Hpr); IIa transfers its phosphoryl group to the IIb domain which finally transfers it to the sugar.
YP_002123776.1	similar to ref|YP_001034277.1| Phosphotransferase system (PTS) cellobiose-specific component IIB, [Streptococcus sanguinis SK36]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in cellobiose transport.
YP_002123777.1	similar to ref|ZP_02186120.1| hypothetical protein CAT7_00288 [Carnobacterium sp. AT7]; Catalysis of the reaction: L-aspartate-4-semialdehyde + pyruvate = dihydrodipicolinate + 2 H2O.
YP_002123778.1	similar to ref|YP_001034276.1| ROK family protein, [Streptococcus sanguinis SK36]; Transcriptional repressor of xylose-utilizing enzymes
YP_002123779.1	similar to ref|YP_279846.1| phosphohydrolase [Streptococcus pyogenes MGAS6180]
YP_002123780.1	similar to ref|YP_001089191.1|  permease [Clostridium difficile 630]; Permease For An Unknown Substrate.
YP_002123781.1	catalyzes the formation of acetoacetate from 3-hydroxybutyrate
YP_002123782.1	similar to ref|YP_599072.1| Acetate CoA-transferase beta subunit [Streptococcus pyogenes MGAS10270]; Catalysis of the reaction: acyl-CoA + acetate = a fatty acid anion + acetyl-CoA.
YP_002123783.1	similar to ref|YP_602948.1| Acetate CoA-transferase alpha subunit [Streptococcus pyogenes MGAS10750]; Catalysis of the reaction: acyl-CoA + acetate = a fatty acid anion + acetyl-CoA.
YP_002123784.1	similar to ref|YP_597070.1| acetyl-CoA acetyltransferase [Streptococcus pyogenes MGAS9429]; Involved in the production of polyhydroxyalkonic acids (PHAs), composed primarily of 3-hydroxybutyric acid (3HB) and 3- hydroxyvaleric acid (3HV).
YP_002123785.1	similar to ref|NP_269683.1|  transcriptional regulator (LysR family) [Streptococcus pyogenes M1 GAS]; Positive Regulatory Protein
YP_002123786.1	similar to ref|ZP_00788202.1| membrane protein, [Streptococcus agalactiae CJB111]
YP_002123788.1	Era; Escherichia coli Ras-like protein; Bex; Bacillus Era-complementing segment; essential protein in Escherichia coli that is involved in many cellular processes; GTPase; binds the cell membrane through apparent C-terminal domain; mutants are arrested during the cell cycle; Streptococcus pneumoniae Era binds to RNA and Escherichia coli Era binds 16S rRNA and 30S ribosome
YP_002123789.1	similar to ref|NP_606734.1|  diacylglycerol kinase [Streptococcus pyogenes MGAS8232]; Recycling of diacylglycerol produced during the turnover of membrane phospholipids. May play a role in adaptability to environmental stress conditions such as acid tolerance, elevated temperatures and high osmolarity.
YP_002123790.1	similar to gb|AAT86548.1| Hypothetical Metal-Binding Protein [Streptococcus pyogenes MGAS10394]
YP_002123791.1	similar to ref|YP_001035552.1| Acetyltransferase, GNAT family,  [Streptococcus sanguinis SK36]; Catalysis of the transfer of an acetyl group to a nitrogen atom on the acceptor molecule.
YP_002123792.1	similar to ref|YP_059730.1| Uracil DNA glycosylase superfamily protein [Streptococcus pyogenes MGAS10394]
YP_002123793.1	similar to ref|YP_596118.1| PhoH protein [Streptococcus pyogenes MGAS9429]
YP_002123794.1	similar to ref|YP_138969.1| hypothetical protein stu0441 [Streptococcus thermophilus LMG 18311]
YP_002123795.1	this stereospecific enzymes reduces the S isomer of methionine sulfoxide while MsrB reduces the R form; provides protection against oxidative stress
YP_002123796.1	similar to ref|YP_819954.1| Predicted RNA-binding protein containing S1-like domain [Streptococcus thermophilus LMD-9]
YP_002123797.1	Rrf; Frr; ribosome-recycling factor; release factor 4; RF4; recycles ribosomes upon translation termination along with release factor RF-3 and elongation factor EF-G; A GTPase-dependent process results in release of 50S from 70S; inhibited by release factor RF-1; essential for viability; structurally similar to tRNAs
YP_002123798.1	Catalyzes the phosphorylation of UMP to UDP
YP_002123799.1	similar to ref|YP_001034501.1| Peptide ABC transporter, ATP-binding protein,  [Streptococcus sanguinis SK36]; Part of the ABC transporter complex. Responsible for energy coupling to the transport system.
YP_002123800.1	similar to ref|YP_001034500.1| Peptide ABC transporter, ATP-binding protein,  [Streptococcus sanguinis SK36]; Part of the ABC transporter complex . Responsible for energy coupling to the transport system.
YP_002123801.1	similar to ref|YP_001034500.1| Peptide ABC transporter, ATP-binding protein,  [Streptococcus sanguinis SK36]; Membrane permease component of an ABC transporter complex.
YP_002123802.1	similar to ref|ZP_00790162.1| peptide ABC transporter, permease [Streptococcus agalactiae 515]; Membrane permease component of an ABC transporter complex.
YP_002123803.1	similar to ref|ZP_00788028.1| peptide ABC transporter, peptide-binding protein [Streptococcus agalactiae CJB111]; ABC transporter complex substrate-binding lipoprotein.
YP_002123804.1	similar to gb|AAQ91575.1| collagen-like protein 3 [Streptococcus equi]; Possible fibronectin-binding adhesin, has a collagen-structural-motif domain composed of 97 Gly-Xaa-Yaa repeats.
YP_002123805.1	in Escherichia coli and Methanococcus, this protein autoregulates expression; the binding site in the mRNA mimics the binding site in the 23S rRNA
YP_002123806.1	binds directly to 23S ribosomal RNA
YP_002123807.1	similar to ref|YP_138591.1| IS1239 transposase [Streptococcus thermophilus LMG 18311]
YP_002123808.1	similar to ref|YP_598726.1| Transcriptional regulator, LacI family [Streptococcus pyogenes MGAS10270]
YP_002123809.1	similar to ref|YP_281736.1| integral membrane protein [Streptococcus pyogenes MGAS5005]
YP_002123810.1	similar to ref|YP_001129017.1| DNA translocase FtsK [Streptococcus pyogenes str. Manfredo]; DNA motor protein, which is both required to move DNA out of the region of the septum during cell division and for the septum formation. Tracks DNA in an ATP-dependent manner by generating positive supercoils in front of it and negative supercoils behind it.
YP_002123812.1	similar to ref|NP_606719.1|  cyclophilin-type protein [Streptococcus pyogenes MGAS8232]; PPIases accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides.
YP_002123813.1	similar to ref|NP_606718.1| integral membrane protein MtsC [Streptococcus pyogenes MGAS8232]; Part of an ATP-driven transport system for a metal; this complex ly has affinity for Zn(2+), Fe(3+) and Cu(2+).
YP_002123814.1	similar to ref|YP_279827.1| manganese transport system ATP-binding protein [Streptococcus pyogenes MGAS6180]; Part of an ATP-driven transport system for a metal; this complex ly has affinity for Zn(2+), Fe(3+) and Cu(2+).
YP_002123815.1	similar to ref|YP_001129021.1| metal ABC transporter substrate-binding lipoprotein precursor [Streptococcus pyogenes str. Manfredo]; Part of an ATP-driven transport system for a metal; this protein ly has affinity for Zn(2+), Fe(3+) and Cu(2+).
YP_002123816.1	similar to ref|YP_279825.1| iron-dependent repressor [Streptococcus pyogenes MGAS6180]; Iron-binding repressor of siderophore biosynthesis and iron uptake.
YP_002123817.1	enables the cleavage of the glycosidic bond in both 5'-methylthioadenosine and S-adenosylhomocysteine
YP_002123818.1	similar to ref|YP_059706.1| Hypothetical membrane associated protein [Streptococcus pyogenes MGAS10394]
YP_002123819.1	similar to ref|ZP_00365482.1| COG0494: NTP pyrophosphohydrolases including oxidative damage repair enzymes [Streptococcus pyogenes M49 591]; Acts on ADP-mannose and ADP-glucose as well as ADP- ribose. Prevents glycogen biosynthesis. The reaction catalyzed by this enzyme is a limiting step of the gluconeogenic process.
YP_002123820.1	similar to gb|AAQ05206.1|AF468690_1 UDP-N-acetyl-glucosamine pyrophosphorylase [Streptococcus equi subsp. zooepidemicus]; Bifunctional Enzyme Responsible For The Acetylation Of Glc-N-1-P To Give Glcnac-1-P And The Synthesis Of UDP-GlcNAc.
YP_002123822.1	similar to ref|YP_601856.1| NAD-dependent oxidoreductase [Streptococcus pyogenes MGAS10750]
YP_002123823.1	similar to ref|ZP_00783841.1| conserved hypothetical protein [Streptococcus agalactiae H36B]
YP_002123824.1	Catalyzes the first of the two reduction steps in the elongation cycle of fatty acid synthesis
YP_002123825.1	similar to ref|YP_001450753.1| hypothetical protein SGO_1474 [Streptococcus gordonii str. Challis substr. CH1]
YP_002123826.1	similar to ref|YP_597968.1| hypothetical protein MGAS10270_Spy0359 [Streptococcus pyogenes MGAS10270]
YP_002123827.1	similar to ref|ZP_00780519.1| cell surface protein, ErfK family [Streptococcus agalactiae 18RS21]
YP_002123828.1	valine--tRNA ligase; ValRS; converts valine ATP and tRNA(Val) to AMP PPi and valyl-tRNA(Val); class-I aminoacyl-tRNA synthetase type 1 subfamily; has a posttransfer editing process to hydrolyze mischarged Thr-tRNA(Val) which is done by the editing domain
YP_002123829.1	similar to ref|YP_597018.1| hypothetical protein MGAS9429_Spy1287 [Streptococcus pyogenes MGAS9429]
YP_002123830.1	similar to ref|ZP_00788728.1| acetyltransferase, GNAT family [Streptococcus agalactiae CJB111]
YP_002123832.1	similar to ref|YP_280764.1| hypothetical cytosolic protein [Streptococcus pyogenes MGAS6180]
YP_002123833.1	similar to ref|NP_665082.1| hypothetical protein SpyM3_1278 [Streptococcus pyogenes MGAS315]
YP_002123835.1	catalyzes the formation of 3-deoxy-D-arabino-hept-2-ulosonate 7-phosphate from phosphoenolpyruvate and D-erythrose 4-phosphate
YP_002123836.1	catalyzes the formation of 3-dehydroquinate from 3-deoxy-arabino-heptulonate 7-phosphate; functions in aromatic amino acid biosynthesis
YP_002123837.1	similar to ref|YP_139291.1| ISSth1, transposase (orf1), IS3 family [Streptococcus thermophilus LMG 18311]
YP_002123838.1	similar to ref|YP_139290.1| ISSth1, transposase (orf2), IS3 family [Streptococcus thermophilus LMG 18311]
YP_002123839.1	similar to ref|YP_140248.1| ISSth1, transposase (orf2), IS3 family [Streptococcus thermophilus LMG 18311]
YP_002123840.1	similar to ref|YP_329133.1| hypothetical protein SAK_0495 [Streptococcus agalactiae A909]; Catalysis of the reaction: uridine + phosphate = uracil + alpha-D-ribose 1-phosphate.
YP_002123841.1	similar to ref|YP_280809.1| shikimate 5-dehydrogenase [Streptococcus pyogenes MGAS6180]; Aromatic amino acids biosynthesis; shikimate pathway; fourth step.
YP_002123842.1	similar to ref|ZP_00366242.1| COG3250: Beta-galactosidase/beta-glucuronidase [Streptococcus pyogenes M49 591]; Catalysis of the hydrolysis of terminal, non-reducing beta-D-galactose residues in beta-D-galactosides.
YP_002123843.1	similar to ref|YP_602908.1| Two-component response regulator yesN [Streptococcus pyogenes MGAS10750]
YP_002123844.1	similar to ref|YP_602909.1| Two-component sensor kinase yesM [Streptococcus pyogenes MGAS10750]
YP_002123845.1	similar to ref|YP_001128123.1| hypothetical protein SpyM50548 [Streptococcus pyogenes str. Manfredo]
YP_002123847.1	similar to ref|NP_665093.1|  sugar ABC transporter substrate binding protein [Streptococcus pyogenes MGAS315]; Probale ABC transporter substrate-binding lipoprotein.
YP_002123848.1	similar to ref|NP_269653.1|  sugar-binding transport protein [Streptococcus pyogenes M1 GAS]; Probably part of a binding-protein-dependent transport system. Probably responsible for the translocation of the substrate across the membrane.
YP_002123849.1	similar to ref|YP_060646.1| Sugar transport system permease [Streptococcus pyogenes MGAS10394]; Probably part of a binding-protein-dependent transport system. Probably responsible for the translocation of the substrate across the membrane.
YP_002123850.1	similar to ref|YP_282674.1| glucokinase [Streptococcus pyogenes MGAS5005]; Catalysis of the reaction: ATP + N-acyl-D-mannosamine = ADP + N-acyl-D-mannosamine 6-phosphate.
YP_002123851.1	similar to ref|ZP_00602650.1| Alpha-1,2-mannosidase,  [Enterococcus faecium DO]
YP_002123852.1	similar to ref|YP_280819.1| beta-glucosidase [Streptococcus pyogenes MGAS6180]; Can hydrolyze salicin, cellobiose, and probably arbutin.
YP_002123853.1	similar to ref|NP_665098.1|  hyaluronidase [Streptococcus pyogenes MGAS315]; virulence factor which is likely to act on connective tissue during invasive infections, lacks a classical SrtA secretion signal sequence.
YP_002123854.1	similar to ref|YP_001128116.1| GntR family regulatory protein [Streptococcus pyogenes str. Manfredo]; Transcriptional repressor like that of the arabinose utilization genes.
YP_002123855.1	similar to ref|YP_060652.1| hypothetical protein M6_Spy1334 [Streptococcus pyogenes MGAS10394]
YP_002123856.1	similar to ref|ZP_00365680.1| COG0383: Alpha-mannosidase [Streptococcus pyogenes M49 591]; Hydrolysis of terminal, non-reducing ?-D-mannose residues in ?-D-mannosides.
YP_002123857.1	similar to ref|YP_001036161.1| ABC-type antimicrobial peptide transporter, ATPase component, [Streptococcus sanguinis SK36]; Part of the ABC transporter complex which could be involved in peptide resistance. Responsible for energy coupling to the transport system ().
YP_002123858.1	similar to ref|YP_001036162.1| ABC-type antimicrobial peptide transporter, permease component, [Streptococcus sanguinis SK36]
YP_002123860.1	similar to ref|YP_535527.1| Phosphinothricin N-acetyltransferase [Lactobacillus salivarius UCC118]; This enzyme is an effector of phosphinothricin tripeptide (PTT or bialaphos) resistance. Inactivates PTT by transfer of an acetyl group.
YP_002123861.1	similar to ref|NP_722218.1|  immunity protein, BLpL-like [Streptococcus mutans UA159]
YP_002123862.1	similar to ref|ZP_01821308.1| BlpN protein [Streptococcus pneumoniae SP6-BS73]
YP_002123863.1	similar to ref|ZP_01821307.1| bacteriocin BlpM [Streptococcus pneumoniae SP6-BS73]
YP_002123864.1	similar to gb|ABQ23940.1| ubericin A immunity protein [Streptococcus uberis]
YP_002123865.1	similar to ref|NP_688076.1| IS861, transposase OrfA [Streptococcus agalactiae 2603V/R]
YP_002123866.1	similar to ref|NP_720882.1|  transposase, ISSmu1 [Streptococcus mutans UA159]
YP_002123867.1	similar to dbj|BAF37251.1| hypothetical protein [Streptococcus bovis]
YP_002123868.1	similar to gb|AAG29818.1|AF298196_1 bovicin 255 peptide precursor [Streptococcus sp. LRC 0255]
YP_002123869.1	similar to ref|YP_601902.1| Bacteriocin processing peptidase / Bacteriocin export ABC transporter [Streptococcus pyogenes MGAS10750]; Possibly involved in transport of competence-stimulating peptide (CSP).
YP_002123870.1	similar to ref|ZP_01821305.1| BlpC ABC transporter [Streptococcus pneumoniae SP6-BS73]
YP_002123871.1	similar to emb|CAC10163.1| bacteriocin-like peptide, double glycin clevage motif [Streptococcus pneumoniae]
YP_002123872.1	similar to ref|ZP_00788187.1| sensor histidine kinase BlpH,  [Streptococcus agalactiae CJB111]
YP_002123873.1	similar to ref|NP_688944.1| response regulator [Streptococcus agalactiae 2603V/R]
YP_002123874.1	similar to ref|YP_138591.1| IS1239 transposase [Streptococcus thermophilus LMG 18311]
YP_002123875.1	similar to gb|AAB91456.1| enhancer peptide for thermophilin 13 precursor; ThmB [Streptococcus thermophilus]
YP_002123876.1	similar to gb|AAB91455.1| amphipathic pore-forming peptide precursor; ThmA [Streptococcus thermophilus]
YP_002123877.1	similar to ref|YP_599044.1| tRNA (Uracil-5-) -methyltransferase [Streptococcus pyogenes MGAS10270]; Could Be A 23s rRNA (Uracil-5-)-Methyltransferase.
YP_002123878.1	similar to ref|ZP_00144239.1| hypothetical protein [Fusobacterium nucleatum subsp. vincentii ATCC 49256]
YP_002123879.1	similar to ref|YP_602677.1| Transposase [Streptococcus pyogenes MGAS10750]
YP_002123880.1	similar to ref|NP_268574.1|  transposase, IS861 [Streptococcus pyogenes M1 GAS]
YP_002123881.1	similar to ref|ZP_01963858.1| hypothetical protein RUMOBE_01582 [Ruminococcus obeum ATCC 29174]
YP_002123882.1	similar to ref|ZP_00372061.1| adenine/cytosine DNA methyltransferase [Campylobacter upsaliensis RM3195]
YP_002123883.1	similar to ref|ZP_02436627.1| hypothetical protein BACSTE_02895 [Bacteroides stercoris ATCC 43183]
YP_002123884.1	similar to emb|CAI94870.1| Hin4II restriction endonuclease [Haemophilus influenzae]
YP_002123885.1	similar to ref|YP_001035816.1| hypothetical protein SSA_1888 [Streptococcus sanguinis SK36]
YP_002123886.1	similar to ref|ZP_02063370.1| hypothetical protein BACOVA_00315 [Bacteroides ovatus ATCC 8483]
YP_002123887.1	binds RecA and inhibits RecA-mediated DNA strand exchange and ATP hydrolysis and coprotease activities
YP_002123888.1	similar to ref|ZP_00365988.1| COG3557: Uncharacterized domain/protein associated with RNAses G and E [Streptococcus pyogenes M49 591]
YP_002123889.1	similar to ref|NP_722103.1| hypothetical protein SMU.1782 [Streptococcus mutans UA159]
YP_002123890.1	similar to ref|ZP_00875692.1| Transposase, IS204/IS1001/IS1096/IS1165 [Streptococcus suis 89/1591]
YP_002123891.1	similar to ref|NP_665162.1|  ribosomal subunit interface protein [Streptococcus pyogenes MGAS315]; Probably Modulates The Activity Of Sigma(54) (RpoN).
YP_002123892.1	similar to ref|YP_060690.1| ComF operon protein 3 [Streptococcus pyogenes MGAS10394]; Involved in transformation (competence for DNA uptake).
YP_002123893.1	similar to ref|YP_599052.1| COMF operon protein 1 [Streptococcus pyogenes MGAS10270]; Involved in transformation (competence for DNA uptake). Required for DNA uptake but not for binding. May provide the driving force for transport of DNA through an aqueous channel.
YP_002123894.1	similar to ref|NP_665166.1| hypothetical protein SpyM3_1362 [Streptococcus pyogenes MGAS315]
YP_002123895.1	similar to ref|ZP_00875431.1| Cysteine synthase K/M:Cysteine synthase A [Streptococcus suis 89/1591]; Cysteine biosynthesis, Catalysis of the reaction: O3-acetyl-L-serine + H2S = L-cysteine + acetate.
YP_002123897.1	similar to gb|AAN58235.1|AE014894_12 polyribonucleotide nucleotidyltransferase (general stress protein 13) [Streptococcus mutans UA159]; Binds mRNA; thus facilitating recognition of the initiation point. It is needed to translate mRNA with a short Shine-Dalgarno purine-rich sequence.
YP_002123898.1	similar to ref|YP_060695.1| Peptidyl-prolyl cis-trans isomerase [Streptococcus pyogenes MGAS10394]; PPIases accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides.
YP_002123899.1	similar to ref|YP_060696.1| Two-component response regulator yvqC [Streptococcus pyogenes MGAS10394]
YP_002123900.1	similar to ref|NP_607684.1|  two-component sensor histidine kinase [Streptococcus pyogenes MGAS8232]
YP_002123901.1	similar to ref|YP_001128043.1| hypothetical protein SpyM50457 [Streptococcus pyogenes str. Manfredo]
YP_002123902.1	similar to ref|YP_599060.1| Serine/threonine protein kinase [Streptococcus pyogenes MGAS10270]; Regulation of stationary phase.
YP_002123903.1	similar to ref|NP_269676.1|  phosphoprotein phosphatase [Streptococcus pyogenes M1 GAS]; Regulation of stationary phase.
YP_002123904.1	similar to ref|YP_060701.1| 16S rRNA m(5)C 967 methyltransferase [Streptococcus pyogenes MGAS10394]
YP_002123905.1	modifies the free amino group of the aminoacyl moiety of methionyl-tRNA(fMet) which is important in translation initiation; inactivation of this gene in Escherichia coli severely impairs growth
YP_002123906.1	binding of PriA to forked DNA starts the assembly of the primosome, also possesses 3'-5' helicase activity
YP_002123907.1	Promotes RNA polymerase assembly. Latches the N- and C-terminal regions of the beta' subunit thereby facilitating its interaction with the beta and alpha subunits
YP_002123908.1	Essential for recycling GMP and indirectly, cGMP
YP_002123910.1	similar to ref|NP_269682.1| hypothetical protein SPy_1633 [Streptococcus pyogenes M1 GAS]
YP_002123911.1	catalyzes the hydrolysis of S-ribosylhomocysteine to homocysteine and autoinducer-2
YP_002123912.1	similar to ref|NP_665189.1| hypothetical protein SpyM3_1385 [Streptococcus pyogenes MGAS315]
YP_002123913.1	similar to ref|YP_001128027.1|  RNA methylase family protein [Streptococcus pyogenes str. Manfredo]
YP_002123914.1	similar to ref|YP_280858.1| cell division initiation protein DivIVA [Streptococcus pyogenes MGAS6180]
YP_002123915.1	similar to ref|YP_599079.1| hypothetical cytosolic protein [Streptococcus pyogenes MGAS10270]
YP_002123916.1	RecU; functions in homologous recombination, DNA repair, and chromosome segregation; binds preferentially to three- and four-stranded DNA intermediates; introduces specific nick sites in four-stranded DNA substrates; functions similarly to Escherichia coli RuvC
YP_002123917.1	similar to ref|YP_280861.1| multimodular transpeptidase-transglycosylase [Streptococcus pyogenes MGAS6180]; Peptidoglycan synthesis, nascent glycan strand synthesis and cross-linking.
YP_002123918.1	similar to ref|YP_280862.1| aminopeptidase C [Streptococcus pyogenes MGAS6180]; Catalysis of the inactivation of bleomycin B2 (a cytotoxic glycometallopeptide) by hydrolysis of a peptide bond of beta-aminoalanine, but also shows general aminopeptidase activity. The specificity varies somewhat with source, but amino acid arylamides of Met, Leu and Ala are preferred.
YP_002123919.1	catalyzes the formation of nicotinamide adenine dinucleotide (NAD) from nicotinic acid adenine dinucleotide (NAAD) using either ammonia or glutamine as the amide donor and ATP; ammonia-utilizing enzymes include the ones from Bacillus and Escherichia coli while glutamine-utilizing enzymes include the Mycobacterial one; forms homodimers
YP_002123920.1	catalyzes the formation of 5-phospho-alpha-D-ribose 1-diphosphate and nicotinate from nicotinate D-ribonucleotide and diphosphate
YP_002123922.1	similar to ref|YP_060723.1| Amino acid permease [Streptococcus pyogenes MGAS10394]; amino-acid or metabolite transport protein.
YP_002123923.1	similar to ref|YP_599086.1| Thioredoxin reductase [Streptococcus pyogenes MGAS10270]; Catalysis of the reaction: thioredoxin + NADP+ = thioredoxin disulfide + NADPH + H+.
YP_002123924.1	similar to ref|NP_269700.1| hypothetical protein SPy_1656 [Streptococcus pyogenes M1 GAS]
YP_002123925.1	similar to ref|YP_597089.1| amino acid transport ATP-binding protein [Streptococcus pyogenes MGAS9429]; Probably part of a binding-protein-dependent transport system for an amino acid. Probably responsible for energy coupling to the transport system.
YP_002123926.1	similar to ref|YP_001128015.1| ABC transporter permease [Streptococcus pyogenes str. Manfredo]; Probably part of a binding-protein-dependent transport system for an amino acid. Probably responsible for the translocation of the substrate across the membrane.
YP_002123928.1	similar to ref|NP_720902.1|  ABC transporter, amino acid binding protein [Streptococcus mutans UA159]; Probably part of the substrate-binding-protein-dependent transport system for an amino acid.
YP_002123930.1	similar to ref|YP_060728.1| ATP-dependent RNA helicase [Streptococcus pyogenes MGAS10394]; Has A Helix-Destabilizing Activity. Plays A Key Role In Optimal Cell Growth At Low Temperature And Is Required For Normal Cell Division. Suppressor Of A Mutant Defective In Rpsb Gene For Ribosomal Protein S2.
YP_002123931.1	First step of the lipid cycle reactions in the biosynthesis of the cell wall peptidoglycan
YP_002123932.1	similar to ref|YP_060731.1| Division specific D,D-transpeptidase [Streptococcus pyogenes MGAS10394]; Peptidoglycan synthesis, Catalysis of the reaction: [GlcNAc-(1, 4)-Mur2Ac(oyl-L-Ala-gamma-D-Glu-L-Lys-D-Ala-D-Ala)](n)- diphosphoundecaprenol + GlcNAc-(1, 4)-Mur2Ac(oyl-L-Ala-gamma-D-Glu-L-Lys-D-Ala-D-Ala)- diphosphoundecaprenol = [GlcNAc-(1, 4)-Mur2Ac(oyl-L-Ala-gamma-D-Glu-L-Lys-D-Ala-D-Ala)](n+1)- diphosphoundecaprenol + UDP diphosphate.
YP_002123933.1	similar to ref|ZP_00365943.1| COG4839: Protein required for the initiation of cell division [Streptococcus pyogenes M49 591]; Involved in initiation of cell division.
YP_002123934.1	similar to sp|Q5XAL3|MRAW_STRP6 S-adenosyl-L-methionine-dependent methyltransferase mraW
YP_002123935.1	similar to ref|NP_607720.1| hypothetical protein spyM18_1678 [Streptococcus pyogenes MGAS8232]
YP_002123936.1	Catalyzes the phosphorylation of L-glutamate during the proline biosynthesis pathway
YP_002123937.1	catalyzes the formation of glutamate 5-phosphate from glutamate in proline biosynthesis
YP_002123938.1	similar to ref|YP_001198821.1| hypothetical protein SSU05_1455 [Streptococcus suis 05ZYH33]
YP_002123940.1	similar to ref|YP_282735.1| ABC transporter permease [Streptococcus pyogenes MGAS5005]
YP_002123941.1	similar to ref|NP_269711.1|  ABC transporter (ATP-binding protein) [Streptococcus pyogenes M1 GAS]; Facilitated transport
YP_002123942.1	similar to ref|YP_602977.1| ABC transporter ATP-binding protein [Streptococcus pyogenes MGAS10750]; Facilitated transport
YP_002123943.1	similar to ref|YP_282737.1| hypothetical protein M5005_Spy_1374 [Streptococcus pyogenes MGAS5005]
YP_002123944.1	catalyzes the formation of ribose 5-phosphate and xylulose 5-phosphate from sedoheptulose 7-phosphate and glyceraldehyde 3-phosphate; can transfer ketol groups between several groups; in Escherichia coli there are two tkt genes, tktA expressed during exponential growth and the tktB during stationary phase
YP_002123946.1	similar to novel fructose-6-phosphate aldolase from Escherichia coli; enzyme from Methanocaldococcus janaschii shows transaldolase activity
YP_002123947.1	Converts glycerol and ADP to glycerol-3-phosphate and ADP
YP_002123949.1	similar to ref|YP_001127997.1|  lipoprotein [Streptococcus pyogenes str. Manfredo]
YP_002123950.1	similar to gb|AAM90904.2|AF493605_7 BlpM-like protein [Streptococcus pyogenes]
YP_002123951.1	similar to ref|YP_281699.1| corrin/porphyrin methyltransferase [Streptococcus pyogenes MGAS5005]
YP_002123952.1	in Bacillus subtilis this protein is involved in the negative regulation of DNA replication initiation; interacts with DnaN and DnaA
YP_002123953.1	similar to ref|NP_721994.1|  signal peptidase II [Streptococcus mutans UA159]; Essential for the phosphorelay during initiation of sporulation. May control the level of phosphorylated spo0A through spo0E activity during sporulation.
YP_002123954.1	catalyzes the DNA-template-directed extension of the 3'-end of a DNA strand; the delta' subunit seems to interact with the gamma subunit to transfer the beta subunit on the DNA.
YP_002123955.1	catalyzes the reversible phosphoryl transfer from adenosine triphosphate (ATP) to thymidine monophosphate (dTMP) to form thymidine diphosphate (dTDP)
YP_002123956.1	similar to ref|YP_596061.1| hypothetical protein MGAS9429_Spy0329 [Streptococcus pyogenes MGAS9429]
YP_002123957.1	similar to ref|NP_722004.1| hypothetical protein SMU.1671c [Streptococcus mutans UA159]
YP_002123958.1	hydrolyzes proteins to small peptides; with the ATPase subunits ClpA or ClpX, ClpP degrades specific substrates
YP_002123959.1	Catalyzes the formation of uracil and 5-phospho-alpha-D-ribosy 1-diphosphate from UMP and diphosphate
YP_002123960.1	similar to ref|YP_059670.1| Export protein for polysaccharides and teichoic acids [Streptococcus pyogenes MGAS10394]
YP_002123961.1	involved in cell wall formation; peptidoglycan synthesis; cytoplasmic enzyme; catalyzes the addition of lysine to UDP-N-acetylmuramoyl-L-alanyl-D-glutamate forming UDP-N-acetylmuramoyl-L-alanyl-D-glutamyl-L-lysine
YP_002123962.1	similar to ref|ZP_00365817.1| COG1120: ABC-type cobalamin/Fe3+-siderophores transport systems, ATPase components [Streptococcus pyogenes M49 591]; Part of the binding-protein-dependent transport system for Fe(3+)-ferrichrome. Probably responsible for energy coupling to the transport system.
YP_002123963.1	similar to ref|NP_268705.1| ferrichrome ABC transporter (ferrichrome-binding protein) [Streptococcus pyogenes M1 GAS]; This is one of the proteins involved in the high-affinity transport of Fe(3+)-ferrichrome into the cell.
YP_002123964.1	similar to ref|YP_001129059.1| ferrichrome transport permease [Streptococcus pyogenes str. Manfredo]; This is one of the proteins involved in the high- affinity transport of Fe(3+)-ferrichrome into the cell.
YP_002123965.1	similar to ref|NP_802841.1|  ferrichrome ABC transporter (permease) [Streptococcus pyogenes SSI-1]; This is one of the proteins involved in the high- affinity transport of Fe(3+)-ferrichrome into the cell.
YP_002123967.1	similar to ref|YP_601808.1| hypothetical cytosolic protein [Streptococcus pyogenes MGAS10750]
YP_002123968.1	catalyzes the hydrolysis of pyrophosphate to phosphate
YP_002123969.1	similar to ref|NP_606672.1|  pyruvate-formatelyase activating enzyme [Streptococcus pyogenes MGAS8232]; Activation of pyruvate formate-lyase under anaerobic conditions by generation of an organic free radical, using S- adenosylmethionine and reduced flavodoxin as cosubstrates to produce 5'-deoxy-adenosine.
YP_002123970.1	similar to ref|YP_279775.1|  hemolysin [Streptococcus pyogenes MGAS6180]
YP_002123971.1	similar to ref|YP_279774.1| SAM-dependent methyltransferase [Streptococcus pyogenes MGAS6180]
YP_002123972.1	similar to ref|YP_194206.1| kanamycin kinase [Lactobacillus acidophilus NCFM]
YP_002123973.1	similar to ref|YP_596046.1| radical SAM superfamily protein [Streptococcus pyogenes MGAS9429]
YP_002123974.1	similar to ref|YP_596045.1| membrane-associated phospholipid phosphatase [Streptococcus pyogenes MGAS9429]
YP_002123975.1	similar to ref|YP_279771.1| riboflavin transporter [Streptococcus pyogenes MGAS6180]
YP_002123976.1	similar to ref|ZP_00785752.1| Unknown [Streptococcus agalactiae COH1]
YP_002123977.1	similar to ref|NP_736400.1| hypothetical protein gbs1967 [Streptococcus agalactiae NEM316]
YP_002123978.1	similar to ref|YP_849451.1| hypothetical protein lwe1254 [Listeria welshimeri serovar 6b str. SLCC5334]
YP_002123979.1	similar to ref|ZP_00874487.1| similar to unknown proteins [Streptococcus suis 89/1591]
YP_002123980.1	similar to ref|NP_736401.1| hypothetical protein gbs1968 [Streptococcus agalactiae NEM316]
YP_002123981.1	similar to ref|NP_736401.1| hypothetical protein gbs1968 [Streptococcus agalactiae NEM316]
YP_002123982.1	similar to ref|YP_059656.1| 23S rRNA methyltransferase [Streptococcus pyogenes MGAS10394]
YP_002123983.1	similar to ref|NP_606663.1| hypothetical protein spyM18_0419 [Streptococcus pyogenes MGAS8232]
YP_002123984.1	similar to ref|YP_279768.1| ribosomal large subunit pseudouridine synthase B [Streptococcus pyogenes MGAS6180]; Responsible for synthesis of pseudouridine from uracil- 2633 in 23S ribosomal RNA.
YP_002123985.1	functions during chromosome segregation; may form a condensin-like structure with SMC and ScpA; forms a homodimer
YP_002123986.1	functions during chromosome segregation; may form a condensin-like structure with SMC and ScpB
YP_002123987.1	site-specific tyrosine recombinase which cuts and rejoins DNA molecules; binds cooperatively to specific DNA consensus sites; forms a heterotetrameric complex with XerC; XerCD exhibit similar sequences; essential to convert chromosome dimers to monomers during cell division and functions during plasmid segregation; cell division protein FtsK may regulate the XerCD complex; enzyme from Streptococcus group has unusual active site motifs
YP_002123988.1	similar to ref|YP_279764.1| CBS domain containing protein [Streptococcus pyogenes MGAS6180]
YP_002123989.1	similar to ref|ZP_00366310.1| COG0622: Predicted phosphoesterase [Streptococcus pyogenes M49 591]
YP_002123990.1	HAM1-like protein; Rec-dependent growth; RgdB; yggV; it is suspected that this protein functions to remove misincorporated bases such as xanthine or hypoxanthine
YP_002123991.1	converts L-glutamate to D-glutamate, a component of peptidoglycan
YP_002123992.1	similar to ref|NP_268684.1| hypothetical protein SPy_0359 [Streptococcus pyogenes M1 GAS]
YP_002123993.1	similar to ref|ZP_00366306.1| COG0670: Integral membrane protein, interacts with FtsH [Streptococcus pyogenes M49 591]
YP_002123994.1	similar to ref|YP_597903.1| Hydrolase [Streptococcus pyogenes MGAS10270]
YP_002123995.1	similar to ref|NP_664062.1|  spoU rRNA Methylase family protein [Streptococcus pyogenes MGAS315]
YP_002123996.1	similar to ref|ZP_01371554.1| transposase, IS4 [Desulfitobacterium hafniense DCB-2]
YP_002123997.1	catalyzes the hydrolysis of acylphosphate
YP_002123998.1	involved in biogenesis of membrane proteins; Firmicutes specific proteins are shorter than other bacterial counterparts and have a signal peptide and lipid attachment site
YP_002123999.1	necessary for efficient RNA polymerase transcription elongation past template-encoded arresting sites; arresting sites in DNA have the property of trapping a certain fraction of elongating RNA polymerases that pass through, resulting in locked ternary complexes. Cleavage of the nascent transcript by cleavage factors such as GreA or GreB allows the resumption of elongation from the new 3'terminus
YP_002124000.1	similar to ref|ZP_00366469.1| COG1559: Predicted periplasmic solute-binding protein [Streptococcus pyogenes M49 591]
YP_002124001.1	similar to ref|ZP_00366468.1| COG0454: Histone acetyltransferase HPA2 and related acetyltransferases [Streptococcus pyogenes M49 591]
YP_002124002.1	Catalyzes the formation of UDP-N-acetylmuramoyl-L-alanine from UDP-N-acetylmuramate and L-alanine in peptidoglycan synthesis
YP_002124003.1	similar to ref|NP_268674.1| hypothetical protein SPy_0343 [Streptococcus pyogenes M1 GAS]
YP_002124004.1	similar to ref|YP_059634.1| SWF/SNF family helicase [Streptococcus pyogenes MGAS10394]
YP_002124005.1	EngA; essential Neisserial GTPase; synchronizes cellular events by interacting with multiple targets with tandem G-domains; overexpression in Escherichia coli suppresses rrmJ mutation; structural analysis of the Thermotoga maritima ortholog shows different nucleotide binding affinities in the two binding domains
YP_002124006.1	Primosomal protein that may act to load helicase DnaC during DNA replication
YP_002124007.1	similar to ref|YP_059631.1| Replicative DNA helicase [Streptococcus pyogenes MGAS10394]
YP_002124008.1	similar to sp|Q5XDR6|NRDR_STRP6 Transcriptional repressor nrdR
YP_002124009.1	similar to ref|NP_802876.1|  two-component sensor histidine kinase (CsrS/CovS) [Streptococcus pyogenes SSI-1]; Member of the two-component regulatory system CovR/CovS involved in the regulation of multiple virulence factors.
YP_002124010.1	similar to ref|NP_802877.1|  two-component response regulator (CsrR/CovR) [Streptococcus pyogenes SSI-1]; Member of the two-component regulatory system CovR/CovS involved in the regulation of multiple virulence factors.
YP_002124011.1	similar to ref|YP_001129097.1| hypothetical protein SpyM51574 [Streptococcus pyogenes str. Manfredo]
YP_002124012.1	metalloprotease
YP_002124013.1	similar to ref|YP_001129099.1| LemA family protein [Streptococcus pyogenes str. Manfredo]
YP_002124014.1	glucose-inhibited division protein B; SAM-dependent methyltransferase; methylates the N7 position of guanosine in position 527 of 16S rRNA
YP_002124015.1	similar to ref|YP_601766.1| Potassium uptake protein ktrB [Streptococcus pyogenes MGAS10750]
YP_002124016.1	similar to ref|YP_601765.1| Potassium uptake protein ktrA [Streptococcus pyogenes MGAS10750]
YP_002124017.1	involved in the import of serine and threonine coupled with the import of sodium
YP_002124018.1	similar to ref|NP_664039.1|  ABC transporter (permease) [Streptococcus pyogenes MGAS315]; Part of the binding-protein-dependent transport system for D-methionine. Probably responsible for the translocation of the substrate across the membrane.
YP_002124019.1	similar to ref|YP_596003.1| ABC transporter ATP-binding protein [Streptococcus pyogenes MGAS9429]; Part of the binding-protein-dependent transport system metNIQ for D-methionine and the toxic methionine analog alpha- methyl-methionine. Probably responsible for energy coupling to the transport system.
YP_002124020.1	similar to gb|AAN59550.1|AE015018_4  peptidase, AtmC; ArgE/DapE/Acy1 family protein [Streptococcus mutans UA159]; Catalysis of the reaction: N-acyl-L-amino acid + H2O = carboxylate + L-amino acid.
YP_002124021.1	similar to ref|YP_279732.1| ABC transporter substrate-binding protein [Streptococcus pyogenes MGAS6180]; This protein is a component of a D-methionine permease, a binding protein-dependent, ATP-driven transport system.
YP_002124022.1	similar to ref|YP_059616.1| ABC transporter substrate-binding protein [Streptococcus pyogenes MGAS10394]; Probably part of a binding-protein-dependent transport system for an amino acid.
YP_002124023.1	similar to ref|YP_059615.1| hypothetical protein M6_Spy0297 [Streptococcus pyogenes MGAS10394]
YP_002124024.1	similar to ref|ZP_00790359.1| MerR family transcriptional regulator [Streptococcus agalactiae 515]; Transcriptional activator.
YP_002124025.1	similar to ref|YP_595998.1| hypothetical cytosolic protein [Streptococcus pyogenes MGAS9429]
YP_002124026.1	similar to ref|YP_281630.1| methyltransferase [Streptococcus pyogenes MGAS5005]
YP_002124027.1	similar to ref|YP_601754.1| iojap protein family [Streptococcus pyogenes MGAS10750]
YP_002124028.1	similar to ref|ZP_00366134.1| COG1713: Predicted HD superfamily hydrolase involved in NAD metabolism [Streptococcus pyogenes M49 591]
YP_002124029.1	transfers an adenyl group from ATP to NaMN to form nicotinic acid adenine dinucleotide (NaAD) which is then converted to the ubiquitous compound NAD by NAD synthetase; essential enzyme in bacteria
YP_002124030.1	similar to ref|YP_059608.1| Hypothetical RNA binding protein [Streptococcus pyogenes MGAS10394]
YP_002124031.1	in Bacillus subtilis this enzyme appears to be involved in 30S ribosomal RNA subunit biogenesis
YP_002124032.1	similar to ref|ZP_00365601.1| COG2179: Predicted hydrolase of the HAD superfamily [Streptococcus pyogenes M49 591]
YP_002124033.1	similar to ref|NP_664024.1|  transcriptional regulator ComX1 [Streptococcus pyogenes MGAS315]; Involved in establishing competence.
YP_002124035.1	similar to ref|YP_597862.1| Oligopeptide transport ATP-binding protein oppF [Streptococcus pyogenes MGAS10270]; Part of the binding-protein-dependent transport system for oligopeptides. Probably responsible for energy coupling to the transport system.
YP_002124036.1	similar to ref|YP_601743.1| Oligopeptide transport ATP-binding protein oppD [Streptococcus pyogenes MGAS10750]; Part of the binding-protein-dependent transport system for oligopeptides. Probably responsible for energy coupling to the transport system.
YP_002124037.1	similar to ref|YP_599868.1| Oligopeptide transport system permease oppC [Streptococcus pyogenes MGAS2096]; Part of the binding-protein-dependent transport system for oligopeptides; probably responsible for the translocation of the substrate across the membrane.
YP_002124038.1	similar to ref|YP_001035872.1| Oligopeptide transport system permease,  [Streptococcus sanguinis SK36]; Part of the binding-protein-dependent transport system for oligopeptides; probably responsible for the translocation of the substrate across the membrane.
YP_002124039.1	similar to ref|YP_001127821.1|  extracellular oligopeptide-binding protein [Streptococcus pyogenes str. Manfredo]; Part of the binding-protein-dependent transport system for oligopeptides; probably an oligopeptide binding protein.
YP_002124040.1	similar to ref|YP_001127820.1|  D-alanyl-D-alanine carboxypeptidase [Streptococcus pyogenes str. Manfredo]; Removes C-terminal D-alanyl residues from sugar-peptide cell wall peptidoglycan precursors.
YP_002124041.1	similar to ref|NP_687183.1| D-alanyl-D-alanine carboxypeptidase family protein [Streptococcus agalactiae 2603V/R]; Removes C-terminal D-alanyl residues from sugar-peptide cell wall precursors.
YP_002124042.1	similar to ref|YP_597856.1| D-alanyl-D-alanine carboxypeptidase [Streptococcus pyogenes MGAS10270]; Removes C-terminal D-alanyl residues from sugar-peptide cell wall precursors.
YP_002124043.1	similar to ref|ZP_00365646.1| COG0719: ABC-type transport system involved in Fe-S cluster assembly, permease component [Streptococcus pyogenes M49
YP_002124044.1	similar to ref|YP_281609.1| iscU protein [Streptococcus pyogenes MGAS5005]; May be involved in the formation or repair of [Fe-S] clusters present in iron-sulfur proteins (potential).
YP_002124045.1	similar to ref|YP_059593.1| Cysteine desulfhydrase [Streptococcus pyogenes MGAS10394]; Catalyzes the removal of elemental sulfur and selenium atoms from L-cysteine, L-cystine, L-selenocysteine, and L- selenocystine to produce L-alanine.
YP_002124046.1	similar to ref|ZP_00366219.1| COG0719: ABC-type transport system involved in Fe-S cluster assembly, permease component [Streptococcus pyogenes M49 591]
YP_002124047.1	similar to ref|YP_279706.1| ABC transporter ATP-binding protein [Streptococcus pyogenes MGAS6180]
YP_002124048.1	similar to ref|YP_601731.1| UDP-phosphate alpha-N-acetylglucosaminephosphotransferase [Streptococcus pyogenes MGAS10750]; Catalyzes the formation of UDP-PP-N- acetylglucosamine. Involved in the synthesis of anionic cell-wall polymers as it mediates the initiation of the linkage unit formation that appears to be common to the two types of teichoic acids attached to the peptidoglycan of B.subtilis; may also be involved in teichuronic acid biosynthesis ().
YP_002124049.1	enables recognition and targeting of proteins for proteolysis, involved in negative regulation of competence
YP_002124050.1	BacA; phosphatase activity in Escherichia coli not kinase; involved in bacitracin resistance as bacitracin supposedly sequesters UDP disphosphate which reduces the pool of lipid carrier available to the cell
YP_002124052.1	similar to ref|NP_606545.1|  glutamine-binding periplasmic protein [Streptococcus pyogenes MGAS8232]; Component of high-affinity glutamine permease, a binding-protein-dependent transport system.
YP_002124053.1	similar to ref|YP_059585.1| Amino acid transport ATP-binding protein [Streptococcus pyogenes MGAS10394]; Probably part of a binding-protein-dependent transport system for an amino acid. Probably responsible for energy coupling to the transport system.
YP_002124054.1	similar to ref|YP_603153.1| Membrane protease family [Streptococcus pyogenes MGAS10750]
YP_002124056.1	similar to ref|YP_599282.1| Dihydroxyacetone kinase family protein [Streptococcus pyogenes MGAS10270]
YP_002124057.1	similar to ref|YP_599283.1| General stress protein, Gls24 family [Streptococcus pyogenes MGAS10270]
YP_002124058.1	required for 70S ribosome assembly
YP_002124059.1	catalyzes the formation of glycerone phosphate and glyceraldehyde 3-phosphate from fructose 1,6, bisphosphate
YP_002124060.1	similar to ref|YP_060935.1| Alpha/beta hydrolase [Streptococcus pyogenes MGAS10394]
YP_002124062.1	CTP synthase; cytidine triphosphate synthetase; catalyzes the ATP-dependent amination of UTP to CTP with either L-glutamine or ammonia as the source of nitrogen; in Escherichia coli this enzyme forms a homotetramer
YP_002124063.1	Tig; RopA; peptidyl-prolyl cis/trans isomerase; promotes folding of newly synthesized proteins; binds ribosomal 50S subunit; forms a homodimer
YP_002124064.1	similar to dbj|BAA24177.1| alpha-amylase precursor [Streptococcus bovis]; Endohydrolysis of 1,4-?-D-glucosidic linkages in polysaccharides containing three or more 1,4-?-linked D-glucose units.
YP_002124065.1	similar to ref|YP_001127832.1| mechanosensitive ion channel protein [Streptococcus pyogenes str. Manfredo]
YP_002124066.1	similar to ref|NP_687139.1| conserved hypothetical protein TIGR01440 [Streptococcus agalactiae 2603V/R]
YP_002124067.1	similar to ref|NP_720565.1| hypothetical protein SMU.86 [Streptococcus mutans UA159]
YP_002124068.1	catalyzes the formation of 4-amino-2-methyl-5-diphosphomethylpyrimidine
YP_002124069.1	mediates pseudouridylation (positions 38, 39, 40) at the tRNA anticodon region which contributes to the structural stability
YP_002124071.1	catalyzes the formation of 4-phospho-L-aspartate from L-aspartate and ATP; lysine and threonine sensitive
YP_002124073.1	similar to ref|NP_801488.1|  competence protein (ComX1) [Streptococcus pyogenes SSI-1]
YP_002124075.1	similar to ref|YP_329930.1| streptococcal histidine triad family protein [Streptococcus agalactiae A909]
YP_002124076.1	similar to ref|NP_608045.1|  laminin adhesion [Streptococcus pyogenes MGAS8232]; Part of the ATP-driven transport system adcABC for zinc. Required for transformability.
YP_002124077.1	similar to ref|NP_687786.1| cell wall surface anchor family protein [Streptococcus agalactiae 2603V/R]
YP_002124078.1	similar to ref|YP_596508.1| transposase [Streptococcus pyogenes MGAS9429]
YP_002124079.1	similar to ref|NP_816282.1| diacylglycerol kinase catalytic domain protein [Enterococcus faecalis V583]; Catalysis of the reaction: ATP + 1,2-diacylglycerol = ADP + 1,2-diacylglycerol 3-phosphate.
YP_002124080.1	similar to pir||JC5310 galactose repressor - Streptococcus mutans; Repressor of the galactose operon. Binds galactose as an inducer.
YP_002124081.1	catalyzes the formation of alpha-D-galactose 1-phosphate from D-galactose in galactose metabolism
YP_002124082.1	catalyzes the formation of alpha-D-glucose 1-phosphate and UDP-galactose from UDP-glucose and alpha-D-galactose 1-phosphate in galactose metabolism
YP_002124083.1	similar to ref|NP_688912.1| UDP-glucose 4-epimerase [Streptococcus agalactiae 2603V/R]; Catalysis of the reaction: UDP-glucose = UDP-galactose.
YP_002124084.1	similar to gb|AAU21551.1| GalM [Streptococcus thermophilus]; Mutarotase converts alpha-aldose to the beta-anomer. It is active on D-glucose, L-arabinose, D-xylose, D-galactose, maltose and lactose.
YP_002124085.1	forms a direct contact with the tRNA during translation
YP_002124086.1	in Escherichia coli this protein is one of the earliest assembly proteins in the large subunit
YP_002124087.1	similar to ref|YP_138591.1| IS1239 transposase [Streptococcus thermophilus LMG 18311]
YP_002124089.1	similar to ref|YP_603238.1| Fatty acid-binding protein, DegV family [Streptococcus pyogenes MGAS10750]
YP_002124090.1	similar to ref|YP_001129143.1| hypothetical protein SpyM51624 [Streptococcus pyogenes str. Manfredo]
YP_002124091.1	similar to ref|YP_281105.1| 23S rRNA methyltransferase [Streptococcus pyogenes MGAS6180]
YP_002124092.1	similar to ref|YP_599330.1| hypothetical membrane associated protein [Streptococcus pyogenes MGAS10270]
YP_002124093.1	similar to ref|ZP_00366252.1| COG1939: Uncharacterized protein conserved in bacteria [Streptococcus pyogenes M49 591]; similar to cysteinyl-tRNA synthetase
YP_002124094.1	catalyzes a two-step reaction; charges a cysteine by linking its carboxyl group to the alpha-phosphate of ATP then transfers the aminoacyl-adenylate to its tRNA
YP_002124095.1	similar to ref|YP_599335.1| serineacetyltransferase [Streptococcus pyogenes MGAS10270]; Cysteine biosynthesis.
YP_002124096.1	similar to ref|YP_001129151.1| hypothetical protein SpyM51632 [Streptococcus pyogenes str. Manfredo]
YP_002124097.1	similar to ref|YP_281113.1| polynucleotide phosphorylase/polyadenylase [Streptococcus pyogenes MGAS6180]; Involved in mRNA degradation. Hydrolyzes single-stranded polyribonucleotides processively in the 3' to 5' direction. Necessary for competence development in Bacillus subtilis. May be necessary for modification of the srfA transcript (stabilization or translation activation).
YP_002124098.1	primary rRNA binding protein; helps nucleate assembly of 30S; binds directly to the 16S rRNA and an intersubunit bridge to the 23S rRNA; autoregulates translation through interactions with the mRNA leader sequence
YP_002124099.1	similar to dbj|BAD00708.1| fibronectin-binding protein [Streptococcus equi subsp. zooepidemicus]; The ability of bacteria to bind fibronectin has been proposed as a virulence factor enabling bacteria to colonize wound tissues and blood clots. Binding of plasma fibronectin to the bacterial surface might block adhesion receptors on S.aureus, thus representing an important defense mechanism against tissue invasion.
YP_002124100.1	cleaves off formyl group from N-terminal methionine residues of newly synthesized proteins; binds iron(2+)
YP_002124101.1	similar to ref|YP_283033.1| oxidoreductase [Streptococcus pyogenes MGAS5005]
YP_002124102.1	similar to ref|YP_060997.1| Transcriptional regulator, MarR family [Streptococcus pyogenes MGAS10394]; Transcriptional Regulation
YP_002124103.1	catalyzes DNA-template-directed extension of the 3'- end of a DNA strand by one nucleotide at a time; required for leading strand synthesis; PolC exhibits 3' to 5' exonuclease activity
YP_002124104.1	similar to ref|NP_720759.1| hypothetical protein SMU.301 [Streptococcus mutans UA159]
YP_002124105.1	catalyzes the formation of prolyl-tRNA(Pro) from proline and tRNA(Pro)
YP_002124106.1	similar to ref|YP_281127.1| pheromone-processing membrane metalloprotease [Streptococcus pyogenes MGAS6180]
YP_002124107.1	similar to ref|ZP_00365468.1| COG0575: CDP-diglyceride synthetase [Streptococcus pyogenes M49 591]; Catalysis of the reaction: CTP + phosphatidate = diphosphate + CDP-diacylglycerol.
YP_002124108.1	catalyzes the formation of UDP pyrophosphate from isopentenyl pyrophosphate
YP_002124109.1	member of preprotein translocase; forms a heterotrimer with SecD and SecF; links the SecD/SecF/YajC/YidC complex with the SecY/SecE/SecG complex
YP_002124110.1	similar to ref|YP_061004.1| Thioredoxin [Streptococcus pyogenes MGAS10394]
YP_002124111.1	similar to ref|YP_283044.1| glucan 1,6-alpha-glucosidase [Streptococcus pyogenes MGAS5005]; The physiological substrates may be short isomaltosaccharides.
YP_002124112.1	similar to ref|NP_269942.1| multiple sugar-binding ABC transport system (ATP-binding protein) [Streptococcus pyogenes M1 GAS]; Involved in a binding protein-dependent transport system responsible for the uptake of melibiose, raffinose and isomaltotriose. Probably responsible for energy coupling to the transport system.
YP_002124113.1	similar to emb|CAA51350.1| leucine rich protein [Streptococcus dysgalactiae subsp. equisimilis]
YP_002124115.1	similar to gb|AAC83933.1| streptokinase precursor [Streptococcus dysgalactiae subsp. equisimilis]
YP_002124116.1	hydrolyzes D-tyrosyl-tRNA(Tyr) into D-tyrosine and free tRNA(Tyr); possible defense mechanism against a harmful effect of D-tyrosine
YP_002124117.1	similar to ref|NP_608020.1| (p)ppGpp synthetase [Streptococcus pyogenes MGAS8232]; In eubacteria ppGpp (guanosine 3'-diphosphate 5-' diphosphate) is a mediator of the stringent response that coordinates a variety of cellular activities in response to changes in nutritional abundance. This enzyme catalyzes the formation of pppGpp which is then hydrolyzed to form ppGpp.
YP_002124118.1	similar to gb|AAD42939.2|AF086813_1 protective antigen [Streptococcus pyogenes]
YP_002124119.1	similar to ref|NP_608022.1|  transcriptional regulator [Streptococcus pyogenes MGAS8232]
YP_002124120.1	has a stimulatory effect on the ribonucleotide reductase activity of NrdH with NrdEF
YP_002124122.1	similar to ref|NP_608024.1| hypothetical protein spyM18_2049 [Streptococcus pyogenes MGAS8232]; Catalysis of the degradation of double-stranded DNA. It acts progressively in a 3' to 5' direction, releasing 5'-phosphomononucleotides.
YP_002124123.1	similar to ref|YP_603278.1| PTS system, glucose-specific IIABC component [Streptococcus pyogenes MGAS10750]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active-transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in glucose transport.
YP_002124124.1	similar to ref|NP_784004.1| transcription regulator [Lactobacillus plantarum WCFS1]
YP_002124125.1	similar to ref|YP_001200768.1| Predicted transcriptional regulator [Streptococcus suis 98HAH33]
YP_002124126.1	similar to ref|YP_001198563.1| lantibiotic efflux protein [Streptococcus suis 05ZYH33]
YP_002124128.1	in Escherichia coli RsmE methylates the N3 position of the U1498 base in 16S rRNA; cells lacking this function can grow, but are outcompeted by wild-type; SAM-dependent m(3)U1498 methyltransferase
YP_002124129.1	methylates ribosomal protein L11 at multiple amino acid positions; mutations of these genes in Escherichia coli or Thermus thermophilus has no apparent phenotype
YP_002124130.1	similar to ref|ZP_00874737.1| Streptococcal histidine triad [Streptococcus suis 89/1591]
YP_002124131.1	similar to ref|ZP_01817507.1| MutT/nudix family protein [Streptococcus pneumoniae SP3-BS71]
YP_002124132.1	similar to ref|ZP_00366058.1| COG4043: Uncharacterized conserved protein [Streptococcus pyogenes M49 591]
YP_002124133.1	similar to ref|YP_001129182.1| hypothetical protein SpyM51665 [Streptococcus pyogenes str. Manfredo]
YP_002124134.1	similar to ref|YP_061021.1| 4-amino-4-deoxychorismate lyase [Streptococcus pyogenes MGAS10394]; Catalyzes the biosynthesis of 4-amino-4-deoxychorismate (ADC) from chorismate and glutamine.
YP_002124135.1	TrpG; with TrpE catalyzes the formation of anthranilate and glutamate from chorismate and glutamine; TrpG provides the glutamine amidotransferase activity
YP_002124136.1	similar to ref|YP_061023.1| recombination factor protein RarA [Streptococcus pyogenes MGAS10394]; ATPase related to the helicase subunit of the Holliday junction resolvase [DNA replication, recombination, and repair]; COG2256.
YP_002124138.1	similar to ref|ZP_01825592.1| transcriptional activator, Rgg/GadR/MutR family protein, C-terminal domain [Streptococcus pneumoniae SP11-BS70]; Transcriptional regulator
YP_002124140.1	similar to ref|YP_820672.1| Permease of the major facilitator superfamily [Streptococcus thermophilus LMD-9]
YP_002124141.1	similar to ref|YP_281151.1| topology modulation protein [Streptococcus pyogenes MGAS6180]
YP_002124142.1	similar to ref|YP_329518.1| cell wall surface anchor family protein [Streptococcus agalactiae A909]; Has domains with similarity to different streptococal surface proteins such as M protein, internalin, and histidine triad proteins.
YP_002124143.1	similar to gb|AAQ91578.1| collagen-like protein 3 [Streptococcus equi]; Possible adhesin, has a collagen-structural-motif domain composed of 60 Gly-Xaa-Yaa repeats.
YP_002124144.1	similar to ref|YP_001037859.1| Phosphoglycerate mutase [Clostridium thermocellum ATCC 27405]
YP_002124145.1	similar to ref|YP_815692.1| MccC family protein [Streptococcus pneumoniae D39]
YP_002124146.1	forms dimers and octamers; involved in conversion of glycerol to dihydroxy-acetone
YP_002124147.1	similar to transaldolase from Escherichia coli; many organisms have multiple copies
YP_002124148.1	similar to ref|YP_281195.1| formate acetyltransferase [Streptococcus pyogenes MGAS6180]; Catalysis of the reaction: acetyl-CoA + formate = CoA + pyruvate.
YP_002124149.1	similar to ref|YP_603332.1| PTS system, cellobiose-specific IIC component [Streptococcus pyogenes MGAS10750]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in cellobiose transport.
YP_002124150.1	similar to ref|YP_603333.1| PTS system, cellobiose-specific IIB component [Streptococcus pyogenes MGAS10750]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in cellobiose transport.
YP_002124151.1	similar to ref|YP_283109.1| PTS system, cellobiose-specific IIA component [Streptococcus pyogenes MGAS5005]; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar substrates concomitant with their translocation across the cell membrane. This system is involved in cellobiose transport.
YP_002124153.1	similar to ref|NP_269997.1|  transcriptional regulator [Streptococcus pyogenes M1 GAS]
YP_002124154.1	similar to ref|ZP_00365881.1| COG1349: Transcriptional regulators of sugar metabolism [Streptococcus pyogenes M49 591]
YP_002124155.1	similar to ref|NP_608074.1|  pyruvate formate-lyase activating enzyme [Streptococcus pyogenes MGAS8232]; Activation of pyruvate formate-lyase 2 under anaerobic conditions by generation of an organic free radical, using S- adenosylmethionine and reduced flavodoxin as cosubstrates to produce 5'-deoxy-adenosine.
YP_002124156.1	catalyzes the formation of N6-(1,2,-dicarboxyethyl)-AMP from L-aspartate, inosine monophosphate and GTP in AMP biosynthesis
YP_002124158.1	similar to ref|NP_606463.1| hypothetical protein spyM18_0155 [Streptococcus pyogenes MGAS8232]
YP_002124159.1	similar to ref|NP_606462.1|  toxic anion resistance protein [Streptococcus pyogenes MGAS8232]
YP_002124160.1	similar to ref|YP_279575.1| sortase [Streptococcus pyogenes MGAS6180]; Fimbrial associated sortase required for subunit polymerization.
YP_002124161.1	similar to gb|AAZ82124.1| fimbrial structural subunit [Streptococcus pyogenes serotype M23]; Fimbrial structural subunit involved in adhesion.
YP_002124162.1	similar to ref|YP_059477.1| Collagen adhesion protein [Streptococcus pyogenes MGAS10394]; Fimbrial component, has a centrally located Von Willebrand factor A domain and a carboxy end located Cna protein B-type domain.
YP_002124163.1	similar to ref|ZP_00782298.1| transcription regulator, ,  [Streptococcus agalactiae H36B]; Regulation of fimbrial gene transcription.
YP_002124165.1	similar to ref|YP_597726.1| Fibronectin-binding protein [Streptococcus pyogenes MGAS10270]
YP_002124166.1	similar to ref|YP_597725.1| Sortase [Streptococcus pyogenes MGAS10270]; Fimbrial associated dedicated sortase required for subunit polymerization.
YP_002124167.1	similar to ref|YP_597720.1| Sortase [Streptococcus pyogenes MGAS10270]; Fimbrial associated dedicated sortase required for subunit polymerization.
YP_002124168.1	similar to ref|YP_597719.1| hypothetical protein MGAS10270_Spy0110 [Streptococcus pyogenes MGAS10270]; Fimbrial subunit protein, has a Cna B-type domain.
YP_002124169.1	similar to ref|YP_597718.1| hypothetical protein MGAS10270_Spy0109 [Streptococcus pyogenes MGAS10270]; Fimbrial structural subunit protein.
YP_002124170.1	similar to ref|ZP_00784533.1| transcriptional regulator, AraC family [Streptococcus agalactiae COH1]
YP_002124172.1	becomes active under oxidative stress; four conserved cysteines bind a zinc atom when they are in the reduced state and the enzyme is inactive; oxidative stress results in oxidized cysteines, release of zinc, and binding of Hsp33 to aggregation-prone proteins; forms dimers and higher order oligomers
YP_002124173.1	similar to ref|YP_595837.1| tRNA-dihydrouridine synthase [Streptococcus pyogenes MGAS9429]; Catalyzes the synthesis of dihydrouridine, a modified base found in the D-loop of most tRNAs.
YP_002124174.1	similar to dbj|BAB16044.1| similar to Lactobacillus acidophilus dA/dG-kinase [Streptococcus equi subsp. zooepidemicus]; DGK/DAK plays an essential role in generating the deoxyribonucleotide precursors, dGTP and dATP, for DNA metabolism.
YP_002124175.1	similar to ref|NP_687848.1| hypothetical protein SAG0833 [Streptococcus agalactiae 2603V/R]
YP_002124176.1	similar to ref|YP_001198619.1| ABC-type uncharacterized transport system, ATPase component [Streptococcus suis 05ZYH33]; Part of the ABC transporter complex. Responsible for energy coupling to the transport system.
YP_002124177.1	similar to ref|YP_001200827.1| ABC-type uncharacterized transport system, permease component [Streptococcus suis 98HAH33]; Part of the binding-protein-dependent transport system. Probably responsible for the translocation of the substrate across the membrane.
YP_002124178.1	similar to ref|YP_001200828.1| hypothetical protein SSU98_1270 [Streptococcus suis 98HAH33]; ABC transporter substrate-binding.
YP_002124179.1	similar to ref|YP_001200829.1| ABC transporter permease [Streptococcus suis 98HAH33]; substrate-binding for ABC transport system.
YP_002124180.1	similar to ref|YP_138591.1| IS1239 transposase [Streptococcus thermophilus LMG 18311]
YP_002124181.1	binds to single stranded DNA and may facilitate the binding and interaction of other proteins to DNA
YP_002124182.1	similar to ref|ZP_00784652.1| conserved hypothetical protein [Streptococcus agalactiae COH1]
YP_002124183.1	similar to ref|YP_059468.1| tRNA binding domain protein [Streptococcus pyogenes MGAS10394]
YP_002124184.1	similar to ref|YP_059467.1| Thioredoxin [Streptococcus pyogenes MGAS10394]; Participates in various redox reactions through the reversible oxidation of its active center dithiol to a disulfide and catalyzes dithiol-disulfide exchange reactions.
YP_002124185.1	similar to ref|NP_801354.1| hypothetical protein SPs0092 [Streptococcus pyogenes SSI-1]
YP_002124186.1	similar to ref|YP_595830.1| glutamyl aminopeptidase [Streptococcus pyogenes MGAS9429]; Release of N-terminal glutamate (and to a lesser extent aspartate) from a peptide.
YP_002124187.1	catalyzes the formation of L-proline from pyrroline-5-carboxylate
YP_002124188.1	similar to ref|NP_268507.1| hypothetical protein SPy_0110 [Streptococcus pyogenes M1 GAS]
YP_002124189.1	similar to ref|YP_821152.1| Predicted metal-dependent membrane protease [Streptococcus thermophilus LMD-9]
YP_002124190.1	similar to ref|NP_722275.1| hypothetical protein SMU.1976c [Streptococcus mutans UA159]
YP_002124191.1	similar to ref|YP_001451172.1| HTH DNA-binding protein [Streptococcus gordonii str. Challis substr. CH1]
YP_002124192.1	similar to ref|YP_597530.1| hypothetical protein MGAS9429_Spy1799 [Streptococcus pyogenes MGAS9429]
YP_002124194.1	similar to ref|YP_061106.1| Anaerobic ribonucleoside-triphosphate reductase activating protein [Streptococcus pyogenes MGAS10394]; Activation of anaerobic ribonucleoside-triphosphate reductase under anaerobic conditions by generation of an organic free radical, using S-adenosylmethionine and reduced flavodoxin as cosubstrates to produce 5'-deoxy-adenosine.
YP_002124195.1	similar to ref|YP_815708.1| acetyltransferase, GNAT family protein [Streptococcus pneumoniae D39]
YP_002124196.1	similar to ref|YP_281240.1|  oxidoreductase [Streptococcus pyogenes MGAS6180]
YP_002124197.1	similar to ref|NP_608112.1| hypothetical protein spyM18_2167 [Streptococcus pyogenes MGAS8232]
YP_002124198.1	Catalyzes the reduction of nucleoside 5'-triphosphates to 2'-deoxynucleoside 5'-triphosphates
YP_002124199.1	similar to ref|NP_665599.1| hypothetical protein SpyM3_1795 [Streptococcus pyogenes MGAS315]
YP_002124201.1	similar to ref|NP_270036.1| hypothetical protein SPy_2112 [Streptococcus pyogenes M1 GAS]
YP_002124202.1	similar to ref|YP_140369.1| Holliday junction resolvase-like protein [Streptococcus thermophilus LMG 18311]; Could be a nuclease that resolves Holliday junction intermediates in genetic recombination.
YP_002124203.1	similar to ref|ZP_00365335.1| COG4472: Uncharacterized protein conserved in bacteria [Streptococcus pyogenes M49 591]
YP_002124204.1	the anti-alpha factor Spx interacts with RNA polymerase alpha subunit C-terminal domain in a region that interacts with the sigma 70 subunit and may interfere with activation of promoters; in Bacillus subtilis this protein is a substrate for ClpXP protease; blocks transcription of the competence regulatory gene encoded by the srf operon; regulates a number of genes involved in thiol homeostasis including trxA and trxB; monomeric member of ArsC family of proteins; does not bind DNA; contains a disulfide bond between C10 and C13 which may sense disulfide stress
YP_002124205.1	similar to ref|YP_140248.1| ISSth1, transposase (orf2), IS3 family [Streptococcus thermophilus LMG 18311]
YP_002124206.1	similar to ref|YP_139290.1| ISSth1, transposase (orf2), IS3 family [Streptococcus thermophilus LMG 18311]
YP_002124207.1	similar to ref|YP_139291.1| ISSth1, transposase (orf1), IS3 family [Streptococcus thermophilus LMG 18311]
YP_002124208.1	similar to ref|YP_602677.1| Transposase [Streptococcus pyogenes MGAS10750]
YP_002124209.1	similar to ref|YP_596865.1| transposase [Streptococcus pyogenes MGAS9429]
YP_002124210.1	catalyzes the hydrolysis of ATP in the presence of single-stranded DNA, the ATP-dependent uptake of single-stranded DNA by duplex DNA, and the ATP-dependent hybridization of homologous single-stranded DNAs
YP_002124211.1	similar to ref|YP_281249.1| competence damage-inducible protein A [Streptococcus pyogenes MGAS6180]
YP_002124212.1	similar to ref|YP_280686.1| hypothetical protein M28_Spy1221 [Streptococcus pyogenes MGAS6180]
YP_002124213.1	similar to ref|NP_665008.1| streptococcal phospholipase A2 - phage associated [Streptococcus pyogenes MGAS315]; Cleaves phospholipids at SN2 position.
YP_002124214.1	similar to ref|YP_138591.1| IS1239 transposase [Streptococcus thermophilus LMG 18311]
YP_002124215.1	similar to ref|YP_001036163.1| hypothetical protein SSA_2251 [Streptococcus sanguinis SK36]
YP_002124216.1	similar to ref|YP_281250.1| DNA-3-methyladenine glycosylase [Streptococcus pyogenes MGAS6180]; Catalyzes the synthesis of GMP from XMP.
YP_002124217.1	plays an essential role in ATP-dependent branch migration of the Holliday junction
YP_002124218.1	similar to ref|YP_597545.1| multidrug resistance protein [Streptococcus pyogenes MGAS9429]
YP_002124219.1	This protein is involved in the repair of mismatches in DNA. It is required for dam-dependent methyl-directed DNA mismatch repair. Promotes the formation of a stable complex between two or more DNA-binding proteins in an ATP-dependent manner without itself being part of a final effector complex
YP_002124220.1	This protein performs the mismatch recognition step during the DNA repair process
YP_002124221.1	similar to ref|NP_722381.1| hypothetical protein SMU.2092c [Streptococcus mutans UA159]
YP_002124222.1	similar to ref|YP_599508.1| Arginine repressor, argR [Streptococcus pyogenes MGAS10270]; Regulates arginine biosynthesis genes
YP_002124223.1	similar to ref|YP_001488305.1| ABC superfamily ATP binding cassette transporter, ABC protein [Bacillus pumilus SAFR-032]; Possibly confers resistance to 14-membered ring macrolides (like erythromycin) and to B streptogramins, by acting as an ATP-dependent efflux pump.
YP_002124224.1	similar to ref|YP_281284.1| hypothetical membrane spanning protein [Streptococcus pyogenes MGAS6180]
YP_002124225.1	similar to ref|YP_597553.1| hypothetical membrane spanning protein [Streptococcus pyogenes MGAS9429]
YP_002124226.1	similar to ref|ZP_00366175.1| COG1284: Uncharacterized conserved protein [Streptococcus pyogenes M49 591]
YP_002124227.1	catalyzes a two-step reaction, first charging an aspartate molecule by linking its carboxyl group to the alpha-phosphate of ATP, followed by transfer of the aminoacyl-adenylate to its tRNA; contains discriminating and non-discriminating subtypes
YP_002124228.1	catalyzes a two-step reaction, first charging a histidine molecule by linking its carboxyl group to the alpha-phosphate of ATP, followed by transfer of the aminoacyl-adenylate to its tRNA; class II aminoacyl-tRNA synthetase; forms homodimers; some organisms have a paralogous gene, hisZ, that is similar to hisS and produces a protein that performs the first step in histidine biosynthesis along with HisG
YP_002124229.1	some L32 proteins have zinc finger motifs consisting of CXXC while others do not
YP_002124230.1	in Escherichia coli BM108, a mutation that results in lack of L33 synthesis had no effect on ribosome synthesis or function; there are paralogous genes in several bacterial genomes, and a CXXC motif for zinc binding and an upstream regulation region of the paralog lacking this motif that are regulated by zinc similar to other ribosomal proteins like L31; the proteins in this group lack the CXXC motif
YP_002124231.1	similar to ref|YP_139512.1| IS1193 transposase [Streptococcus thermophilus LMG 18311]
YP_002124232.1	similar to ref|NP_345531.1| transcriptional regulator PlcR,  [Streptococcus pneumoniae TIGR4]
YP_002124233.1	similar to ref|YP_078429.1| Major facilitator superfamily [Bacillus licheniformis ATCC 14580]
YP_002124235.1	similar to ref|NP_815050.1| HesA/MoeB/ThiF family protein [Enterococcus faecalis V583]
YP_002124236.1	similar to gb|AAN18298.1| immunoreactive protein Se68.9 [Streptococcus equi]
YP_002124237.1	similar to ref|NP_830667.1| Sensor protein comP [Bacillus cereus ATCC 14579]
YP_002124238.1	similar to ref|YP_001196982.1| two component transcriptional regulator, LuxR family [Flavobacterium johnsoniae UW101]
YP_002124239.1	similar to gb|AAC33119.1| avirulence D protein [Pseudomonas syringae pv. cilantro]
YP_002124240.1	similar to ref|YP_873838.1| hypothetical protein Acel_2080 [Acidothermus cellulolyticus 11B]
YP_002124241.1	similar to ref|ZP_01940408.1| ABC transporter, ATP-binding protein [Listeria monocytogenes 10403S]
YP_002124242.1	similar to gb|AAN18297.1|  ABC transporter permease [Streptococcus equi]
YP_002124244.1	similar to ref|XP_312188.4| AGAP002737-PA [Anopheles gambiae str. PEST]
YP_002124245.1	similar to ref|YP_599528.1| Integral membrane protein [Streptococcus pyogenes MGAS10270]
YP_002124246.1	similar to ref|YP_599529.1| Phosphohydrolase [Streptococcus pyogenes MGAS10270]; Probably mediates the hydrolysis of some nucleoside diphosphate derivatives.
YP_002124247.1	similar to ref|YP_061164.1| Transcriptional regulator, PadR family [Streptococcus pyogenes MGAS10394]
YP_002124249.1	similar to ref|YP_001449372.1| hypothetical protein SGO_0050 [Streptococcus gordonii str. Challis substr. CH1]
YP_002124250.1	similar to ref|NP_608148.1| hypothetical protein spyM18_2213 [Streptococcus pyogenes MGAS8232]
YP_002124251.1	similar to ref|NP_270087.1|  transcriptional regulator (TetR/AcrR family) [Streptococcus pyogenes M1 GAS]
YP_002124252.1	similar to ref|ZP_00787238.1| conserved hypothetical protein [Streptococcus agalactiae CJB111]
YP_002124253.1	similar to ref|ZP_00787181.1| Unknown, [Streptococcus agalactiae CJB111]
YP_002124254.1	similar to ref|YP_330669.1| prophage Sa05, transcriptional regulator, ArpU family [Streptococcus agalactiae A909]
YP_002124255.1	similar to ref|YP_001129292.1|  DNA-binding phage protein [Streptococcus pyogenes str. Manfredo]
YP_002124256.1	primary rRNA binding protein; nucleates 30S assembly; involved in translational accuracy with proteins S5 and S12; interacts with protein S5; involved in autogeneously regulating ribosomal proteins by binding to pseudoknot structures in the polycistronic mRNA; interacts with transcription complex and functions similar to protein NusA in antitermination
YP_002124257.1	similar to ref|ZP_00875692.1| Transposase, IS204/IS1001/IS1096/IS1165 [Streptococcus suis 89/1591]
YP_002124258.1	similar to ref|YP_061170.1| hypothetical protein M6_Spy1852 [Streptococcus pyogenes MGAS10394]
YP_002124259.1	unwinds double stranded DNA
YP_002124260.1	in Escherichia coli this protein is wrapped around the base of the L1 stalk
YP_002124261.1	similar to ref|YP_599565.1| Phosphoesterase, DHH family protein [Streptococcus pyogenes MGAS10270]
YP_002124262.1	similar to ref|YP_815645.1| MutT/nudix family protein [Streptococcus pneumoniae D39]
YP_002124263.1	catalyzes a sulfuration reaction to synthesize 2-thiouridine at the U34 position of tRNAs
YP_002124265.1	similar to ref|YP_061176.1| L-serine dehydratase beta subunit [Streptococcus pyogenes MGAS10394]; Catalysis of the reaction: L-serine = pyruvate + NH3.
YP_002124266.1	similar to ref|YP_599570.1| L-serinedehydratase alpha subunit [Streptococcus pyogenes MGAS10270]; Catalysis of the reaction: L-serine = pyruvate + NH3.
YP_002124267.1	similar to ref|YP_001036270.1| Phosphoglycolate phosphatase,  [Streptococcus sanguinis SK36]; Catalysis of the reaction: 2-phosphoglycolate + H2O = glycolate + phosphate.
YP_002124268.1	similar to ref|YP_597585.1| transglycosylase SLT domain family protein [Streptococcus pyogenes MGAS9429]
YP_002124269.1	similar to ref|ZP_00366389.1| COG0619: ABC-type cobalt transport system, permease component CbiQ and related transporters [Streptococcus pyogenes M49 591]; Part of the ABC transporter complex cbiONQ involved in cobalt import. Transmembrane domains (TMD) form a pore in the membrane and the ATP-binding domain (NBD) is responsible for energy generation.
YP_002124270.1	with CbiNQ forms the ABC transporter for cobalt import; Streptococcus has two adjacent copies of this gene
YP_002124271.1	with CbiNQ forms the ABC transporter for cobalt import; Streptococcus has two adjacent copies of this gene
YP_002124272.1	similar to gb|ABW75773.1| CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase [Streptococcus equi subsp. zooepidemicus]; Catalysis of the reaction: CDP-diacylglycerol + glycerol 3-phosphate = CMP + 3-(3-phosphatidyl)-glycerol 1-phosphate.
YP_002124273.1	similar to ref|ZP_00366385.1| COG1426: Uncharacterized protein conserved in bacteria [Streptococcus pyogenes M49 591]
YP_002124274.1	similar to ref|YP_281345.1| hypothetical membrane associated protein [Streptococcus pyogenes MGAS6180]
YP_002124275.1	similar to ref|YP_603459.1| Zinc protease [Streptococcus pyogenes MGAS10750]
YP_002124276.1	similar to ref|YP_061185.1| Zinc protease [Streptococcus pyogenes MGAS10394]
YP_002124277.1	similar to ref|YP_597596.1| hypothetical cytosolic protein [Streptococcus pyogenes MGAS9429]
YP_002124278.1	Required for DNA replication; binds preferentially to single-stranded, linear DNA
YP_002124279.1	similar to ref|YP_283219.1| glucose uptake protein homolog [Streptococcus pyogenes MGAS5005]
YP_002124280.1	similar to ref|NP_466326.1| hypothetical protein lmo2804 [Listeria monocytogenes EGD-e]
YP_002124281.1	similar to ref|YP_001034253.1| hypothetical protein SSA_0244 [Streptococcus sanguinis SK36]
YP_002124282.1	similar to ref|YP_001034253.1| hypothetical protein SSA_0244 [Streptococcus sanguinis SK36]
YP_002124283.1	similar to ref|ZP_01928725.1| hypothetical protein LMHG_00511 [Listeria monocytogenes FSL N1-017]
YP_002124285.1	catalyzes the synthesis of xanthosine monophosphate by the NAD+ dependent oxidation of inosine monophosphate
YP_002124286.1	catalyzes a two-step reaction, first charging a tryptophan molecule by linking its carboxyl group to the alpha-phosphate of ATP, followed by transfer of the aminoacyl-adenylate to its tRNA
YP_002124287.1	similar to ref|NP_270115.1| hypothetical protein SPy_2209 [Streptococcus pyogenes M1 GAS]
YP_002124288.1	similar to ref|YP_001129344.1| hypothetical protein SpyM51832 [Streptococcus pyogenes str. Manfredo]
YP_002124289.1	similar to ref|NP_270116.1| ABC transporter, ATP-binding protein [Streptococcus pyogenes M1 GAS]
YP_002124290.1	similar to ref|NP_665665.1|  ABC transporter, permease [Streptococcus pyogenes MGAS315]
YP_002124291.1	SPOUT methyltransferase family protein; crystal structure shows homodimer; in Escherichia coli this protein methylates pseudouridine at position 1915 of the 23S ribosomal RNA
YP_002124292.1	similar to ref|NP_270119.1|  serine protease [Streptococcus pyogenes M1 GAS]; Degrades abnormal exported proteins. Needed for the propeptide processing of a natural pro-protein and for the maturation of a native protein. Responsible for the housekeeping of exported proteins.
YP_002124293.1	similar to ref|YP_061204.1| Chromosome partitioning protein [Streptococcus pyogenes MGAS10394]; Required for the initiation of sporulation and for normal chromosome segregation. Antagonizes sporulation inhibition of soj. It probably interacts with a specific DNA site and other proteins involved in partitioning and cell division, and antagonizes soj in response to cell cycle events related to chromosome partitioning.